Analyse: Separate information into components

Argue: Present a reasoned case

and identify their characteristics

Assess: Make an informed judgement Compare: Identify similarities and/ or differences

Consider: Review and respond to given

Contrast: Identify differences
information

Criticise: Access worth against explicit Debate: Present different perspectives on an

expectations issue

Define: Specify meaning Describe: Give an account of

Discuss: Present key points Evaluate: Judge from available evidence

Explain: Give reasons Identify: Name or otherwise characterise

Justify: Support a case with evidence State: Express in clear terms

Suggest: Present a possible case

Accuracy: A measurement result is considered accurate if it is judged to be close to the true value.

Calibration: Marking a scale on a measuring instrument.

This involves establishing the relationship between indications of a measuring instrument and
standard or reference quantity values, which must be applied. For example, placing a thermometer
in melting ice to see whether it reads 0⁰C, in order to check if it has been calibrated correctly.

Errors: See also uncertainties.

Measurement error: The difference between a measured value and the true value.

Anomalies: These are values in a set of results which are judged not to be part of the variation
caused by random uncertainty.

Random error: These cause readings to be spread about the true value, due to results varying in an
unpredictable way from one measurement to the next. Random errors are present when any
measurement is made, and cannot be corrected. The effect of random errors can be reduced by
making more measurements and calculating a new mean.

Systematic error: These cause readings to differ from the true value by a consistent amount each
time a measurement is made. Sources of systematic error can include the environment, methods of
observation or instruments used. Systematic errors cannot be dealt with by simple repeats. If a
systematic error is suspected, the data collection should be repeated using a different technique or a
different set of equipment, and the results compared.

zero error: Any indication that a measuring system gives a false reading when the true value of a
measured quantity is zero, eg the needle on an ammeter failing to return to zero when no current
flows. A zero error may result in a systematic uncertainty.
Evidence: Data which has been shown to be valid.

Fair test: A fair test is one in which only the independent variable has been allowed to affect the
dependent variable.

Hypothesis: A proposal intended to explain certain facts or observations.

Interval: The quantity between readings, eg a set of 11 readings equally spaced over a distance of 1
metre would give an interval of 10 centimetres.

Precision: Precise measurements are ones in which there is very little spread about the mean value.
Precision depends only on the extent of random errors – it gives no indication of how close results
are to the true value.

Prediction: A prediction is a statement suggesting what will happen in the future, based on
observation, experience or a hypothesis.

Range: The maximum and minimum values of the independent or dependent variables; important in
ensuring that any pattern is detected.
For example a range of distances may be quoted as either: 'From 10cm to 50 cm' or 'From 50 cm to
10 cm'

Repeatable: A measurement is repeatable if the original experimenter repeats the investigation

using same method and equipment and obtains the same results.

Reproducible: A measurement is reproducible if the investigation is repeated by another person, or

by using different equipment or techniques, and the same results are obtained.

Resolution: This is the smallest change in the quantity being measured (input) of a measuring
instrument that gives a perceptible change in the reading.

Sketch graph: A line graph, not necessarily on a grid, that shows the general shape of the
relationship between two variables. It will not have any points plotted and although the axes should
be labelled they may not be scaled.

True value: This is the value that would be obtained in an ideal measurement.

Uncertainty: The interval within which the true value can be expected to lie, with a given level of
confidence or probability, eg “the temperature is 20 °C ± 2 °C, at a level of confidence of 95 %.

Validity: Suitability of the investigative procedure to answer the question being asked. For example,
an investigation to find out if the rate of a chemical reaction depended upon the concentration of
one of the reactants would not be a valid procedure if the temperature of the reactants was not
controlled.

Valid conclusion: A conclusion supported by valid data, obtained from an appropriate experimental
design and based on sound reasoning.

Variables: These are physical, chemical or biological quantities or characteristics.

Categoric variables: Categoric variables have values that are labels. Eg names of plants or types of
material.
continuous variables: Continuous variables can have values (called a quantity) that can be given a
magnitude either by counting (as in the case of the number of shrimp) or by measurement (eg light
intensity, flow rate etc).

control variables: A control variable is one which may, in addition to the independent variable, affect
the outcome of the investigation and therefore has to be kept constant or at least monitored.

dependent variables: The dependent variable is the variable of which the value is measured for each
and every change in the independent variable.

independent variables: The independent variable is the variable for which values are changed or
selected by the investigator.
New A level Biology

Topic: Surface area to volume ratio

Specification
 The relationship between the size of an organism or structure and its surface area to volume
ratio.
 Changes to body shape and the development of systems in larger organisms as adaptations
that facilitate exchange as this ratio reduces.
 Students should be able to appreciate the relationship between surface area to volume
ratio and metabolic rate.

Previous knowledge
 Define diffusion
 Suggest some factors that affect rate of diffusion

EMPA investigation: looking at SA:VOL using agar cubes (with cresol red) and HCL

Biofactsheet: 165

Organisms must exchange materials (food, gases, heat) between themselves and their surroundings.

Calculating surface area to volume ratio (SA:Vol)

Cube side Surface area (SA) Volume (Vol) cm3 SA:VOL (SA÷Vol)
length cm2

2
3
4
6
10
20
30
 Q. What is the relationship between SA:VOL and what does this mean for the organisms?

As organisms get bigger the surface area to volume ratio decrease. Volume increases at a greater rate than surface
area. In other words the volume of cells demanding materials increases but the surface area to provide them
decreases.

Single cell organisms and other small organisms often have a large surface area compared to their volume and thus
can exchange materials by diffusion across their body surface as the diffusion pathway is short

Larger organisms have a small SA:VOL ratio and must

1) Develop gas exchange surfaces (Gills, lungs)

2) As diffusion is slow and most cells are far away from the gas exchange surface they also need to develop
transport system (circulatory system)

Some larger organisms may adopt unique body shapes, like flat worm

Q. Features of an exchange surface that help increase the efficiency of exchange

Q. Features of a transport system

Q2.How does SA:VOL affect heat loss in animals (particular emphasis on mammals and birds that
are warm blooded)?

Use model experiment to answer this question. The small beaker represents a small animal and the
large beaker represents a large animal

Time (minutes) Temperature 0C Use the information to calculate

Large beaker Small beaker
the SA:Vol ratio for the two
0
beakers whilst gathering your data
1
2
3 50ml beaker
4 Holds 70ml water
5 Has a surface area of: 100.00cm2
6
7 250ml beaker
8 Holds 300ml of water
9
Has a surface area of 270.00cm2
10
SA:VOL for beakers

Conclusion:

Q. Use the results to suggest why a large mammal such as an elephant might experience difficulties in
regulating body temperature (2) (Extension: what is their solution to this problem)

A zoologist investigated the

relationship between
body mass and rate of
oxygen uptake in four
species of mammal. The
results are shown in the
graph.

Q. Describe the relationship between body mass and oxygen uptake. (1)

Q. Heat from respiration helps mammals to maintain a constant body temperature. Use this information
to explain the relationship between body mass and oxygen uptake shown in the graph. (3)
Depending on the circumstances, it may be advantageous to have a small S/V while at other times a large S/V is
an advantage. Thus, optimizing S/V ratios has been a driving force in the evolution of all organisms. Since S/V
is a function of both size and shape, these have also been under strong evolutionary pressure.

Flatworms are small animals that live in water. They have no

specialised gas exchange or circulatory systems.

(Thin & flat body) so short diffusion pathway; large surface area
to volume ratio; so gases can move across the body by diffusion

The table below will illustrate=rate the effect of a body shape like the tape worm on SA:VOL

Q. What do you notice about the data??

Q. Voles in northern Scotland are much bigger than those found in southern France; explain how the voles in the
North of Scotland became so big (5)
SA to volume ratio and leaves

Water evaporates from leaves through the stomata, a process called transpiration. In dry climates plants need to
conserve water and thus reduce transpiration. So xerophytic plants have leaves with a small surface area to
volume ratio, like the cactus has reduced its leaves to spines.

Considering the theoretical calculations we made above, we hypothesize that plants that live in a
xeric (dry) environment will have a smaller S/V than a plant that lives in a mesic (moderate)
environment. You will be provided with the leaves of two plants (Jade plant (Crassula argenta) and
honeysuckle (Lonicera tartarica) or other species.
Examine the leaves and then make some predictions about the conditions in which these species
evolved.

Method
1. Estimate the SA of each leaf by tracing the leaf on graph paper. Count the number of boxes
completely within the tracing (Table 5). Count as 0.5 any box that is intersected by the tracing.
Measure the size of one box (_____ cm x ______ = _____ cm2). Determine the surface area of one
side of a leaf. Multiply by 2 for both sides of the leaf. Note: we will ignore the surface area of the
edge of the leaves.
Surface area estimate: ____________________ cm2

Then try this method to estimate surface area

Cut a piece of graph paper that is 10cm × 10cm (100cm2) then weigh it.
a) 100cm2 = ___________g
b) 1cm2 = _____________g
Draw round the leaf and cut out the shape and weigh it. c) Mass of cut out = ___________g
Divide the mass of the leaf cut out (c), by the mass of 1cm2 of graph paper (b) and multiply by 2
Surface area estimate = ______________________ cm2

2. Calculate the volume by weighing each leaf to the nearest 0.01 g. This will give a rough
approximation to volume since the fresh weight of the leaves is largely water (density = 1 gm/cm3).

3. Calculate SA/VOL
 Adaptations of gas exchange surfaces
Specification
Adaptations of gas exchange surfaces, shown by gas exchange:
 across the body surface of a single-celled organism
 in the tracheal system of an insect (tracheae, tracheoles and spiracles)
 across the gills of fish (gill lamellae and filaments including the counter-current principle)
 by the leaves of dicotyledonous plants (mesophyll and stomata).

Structural and functional compromises between the opposing needs for efficient gas exchange and
the limitation of water loss shown by terrestrial insects and xerophytic plants.

The gross structure of the human gas exchange system limited to the alveoli, bronchioles, bronchi,
trachea and lungs.
The essential features of the alveolar epithelium as a surface over which gas exchange takes place.
Ventilation and the exchange of gases in the lungs. The mechanism of breathing to include the role
of the diaphragm and the antagonistic interaction between the external and internal intercostal
muscles in bringing about pressure changes in the thoracic cavity.

Students should be able to:

 interpret information relating to the effects of lung disease on gas exchange and/or ventilation
 interpret data relating to the effects of pollution and smoking on the incidence of lung disease
 analyse and interpret data associated with specific risk factors and the incidence of lung
disease
 evaluate the way in which experimental data led to statutory restrictions on the sources of
risk factors
 Recognise correlations and causal relationships.

Previous knowledge

Cross section of a leaf and adaptations (specifically aimed at spongy mesophyll, stomata, guard cells
and waxy cuticle)

Diffusion definition and factors affecting it

SA:VOL ratio relationship

Practical investigations

Biofact sheets: 26 & 81 & 160 & 193

We have said that as organisms get bigger their SA:VOL decreases. This can be a good thing as it
reduces heat loss, but when it comes to exchanging gases by simple diffusion across the body
surface, diffusion would be too slow provide cells with the oxygen needed. Consequently, organisms
develop specialised exchange surfaces and transport systems. Here we wish to focus on how these
exchange surfaces maximise the rate of diffusion. We will focus on
 Mammalian lungs
 Fish gills
 Insect tracheal system
 Leaves of plants
Fick’s law suggests that the rate of diffusion is related to…….
 How the Lungs/Alveoli are adapted for efficient gas exchange

The mechanism of breathing

Breathing in: …………..Inspiration

Breathing out: ……………….Expiration

Inspiration Expiration
 Trachea:

Bronchi

Bronchioles

Alveoli (site of gas exchange)

The lungs are inside the thoracic cavity, surrounded by the rib-cage
Pulmonary ventilation: this is the total volume of air moved into the lungs in a and diaphragm. Lining the entire cavity and encasing the lungs are the
minute two pleural membranes. These secrete pleural fluid that:
a) Reduces friction from the movement of the lungs during breathing
Tidal volume: the volume of air taken in with a normal breath and
Ventilation rate: the number of breaths taken in one minute
b) Attaches the lungs to the inside of the ribs (by surface tension), so
allowing them to move with the ribs.
Pulmonary Ventilation Rate = Tidal Volume × Ventilation
(dm3min-1) (dm3) (min-1)
For fish gas exchange is difficult because

How the gills are adapted for efficient gas exchange

Explain how the counter-current principle helps fish to extract oxygen from water.(3)

You can see that in the counter current flow

1. Blood and water flow in opposite directions

2. AnWater is dense,
equilibrium so areached
is not lot of energy
(bloodisalways
required to movewa
encounters it,
a slightly higher oxygen concentration)

3. So a concentration gradient is maintained across the entire

 How the tracheal system of insects are adapted

Spiracles need to open for gas exchange

When the spiracles are open water can evaporate out
The spiracles are not always open this conserves water…….

