Ijms 24 17327

See discussions, stats, and author profiles for this publication at: https://www.researchgate.
net/publication/376390256
Transcriptomic Changes in Response to Form of Selenium on the Interferon-

Tau Signaling Mechanism in the Caruncular Tissue of Beef Heifers at Maternal
Recognition of Pregnancy
Article · December 2023

DOI: 10.3390/ijms242417327
CITATIONS READS
0 8
4 authors, including:
Harshraj Subhash Shinde

University of Kansas Medical Center
42 PUBLICATIONS 278 CITATIONS
SEE PROFILE
All content following this page was uploaded by Harshraj Subhash Shinde on 10 December 2023.
The user has requested enhancement of the downloaded file.

International Journal of
Molecular Sciences
Article
Transcriptomic Changes in Response to Form of Selenium on
the Interferon-Tau Signaling Mechanism in the Caruncular
Tissue of Beef Heifers at Maternal Recognition of Pregnancy
Sarah N. Carr, Benjamin R. Crites, Harshraj Shinde and Phillip J. Bridges *
Department of Animal and Food Sciences, University of Kentucky, Lexington, KY 40546, USA;
sarah.carr@uky.edu (S.N.C.); benjamin.crites@uky.edu (B.R.C.); harshraj19@uky.edu (H.S.)
* Correspondence: phillip.bridges@uky.edu
Abstract: We have reported that selenium (Se) provided to grazing beef cattle in an inorganic (ISe)
form versus a 1:1 mixture (MIX) of inorganic and organic (OSe) forms affects cholesterol biosynthesis
in the corpus luteum (CL), the abundance of interferon tau (IFNτ) and progesterone (P4)-induced
mRNAs in the caruncular (CAR) tissue of the endometrium, and conceptus length at maternal
recognition of pregnancy (MRP). In this study, beef heifers were supplemented with a vitamin–
mineral mix containing 35 ppm Se as ISe or MIX to achieve a Se-adequate status. Inseminated
heifers were killed at MRP (d 17, n = 6 per treatment) for tissue collection. In CAR samples from
MIX versus ISe heifers, qPCR revealed that mRNA encoding the thyroid regulating DIO2 and DIO3
was decreased (p < 0.05) and a complete transcriptomic analysis revealed effects on the interferon
JAK-STAT1/2 pathway, including decreased expression of mRNAs encoding the classical interferon
stimulated genes IFIT1, IFIT2, IFIT3, IRF1, IRF9, ISG15, OAS2, and RSAD2 (p < 0.05). Treatment
also affected the abundance of mRNAs contributing to the immunotolerant environment (p < 0.05).
In combination, these findings suggest more advanced preparation of the CAR and developing
conceptus for implantation and to evade immune rejection by the maternal system in MIX- vs.
ISe-treated heifers.
Citation: Carr, S.N.; Crites, B.R.;
Shinde, H.; Bridges, P.J.
Keywords: selenium; selenoproteins; caruncle; endometrium; maternal recognition of pregnancy;
Transcriptomic Changes in Response
interferon tau; interferon signaling; beef cattle
to Form of Selenium on the
Interferon-Tau Signaling Mechanism
in the Caruncular Tissue of Beef
Heifers at Maternal Recognition of
Pregnancy. Int. J. Mol. Sci. 2023, 24, 1. Introduction
17327. https://doi.org/10.3390/ Selenium (Se) was initially recognized as having toxic effects on both humans and live-
ijms242417327 stock [1], with the critical role of this mineral defined within the subsequent years [2–4]. This
Academic Editor: Natalie Krahn
trace mineral is an essential micronutrient at low levels, but is toxic at high levels [5],
providing a narrow aperture between dietary adequacy and toxicity [6]. The physio-
Received: 19 October 2023 logical relevance of Se was initially identified as a necessary structural component of
Revised: 5 December 2023 glutathione peroxidases (GPX; [7]), a group of selenoproteins with antioxidant activities
Accepted: 7 December 2023 that catalyze harmful hydrogen peroxide (H2 O2 ) into water (H2 O [8]). Presently, there are
Published: 10 December 2023
25 selenoprotein genes identified in humans [8] and pigs [9], and 25 selenoproteins that
we routinely investigate in cattle [10,11]. Many selenoproteins, including selenoprotein
H (SELENOH [12]), selenoprotein K (SELENOK [13]), selenoprotein M (SELENOM [14]),
Copyright: © 2023 by the authors.
selenoprotein P (SELENOP [15]), selenoprotein R (SELENOR [16]), and selenoprotein W
Licensee MDPI, Basel, Switzerland. (SELENOW [17]), have been identified or proposed to have antioxidant capabilities. Harm-
This article is an open access article ful oxidative species can cause damage to DNA, RNA, and proteins, and can engender cell
distributed under the terms and death [18]. Therefore, it is necessary for the cells to effectively scavenge reactive oxygen
conditions of the Creative Commons species (ROS) to protect cells from oxidative stress.
Attribution (CC BY) license (https:// Across the United States, the concentration of Se in the soils and, subsequently, in the
creativecommons.org/licenses/by/ forages available to grazing livestock varies by geographic region [19]. The concentration
4.0/). of Se in the forages and grains in the southeastern United States, including Kentucky,
Int. J. Mol. Sci. 2023, 24, 17327. https://doi.org/10.3390/ijms242417327 https://www.mdpi.com/journal/ijms

Int. J. Mol. Sci. 2023, 24, 17327 2 of 24
are low, at less than 0.05 ppm, to variable. Only about 50% of the feedstuffs produced
contain greater than 0.1 ppm [19], the minimal recommended dietary intake of this trace
mineral [20]. This provides a challenge for cattle producers in these Se-deficient regions;
hence, it is necessary to supplement Se in the diet of cattle grazing these forages [21–25].
Providing this auxiliary Se to overcome a deficiency in this trace mineral is essential for var-
ious physiological processes, including immune function [24,26], growth [22], antioxidant
status [27], and fertility [23]. Commonly, supplemental Se is provided in a vitamin–mineral
mix as an inorganic form (ISe), sodium selenite, or sodium selenate. However, organic
forms of selenium (OSe), and particularly selenomethionine, are available when cattle graze
forage [19].
We consistently studied the effects of form of supplemental Se as either ISe or a
50%:50% mixture of ISe to OSe (MIX) on gonadal function in cattle and reported a MIX-
induced increase in the systemic concentration of progesterone (P4) in the early luteal
phase of the estrous cycle [28,29], with this increase occurring at a time that can signifi-
cantly improve embryonic development by altering endometrial function that supports
conceptus elongation [30–32] and the production of interferon tau (IFNτ), a protein from
the developing conceptus that signals maternal recognition of pregnancy (MRP [33]). In-
deed, we observed a significant increase in the length of the conceptus in MIX versus
ISe-supplemented heifers, which has clear implications for fertility outcomes as it may be
better prepared for the impending processes of attachment and implantation [34]. Recep-
tivity of the endometrium to allow implantation of the conceptus is dependent on P4 [35],
uterine restructuring to promote placentation [36], and the ability of the fetal allograft
to evade the maternal immune response [37]. Considerably, we performed a targeted
qPCR analysis, determining changes in the relative abundance of several P4 and IFNτ-
regulated mRNA transcripts in the caruncular (CAR) tissues of the endometrium from ISe-
versus MIX-supplemented heifers at MRP (d 17 of gestation) and observed a significant
decrease in the expression of mRNAs encoding diacylglycerol o-acyltransferase 2 (DGAT2),
fibroblast growth factor 2 (FGF2), interferon induced protein with tetratricopeptide repeats
3 (IFIT3), ISG15 ubiquitin like modifier (ISG15), MX dynamin like GTPase 1 (MX1), 20 -50 -
oligoadenylate synthetase 2 (OAS2), and radical S-adenosyl methionine domain containing
2 (RSAD2 [34]), with this study expanding on those results.
The necessary immunotolerant environment is the result of a careful balance be-
tween compositional changes in the innate immune system, which appears to remain
active to protect against pathogens [38], and the adaptive immune system, which must
be repressed [37,38]. During this time period, ligands from the conceptus signal the en-
dometrium to effect necessary changes, and in the presence of P4, there is an increase in
macrophages, dendritic cells, and NK cells that migrate into uterine epithelial, endothelial,
and stomal cells [37], as well as changes in the abundance of molecules that promote
immune tolerance such as indoleamine 2,3-dioxygenase 1 (IDO1), transforming growth
factor beta (TGFB), and interferon stimulated genes (ISG) [37].
In our present experiment, commercial Angus-cross heifers (N = 20) received 45-day
ad libitum access to a basal vitamin–mineral mix with no exogenous source of Se (depletion
phase), followed by 45-day supplementation with a vitamin–mineral mix containing 35 ppm
Se as ISe (repletion phase), and then were randomly assigned to received ad libitum
access to supplemental treatment as either inorganic (ISe; sodium selenite, n = 10) or a 1:1
combination (MIX, n = 10) of ISe and OSe (1:1 sodium selenite and SEL-PLEX) for at least
90 days prior to estrous synchronization and artificial insemination. Heifers were then
killed at d 17 of presumed pregnancy. An intact conceptus and other experimental samples
were collected from both ISe- and MIX-treated heifers (n = 6 per treatment) immediately
after death. Caruncular (CAR) tissue was used herein; however, the embryo, CAR and
intercaruncular (ICAR) tissues, whole blood, and serum were utilized in Crites et al. [34].
This experiment had two primary objectives. Firstly, we aimed to quantify the changes
in mRNA transcripts of selenoproteins with known or proposed antioxidant capabilities and
select selenoprotein receptors in response to the form of Se at MRP. Our hypothesis was that
Selenop Selenoprotein P 1.04 1.09 1.10
Selenor Selenoprotein R 1.11 1.11 0.18
Selenos Selenoprotein S 1.07 1.11 0.14
Int. J. Mol. Sci. 2023, 24, 17327 Selenot Selenoprotein T 1.01 1.03 30.06
of 24
Selenov Selenoprotein V 1.10 1.14 0.21
Selenow Selenoprotein W 1.02 0.93 0.09
a cohort of these enzymes, and particularly the cytosolic GPX1, will be of greater abundance
Selenophosphate synthetase
in MIX- vs. ISe-treated heifers, which would correspond with the whole animal’s ability to
Sephs2
mitigate Selenophosphate
the increased synthetase
ROS that is associated 2 1.02
with an increased metabolic1.15 0.08
demand at MRP.
Selenoprotein
Subsequently, withPthe
receptors
absence of a global perspective on the effect of form of Se on mRNA
transcripts in the caruncular regions of the endometrium, the second objective of this study
Lrp2 LDL receptor related protein 2 1.02 0.78 0.11
was to examine transcriptomic changes in the CAR tissue at MRP, postulating that we
Lrp8observe MIX-induced
would LDL receptor related
changes proteinexpression
in transcript 8 1.05indicating
0.85 0.11
advancement
of Tfrc Transferrin
the CAR transcriptome receptor
in preparation for the impending 1.10
processes of0.93
attachment0.17
and
implantation.
1 Selenium wasDefining the mRNAat
supplemented profile
35 ppmof selenoproteins and the(ISe;
as either inorganic transcriptome of CAR or a 1:1
sodium selenite)
tissue as a whole will provide insight into how the form of Se is related to improved
tion (MIX) of ISe and OSe (1:1 sodium selenite and SEL-PLEX). Selenium was supplemente
fertility and longer conceptuses at MRP. Ultimately, this provides a producer-friendly
ment groups ad libitum. 2 Data for Dio2, Gpx2, Selh, Selr, Selw, and Tfrc were natural log tra
and sustainable method to increase whole farm productivity and profitability of grazing
due to having not-normal distribution. 3 Data are expressed as a ratio of MIX relative t
beef cattle.
values are associated with Student’s t-test using the PROC TTEST procedure of SAS statis
2.ware package (version 9.4, SAS Institute Inc., Cary, NC, USA) at n = 6 per treatment.
Results
2.1. Real-Time PCR Analysis of Selenoproteins and Selenoprotein P Receptors mRNA
2.2.ACluster
total of Analyses
twenty-nine selenoprotein and selenoprotein P receptor transcripts were
targeted via qPCR analysis. The MIX form of supplemental Se significantly (p < 0.05) de-
Principal component analysis (PCA) of all RNA-Seq data was performed to
creased the relative abundance of Dio2 and Dio3 mRNAs (Table 1). The relative abundance
ofthe relativeencoding
transcripts relationships
the otherand variation
targeted amongand
selenoproteins thethe
individual heifers.
selenoprotein The score p
P receptors
urenot
was 1A) demonstrates
affected thatRNAseq
by form of Se. principal
also component 1 (PC#1,
indicated that the x-axis)
MIX form of Se explained
significantly 25% of
(pamong
< 0.05) decreased the relative abundance of Txnrd2 and Selenon mRNAs,
the samples and principal component 2 (PC#2, y-axis) explained and increased12% of v
the abundance of Selnok mRNA; however, these findings were not confirmed by qPCR.
Results indicate that there is slight separation between treatment groups, with so
ilarities
2.2. Clusterin the expression of DEGs.
Analyses
Hierarchical
Principal clustering
component analysis
analysis (PCA) ofRNA-Seq
of all the top data
1000was
DEGs (Figure
performed 1B) indicates a
to evaluate
erable
the separation
relative between
relationships Se treatments;
and variation among thehowever,
individual there
heifers.may
Thebe some
score plotoverlap
(Figure
scriptomic profiles of the CAR from ISe- and MIX-supplemented heifers.of
1A) demonstrates that principal component 1 (PC#1, x-axis) explained 25%
variance among the samples and principal component 2 (PC#2, y-axis) explained 12% of
variance. Results indicate that there is slight separation between treatment groups, with
some similarities in the expression of DEGs.
Figure 1. (A) Score plot and (B) hierarchical matrix of data derived from RNA-Seq analysis of
each sample of caruncular (CAR) tissue from heifers supplemented with a vitamin–mineral mix
Figure 1.35(A)
containing ppmScore
as ISeplot
(n =and
6) or (B) hierarchical
1:1 mixture matrix
of ISe:OSe ofndata
(MIX, derived
= 6). (A) from
Principal RNA-Seq
component 1 analys
sample of caruncular (CAR) tissue from heifers supplemented with a
(PC#1) accounted for 25% of the variance, and principal component 2 (PC#2) accounted for 12% vitamin–mineral mi
ofing
the35 ppm as
variation ISe (n
among = 6) or(B)
samples. 1:1Hierarchical
mixture ofcluster
ISe:OSe (MIX,
analysis wasn composed
= 6). (A) of
Principal componen
the top 1000
accounted expressed
differentially for 25% of the variance,
transcripts and principal
using iDEP.96. component
Significance 2 (PC#2)
was determined accounted
by Wald for 12% o
test, with
iation among
significance samples.
declared (B)for
at p < 0.05 Hierarchical
all. cluster analysis was composed of the top 1000 diff
Int. J. Mol. Sci. 2023, 24, 17327 4 of 24
Hierarchical clustering analysis of the top 1000 DEGs (Figure 1B) indicates a consider-
able separation between Se treatments; however, there may be some overlap in transcrip-
tomic profiles of the CAR from ISe- and MIX-supplemented heifers.
Table 1. Relative abundance of mRNA encoding selenoproteins and selenoprotein P receptors in the
caruncular (CAR) tissue of ISe- (n = 6) or MIX- (n = 6) treated heifers 1 .
qPCR 3
Gene 2 Gene Name
ISe MIX SEM p-Value 4
Iodothyronine deiodinases
Dio1 Iodothyronine deiodinase 1 Unable to be detected
Dio2 Iodothyronine deiodinase 2 1.15 0.53 0.25 <0.05
Dio3 Iodothyronine deiodinase 3 1.03 0.73 0.10 <0.05
Glutathione peroxidases
Gpx1 Glutathione peroxidase 1 1.01 0.90 0.09 0.40
Thioredoxin reductases
Txnrd1 Thioredoxin reductase 1 1.08 1.00 0.15 0.69
Other selenoproteins
Selenof Selenoprotein F 1.05 1.15 0.15 0.66
Selenoh Selenoprotein H 1.06 0.79 0.12 0.18
Selenoi Selenoprotein I 1.01 1.02 0.07 0.97
Selenok Selenoprotein K 1.03 1.12 0.12 0.61
Selenom Selenoprotein M 6.59 5.36 2.90 0.77
Selenon Selenoprotein N 1.01 0.96 0.07 0.56
Selenoo Selenoprotein O 1.05 1.12 1.10 0.63
Selenop Selenoprotein P 1.04 1.09 1.10 0.71
Selenor Selenoprotein R 1.11 1.11 0.18 0.68
Selenos Selenoprotein S 1.07 1.11 0.14 0.85
Selenot Selenoprotein T 1.01 1.03 0.06 0.84
Selenov Selenoprotein V 1.10 1.14 0.21 0.90
Selenow Selenoprotein W 1.02 0.93 0.09 0.47
Sephs2 Selenophosphate synthetase 2 1.02 1.15 0.08 0.25
Selenoprotein P receptors
Lrp2 LDL receptor related protein 2 1.02 0.78 0.11 0.17
Lrp8 LDL receptor related protein 8 1.05 0.85 0.11 0.26
Tfrc Transferrin receptor 1.10 0.93 0.17 0.62
1 Selenium was supplemented at 35 ppm as either inorganic (ISe; sodium selenite) or a 1:1 combination (MIX) of
ISe and OSe (1:1 sodium selenite and SEL-PLEX). Selenium was supplemented to treatment groups ad libitum.
2 Data for Dio2, Gpx2, Selh, Selr, Selw, and Tfrc were natural log transformed due to having not-normal distribution.
3 Data are expressed as a ratio of MIX relative to ISe. 4 p-values are associated with Student’s t-test using the
PROC TTEST procedure of SAS statistical software package (version 9.4, SAS Institute Inc., Cary, NC, USA) at
n = 6 per treatment.
2.3. Differentially Expressed Genes

