Phenylthiocarbamide (PTC) Polymerase chain reaction (PCR)

based genetic analysis of the PTC genotype using human-

specific DNA primers, RNA Evaluation & Bacterial Strain
Identification. (Week 3)
Biomolecular Techniques; RNA Isolation & Quantification, RFLP Gel Electrophoretic Analysis & PCR

Before you start to set up the PCR reaction could you please retrieve your samples from the heating
blocks/noting your template positions, because these blocks are needed for the bacterial PCR practical
setup.

1. RNA Analysis

1. Obtain RNA tubes from last week’s practical list, centrifuge at 12,000 rpm for 10 min using
normal centrifuge.
2. Carefully remove and discard the ethanol (careful not to disturb the small white pellet but
move as much ethanol as possible) using a 200ul pipette to remove remaining ethanol. Air-
dry the RNA pellet for 10-20 min until ethanol evaporates. (Can use finger heat to aid
evaporation whilst taking care not to lose the pellet).
3. Dissolve dried RNA pellet in 25 µl RNase free water. Pipette and finger flick to aid RNA
dissolution.
4. Spectrophotometer quantification of RNA. A Nanodrop spectrophotometer will be used for
RNA analysis. You will require 1.5 ul for the analysis. Read and note your RNA
concentration. Provide your initials and bench number for the Nanodrop reading.
5. Mix 1 µg of RNA to final volume of 10 µl and add 2 µl RNA loading buffer, mix pulse spin
and get PCR samples ready for analysis. You will need to load and start electrophoresis of
ALL of the samples at the same time (PCR product & PCR Digest & RNA & DNA ladder).

2. RFLP Analysis

6. Access your undigested PCR tube carefully (see template for ID), trying not to disturb the
other students’ PCR tubes.
7. Access your Fnu4HI restriction enzyme digest (established last week) trying not to disturb
the other students’ tubes.
8. Setup 2% submerged agarose gel (already prepared); Add running buffer (0.5x TBE) and
remove comb ready for sample loading. Use GLOVES care with Ethidium Bromide.
9. Add 8 µl of DNA loading buffer to a tube containing PCR/R Enzyme digest (week 2).
10. Add 8 µl of DNA loading buffer to a tube containing residual PCR (week 1).
11. Mix (finger) and pulse spin both tubes and add 10 µl of this mixture to a 2% agarose gel
submerged in TBE buffer noting the lanes you have loaded (Undigested & Digested).
12. Add 10 µl of 100 bp DNA Ladder to remaining well as a DNA marker
13. Gels now contain (x1) RNA (1ug), (X participants) DNA (digested), (X participants) DNA
(undigested), (x1) 100 bp DNA ladder, noting sample positions on gel.
14. Electrophoresis at 90 V for approx. 45min until blue marker is halfway through gel.
15. Photograph gel under UV transillumination. Use Gloves to transport gel!!
16. Dispose of Ethidium Bromide & Agarose gel responsibly in the available designated
container
17. Please note your PCR result (Y/N), Taste result (Y/N), Genotype (+/+; +/-; -/-) and
Phenotype (V/B/NT) on the Excel sheet.

DNA primer pairs;

PTC Forward 1 AACTGGCAGAATAAAGATCTCAATTTAT

PTC Reverse 2 AACACAAACCATCACCCCTATTTT

3. Identification of Staphylococcal strains

Please take care, use gloves and do not use any hand to mouth interaction.
Each bench is provided with 6 bacterial colonies. Each side of the bench (groups of 3/2) are
required to analyse ALL 6 of the bacterial colonies provided.

Preparation of template DNA.

1. For each culture pick off about 5 individual colonies using a sterile plastic loop (Blunt
end) and suspend in 200µl of Chelex suspension in separate 0.5ml eppendorf tubes.
2. Treat each tube at 95°C for 15 minutes to release DNA. (This can be done in the thermal
cycler/heating block/water bath).
4. Briefly vortex and spin at 13000 rpm for 5 minutes and transfer supernatant (the DNA
template x6) to a fresh sterile tube.

PCR

Be VERY careful to avoid contamination, use gloves, do not touch the insides of the lids when
opening tubes.

1. Each culture under investigation (and also control tube; total = 7), add the following to a
Pharmacia PCR bead.
2. 18µl sterile deionised water
3. 1µl of each primer (M1, M2, N1 & N2; 4ul in total). Required to add two primer sets
(MECA & NUC) to each tube. This is called multiplex PCR, amplifying two products at the same
time.
4. 3µl bacterial template DNA preparation (3µl water for your control tube).Total vol. = 25ul
5. Mix to dissolve, then pulse spin (x7 tubes)
6. Place tubes in rack and indicate sample positions with unique identifier on template.
7. Place in thermal cycler, and run the following programme:

Staphylococcal PCR Protocol

95°C 15 minutes

95°C 60 seconds
55°C 60 seconds 34 cycles
72°C 60 seconds

72°C 10 minutes

At this point the PCR products will be frozen until the samples are analysed using agarose gels
which will be resolved in the final session (next week).