horticulturae
Article
Microsatellite-Based Molecular Diversity in Sour Cherry
Genotypes (Prunus cerasus L.) Cultivated in Hungary
Janka Bedő, Andrea Kitti Tóth-Lencsés, Zsófia Kovács * , Bánk Pápai, Antal Szőke, Erzsébet Kiss and Anikó Veres
Citation: Bedő, J.; Tóth-Lencsés, A.K.;
Kovács, Z.; Pápai, B.; Szőke, A.; Kiss,
E.; Veres, A. Microsatellite-Based
Molecular Diversity in Sour Cherry
Genotypes (Prunus cerasus L.)
Cultivated in Hungary. Horticulturae
2023, 9, 892. https://doi.org/
10.3390/horticulturae9080892
Academic Editor: Hrotkó Károly
Received: 10 July 2023
Revised: 1 August 2023
Accepted: 2 August 2023
Published: 6 August 2023
Copyright: © 2023 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
Horticulturae 2023, 9, 892. https://doi.org/10.3390/horticulturae9080892
Molecular Genetics and Breeding Group, Department of Genetics and Genomics, Institute of Genetics and
Biotechnology, Hungarian University of Agriculture and Life Sciences (MATE), H-2100 Gödöllő, Hungary;
bedo.janka@uni-mate.hu (J.B.); toth-lencses.andrea.kitti@uni-mate.hu (A.K.T.-L.); papai.bank@uni-mate.hu (B.P.);
szoke.antal@uni-mate.hu (A.S.); kiss.erzsebet@uni-mate.hu (E.K.); veres.aniko@uni-mate.hu (A.V.)
* Correspondence: kovacs.zsofia@uni-mate.hu
Abstract: The aim of this study was to evaluate the genetic diversity of sour cherries using SSR
markers, correlate the data with phenotypic traits, and investigate the suitability of Prunus-specific
microsatellite markers in this species. Nineteen sour cherry genotypes from the Fruit Research
Institute in Érd, Hungary, were analyzed using twelve SSR primer pairs. The number of alleles
ranged from two to ten, with a mean value of 4.67 per locus. The highest number of alleles was
generated with BPPCT 007. All the primers displayed a polymorphic pattern. The most informative
markers, based on the highest PIC values, were CPPCT022, BPPCT041, and BPPCT030. The genotypes
were grouped based on flowering time, ripening time, and fruit weight. To determine the correlation,
we have performed a regression analysis association with fruit traits and molecular markers. The
marker PceGA025 appeared to have an allele size that statistically significantly correlates to flowering
and ripening time. Also, BPPCT002, BPPCT007 and UCDCH17 have an allele that significantly
correlates to ripening time. Additionally, one of the alleles of UDP 98 410 appeared to be correlated
with fruit weight.
Keywords: genetic diversity; Prunus cerasus L.; microsatellite; correlation
1. Introduction
Within the Rosaceae family, there are several agronomically and economically important
stone fruit plants, such as almonds, plums, peaches, and nectarines [1]. The Prunus genus
alone includes about 400 to 430 species, including peaches (Prunus persica L., 2n = 2x= 16),
apricots (Prunus armeniaca L., 2n = 2x = 16), sweet cherries (Prunus avium L., 2n = 2x = 16),
and sour cherries (Prunus cerasus L., 2n = 4x = 32) [1–5]. Cherries are indigenous to Europe
and Asia, while sour cherries are native to the Near East center (Asia Minor, Iran, Iraq,
Syria) [6]. Prunus cerasus L. is an allotetraploid species that evolved from the natural
hybridization of Prunus avium L. (2x = 16) and Prunus fruticosa L. (4x = 32) both originating
from the same area [7,8].
Several theories have been proposed regarding the arrival of sour cherries in Europe,
but the most widely accepted suggestion is that various ecotypes have developed over
the years to adapt to different weather conditions [9]. As a result of this broad adaptation,
sour cherries can be grown in various areas, including Hungary. Additionally, Hrotkó
et al. [10] explored the genetic background of Prunus fruticosa Pall. in various hybrid
derivatives, revealing that the female parent of sour cherry must be Prunus fruticosa. For
natural hybridization to occur, both species need to share the same habitat and flowering
time, providing an opportunity for normal Prunus fruticosa gametes to encounter unreduced
Prunus avium gametes. This finding was further supported by Wöhner et al. [11], who
provided evidence through long-read chromosome-level draft genome assembly.
The vegetation period of sour cherries is between 200 and 240 days, with the blooming
period starting in the middle of April and lasting until the beginning of May. Moreover,
https://www.mdpi.com/journal/horticulturae
Horticulturae 2023, 9, 892 2 of 16

these fruits exhibit excellent adaptability to different climates and they can tolerate tem-
peratures as low as −35 ◦ C during the winter period [12]. Although other countries
initiated their sour cherry breeding projects in the early 1900s, Hungary only established
its foundation in the 1950s when Pál Maliga aimed to select clones that ripened earlier
than Pándy clones, were self-fertile, and possessed multi-purpose utilization [13]. Until
that time, Pándy dominated the market, despite being self-incompatible and having a low
yield [12]. However, there are no perfect varieties that can be used for every purpose, and
breeders need to consider their customers’ demands. Furthermore, due to climate change,
there is a need to improve and develop new, modern varieties that can adapt to the new
environmental conditions and meet the interests of consumers and breeders [14–16]. To
accomplish this, traits are separated into various categories according to different priorities.
For example, from the customers’ perspective, the primary group of traits includes ripening
time, fruit size, skin color, taste, etc., while the secondary group encompasses kernel size,
vitamin content, flesh color, etc. [12].
Several studies have demonstrated that molecular markers are useful tools that allow
breeders to select from their collections, reduce time and costs, and increase potential
profit [17,18]. Molecular markers are widely used to assess genetic variation in germplasm
collections [19], evolutionary studies [20], ecological and phylogenetic studies, as well as in
various fields such as taxonomy and genetic engineering [21–23].
One of the most popular molecular markers are microsatellites, or simple sequence
repeats (SSRs), which can be detected using simple reproducible assays. They are co-
dominant, abundant, multi-allelic, and uniformly distributed throughout the genome [24].
SSRs can be classified as mono-, di-, tri-, tetra-, penta-, and hexanucleotide repeats, with
lengths ranging from 1 to 6 nucleotides [25]. Typically, they consist of tandem repeats
of 5–20 times in the genome with a minimum repeat length of twelve base pairs [26–28]
and are widely applied in research [29–33]. Microsatellites have been successfully used in
Prunus species since the early 2000s [2,34–37], and were primarily developed in peaches, but
have also been tested and used in other species [2]. Moreover, SSRs have been developed
and applied in sour cherries, not only in Prunus cerasus L., but also in other members of
the Rosaceae family [38,39]. For instance, Downey and Iezzoni [40] used two sour cherry
microsatellites in black cherry along with sweet cherry and peach primers. Furthermore,
microsatellites have evolved to be suitable not only for diversity evaluation [31,41]; they
have also helped to preserve the germplasm [42], assess the pollinizer success rate [43],
and supported further studies regarding, for instance, sex determination in the case of
dioecious plants [44] within or outside of the Rosaceae family.
Therefore, the aim of this study was to assess the genetic diversity within sour cherry
genotypes cultivated in Hungary. The subject of this present research is also to assess
the correlation between genotypic data and phenotypic traits to provide background
information and a tool that is suitable for selecting plants during breeding, thereby helping
the work of breeders. This examination also assesses the transferability of microsatellite
markers developed in other species to sour cherry.

2. Materials and Methods

2.1. Plant Material and DNA Isolation
The plant materials used for the SSR analysis consisted of a total of 19 sour cherry
genotypes (Tables 1 and 2) which were obtained from the Fruit Research Institute in Érd,
Hungary. Leaves were collected and stored at −20 ◦ C until further use. DNA extractions
were carried out with Qiagen DNeasy® Plant Mini Kit with PVP (Polyvinylpyrrolidone)
according to the manufacturer’s protocols.
Horticulturae 2023, 9, 892 3 of 16

Table 1. Sour cherry genotypes from which leaves were collected and analyzed. The second column
of the table shows their origin, where they were discovered or how they were developed, and the
third lists the breeder who cultivated them or found them (Sources: [12,45–48]).