The Wald test of DESeq2 was used to identify changes in CAR between the ISe- and
MIX-supplemented heifers. At p < 0.05, there were 2029 DEGs with 1038 transcripts upreg-
ulated, and 991 transcripts downregulated in MIX compared to ISe. The most differentiated
genes that were increased and decreased according to fold change in MIX compared to ISe
are provided in Table 2.
Int. J. Mol. Sci. 2023, 24, 17327 5 of 24
Table 2. Top 10 most highly up- and downregulated differentially expressed genes (DEGs) in the
caruncular (CAR) tissue of ISe- (n = 6) versus MIX- (n = 6) treated heifers 1 .
Gene ID Gene Description Fold Change p-Value 2

Upregulated in MIX
CCDC152 Coiled-coil domain containing 152 4.03 0.0111
CD79B CD79b molecule 3.75 0.0329
TM4SF5 Transmembrane 4 L six family member 5 3.39 0.0366
C22orf31 Chromosome 22 open reading frame 31 3.38 0.0152
SLC17A7 Solute carrier family 17 member 7 3.34 0.0338
CCL21 C-C motif chemokine ligand 21 2.93 0.0359
FAM180B Family with sequence similarity 180 member B 2.88 0.0103
COL17A1 Collagen type XVII alpha 1 chain 2.35 0.0019
CCR9 C–C motif chemokine receptor 9 2.34 0.0184
OMG Oligodendrocyte myelin glycoprotein 2.33 0.0429
Downregulated in MIX
DPYSL4 Dihydropyrimidinase-like 4 −4.07 0.0108
KLK5 Kallikrein-related peptidase 5 −4.03 0.0004
GRM3 Glutamate metabotropic receptor 3 −3.70 0.0004
NIPAL4 NIPA-like domain containing 4 −3.59 0.0020
NALCN Sodium leak channel, nonselective −3.26 0.0134
PTGER1 Prostaglandin E receptor 1 −3.16 0.0178
COL28A1 Collagen type XXVIII alpha 1 chain −3.12 0.0105
SLC26A8 Solute carrier family 26 member 8 −3.12 0.0026
SLC34A3 Solute carrier family 34 member 3 −3.11 0.0237
DMKN Dermokine −2.93 <0.0001
2 For statistical analysis, p-values were determined using the Wald test in DESeq2.
2.4. Pathway and Gene Network Analysis

To determine global changes in DEGs in response to form of Se, bioinformatic analysis
was performed using QIAGEN’s Ingenuity Pathway Analysis (IPA, QIAGEN, Redwood
City, CA, USA). Canonical pathway analysis indicated that the top five canonical pathways
(Table 3) based on p-values affected by the form of Se are ATM signaling (p < 0.0001),
spliceosomal cycle (p < 0.0001), role of protein kinase R (PKR) in interferon induction and
antiviral response (p < 0.0001), coordinated lysosomal expression and regulation (CLEAR)
signaling pathway (p < 0.0001), and autophagy (p < 0.0001). Further, Figure 2 shows the top
canonical pathways in CAR ranked by z-score, which is used to predict activation state.
Interestingly, the most significantly affected pathways that were positively affected are
spliceosomal cycle (z-score = 2.673), cold shock domain containing E1 (CSDE1) signaling
pathway (z-score = 2.138), cell cycle control of chromosomal replication (z-score = 1.508), cell
cycle: G1/S checkpoint regulation (z-score = 1.414), and 3-phosphoinositide biosynthesis
(z-score = 1.342). The most negatively affected pathways based on z-score are the role of
PKR in interferon induction and antiviral response (z-score = −3.128), interferon signaling
(z-score = −2.333), CD40 signaling (z-score = −2.333), death receptor signaling (z-score = −2.183),
and TNF receptor superfamily member 1A (TNFR1) signaling (z-score = −2.121).
The top upstream regulators identified using IPA at p < 0.05 were hepatocyte nuclear
factor 4 alpha (HNF4A), estrogen receptor 1 (ESR1), KRAS proto-oncogene, GTPase (KRAS),
transforming growth factor beta 1 (TGFB1), and Pyridostatin. The top five molecular and
cellular functions with specific actions identified by IPA are indicated in Table 4. Only
functions with a z-score greater than or equal to the absolute value of 0.5 are reported.
Int. J. Mol. Sci. 2023, 24, 17327 6 of 24
Table 3. Top 5 IPA-identified canonical pathways of genes differentially expressed from caruncular
(CAR) tissue of ISe- (n = 6) versus MIX- (n = 6) supplemented heifers 1 .
Canonical
Gene Symbols Ratio 3 Z-Score p-Value 4
Pathway 2
Up: ATR, CBX1, CBX3, CBX5,
CCNB2, CDK2, HP1BP3,
MDC1, PPP2R1B, RAD50,
RAD51, RBBP8, RNF8, SMC2, 0.25
ATM Signaling 0.471 <0.0001
SMC3, SMC1A, ZNF420 (25/100)
Down: BID, BRAT1,
MAPK12, MAPK13, PPM1L,
PPP2R1A, TP73, TRRAP
UP: BCAS2, CDC5L,
CTNNBL1, CWC15, DDX23,
Spliceosomal DHX38, ISY1-RAB43, 0.29
2.673 <0.0001
Cycle MAGOHB, RBM8A, SLU7, (14/49)
SNRNP200, ZNF830
Down: PRPF19, SF3B3
Up: APAF1, DNAJC3,
HMGB1, HSP90AA1,
Role of PKR in HSP90AB1, HSP90B1, HSPA4,
Interferon METAP2, MSR1, REL
0.19
Induction and Down: ATF3, BID, FADD, −3.128 <0.0001
(26/136)
Antiviral FOS, HSPA6, IRF1, IRF9,
Response MAPK12, MAPK13, PDGFRB,
PYCARD, RELA, STAT2,
STAT3, TARBP2, TNFRSF1A
Up: ATP6V1C1, ATP6V1E1,
BECN1, BMPR1B, HPS5,
ITPR2, MAP4K3, NRBF2,
PPP2R1B, RRAGB, VPS26A,
YWHAE
Down: ATP6V0A1,
ATP6V0D1, BLOC1S3, BMP6,
CLEAR Signaling CRTC2, CTNS, CTSA, FLT1, 0.15
−0.762 <0.0001
Pathway GBA1, GLB1, KCNIP3, (43/285)
MAPK7, MAPK12, MAPK13,
MLST8, PDGFRB, PML,
PPM1L, PPP2R1A, PRKAG1,
PRKCB, RAB7A, RPTOR,
SEC13, SESN2, TCIRG1,
TGFA, TGFBR3, TNFRSF1A,
TRPM1, TSC2
Up: ATG3, ATG10, ATR,
BECN1, CALM1, CDKN1B,
GNAI3, NRBF2, PIK3C2A,
PPP2R1B, RB1CC1, SESN1,
STX17, VPS41
Down: ATG2A, BMP6, FOS, 0.16
Autophagy 0.845 <0.0001
IRS1, IRS2, MAPK12, MLST8, 35/216
PI4K2A, PPM1L, PPP2R1A,
PRKAG1, RAB7A, RAB7B,
RIPK1, RPTOR, SLC7A5,
TGFA, TNFRSF1A, TSC2,
ULK1, WIPI2
2 Results from IPA were obtained based on log2 fold changes calculated using DESeq2. 3 The ratio calculated as
the number of differentially expressed genes (p < 0.05) in a given pathway divided by the total number of genes
that make up that pathway. 4 p-values were determined using IPA.
Formation of cellular protrusions −0.647 <0.0001
Replication of centriole 0.921 <0.0001
1 Selenium was supplemented at 35 ppm as either inorganic (ISe; sodium selenite) or a 1:1 combina-
tion (MIX) of ISe and OSe (1:1 sodium selenite and SEL-PLEX). Selenium was supplemented to treat-
ment groups ad libitum. 2 Results from IPA were obtained based on log2 fold changes calcu-
lated using DESeq2. 3 Z-score was calculated using IPA and was used to infer activation
Int. J. Mol. Sci. 2023, 24, 17327 7 of 24
state. Only fractions resulting in a z-score with an absolute value of ≥0.5 are reported
herein. 4 p-values were determined using IPA.
Figure 2. Top IPA-identified canonical pathways of genes differentially expressed from CAR of heif-
Figure 2. Top IPA-identified canonical pathways of genes differentially expressed from CAR of
ers supplemented a vitamin–mineral mix containing 35 ppm as ISe (n = 6) or 1:1 mixture of ISe:OSe
heifers
(MIX,supplemented
n = 6). Pathwaysa are
vitamin–mineral mix
ranked by z-score, containing
with 35 ppma as
orange indicating ISe (nthat
pathway = 6)is or 1:1 mixture
predicted to of
ISe:OSe (MIX, n =(positive
be upregulated 6). Pathways
z-score)are
andranked
the blueby z-score,awith
indicating orange
pathway that indicating
is predictedatopathway
be down-that is
regulated
predicted (negative
to be z-score).
upregulated (positive z-score) and the blue indicating a pathway that is predicted to
be downregulated (negative z-score).
2.5. Real-Time PCR Analysis of Select mRNA Transcripts
Table 4. Top 5 IPA-identified molecular and cellular functions in caruncular (CAR) tissue of ISe-
(n = 6) versus MIX- (n = 6) supplemented heifers 1 .
Molecular and Cellular Functions 2 Z-Score 3 p-Value 4

