See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/364351531

Identification of Tropical Freshwater Eels, Anguilla spp., in Cagayan River,

Philippines

Article in Philippine Agricultural Scientist · October 2022

CITATIONS READS

0 715

2 authors, including:

Joyce Hilario
Wageningen University & Research
3 PUBLICATIONS 2 CITATIONS

SEE PROFILE

All content following this page was uploaded by Joyce Hilario on 31 October 2022.

The user has requested enhancement of the downloaded file.

PHILIPP AGRIC SCIENTIST ISSN 0031-7454
Vol. 105 No. 3, 226-235
September 2022

Identification of Tropical Freshwater Eels, Anguilla spp., in

Cagayan River, Philippines

Joyce A. Hilario1,2, Casiano H. Choresca Jr.2, Ma. Jodecel C. Danting1, Faith Loraine T.
Magbanua1,2, and Ma. Theresa T. Oclos2,*
1
Bureau of Fisheries and Aquatic Resources-National Freshwater Fisheries Technology Center, Science City of Muñoz, Nueva
Ecija, Philippines
2
National Fisheries Research and Development Institute-Fisheries Biotechnology Center, Science City of Muñoz, Nueva Ecija,
Philippines

*
Author for correspondence; E-mail: fisheries.biotech@gmail.com

Received: January 04, 2021/ Revised: June 03, 2022/ Accepted: June 12, 2022

Anguillid eels are high-value food fish with 16 known species worldwide. Due to its taxonomic ambiguity
and insufficient data on species composition, this family of freshwater eels were inadvertently regarded as a
single species. This study collected 63 freshwater eels at 3 life stages (glass eel, elver, yellow eel) from
Cagayan River, Philippines, to evaluate the accuracy of morphological identification in comparison with
molecular analysis. Morphological results displayed clear distinctiveness between Anguilla bicolor and
Anguilla marmorata despite some overlapping physical characteristics between Anguilla marmorata and
Anguilla luzonensis. Phylogenetic analysis revealed that 15 out of 23 glass eel specimens were molecularly
identified as A. marmorata, while 8 were identified as A. bicolor pacifica. For elver specimens, there were A.
bicolor pacifica (n = 10), A. marmorata (n = 8), and A. luzonensis (n = 2). For yellow eels, there were A.
bicolor pacifica (n = 10) and A. marmorata (n = 10). The results showed the inaccuracy of morphological
identification in determining the richness and composition of Anguillids, which otherwise proved that
molecular analysis is a more reliable approach in identifying freshwater eel species.

Keywords: Anguilla spp., cytochrome b, freshwater eels, genetic identification

Abbreviations: AFL—anal fin length, AD—anodorsal, cyt b—cytochrome b, DFL—dorsal fin length,
DNA—deoxyribonucleic acid, NJ—neighbor-joining, PAFL—preanal fin length, PCR—polymerase chain reaction,
PDFL—predorsal fin length, TL—total length

INTRODUCTION Eel farming only relies on wild-caught glass eels, also

Declining population and restricting conservation
measures of temperate eel species have opened market
opportunities for tropical eels to supplement growing
international demand (Cuvin-Aralar et al. 2019).
However, due to increased exportation in Southeast Asia,
particularly in the Philippines, the tropical eel export
industry has now been confronted with widespread
exploitation and more fishing pressure. This has led the
Bureau of Fisheries and Aquatic Resources (PH) to
impose an export ban for juvenile eels not exceeding
15 cm in length (Fisheries Administrative Order No. 242
2012). The capture production of live eels including glass
eels and larger juveniles are only intended for eel
farming, which increases its cultivation in captivity
(Crook 2014).
known as eel fry. Glass eels are post-larval forms, with
length not exceeding 5 cm and with glass-like
transparency. But due to their indistinct physical
characteristics, eels at this juvenile stage are difficult to
identify. Improper identification usually leads to having
different species grouped into a single species. Since glass
eels will be reared in captivity, and rearing conditions
vary across species, introduction of mixed eel stock not
specific to a certain rearing condition could potentially
result to production loss (Espiñeira and Vieites 2016). For
instance, a previous study conducted by Luo et al. (2013)
found that species of A. marmorata and A. bicolor pacifica
collected in the Philippines showed different tolerance
and growth rate at varying water temperatures.
Unfortunately, the Philippines has yet to formulate a
standardized rearing protocol for freshwater eels. Thus,