Genotype Origin Breeder (s)

Selected from a Carpathian
Cigány 59 Sándor Brózik
basin population
Selected from a range of
Bosnian sour cherry varieties
Csengődi János Apostol
grown in the
Csengőd-Akasztó area
Selected landrace from a
Debreceni bőtermő Attila Ménesi and Tibor Szabó
suburb in Debrecen
Érdi bőtermő Pándy x Nagy angol Pál Maliga and János Apostol
Érdi jubileum Pándy x Eugenia Pál Maliga and János Apostol
Hankovszky’s early cherry
Érdi nagygyümölcsű type seedling with open Pál Maliga
pollination
Favorit Pándy x Montreuilli Pál Maliga
Hibrid 3/48 Érdi bőtermő x Meteor korai János Apostol
Landrace selection around
Kántorjánosi 3 Tibor Szabó
Mátészalka
Korai pipacs Pándy x Császár Pál Maliga and János Apostol
Landrace selection around
Kőrösi korai Sándor Kovács
Debrecen and Nyírség
Maliga emléke Pándy x Eugenia Pál Maliga and János Apostol
Meteor korai Pándy x Nagy angol Pál Maliga and János Apostol
Selected from a range of
Oblacsinszka
Bosnian sour cherry varieties
Clone of a selected Carpathian
Pándy 48 Sándor Brózik
basin population
Clone of a selected Carpathian
Pándy 279 Sándor Brózik
basin population
A selected cultivar from a
Pipacs range of Pipacs sour cherry Sándor Kovács
varieties from Kecel cropland
M221(Pándy x Olivet) x
Piramis János Apostol
Meteor korai
Landrace selection around
Újfehértói fürtös Ferenc Pethő and Tibor Szabó
Újfehértó

Table 2. Summarized characteristics of Prunus cerasus L. genotypes that are used in this research.
For each column, the background color represents the groups that share similar characteristics
(orange indicates group 1, purple indicates group 2, green indicates group 3, and blue indicates
group 4 for each trait). Each trait has its own groups; each group of traits are analyzed separately
(Sources: [12,45–48]).

Genotype Blooming Time Beginning of Ripening Time Fruit Size

Cigány 59 Mid–late ~June 20–22. 3–4 g, 14–20 mm
Csengődi Early–mid ~June 8–10. ~5 g, 21–22 mm
Debreceni bőtermő Late End of June–beginning of July 5–6 g, 22–23 mm
Érdi bőtermő Early ~ June 16–18. 5–6 g, 21–23 mm
Érdi jubileum Mid–late ~ June 12. 4–5 g, 21–23 mm
Érdi
Mid ~June 12–15. ~6 g, 23–25 mm
nagy-gyümölcsű
Favorit Early–mid ~June 10–12. ~6 g, ~24 mm
Hibrid 3/48 Mid ~May 22–25. ~3 g, 19–21 mm
Horticulturae 2023, 9, 892 4 of 16

Table 2. Cont.

Genotype Blooming Time Beginning of Ripening Time Fruit Size

Kántorjánosi 3 Late End of June–beginning of July 5–6 g, 22–23 mm
Korai pipacs Mid ~June 12–15. ~5 g, 21–22 mm
Kőrösi korai ~Middle of June ~4, 3 g
Maliga emléke Mid ~June 22. 6–8 g, 23–25 mm
4, 5–5, 5 g, 21–22
Meteor korai Early–mid ~June 3–5.
mm
Oblacsinszka ~June 10–15. 2, 5–3 g, 16–18 mm
Pándy 48 Early ~June 22. 6–8 g, 21–24 mm
Pándy 279 Late ~June 25–30. 6–8 g, 21–24 mm
Pipacs Late ~June 22–25. 4–5 g, ≥20 mm
Piramis Early Beginning of June 8–9 g, 24–26 mm
Újfehértói fürtös Late Beginning of July 5–6 g, 22–24 mm

2.2. PCR Condition

PCR was conducted using a Thermal Cycler GeneAmp PCR System 9700 with a final
volume of 10 µL for 15–20 ng of template DNA. The reaction mixture contained DreamTaq™
DNA polymerase (Thermo Fisher Scientific™); the protocols were performed according
to the manufacturer’s instructions (Table 3). Touchdown PCRs were carried out, which
consisted of an initiation cycle at 95 ◦ C for 3 min; 10 cycles of denaturation at 95 ◦ C for
30 s, primer annealing at 65 ◦ C for 30 s and extension at 72 ◦ C for 30 s, at which point the
annealing temperature was decreased by 1 ◦ C at each cycle. This was followed by 25 cycles
of denaturation at 95 ◦ C for 30 s, annealing at 56 ◦ C for 30 s and extension at 72 ◦ C for 30 s.
The reaction was completed with a post-polymerization extension cycle at 72 ◦ C for 5 min.

Table 3. List of SSR locus names applied in this sour cherry research, the sequences and the origin of
microsatellites, where they were first developed, and their references (Sources: [2,34,35,37,48–50]).

SSR Locus Forward Sequence Reverse Sequence Origin References

BPPCT 002 TCGACAGCTTGATCTTGACC CAATGCCTACGGAGATAAAAGAC
BPPCT 007 TCATTGCTCGTCATCAGC CAGATTTCTGAAGTTAGCGGTA
BPPCT 015 ATGGAAGGGAAGAGAAATCG GTCATCTCATCAAACTTTTCCG P. persica [2]
BPPCT 030 AATTGTACTTGCCAATGCTATGA CTGCCTTCTGCTCACACC
BPPCT 041 TGAAAGTGAAACAATGGAAGC CAGCCGAACCAAGGAGAC
CPPCT 022 CAATTAGCTAGAGAGAATTATTG GACAAGAAGCAAGTAGTTTG P. persica [35]
Ma39a AGAAAGGCACTTTATCTAGG TTGTTTTGGGGATGGTAGT P. persica [49]
PceGA25 GCAATTCGAGCTGTATTTCAGATG CAGTTGGCGGCTATCATGTCTTAC P. cerasus [38]
UCDCH 17 TGGACTTCACTCATTTCAGAGA ACTGCAGAGAATTTCCACAACCA P. avium [37]
UDP96 001 AGTTTGATTTTCTGATGCATCC TGCCATAAGGACCGGTATGT
P. persica [34]
UDP96 005 GTAACGCTCGCTACCACAAA CCTGCATATCACCACCCAG
UDP98 410 AATTTACCTATCAGCCTCAAA TTTATGCAGTTTACAGACCG P. persica [50]

2.3. SSR and Statistical Analysis

In this study, the amplified PCR products were first tested on a 1% TBE agarose gel
and then separated on a 6% polyacrylamide gel (© Bio-Rad Laboratories, Inc., Budapest,
Hungary) using a vertical system (ALF-Express II., Amersham Biosciences, AP Hungary
LTD, Budapest, Hungary). Fragments were detected using a Cyanine5 (Cy5) label attached
to the forward primer (Bio-Science Kereskedelmi és Szolgáltató Kft, Budapest, Hungary).
Cy5 is a far-red-fluorescent dye which, at 633 nm or 647 nm laser lines, results in an
excitation; therefore, the sensors can notice the signals. The allele sizes at the SSR loci were
determined using DNA molecular weight standards and the ALFwin Fragment Analyser
1.0 software.
Horticulturae 2023, 9, 892 5 of 16