Spiracles are controlled by valves

Valves open when CO2 concentrations get to a critical level, shown in the graph above.
When CO2 gets to 4.2 units, CO2 decreases and oxygen increases, meaning gas exchange can
take place.
 Leaves have a large surface area to volume ratio (they are broad and flat)
Large number of stomata provides a large surface area
Guard cells open stomata
CO2 enters through the stomata by diffusion (down a concentration gradient)
Diffuses through the air spaces, which allows faster diffusion
Leaves are thin to provide a short diffusion pathway
Air movements around the leaf help to maintain concentration gradients

Reducing water loss in plants

Reducing water loss in insects

Increasing gas exchange

Effects of
exchange

Emphysema
Summary sheet:
Questions

Describe and explain how the counter-current system leads to efficient gas exchange across the gills
of a fish. (3)
……………………………………………………………………………………………………………..………………………………….

………………………………………………………………………………………………………………………………………….…….

……………………………………………………………………………………………………………..………………………………….

………………………………………………………………………………………………………………………………………….…….

Amoebic gill disease (AGD) is caused by a parasite that lives on the gills of some species of fish. The
disease causes the lamellae to become thicker and to fuse together. AGD reduces the efficiency of
gas exchange in fish. Give two reasons why. (2)

……………………………………………………………………………………………………………..………………………………….

………………………………………………………………………………………………………………………………………….…….

……………………………………………………………………………………………………………..………………………………….

………………………………………………………………………………………………………………………………………….…….

The volume of water passing over the gills increases if the temperature of the water increases.
Suggest why. (1)
……………………………………………………………………………………………………………..………………………………….

………………………………………………………………………………………………………………………………………….…….

Explain how the structure of the gill makes oxygen uptake efficient. (2)

……………………………………………………………………………………………………………..………………………………….

………………………………………………………………………………………………………………………………………….…….

Describe how the gills of a fish are ventilated after water has entered through its mouth. (3)

……………………………………………………………………………………………………………..………………………………….

………………………………………………………………………………………………………………………………………….…….

……………………………………………………………………………………………………………..………………………………….

………………………………………………………………………………………………………………………………………….…….

There is a one-way flow of water over the gills of a fish whereas there is a two-way flow of air
in the lungs of a mammal. Suggest one advantage to a fish of this one-way flow of water over
its gills. (1)

...................................................................................................................................

...................................................................................................................................
 (a) When first hatched, the young of some species of fish are less than 2 mm long.
Explain how these young fish get enough oxygen to their cells without having
gills.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................
(2)

(b) Mackerel are fast swimming fish whereas toadfish only swim slowly. The table
shows some features of the gills of these fish.

Thickness of Number of lamellae

lamellae / µm per mm of gill length

Mackerel 5 32

Toadfish 35 8

Use evidence from the table to explain how mackerel are able to swim faster
than toadfish.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................
(3)
(Total 5 marks)

(a) Scientists who investigate disease may look at risk factors. What is a risk factor?

.......................................................................................................................

...................................................................................................................(1)

Scientists investigated the link between pollution from vehicle exhausts and the
number of cases of asthma. Between 1976 and 1996, the scientists recorded
changes in the following

• the concentration in the air of substances from vehicle exhausts

• the number of cases of asthma.

 The graph shows their results

(b) Between which years on the graph was there

(i) a positive correlation between the number of cases of asthma and the
concentration in the air of substances from vehicle exhausts

........................................................................................................ (1)

(ii) a negative correlation between the number of cases of asthma and the
concentration in the air of substances from vehicle exhausts?

......................................................................................................(1)

(c) The scientists concluded that substances in the air from vehicle exhausts did not
cause the increase in asthma between 1976 and 1980. Explain why.

.......................................................................................................................

.......................................................................................................................

.......................................................................................................................

.......................................................................................................................

.......................................................................................................................

.................................................................................................................. (3)
Emphysema reduces the efficiency of gas exchange in the lungs. Explain why.

...................................................................................................................................................

..................................................................................................................................................

...................................................................................................................................................

..................................................................................................................................................

...................................................................................................................................................

..................................................................................................................................................

...................................................................................................................................................(4)
 Miner’s lung is a disease caused by breathing in dust in coal mines. The dust causes the alveolar
epithelium to become thicker. People with miner’s lung have a lower concentration of oxygen in
their blood than healthy people. Explain why people with miner’s lung have a lower concentration
of oxygen in their blood.

.............................................................................................................

............................................................................................................. (1)

Read the following passage.

Several diseases are caused by inhaling asbestos fibres. Most of these

diseases result from the build-up of these tiny asbestos fibres in the lungs.

One of these diseases is asbestosis. The asbestos fibres are very small and
enter the bronchioles and alveoli. They cause the destruction of phagocytes
5 and the surrounding lung tissue becomes scarred and fibrous. The fibrous
tissue reduces the elasticity of the lungs and causes the alveolar walls
to thicken. One of the main symptoms of asbestosis is shortness of breath
caused by reduced gas exchange.

People with asbestosis are at a greater risk of developing lung cancer. The time
10 between exposure to asbestos and the occurrence of lung cancer is 20–30 years.

Use information in the passage and your own knowledge to answer the following
questions.

(a) Destruction of phagocytes (lines 4–5) causes the lungs to be more susceptible to
infections. Explain why.

......................................................................................................................

......................................................................................................................

................................................................................................................. (2)

(b) (i) The reduced elasticity of the lungs (lines 6–7) causes breathing difficulty.
Explain how.

.............................................................................................................

.............................................................................................................

.............................................................................................................

......................................................................................................... (2)
 (ii) Apart from reduced elasticity, explain how changes to the lung tissue reduce
the efficiency of gas exchange.

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

........................................................................................................ (4)

(c) (i) Doctors did not make the link between exposure to asbestos and an
increased risk of developing lung cancer for many years. Use information in
the passage to explain why.

.............................................................................................................

......................................................................................................... (1)

(ii) Give one factor, other than asbestos, which increases the risk of developing
lung cancer.

.......................................................................................................... (1)

Pulmonary ventilation is the volume of air that can be breathed in and out in one minute. Pulmonary
ventilation is calculated from the equation
Pulmonary ventilation = breathing rate × tidal volume
Where breathing rate is the number of breaths per minute and tidal volume is the volume of air
breathed in and out in one breath. Table 1 shows the pulmonary ventilation and breathing rates of
an athlete at rest and after vigorous exercise.

 Calculate the tidal volume of the athlete at rest. (1 mark)

 Calculate the percentage increase in pulmonary ventilation after vigorous exercise. Show
your working. Answer (2 marks)
 Suggest why the percentage of nitrogen is lower in exhaled air than in inhaled air. (1 mark)
Gas exchange quiz /24 ____% Grade: _____

1. Where gas exchange occurs in plants? (1)

2. Where gas exchange occurs in insects? (1)

3. Write out Ficks law (1)

4. The scientific word for ‘flattened cells’ (1)

5. What happens to SA:Vol as organisms get bigger (1)

6. What controls the opening of the valves in insects? (1)

7. Why is it important insects do not always have the entrance to trachea open? (1)

8. Explain what counter current flow means and why it is so efficient? (3)

9. Name the abundant structure that give fish gills a large surface area? (1)

10. Explain how a fish takes water into the mouth (4)

11. How do organisms use oxygen (2)

12. What are the narrowest vessels of the insects gas exchange system called? (1)

13. How do small unicellular organisms get the oxygen they require? (2)

14. Why is it an advantage to fish to have a one way flow of water over the gills (2)

15. How is a single alveolus adapted for gas exchange [adaptation and function] (2)
Specification

During digestion, large biological molecules are hydrolysed to smaller molecules that can be absorbed
across cell membranes.
Digestion in mammals of:
Carbohydrates by amylases and membrane-bound disaccharidases
Lipids by lipase, including the action of bile salts
Proteins by endopeptidases, exopeptidases and membrane-bound dipeptidases.
Mechanisms for the absorption of the products of digestion by cells lining the ileum of mammals, to
include:
Co-transport mechanisms for the absorption of amino acids and of monosaccharides
The role of micelles in the absorption of lipids.

Previous knowledge GCSE/unit 1 knowledge

 Digestion is hydrolysis of large insoluble molecules into smaller molecules that can be
absorbed across cell membranes into blood stream
 Enzyme structure, properties
 Digestive enzymes, site of production, site of activity, products, role of bile
 Digestive system components
 Structure of polymers, biochemical tests, biochemistry
 Structure of membranes and role of carrier proteins, channel proteins

Practical

 Effect of pH on enzyme activity

 Effect of bile on enzyme activity
 Model gut investigation

Biofact sheets: 24 & 140

 Enzyme properties
They are made of _____________ chains folded in a specific way.
They have a special region on them where the substrate attaches called the ___________
They increase the rate of chemical reactions because they __________ the activation energy
______________________ in the reaction

They have a temperature and pH where they work best, it is called the __________
temperature/pH.

In very high temperatures or extreme pH values the enzyme may become _____________.
This means the active site has changed shape and is no longer ______________ to the
substrate
Proteins are folded into unique shapes to
make enzymes. But proteins can also be
muscles components
hormones
If the temperature passes the optimum for a particular
antibodies
catalysts. enzyme, then the enzyme begins to __________,
meaning the _________________ changes shape and
is no longer complementary to the ____________

As the temperature increases the rate

of activity increases because

The ______________ have more

___________ energy and therefore
they __________ more often and
more _______________. This means
there are more enzyme substrate
complexes formed and more
successful reactions

As the pH moves away from the optimum the activity decreases

Enzymes have optimum activity in different pH values, those in

the stomach need acidic conditions and would not work in the
small intetsine
 What do you know about bile??? Tissue:
Organ:

Previous knowledge

How the Villi are adapted to increase the rate of absorption


1. Mouth (Buccal cavity). The teeth and tongue physically break up the food into small
pieces with a larger surface area, and form it into a ball or bolus. The salivary glands
secrete saliva, which contains water to dissolve soluble substances, mucus for lubrication,
lysozymes to kill bacteria and salivary amylase to digest starch. The food bolus is
swallowed by an involuntary reflex action through the pharynx (the back of the mouth).
During swallowing the trachea is blocked off by the epiglottis to stop food entering the
lungs.
2. Oesophagus (gullet). This is a simple tube through the thorax, which connects the mouth
to the rest of the gut. No digestion takes place here. There is a epithelium, no villi, a few
glands secreting mucus, and a thick layer of circular and longitudinal muscle to propel the
food by peristalsis. Peristalsis is a wave of circular muscle contraction, which passes down
the gut and is completely involuntary. The oesophagus is a soft tube that can be closed,
The mucosa, which secretes digestive juices and absorbs digested food. It is often folded to
increase its surface area. There is a layer of columnar epithelial cells lining the mucosa. These
epithelial cells contain microvilli, membrane proteins for facilitated diffusion and active transport,
mitochondria, and membrane-bound enzymes. Epithelial cells are constantly worn away by
friction with food moving through the gut, so are constantly being replaced.
• The submucosa, which contains blood vessels, lymph vessels and nerves to control the muscles.
It may also contain secretory glands.
• The muscle layer, which is made of smooth muscle, under involuntary control. It can be
subdivided into circular muscle (which squeezes the gut when it contracts) and longitudinal
muscle (which shortens the gut when it contracts). These two muscles therefore have opposite
effects and so are antagonistic. The combination of these two muscles allows food to be pushed
along the gut by peristalsis.
3. Stomach. This is an expandable bag where the food is stored for up to a few hours. There are
three layers of muscle to churn the food into a liquid called chyme. This chime is gradually released
in to the small intestine by a sphincter, a region of thick circular muscle that acts as a valve. The
mucosa of the stomach wall has no villi, but does have numerous gastric pits (104 cm-2) leading to
gastric glands in the mucosa layer. These glands secrete gastric juice, which contains: hydrochloric
acid (pH 1) to kill bacteria (the acid does not help digestion, in fact it hinders it by denaturing most
enzymes); mucus to lubricate the food and to line the epithelium to protect it from the acid; and
some protease enzymes. No other digestion takes place in the stomach.
4. Small Intestine. The first 30cm of the small intestine is called the duodenum. Although this is
short, almost all the digestion takes place here, due to two secretions: pancreatic juice and bile.
Pancreatic juice is secreted by the pancreas into the duodenum through the pancreatic duct.
Pancreatic juice contains numerous amylase, protease and lipase enzymes. Bile is secreted by the
liver, stored in the gall bladder, and released into the duodenum through the bile duct. Bile doesn’t
contain any enzymes, but it does contain bile salts to aid lipid digestion, and the alkali sodium
hydrogen carbonate to neutralise the stomach acid. This alkali gives chyme in the duodenum a pH
of around 7.5, so the pancreatic enzymes can work at their optimum pH. The mucosa of the
duodenum has few villi, since there is no absorption, but the submucosa contains glands secreting
mucus and sodium hydrogen carbonate. The rest of the small intestine is called the Ileum. This is
the site of final digestion and absorption. To maximise the rate of absorption the ileum has the
three features dictated by Fick’s law: large surface area, short diffusion distance and a steep
concentration gradient sustained by movement of fluids on both sides of exchange surface (see
sheet above for detail).
 Digestion

Types of digestion

Humans, like all animals, use holozoic nutrition, which consists of these stages:
• Ingestion- taking large pieces of food into the body
• Digestion- breaking down the food by mechanical and chemical means
• Absorption- taking up the soluble digestion products into the body's cells
• Assimilation- using the absorbed materials
• Egestion- eliminating the undigested material

Food moves through the alimentary canal by peristalsis, a wave of circular muscle contraction

Carbohydrate digestion
Protein digestion

Proteases are synthesised in inactive forms called zymogens. They are activated when required
Lipid digestion

Digestion and absorption of fats

Activation
Site of production Enzyme Classification Substrate Products
hydrolysed
Salivary Glands Amylase Carbohydrase
Stomach Pepsin Endopeptidases
Amylase Carbohydrase
Trypsin Endopeptidases
Pancreas Chymotrypsin Endopeptidases
Carboxypeptidase Exopeptidase
Lipase Lipase
Maltase Carbohydrase
Sucrase Carbohydrase
Ileum Lactase Carbohydrase
Amino/carboxy
peptidase & Exopeptidases
dipeptidase
Questions

(a) Describe how lipids are digested and absorbed in the ileum.

.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
................................................................................................................... (4 marks)

Surgery is sometimes carried out to remove the gall bladder. Explain why a change in
diet is required after removal of the gall bladder.

.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
................................................................................................................... (3 marks)

Pancreatic enzymes become active when they reach the duodenum. If the pancreatic
duct becomes blocked, enzymes can become active in the pancreas. Suggest how
activation of these enzymes in the pancreas could affect the pancreas.
.............................................................................................................................................
................................................................................................................................(1 mark)

Explain how glucose and fructose are absorbed by the ileum when no inhibitor is
present. (3 marks)
Describe how the gut wall is adapted
(a) to push food down the oesophagus (2 marks)
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................

(b) to neutralise the stomach acid in the duodenum (2 marks)

..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
........................................................................................................................................
..........................................................................................................................................

(c) to absorb the products of digestion in the ileum. (3 marks)

..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................

6 Students investigated the digestion of lipids in milk by lipase. They set up three test tubes.
In tube A, milk was incubated with lipase only.
In tube B, milk was incubated with lipase and bile salts.
In tube C, milk was incubated with bile salts only.
Their results are shown in the table.
  The pH changed in test tube A. Explain why. ( 2marks)
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................

 The pH did not fall below a value of 6.5 in tube A. Suggest one reason why. (1 mark)
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................

 The rate at which the pH fell in tube A was different from the rate at which the pH fell in
tube B. Explain why the pH fell at a different rate. (2 marks)
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................

 Explain why test tube C was set up. (1 mark)

..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................

Some of the enzymes produced by the gut wall hydrolyse polypeptides. Different enzymes hydrolyse
the peptide bonds between different amino acids in a polypeptide. Use your knowledge of the way
in which enzymes work to explain why. (3 marks)
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
Endopeptidases are produced by the stomach wall and by the pancreas. Exopeptidases are produced
by the small intestine. This results in the efficient digestion of polypeptides. Explain why. (2 marks)
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................

Describe the processes involved in the digestion of triglycerides and the absorption of
the products of this digestion in the small intestine. (6 marks)

..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................

Explain how the structures of the stomach wall and the ileum wall are related to the
functions of these organs.(6 marks)
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
Explain how the action of these enzymes accounts for the results. (4 marks)

..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
 Digestion Quiz

1. What is a polymer? (1)

2. What are the bonds called in, proteins, carbohydrates, lipids? (3)

3. What 4 elements are proteins made from? (1)

4. What are the monomers in Lipids (1)

5. What is the purpose of physical digestion? (1)

6. What scientific term can we use to describe the breakdown of biological molecules? (1)

7. What word describe the movement of material through the digestive system (1)

8. Describe the complete breakdown of starch (5)

9. What are the products of protein digestion (1)

10.Where does most digestion take place and what secretions does it receive (3)

11.What do we call the mulch that is slowly released from the stomach (1)

12.Write three simple equations for the breakdown of, lactose, maltose and sucrose; include the
substrate, the enzyme and products (3)

13.Describe the absorption of glucose (4)

14.Describe how the small intestine is adapted for digestion and absorption? (5)

15.What is the name of the protease in the stomach? (1)

16. In what part of the small intestine does most occur? (1)

17.Suggest how lactose intolerance could lead to diarrhoea? (3)

18.Describe the complete digestion and absorption of fats (6)

Specification: Mass transport in animals: 3.3.4.1
The haemoglobins are a group of chemically similar molecules found in many different organisms.
Haemoglobin is a protein with a quaternary structure.

The role of haemoglobin and red blood cells in the transport of oxygen. The loading, transport and
unloading of oxygen in relation to the oxyhaemoglobin dissociation curve. The cooperative nature of
oxygen binding to show that the change in shape of haemoglobin caused by binding of the first
oxygen makes the binding of further oxygen easier. The effects of carbon dioxide concentration on
the dissociation of oxyhaemoglobin (the Bohr effect).

Many animals are adapted to their environment by possessing different types of haemoglobin with
different oxygen transport properties.

The general pattern of blood circulation in a mammal. Names are required only of the coronary
arteries and of the blood vessels entering and leaving the heart, lungs and kidneys.

The gross structure of the human heart. Pressure and volume changes and associated valve
movements during the cardiac cycle that maintain a unidirectional flow of blood.

The structure of arteries, arterioles and veins in relation to their function.

The structure of capillaries and the importance of capillary beds as exchange surfaces. The formation
of tissue fluid and its return to the circulatory system.

Students should be able to:

•• analyse and interpret data relating to pressure and volume changes during the cardiac cycle
•• analyse and interpret data associated with specific risk factors and the incidence of cardiovascular
disease
•• evaluate conflicting evidence associated with risk factors affecting cardiovascular disease
•• recognise correlations and causal relationships.

Previous knowledge
Protein structure form unit 1 (primary  quaternary)
Surface area to volume ratio relationship

Biofact sheets:

Oxygen dissociation curves: 9 & 175

Tissue fluid: 89 & 171

Heart: 139 & 35 & 37

Haemoglobin structure

It is a protein

It has a quaternary structure, (association of more than one polypeptide); in this case it is 4 polypeptide chains 2α
and 2β

Each polypeptide chain is associated with an iron containing haem group, and each haem group can bind one
oxygen molecule. So a Hb molecules can carry 4 oxygen molecules

Oxygen dissociation curves: A sigmoid curve

Loading

Unloading/dissociation
 A sample of blood can therefore be in any state from completely
deoxygenated (0% saturated) to fully oxygenated (100% saturated).
Since deoxyhaemoglobin and oxyhaemoglobin are different colours, it is easy
to measure the % saturation of a sample of blood in a colorimeter.
As the chemical equation shows, oxygen drives the reaction to the right, so
the more oxygen there is in the surroundings, the more saturated the
haemoglobin will be.
This relation is shown in the oxygen dissociation curve:
Hb shows cooperative bonding, where the attachment of one molecule of
oxygen changes the shape of the Hb and affects the binding of the other
oxygen molecules
This curve has an S (or sigmoid) shape, and shows several features that help in
the transport of oxygen in the blood:
• In the alveoli, ventilation of the lungs oxygen is concentration is kept high, at
around 14 kPa. As blood passes through the capillaries surrounding the alveoli
the haemoglobin binds oxygen to become almost 100% saturated. Even if the
alveolar oxygen concentration falls a little the haemoglobin stays saturated
because the curve is flat here.
• In tissues, like muscle, liver or brain, oxygen is used by respiration, so is low,
typically about 4 kPa. At this PO2 the haemoglobin is only 50% saturated, so it
unloads about half its oxygen (i.e. from about 100% saturated to about 50%
saturated) to the cells, which use it for respiration
• In tissues that are respiring quickly, such as contracting muscle cells, the PO2
drops even lower, to about 2 kPa, so the haemoglobin saturation drops to about
10%, so almost 90% of the oxygen is unloaded, providing more oxygen for the
muscle cells.
• Actively-respiring tissues also produce a lot of CO2, which dissolves in tissue
fluid to make carbonic acid and so lowers the pH. The chemical equation above
shows that hydrogen ions drive the reaction to the left, so low pH reduces the %
saturation of haemoglobin at any PO2.
This is shown on the graph by the dotted line, which is lower than the normal
dissociation curve. This downward shift is called the Bohr effect, after the Danish
scientist who first discovered it. So at a PO2 of 2%, the actual saturation is nearer
5%, so almost all the oxygen loaded in the lungs is unloaded in respiring tissues.
Bohr Effect
Different Haemoglobins

Different animals possess different types of haemoglobin with different oxygen transporting properties. These properties are related to the animal’s way of life, so they are
an adaptation that helps the animal survive in its environment.

replaced by adult haemoglobin during the first

year after birth.

Myoglobin is a pigment found in muscles

that are involved in sustained contractions. .
It has a higher affinity for oxygen than Hb. It
can act as an oxygen store only releasing
oxygen when PPo2 is very low, thus it delays
anaerobic respiration as long as possible
Some bacteria require living in plant root nodules require an environment with a very low
concentration of oxygen. The walls of the nodule contain a type of haemoglobin. The oxygen-
haemoglobin dissociation curve of this haemoglobin is far to the left of that for human haemoglobin.
Suggest and explain the role of haemoglobin in the nodule. (3)
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................