https://pas.cafs.uplb.edu.ph
Genetic Identification of Anguilla spp.
accurate information on species composition in
freshwater eel harvesting site is deemed necessary
considering that some species have specific culture
preferences.
In addition, the misclassification of these freshwater
eels could then affect the distribution of eel products in
the market with species-specific preference. In Japan, for
instance, consumers prefer A. bicolor as an alternative to
A. japonica due to its similar taste and texture (Arai 2014
as cited in Shiraishi and Crook 2015). By providing these
information, agencies regulating the eel farming industry
will be guided to pass appropriate management
techniques and fill in the deficient data on some
freshwater eel species. It is also crucial to develop a
knowledge repository that will assist in identifying
certain eel species, particularly of glass eels intended for
aquaculture.
Species identification of freshwater eels often uses a
morphology-based key which could be performed
ambiguously due to the lack of distinct morphological
characteristics of each species. Furthermore, as freshwater
eels approach maturity, they undergo metamorphosis
showing a continuous change in body forms and
pigmentations. This makes distinct characteristics of
individuals not comparable to their different life stages.
Due to intraspecific variation in family Anguillidae, it is
recommended for morphological identification to be
combined with molecular analysis for more reliable
traceability and accurate similar species discrimination
(Watanabe et al. 2004; Silfvergrip 2009).
In the Philippines, there are 3 major species and
subspecies of freshwater eels, namely, A. marmorata, A.
bicolor pacifica, and A. luzonensis. But despite their
different taxonomic classification, these freshwater eels
are often regarded as a single group because their
morphological features are quite difficult to tell apart.
Hence, tools enabling the discrimination of species,
especially in their juvenile stage, would certainly improve
eel farming management in the country. Likewise,
molecular approach as a standard analytical tool has been
regarded useful in taxonomic and phylogenetic studies.
This approach is primarily based on the amplification of a
partial sequence of mitochondrial DNA. Molecular
identification of the genus Anguilla uses cytochrome b (cyt
b) marker because it reveals clear divergences between
species and subspecies (Aoyama et al. 2001; Han et al.
2002; Minegishi et al. 2009). Also, the use of cyt b marker
is suggested for freshwater eel identification due to the
existence of a large number of species-specific nucleotide
positions, which makes the molecular identification more
accurate (Lin et al. 2002; Jamandre et al. 2007).
227 | Philipp Agric Scientist (2022)105(3):226-235
Joyce A. Hilario et al.
This study compared morphological and molecular
methods in the identification of 3 different developmental
stages of freshwater eels. Cyt b gene was used to establish
a DNA-based test in identifying tropical eels collected in
Cagayan River. As the largest river system in the country,
the Cagayan River has long been a major fishing ground
for freshwater eels. It is also home to A. luzonensis, the
most recent discovery of eel species in northern Luzon
recorded in 2009 (Watanabe et al. 2009).
It is intended in this study to provide data on species
diversity of juvenile eels harvested for aquaculture.
Likewise, it presents more accurate and reliable tools in
the identification and documentation of freshwater eels,
which can be helpful in the country’s policymaking
initiatives and conservation management practices on
Anguillid species.
MATERIALS AND METHODS
Sample Collection
A total of 63 freshwater eels (23 glass eels, 20 elvers, and
20 yellow eels) were randomly sampled at the eel culture
facility of the Bureau of Fisheries and Aquatic Resources
(PH), National Freshwater Fisheries Technology Center.
The specimens were collected from Cagayan River at
Barangay Toran, Aparri, Cagayan. They were aerated in
plastic bags and were transported immediately to the eel
culture facility.
Morphological Analysis
Glass eels were identified using the method of Tabeta et
al. (1976). The glass eels’ cutaneous tail pigmentations
were examined using an Olympus SZX16
stereomicroscope, which served as basis for the
preliminary identification of the species. Then, the
specimens were preserved in 95% ethanol for molecular
analysis.
Elvers and adult eels, on the other hand, were
morphologically identified based on the method of
Watanabe et al. (2004). Morphometric measurements
were obtained by determining the total length (TL),
preanal fin length (PAFL), predorsal fin length (PDFL),
dorsal fin length (DFL), anal fin length (AFL), anodorsal
(AD), and proportion of anodorsal to percent total length
(AD/%TL). The AD and AD/%TL were derived from the
values of the aforementioned measurements and not
through direct measurement. Samples with AD/%TL
values greater than 13% were classified as A. marmorata,
while those with values less than 13% were classified as
A. luzonenis or A. celebesensis (Leander et al. 2012). The
investigated morphological traits were subjected to
principal component analysis (PCA). Biplot analysis of
https://pas.cafs.uplb.edu.ph
Genetic Identification of Anguilla spp. Joyce A. Hilario et al.