To analyze the genetic similarity among the genotypes, a dendrogram was constructed
using the IBM SPSS Statistics 23 (Release 23.0.0.0) program. We classified the genotypes
into hierarchical clusters using the “Within-groups linkage” cluster method by checking
the binary data “variance”. Furthermore, the Jaccard index was calculated using the
Past 4.03 (Paleontological Statistics) program. The Jaccard index is a measure of genetic
similarity based on the presence or absence of alleles on a scale 0–1, where 1 means complete
similarity and 0 indicates a complete difference between genotypes. Furthermore, the
genotypes were classified into 4–4 groups for each trait based on flowering time (1—early,
2—early–mid, 3—mid, mid–late and 4—late), ripening time (1—before June 5; 2—June 5–15,
3—June 15–25, 4—after June 25) and fruit weight (1– ≤ 3–4 g; 2–4–5 g; 3–5–6 g; 4–6 g≤) and
regression association analysis was applied again with this software. Then, a Chi-square
test was performed based on the allele size dispersion according to flowering time, ripening
time, and fruit weight groups. The SSR fragments were scored as either present or absent,
and subsequent association analysis was conducted to identify markers that were correlated
with the studied characteristics. This analysis aimed to establish relationships between the
molecular data and the trait data under investigation.
Additionally, the results were evaluated using various parameters. The expected
heterozygosity index (H), Polymorphic Information Content (PIC), Effective multiplex ratio,
Marker index and Discriminating power were calculated using the iMEC: Online Marker
Efficiency Calculator program developed by Amiryousefi et al. [51]. The program utilizes
different calculations based on previous research. It is an R software-based analytical
webpage which is available online. The expected heterozygosity was determined based
on the work of Liu et al. [52], the PIC was based on Botstein et al.’s research [53], and the
mean heterozygosity, marker index, and discriminating power were based on the work of
Tessier et al. [54]. Binary data were used for the analysis, and for codominant markers, the
maximum value of H and PIC was assumed to be 0.5, since both values were affected by
the number and frequency of alleles, and it is assumed that there were two alleles per locus.
Higher values of the indices indicated higher levels of polymorphism between genotypes.

3. Results
In this study, nineteen sour cherry varieties (Table 1) were fingerprinted using twelve
microsatellite markers, six newly applied pairs of SSR (Simple Sequence Repeat) primers,
alongside with six previously used microsatellites together (Table 4, [55]) to assess their
genetic diversity and relatedness.

Table 4. Repeat motifs of the applied twelve microsatellite marker loci, and a summary of the results
of the screened in sour cherry cultivars regarding number of alleles and allele size range.

Allele Size Range

Locus Repeat Motif Number of Alleles
(bp)
BPPCT002 a (AG)25 4 167–183
BPPCT007 (AG)22 (CG)2 (AG)4 10 110–234
BPPCT015 (AG)13 5 78–190
BPPCT030 a (AG)25 3 141–163
BPPCT041 a (AG)21 2 200–228
CPPCT022 (CT)28 CAA(CT)20 5 223–261
Ma39a (GA)23 4 161–181
PceGA025 n.d. 4 160–184
UCDCH17 a (CT)11 7 176–200
UDP 96 001 a (CA)17 3 101–125
UDP 96 005 a (AC)16 TG(CT)2 CA(CT)11 5 102–134
UDP 98 410 (AG)23 4 125–141
a Previously published results, [55]. n.d.: no data.
Horticulturae 2023, 9, 892 6 of 16

A total of 56 alleles were found, with the number of alleles per locus ranging from
2 to 10, and a mean of 4.67 alleles per locus. The highest number of alleles was observed in
BPPCT007 (Table 4).
None of the twelve examined SSR loci exhibited a monomorphic pattern. We evaluated
our SSR results based on a study by Amiryousefi et al. [51] (Table 5). The loci Ma39a,
UCDCH17 and UDP 96 005 showed the highest heterozygosity index (H = 0.50), while
CPPCT022 had the lowest (H = 0.35). These three primer pairs have the highest probability
of predicting a heterozygous individual for the given locus. The average heterozygosity
index across the twelve markers was 0.46. Among the twelve markers tested, CPPCT022
(PIC = 0.43), BPPCT041 (PIC = 0.42), and BPPCT030 (PIC = 0.41) exhibited the highest PIC
values in Prunus cerasus L. The effective multiplex ratio (EMR), ranging from 0.55 to 6.23,
reflects the effectiveness of the primer–marker system, with higher values indicating better
effectiveness. The Marker Index (MI) is interpreted similarly to EMR, where higher values
indicate better performance. According to the discriminating power, BPPCT041 (DP = 0.93)
and UDP 98 410 (DP = 0.89) have the best ability to distinguish individuals in a population,
thus reducing the probability of confusion between individuals, meanwhile CPPCT022 has
the poorest ability at 0.41 (Table 5).

Table 5. Report of characterization based on heterozygosity index, polymorphic information content,

effective multiplex ratio, marker index, and discriminating power of the twelve microsatellite primer
pairs used in this study to differentiate 19 Prunus cerasus L. genotypes.

Polymorphic Effective
Heterozygosity Discriminating
No. Locus Information Multiplex Marker Index
Index a Power
Content a Ratio
1 BPPCT002 0.48 0.38 2.36 0.013 0.65
2 BPPCT007 0.47 0.39 6.23 0.013 0.61
3 BPPCT015 0.48 0.38 2.96 0.013 0.65
4 BPPCT030 0.42 0.41 2.09 0.013 0.52
5 BPPCT041 0.40 0.42 0.55 0.005 0.93
6 CPPCT022 0.35 0.43 3.86 0.012 0.41
7 Ma39a 0.50 0.37 1.96 0.011 0.76
8 PceGA025 0.49 0.38 2.32 0.013 0.67
9 UCDCH17 0.50 0.37 3.41 0.011 0.76
10 UDP 96 001 0.49 0.38 1.73 0.013 0.67
11 UDP 96 005 0.50 0.37 2.41 0.011 0.77
12 UDP 98 410 0.44 0.40 1.32 0.007 0.89
a The highest value could be 0.5 according to Amiryousefi et al. [51].

The Jaccard index, among the examined Prunus cerasus L. genotypes, indicates that
Pándy clones are identical to each other. Also, Újfehértói fürtös, Debreceni bőtermő, and
Kántorjánosi 3 exhibit high similarity (Table 6). The genotypes based on SSR data that bear
the closest resemblance to Érdi bőtermő are Favorit, Hibrid 3/48, and Maliga emléke.
 Horticulturae
Horticulturae 2023,2023, 9, 892PEER REVIEW
9, x FOR 7 of 167 of 16

Table 6. Genetic relatedness of sour cherry genotypes based on Jaccard index using twelve Prunus
Table 6. Genetic relatedness of sour cherry genotypes based on Jaccard index using twelve Prunus
specific microsatellites. (The darker the color, the more closely the genotypes are associated with
specific microsatellites. (The darker the color, the more closely the genotypes are associated with
each other).
each other).

Érdi Nagygyümölcsű
Debreceni Bőtermő

Újfehértói Fürtös
Maliga Emléke
Kántorjánosi 3
Érdi Jubileum

Oblecsinszka
Érdi Bőtermő

Meteor Korai
Kőrösi Korai
Korai Pipacs
Hibrid 3/48

Pándy 279
Cigány 59

Csengődi

Pándy 48

Piramis
Favorit

Pipacs
Cigány 59 1
Csengődi 0.61 1
Debreceni
bőtermő 0.51 0.50 1
Érdi bőtermő 0.42 0.44 0.57 1
Érdi jubileum 0.50 0.61 0.63 0.61 1
Érdi
nagygyümölcsű 0.47 0.59 0.56 0.54 0.65 1
Favorit 0.37 0.43 0.56 0.76 0.55 0.57 1
Hibrid 3/48 0.51 0.54 0.68 0.75 0.68 0.76 0.74 1
Kántorjánosi 3 0.53 0.49 0.97 0.60 0.65 0.55 0.55 0.70 1
Korai pipacs 0.45 0.51 0.65 0.68 0.74 0.73 0.62 0.80 0.68 1
Kőrösi korai 0.61 0.59 0.65 0.51 0.61 0.50 0.58 0.58 0.63 0.55 1
Maliga emléke 0.43 0.45 0.59 0.74 0.58 0.60 0.74 0.77 0.61 0.65 0.53 1
Meteor korai 0.49 0.51 0.69 0.59 0.65 0.54 0.62 0.66 0.68 0.63 0.59 0.61 1
Oblecsinszka 0.79 0.55 0.53 0.48 0.53 0.46 0.40 0.54 0.56 0.48 0.63 0.42 0.48 1
Pándy 279 0.54 0.53 0.94 0.56 0.62 0.55 0.55 0.67 0.92 0.64 0.68 0.58 0.73 0.52 1
Pándy 48 0.54 0.53 0.94 0.56 0.62 0.55 0.55 0.67 0.92 0.64 0.68 0.58 0.73 0.52 1 1
Pipacs 0.44 0.46 0.52 0.50 0.48 0.53 0.49 0.56 0.51 0.54 0.43 0.51 0.43 0.46 0.55 0.55 1
Piramis 0.35 0.43 0.60 0.54 0.55 0.49 0.61 0.64 0.62 0.58 0.58 0.59 0.58 0.43 0.59 0.59 0.49 1
Újfehértói fürtös 0.55 0.50 0.91 0.54 0.59 0.53 0.53 0.64 0.89 0.62 0.70 0.55 0.70 0.54 0.97 0.97 0.56 0.56 1