DPG is a substance produced in small

amounts in red blood cells. The graph
shows the effects of DPG on the oxygen
haemoglobin dissociation curve.

Anaemia is a condition in which not

enough oxygen is delivered to the tissues.
The red blood cells of people with anaemia
produce large amounts of DPG. Explain the
advantage to people with anaemia of
producing large amounts of DPG.(4)

.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................

Explain how oxygen is loaded, transported and unloaded in the blood.(6)

.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
The table shows the number of red blood cells in the blood of mammals that spent their life at sea
level or at high altitude. At sea level, the partial pressure of oxygen is 21 kPa and at 4500 m above
sea level it is 11 kPa.

Explain the advantage of the increased number of red cells in mammals living at high altitude.(2)
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................

Suggest which two of the species in the table live naturally at high altitude. Use the data to explain
your answer.(2)

.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................

Explain the advantage to the shrew of the oxygen dissociation curve being to the right of that of a
human. (3)
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
 Mass transport

Diffusion is a slow process so is only effective over short distances

Diffusion is a passive process (does not require energy)

Mass flow: moves materials in a particular direction, usually in bulk using water as a solvent. It
requires a pumping mechanism and it is fast

Humans
We have a double circulatory system

Blood flows through the heart twice for one circuit of the body

Blood flows from the right side of the heart to the lungs and back to the left side of the heart: this is
pulmonary circulation

Blood flows from the left side of the heart around to rest of the body this is systemic flow

Valves in the heart and veins ensures one way flow of blood (valves prevent back flow)
The structure of the heart

.
 The mechanism of a heartbeat

Blood flow in the heart is a result of pressure gradients and the presence of valves that prevent
backflow

Unidirectional flow in the heart

Pathway of blood through the heart and lungs

Vena Cava

RA

RV

Pulmonary artery

Lungs

Pulmonary Vein

LA

LV

Aorta

Body
 16
Delay for depolarisation to spread SAN  AVN  Ventricles. T wave ventricular repolarisation
A o rta

12

L eft
8 v en tricle
P ressu re /
kPa
C u rv e X
4

–2
0 0 .1 0 .2 0 .3 0 .4 0 .5 0 .6 0 .7 0 .8 0 .9 1 .0
Tim e / s

Curve x is the right ventricle, this is clear as the pattern is the same as that of the left ventricle, but
the pressure is lower as a result of the smaller muscle content of the wall.
When the left ventricle pressure crosses the pressure line representing the aorta the blood flows
through the semi-lunar valves. When ventricular pressure drops below the aorta pressure then the
valves shut. This causes the second sound you can hear on a heart beat (dub).

When atrial pressure is greater than

ventricular pressure the
atrioventricular valves are open

When ventricular pressure exceeds

atrial pressure (1) then the
atrioventricular valves close
(tricuspid/bicuspid). The first heart
sound Lub

When ventricular pressure exceeds

arterial pressure (2) the semi lunar
valves open

When ventricular pressure is less

than arterial pressure (3) the semi
lunar valves shut, this is the second
sound of the heart beat (dup)

The QRS wave is associated with the spreading of electrical activity over the ventricles. This is evident as it occurs
before the pressure in the ventricles begins to increase. Pressure increase in the ventricles is due to ventricular
systole. P is the wave of depolarisation for atrial systole. PQ flat line is the time Delay for depolarisation to
spread SAN  AVN  Ventricles. T wave ventricular repolarisation
Cardiac Output
Cardiac Output is the amount of blood flowing through the heart each minute. It is
calculated as the product of the heart rate and the stroke volume:

Cardiac output = heart rate x stroke volume

• The heart rate can be calculated from the pressure graph by measuring the time taken for
one cardiac cycle and using the formula:

• The stroke volume is the volume of blood pumped in each beat.

Both the heart rate and the stroke volume can be varied by the body. When the body
exercises the cardiac output can increase dramatically so that

• Oxygen and glucose can get to the muscles faster

• Carbon dioxide and lactate can be carried away from the muscles faster
• Heat can be carried away from the muscles faster
Questions
1 For each equation, rearrange to make A the subject.
a C=B–A (1 mark)
b P+Q=A×B (1 mark)
3
2 An individual at rest had a stroke volume of 75 cm and a heart rate
of 60 beats per minute.
a Calculate the cardiac output in dm-3 min-1. (1 mark)
b Calculate the cardiac output when the same individual exercises
with a stroke volume of 98 cm3 and a heart rate of 103 beats per
minute. (1 mark)
c What is the percentage increase in cardiac output? (2 marks)
3 Figure 2 shows the ECG of a healthy person at rest.

Figure 2
a What is the heart rate of the person? (1 mark)
3
b If the stroke volume of the person is 80 cm , what is the cardiac
output in litres per minute? (1 mark)
c What would the heart rate of the person be if their CO rose to 9.6
dm-3 min-1 and their stroke volume increased by 50%? (2 marks)
4 Figure 3 shows the ECG of a person at rest. The same person
measured their blood pressure with a portable meter and found it to
be 123 / 82 mmHg.
a Use the graph to find the person's heart rate. (1 mark)
b Use the following formula to estimate the person's stroke volume
systolic pressure – diastolic pressure = pulse pressure
Assume that pulse pressure = stroke volume in cm3. (1 mark)
c Calculate the cardiac output for this person. (1 mark)
d When exercising, the person's heart rate rose to 105 beats per
minute. What would be the percentage increase in stroke volume
required to give them a cardiac output of 5.6 dm-3 min-1? (2 marks)
 What is atheroma? (2)

Describe how atheroma can lead to an aneurysm. (2)

Describe how atheroma may form and lead to a myocardial infarction.(6)

Explain how smoking and a high blood cholesterol

concentration increase the risk of developing
coronary heart disease. (6)
CHD = heart muscle receives inadequate amount of
blood or oxygen / (coronary) blood supply reduced;
Smoking:
Raises concentration of fibrinogen (in blood) /
increased risk of clotting;
Increases viscosity of blood;
(Nicotine) causes platelets to stick together / causes
vasoconstriction;
Carbon monoxide associated with plaque formation;
Reduces ability of arteries to dilate / reduces
elasticity;
 Name the structure labelled X.

....................................................................................................................................................................
......... (1 mark)

(ii) Suggest how the structures labelled Y help to maintain the flow of blood in one direction through
the heart.
....................................................................................................................................................................
.........................
....................................................................................................................................................................
......... (2 marks)

(i) Suggest a function of the coronary artery.

...................................................................................................................................
................................................................................................................................... (1 mark)

(ii) From which blood vessel does the coronary artery originate?
...................................................................................................................................
................................................................................................................................... (1 mark)

The table shows some of the events during the cardiac cycle. Complete the table with
ticks to show whether each event occurs when the ventricles are filling or when they
are emptying.(2)
The walls of the left and right ventricles have different thicknesses. Explain the
advantage of this. (1)
...................................................................................................................................
...................................................................................................................................
The left and right ventricles pump the same volume of blood with each beat of
the heart. Explain why.(1)
...................................................................................................................................
...................................................................................................................................

The graphs shows some of the pressure and

volume changes that take place in the left
side of the heart during part of a cardiac
cycle.

Using information from the graphs, describe

the events that produce the changes in the
volume of the left ventricle between times P
and Q.(4)

....................................................................................................................................................................
...................................................
..............................................................................................................................................
....................................................................................................................................................................
....................................................
................................................................................................................................................
The volume of blood pumped out of the left ventricle during one cardiac cycle is
called the stroke volume. The volume of blood pumped out of the left ventricle in one minute
is called the cardiac output. It is calculated using the equation

Cardiac output = stroke volume heart rate

After several months of training, an athlete had the same cardiac output but a lower
resting heart rate than before. Explain this change.(2)
...................................................................................................................................
...................................................................................................................................
Key Tissues in blood vessels and their functions

Artery:

Artery
 A B

Valve shuts when the pressure at B is higher than at A;

Blood (on B side) pushes against valve, forces flaps shut;

Veins:

How is blood flow in the veins is maintained.

 The capillary is adapted for the exchange of substances between
blood and the surrounding tissue.

Describe and explain ways in which a capillary adapts for exchange

Explain two ways in which the small diameter of the capillaries results in the efficient transfer of oxygen from
the alveoli to the red blood cells.
 B loo d v essel
A rtery C a p illa ry Vein
M ean d iam eter
4 .0 m m 8 .0 m 5 .0 m m
o f v essel
P rop erty M ean
th ick n ess o f 1 .0 m m 0 .5 m 0 .5 m m
w all
R ela tiv e th ick n ess (sh o w n b y len g th o f b a r)
E n d o th eliu m
T issu es
p resen t in E lastic tissu e
w a ll
M u scle

E lastic
fib res P e rm eab ility

M u sc le
fib res

A orta S m all A rterio les C ap illaries Ven u les Ve in s

arte ries

As you move away from the heart the proportion of elastic

tissues in the vessels decrease and the proportion of muscle
increases. This reflects the decreasing pressure surges and need
for elasticity, but the increased need for maintaining pressure
and controlling the blood flow to different organs.

Permeability increases at the capillaries, the site of exchange,

they are one cell thick

Veins have a lot less muscle and elastic tissue than arteries,
thinner walls as a consequence. A wider lumen helps to reduce
restriction to flow
 At the capillaries fluid is forced out
Tissue fluid/Interstitial fluid along with soluble components.
 Glucose
 Amino acids
 Salts/ions

This fluid bathes the cells and is

called tissue fluid

Hydrostatic pressure forces fluid out

at the arteriole end,

Water enters at the venous end by

osmosis (osmotic effect, OE)

Arteriole end: HP>OE

Venous end: OE>HP

Oedema: build-up of tissue fluid, caused by…..

Tissue fluid formation
Starvation/lack of protein

Return of tissue fluid to general circulation Histamine

High blood pressure

The plasma proteins are too large to pass out the capillaries, and as water is lost the fluid in the capillary
becomes more concentrated and the osmotic pressure increases
So as we move along the capillary, arteriole to venous end, HP decreases and osmotic effect increases
Blood vessel Quiz /27 ____% Grade: _____

1. The blood vessel returning blood to the heart? (1)

2. The blood vessel carrying blood to the lungs? (1)
3. The blood vessel carrying blood back to the heart from the lungs? (1)
4. Blood vessel carrying blood to the kidney (1)
5. Blood vessel carrying blood away from the liver (1)
6. Blood vessel carrying blood to the liver form the small intestine (1)
7. The blood vessel carrying blood to the rest of the body (from the heart) (1)
8. What does a double circulatory system mean? (1)
9. What do we call the circulation between the heart and the lungs? (1)
10. What do we call circulation between the heart and the rest of the body (1)
11. The vessels that carry blood way from the heart? (1)
12. The vessels that carry blood to the heart? (1)
13. The vessels where exchange occurs? (1)
14. The purpose of valves in the blood vessels (1)
15. The name of the hollow part of the blood vessel through which the blood moves? (1)
16. The purpose of a smooth endothelium? (1)
17. The role of elastic tissue in blood vessels leaving the heart (3)
18. The role of smooth muscle in vessels bringing blood to the organs (3)
19. Explain two ways in which the small diameter of the capillaries results in the efficient
transfer of oxygen from the alveoli to the red blood cells. (2)

20. Describe two ways by which blood flow in the veins is maintained. (2)

21. Give two ways in which the structure of an artery is different from the structure of a
vein. (2)
Specification
Xylem as the tissue that transports water in the stem and leaves of plants. The cohesion-tension
theory of water transport in the xylem.

Phloem as the tissue that transports organic substances in plants. The mass flow hypothesis for the
mechanism of translocation in plants. The use of tracers and ringing experiments to investigate
transport in plants.