PC1 and PC2 were conducted to identify the traits that

mainly contributed to morphological variation of each
species in an R environment (RStudio Team 2020).

Molecular Analysis
Whole genomic DNA was extracted from muscle tissue
using a NucleoSpin Tissue DNA extraction kit.
Mitochondrial cyt b gene was amplified by polymerase
chain reaction (PCR) using primers composed of cyt b
universal forward 5’ GATGCCCTAG TGGATCTACC 3’,
and cyt b universal reverse 5’
TATGGGTGTTCTACTGGTAT 3’ (Han et al. 2012). A
total of 50 µL reaction mixture was prepared containing
PCR master mix, 1.5 µL of each 10 pmol primer, and 5 µL
of each extracted DNA sample. The PCR was carried out
in thermal cycler Bio-Rad T100 with the following profile:
initial denaturation at 94°C for 3 min, 34 cycles of
denaturation at 94°C for 30 s, annealing at 56.9°C for 30 s,
extension at 68°C for 30 s, and a final extension at 68°C for
10 min. To avoid interference with sequencing, PCR
products were cleaned up using a NucleoSpin gel and
PCR cleaning kit. Samples were sent for sequencing at
First BASE Laboratories in Selangor, Malaysia. Thereafter,
the newly obtained sequences were submitted to
GenBank.

Phylogenetic Analysis
Sequence alignments were conducted using multiple
sequence alignment algorithms in MEGA (MEGA 7.0.26).
Neighbor-joining (NJ) trees were constructed with 1000
bootstrap replicates using TN93 model, as this was
identified as the best fitting evolutionary model using the
same software. All known species and subspecies of
Anguilla were included in the NJ tree represented by the
sequences with GenBank accession no. NC006531–
NC006535, NC006537–NC006547, NC002707. While the
Channa striata, with accession no. NC032037, was used as
an outgroup to clearly show that the collected samples
Fig. 1. Specimen of freshwater eels used in the study. a)
were on the same clade. Anguilla marmorata glass eels, b) Anguilla bicolor glass
eels, c) Anguilla marmorata elvers, d) Anguilla luzonensis
RESULTS elvers, e) Anguilla bicolor elvers, f) Anguilla marmorata
yellow eels, and g) Anguilla bicolor yellow eels.
Morphological Analysis
Figure 1 shows the specimens of freshwater eels as they
undergo different life stages. Morphological identification
has classified the 23 glass eel specimens into 2 species
based on the coloration of the caudal fin (Fig. 2).
Specimens G1 to G8 (GenBank accession no. MN080877–
MN080884) were identified as A. bicolor pacifica
characterized by a pigmentation pattern stretching up to
the tip of the caudal fin. While specimens G9 to G23 Fig. 2. Caudal fin pigmentation pattern of glass eels. a)
Anguilla marmorata, and b) Anguilla bicolor.
(GenBank accession no. MN080885–MN080899) were
identified as A. marmorata. Unlike A. bicolor pacifica, A.

https://pas.cafs.uplb.edu.ph Philipp Agric Scientist (2022)105(3):226-235 | 228

Genetic Identification of Anguilla spp. Joyce A. Hilario et al.

marmorata species do not have pigmentation pattern on

the caudal fin.