To determine genetic relatedness, a dendrogram was constructed based on the SSR

On the other hand, Pipacs genotypes show the least similarity to the analyzed samples
data of the nineteen
according sourindex
to the Jaccard cherry cultivars
(Table 6). using 12 microsatellite markers, as shown in
Figure To1. The dendrogram
determine reveals two
genetic relatedness, main groups.
a dendrogram wasThe first and
constructed largest
based group
on the contains
SSR data
Pándy
of the nineteen sour cherry cultivars using 12 microsatellite markers, as shown in Figure 1. The
clones, Érdi jubileum, a Cigány clone, and Debreceni bőtermő, among others.
second main groupreveals
The dendrogram consiststwoofmain
Korai pipacs,
groups. Favorit,
The first andand the other
largest grouptwo Érdi Pándy
contains genotypes,
clones,
among Érdi jubileum,
others. Pándy 48 a Cigány clone,279
and Pándy and Debreceni
cannot bőtermő, among
be distinguished others.
from eachThe second
other based on
main group consists of Korai pipacs, Favorit, and the other two Érdi
the dendrogram. Additionally, Pipacs, Cigány 59, and Oblecsinszka genotypes are genotypes, among
others. Pándy 48 and Pándy 279 cannot be distinguished from each other based on the
genetically the furthest from the analyzed samples within their respective cluster, as
dendrogram. Additionally, Pipacs, Cigány 59, and Oblecsinszka genotypes are genetically
indicated in Figure 1.
the furthest from the analyzed samples within their respective cluster, as indicated in
Figure 1.
Horticulturae 2023,
Horticulturae 2023, 9,
9, 892
x FOR PEER REVIEW 88 of 16
of 16

Figure 1. Hierarchical cluster analysis of nineteen Prunus cerasus L. genotypes cultivated in Hungary
Figure
using 12
using 12 SSR
SSR markers
markers illustrated
illustrated on
on dendrogram.
dendrogram.

Additionally, based
Additionally, based onon their
their characteristics
characteristics (flowering
(flowering time, ripening time, and fruit
weight)
weight) wewe classified
classified thethe genotypes
genotypes into into 4–4
4–4 groups
groups for each trait (Table 2), then regression
association analysis
analysis waswasperformed
performedtotodetermine
determine thethe linkage
linkage forfor
each each phenotypic
phenotypic traittrait
and
and the microsatellite markers used. The aim of these
the microsatellite markers used. The aim of these analyses is to be able analyses is to be able to examine
examine
populations
populations to help help breeders
breedersin inthe
theearly
earlyselection
selection phase.
phase. Thus,
Thus, wewe havehave demonstrated
demonstrated the
the dispersion
dispersion of allele
of allele sizessizes on heatmaps
on heatmaps (Figure(Figure
2). The2). statistically
The statistically significant
significant valuesvalues
were
were
marked marked
with withgreengreen asterisks.
asterisks. Following
Following this analysis,
this analysis, we carried
we carried out aout a Chi-square
Chi-square test.
test. PceGA025
PceGA025 172 was was found
172 found to be to be associated
associated withwithflowering
floweringtime. time. TheThe marker
marker alleles
alleles
BPPCT002
BPPCT002179 179,, BPPCT007
BPPCT007122 122, , PceGA025
PceGA025172 , ,UCDCH17
172 UCDCH17182 showedan
182showed an association
association with
with the
the
ripening time. Also, UDP98
ripening time. Also, UDP98 410141 410 141 showed correlation with fruit weight. The highest
showed correlation with fruit weight. The highest
correlation 2 2
correlation was was shown
shown by byPceGA025
PceGA025 172 and
172 and UCDCH17
UCDCH17182 182 (R
(R2 == 0.795
0.795 and
and RR2 == 0.852,
0.852,
respectively) One of the markers,
respectively).. One of the markers, BPPCT007 BPPCT007 , had −
122 122, had −0.753 as a standardizedcoeffi-
0.753 as a standardized beta beta
cient and showed
coefficient and showedstatistically significant
statistically (t = −5.965,
significant p < 0.001)
(t = −5.965, negative
p < 0.001) correlation
negative with
correlation
ripening time. BPPCT002
with ripening time. BPPCT002179 also179had a statistically
also significant
had a statistically correlation
significant with ripening
correlation with
time,
ripening time, where the standardized beta coefficient was 0.763 (t = 6.525, p <(Table
where the standardized beta coefficient was 0.763 (t = 6.525, p < 0.001) 0.001)7).
(Table
7).
Horticulturae 2023, 9, x FOR PEER REVIEW 9 of 16

Horticulturae 2023, 9, 892 9 of

Table 7. Regression analysis of SSR marker alleles of 19 sour cherry genotypes associated with 16
fruit
traits.

Standardized
SSR
Table 7. Regression Marker
analysis of SSR marker alleles of 19 sour cherry genotypes associated with
Trait r R2 Beta t Value p Value
fruit traits. (Alleles)
Coefficients
Flowering time PceGA025
SSR 172 0.588 0.346 Standardized
−0.588 −2.816 0.013
Trait Marker 179 r 2
R0.386 Beta t Value p Value
BPPCT002 0.621 0.763 6.525 <0.001
(Alleles) Coefficients
BPPCT007122 0.758 0.575 −0.753 −5.965 <0.001
Ripening
Flowering time
time PceGA025
PceGA025172 0.588 0.346 −0.588 −2.816 0.013
172 0.892 0.795 −0.430 −3.634 0.003
BPPCT002179 0.621 0.386 0.763 6.525 <0.001
UCDCH17
BPPCT007
182 0.923
0.758
0.852
0.575
0.285
−0.753
2.319
−5.965
0.036
<0.001
Ripening time UDP98410122
Fruit weight 0.567 0.321 −0.567 −2.838 0.011
PceGA025172141 0.892 0.795 −0.430 −3.634 0.003
UCDCH17182 0.923 0.852 0.285 2.319 0.036
Fruit weight UDP98410141 0.567 0.321 −0.567 −2.838 0.011

Figure 2. Cont.
Horticulturae2023,
Horticulturae 2023,9,9,892
x FOR PEER REVIEW 10
10 of 16
of 16