Students should be able to:

•• recognise correlations and causal relationships
•• interpret evidence from tracer and ringing experiments and to evaluate the evidence for and
against the mass flow hypothesis.

Previous knowledge
Cross section of a leaf and adaptations
Leaf tissues
Role of xylem and phloem

Practicals
Capillarity

Biofactsheets: 64 & 132

Root and stem structure:

Water is carried through the plant in the xylem. The flow is unidirectional, from roots to leaves and out
to the atmosphere via evaporation at the stomata (transpiration). The movement is called the
transpiration stream. Xylem tissue is adapted to facilitate this process of water movement

How Xylem vessels are adapted for their function

Cohesion Tension Theory

C
Evidence to support supports cohesion Factors affecting the rate of transpiration

Q. In dry conditions, the rate of transpiration is affected by

an increase in temperature. Describe and explain how.

The argument against is that root pressure would force the xylem wider and thus
increase the diameter of the tree

At 12.00 transpiration is a t it’s highest because this is when water flow is at its maximum. As

Rate of flow increases from a minimum at 00.00 hours to a maximum at 12.00 hours and then decreases to
a minimum again at 24.00 hours.

Evaporation increases during the morning (due to higher temperature & light causing stomata to open)
It pulls water molecules up the xylem because due to cohesion.
This transpiration pull creates a negative pressure (tension) in xylem.
The greater the rate of transpiration, the greater the water flow the greater the tension, and the more the
trunk shrinks

R e serv o ir fo r p u sh in g a ir b u b b le b a ck
R u b b e r sto p p er
to rig h t-h an d e n d o f cap illary tu b e
C ap illary tu b e w ith sca le
A ir bu b b le
The volume of water taken up in a given time
can be calculated using the formula πr2l
(where π = 3.142, r = radius of the capillary
tube, and l = the distance moved by the air
bubble). In an experiment the mean distance
moved by the air bubble in a capillary tube of
radius 0.5 mm during 1 min
was 15.28 mm. Calculate the rate of water
uptake in mm3 h−1. Show your working.
Describe how this apparatus could be used to measure the rate of water
uptake by a leafy shoot in cm3 per minute.
The potometer
This is a bubble potometer: measuring the rate of water uptake by a plant by timing how long it
takes for a bubble to move a certain distance along a capillary tube of known diameter
A mass photometer exists measuring the water loss from the plant by the change in mass over
a given time; accuracy limited by accuracy of balance used (does assume all the loss in mass is
water loss)
Potometer above assumes that all the water taken up is lost in transpiration but some will be
used in….
Photosynthesis, maintaining turgidity of cell, hydrolysis reactions, some of the water
evaporating is form respiration; some may evaporate if apparatus is not sealed
Volume of water up taken by shoot = πr2 × distance travelled (r = radius of capillary tube)
Rate of transpiration = distance moved by bubble ÷ time taken
Rate of water uptake (mm3s-1) = Speed of movement of air bubble (mm s-1) x cross-sectional
area of capillary tube (mm2)
The theory behind this is that as water evaporates from the leaves of the shoot water is moved
up the shoot due to cohesive forces and the air bubble is drawn along the capillary tube at the
same rate thus giving a measure of the transpiration rate. However, it is actually the rate of
water uptake being measured this is not the same as transpiration because….
The cross sectional area of the shoot is not as large as the area of the root hairs that normally
absorb water to supply the leaves so rate of uptake is less than transpiration.
Setting up the potometer
Cut a leafy shoot from the plant and immediately put it under water then cut a small section
from the stem again while it is under water, this prevents air getting into the xylem and breaking
the column of water.
Do not get the leaves wet as this will affect the transpiration rate.
Put the potometer under the water (freshly boiled and cooled water minimises air bubbles) and
move it from side to side to remove the air from the system then attach the leafy shoot into the
potometer under water also.
Seal all joints with water proofing substance like petroleum jelly so that any water loss is from
the leafs only
Ensure the environmental conditions don’t change around the leaves as this will heavily
influence the transpiration rate
The air bubble introduce into the capillary tube can be timed as it moves across a set distance,
thus the rate of water loss can be measured.
 Phloem structure (key components: sieve tube elements, companion cells)

Sieve tube element

Companion cells:

The phloem contains a very concentrated solution of dissolved solutes, mainly sucrose, but also other sugars, amino acids, and minerals like phosphate and potassium and
also plant growth factors like auxin. This solution is called the sap, and the transport of solutes in the phloem is called translocation.

Unlike the water in the xylem, the contents of the phloem can move both up and down a plant stem, often simultaneously. It helps to identify where the sugar is being
transported from (the source: organ producing more sugar than required), and where to (the sink: organ consuming sugars for growth or storage).

• During the summer sugar is mostly transported from the leaves, where it is made by photosynthesis (the source) to the roots, where it is stored (the sink).

• During the spring, sugar is often transported from the underground root store (the source) to the growing leaf buds (the sink).

• Flowers and young buds are not photosynthetic, so sugars can also be transported from leaves or roots (the source) to flowers or buds (sinks).

The exact mechanism of translocation is not known, but is too fast to be simple diffusion. The mechanism is thought to be the mass flow of fluid up the xylem and down
the phloem, carrying dissolved solutes with it. The mass flow is driven by a combination of active transport (energy from ATP) and evaporation (energy from the sun). This
is called the mass flow theory.
How carbohydrate is moved in plants

Evidence against this theory

Aphid Stylet Experiments
Aphids have specialised mouthparts
called stylets, which they use to
penetrate phloem tubes and sup of the
sugary sap. If the aphids are
anaesthetised with carbon dioxide and
the body cut off so the stylet remains in
the phloem so pure phloem sap can be
collected through the stylet for
analysis, the aphid’s enzymes ensure
that the stylet doesn’t get blocked.

Analysis of the collected solution

shows it contains sucrose, showing this
travels in the phloem
Puncture Experiments
Phloem is punctured with hollow tube sap oozes out,
showing that there is high pressure inside the
phloem.
If the xylem is punctured then air is sucked in,
showing that there is low pressure (tension) inside
the xylem. This illustrates the main difference
between transport in xylem and phloem: Water is
pulled up the xylem, sap is pushed down in the
phloem.
Radioactive Tracer Experiments
Radioactive isotopes can be used to trace precisely where
different compounds are being transported from and to, and the
rate of transport.
The radioactivity can be traced using photographic film (an
autoradiograph) or a GM tube. These techniques can be used to
trace sugars, ions or even water.
In a typical experiment a plant is grown in the lab and one leaf is
exposed for a short time to carbon dioxide containing the
radioactive isotope 14C. This 14CO2 will be taken up by
photosynthesis and the 14C incorporated into glucose and then
sucrose.

The plant is then frozen in liquid nitrogen to kill and fix it

Ringing Experiments
Phloem vessels are outside the xylem vessels, they
can be removed by cutting a ring in a stem just
deep enough to cut the phloem but not the xylem.
Swelling occurs above the ring, reduced growth
below the ring and the leaves are unaffected. This
was early evidence that sugars were
transported downwards in the phloem.
quickly, and placed onto photographic film in the dark. The
resulting autoradiograph shows the location of compounds
containing 14C. was the phloem This experiment shows that
organic compounds (presumably sugars) are transported
downwards from the leaf to the roots.
More sophisticated experiments using fluorescently labelled
compounds can locate the compound specifically to the phloem
cells.
Questions
1 Humans have a closed double circulation.
a Explain the term closed double circulation. (2 marks)
b Explain why the wall of the left ventricle is thicker than the wall of the right
ventricle. (3 marks)
c The graph shows how
blood pressure in
different locations
changes through one
cardiac cycle.

Give the number from the graph where each of these events occurs:
i atrio-ventricular valves open (1 mark)
ii semilunar valves close. (1 mark)
iii State the time in this cardiac cycle where ventricular systole begins. (1
mark)
iv Use the graph to calculate the heart rate in beats per minute. (1 mark)

2 a Describe how xylem vessels are adapted for transport of water in plants. (4 marks)
b Outline the mass flow hypothesis of transport in phloem. (4 marks)

3 a Describe how the structure of haemoglobin makes it effective in the

transport of oxygen. (4 marks)
b Tobacco smoke contains carbon monoxide, CO, which binds to
haemoglobin in place of oxygen. A heavy smoker can have haemoglobin
with 20% of the oxygen binding sites occupied by CO.
The graph shows the dissociation curves for haemoglobin with no CO and
with 20% CO.
 i Use the graph to describe the effect of CO on haemoglobin saturation.
(3 marks)
ii Use the graph to predict the effect of CO on the circulatory system of
the heavy smoker. (2 marks)
c Describe how the structure of an artery wall differs from that of a capillary
wall in relation to the functions of the two blood vessels. (3 marks)
Specification

In prokaryotic cells, DNA molecules are short, circular and not associated with proteins.

In the nucleus of eukaryotic cells, DNA molecules are very long, linear and associated with proteins,
called histones. Together a DNA molecule and its associated proteins form a chromosome.

The mitochondria and chloroplasts of eukaryotic cells also contain DNA which, like the DNA of
prokaryotes, is short, circular and not associated with protein.

A gene is a base sequence of DNA that codes for:

•• the amino acid sequence of a polypeptide
•• a functional RNA (including ribosomal RNA and tRNAs).

A gene occupies a fixed position, called a locus, on a particular DNA molecule.

A sequence of three DNA bases, called a triplet, codes for a specific amino acid. The genetic code is
universal, non-overlapping and degenerate.

In eukaryotes, much of the nuclear DNA does not code for polypeptides. There are, for example,
non-coding multiple repeats of base sequences between genes. Even within a gene only some
sequences, called exons, code for amino acid sequences. Within the gene, these exons are separated
by one or more non-coding sequences, called introns.

Previous knowledge

Define
 Gene
 Allele
 Mutation
Explain how DNA is responsible for the structure of proteins
Structure of DNA/nucleotides……………….DNA structure for function
Define a polymer

Practicals
 Genetic terms

Gene: ...................................................................................................................................
...................................................................................................................................

Locus: ...................................................................................................................................
...................................................................................................................................

Allele: ...................................................................................................................................
...................................................................................................................................

Non-overlapping (genetic code): ...........................................................................................

...................................................................................................................................

Degenerate (genetic code): ..................................................................................................

...................................................................................................................................

Eukaryotic: ...................................................................................................................................
...................................................................................................................................

Prokaryotic: ...................................................................................................................................
...................................................................................................................................

Introns: ...................................................................................................................................
...................................................................................................................................

Exons: ...................................................................................................................................
...................................................................................................................................

Codon: ...................................................................................................................................
...................................................................................................................................

Key fact to learn

Eukaryotic and prokaryotic DNA is different because……

Eukaryotic DNA
Eukaryotic DNA Is associated with histone proteins, prokaryotic DNA is not
Eukaryotic DNA has introns, prokaryotic DNA does not
Eukaryotic DNA is linear, prokaryotic DNA is circular.

DNA + histone proteins = Chromosome

Mitochondria and Chloroplasts contain short, circular DNA not associated with proteins, like that of prokaryotic
cells. They also contain 70s ribosomes that are found in prokaryotic cells.

What is the advantage of the DNA and ribosomes???

Synthesise enzymes for respiration/photosynthesis

What else does this suggest? Look up endosymbiosis for some personal learning
Eukaryotic cells evolved from prokaryotic cells
Describe the molecular structure of DNA

Describe how the structure of DNA is related to its function

Describe the features of a gene

Genome: the complete set of genes in a cell

Proteome: full range of proteins a cell can produce

Genetics quick test 1
1. What do the terms locus/loci refer to on chromosomes
2. What is a homologous pair of chromosomes?
3. What is an allele?
4. What are introns?
5. What are exons?
6. What does diploid mean
7. What does haploid mean
8. What is the function of the histone proteins in DNA?
9. How are complimentary base pairs held together?
10. What are the base pairs?
11. What is the difference between a purine and pyrimidine base
12. How many codons are there?
13. What do these codons mean?
14. How many amino acids are there?
15. What is a codon?
16. How does eukaryotic and prokaryotic DNA differ?
17. What is a gene?
18. What is a mutation?
19. How can a mutation result in a non-functioning enzyme?
20. What are possible types of mutations?
21.What are mutagens and give some examples?
22.What does it mean to say the genetic code is degenerate?
23.What does it mean that the genetic code is non-overlapping?
Specification
The concept of the genome as the complete set of genes in a cell and of the proteome as the full range
of proteins that a cell is able to produce.