On the other hand, the initial assessment of elvers

using taxonomic keys has identified 3 species: A.
marmorata, A. luzonensis, and A. bicolor. The total length for
elver specimens ranges from 7.04 to 9.37 cm with an
average total length of 8.57 cm ± 0.79. Specimens J1 to J10
have predorsal fin length of 2.24 to 4.54 cm, and anal fin
length of 2.29 to 4.57 cm. The percent value of AD/%TL
ranges from 0.13 to 2.27, and identified as short-finned eel
or A. bicolor. Specimens J11 to J20 have predorsal fin
length of 1.99 to 2.72 cm, and preanal fin length of 3.01 to
4.06 cm. Three specimens have AD/%TL values of less
than 13 but greater than 5 (9.23 – 12.67), and were
morphologically identified as A. luzonensis or A.
celebesensis. While the other 7 specimens were identified as
A. marmorata with AD/%TL values of 13.39 to 16.31. The Fig. 3. Biplot of 6 meristic characters of elvers based on
morphological identification: predorsal fin length (PDFL),
coloration of samples varied from brown to black having anal fin length (AFL), total length (TL), preanal fin length
no correlation with the identification of species. (PAFL), dorsal fin length (DFL), anodorsal, and proportion
of anodorsal to percent total length (AD/%TL).
Results from PC1 and PC2 explained 82.9% of the
variance contained within the dataset of elvers. Anguilla bicolor specimens formed a cluster on the left of the biplot
bicolor formed a distinct cluster on the left of the biplot characterized by PDFL, PAFL, and AFL (Fig. 4).
characterized mainly by low values of predorsal fin Specimens of yellow eels have total length of 19.10 to
length. The biplot of morphological criteria used to 56.50 cm. Specimens A1 to A10 (MN150037–MN150046)
discriminate between species of freshwater eels also have predorsal fin length of 15.5 to 24.5 cm, preanal fin
revealed some overlap in the morphometric values of length of 16.20 to 24.70 cm, and AD/%TL values of 0.18 to
specimens molecularly identified as A. marmorata and A. 3.33. Based on morphological identification, specimens A1
luzonensis (Fig. 3). to A10 were identified as A. bicolor, popularly known as
short-finned eel. They have plain black to grey
Additionally, the biplot of yellow eels showed
pigmentation pattern and white belly.
differences in two sets of characters that separated A.
marmorata and A. bicolor (Fig. 4). A. marmorata specimens While the specimens A11 to A20 (MN150047–
formed a distinct cluster in the right of the biplot MN150056) have predorsal fin length of 5.10 to 7.20 cm,
characterized by anodorsal and AD/%TL values, while A. preanal fin length of 8.00 to 11.70 cm, and AD/%TL values

Fig. 4. Biplot of 6 meristic characters of yellow eels based on morphological identification: predorsal fin length (PDFL),
anal fin length (AFL), total length (TL), preanal fin length (PAFL), dorsal fin length (DFL), anodorsal, and proportion of
anodorsal to percent total length (AD/%TL).

229 | Philipp Agric Scientist (2022)105(3):226-235 https://pas.cafs.uplb.edu.ph

Genetic Identification of Anguilla spp. Joyce A. Hilario et al.

of 14.95 to 17.48. Based on morphological identification,
specimens A11 to A20 appeared to have mottles on their
skin, and they also have long fins.
Molecular Analysis
Using similarity search on the GenBank database,
specimens G1 to G8 have matched sequences with A.
bicolor pacifica with a homology of 99% to 100%, while
specimens G9 to G23 closely matched with A. marmorata
with a homology of 100% (Fig. 5). Phylogenetic analysis
of glass eels using mitochondrial cyt b gene sequences
showed distinct clades with strong bootstrap support of
greater than 99. However, taxonomic classification using
AD/%TL produced different findings and identification
on species level of elvers.

Fig. 5. Neighbor-joining phylogenetic tree of glass eels mtDNA cyt b sequences collected from Cagayan River, Philippines,
with species and subspecies of the genus Anguilla from GenBank as comparison.

https://pas.cafs.uplb.edu.ph Philipp Agric Scientist (2022)105(3):226-235 | 230

Genetic Identification of Anguilla spp. Joyce A. Hilario et al.

Specimens J15 and J17 have AD/%TL values of less
than 13 and are morphologically identified as A.
luzonensis or A. celebesensis. Although, genetic sequence
analysis on these 2 specimens showed 100% similarity
with A. marmorata instead (Fig. 6).
morphologically. As for specimens J1 to J10
morphologically identified as A. bicolor, phylogenetic
analysis showed a clustering of all samples with A. bicolor
pacifica sequence, and therefore confirmed the reliability
of AD/%TL value in identification of this species.