Cell death and survival (732 molecules)
Necrosis −1.392 <0.0001
Apoptosis −2.252 <0.0001
Cell death of tumor cell lines −1.757 <0.0001
Cell survival 1.029 <0.0001
Apoptosis of tumor cell lines −1.425 <0.0001
Cell viability 1.112 <0.0001
Cell viability of tumor cell lines 1.278 <0.0001
Necrosis of epithelial tissue −1.682 <0.0001
Cell death of osteosarcoma cells −1.671 <0.0001
Cell death of bone cancer cell lines −0.434 <0.0001
Cell death of blood cells −1.469 <0.0001
Cell death of sarcoma cell lines −0.943 <0.0001
Colony survival of tumor cell lines 1.183 <0.0001
Necrosis of tumor −1.881 <0.0001
Cell death of breast cancer cell lines −2.267 <0.0001
Apoptosis of peritoneal macrophages −0.574 <0.0001
Int. J. Mol. Sci. 2023, 24, 17327 8 of 24
Table 4. Cont.
Molecular and Cellular Functions 2 Z-Score 3 p-Value 4

Cellular response to therapeutics (149 molecules)
Radiosensitivity of cells −1.38 <0.0001
Gene expression (462 molecules)
Expression of RNA −3.621 <0.0001
Transcription of RNA −2.971 <0.0001
Transcription −2.877 <0.0001
Transcription of DNA −2.485 <0.0001
Activation of DNA endogenous promoter −2.373 <0.0001
Transactivation 1.115 <0.0001
Transactivation of RNA 0.804 <0.0001
Repression of RNA 0.646 <0.0001
RNA post-translational modification (92 molecules)
Processing of RNA −1.066 <0.0001
Processing of mRNA −1.635 <0.0001
Splicing of RNA −1.339 <0.0001
Splicing of mRNA −1.682 <0.0001
Cellular assembly and organization (505 molecules)
Development of cytoplasm −1.738 <0.0001
Cohesion of sister chromatids 0.854 <0.0001
Formation of centriole 0.921 <0.0001
Remodeling of chromatin 0.900 <0.0001
Formation of cellular protrusions −0.647 <0.0001
Replication of centriole 0.921 <0.0001
2 Results from IPA were obtained based on log2 fold changes calculated using DESeq2. 3 Z-score was calculated
using IPA and was used to infer activation state. Only fractions resulting in a z-score with an absolute value of
≥0.5 are reported herein. 4 p-values were determined using IPA.
2.5. Real-Time PCR Analysis of Select mRNA Transcripts

To validate the outcomes of the RNA-sequencing, real-time PCR analysis was con-
ducted on select transcripts that are responsive to interferons or are relative to uterine
function at MRP (Table 5). The results of qPCR were consistent with RNA-sequencing
analysis at either significance, declared at p ≤ 0.05, or a tendency at 0.05 < p ≤ 0.10, except
for Irf9, Isg20, and Scarb1 mRNA. However, these were consistent in trend when compared
to RNA-sequencing results, but were not significant for qPCR analyses. We did not corrob-
orate all identified RNA-sequencing transcripts of interest; some are included below for
purposes of clarity in the discussion.
Int. J. Mol. Sci. 2023, 24, 17327 9 of 24
Table 5. RNA-Seq corroboration of select interferon responsive transcripts at MRP from caruncular (CAR) tissue of ISe- (n = 6) or MIX- (n = 6) supplemented
heifers 1 .
RNA-Seq 3 qPCR 3
Gene 2 Gene Name ISe MIX p-Value ISe MIX SEM p-Value 4
Ido1 Indoleamine 2,3-dioxygenase 1 1.00 0.68 0.02 Not corroborated
Ifit1 Interferon-induced protein with tetratricopeptide repeats 1 1.00 0.83 0.04 Not corroborated
Ifit2 Interferon induced protein with tetratricopeptide repeats 2 1.00 0.71 0.01 1.11 0.54 0.17 0.04
Ifit3 * Interferon induced protein with tetratricopeptide repeats 3 1.00 0.78 0.02 1.08 0.65 0.13 0.04
Irf1 * Interferon regulatory factor 1 1.00 0.79 0.02 1.05 0.75 0.11 0.08
Irf9 Interferon regulatory factor 9 1.00 0.83 <0.01 1.01 0.95 0.06 0.47
Isg15 * ISG15 ubiquitin like modifier 1.00 0.78 <0.01 1.04 0.76 0.09 0.05
Isg20 Interferon stimulated exonuclease, transcript variant 1 1.00 0.74 <0.01 1.06 0.76 0.12 0.11
Oas2 * 20 -50 -oligoadenylate synthetase 2 1.00 0.81 0.01 1.03 0.67 0.10 0.01
Rsad1 Radical S-adenosyl methionine domain containing 1 1.00 0.83 <0.01 Not corroborated
Rsad2 * Radical S-adenosyl methionine domain containing 2 1.00 0.75 <0.01 1.05 0.57 0.14 0.01
Scara5 Scavenger receptor class A member 5 1.00 0.87 0.09 1.04 0.71 0.09 0.02
Scarb1 Scavenger receptor class B member 1 1.00 0.83 0.01 1.04 0.81 0.09 0.12
Stat1 Signal transducer and activator of transcription 1 1.00 0.92 0.16 Not corroborated
Stat2 Signal transducer and activator of transcription 2 1.00 0.84 0.02 Not corroborated
Tgfb1 Transforming growth factor beta 1 1.00 0.87 0.06 Not corroborated
Timp2 TIMP metallopeptidase inhibitor 2 1.00 0.86 0.26 1.02 0.93 0.08 0.48
Timp3 TIMP metallopeptidase inhibitor 3 1.00 0.83 <0.01 1.02 0.79 0.08 0.06
Trim56 Tripartite motif containing 56 1.00 0.83 0.02 1.04 0.55 0.09 <0.01
1 Selenium was supplemented at 35 ppm as either inorganic (ISe; sodium selenite) or a 1:1 combination (MIX) of ISe and OSe (1:1 sodium selenite and SEL-PLEX). Selenium was
supplemented to treatment groups ad libitum. 2 qPCR data for Isg20 were natural log transformed due to having not-normal distribution. 3 Data are expressed as a ratio of MIX relative
to ISe, and p-values are associated with statistical significance between treatment groups for each respective test. 4 p-values were obtained from Student’s t-test using the PROC TTEST
procedure of SAS statistical software package (version 9.4; SAS Institute, Inc., Cary, NC, USA) at n = 6 per treatment. * qPCR results are reported in [34].
Int. J. Mol. Sci. 2023, 24, 17327 10 of 24
3. Discussion
Soils and hence forages in geographic regions that are low in Se require producers
to supplement this trace mineral in the diet of beef cattle to overcome Se-deficiency-
associated challenges with immune function [24,26], growth [22], antioxidant status [27],
and fertility [23]. Commonly, supplemental Se is provided in a vitamin–mineral mix as ISe;
however, Ose forms are available when cattle graze forage [19].
The organic forms of Se are more bioavailable than the inorganic forms [39], and
organic selenium can raise whole blood levels of Se more effectively compared to the
inorganic sodium selenite or sodium selenate [40]. Additionally, transcriptomic analysis in
the liver of growing beef heifers supplemented with Se as either ISe, OSe, or a 50%:50%
mixture of ISe or OSe (MIX) demonstrated that the form of Se creates specific phenotypes
respective to form, with distinct physiological capabilities including changes in redox
potential. Additionally, these transcriptomic changes were not indicative of a gradient
effect respective to the different forms of Se utilized [41].
Using an extensively reported model [10,28,29,42,43], we studied the effects of sup-
plemental form of Se as ISe (the industry standard) or a 1:1 mixture of ISe to OSe (MIX)
on grazing beef cows and heifers and observed significant effects on the CL [10] and
endometrium [34], which laid the premise for the present study. This experiment had
two specific objectives. Firstly, we aimed to quantify the changes in mRNA transcripts of
selenoproteins with known or proposed antioxidant capabilities and select selenoprotein P
receptors in caruncular (CAR) tissue in response to form of Se at MRP. Secondly, this study
sought to augment previous findings in our lab that identified key caruncular changes in
the abundance of mRNA encoding several P4 and IFNτ-induced endometrial transcripts,
which occurred synonymously with longer conceptuses in MIX- versus ISe-supplemented
heifers at MRP [34]. Therefore, we performed a transcriptomic analysis to elucidate global
changes in the CAR transcriptome in response to form of Se. These results expand our un-
derstanding of mechanistic changes in the CAR that may be contributing to the previously
observed significant differences in conceptus length at MRP and may be better preparing
the CAR for attachment and implantation.
3.1. Selenoproteins
There are 25 selenoprotein genes identified in mammals [8,9], and we sought to analyze
the Se-form effects on mRNA transcripts, encoding these, as well as select selenoprotein
P receptors, in the caruncular tissue of heifers at MRP (d 17 of gestation). We hypoth-
esized that a cohort of these enzymes, and particularly the cytosolic GPX1, will be of
greater abundance in MIX- vs. ISe-treated heifers, which would indicate changes in the
ability to mitigate potentially elevated reactive oxygen species associated with an increased
metabolic demand at MRP, with the CAR at this time differentiating in early preparation
for implantation and placentation.
Unexpectedly, we only observed changes in the abundance of mRNA transcripts en-
coding the intracellular iodothyronine deiodinases 2 and 3 (Dio2 and Dio3), and the relative
abundance of mRNA encoding these two selenoproteins was significantly lower (p < 0.05)
in MIX-supplemented heifers compared to those on ISe alone. Iodothyronine deiodinases
(DIOs) are a family of selenoproteins that regulate the activation and deactivation of thyroid
hormones, and, subsequently, growth, development, thermogenesis, cell differentiation and
proliferation, and energy metabolism, including regulating metabolism of carbohydrates,
proteins, and lipids [44,45]. Regulating the circulating and intracellular concentrations
of thyroid hormones is critical for placental development and function, as well as fetal
growth [45].
DIO1 is bound in the plasma membrane and has been primarily localized to the
liver, kidney, and thyroid [8]. This selenoprotein converts T4 to T3 by deiodination of
the outer ring, and it can convert T3 and T4 into the inactive T2 or rT3, respectively, via
inner ring deiodination [46]. Given the primary localization and function of DIO1, it is not
unsurprising that we were unable to detect a measurable concentration of mRNA encoding
Int. J. Mol. Sci. 2023, 24, 17327 11 of 24
this protein in CAR samples; however, it should be noted that previous studies have shown
DIO1 to be abundant in the term placenta [47], which may be associated with circulating
concentrations of T3 being highest at parturition [47,48].
Intracellular DIO2 is located in the endoplasmic reticulum and is primarily expressed
in the nervous system, pituitary, thyroid, and brown adipose tissue [8]. Low levels of
serum T4 can result in an elevation in the activity of DIO2 [49]. DIO3 is another membrane-
bound selenoprotein that is primarily expressed in vascular tissue, skin, and the placenta,
as well as being highly expressed in fetal and neonatal tissues [44]. Its high level of
expression in the placenta is to protect the growing fetus from the activity of maternal
thyroid hormone as DIO3 primarily inactivates T3 [50]. However, in ruminants, the placenta
may be impermeable to transfer of thyroid hormones [45]. It seems plausible that T3 could
be effectively regulating the structural and metabolic changes occurring in the CAR in
preparation for placental development in our experimental animals, which would be
consistent with the previously observed longer embryos in MIX- versus ISe-supplemented
heifers at MRP [34].
3.2. Caruncular Transcriptomics