The structure of molecules of messenger RNA (mRNA) and of transfer RNA (tRNA).

Transcription as the production of mRNA from DNA. The role of RNA polymerase in joining mRNA
nucleotides.

•• In prokaryotes, transcription results directly in the production of mRNA from DNA.

•• In eukaryotes, transcription results in the production of pre-mRNA; this is then spliced to form
mRNA.

Translation as the production of polypeptides from the sequence of codons carried by mRNA. The
roles of ribosomes, tRNA and ATP.

Students should be able to:

•• relate the base sequence of nucleic acids to the amino acid sequence of polypeptides, when
provided with suitable data about the genetic code

•• interpret data from experimental work investigating the role of nucleic acids.

Students will not be required to recall in written papers specific codons and the amino acids for which
they code.

Previous knowledge
The role of ribosomes
How replication occurs in DNA
Structure of DNA and the function of these structures
What introns and exons are?
What a codon is
What it means to say the genetic code is non-overlapping and degenerate

Biofact sheets: 22 & 49

RNA
RNA is a nucleic acid like DNA, but with 4 differences:
 RNA has the sugar ribose instead of deoxyribose
 RNA has the base uracil instead of thymine
 RNA is usually single stranded, but can fold into 3-dimentional structures, like
proteins.
 RNA is usually shorter than DNA

Messenger RNA (mRNA)

mRNA carries the "message" that codes for a particular protein from the nucleus (where the
DNA master copy is) to the cytoplasm (where proteins are synthesised). It is single stranded
and just long enough to contain one gene only. It has a short lifetime and is degraded soon
after it is used.

Ribosomal RNA (rRNA)

rRNA, together with proteins, form ribosomes, which are the site of mRNA translation and
protein synthesis. Ribosomes have two subunits, small and large, and are assembled in the
nucleolus of the nucleus and exported into the cytoplasm. rRNA is coded for by numerous
genes in many different chromosomes. Ribosomes free in the cytoplasm make proteins for
use in the cell, while those attached to the RER make proteins for export.

Transfer RNA (tRNA)

tRNA is an “adapter” that matches amino acids to their codon. tRNA is only about 80
nucleotides long, and it folds up by complementary base pairing to form a looped clover-leaf
structure. At one end of the molecule there is always the base seqence ACC, where the
amino
acid binds. On the middle loop there is a triplet nucleotide sequence called the anticodon.
There are 64 different tRNA molecules, each with a different anticodon sequence
complementary to the 64 different codons. The amino acids are attached to their tRNA
molecule by specific aminoacyl tRNA synthase enzymes. These are highly specific, so that
each amino acid is attached to a tRNA adapter with the appropriate anticodon.
Compare tRNA vs mRNA Compare DNA Vs RNA Compare the structures of RNA and DNA;
1) tRNA Similarities:

2) mRNA Differences
 Transcription
Production of mRNA from DNA

Transcription (DNA  mRNA)

Comparison of replication and transcription

Similarities

Differences
•In prokaryotes, transcription directly produces mRNA from DNA.

•In eukaryotes, transcription produces pre-mRNA this is then spliced to

form mRNA which has the introns removed and contains only exons.
Translation: production of polypeptides from the sequence of codons carried by mRNA
Three important things

1. Most amino acids have more than one

codon. In this codon only the first 2 bases
are crucial, the third can change, degeneracy
exists in the 3rd base, building in some
tolerance for mutations in the code. Where
a base change (substitution mutation) still
results in a codon for the same amino acid

2. There are three stop codons, they do not

code for amino acids

3. Methionine codon is a start codon also. This

means that newly synthesised polypeptides
will start with methionine, this is often
removed in processing.
 Q. Complete the table to
show the codes at the
various stages in the
protein synthesis
process

Q. What would be the order of nucleotides in the mRNA produced by this DNA strand?

ACGATTGTGCACGAG
___________________

Q. A polypeptide consists of 145 amino acids. 14 amino acids are in its structure
How many base pairs must there be in the gene for this polypeptide?
How many nucleotides are there in the mRNA transcribed from this gene?
How many different types of tRNA are needed to synthesise this protein?

Q. Look at the table on the previous page giving the mRNA codons for the various amino acids. A
section of mRNA has the following sequence AAG CGC UCU GCA, what will be the order of amino
acids in the polypeptide: Lysine, Arginine, Serine, Alanine

Q. What would the DNA codons have been to generate this mRNA strand? TTC GCG AGA CGT

Q. What anticodons will attach to this sequence of mRNA? UUC GCG AGA CGU
Questions
1 a State two similarities between the DNA in mitochondria and the DNA in a prokaryotic
cell. (2 marks)

b There are 20 amino acids and four DNA bases. Explain why amino acids need to be
coded by triplets of three bases. (1 mark)

c The DNA triplets for three different amino acids are shown. Write the sequence of
bases that would be present on the tRNA anticodon for each of them.
C C G T A G G T C (3 marks)

d A polypeptide has 120 amino acids. Calculate the minimum number of bases on an
mRNA molecule required to code for this polypeptide. (1 mark)

2 a Name the stages represented by the letters X and Y below:

b Define the terms:

i gene (1 mark)
ii chromosome. (1 mark)

c Describe the role of tRNA in protein synthesis. (3 marks)

d Give the meaning of the following terms in the context of the genetic code:
i redundant (1 mark)
ii universal. (1 mark)

3 a Name the two biological molecules contained in chromosomes. (2 marks)

b Pre-mRNA is formed in the nucleus. Sequences can be cut out from pre-mRNA.
i Name this process. (1 mark)
ii Give the name for the sequences which are cut out. (1 mark)

c The diagram shows part of the translation process at a ribosome.

Use the diagram and the table to answer the following questions.
i Give the sequence of the anticodon on the tRNA leaving the ribosome. (1 mark)

ii Name the amino acid represented by AA3. (1 mark)

iii Predict the next amino acid in the sequence after AA3. (1 mark)

iv The polypeptide in the diagram will be complete after the 45th amino acid.
Mutation is a change in a nucleic acid sequence.
State and explain the consequence of a mutation changing the U G C codon to U G A.
(2 marks)
 Specification Biofact sheets: 76 & 237 & 94

Gene mutations involve a change in the base sequence of chromosomes. They can arise
spontaneously during DNA replication and include base deletion and base substitution. Due to the
degenerate nature of the genetic code, not all base substitutions cause a change in the sequence of
encoded amino acids. Mutagenic agents can increase the rate of gene mutation.

Mutations in the number of chromosomes can arise spontaneously by chromosome non-disjunction

during meiosis.

Meiosis produces daughter cells that are genetically different from each other.

The process of meiosis only in sufficient detail to show how:

• Two nuclear divisions result usually in the formation of four haploid daughter cells from a single
diploid parent cell
• Genetically different daughter cells result from the independent segregation of homologous
chromosomes
• Crossing over between homologous chromosomes results in further genetic variation among
daughter cells.

Students should be able to:

• complete diagrams showing the chromosome content of cells after the first and second meiotic
division, when given the chromosome content of the parent cell

• explain the different outcome of mitosis and meiosis

• recognise where meiosis occurs when given information about an unfamiliar life cycle
• explain how random fertilisation of haploid gametes further increases genetic variation within a
species.

Previous knowledge
Explain what a mutation is
Outline the key steps in meiosis
Explain the steps in the cell cycle (IPMAT)
Explain the key steps in mitosis
Stages in polypeptide formation, primary, secondary, tertiary structure
Mutagens/mutagenic agents
What diploid and haploid means

Write a short explanation of meiosis

Write a short explanation of mitosis

Mutations: changes in the order or quantity of DNA The genetic code is a blue print for the ribosomes on how to build proteins, when they
read it, in its normal state it make sense and the build functioning proteins.
They can occur as
Imagine that the original genetic code read like the following sentence. It makes sense

THE WEE
SAD LAD
Addition

THE WEE X SAW HIS

THE
SAD LAD OLD DAD
SAW
WEE HIS
OLD DAD Deletion

XSA DLA
TH_ WEE
THW
SAD
DSA EES ADL ADS AWH ISO LDD AD
LAD
SAW HIS
WHI Substitution:

OLD DAD
THE WEE
THESOL
WEE SAD LAD SAQ HIS OLD DAD
SAD LAD
DDAHIS
SAW D
OLD DAD
A closer look at mutations and their classification
DNA base sequence determines the mRNA sequence; this determines the order of
amino acids assembled at the ribosomes. The primary structure determine how H-
bonds form between the amino acids during folding for the secondary structure,
further folding then ensues to form the tertiary structure of the protein. Mutations
impact mostly on tertiary structure. As secondary folding is between carboxyl and
hydroxyl groups which all amino acids have. Tertiary structure and protein function
involves the R groups which can differ significantly.

Silent mutations: Do not result in a change to the amino acid sequence of a protein.
They may occur in a non-coding region (outside of a gene or within an intron),
They may occur within an exon in a manner that does not alter the final amino acid
sequence. This happens when the change is on the third base of a codon, due to the
degeneracy of the genetic code, most amino acids have more than one codon,
differing only in the third base. So the genetic code is more likely to tolerate
mutations in the third base.

Alters the codon so that when it is transcribed a different amino acid will be put in
place. This can have a big effect if the amino acid is crucial to the bonding in folding
of the protein or if it acts as a part of the active site of an enzyme. However, if an
amino acid with similar properties is coded for, or the amino acid was not involved in
the tertiary folding of the chain or the functioning of the enzyme, then it may not be
a serious mutation, the protein may still function

With a nonsense mutation, the new nucleotide changes a codon that specified an
amino acid to one of the STOP codons (TAA, TAG, or TGA). Therefore, translation of
the messenger RNA transcribed from this mutant gene will stop prematurely. The
earlier in the gene that this occurs, the more truncated the protein product and the
more likely that it will be unable to function.

This is caused by addition or deletion of bases. Changes the way the codons are read
(causes a frame shift) and as such changes the primary sequence of amino acids. This
will affect the folding of the protein and may result in a non-functioning protein. CFTR
protein in cystic fibrosis is a result of deletion of one codon
Mutation Rates and Mutagens

Mutations are normally very rare, which is why members of a species all look alike and can interbreed. However the rate of mutations is increased by
chemicals or by radiation. These are called mutagenic agents or mutagens, and include:

 High energy ionising radiation such as x-rays, ultraviolet rays, , , or rays from radioactive sources. These ionise the bases so that they don't form
the correct base pairs.

 Intercalating chemicals such as mustard gas (used in World War 1), which bind to DNA separating the two strands.

 Chemicals that react with the DNA bases such as benzene, nitrous acid, and tar in cigarette smoke.