Specimen J20 has AD/%TL value of 15.56 and was Furthermore, phylogenetic analysis on yellow eel
morphologically identified as A. marmorata, however, the specimens A1 to A10 showed 99 to 100% homology with
resultant topology indicates clustering of the specimen on A. bicolor pacifica, while specimens A11 to A20 showed
A. luzonensis. The findings showed that A. marmorata and 100% homology with A. marmorata (Fig. 7).
A. luzonensis can be incorrectly identified

Fig. 6. Neighbor-joining phylogenetic tree of elvers mtDNA cyt b sequences collected from Cagayan River, Philippines,
with species and subspecies of the genus Anguilla from GenBank as comparison.

231 | Philipp Agric Scientist (2022)105(3):226-235 https://pas.cafs.uplb.edu.ph

Genetic Identification of Anguilla spp. Joyce A. Hilario et al.

DISCUSSION Eels can be identified into 3 species using the

The pigmentation patterns on caudal fin and the
proportion of anodorsal to the percentage of the total
length values are widely used criteria in freshwater eel
identification. Pigmentation patterns can be classified into
3 types, wherein type 1 has no pigmentation on both the
tailbud and the caudal fin (e.g., A. japonica); type 2 has a
large patch of small (stellate) melanophores on the caudal
fin (e.g., A. bicolor pacifica); and type 3 has a large patch of
diffused melanophores on the tailbud (e.g., A. marmorata,
A. luzonensis, and/or A. celebesensis) (Leander et al. 2012).
proportion of anodorsal to the percentage of the total
length values. These species are A. bicolor, A. luzonensis/A.
celebesensis, and A. marmorata. Leander et al. (2012)
classified A. bicolor species with AD/%TL values of less
than 5%, A. luzonensis/A. celebesensis with greater than 5%
but less than 13%, and A. marmorata with greater than
13%. However, one of the biggest problems in
distinguishing species of freshwater eels using
morphological criteria is the inclusion of geographic
distribution since each location has some overlapping
characteristics (Watanabe 2004). Also, this is challenging

Fig. 7. Neighbor-joining phylogenetic tree of yellow eels mtDNA cyt b sequences collected from Cagayan River,
Philippines, with species and subspecies of the genus Anguilla from GenBank as a comparison.