With the absence of a global perspective of mRNA transcripts in the CAR in response
to form of Se, we performed a transcriptomic analysis using next-generation sequencing
to reveal the form of Se-affected pathways that may advance or impede the impending
placental attachment. Our previous observation that MIX-supplemented heifers had sig-
nificantly longer conceptuses on d 17 of gestation, coincident with a decreased level of
expression of known P4- and INF-induced transcripts, including DGAT2, MX1, and OAS2
in the CAR [34], suggests that the process of MRP is more advanced in these heifers, as
may be the development of the caruncular transcriptome in preparation for the initial
process of adhesion and attachment, which is observed as early as days 16–18 of pregnancy
in cattle [51,52]. Results from the current transcriptomic analysis correspond with this,
as evidenced by the significant changes in both interferon signaling, which is affecting
the transcription of interferon responsive genes, and by the noted changes in transcripts
regulating cellular organization, survival, and death.
Prominently, the top two canonical pathways downregulated in MIX-treated heifers
were associated with endometrial response to type I interferon signaling (“Role of PKR in
interferon induction and antiviral response” and “Interferon signaling”). The trophoblast-
derived IFNτ is a type I interferon that signals by binding to the ubiquitously expressed
type 1 interferon receptors (IFNAR1 and IFNAR2) on the endometrial luminal and su-
perficial glandular epithelium [38,53]. The primary function of this signal is to inhibit
transcription of the estrogen (ER), effectively preventing estrogen-induced increases in
the synthesis of ER, nuclear progesterone receptor (PGR), and oxytocin receptor (OTR),
thus blocking production of luteolytic pulses of prostaglandin F2α (PGF2α ). This mech-
anism also appears to involve the actions of IRF2 [30]. Presently, and reported in Crites
et al. [34], the presence of a more developed conceptus in MIX- versus ISe-treated heifers
demonstrated successful signaling at MRP. However, the absence of Se-form effects on the
abundance of mRNA encoding IFNAR1, IFNAR2, IRF2, ER, or OXTR suggests that there
are mechanisms still to be elucidated that may be of significance. Additionally, as reported
in Crites et al. [34], qPCR analysis revealed a tendency for Pgr mRNA to be less abundant
in MIX, which is consistent with the previously observed decrease in the expression of Pgr
in response to continuous exposure of P4 in the endometrium [54].
In conjunction with being antiluteolytic, IFNτ exerts immense effects in the en-
dometrium during MRP by promoting the transcription of interferon stimulated genes
(ISGs, [55,56]). To do so, IFNτ binds IFNAR1 and IFNAR2 to activate the JAK/STAT signal
transduction pathway. STAT1 can form a homodimer that translocates into the nucleus to
stimulate the transcription of specific genes by binding to interferon-gamma-activated se-
quence (GAS). Alternatively, STAT1 and STAT2 form a heterodimer and interact with IRF9
to form the transcriptionally active gene complex factor 3. This complex migrates into the
conceptus occurred earlier in MIX supplemented heifers, as there was a stark decrease i
the abundance of mRNA transcripts encoding IRF9. Notably, Irf9 mRNA is typically mor
abundant between days 14–18 compared to days 25–40 of pregnancy in cattle, coinciden
with decreases in mRNA encoding IRF3, MX1α, MX1β, and MX2 in CAR at these two tim
Int. J. Mol. Sci. 2023, 24, 17327 points [59]. To corroborate these findings, quantifying IFNτ in the uterine fluid
12 of 24 would
provide an indication of the concentration of this protein in the histotroph. Unfortunately
in the present study, recovery of the uterine fluid at sample collection proved too incon
sistent to
nucleus forbind
subsequent
interferonquantification of theelements
stimulated response concentrations offacilitate
(ISRE) that IFNτ protein.
transcription
of ISGs (Figure 3) [38,56,57].
Figure3. 3. Mechanistic
Figure Mechanisticillustration
illustration of downregulation
of downregulation of interferon-responsive
of interferon-responsive genes and genes an
JAK/STAT1/2 signaling pathway. Red arrows demonstrate lower transcript
JAK/STAT1/2 signaling pathway. Red arrows demonstrate lower transcript abundance in MIX-Se- abundance in MIX-Se
compared
compared toto ISe-supplemented
ISe-supplemented heifers.
heifers. All transcripts
All transcripts included included were significant
were significant via transcriptomi
via transcriptomic
analysis,and
analysis, andanan asterisk
asterisk (*) indicates
(*) indicates thosethose transcripts
transcripts that werethatcorroborated
were corroborated
via qPCRviaat pqPCR at p ≤ 0.05
≤ 0.05.
Resultsofof
Results qPCR
qPCR analysis
analysis for MX1
for MX1 are reported
are reported in Crites
in Crites et al. [34].
et al. [34].
Results of the present transcriptomic analysis revealed significant MIX-form downreg-

For successful attachment and implantation to occur, there must also be restructurin
ulation in the abundance of ISGs, particularly to those that are activated by ISRE. During
of the endometrium and evasion of the maternal immune system by the developing con
RNA-sequencing analysis, we observed a significant MIX-induced decrease in Stat2 and Irf9
ceptuswith
mRNA [36,37]. Functional
no change in mRNAanalysis of the
encoding significantly
STAT1. affected
This suggests mRNA transcripts
that downregulation of in th
present
ISG study via
is occurring identified significant
the interferon changesfactor
gene complex in the “spliceosomal
3 protein cycle”,
complex that “cell death and
translocates
survival”,
into “cellular
the nucleus assembly
to bind andpromoter
ISRE in the organization”,
regions and “autophagy”
of ISGs pathways,
[38]. Additionally, suggestin
STAT2
and IRF9 self-regulate transcription of their own genes, thus leading to potentially further
effects on the type 1 interferon JAK/STAT signaling transduction pathway [58].
Of the classical ISGs that are transcribed following activation of ISRE, mRNA tran-
scripts for IFIT2, IFIT3, IRF9, ISG15, and STAT2 were significantly downregulated in
MIX-supplemented heifers (Figure 3). We further detected significant decreases in mRNAs
encoding the interferon-stimulated genes OAS2, RSAD2 and ISG20, and we previously
reported a MIX-Se downregulation of Mx1 mRNA at this time [34].
Results support the present concept that the peak signal of IFNτ from the developing
conceptus occurred earlier in MIX supplemented heifers, as there was a stark decrease in
the abundance of mRNA transcripts encoding IRF9. Notably, Irf9 mRNA is typically more
abundant between days 14–18 compared to days 25–40 of pregnancy in cattle, coincident
with decreases in mRNA encoding IRF3, MX1α, MX1β, and MX2 in CAR at these two time
points [59]. To corroborate these findings, quantifying IFNτ in the uterine fluid would
provide an indication of the concentration of this protein in the histotroph. Unfortunately, in
the present study, recovery of the uterine fluid at sample collection proved too inconsistent
for subsequent quantification of the concentrations of IFNτ protein.
For successful attachment and implantation to occur, there must also be restructuring
of the endometrium and evasion of the maternal immune system by the developing
conceptus [36,37]. Functional analysis of the significantly affected mRNA transcripts in the
present study identified significant changes in the “spliceosomal cycle”, “cell death and
survival”, “cellular assembly and organization”, and “autophagy” pathways, suggesting
Int. J. Mol. Sci. 2023, 24, 17327 13 of 24
that significant structural and functional changes are occurring. The canonical pathway
most predicted to be upregulated in MIX was the spliceosomal cycle. Most genes are
transcribed as pre-mRNAs containing introns that must be spliced out to form the mRNA
for translation [60–62]. Splicing of pre-mRNA is facilitated by the enzymatic activity of the
spliceosome, consisting of five ribonucleoprotein subunits (snRNPs) and various protein
co-factors [63,64]. This cycle is dependent on ATP [63] and is heavily regulated to ensure
accurate splicing [60]. Although the spliceosome cycle is significantly affected by the form
of supplemental Se, the physiological relevance of this effect is unclear at this time.
Effective attachment and implantation also require a transient evasion of the ma-
ternal immune system to allow the fetal allograft to closely interact with the maternal
interface [38]. The control of this mechanism appears to be modulated predominantly
by the endometrium, although it may also be stimulated by IFNτ and other signals from
the developing conceptus [37,65]. This immunotolerant environment is the result of a
careful balance between compositional changes in the innate immune system consisting
of granulocytes, monocytes, and dendritic cells, which may remain constitutively respon-
sive to protect against pathogens [38], and the adaptive immune system, which must be
repressed so as to not reject the invading conceptus [37,38]. Ligands from the conceptus
as well as prostaglandins act on the endometrium that has been primed by P4 to effect
changes in both the innate and adaptive immune responses. There is a significant increase
in the abundance of the MHC II-expressing molecules, macrophages, and dendritic cells,
as well as NK cells that migrate into the uterine epithelial, endothelial, and stomal cells
in the presence of elevated levels of P4. Additionally, there is an increased abundance of
molecules that promote immune tolerance such as indoleamine 2,3-dioxygenase 1 (IDO1)
and, subsequently, kynurenine, IL10, TGFB, and various cell surface receptors (CTLA4,
PD-L1, and LAG3). Furthermore, there is increased expression of several ISGs associated
with immune tolerance in the uterus and circulating immune cells [37].
Of interest, IDO1 catalyzes the rate-limiting step in the catabolism of tryptophan via
the kynurenine pathway, although it is also critical in immune tolerance and protecting the
embryo from rejection [37,66]. The relative abundance of this transcript was significantly
reduced in MIX versus ISe CAR samples. When comparing pregnancy to cyclic cows, IDO1
is significantly more abundant on day 17 of gestation [66,67], but then dramatically declines
by day 20 [67]. This elevated expression of IDO1 is coupled with a decrease in the relative
concentration of tryptophan: kynurenine [66], and kynurenine can further affect immune
tolerance [68]. Relatedly, mRNA encoding ISG20 and SCARA1 were significantly lower,
and mRNA encoding the transforming growth factor beta 1 (TGFB1) tended to be lower in
the MIX-supplemented heifers, which is indicative of a decreased antiviral response and an
increased tolerance for cell invasion [37,38].
In combination, these findings suggest more advanced preparation of the developing
conceptus to evade immune rejection by the maternal endometrium. This supports our
hypothesis that there is a shift in the timing of peak IFNτ signaling (MRP), and advancement
of the conceptus and endometrium to better support impending attachment, implantation,
and placentation.
4. Materials and Methods

This project (protocol number 2017-2828) was approved by the University of Ken-
tucky’s Institutional Animal Care and Use Committee.
4.1. Animals and Experimental Procedure

Angus-cross heifers (N = 20) received 45 days of Se depletion with no supplemental
Se, followed by 45 days of Se repletion with a vitamin–mineral mix containing 35-ppm
Se as only ISe to reestablish systemic Se to an adequate status [69,70]. The heifers were
then randomly assigned to supplemental Se treatment formulated with a vitamin–mineral
mix containing 35 ppm Se as either inorganic Se (n = 10, ISe, sodium selenite, Prince Agri
Products, Inc., Quincy, IL, USA) or a 1:1 ratio of ISe and OSe (n = 10, MIX, SEL-PLEX;
Int. J. Mol. Sci. 2023, 24, 17327 14 of 24
Alltech, Inc., Nicholasville, KY, USA). Heifers received dietary treatments for at least 90
days prior to estrous synchronization.
Whole blood was collected via jugular venipuncture prior to depletion, repletion, and
the start of treatment. It was also recovered bimonthly during treatment until the end of
experimentation to confirm Se adequate status throughout. Whole blood was also collected
from each heifer at estrus and prior to slaughter (d 17). Total blood Se was quantified
by the University of Kentucky’s Veterinary Diagnostics Laboratory (Lexington, KY, USA)
using an Agilent 7900 inductively coupled plasma–mass spectrometer [71]. Throughout
experimentation, all animals maintained Se-adequate status [69,70], and there tended to be
an effect of Se treatment (p = 0.07) as previously described in Crites et al. [34].
4.2. Experimental Regimen and Serum Collection

After at least 90 days of Se supplementation with each respective treatment (ISe vs.
MIX), heifers were randomly injected with one or two doses of dinoprost tromethamine
(25 mg, Lutalyse, Zoetis, Parsippany, NJ, USA) to induce regression of the CL. Heifers
were then monitored daily for behavioral estrus (d 0) by visual observation as well as
using CowManager technology (Gerverscop 9, Harmelen, The Netherlands) to predict
the timing of estrus. The presence of a preovulatory follicle (estrus, d 0) was confirmed
via transrectal ultrasonography using a 5–8 MHz linear transducer (Ibex Pro, E.I. Medical
Imaging, Loveland, CO, USA) prior to artificial insemination at 0 h, 12 h, and 24 h using
commercially available frozen semen from a single established high-fertility bull.
The reproductive tract (ovaries, uterus, and cervix) was collected from each heifer
on d 17 following euthanasia via captive bolt stunning and exsanguination at the USDA
inspected University of Kentucky Meat Laboratory. Initially, the uterus was flushed to
collect the conceptus as described in Crites et al. [34]. An intact conceptus was recovered
from six heifers in each treatment group (ISe, n = 6; MIX, n = 6), and only these heifers were
used for analyses in the present study.
Subsequently, caruncular endometrial samples were collected from the uterine horn
ipsilateral to the ovary bearing the CL. This respective uterine horn was cut longitudinally
to expose the uterine lumen, and an 8 mm biopsy punch (Integra LifeSciences Production
Corporation, Mansfield, MA, USA) was used to collect CAR endometrial samples from all
animals. These samples were flash-frozen in liquid N2 and stored at −80 ◦ C to be used for
RNA extraction, RNA sequencing, and for real-time PCR (qPCR) analysis.
4.3. RNA Extraction