Figure
Figure2.2. Heatmaps
Heatmaps of of microsatellite
microsatellite markers
markers that
that displayed
displayed significant
significant alleles
alleles based
based onon regression
regression
analysis
analysis according to flowering time, ripening time, and fruit weight. The statistically significant
according to flowering time, ripening time, and fruit weight. The statistically significant
values
values were
were marked
marked with
with green
greenasterisks.
asterisks. The
The group
group numbers
numbers assigned
assigned totoflowering
flowering timetime indicate
indicate
different categories:
different categories: 11 represents
represents early
early flowering,
flowering, 22 represents
represents early
early to
tomid-flowering,
mid-flowering, 33 represents
represents
mid-flowering, and
mid-flowering, and 44 represents
represents late
late flowering.
flowering. Similarly,
Similarly, for
for ripening
ripening time,
time, the
the group
group numbers
numbers are
are
asfollows:
as follows: 11 corresponds
corresponds toto fruits
fruits ripening
ripening before
beforeJune
June 5th,
5th, 22 corresponds
correspondsto to fruits
fruits ripening
ripening between
between
June5th
June 5thand
and15th,
15th,33corresponds
correspondstotofruits
fruitsripening
ripening between
between June
June 15th
15th andand 25th,
25th, and and 4 corresponds
4 corresponds to
to fruits ripening after June 25th. Regarding fruit weight, the group numbers represent the
fruits ripening after June 25th. Regarding fruit weight, the group numbers represent the following:
following: 1 indicates fruits weighing less than or equal to 3–4 g, 2 indicates fruits weighing between
1 indicates fruits weighing less than or equal to 3–4 g, 2 indicates fruits weighing between 4 and 5 g,
4 and 5 g, 3 indicates fruits weighing between 5 and 6 g, and 4 indicates fruits weighing 6 g or more.
3 indicates fruits weighing between 5 and 6 g, and 4 indicates fruits weighing 6 g or more.
4. Discussion
4. Discussion
Simple Sequence
Simple Sequence Repeats
Repeats (SSRs)
(SSRs) were
wereprimarily
primarilydeveloped
developedand andtested
testedinin
peaches in
peaches
the Rosaceae family. However, multiple studies have shown
in the Rosaceae family. However, multiple studies have shown that although they were that although they were
generated in
generated in Prunus
Prunus persica
persica L.,
L., some
some of of them
them cancan also
also be
be used
used in
in other
other species
species within
within the
the
Rosaceaefamily
Rosaceae family[2,32,56].
[2,32,56].
ItIt is
is aa difficult
difficult challenge
challenge to
to analyze
analyze sour
sour cherries
cherries because
because they
they are
are tetraploid
tetraploid and
and most
most
of the statistical analysis techniques and software used molecular
of the statistical analysis techniques and software used molecular genetics are designed genetics are designed
for diploid
for diploid species
species or
ordominant
dominantfeatures.
features.Moreover,
Moreover, diversity
diversity analyses
analysesin sour cherries
in sour are
cherries
usually
are usually basedbasedononmorphological
morphological characteristics
characteristics [57];
[57];only
onlyaafew
few studies applied
studies have applied
genetic markers
genetic markers to to examine
examine them
them [7,58].
[7,58]. In
In the
the present
present study,
study,twelve
twelvemolecular
molecular markers
markers
were used to analyze and characterize the genetic diversity of sour cherries cultivated in
Horticulturae 2023, 9, 892 11 of 16

were used to analyze and characterize the genetic diversity of sour cherries cultivated in
Hungary and we attempted to overcome the associated limitations. Of these markers, ten
originated from peach, one from sweet cherry, and one from sour cherry (Table 3). Among
these twelve microsatellites, only Ma039a has never been previously applied in Prunus
cerasus L.; however, we have proved that this marker is applicable in this genus. Moreover,
this marker could be link to flowering time [59].
There are studies in which the same markers were used in sour cherry, but detailed
data on the generated alleles are not available [60,61]. However, our data are within or close
to the size ranges reported in other analyses. Dirlewanger et al. [2] developed several Prunus
microsatellites in peach and tested them in species within the Rosaceae family and outside
of the family. They reported the exact allele sizes for Prunus persica L. and Prunus avium
L. However, for other tested genotypes, there were cases in which the markers worked,
partially worked, or did not amplify at all. In the case of sour cherry, markers BPPCT002,
BPPCT015, BPPCT030, and BPPCT041 generated amplicons in the tested genotypes, while
only BPPCT007 did not yield fragments for all individuals. Additionally, the BPPCT007
microsatellite appears to be multilocal since more than four fragments were detected in
approximately half of the samples. It has been reported that this locus is also multilocal in
sweet cherry, which is a parent of sour cherry, explaining the shared characteristics.
Although Dirlewanger et al. [2] did not report allele sizes, subsequent studies have
used these markers and reported them. Wünsch et al. [62] applied BPPCT002 and BP-
PCT007, but only size ranges were published. In the case of BPPCT002, the expected
amplicon length was between 166 bp and 180 bp. Comparing our results (Table 4) to theirs,
the generated allele sizes are within or slightly above their range. In the case of BPPCT007,
the lowest range is quite similar to theirs, but in our case the highest size is approximately
50 bp longer. Antonius et al. [63] in agreement with Khadiv-Khub et al. [7,64,65] also
applied these to markers in sour cherry. While their results showed similar fragment
lengths for BPPCT002, the highest value for BPPCT007 was 187 bp and 189 bp, respectively,
compared to our result of 234 bp. Khadivi-Khub [65] has indicated that the 234 bp fragment
of BPPCT007 is associated with doubled fruit, but this trait was not the focus of our research.
Nevertheless, we observed this length in almost half of our examined genotypes.
Cantini et al. [38], Pedersen et al. [39], Lacis et al. [66], and Najafzadeh et al. [67]
reported the use of PceGA025. Our allele results are within the size range reported by these
authors. Moreover, Pedersen et al. [39] have analyzed four genotypes that are consistent
with our analyzed varieties. In the case of the Favorit genotype, our results match with
theirs, but for Érdi jubileum, Oblacsinszka, and Újfehértói fürtös, we observed one fewer
allele. Even though we used the same percentage for the polyacrylamide gel, we used
different running conditions and a different visualization method. The other researchers
used dried gel that was exposed to Kodak BioMax film and in our case, a computer program
detected the fragments. It might not be able to sense the allele sizes that are too close to
each other; thus, the different technique could be the reason for the lower number of alleles.
UDP 96 001 marker was studied in flowering cherries by Ohta et al. [60] and in Prunus
rootstock by Turkoglu et al. [68]. They obtained almost identical results to ours. However,
Najafzadeh et al. [67] have also applied this primer pair, and their reported size range was
slightly broader, with triple the number of alleles compared to ours. They also analyzed
their samples with a UDP 96 005 microsatellite, and in that case, their size range was much
larger (75–180 bp) than ours (102–134 bp). Nonetheless, Wünsch et al., Turkoglu et al. and
Khadivi-Khub et al. reported similar allele sizes and ranges to ours [7,62,68]. Khadivi-
Khub [65] suggested that the 122 bp length of UDP 96 005 is correlated with fruit weight,
fruit length, and fruit diameter. We did not obtain this specific allele size in our study; the
closest size we obtained was 118 bp. However, it was present in all genotypes regardless
of their fruit weight and length (Table 2). Thus far, we have only had the opportunity
to examine individuals and Khadivi-Khub [65] has used only five wild cherry (Mazzard)
and four sour cherry genotypes; it is important and necessary to investigate segregating
generations to prove and establish a correlation.
Horticulturae 2023, 9, 892 12 of 16

The data of Kompetenzzentrum [69] include four markers (CPPCT022, UCDCH17,

UDP 96 001, UDP 98 410) applied in sour cherry, and three of them (UCDCH17, UDP
96 001, UDP 98 410) produced exact sizes in their study, with four genotypes (Favorit,
Kánotjánosi 3, Maliga emléke, Újfehértói fürtös) matching with ours. Regarding UCDCH17
and UDP 96 001, although our data are close to their size range, all common genotypes
had one additional allele. In the case of UDP 98 410, the two datasets are the same.
However, differences in the technique (Multiplex PCR), polymerase (GE Taq Polymerase),
and running conditions (sequencer for analyzing fragments) used in the research may
account for the slight discrepancies in exact allele sizes. For example, UDP 98 410 results
show that in the case of Kompetenzzentrum [69], they obtained 127 bp,135 bp and 127 bp
for Favorit and Maliga emléke, respectively, while in our dataset, the same genotypes had
131 bp,139 bp, and 131 bp, respectively.
The twelve primer pairs used to screen the nineteen sour cherry genotypes generated
a total of 52 distinct alleles. The average allele number per locus was 4.67, ranging from 2
to 10 (Table 4).
In conclusion, in our research, the lowest heterozygosity index was observed for
CPPCT022 (H = 0.35), while the highest values were observed for Ma39a(H = 0.50),
UCDCH17(H = 0.50) and UDP 96 005 (H = 0.50). On the other hand, in the case of PIC the
lowest applies to Ma39a (PIC = 0.37), UCDCH17 (PIC = 0.37), and UDP 96 005 (PIC = 0.37).
The highest values were 0.43 for CPPCT022, followed by 0.42 for BPPCT041. Regarding
Effective Multiplex Ratio (EMR), the values ranged from 0.55 to 6.23, with BPPCT 007
having the highest value and BPPCT 041 having the lowest. Similar results were observed
for the Marker Index (MI). Additionally, according to our results, BPPCT041 (DP = 0.93)
and UDP 98 410 (DP = 0.89) have a higher chance of distinguishing a genotype, while
CPPCT022 (DP = 0.41) has the least discriminative power (Table 5).
Regarding the Jaccard index (Table 6), the lowest average similarity was observed for
Pipacs, followed by Csengődi and Cigány 59, respectively. All the genotypes selected are
from different regions. Correspondingly, the dendrogram partially supported the results,
as genetically, the furthest genotypes were Pipacs, Piramis, and Csengődi (Figure 1).
The regression association analysis showed that PceGA025172, BPPCT002179, BPPCT007122,
UCDCH17182 , and UDP98410141 had statistically significant values regarding flowering
time, ripening time, and fruit weight (Table 2). In the case of peach genotypes, BPPCT007
was associated with fruit weight [70,71]; in our case, statistically it was more in line with
ripening time. Dirlewanger et al. [59] found in the case of apricot UDP 98 410, BPPCT007,
Ma39a, and CPPCT022, and in the case of sweet cherry BPPCT002, UDP 98 410, and
CPPCT022 that they could relate to flowering time.
In summary, based on our results, the most efficient primers used to analyze the
nineteen sour cherry genotypes were BPPCT 007, and BPPCT 002, while the least efficient
was BPPCT 041.
Additionally, this type of research can help breeders to overcome limitations and
may assist with early selection. Moreover, monilia and blumeriella leaf spot are common
diseases of cherries [72], so the breeding of varieties resistant or tolerant to these diseases is
crucial, and the analysis of additional morphological characteristics could contribute a lot
to the work of breeders.