https://pas.cafs.uplb.edu.ph Philipp Agric Scientist (2022)105(3):226-235 | 232

Genetic Identification of Anguilla spp.
because the geographic distribution of some species like
A. luzonensis is not yet fully defined.
This study found that specimens identified as A.
marmorata and A. luzonensis are hard to discriminate
using morphological analysis and their AD/%TL values
were inaccurate. For instance, specimens distinctly
identified as A. marmorata and A. luzonensis in the
molecular analysis exhibited similar morphological
characteristics. Also, molecular analysis using
mitochondrial cyt b gene sequencing revealed inaccuracy
of morphological analysis in elvers by misidentifying
some species of A. marmorata as A. luzonensis, and vice
versa. The phylogenetic reference to all species of
freshwater eels and a selected outgroup depicted the
separation of each species into distinct clades supported
by high bootstrap values.
Several studies also mentioned the effect of different
environmental factors on the phenotype of each
Anguillid species (Han et al. 2002; Politis et al. 2017).
Since freshwater eels have large panmictic and
semelparous spawning habits in great ocean depths and
passive larval drift to continents, environment is
considered to have a significant impact on their
morphology (Vøllestad 1992). Therefore, the use of
morphological identification in discriminating freshwater
eels is not highly reliable, especially since species of A.
marmorata exhibited similar morphological characteristics
as A. luzonensis.
Three species of freshwater eels, A. marmorata, A.
bicolor, and A. luzonensis were accurately identified in the
study using molecular analysis from mixed species of
freshwater eels collected from Cagayan River. The
Cagayan River is one of the most important geographical
niches of tropical Anguillid. These species of freshwater
eels are believed to be the most basal species of the
family Anguillidae found in the Indo-Pacific region
(Aoyama et al. 2001). A. marmorata, for instance, is
reported to have multiple populations scattered
throughout the region from the Indian Ocean to the
French Polynesia (Kuroki et al. 2014). However, unlike A.
marmorata which is well-studied and with known
spawning sites, little information is known about A.
bicolor pacifica and A. luzonensis (Kuroki et al. 2007;
Kuroki et al. 2012). For further biological and ecological
studies, it is necessary to employ both morphological and
molecular analyses on the identification and
documentation of these species.
Freshwater eels are economically valuable
commodities traded at various life stages from juveniles
to adults. With the declining population and the passing
of strict conservation measures on the exploitation and
233 | Philipp Agric Scientist (2022)105(3):226-235
Joyce A. Hilario et al.
exportation of temperate eel species, tropical eels have
now become the center of economic interest for the
supply of freshwater eels (Nijman 2015). This study
argues that without intensive morphological examination
and molecular analysis, discrimination of freshwater eel
species may be inaccurate and inconsistent. As they
approach maturity, freshwater eels undergo
metamorphosis showing a continuous change in body
forms and pigmentation patterns, making distinct
physical characteristics of individuals not comparable at
different life stages.
The Philippine archipelago has been identified as an
important source of tropical freshwater eels in recent
years. It is home to at least 5 freshwater eel species,
namely, A. bicolor, A. marmorata, A. japonica, A.
celebesensis, and A. luzonensis. However, some of these
species were not yet well-studied (Yoshinaga et al. 2014).
For instance, A. luzonensis is a new species of eel
previously identified by Watanabe et al. (2009).
Unfortunately, A. luzonensis has been listed under the
vulnerable category of the International Union for
Conservation of Nature (IUCN) Red List of Threatened
Species in 2018 (Pike et al. 2020). The IUCN assessed that
A. luzonensis, known as the Philippine mottled eel,
needed a management plan and international trade
control due to its high risk of extinction in the wild.
Considering the increase in catch and trade without
proper stock assessment, freshwater eel population is
expected to rapidly decline outside safe biological limits.
Therefore, it is highly important to develop an accurate
species identification for Anguillid eels using molecular
analysis, which will permit correct traceability
verification, classification, and labelling in the production
cycle of Anguillids, and their supply and demand chain.
ACKNOWLEDGMENT
This research was supported by the Bureau of Fisheries
and Aquatic Resources National Freshwater Fisheries
Technology Center, and the National Fisheries Research
and Development Institute–Fisheries Biotechnology
Center.
REFERENCES CITED
AOYAMA J, NISHIDA M, TSUKAMOTO K. 2001.
Molecular phylogeny and evolution of the freshwater
eel, genus Anguilla. Mol Phylogenet Evol. 20:450–459.
CUVIN-ARALAR ML, AYA F, ROMANA-EGUIA MR,