Total RNA was extracted from approximately 200 mg CAR samples of the endometrium
using TRIzol Reagent (Invitrogen Corporation, Carlsbad, CA, USA). All samples had high
purity, with 260/280 absorbance ratios of 1.88 or greater as quantified using a NanoDrop
ND-100 Spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA).
4.4. RNA-Sequencing
Transcriptomic analysis using RNA-sequencing was conducted using mRNA extracted
from CAR tissue. Library preparation was performed by Zymo Research Corporation
(Irvine, CA, USA). Initially, 500 ng of total RNA was used to construct the total RNA-Seq
libraries. The method described in Bogdanova et al. [72] was used to remove ribosomal
RNA (rRNA) with some modifications, and libraries were prepared using the Zymo-Seq
RiboFree Total RNA Library Prep Kit (Zymo Research Corporation, Irvine, CA, USA). The
RNA-Seq libraries were then sequenced using an Illumina NovaSeq with a sequencing
depth of at least 30 million read pairs per sample.
The RNA-Seq pipeline utilized by the Zymo Research Corporation (Irvine, CA, USA)
was adapted from nf-core/rnaseq pipeline v1.4.2 [73] and built using Nextflow [74]. The
quality of raw reads was analyzed using FastQC v0.11.9, and adaptor and low-quality reads
were trimmed using Trim Galore! v0.6.6. The resultant trimmed reads were aligned to the
reference genome using STAR v2.6.1d [75]. SAMtools v1.9 was used for BAM file filtering
reads were trimmed using Trim Galore! v0.6.6. The resultant trimmed reads were aligned
to the reference genome using STAR v2.6.1d [75]. SAMtools v1.9 was used for BAM file
filtering and indexing [76], and library quality control was executed using QualiMap
v2.2.2-dev [77] and RSeQC v4.0.0 [78]. Duplicated reads were marked using Picard tools
Int. J. Mol. Sci. 2023, 24,(Broad
v2.23.9 17327 Institute, Cambridge, MA, USA), and quality control of the duplication rate 15 of 24
was analyzed using dupRadar v1.18.0 [79]. The complexity of the library was estimated
using Preseq v2.0.3 [80], and gene assignments were applied to reads that overlapped with
and indexing [76], and library quality control was executed using QualiMap v2.2.2-dev [77]
exons using featureCounts
and RSeQC v2.0.1 [81].Duplicated reads were marked using Picard tools v2.23.9 (Broad
v4.0.0 [78].
Count data were uploaded
Institute, Cambridge,to Integrated
MA, USA), and Differential Expression
quality control and Pathway
of the duplication rate was Anal-
analyzed
ysis (iDEP.96, [82]), usingand lowly expressed
dupRadar v1.18.0 [79].transcripts
The complexitywereof removed
the library at
was <1.0 count using
estimated per mil-
Preseq
v2.0.3 [80], and gene assignments were applied to reads
lion (CPM). Data were log2 transformed and then subjected to principal component anal- that overlapped with exons using
featureCounts v2.0.1 [81].
ysis (PCA) and hierarchical clustering of the top 1000 expressed genes to visualize sample
Count data were uploaded to Integrated Differential Expression and Pathway Analysis
variation. For all (iDEP.96,
samples, theand
[82]), average mappingtranscripts
lowly expressed percentage wereofremoved
the identified transcripts
at <1.0 count per million
was 92.33%. The total (CPM). counts for all
Data were log2samples are displayed
transformed in Figure
and then subjected 4A, andcomponent
to principal data for each
analysis
(PCA) and hierarchical clustering of the top 1000 expressed
sample were normally distributed (Figure 4B). The average correlation among all samples genes to visualize sample
variation. For all samples, the average mapping percentage of the identified transcripts
was 0.97, as indicated in Figure 5. Differentially expressed gene/transcript (DEG) expres-
was 92.33%. The total counts for all samples are displayed in Figure 4A, and data for
sion analysis waseach completed
sample wereusing DESeq2
normally v1.28.0 (Figure
distributed [83], which uses
4B). The the Wald
average test for
correlation hy- all
among
pothesis testing. At the significance
samples level p in
was 0.97, as indicated < 0.05,
Figurea5.total of 2029 expressed
Differentially gene transcripts demon-
gene/transcript (DEG)
strated an effect ofexpression
treatment with awas
analysis false discovery
completed rate
using (FDR)
DESeq2 of <40%.
v1.28.0 Presently,
[83], which theWald
uses the hightest
FDR appears to be fordue
hypothesis testing.sample
to the small At the significance
size, sample level p < 0.05, aand
variation, totalrelatively
of 2029 genelowtranscripts
pro-
demonstrated an effect of treatment with a false discovery rate (FDR) of <40%. Presently,
portion of DEGs the in the MIX compared to ISe treatment groups. However, it is generally
high FDR appears to be due to the small sample size, sample variation, and relatively
accepted that corroborating
low proportion multiple
of DEGsgene in thetranscripts
MIX compared after high-throughput
to ISe treatment groups.analysis
However, byit is
qPCR provides validation of the observed
generally accepted changesmultiple
that corroborating [84]. gene transcripts after high-throughput
analysis by qPCR provides validation of the observed changes [84].
Figure
Figure 4. The (A) total The (A)and
4. counts
read total(B)
read counts and (B)
distribution distribution
of log2 of log2 data
transformed transformed
derived data derived
from RNA- from
Seq analysis of each sample of caruncular (CAR) tissue from heifers supplemented with a vitamin– a
RNA-Seq analysis of each sample of caruncular (CAR) tissue from heifers supplemented with
vitamin–mineral
mineral mix containing 35 ppm asmix ISecontaining
(n = 6) or351:1
ppm as ISe (nof
mixture = 6) or 1:1 mixture
ISe:OSe (MIX,ofn ISe:OSe
= 6). (MIX, n = 6).
To assess global effects of Se treatment on the abundance of CAR transcripts at MRP,
DEGs identified in DESeq2 analysis were analyzed for canonical, functional, and network
analyses using QIAGEN’s Ingenuity Pathway Analysis (IPA, QIAGEN, Redwood City, CA,
USA, http://www.ingenuity.com (accessed on 10/03/2023)). The raw data (FASTQ files)
of this manuscript were deposited into the National Center for Biotechnology Information
(NCBI) Sequence Read Archive (SRA, accession number PRJNA1029628, release date:
30 April 2024).
4.5. Real-Time PCR Analysis

Real-time PCR (qPCR) was used to quantify the relative abundance of mRNA in
CAR samples for identified genes that differed according to the RNA-Seq analysis and to
characterize mRNA transcript abundance of selenoproteins and related receptors in CAR at
MRP using a technique that is routinely used in our laboratory [10,34,43]. Approximately
1 µg of RNA from each sample was reverse-transcribed into cDNA using SuperScript IV
VILO Master Mix with ezDNAse Enzyme (Invitrogen by Thermo Fisher Scientific, Vilnius,
Lithuania). Each sample was compared to a no-reverse-transcription control to ensure that
subsequent qPCR results were not a result of genomic DNA contamination.
Real-time PCR analysis occurred in two experiments. Initially, the relative abundance of
mRNAs encoding the selenoproteins DIO1, DIO2, DIO3, GPX1, GPX2, GPX3, GPX4, GPX6,
TXNRD1, TXNRD2, TXNRD3, SELENOF, SELENOH, SELENOI, SELENOK, SELENOM,
Int. J. Mol. Sci. 2023, 24, 17327 16 of 24
SELENON, SELENOO, SELENOP, SELENOR, SELENOS, SELENOT, SELENOV, SELENOW,

and SEPHS2, and the selenoprotein P receptors LRP2, LRP8, and TFRC was determined.
Subsequently, the relative abundance of mRNA transcripts Ifit2, Irf9, Isg20, Scara5,
Scarb1, Timp2, Timp3, and Trim56 was determined to corroborate RNA-Seq results herein.
Additionally,
Int. J. Mol. Sci. corroborating qPCR for the mRNA transcripts17 ofIfit3,
2023, 24, x FOR PEER REVIEW 27 Irf1, Isg15, Oas2, and
Rsad2 were published previously in Crites et al. [34] in a targeted mRNA analysis prior to
conducting RNA sequencing in the present study.
Figure 5. Correlation matrix of data derived from RNA-Seq analysis of each sample of caruncular
Figure 5. Correlation matrix of data derived from RNA-Seq analysis of each sample of caruncular
(CAR) tissue from heifers supplemented with a vitamin–mineral mix containing 35 ppm as ISe (n =
(CAR) tissue from heifers
6) or 1:1 mixture supplemented
of ISe:OSe with correlation
(MIX, n = 6). The average a vitamin–mineral mix
among all samples was containing 35 ppm as ISe (n = 6)
0.97.
or 1:1 mixture ofToISe:OSe (MIX,

assess global effects n = treatment
of Se 6). Theonaverage correlation
the abundance among
of CAR transcripts all samples was 0.97.
at MRP,
DEGs identified in DESeq2 analysis were analyzed for canonical, functional, and network
analyses using QIAGEN’s Ingenuity Pathway Analysis (IPA, QIAGEN, Redwood City, CA,
PrimersUSA,
were designed against
http://www.ingenuity.com (accessedeach respective
on 10/03/2023)). RefSeq
The raw data using
(FASTQ files) of thisthe NCBI Primer-BLAST
manuscript were deposited into the National Center for Biotechnology Information (NCBI)
tool (https://www.ncbi.nlm.nih.gov/tools/primer-blast/ (accessed
Sequence Read Archive (SRA, accession number PRJNA1029628, release date: 30 April 2024).
on 9 June 2023)). Tar-
get products in cDNA were verified by DNA sequencing at ACGT, Inc. (Wheeling, IL,
4.5. Real-Time PCR Analysis
USA), and sequencing results
Real-time PCR (qPCR) were
was used compared
to quantify the relativeto eachofrespective
abundance mRNA in CAR primer template using
the NCBI Nucleotide-BLAST tool
samples for identified genes that (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=
differed according to the RNA-Seq analysis and to char-
acterize mRNA transcript abundance of selenoproteins and related receptors in CAR at
blastn&BLAST_SPEC=GeoBlast&PAGE_TYPE=BlastSearch (accessed on 8 August 2023)).
MRP using a technique that is routinely used in our laboratory [10,34,43]. Approximately
The GenBank accession numbers, forward and reverse primer sequences, amplicon length
of each product, and product identify for each transcript of interest are listed in Appendix A.
To perform qPCR analysis, a total volume of 25 µL containing 5 µL of cDNA, 1 µL of a
10 µM stock of each primer (forward and reverse), 12.5 µL of 2 × SYBR Green PCR Master
Mix (iTaq Universal SYBR Green Supermix, BIO-RAD, Hercules, CA, USA), and 5.5 µL of
nuclease-free water was used. Reactions were conducted using a Bio-Rad CFX Maestro
thermal cycler (Bio-Rad, Hercules, CA, USA).
The relative abundance of each transcript was quantified using the 2−∆∆CT method [85]
using transcripts for three consecutively expressed normally distributed genes that were
not affected by Se treatment to normalize the data. For selenoprotein and selenoprotein
P mRNA analyses, Gapdh, Hprt1, and Sdha transcripts were used as reference genes. Al-
ternatively, for transcriptomics corroboration mRNA analysis, Gapdh, Hprt1, and RPS11
transcripts were the respective reference genes. Data were normalized to the expression
level of ISe. A total of six heifers per treatment were analyzed via qPCR, and all reactions
were performed in triplicate.
Int. J. Mol. Sci. 2023, 24, 17327 17 of 24
4.6. Statistical Analysis

Data are presented as least square means (±SEM), with individual heifer as the experi-
mental unit. Data were analyzed for normal distribution and homogeneity. When appropri-
ate, qPCR data were natural log transformed given that the samples were not distributed
normally. For selenoprotein mRNA analysis, the transcripts Dio2, Gpx2, Selh, Selr, Selw, and
Tfrc were natural log transformed, and for mRNA analysis to corroborate transcriptomic
data, Isg20 was natural log transformed due to being non-normally distributed. The relative
expression for each transcript identified in RNA-sequencing results was subjected to the
Wald test using DESeq2, as described in Section 4.4. “RNA-Sequencing” above.
To determine the effect of form of Se on concentrations of each mRNA transcript, data
were analyzed using Student’s t-test with the PROC TTest procedure of SAS statistical
software package (version 9.4; SAS Institute, Inc., Cary, NC, USA), and each treatment
group contained six heifers (ISe, n = 6; MIX, n = 6). Results were considered statistically
significant at p ≤ 0.05 or with a tendency to differ at 0.05 < p ≤ 0.10.
5. Conclusions
This research had two distinct objectives. Initially, we performed a targeted mRNA
analysis to quantify the relative abundance of mRNA encoding selenoproteins and se-
lenoprotein P receptors in the CAR at d 17 of gestation (MRP) in response to ISe- or MIX-
supplemental Se. Subsequently, we employed a global transcriptomic approach to expand
upon previous findings in our lab that identified key changes in the abundance of mRNA
encoding the P4 and IFNτ-induced DGAT2, FGF2, IFIT3, ISG15, MX1, OAS2, and RSAD2
in response to MIX-form Se diet compared to ISe, which occurred synonymously with
longer conceptuses in MIX-supplemented heifers [34]. Therefore, the second objective of
this study was to examine transcriptomic changes using RNA sequencing analysis in the
CAR tissue of the endometrium at MRP, testing the hypothesis that there will be changes
in the endometrium indicating an advancement in CAR preparation for implantation of
the conceptus. Results from the current transcriptomic analysis correspond with this hy-
pothesis, as evidenced by the significant downregulation of interferon signaling through
the JAK/STAT1/2 signal transduction pathway and downregulation of mRNA encod-
ing the classical ISGs: IFIT1, IFIT2, IFIT3, IRF1, IRF9, ISG15, ISG20, OAS2, and RSAD2.
This presumed shift in the timing of MRP appears plausible given the additional findings
of changes in the cellular organization and function, and immune evasion occurring in
MIX-supplemented heifers compared to those supplemented with ISe alone.
Author Contributions: Conceptualization and methodology, P.J.B.; funding acquisition, P.J.B. and
S.N.C.; project administration, P.J.B.; investigation, P.J.B., S.N.C., B.R.C. and H.S.; writing—original
draft preparation, S.N.C.; writing—review and editing, P.J.B. and B.R.C. All authors have read and
agreed to the published version of the manuscript.
Funding: This project was funded by the Agriculture and Food Research Initiative Competitive Grant
no. 2018-67015-27613 from the USDA National Institute of Food and Agriculture (P.J.B.) and by the
Agricultural and Food Research Initiative Postdoctoral Fellowship Grant no. 2023-67012-39788 from
the USDA National Institute of Food and Agriculture (S.N.C.).
Institutional Review Board Statement: The animal study protocol was approved by the Institutional
Review Board of the University of Kentucky (IACUC #2017-2828, date of approval: 14 December 2020).
Informed Consent Statement: Not applicable.
Data Availability Statement: The raw data (FASTQ files) are available in the National Center for
Biotechnology Information (NCBI) Sequence Read Archive (SRA, accession number PRJNA1029628).
Acknowledgments: The authors thank the faculty and farm crew at the University of Kentucky
Research and Education Center at Princeton, KY, and the C. Oran Little Research Center in Versailles,
KY, for their dedicated work in maintaining the cattle used herein.
Conflicts of Interest: The authors declare no conflict of interest.
Int. J. Mol. Sci. 2023, 24, 17327 18 of 24
Appendix A
Table 1. Primer sets and product identities of qPCR analysis of selenoprotein and selenoprotein P transcripts.
Oligonucleotide Primer Design Product