 Viruses. Some viruses can change the base sequence in DNA causing genetic disease and cancer. During the Earth's early history there were far more
of these mutagens than there are now, so the mutation rate would have been much higher than now, leading to a greater diversity of life. Some of
these mutagens are used today in research, to kill microbes or in warfare. They are often carcinogens since a common result of a mutation is cancer.
 The cell cycle is divided into several stages
The cell cycle
Interphase: consisting of the G1, S and G2 phases

This takes up about 90% of the cell cycle

The remaining 10% is the mitotic phase (IPMAT). There are some
distinct activities that can be attributed to the various parts of the
mitotic phase. These are outlined below

Interphase Prophase Metaphase Anaphase Telophase

 The importance of meiosis: Meiosis halves the number of chromosomes (formation of haploid gametes, eggs and sperm) Restoration of
diploid number at fertilisation; Introduces genetic variation;

A second possible permutation to

The stages of meiosis I illustrate independent assortment

Pro(1) Synapsis & Met(1)

Crossing over

Cell 1

Cell 2 Ana(1)
Telo(1)
 The stages of meiosis II

Cell 1

PII MII AII

TII
Independent assortment/segregation is important to provide
 Non-disjunction

Is the failure of homologous chromosomes or sister

chromatids to separate properly during cell division.

Most cases of aneuploidy (abnormal chromosome

numbers in a cell) are attributed to female meiotic
process than males

More common as women age

Down syndrome: result of an extra number 21 chromosome. Children with this condition can have
heart defects, short stature, susceptibility to respiratory disease, reduced life span and increased risk
of Alzheimer’s and leukaemia. This is caused by non-disjunction in the fathers chromosome.

Patau Syndrome: extra number 13 chromosome. Symptoms of this condition are eye, brain and
circulatory defects and cleft palate

Edwards’s Syndrome: extra number 18 chromosome. Affects most organ systems

Klinefelter syndrome: (XXY): sterile males with more feminine body characteristics than normal
: (XYY): taller than average, less than average intelligence
Trisomy X (XXX): no obvious effects
Monosomy (X): genetically female but do not mature sexually at puberty and are sterile
Questions
1 What is the possible number of combinations that could be made
from
a 6 pairs (1 mark)
b 8 pairs (1 mark)
c 15 pairs. (1 mark)
2 How many possible combinations of chromosomes could be made from
gametes with
a 3 chromosomes (1 mark)
b 9 chromosomes (1 mark)
c 23 chromosomes. (1 mark)

3 An organism has five pairs of chromosomes (2n =10). Assuming no crossing over
occurs.
a What is the number of possible gametes that can be made by
meiosis? (2 marks)
b What is the number of possible zygotes that can be produced by
a random mating? (1 mark)

4 Human beings have a diploid number 2n = 46.

a What is the possible number of different chromosome
combinations in each gamete? (2 marks)
b What is the number of possible zygotes that can be produced by
a random mating? (1 mark)

5 A horse has a diploid number 2n = 64, while a donkey has 2n = 62.

a Assuming no crossing over occurs, how many different gametes
could be made by each animal? (1 mark)
b How many chromosome combinations would be possible in the
offspring? (1 mark)
Specification

Genetic diversity as the number of different alleles of genes in a population.

Genetic diversity is a factor enabling natural selection to occur.

The principles of natural selection in the evolution of populations.

• Random mutation can result in new alleles of a gene.
• Many mutations are harmful but, in certain environments, the new allele of a gene might
benefit its possessor, leading to increased reproductive success.
• The advantageous allele is inherited by members of the next generation.
• As a result, over many generations, the new allele increases in frequency in the
population.

Directional selection, exemplified by antibiotic resistance in bacteria, and stabilising

selection, exemplified by human birth weights.

Natural selection results in species that are better adapted to their environment. These
adaptations may be anatomical, physiological or behavioural.

Students should be able to:

• use unfamiliar information to explain how selection produces changes within a population
of a species
• interpret data relating to the effect of selection in producing change within populations
• Show understanding that adaptation and selection are major factors in evolution and
contribute to the diversity of living organisms.

Previous knowledge
Explain the terms, mutation, allele, gene,
Understand different types of mutations
Explain how mutations affect protein structure (tertiary development)
Explain how natural selection occurs (using Darwin’s theory)
Explain the steps in speciation
Define a species
Define speciation

Practical work
Aseptic techniques to investigate the effect of antimicrobial substances on microbial
growth.

Biofact sheets: 44 & 142 & 103

 How would Darwin explain how a Giraffe with a long neck evolved from a shorter
neck ancestor?

The vole is a small, mouse-like animal. Voles found on some cold

islands are much larger than voles found in warmer areas.
Explain how natural selection may have caused the northern
voles to be larger in size. (5)
Types of selection
 Stabilising selection

Bacterial resistance to antibiotics, an example of direction selection

Antibiotics kill bacteria, but occasionally a chance mutant appears that is resistant to
that antibiotic. In an environment where the antibiotic is often present, this mutant
has an enormous selective advantage since all the normal (wild type) bacteria are
killed leaving the mutant cell free to reproduce and colonise the whole environment
without any competition. Some farmers routinely feed antibiotics to their animals to
uptive selection prevent infection, but this is a perfect environment for resistant bacteria to thrive.
The best solution is to stop using the antibiotic so that the resistant strain has no
selective advantage, and may die out.
Birth mass of babies as an example of stabilising selection
It is harmful for an infant to be born with a very low birth weight. They are much
more vulnerable to heat loss due to their high surface area to volume ratio and
consequently their respiratory demands are very high. Pre-term babies (which
account for 67% of low-birthweight infants(1)) are particularly susceptible to
respiratory problems (lack of surfactant in the lungs), cardiac problems (Patent
ductus arteriosus - the lungs are still bypassed when the umbilical cord has
been cut) and dangerous intestinal problems (Necrotizing enterocolitis)
amongst many other conditions can all be fatal and are reflected in high
mortality rates at these low birth rates. It is therefore not beneficial to be on
the extremes of birth weight.

Similarly, delivering a child of too high birth weight can cause complications
with delivery if the head and shoulders are too wide to pass through the
mother's hips. Therefore the other extreme of high birth rate is also not
Specification
Two organisms belong to the same species if they are able to produce fertile offspring. Courtship
behaviour as a necessary precursor to successful mating. The role of courtship in species recognition.

A phylogenetic classification system attempts to arrange species into groups based on their
evolutionary origins and relationships. It uses a hierarchy in which smaller groups are placed within
larger groups, with no overlap between groups. Each group is called a taxon (plural taxa).

One hierarchy comprises the taxa: domain, kingdom, phylum, class, order, family, genus and species.

Each species is universally identified by a binomial consisting of the name of its genus and species,
eg, Homo sapiens.

Recall of different taxonomic systems, such as the three domain or five kingdom systems, will not be
required.

Students should be able to appreciate that advances in immunology and genome sequencing help to
clarify evolutionary relationships between organisms.

Previous knowledge
Definition of a species

Biofact sheets: 91 & 170

Courtship

Innate behaviour: Species specific

Courtship involves sign stimuli (usually specific external stimuli like, sound, scent, colour, movements)
The purpose is to make breeding more successful because it allows

 Recognition of members of your own species is possible

 Attracts opposite sex
 Reduces aggression
 It can be an indicator of health/fitness (survival of fittest)
 Identification of sexually mature members of species, or those receptive to reproduction (‘in
heat’)
 Formation of pair bonds (not always) where parents mate for life and work together to raise
young

The courtship process is a ritual relaying on a call and response type of behaviour, in other words…….
The male may perform a specific sign stimulus
This will elicit a response from the female that encourages a further action from the male
The process repeats in the ‘stimulus response chain’

If at any point appropriate responses are not performed then the courtship ritual stops

How have elaborate courtship rituals/displays evolved

Best display/grandest colours are most attractive to
These individuals breed
Pass on alleles for this characteristic

Courtship can be used in classification as it is species specific. Species with similar rituals suggests they are
more closely related to each other.

Duck A and B are same species as they have the same ritual, duck C is only a closely related species
as it is only missing one element of the ritual. F displays quite a different sequence of behaviour and
so is a more distant relative of A.
 Classification/Taxonomy

The art of arranging organisms into groups based on similarities and differences. There are a few
classification systems in use.

The most common system is a hierarchical system.

A hierarchy is defined as

Groups within groups with no overlap between the groups.

Meaning the largest group is the

Kingdom (animal, plant)

Within this the animal kingdom there is the phylum, vertebrates and invertebrate,

Within the vertebrates there are classes, fish, mammals, reptiles, amphibians.

Within the mammals there are orders

This is further divided in to family

Genus and species

K As you move down the hierarchy the

P
__________
groups get smaller and the
similarities between the organisms
increases
__________
C All organisms are assigned a binomial
name which consists of the

__________
O Genus + Species
F
__________
__________
G
__________
S
__________
King kingdom (animal, plant, fungi, protest, moneran)
Phillip Phylum (chordate, arthropod, mollusc,
Came Class (mammal, bird, reptile)
Over Order (carnivore, primate, rodents)
From Family (Canidae: dogs, Felidae: cats, hominidae)
Germany Genus (Acinonyx: cheetah Panthera: lion, tiger)
Swimming  Species (Panthera leo (lion), Panthera tigris (tiger)

The cheetah, Acinonyx

jubatus, and other cat
species belong to the family
Felidae. Complete the table
to show the classification of
the cheetah.
The bobcat and lion share the same
Kingdom: animals Phylum: chordata Class: mammals Order: carnivores Family: felidae

But they belong to a different genus. So they are very closely related as they share so many groups within the
hierarchy, meaning that they have many similar charcateristics.
Bobcat’s binomial name: Lynx Rufus
Lions binomial name: Panthera leo
 Phylogenetics

Members of the Hominidae family (great apes and humans) evolved from a common ancestor. First
orang-utans diverged from the common ancestor, followed by gorillas and then humans closely
followed by bonobos and chimp.

Humans and chimps are closely related as they diverged recently. You can see their branches are close
together. Humans and orang-utans are distantly related, diverged longer ago.
Classification can have problems like

Inability to observe reproductive behaviour of living species, of extinct species, of those that
reproduce asexually.

Because of some of the limitations of observable features, behaviour scientists will use molecular
techniques to determine the relationship between organisms

Molecular classification techniques

Some examples of this are discussed below

1) DNA sequencing and comparisons: comparing the base sequences for specific genes in
organisms

Table showing the % similarity of DNA between different

species

2) A second way of comparing base sequences

a. ATTGTCTGATTGGTGCTAGTCGTCGATGCTAGGATCG
b. ATTGTATGATTGGTGCTAGTCGGCGATGCTAGGATCG
c. ATTGTTAGATTGAAACTAATCGACGAATATAGGAGTC
There are 13 differences between species a & c and only 2 between species a & b, suggesting
species a & b are more closely related.

3) DNA sequencing is difficult, so we can compare

amino acid sequences in proteins given that
the DNA sequence determines the order of
amino acids in a protein.
 DNA hybridisation

Immunological comparisons.
Evolutionary relationships between different primates can be found by comparing their proteins and
DNA. All primates produce a species-specific type of haemoglobin. An antibody against human
haemoglobin could be used to compare the evolutionary relationships between different primates.
Describe and explain how. (3)

............................................................................................................................................
............................................................................................................................................
............................................................................................................................................
............................................................................................................................................
............................................................................................................................................
............................................................................................................................................

Scientists used DNA hybridisation to determine the evolutionary relationships between five species of
primate. The temperature at which a molecule of double-stranded DNA separates into two single
strands is the separation temperature.
The scientists recorded the mean separation temperature of DNA in which both strands were from the
same species. The scientists then recorded the mean decrease in separation temperature of DNA in
which one of the strands was from another species.

These data suggest that gibbons are the most distantly related to humans. Explain how. (2)
............................................................................................................................................
............................................................................................................................................
............................................................................................................................................
............................................................................................................................................
............................................................................................................................................

There were differences in separation temperature of DNA formed from single-stranded DNA of the
same species of primate. Suggest why. (1)

............................................................................................................................................
............................................................................................................................................
............................................................................................................................................

The scientists assumed that the decreases in separation temperatures are directly proportional to the
time since the evolutionary lines of these primates separated. Gorillas are thought to have separated
from orang-utans 20 million years ago. Use this information to calculate how long ago the
evolutionary lines of humans and chimpanzees separated. Show your working. (2)

________________________ million years

Questions
1 The olinguito is an animal newly discovered in 2014.