LOGRONIO DJ. 2019. Nursery culture of tropical
Anguillid eels in the Philippines. Philippines:
Southeast Asian Fisheries Development Center,
Aquaculture Department.
https://pas.cafs.uplb.edu.ph
Genetic Identification of Anguilla spp.
CROOK V. 2014. Slipping away: international Anguilla
eel trade and the role of the Philippines. United
Kingdom, Cambridge: TRAFFIC and Zoological
Society London.
ESPIÑEIRA M, VIEITES JM. 2016. Genetic system for an
integral traceability of European eel (Anguilla
anguilla) in aquaculture and seafood products:
authentication by fast real-time PCR. Eur Food Res
Technol. 242(1):25–31.
FISHERIES ADMINISTRATIVE ORDER NO. 242. 2012.
Retrieved Apr. 12, 2012 from https://
www.bfar.da.gov.ph/laws-regulations-issuances/
administrative-orders/.
HAN YS, YAMBOT AV, ZHANG H, HUNG CL. 2012.
Sympatric spawning but allopatric distribution of
Anguilla japonica and Anguilla marmorata: temperature
- and oceanic current-dependent sieving. PLoS ONE 7
(6):e37484.
HAN YS, YU CH, YU HT, CHANG CW, LIAO IC,
TZENG WN. 2002. The exotic American eel in
Taiwan: ecological implications. J Fish Biol. 60:1608–
1612.
JAMANDRE BWD, SHEN KN, YAMBOT AV, TZENG
WN. 2007. Molecular phylogeny of Philippine
freshwater eels Anguilla spp. (Actinopterygi:
Anguilliformes: Anguillidae) inferred from
mitochondrial DNA. Raffles B Zool. 14 Suppl:51–59.
KUROKI M, AOYAMA J, WOUTHUYZEN S,
SUMARDHIHARGA K, MILLER MJ, TSUKAMOTO
K. 2007. Age and growth of Anguilla bicolor bicolor
leptocephali in the eastern Indian Ocean. J Fish Biol.
70(2):538–550.
KUROKI M, MILLER MJ, AOYAMA J, WATANABE S,
YOSHINAGA T, TSUKAMOTO K. 2012. Offshore
spawning for the newly discovered Anguillid species
Anguilla luzonensis (Teleostei: Anguillidae) in the
Western North Pacific. Pacific Sci. 66(4):497–507.
KUROKI M, MILLER MJ, TSUKAMOTO K. 2014.
Diversity of early life-history traits in freshwater eels
and the evolution of their oceanic migrations. Can J
Zool. 92(9):749–770.
LEANDER NJ, SHEN KN, CHEN RT, TZENG WN. 2012.
Species composition and seasonal occurrence of
recruiting glass eels (Anguilla sp.) in the Hsiukuluan
River, Eastern Taiwan. Zool Stud. 51(1):59–71.
https://pas.cafs.uplb.edu.ph
Joyce A. Hilario et al.
LIN YS, POH YP, LIN SM, TZENG CS. 2002. Molecular
techniques to identify freshwater eels: RFLP analyses
of PCR-amplified DNA fragments and allele-specific
PCR from mitochondrial DNA. Zool Stud. 41(4):421–
430.
LUO M, GUAN R, LI Z, JIN H. 2013. The effects of water
temperature on the survival, feeding, and growth of
the juveniles of Anguilla marmorata and A. bicolor
pacifica. Aquaculture. 400–401:61–64.
MINEGISHI Y, AOYAMA J, INOUE JG, AZANZA RV,
TSUKAMOTO K. 2009. Inter-specific and subspecific
genetic divergences of freshwater eels, genus Anguilla
including a recently described species, A. luzonensis,
based on whole mitochondrial genome sequences.
Coastal Mar Sci. 33:1–14.
NIJMAN V. 2015. CITES-listings, EU eel trade bans and
the increase of export of tropical eels out of
Indonesia. Mar Policy. 58:36–41.
PIKE C, CROOK V, JACOBY D, GOLLOCK M. 2020.
Anguilla luzonensis: amended version of 2019
assessment. The IUCN Red List of Threatened Species
2020: e.T18435966A176497159.
POLITIS SN, MAZURAIS D, SERVILI A, ZAMBONINO-
INFANTE JL, MIEST JJ, SØRENSEN SR,
TOMKIEWICZ J, BUTTS IAE. 2017. Temperature
effects on gene expression and morphological
development of European eel, Anguilla anguilla
larvae. PLoS One. 12(8):e0182726.
RSTUDIO TEAM. 2020. RStudio: integrated
development for R. RStudio, PBC. Boston, MA. http://
www.rstudio.com/.
SHIRAISHI H, CROOK V. 2015. Eel market dynamics: an
analysis of Anguilla production. Japan, Tokyo: Traffic.
SILFVERGRIP AMC. 2009. CITES identification guide to
the freshwater eels (Anguillidae): with focus on the
European eel Anguilla. Sweden, Stockholm: Swedish
Environmental Protection Agency. Report No.: 5943.
TABETA O, TANIMOTO T, TAKAI T, MATSUI I,
IMAMURA T. 1976. Seasonal occurrence of Anguillid
elvers in Cagayan River, Luzon Island, the
Philippines. Bull Japan Soc Sci Fish. 42(4):421–426.
VØLLESTAD LA. 1992. Geographic variation in age and
length at metamorphosis of maturing European eel:
environmental effects and phenotypic plasticity. J
Anim Ecol. 61:41–48.
Philipp Agric Scientist (2022)105(3):226-235 | 234
Genetic Identification of Anguilla spp. Joyce A. Hilario et al.

WATANABE S, AOYAMA J, TSUKAMOTO K. 2004. YOSHINAGA T, AOYAMA J, SHINODA A,

Reexamination of Ege’s (1939) use of taxonomic WATANABE S, AZANZA RV, TSUKAMOTO K.
characters of the genus Anguilla. Bull Mar Sci. 74:337– 2014. Occurrence and biological characteristics of
351. glass eels of the Japanese eel Anguilla japonica at the
Cagayan River of Luzon Island, Philippines in 2009.
WATANABE S, TSUKAMOTO K, AOYAMA J. 2009. A
Zool Stud. 53:13.
new species of freshwater eel Anguilla luzonensis
(Teleostei: Anguillidae) from Luzon Island of the
Philippines. Fish Sci. 75:387–392.

235 | Philipp Agric Scientist (2022)105(3):226-235 https://pas.cafs.uplb.edu.ph

View publication stats