Gene Gene Name Accession Number 1 Amplicon Length (bp)
(50 to 30 ) Direction Identity (%) 2
Enzymatic transcripts
F: TCCTGTAGTCCGCCTGTCA
Dio1 Iodothyronine deiodinase 1 NM_001122593.2 242 99
R: TCCGGTGATTCTTGATGTCCA
F: GATGGGCATCCTCAGCGTAG
R: TTCTCCTGGGCACCATTTCC
F: AAGTGGAGCTCAACAGCGAT
R: AGTCGAGGATGTGCTGGTTC
Glutathione peroxidases
F: GCAACCAGTTTGGGCATCAG
Gpx1 Glutathione peroxidase 1 NM_174076.3 210 100
R: TAGGGTCGGTCATGAGAGCA
F: AACAGCCTCAAGTACGTCCG
R: TCGGTCATGAGGGAAAACGG
F: GCACCATCTATGAGTACGGGG
R: CCCCATTCACATCGCCTTTC
F: GATCAAAGAGTTCGCCGCTG
R: CCATACCGCTTCACCACACA
F: CACTGTTCCTGGTCGGCTTA
R: CCCAGCACAACTACACCGAA
Thioredoxin reductases
F: AAGGCCGCGTTATTTGGGTA
Txnrd1 Thioredoxin reductase 1 NM_174625.5 306 100
R: CCTGGTGTCCCTGCTTCAAT
F: CAAATGGCTTCGCTGGTCAC
Txnrd2 Thioredoxin reductase 2 NM_174626.2 230 100
R: TTCGTATGCACACCAGCCTT
F: CGGCGTATGACTACGACCTC
Txnrd3 Thioredoxin reductase 3 XM_015468824.1 249 100
R: GACTGTACTCCCAGCCGAAC
Int. J. Mol. Sci. 2023, 24, 17327 19 of 24
Table 1. Cont.

Other selenoproteins
F: GCAGCTCCTGTGATTTGCTT
Selenof Selenoprotein F NM_001034759.2 241 100
R: TTTAGCACAGGGTCTGAACCG
F: CACGAGCTGACGAGTCTACG
Selenoh Selenoprotein H NM_001321327.1 235 100
R: CTTCTTCAGCTCCTCCAGCA
F: TCTGGCTTTCTGCTGGTTGT
Selenoi Selenoprotein I NM_001075257.2 212 100
R: TGGTCAAAAAGCTCCCCCAG
F: CCGTTTTGTCGATTCACGGC
Selenok Selenoprotein K NM_001037489.3 278 100
R: CAGATGAGCTTCCGTAGCCT
F: CCCACTCTACCACAACCTGG
Selenom Selenoprotein M NM_001163171.2 249 100
R: ACCTAAAGGTCTGCGTGGTC
F: GTGGCCATGTACCCCTTCAA
Selenon Selenoprotein N NM_001114976.2 265 100
R: GGGATGGGTTCTCCTGGTTG
F: TGGACAGGTATGACCCCGAT
Selenoo Selenoprotein O NM_001163193.2 202 100
R: ATCTTCTGCAGGTAGTGCCG
F: TCAGGTCTTCATCACCACCA
Selenop Selenoprotein P NM_174459.3 201 100
R: GTGGCAACAGCAGCTACTCA
Selenoprotein R,
F: GAACCACTTTGAGCCGGGTA
Selenor Methionine sulfoxide NM_001034810.2 221 100
R: GGCCATCGTTCAGGAACTCA
reductase B1 (MSRB1)
F: CCCACCCTCGAGACCGA
Selenos Selenoprotein S NM_001046114.3 394 100
R: GCCCAGGACTGTCTTCTTCC
F: TGGTCACCTTCCATCCATGC
Selenot Selenoprotein T NM_001103103.2 240 100
R: AAGAGGTACAACGAGCCTGC
F: ACTCCATTGGCCACCGATTT
Selenov Selenoprotein V NM_001163244.2 224 100
R: AGGCCACAGTAAACCACTCG
F: AGTGTTCGTAGCGGGAAAGC
Selenow Selenoprotein W NM_001163225.1 233 98
R: CGCGAGAACATCAGGGAAGG
Int. J. Mol. Sci. 2023, 24, 17327 20 of 24
Table 1. Cont.

F: GATCCCTACATGATGGGGCG
Sephs2 Selenophosphate synthetase 2 NM_001114732.2 219 100
R: GTTTACCACCGTTTGCCCAC
Selenoprotein P receptors
LDL receptor related protein F: GTGGTTTGGGTTACCGTTGC
Lrp2 XM_024983502.1 304 99
2 R: GGCACCCTGTTAGCTGTGAT
LDL receptor related protein F: AGCCACCCTTTTGGGATAGC
Lrp8 NM_001097565.1 231 100
8 R: AAGGCACAGGTACTCACAGC
F: CCAGGTTTAGTCTGGCTCGG
Tfrc Transferrin receptor NM_001206577.1 339 99
R: GGTCTGCCCAGAATATGCGA
1 These contents are associated with each gene symbol and are the accession numbers of the sequences retrieved from the NCBI RefSeq database for designing primers and probes. 2 All
qPCR products were validated by sequencing. The identity values (%) presented are the base pair ratios between the total amplicon length and the number of identical base pairs.
Table 2. Primer sets and product identities of qPCR analysis of IFNτ-responsive transcripts and all reference transcripts.
Primer Design Product