5. Conclusions
In this study, twelve SSR primer pairs were used to analyze 19 sour cherry genotypes.
All the microsatellites showed a polymorphic pattern, indicating genetic variation among
the genotypes. The polymorphic information content (PIC) value was highest for CPPCT
022. However, further data analysis based on regression association analysis revealed that
BPPCT 007, BPPCT 002, PceGA025, and UCDCH17 were the best markers for distinguish-
ing Prunus cerasus L. genotypes. These markers provided the most informative data for
genotype differentiation. It is important to note that there may be non-distinguishable
clones among the genotypes analyzed in this study. To overcome this limitation and
Horticulturae 2023, 9, 892 13 of 16

enhance our ability to differentiate between closely related genotypes, it is advisable to

use additional molecular markers in future studies. Furthermore, among other studied
microsatellite marker alleles, BPPCT007122 and BPPCT002179 indicated high correlation
with ripening time based on regression association analysis. Studying genetic diversity
among different cultivars and populations is crucial, particularly for stock nurseries in
which fruit production is not allowed. In such cases, breeders face challenges in terms of
distinguishing genotypes visually based on morphological traits. Our results can help to
predict genotypes’ flowering time, ripening time, and fruit weight and help breeders with
early selection to reduce time and cost. Furthermore, molecular-based genetic analysis
plays a vital role in assisting breeders in making informed decisions about genotypes, since
molecular markers are not influenced by environmental effects and can help to predict char-
acteristics in early stages of development. By providing valuable information on genetic
diversity, these analyses can facilitate the selection and breeding of improved sour cherry
varieties.

Author Contributions: Conceptualization, E.K.; methodology, J.B. and A.K.T.-L.; software, J.B. and
Z.K.; validation, A.S., A.V. and E.K.; formal analysis, B.P.; investigation, J.B. and Z.K.; data curation,
B.P., Z.K. and A.K.T.-L.; writing—original draft preparation, J.B.; writing—review and editing, Z.K.,
A.V., A.S. and E.K.; visualization, J.B. and Z.K.; supervision, E.K., A.V. and A.S. All authors have read
and agreed to the published version of the manuscript.
Funding: This research received no external funding; it was solely supported by the Hungarian
University of Agriculture and Life Sciences.
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: The data presented in this study are available on request from the
corresponding author. Informed consent was obtained from all subjects involved in the study.
Acknowledgments: The authors would like to thank the Fruit Research Institute in Érd, Hungary,
for their time and assistance when collecting the plant materials. We wish to express our deepest
gratitude to Ákos Tarnawa (Hungarian University of Agriculture and Life Sciences) for his knowledge
and the comments on the manuscript that we received to carry out the research.
Conflicts of Interest: The authors declare no conflict of interest.

References
1. Marquis, D.A. Prunus serotina Ehrh. black cherry. Silv. N. Am. 1990, 2, 594–604.
2. Dirlewanger, E.; Cosson, P.; Tavaud, M.; Aranzana, J.; Poizat, C.; Zanetto, A.; Arus, P.; Laigret, F. Development of microsatellite
markers in peach [Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry (Prunus avium
L.). Theor. Appl. Genet. 2002, 105, 127–138. [CrossRef]
3. Dirlewanger, E.; Graziano, E.; Joobeur, T.; Garriga-Caldere, F.; Cosson, P.; Howad, W.; Arus, P. Comparative mapping and
marker-assisted selection in Rosaceae fruit crops. Proc. Natl. Acad. Sci. USA 2004, 101, 9891–9896. [CrossRef]
4. Tavaud, M.; Zanetto, A.; David, J.L.; Laigret, F.; Dirlewanger, E. Genetic relationships between diploid and allotetraploid cherry
species (Prunus avium, Prunus x gondouinii and Prunus cerasus). Heredity 2004, 93, 631–638. [CrossRef]
5. Das, B.; Ahmed, N.; Singh, P. Prunus diversity-early and present development: A review. Int. J. Biodivers. Conserv. 2011, 3,
721–734.
6. Vavilov, N.I.; Vavylov, M.I.; Dorofeev, V.F. Origin and Geography of Cultivated Plants; Cambridge University Press: Cambridge, MA,
USA, 1992.
7. Khadivi-Khub, A. Genetic relationships among cherry species with transferability of simple sequence repeat loci. Mol. Biol. Rep.
2014, 41, 6201–6210. [CrossRef]
8. Dondini, L.; Lugli, S.; Sansavini, S. Cherry breeding: Sweet cherry (Prunus avium L.) and sour cherry (Prunus cerasus L.). In
Advances in Plant Breeding Strategies: Fruits; Springer: Berlin/Heidelberg, Germany, 2018; pp. 31–88.
9. Quero-García, J.; Iezzoni, A.; Pulawska, J.; Lang, G.A. Cherries: Botany, Production and Uses; CABI: Wallingford, UK, 2017.
10. Hrotkó, K.; Feng, Y.; Halász, J. Spontaneous hybrids of Prunus fruticosa Pall. in Hungary. Genet. Resour. Crop Evol. 2020, 67,
489–502. [CrossRef]
Horticulturae 2023, 9, 892 14 of 16

11. Wöhner, T.W.; Emeriewen, O.F.; Wittenberg, A.H.; Schneiders, H.; Vrijenhoek, I.; Halász, J.; Hrotkó, K.; Hoff, K.J.; Gabriel, L.;
Lempe, J. The draft chromosome-level genome assembly of tetraploid ground cherry (Prunus fruticosa Pall.) from long reads.
Genomics 2021, 113, 4173–4183. [CrossRef]
12. Tóth, M. Gyümölcsfaj-és Fajtaismeret; Inkart Kft.: Budapest, Hungary, 2009; pp. 103–114. ISBN 978-963-503-406-2.
13. Bedő, Z.B.L.; Karsai, I.; Kruppa, J.; Matuz, J.; Oláh, I.A.; Polgár, Z.; Veisz, O. (Eds.) A magyar növénynemesítés eredményei az
ezredfordulón (1990–2018). Agroinform. Bp. 2019, 79–89.
14. Khaeim, H.; Kende, Z.; Balla, I.; Gyuricza, C.; Eser, A.; Tarnawa, Á. The Effect of Temperature and Water Stresses on Seed
Germination and Seedling Growth of Wheat (Triticum aestivum L.). Sustainability 2022, 14, 3887. [CrossRef]
15. Kovács, Z.; Bedő, J.; Pápai, B.; Tóth-Lencsés, A.K.; Csilléry, G.; Szőke, A.; Bányai-Stefanovits, É.; Kiss, E.; Veres, A. Ripening-
Induced Changes in the Nutraceutical Compounds of Differently Coloured Pepper (Capsicum annuum L.) Breeding Lines.
Antioxidants 2022, 11, 637. [CrossRef]
16. Pápai, B.; Kovács, Z.; Tóth-Lencsés, K.A.; Bedő, J.; Csilléry, G.; Veres, A.; Szőke, A. Evaluation of Abnormal Hypocotyl Growth of
Mutant Capsicum annuum Plants. Agriculture 2023, 13, 481. [CrossRef]
17. Hasan, N.; Choudhary, S.; Naaz, N.; Sharma, N.; Laskar, R.A. Recent advancements in molecular marker-assisted selection and
applications in plant breeding programmes. J. Genet. Eng. Biotechnol. 2021, 19, 1–26. [CrossRef]
18. Shi, Y.; Zhu, H.; Zhang, J.; Bao, M.; Zhang, J. Development and validation of molecular markers for double flower of Prunus
mume. Sci. Hortic. 2023, 310, 111761. [CrossRef]
19. Bayo-Canha, A.; López-Ortega, G.; Hernández-Munuera, M.; Frutos-Tomás, D. Genetic analysis of a germplasm collection of
sweet cherry with a set of SSR markers. In Proceedings of the VIII International Cherry Symposium 1235, Yamagata, Japan, 5–9
June 2017; pp. 79–84.
20. Patzak, J.; Henychova, A.; Paprstein, F.; Sedlak, J. Evaluation of Genetic Diversity within Sweet Cherry Accessions of Czech Genetic
Resources by Molecular SSR Markers; Acta Horticulturae 1235; ISHS: Coimbatore, India, 2019; pp. 71–78.
21. Agarwal, M.; Shrivastava, N.; Padh, H. Advances in molecular marker techniques and their applications in plant sciences. Plant
Cell Rep. 2008, 27, 617–631. [CrossRef]
22. Marchese, A.; Giovannini, D.; Leone, A.; Mafrica, R.; Palasciano, M.; Cantini, C.; Di Vaio, C.; De Salvador, F.; Giacalone, G.;
Caruso, T. S-genotype identification, genetic diversity and structure analysis of Italian sweet cherry germplasm. Tree Genet.
Genomes 2017, 13, 93. [CrossRef]
23. Barreneche, T.; Cárcamo de la Concepción, M.; Blouin-Delmas, M.; Ordidge, M.; Nybom, H.; Lacis, G.; Feldmane, D.; Sedlak, J.;
Meland, M.; Kaldmäe, H. Ssr-based analysis of genetic diversity and structure of sweet cherry (Prunus avium L.) from 19 countries
in Europe. Plants 2021, 10, 1983. [CrossRef] [PubMed]
24. Powell, W.; Morgante, M.; Andre, C.; Hanafey, M.; Vogel, J.; Tingey, S.; Rafalski, A. The comparison of RFLP, RAPD, AFLP and
SSR (microsatellite) markers for germplasm analysis. Mol. Breed. 1996, 2, 225–238. [CrossRef]
25. Oppen, M.J.v.; Rico, C.; Turner, G.F.; Hewitt, G.M. Extensive homoplasy, nonstepwise mutations, and shared ancestral polymor-
phism at a complex microsatellite locus in Lake Malawi cichlids. Mol. Biol. Evol. 2000, 17, 489–498. [CrossRef] [PubMed]
26. Vaughan, S.; Russell, K. Characterization of novel microsatellites and development of multiplex PCR for large-scale population
studies in wild cherry, Prunus avium. Mol. Ecol. Notes 2004, 4, 429–431. [CrossRef]
27. Ellegren, H. Microsatellites: Simple sequences with complex evolution. Nat. Rev. Genet. 2004, 5, 435–445. [CrossRef]
28. Prajapati, B.; Gupta, J.; Pandey, D.; Parmar, G.; Chaudhari, J. Molecular markers for resistance against infectious diseases of
economic importance. Vet. World 2017, 10, 112. [CrossRef]
29. Zhang, Q.; Yan, G.; Dai, H.; Zhang, X.; Li, C.; Zhang, Z. Characterization of Tomentosa cherry (Prunus tomentosa Thunb.)
genotypes using SSR markers and morphological traits. Sci. Hortic. 2008, 118, 39–47. [CrossRef]
30. Jin, H.; Tan, X.; Liu, X.; Ding, Y. The study of effect of tea polyphenols on microsatellite instability colorectal cancer and its
molecular mechanism. Int. J. Color. Dis. 2010, 25, 1407–1415. [CrossRef] [PubMed]
31. Cho, Y.-I.; Park, J.-H.; Lee, C.-W.; Ra, W.-H.; Chung, J.-W.; Lee, J.-R.; Ma, K.-H.; Lee, S.-Y.; Lee, K.-S.; Lee, M.-C. Evaluation of the
genetic diversity and population structure of sesame (Sesamum indicum L.) using microsatellite markers. Genes. Genom. 2011, 33,
187–195. [CrossRef]
32. Antanynienė, R.; Šikšnianienė, J.B.; Stanys, V.; Frercks, B. Fingerprinting of Plum (Prunus domestica) Genotypes in Lithuania Using
SSR Markers. Plants 2023, 12, 1538. [CrossRef] [PubMed]
33. Choudhury, D.R.; Kumar, R.; Maurya, A.; Semwal, D.P.; Rathi, R.S.; Gautam, R.K.; Trivedi, A.K.; Bishnoi, S.K.; Ahlawat, S.P.; Singh,
K.; et al. SSR and SNP Marker-Based Investigation of Indian Rice Landraces in Relation to Their Genetic Diversity, Population
Structure, and Geographical Isolation. Agriculture 2023, 13, 823. [CrossRef]
34. Cipriani, G.; Lot, G.; Huang, W.-G.; Marrazzo, M.; Peterlunger, E.; Testolin, R. AC/GT and AG/CT microsatellite repeats in peach
[Prunus persica (L) Batsch]: Isolation, characterisation and cross-species amplification in Prunus. Theor. Appl. Genet. 1999, 99,
65–72. [CrossRef]
35. Aranzana, M.; Carbó, J.; Arús, P. Microsatellite variability in peach [Prunus persica (L.) Batsch]: Cultivar identification, marker
mutation, pedigree inferences and population structure. Theor. Appl. Genet. 2003, 106, 1341–1352. [CrossRef]
36. Messina, R.; Lain, O.; Marrazzo, M.T.; Cipriani, G.; Testolin, R. New set of microsatellite loci isolated in apricot. Mol. Ecol. Notes
2004, 4, 432–434. [CrossRef]
Horticulturae 2023, 9, 892 15 of 16