Interferon induced protein with F: CAGATGTGATTCGAGGGGCA
Ifit2 XM_002698356.5 282 100
tetratricopeptide repeats 2 R: CATGGAGGCAGGCGAGATAG
Interferon induced protein with F: ATTCTGAAGCAGGCCGTTGA
Ifit3 * NM_001075414.1 224 100
tetratricopeptide repeats 3 R: TCCAGTGCCCTTAGCAACAG
F: ACAGCCCCGATACCTTCTCT
Irf1 * Interferon regulatory factor 1 NM_001191261.2 338 100
R: CTTCCCATCCACGCTTGTCT
F: GCGCTGTGCTCTCAACAAAA
Irf9 Interferon regulatory factor 9 NM_001024506.1 285 100
R: AAGTCTAAACGGCCAGCTCC
F: CCATCCTGGTGAGGAACGAC
Isg15 * ISG15 ubiquitin like modifier NM_174366.1 200 99
R: GAACACGGTGCACCCCTTCA
F: CTTGTGGACTACCACGGCTC
Isg20 Interferon stimulated exonuclease gene 20 XM_002696514.5 234 98
R: GATGGCGTAGTCGCTCATGT
Int. J. Mol. Sci. 2023, 24, x FOR PEER REVIEW 22 of 26
Int. J. Mol. Sci. 2023, 24, 17327 21 of 24
F: CCATCCTGGTGAGGAACGAC
Isg15 * ISG15 ubiquitin like modifier
Table 2. Cont. NM_174366.1 200 99
R: GAACACGGTGCACCCCTTCA
Interferon stimulated exonuclease gene F: CTTGTGGACTACCACGGCTC
Primer Design Product
Isg20
Gene Gene Name XM_002696514.5
Accession Number 1 234
Amplicon Length (bp) 98
20 R: 0
(5 to GATGGCGTAGTCGCTCATGT
30 ) Direction Identity (%) 2
F:ACTGGTTTCAAAAGTGCCAGG
F: ACTGGTTTCAAAAGTGCCAGG
Oas2
Oas2 ** 2′-5′-oligoadenylate
20 -50 -oligoadenylate synthetasesynthetase
2 2 NM_001024557.1
NM_001024557.1 314 314 9898
R: CAGCCAGCAGGTGTTATCCA
R: CAGCCAGCAGGTGTTATCCA
Rsad2 RadicalRadical
S-adenosylS-adenosyl
methionine methionine
domain domain F:GTGGTTCCAGAAGTACGGTGA
F: GTGGTTCCAGAAGTACGGTGA
Rsad2 ** NM_001045941.1
NM_001045941.1 315 315 100
100
containing containing
2 2 R:AACCGTTCCGCTTCTCTCAG
R: AACCGTTCCGCTTCTCTCAG
F:AGGACCTACGCCTCAAGGAT
F: AGGACCTACGCCTCAAGGAT
Scara5
Scara5 Scavenger Scavenger
receptor receptor class A5 member 5 NM_001102499.1
class A member NM_001102499.1 256 256 100
100
R:GGGCCTCGATCACCTTTGAA
R: GGGCCTCGATCACCTTTGAA
F:GCAGACATGGGCAACCTCT
F: GCAGACATGGGCAACCTCT
Scarb1
Scarb1 Scavenger Scavenger
receptor receptor class B1 member 1 NM_174597.2
class B member NM_174597.2 249 249 100
100
R:
R:GCCTTGGATGATCCCCTCAG
GCCTTGGATGATCCCCTCAG
F: GGGTCTCGCTGGACATTG
F: GGGTCTCGCTGGACATTG
Timp2 ⱡ
Timp2 TIMP metallopeptidase
TIMP metallopeptidase 2inhibitor
inhibitorInt. J. Mol. Sci.22023, NM_174472.4
24, NM_174472.4
x FOR PEER REVIEW 256 256 100
100
R:
R:TTGATGTTCTTCTCCGTGACC
TTGATGTTCTTCTCCGTGACC
Bos taurus BosTIMP
taurus TIMP metallopeptidase
metallopeptidase inhibitor 3 in- F:GGATTCACCAAGATGCCCCA
F: GGATTCACCAAGATGCCCCA
Timp3
Timp3 NM_174473.4
NM_174473.4 222 222 9999
(TIMP3), mRNA3 (TIMP3), mRNA
hibitor R:
R:GCAGTTACAGCCCAGGTGAT
GCAGTTACAGCCCAGGTGAT
F:
F: TTCAGACCCCAAATCAGGAC
TTCAGACCCCAAATCAGGAC F: CCATCCTGGTGAGGAACGAC
Trim56
Trim56 Tripartite motif containing
Tripartite 56
motif containing Isg15 56* NM_001206574.1
ISG15 ubiquitin like modifier
NM_001206574.1 NM_174366.1 126 126 9999 20
R:
R:TCTGGGCTCTGCTCTCTTTC
TCTGGGCTCTGCTCTCTTTC R: GAACACGGTGCACCCCTTCA
Housekeeping Transcripts
Housekeeping Transcripts Interferon stimulated exonuclease gene F: CTTGTGGACTACCACGGCTC
Isg20 XM_002696514.5 23
Glyceraldehyde 3-phosphate dehydro- 20 F:ACATCAAGTGGGGTGATGCT
F: ACATCAAGTGGGGTGATGCT R: GATGGCGTAGTCGCTCATGT
Gapdh
Gapdh Glyceraldehyde 3-phosphate dehydrogenase NM_001034034.2
NM_001034034.2 200 200 9999
genase R:
R:GGCATTGCTGACAATCTTGA
GGCATTGCTGACAATCTTGA F: ACTGGTTTCAAAAGTGCCAGG
Oas2 * 2′-5′-oligoadenylate synthetase 2 NM_001024557.1 31
Hypoxanthine phosphoribosyltransfer- F:
F: GCCAGCCGGCTACGTTAT
GCCAGCCGGCTACGTTAT R: CAGCCAGCAGGTGTTATCCA
Hprt1
Hprt1 Hypoxanthine phosphoribosyltransferase 1 NM_001034035.2
NM_001034035.2 256 256 100
100
ase 1 R:
R:ATCCAACAGGTCGGCAAAGA
Radical S-adenosyl methionine domain
ATCCAACAGGTCGGCAAAGA F: GTGGTTCCAGAAGTACGGTGA
Rsad2 * NM_001045941.1 31
containing 2 F:
F: AAGATGGCGGACATTCAGAC
AAGATGGCGGACATTCAGAC R: AACCGTTCCGCTTCTCTCAG
Rps11
Rps11 Ribosomal protein S11
Ribosomal protein S11 NM_001024568.2
NM_001024568.2 214 214 9999
R:
R:GCCCTCGAATGGAGACATTA
GCCCTCGAATGGAGACATTA F: AGGACCTACGCCTCAAGGAT
Scara5 Scavenger receptor class A member 5 NM_001102499.1 25
Sdha
Succinate dehydrogenase
Succinate complex flavoprotein
dehydrogenase complex fla- NM_174178.2
F:
F: GCAGAACCTGATGCTTTGTG
GCAGAACCTGATGCTTTGTG 185
R: GGGCCTCGATCACCTTTGAA 9999
Sdha subunit A NM_174178.2 R: CGTAGGAGAGCGTGTGCTT 185
voprotein subunit A R: CGTAGGAGAGCGTGTGCTT F: GCAGACATGGGCAACCTCT
11
Scarb1 Scavenger receptor class B member 1 NM_174597.2 2 All 24
These contents
These contentsareare
associated
associatedwithwith
each gene
each symbol and are the
gene symbol andaccession
are the numbers
accessionof numbers
the sequences retrieved
of the from the
sequences NCBI RefSeq
retrieved R:database
from GCCTTGGATGATCCCCTCAG
for designing
the NCBI primers and
RefSeq database forprobes.
designing
qPCR products were validated by sequencing. The identity values (%) presented are the base pair ratios
primers and probes. All qPCR products were validated by sequencing. The identity values (%) presented are the F:
2 between the total amplicon length
base pair ratios between the total amplicon*
and the number of identical base pairs.
ⱡ
GGGTCTCGCTGGACATTG
Primers are reported Timp2
in [34]. Primer reported TIMP
in [86]. metallopeptidase
length and the number of identical base pairs. * Primers are reported in [34]. inhibitor 2
ⱡ Primer NM_174472.4
reported in [86]. 25
R: TTGATGTTCTTCTCCGTGACC
Bos taurus TIMP metallopeptidase in- F: GGATTCACCAAGATGCCCCA
Timp3 NM_174473.4 22
hibitor 3 (TIMP3), mRNA R: GCAGTTACAGCCCAGGTGAT
F: TTCAGACCCCAAATCAGGAC
Trim56 Tripartite motif containing 56 NM_001206574.1 12
R: TCTGGGCTCTGCTCTCTTTC
Housekeeping Transcripts
Glyceraldehyde 3-phosphate dehydro- F: ACATCAAGTGGGGTGATGCT
Gapdh NM_001034034.2 20
genase R: GGCATTGCTGACAATCTTGA
Int. J. Mol. Sci. 2023, 24, 17327 22 of 24
References
1. Franke, K.W. A new toxicant occurring naturally in certain samples of plant foodstuffs. J. Nutr. 1934, 8, 597–608. [CrossRef]
2. Schwarz, K.; Foltz, C.M. Selenium as an integral part of factor 3 against dietary necrotic liver degeneration. J. Am. Chem. Soc.
1957, 79, 3292–3293. [CrossRef]
3. McCoy, K.E.; Weswig, P.H. Some selenium responses in the rat not related to vitamin E. J. Nutr. 1969, 98, 383–389. [CrossRef]
4. Thompson, J.N.; Scott, M.L. Role of selenium in the nutrition of the chick. J. Nutr. 1969, 97, 335–342. [CrossRef]
5. Hatfield, D.L.; Tsuji, P.A.; Carlson, B.A.; Gladyshev, V.N. Selenium and selenocysteine: Roles in cancer, health, and development.
Trends Biochem. Sci. 2014, 39, 112–120. [CrossRef]
6. Shini, S.; Sultan, A.; Bryden, W.L. Selenium biochemistry and bioavailability: Implications for animal agriculture. Agriculture
2015, 54, 1277–1288. [CrossRef]
7. Flohe, L.; Gunzler, W.A.; Schock, H.H. Glutathione peroxidase: A selenoenzyme. FEBS Lett. 1973, 32, 132–134. [CrossRef]
8. Labunskyy, V.M.; Hatfield, D.L.; Gladyshev, V.N. Selenoproteins: Molecular pathways and physiological roles. Physiol. Rev. 2014,
94, 739–777. [CrossRef]
9. Chen, X.D.; Zhao, Z.P.; Zhao, J.C.; Lei, X.G. Evolution, regulation, and function of porcine selenogenome. Free Radic. Biol. Med.
2018, 127, 116–123. [CrossRef]
10. Carr, S.N.; Crites, B.R.; Pate, J.L.; Hughes, C.H.K.; Matthews, J.C.; Bridges, P.J. Form of supplemental selenium affects the
expression of mRNA transcripts encoding selenoproteins, and proteins regulating cholesterol uptake, in the corpus luteum of
grazing beef cows. Animals 2022, 12, 313. [CrossRef]
11. Li, Q.; Chen, K.C.; Bridges, P.J.; Matthews, J.C. Pituitary and liver selenoprotein transcriptome profiles of grazing steers and their
sensitivity to the form of selenium in vitamin-mineral mixes. Front. Anim. Sci. 2022, 3, 911094. [CrossRef]
12. Novoselov, S.V.; Kryukov, G.V.; Xu, X.M.; Carlson, B.A.; Hatfield, D.L.; Gladyshev, V.N. Selenoprotein H is a nucleolar thioredoxin-
like protein with a unique expression pattern. J. Biol. Chem. 2007, 282, 11960–11968. [CrossRef]
13. Lu, C.; Qiu, F.; Zhou, H.; Peng, Y.; Hao, W.; Xu, J.; Yuan, J.; Wang, S.; Qiang, B.; Xu, C.; et al. Identification and characterization of
selenoprotein K: An antioxidant in cardiomyocytes. FEBS Lett. 2006, 580, 5189–5197. [CrossRef] [PubMed]
14. Reeves, M.A.; Bellinger, F.P.; Berry, M.J. The neuroprotective functions of selenoprotein M and its role in cytosolic calcium
regulation. Antioxid. Redox Signal. 2010, 12, 809–818. [CrossRef]
15. Takebe, G.; Yarimizu, J.; Saito, Y.; Hayashi, T.; Nakamura, H.; Yodoi, J.; Nagasawa, S.; Takahashi, K. A comparative study on the
hydroperoxide and thiol specificity of the glutathione peroxidase family and selenoprotein P. J. Biol. Chem. 2002, 277, 41254–41258.
[CrossRef] [PubMed]
16. Kryukov, G.V.; Kumar, R.A.; Koc, A.; Sun, Z.; Gladyshev, V.N. Selenoprotein R is a zinc-containing stereo-specific methionine
sulfoxide reductase. Proc. Natl. Acad. Sci. USA 2002, 99, 4245–4250. [CrossRef] [PubMed]
17. Beilstein, M.A.; Vendeland, S.C.; Barofsky, E.; Jensen, O.N.; Whanger, P.D. Selenoprotein W of rat muscle binds glutathione and
an unknown small molecular weight moiety. J. Inorg. Biochem. 1996, 61, 117–124. [CrossRef]
18. Redza-Dutordoir, M.; Averill-Bates, D.A. Activation of apoptosis signalling pathways by reactive oxygen species. Biochim. Biophys.
Acta 2016, 1863, 2977–2992. [CrossRef]
19. Ammerman, C.B.; Miller, S.M. Selenium in ruminant nutrition: A review. J. Dairy. Sci. 1975, 58, 1561–1577. [CrossRef]
20. NASEM. Nutrient Requirements of Beef Cattle: Eighth Revised Edition; The National Academies Press: Washington, DC, USA, 2016.
21. Boyne, R.; Arthur, J.R. Alterations of neutrophil function in selenium-deficient cattle. J. Comp. Pathol. 1979, 89, 151–158. [CrossRef]
22. Gleed, P.T.; Allen, W.M.; Mallinson, C.B.; Rowlands, G.J.; Sansom, B.F.; Vagg, M.J.; Caswell, R.D. Effects of selenium and copper
supplementation on the growth of beef steers. Vet. Rec. 1983, 113, 388–392. [CrossRef] [PubMed]
23. McClure, T.J.; Eamens, G.J.; Healy, P.J. Improved fertility in dairy cows after treatment with selenium pellets. Aust. Vet. J. 1986, 63,
144–146. [CrossRef] [PubMed]
24. Erskine, R.J.; Eberhart, R.J.; Grasso, P.J.; Scholz, R.W. Induction of Escherichia coli mastitis in cows fed selenium-deficient or
selenium-supplemented diets. Am. J. Vet. Res. 1989, 50, 2093–2100.
25. Enjalbert, F.; Lebreton, P.; Salat, O. Effects of copper, zinc and selenium status on performance and health in commercial dairy
and beef herds: Retrospective study. J. Anim. Physiol. Anim. Nutr. 2006, 90, 459–466. [CrossRef]
26. Arthur, J.R.; McKenzie, R.C.; Beckett, G.J. Selenium in the immune system. J. Nutr. 2003, 133, 1457S–1459S. [CrossRef] [PubMed]
27. Sgoifo Rossi, C.A.; Compiani, R.; Baldi, G.; Muraro, M.; Marden, J.P.; Rossi, R.; Pastorelli, G.; Corino, C.; Dell’Orto, V. Organic
selenium supplementation improves growth parameters, immune and antioxidant status of newly received beef cattle. J. Anim.
Feed Sci. 2017, 26, 100–108. [CrossRef]
28. Carr, S.N.; Jia, Y.; Crites, B.R.; Hamilton, C.H.; Burris, W.R.; Edwards, J.L.; Matthews, J.C.; Bridges, P.J. Form of supplemental
selenium in vitamin-mineral premixes differentially affects early luteal and gestational concentrations of progesterone, and
postpartum concentrations of prolactin in beef cows. Animals 2020, 10, 967. [CrossRef]
29. Cerny, K.L.; Anderson, L.; Burris, W.R.; Rhoads, M.; Matthews, J.C.; Bridges, P.J. Form of supplemental selenium fed to cycling
cows affects systemic concentrations of progesterone but not those of estradiol. Theriogenology 2016, 85, 800–806. [CrossRef]
30. Spencer, T.E.; Bazer, F.W. Biology of progesterone action during pregnancy recognition and maintenance of pregnancy. Front.
Biosci. 2002, 7, d1879–d1898. [CrossRef]
Int. J. Mol. Sci. 2023, 24, 17327 23 of 24
31. Carter, F.; Forde, N.; Duffy, P.; Wade, M.; Fair, T.; Crowe, M.A.; Evans, A.C.O.; Kenny, D.A.; Roche, J.F.; Lonergan, P. Effect of
increasing progesterone concentration from Day 3 of pregnancy on subsequent embryo survival and development in beef heifers.
Reprod. Fertil. Dev. 2008, 20, 368–375. [CrossRef]
32. Garrett, J.E.; Geisert, R.D.; Zavy, M.T.; Morgan, G.L. Evidence for maternal regulation of early conceptus growth and development
in beef cattle. J. Reprod. Fertil. 1988, 84, 437–446. [CrossRef] [PubMed]
33. Mann, G.E.; Lamming, G.E. Relationship between maternal endocrine environment, early embryo development and inhibition of
the luteolytic mechanism in cows. Reprod 2001, 121, 175–180. [CrossRef]
34. Crites, B.R.; Carr, S.N.; Anderson, L.H.; Matthews, J.C.; Bridges, P.J. Form of dietary selenium affects mRNA encoding interferon-
stimulated and progesterone-induced genes in the bovine endometrium and conceptus length at maternal recognition of
pregnancy. J. Anim. Sci. 2022, 100, skac137. [CrossRef] [PubMed]
35. Mansouri-Attia, N.; Aubert, J.; Reinaud, P.; Giraud-Delville, C.; Taghouti, G.; Galio, L.; Everts, R.E.; Degrelle, S.; Richard, C.; Hue,
I.; et al. Gene expression profiles of bovine caruncular and intercaruncular endometrium at implantation. Physiol. Genom. 2009,
39, 14–27. [CrossRef]
36. Haeger, J.D.; Hambruch, N.; Pfarrer, C. The bovine placenta in vivo and in vitro. Theriogenology 2016, 86, 306–312. [CrossRef]
[PubMed]
37. Ott, T.L. Symposium review: Immunological detection of the bovine conceptus during early pregnancy. J. Dairy. Sci. 2019, 102,
3766–3777. [CrossRef]
38. Walker, C.G.; Meier, S.; Littlejohn, M.D.; Lehnert, K.; Roche, J.R.; Mitchell, M.D. Modulation of the maternal immune system by
the pre-implantation embryo. BMC Genom. 2010, 11, 474. [CrossRef]
39. Khanam, A.; Platel, K. Bioaccessibility of selenium, selenomethionine and selenocysteine from foods and influence of heat
processing on the same. Food Chem. 2016, 194, 1293–1299. [CrossRef]
40. Daniels, L.A. Selenium metabolism and bioavailability. Biol. Trace Elem. Res. 1996, 54, 185–199. [CrossRef]
41. Matthews, J.C.; Zhang, Z.; Patterson, J.D.; Bridges, P.J.; Stromberg, A.J.; Boling, J.A. Hepatic transcriptome profiles differ among
maturing beef heifers supplemented with inorganic, organic, or mixed (50% inorganic:50% organic) forms of dietary selenium.
Biol. Trace Elem. Res. 2014, 160, 321–339. [CrossRef]
42. Cerny, K.; Garbacik, S.; Skees, C.; Burris, W.; Matthews, J.; Bridges, P. Gestational form of selenium in free-choice mineral mixes
affects transcriptome profiles of the neonatal calf testis, including those of steroidogenic and spermatogenic pathways. Biol. Trace
Elem. Res. 2016, 169, 56–68. [CrossRef]
43. Crites, B.R.; Carr, S.N.; Matthews, J.C.; Bridges, P.J. Form of dietary selenium affects mRNA encoding cholesterol biosynthesis
and immune response elements in the early luteal phase bovine corpus luteum. J. Anim. Sci. 2022, 100, skac135. [CrossRef]
44. Mullur, R.; Liu, Y.Y.; Brent, G.A. Thyroid hormone regulation of metabolism. Physiol. Rev. 2014, 94, 355–382. [CrossRef]
45. Silva, J.F.; Ocarino, N.M.; Serakides, R. Thyroid hormones and female reproduction. Biol. Reprod. 2018, 99, 907–921. [CrossRef]
46. Bianco, A.C.; Salvatore, D.; Gereben, B.; Berry, M.J.; Larsen, P.R. Biochemistry, cellular and molecular biology, and physiological
roles of the iodothyronine selenodeiodinases. Endocr. Rev. 2002, 23, 38–89. [CrossRef]
47. Kirovski, D.; Dodovski, P.; Savić, Ð.; Vujanac, I.; Prodanović, R.; Mirilović, M.; Sladojević, Ž.; Ðord̄ević, A. Placental iodothyronine
deiodinases expression in pregnant cows exposed to propylthiouracil (PTU) and thyroid axis activity of their calves. Act. Vet.
2016, 66, 61–75. [CrossRef]
48. Awadeh, F.T.; Kincaid, R.L.; Johnson, K.A. Effect of level and source of dietary selenium on concentrations of thyroid hormones
and immunoglobulins in beef cows and calves. J. Anim. Sci. 1998, 76, 1204–1215. [CrossRef]
49. Gereben, B.; Zeöld, A.; Dentice, M.; Salvatore, D.; Bianco, A.C. Activation and inactivation of thyroid hormone by deiodinases:
Local action with general consequences. Cell Mol. Life Sci. 2008, 65, 570–590. [CrossRef]
50. Forhead, A.J.; Fowden, A.L. Thyroid hormones in fetal growth and prepartum maturation. J. Endocrinol. 2014, 221, R87–R103.
[CrossRef] [PubMed]
51. Greenstein, J.S.; Murray, R.W.; Foley, R.C. Observations on the morphogenesis and histochemistry of the bovine preattachment
placenta between 16 and 33 days of gestation. Anat. Rec. 1958, 132, 321–341. [CrossRef]
52. Assis Neto, A.C.; Pereira, F.T.; Santos, T.C.; Ambrosio, C.E.; Leiser, R.; Miglino, M.A. Morpho-physical recording of bovine conceptus
(Bos indicus) and placenta from days 20 to 70 of pregnancy. Reprod. Domest. Anim. 2010, 45, 760–772. [CrossRef] [PubMed]
53. Spencer, T.E.; Sandra, O.; Wolf, E. Genes involved in conceptus-endometrial interactions in ruminants: Insights from reductionism
and thoughts on holistic approaches. Reproduction 2008, 135, 165–179. [CrossRef] [PubMed]
54. Spencer, T.E.; Johnson, G.A.; Burghardt, R.C.; Bazer, F.W. Progesterone and placental hormone actions on the uterus: Insights
from domestic animals. Biol. Reprod. 2004, 71, 2–10. [CrossRef] [PubMed]
55. Bazer, F.W.; Spencer, T.E.; Johnson, G.A. Interferons and uterine receptivity. Semin. Reprod. Med. 2009, 27, 90–102. [CrossRef]
56. Bazer, F.W.; Burghardt, R.C.; Johnson, G.A.; Spencer, T.E.; Wu, G. Interferons and progesterone for establishment and maintenance
of pregnancy: Interactions among novel cell signaling pathways. Reprod. Biol. 2008, 8, 179–211. [CrossRef] [PubMed]
57. Forde, N.; Carter, F.; Spencer, T.; Bazer, F.; Sandra, O.; Mansouri-Attia, N.; Okumu, L.; McGettigan, P.; Mehta, J.; McBride, R.
Conceptus-induced changes in the endometrial transcriptome: How soon does the cow know she is pregnant? Biol. Reprod. 2011,
85, 144–156. [CrossRef]
58. Mesev, E.V.; LeDesma, R.A.; Ploss, A. Decoding type I and III interferon signalling during viral infection. Nat. Microbiol. 2019, 4,
914–924. [CrossRef]
Int. J. Mol. Sci. 2023, 24, 17327 24 of 24
59. Shirozu, T.; Sasaki, K.; Kawahara, M.; Yanagawa, Y.; Nagano, M.; Yamauchi, N.; Takahashi, M. Expression dynamics of bovine
MX genes in the endometrium and placenta during early to mid pregnancy. J. Reprod. Dev. 2016, 62, 29–35. [CrossRef]
60. Matera, A.G.; Wang, Z. A day in the life of the spliceosome. Nat. Rev. Mol. Cell Biol. 2014, 15, 108–121. [CrossRef]
61. Berget, S.M.; Moore, C.; Sharp, P.A. Spliced segments at the 50 terminus of adenovirus 2 late mRNA. Proc. Natl. Acad. Sci. USA
1977, 74, 3171–3175. [CrossRef]
62. Chow, L.T.; Gelinas, R.E.; Broker, T.R.; Roberts, R.J. An amazing sequence arrangement at the 50 ends of adenovirus 2 messenger
RNA. Cell 1977, 12, 1–8. [CrossRef]
63. Will, C.L.; Lührmann, R. Spliceosome structure and function. Cold Spring Harb. Perspect. Biol. 2011, 3, a003707. [CrossRef]
64. Lerner, M.R.; Boyle, J.A.; Mount, S.M.; Wolin, S.L.; Steitz, J.A. Are snRNPs involved in splicing? Nature 1980, 283, 220–224.
[CrossRef]
65. von Rango, U. Fetal tolerance in human pregnancy--a crucial balance between acceptance and limitation of trophoblast invasion.
Immunol. Lett. 2008, 115, 21–32. [CrossRef]
66. Groebner, A.E.; Schulke, K.; Schefold, J.C.; Fusch, G.; Sinowatz, F.; Reichenbach, H.D.; Wolf, E.; Meyer, H.H.; Ulbrich, S.E. Immunolog-
ical mechanisms to establish embryo tolerance in early bovine pregnancy. Reprod. Fertil. Dev. 2011, 23, 619–632. [CrossRef]
67. Kamat, M.M.; Vasudevan, S.; Maalouf, S.A.; Townson, D.H.; Pate, J.L.; Ott, T.L. Changes in myeloid lineage cells in the uterus and
peripheral blood of dairy heifers during early pregnancy. Biol. Reprod. 2016, 95, 68. [CrossRef] [PubMed]
68. Vacca, P.; Cantoni, C.; Vitale, M.; Prato, C.; Canegallo, F.; Fenoglio, D.; Ragni, N.; Moretta, L.; Mingari, M.C. Crosstalk between
decidual NK and CD14+ myelomonocytic cells results in induction of Tregs and immunosuppression. Proc. Natl. Acad. Sci. USA
2010, 107, 11918–11923. [CrossRef]
69. Gerloff, B.J. Effect of selenium supplementation on dairy cattle. J. Anim. Sci. 1992, 70, 3934–3940. [CrossRef] [PubMed]
70. Dargatz, D.A.; Ross, P.F. Blood selenium concentrations in cows and heifers on 253 cow-calf operations in 18 states. J. Anim. Sci.
1996, 74, 2891–2895. [CrossRef]
71. Wahlen, R.; Evans, L.; Turner, J.; Hearn, R. The use of collision/reaction cell ICP-MS for the determination of elements in blood
and serum samples. Spectroscopy 2005, 20, 84–89.
72. Bogdanova, E.A.; Barsova, E.V.; Shagina, I.A.; Scheglov, A.; Anisimova, V.; Vagner, L.L.; Lukyanov, S.A.; Shagin, D.A. Normaliza-
tion of full-length-enriched cDNA. Methods Mol. Biol. 2011, 729, 85–98. [CrossRef]
73. Ewels, P.A.; Peltzer, A.; Fillinger, S.; Patel, H.; Alnebert, J.; Wilm, A.; Garcia, M.U.; Di Tommaso, P.; Nahnsen, S. The nf-core
framework for community-curated bioinformatics pipelines. Nat. Biotechnol. 2020, 38, 276–278. [CrossRef]
74. Di Tommaso, P.; Chatzou, M.; Floden, E.W.; Barja, P.P.; Palumbo, E.; Notredame, C. Nextflow enables reproducible computational
workflows. Nat. Biotechnol. 2017, 35, 316–319. [CrossRef]
75. Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast
universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [CrossRef]
76. Danecek, P.; Bonfield, J.K.; Liddle, J.; Marshall, J.; Ohan, V.; Pollard, M.O.; Whitwham, A.; Keane, T.; McCarthy, S.A.; Davies, R.M.;
et al. Twelve years of SAMtools and BCFtools. Gigascience 2021, 10, giab008. [CrossRef] [PubMed]
77. García-Alcalde, F.; Okonechnikov, K.; Carbonell, J.; Cruz, L.M.; Götz, S.; Tarazona, S.; Dopazo, J.; Meyer, T.F.; Conesa, A. Qualimap:
Evaluating next-generation sequencing alignment data. Bioinformatics 2012, 28, 2678–2679. [CrossRef]
78. Wang, L.; Wang, S.; Li, W. RSeQC: Quality control of RNA-seq experiments. Bioinformatics 2012, 28, 2184–2185. [CrossRef]
[PubMed]
79. Sayols, S.; Scherzinger, D.; Klein, H. dupRadar: A Bioconductor package for the assessment of PCR artifacts in RNA-Seq data.
BMC Bioinform. 2016, 17, 428. [CrossRef] [PubMed]
80. Daley, T.; Smith, A.D. Predicting the molecular complexity of sequencing libraries. Nat. Methods 2013, 10, 325–327. [CrossRef]
[PubMed]
81. Liao, Y.; Smyth, G.K.; Shi, W. featureCounts: An efficient general purpose program for assigning sequence reads to genomic
features. Bioinformatics 2014, 30, 923–930. [CrossRef] [PubMed]
82. Ge, S.X.; Son, E.W.; Yao, R. iDEP: An integrated web application for differential expression and pathway analysis of RNA-Seq
data. BMC Bioinform. 2018, 19, 534. [CrossRef]
83. Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome
Biol. 2014, 15, 550. [CrossRef] [PubMed]
84. Rockett, J.C.; Hellmann, G.M. Confirming microarray data—Is it really necessary? Genomics 2004, 83, 541–549. [CrossRef]
[PubMed]
85. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−∆∆CT method.
Methods 2001, 25, 402–408. [CrossRef]
86. Ulbrich, S.E.; Meyer, S.U.; Zitta, K.; Hiendleder, S.; Sinowatz, F.; Bauersachs, S.; Büttner, M.; Fröhlich, T.; Arnold, G.J.; Reichenbach,
H.D.; et al. Bovine endometrial metallopeptidases MMP14 and MMP2 and the metallopeptidase inhibitor TIMP2 participate in
maternal preparation of pregnancy. Mol. Cell. Endocrinol. 2011, 332, 48–57. [CrossRef] [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.
View publication stats