37. Struss, D.; Ahmad, R.; Southwick, S.M.; Boritzki, M. Analysis of sweet cherry (Prunus avium L.) cultivars using SSR and AFLP
markers. J. Am. Soc. Hortic. Sci. 2003, 128, 904–909. [CrossRef]
38. Cantini, C.; Iezzoni, A.F.; Lamboy, W.F.; Boritzki, M.; Struss, D. DNA fingerprinting of tetraploid cherry germplasm using simple
sequence repeats. J. Am. Soc. Hortic. Sci. 2001, 126, 205–209. [CrossRef]
39. Pedersen, B. DNA fingerprints of 51 sweet and sour Prunus accessions using simple sequence repeats. J. Hortic. Sci. Biotechnol.
2006, 81, 118–124. [CrossRef]
40. Downey, S.L.; Iezzoni, A.F. Polymorphic DNA markers in black cherry (Prunus serotina) are identified using sequences from sweet
cherry, peach, and sour cherry. J. Am. Soc. Hortic. Sci. 2000, 125, 76–80. [CrossRef]
41. Ahmad, N.; Tian, R.; Lu, J.; Li, G.; Sun, J.; Lin, R.; Zhao, C.; Zhou, C.; Chang, H.; Zhao, S. DNA fingerprinting and genetic
diversity analysis in Asparagus officinalis L. cultivars using microsatellite molecular markers. Genet. Resour. Crop Evol. 2023, 70,
1163–1177. [CrossRef]
42. Savoia, M.A.; Del Faro, L.; Turco, A.; Fanelli, V.; Venerito, P.; Montemurro, C.; Sabetta, W. Biodiversity Evaluation and Preservation
of Italian Stone Fruit Germplasm (Peach and Apricot) in Southern Italy. Plants 2023, 12, 1279. [CrossRef] [PubMed]
43. Gasi, F.; Pojskić, N.; Stroil, B.K.; Frøynes, O.; Fotirić Akšić, M.; Meland, M. Determining Pollinizer Success Rates among Several
Apple (Malus domestica L.) Cultivars Using Microsatellite Markers. Agronomy 2023, 13, 1106. [CrossRef]
44. Ahmad, N.; Tian, R.; Li, G.; Zhao, C.; Fan, S.; Sun, J.; Zhao, S.; Wang, X. Establishment of male-specific sequence-tagged site
markers in Asparagus officinalis: An efficient tool for sex identification. Plant Breed. 2022, 141, 471–481. [CrossRef]
45. Brózik, S.; Kállay, T. Gyümölcsfajták 2.—Csonthéjas és Héjas Gyümölcsfajták; Mezőgazda Kiadó: Budapest, Hungary, 2001; pp. 26–38.
46. Papp, J. A Gyümölcsök Termesztése 2; Mezőgazda Kiadó: Budapest, Hungary, 2004; pp. 303–306.
47. Meggy-Gyümölcstermesztési Kutatóintézet. Available online: https://fruitresearch.naik.hu/gyki-gyumolcsnemesites-meggy#
fajtak (accessed on 10 June 2023).
48. Tóth, M. Gyümölcsészet; Primom Sz-Sz-B. Megyei Vállalkozásélénkítő Alapítvány, Vállalkozói Központ: Nyíregyháza, Hungary,
1997; pp. 257–272.
49. Yamamoto, T.; Mochida, K.; Imai, T.; Shi, Y.; Ogiwara, I.; Hayashi, T. Microsatellite markers in peach [Prunus persica (L.) Batsch]
derived from an enriched genomic and cDNA libraries. Mol. Ecol. Notes 2002, 2, 298–301. [CrossRef]
50. Testolin, R.; Marrazzo, T.; Cipriani, G.; Quarta, R.; Verde, I.; Dettori, M.T.; Pancaldi, M.; Sansavini, S. Microsatellite DNA in
peach (Prunus persica L. Batsch) and its use in fingerprinting and testing the genetic origin of cultivars. Genome 2000, 43, 512–520.
[CrossRef] [PubMed]
51. Amiryousefi, A.; Hyvönen, J.; Poczai, P. iMEC: Online marker efficiency calculator. Appl. Plant Sci. 2018, 6, e01159. [CrossRef]
[PubMed]
52. Liu, B.H. Statistical Genomics: Linkage, Mapping, and QTL Analysis; CRC Press: Boca Raton, FL, USA, 2017.
53. Botstein, D.; White, R.L.; Skolnick, M.; Davis, R.W. Construction of a genetic linkage map in man using restriction fragment
length polymorphisms. Am. J. Hum. Genet. 1980, 32, 314. [PubMed]
54. Tessier, C.; David, J.; This, P.; Boursiquot, J.-M.; Charrier, A. Optimization of the choice of molecular markers for varietal
identification in Vitis vinifera L. Theor. Appl. Genet. 1999, 98, 171–177. [CrossRef]
55. Baris, E.; Bedő, J.; Edosa, O.S.; Kiss, E.; Veres, A. Preliminary results of SSR based characterization of sour (Prunus cerasus L.) and
sweet cherry (Prunus avium L.) genotypes cultivated in Hungary. COLUMELLA–J. Agric. Environ. Sci. 2017, 4, 31–45. [CrossRef]
56. Akpınar, A.; Koçal, H.; Ergül, A.; Kazan, K.; Şelli, M.; Bakır, M.; Aslantaş, Ş.; Kaymak, S.; Sarıbaş, R. SSR-based molecular analysis
of economically important Turkish apricot cultivars. Genet. Mol. Res. 2010, 9, 324–332. [CrossRef] [PubMed]
57. Momeni, H.; Bouzari, N.; Zeinolabedini, M.; Jahromi, M.G. Genetic diversity in a core collection of Iranian sour cherry. Braz. J.
Biol. 2023, 84, e273386. [CrossRef]
58. Clausen, S.K.; Andersen, S.B.; Henriksen, K.; Toldam-Andersen, T.; Grout, B.W.W. Assessment of genetic diversity within sour
cherry clones. Sci. Hortic. 2013, 164, 556–562. [CrossRef]
59. Dirlewanger, E.; Quero-Garcia, J.; Le Dantec, L.; Lambert, P.; Ruiz, D.; Dondini, L.; Illa, E.; Quilot-Turion, B.; Audergon, J.M.;
Tartarini, S.; et al. Comparison of the genetic determinism of two key phenological traits, flowering and maturity dates, in three
Prunus species: Peach, apricot and sweet cherry. Heredity 2012, 109, 280–292. [CrossRef]
60. Ohta, S.; Katsuki, T.; Tanaka, T.; Hayashi, T.; Sato, Y.-I.; Yamamoto, T. Genetic variation in flowering cherries (Prunus subgenus
Cerasus) characterized by SSR markers. Breed. Sci. 2005, 55, 415–424. [CrossRef]
61. Xuan, H.; Wang, R.; Büchele, M.; Möller, O.; Hartmann, W. Microsatellite markers (SSR) as a tool to assist in identification of
sweet (Prunus avium) and sour cherry (Prunus cerasus). In Proceedings of the I International Symposium on Biotechnology of
Fruit Species: BIOTECHFRUIT2008 839, Dresden, Germany, 1–5 September 2008; pp. 507–514.
62. Wünsch, A. Cross-transferable polymorphic SSR loci in Prunus species. Sci. Hortic. 2009, 120, 348–352. [CrossRef]
63. Antonius, K.; Aaltonen, M.; Uosukainen, M.; Hurme, T. Genotypic and phenotypic diversity in Finnish cultivated sour cherry
(Prunus cerasus L.). Genet. Resour. Crop Evol. 2011, 59, 375–388. [CrossRef]
64. Khadivi-Khub, A.; Zamani, Z.; Fattahi, R.; Wünsch, A. Genetic variation in wild Prunus, L. subgen. Cerasus germplasm from
Iran characterized by nuclear and chloroplast SSR markers. Trees 2013, 28, 471–485. [CrossRef]
65. Khadivi-Khub, A. Regression association analysis of fruit traits with molecular markers in cherries. Plant Syst. Evol. 2014, 300,
1163–1173. [CrossRef]
Horticulturae 2023, 9, 892 16 of 16

66. Lācis, G.; Rashal, I.; Trajkovski, V. Implementation of a limited set of SSR markers for screening of genetic variability in Latvian
and Swedish sour cherry (L.) genetic resources collections. Proc. Latv. Acad. Sci. 2011, 65, 21–28. [CrossRef]
67. Najafzadeh, R.; Arzani, K.; Bouzari, N.; Saei, A. Genetic variation and identification of promising sour cherries inferred from
microsatellite markers. Russ. J. Genet. 2016, 52, 64–73. [CrossRef]
68. Turkoglu, Z.; Bilgener, S.; Ercisli, S.; Yildirim, N. Simple sequence repeat (SSR) analysis for assessment of genetic variability in
wild cherry germplasm. J. Appl. Bot. Food Qual. 2013, 85, 229.
69. Chase, A. Analysing the Sweet- and Sour-Cherry Cultivars by use of SSRs; Kompetenzzentrum Obstbau-Bodensee (KOB) KOB:
Budapest, Hungary, 2014.
70. Da Silva Linge, C.; Bassi, D.; Bianco, L.; Pacheco, I.; Pirona, R.; Rossini, L. Genetic dissection of fruit weight and size in an F2
peach (Prunus persica (L.) Batsch) progeny. Mol. Breed. 2015, 35, 71. [CrossRef]
71. Cao, K.; Wang, L.; Zhu, G.; Fang, W.; Chen, C.; Luo, J. Genetic diversity, linkage disequilibrium, and association mapping analyses
of peach (Prunus persica) landraces in China. Tree Genet. Genomes 2012, 8, 975–990. [CrossRef]
72. Hrotkó, K. Cseresznye és Meggy; Mezőgazda: Budapest, Hungary, 2003.

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.