Ijms 24 17327

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Ijms 24 17327

Uploaded by

Copyright:

Available Formats

See discussions, stats, and author profiles for this publication at: https://www.researchgate.

Transcriptomic Changes in Response to Form of Selenium on the Interferon-

Article · December 2023

Harshraj Subhash Shinde

The user has requested enhancement of the downloaded file.

Int. J. Mol. Sci. 2023, 24, 17327. https://doi.org/10.3390/ijms242417327 https://www.mdpi.com/journal/ijms

2.3. Differentially Expressed Genes

Gene ID Gene Description Fold Change p-Value 2

2.4. Pathway and Gene Network Analysis

Molecular and Cellular Functions 2 Z-Score 3 p-Value 4

Molecular and Cellular Functions 2 Z-Score 3 p-Value 4

2.5. Real-Time PCR Analysis of Select mRNA Transcripts

3.2. Caruncular Transcriptomics

Results of the present transcriptomic analysis revealed significant MIX-form downreg-

4. Materials and Methods

4.1. Animals and Experimental Procedure

4.2. Experimental Regimen and Serum Collection

4.3. RNA Extraction

4.5. Real-Time PCR Analysis

SELENON, SELENOO, SELENOP, SELENOR, SELENOS, SELENOT, SELENOV, SELENOW,

or 1:1 mixture ofToISe:OSe (MIX,

4.6. Statistical Analysis

Oligonucleotide Primer Design Product

Oligonucleotide Primer Design Product

Oligonucleotide Primer Design Product

Primer Design Product

View publication stats

You might also like