The olinguito lives in trees in the Andes mountains. It is a carnivore.

a In the currently accepted classification system, one of the groups
is class. Give one piece of evidence from the information given,
that the olinguito should be placed in the mammal class. (1 mark)
b The olinguito is similar in appearance to a type of racoon that has
already been classified.
Describe how biologists could determine whether the olinguito
was in the same species as the racoon. (2 marks)
c The sloth is another animal that lives in trees. Describe how
biological molecules could be used to determine how closely
related the sloth and the olinguito are in evolutionary terms. (4
marks)

2 The diagram shows part of the phylogenetic, or evolutionary, tree for fish. The closer
to the top of the tree, the more recent the timescale.

a Name the
most recent
common ancestor
for:
i the
tuna and the
halibut(1
mark)
ii the cod
and the
squirrelfish. (1
mark)
b Name the fish that share the most recent common ancestor. (1
mark)
c The Teleostei first evolved around 200 – 250 million years ago. How do
we know this? (2 marks)

3 a A group of students carried out an investigation into the variety of

plant species in a field.
i State what is meant by the term species richness. (1 mark)
ii They decide to use a quadrat to sample the species.
One of the students decides to place the quadrat alternately in
areas where there is first high and then low diversity of plants.
Explain whether this is a reliable strategy. (2 marks)
iii Suggest how they could identify unfamiliar plants. (1 mark)

b Their results are shown in the table.

plant species number of plants
 daisy 39
plantain 24
clover 248
buttercup 17
i Use the formula
N (N – 1)
d=
Σn(n – 1)
to calculate the diversity index for the plants in this field.
Show your working. (3 marks)
ii The students compared their results with another group who
did the same investigation six months previously.
The way the field was used had not changed in that time, yet
their results were very different.
Suggest reasons for the differences. (2 marks)
c Explain why using land for intensive crop culture reduces
biodiversity. (3 marks)
Specification Biofact sheets: 65

Biodiversity can relate to a range of habitats, from a small local habitat to the Earth.

Species richness is a measure of the number of different species in a community.

An index of diversity describes the relationship between the number of species in a community and
the number of individuals in each species.

Calculation of an index of diversity (d) from the formula

N = total number of organisms of all species

n = total number of organisms of each species.

Farming techniques reduce biodiversity. The balance between conservation and farming.

Previous knowledge
Define a habitat...................................................................................................................
............................................................................................................................................
............................................................................................................................................

Define a population...........................................................................................................
............................................................................................................................................
............................................................................................................................................

Define a species................................................................................................................
............................................................................................................................................
............................................................................................................................................

Define a community.............................................................................................................
............................................................................................................................................
............................................................................................................................................

Weeds....................................................................................................................
............................................................................................................................................

Pesticides...................................................................................................................
............................................................................................................................................

Herbicide..................................................................................................................
............................................................................................................................................

Insecticide..................................................................................................................
............................................................................................................................................

Fungicide......................................................................................................................
............................................................................................................................................
 Biodiversity is the variety of life

It has 3 levels: genetic, species and ecosystem

Genetic diversity: differences in alleles

Suggest some factors that can increase genetic diversity?

Species diversity: the number of different species in a habitat

This can give an indication of the complexity, quality and stability of a habitat but does not take account of
organisms present in low/high numbers

To get a true picture of biodiversity we need to know

Species richness: number of different types of species,

Species abundance: number of each population

To get accurate estimations of these figures we need to sample the population in such a way to avoid bias (use
random sampling methods, this will also allow statistical analysis of data) and to ensure that the sample is
representative (large samples)

The Simplon Diversity Index can be used to calculate the biological diversity in a habitat. It is useful as it
measures the number of individuals and the number of species taking account of those present in low numbers

N = total number of individuals

n = number of each species

 Area A Area B
Species Abundance Species Abundance
A 90 A 34
B 5 B 33
C 5 C 33
Total

Two fields were sampled one and agricultural field and one a field that has been left unmanaged for many
years. The results are shown in the table above.

Calculate the index of diversity for both areas. Show your working below

If provided with some basic information from the investigation it would seem the fields were both similar
and that land management had no impact, there were 3 different species present; there were a total of 100
organisms present. However, when provided with more detailed data we can see that area A is dominated
by one species, possibly a field with a particular crop being grown and the others in low numbers typically
being controlled by herbicides. The diversity index for A is much lower than that of B. B is a more balanced
habitat, and likely to be a lot more stable as a result.
Calculate the index of diversity of plants in the forest (2)

The forest was cleared to make more land available for agriculture. After the forest was
cleared the species diversity of insects in the area decreased. Explain why. (3)
............................................................................................................................................
............................................................................................................................................
............................................................................................................................................
............................................................................................................................................
............................................................................................................................................
............................................................................................................................................
............................................................................................................................................
............................................................................................................................................
 The scientists collected insects at sites chosen at random. Explain
the importance of the sites being chosen at random. (1)
Removes bias;

Calculate the index of diversity (2)

Without carrying out any further calculations, estimate

whether the index of diversity for the wheat field would be
higher or lower than the index of diversity for the wood.
Explain how you arrived at your answer.

A journalist concluded that this investigation showed that farming reduces species diversity.
Evaluate this conclusion. (2)

Farmers were offered grants by the government to plant hedges around their fields. Explain the effect
planting hedges could have on the index of diversity for animals. (2)
 Costa Rica is a Central American country. It has a high level of species diversity. There are over 12 000 species of plants in Costa Rica. Explain how
this has resulted in a high species diversity of animals. (2)

The number of species present is one way to measure biodiversity. Explain why an index of diversity may be a more useful measure of biodiversity.
(2)

Frogs lay their eggs in pools of water. These eggs are small. Use this information to explain why frogs’ eggs are very likely to be affected by pesticides
in the water. (2)

An increase in temperature leads to evaporation of water. Suggest how evaporation may increase the effect of pesticides on frogs’ eggs. (1)
Factors reducing biodiversity Forests have a high biodiversity because a mature forest has
many different species of plants in several layers; each adapted
to their own conditions of light and nutrient availability. The
different plants have different animals feeding on them and
living in them; and the different primary consumers have
different secondary consumers feeding on the. So forests
contain complex food webs with high diversity.

By contrast, a field of crops has very low diversity (particularly

with tendency for monoculture) with very few plants (often just
the crop and a few weeds) and so few animals. Use of pesticides
(herbicide and insecticide) will reduce biodiversity further. Use
of fertilisers can lead to leeching and eutrophication in ponds
and lakes which kills living organisms

Deforestation therefore reduces biodiversity.

Explain the advantages of conserving a forest
ecosystem.
 Species richness
This is a measure of the number or different species in a particular
ecosystem.
It takes no account of the relative numbers of each species or where
they are distributed.

Questions
4 Three examples of data are shown in the table below.
Moorland Rocky shore Potato field
Mean % Mean Mean %
Species cover per Species number per Species cover per
quadrat quadrat quadrat
Milkwort 5 Limpet 82 Potato 89
Carnation grass 16 Grey top shell 12 Dandelion 8
Purple moor
29 Toothed top shell 36 Clover 13
grass
Bell heather 6 Edible periwinkle 35 Nettle 7
Starry sedge 5 Chiton 4 Dock 14
Common heather 48 Beadlet anemone 23
Snakelocks
Tormentil 13 7
anemone
Sheep's fescue 82 Dog whelk 34
Sheep's sorrel 11 Barnacle 197
Mat grass 23
a Calculate the species diversity for each site. (6 marks)
b Comment on the diversity of the three sites. (3 marks)

5 Samples were taken from three randomly located positions in a

freshwater pond. The results are shown in the table below.
Number of specimens of each species found in freshwater pond samples
Sample number
Species
1 2 3
Water boatman 12 9 5
Great diving beetle 4 0 5
Water flea 56 78 36
Freshwater shrimp 35 12 24
Ramshorn pond snail 0 11 2
Dragonfly nymphs 9 10 7
a Calculate the mean number of each species present. (3 marks)
b Calculate the value of D for this pond by using the formula

(2 marks)
c Suggest how the random sampling positions might have been
determined. (2 marks)
d Discuss how the data might have been different had the sampling
not been random. (3 marks)
e Dragonfly nymphs were counted together and not as separate
species. Suggest how this might have influenced the value of D
that you have calculated. (3 marks)
Specification
Genetic diversity within, or between species, can be made by comparing:

• The frequency of measurable or observable characteristics

• The base sequence of DNA
• The base sequence of mRNA
• The amino acid sequence of the proteins encoded by DNA and mRNA.

Students should be able to:

• interpret data relating to similarities and differences in the base sequences of DNA and in the amino
acid sequences of proteins to suggest relationships between different organisms within a species and
between species

• appreciate that gene technology has caused a change in the methods of investigating genetic
diversity; inferring DNA differences from measurable or observable characteristics has been replaced
by direct investigation of DNA sequences.

Knowledge of gene technologies will not be tested.

Quantitative investigations of variation within a species involve:

• collecting data from random samples
• calculating a mean value of the collected data and the standard deviation of that mean
• interpreting mean values and their standard deviations. Students will not be required to calculate
standard deviations in written papers.

Previous knowledge
Structure of DNA related to function
How DNA codes for proteins
Protein structure (primary, secondary, tertiary)
mRNA structure and production in transcription
Molecular techniques for classification (DNA, amino acids sequencing, DNA hybridisation,
immunological techniques
Explain crossing over
Independent assortment
Discuss mutations
Sampling techniques (random and transect)

Practical
Factor affecting leaf size

Biofact sheets: 68 & 50

 Factors affecting
distribution of
organisms

HOW DO WE MEASURE DISTRIBUTION

Random sampling Systematic sampling
Describe how to estimate the
number of daisies growing in a
Transects
field
Describe how you would investigate how the
species change across the stream, from one bank
to the other
Variation: differences between organisms. Intraspecific: within a species, interspecific: between species (often much greater). This is caused by genes inherited,
environment or a combination of both
Genetic diversity: the different alleles in a population
Gene pool: all the alleles of all the genes in a population
Genetic variation is the basis of survival and evolution. It provides a range of phenotypes some better suited to the environment than others. Those best suited will
survive, reproduce and pass on alleles. Allele frequencies may change over time, as advantageous alleles become more prevalent in the gene pool
 Types of variation

Discontinuous/discrete

Continuous variation

Standard deviation shows the spread of the results around the mean value.

Standard deviation is a useful measurement when comparing variation in a population

because unlike range and mean, it is not affected by a single outlier. Furthermore, the
standard deviation can be used in statistical analysis to look for significant differences.

From a sample of data

68% of the data values will lie 1Standard Deviation either side of the mean

99% of the data values will lie within 2 standard deviations of the mean
 Two scientists propose two methods for
measuring the rate of a chemical reaction. They
both get an average rate of 44, and so we may
assume that both methods are adequate.
However, when we look more closely at the
data and do some mathematical analysis we
can see that this assumption is incorrect, as
method B generates results with a lot of
variation.

Both sets of data produce the same mean value of

44, so on the surface it may seem that both methods
are adequate for collecting data in this investigation.
However, when provided with the SD, we can see
that data set B has a large spread of results around
the mean
Hypotheses: south facing leaves are smaller than north facing leaves

Results:
Mean surface area of south facing leaves 50mm2
Mean surface area of north facing leaves 70mm2

On this basis you would probably accept that the hypothesis was correct.

However, what happens when we add in the SD, the spread of the results around the mean

Results ± standard deviation

South leaves =50mm2 ± 14

North leaves = 70mm2 ± 17

We can see there is an overlap in standard deviations

The maximum size of south leaves was 64mm2, and the minimum size of north leaves was 53
mm2, so sometimes south leaves are bigger than north leaves so the difference in length may not
be a significant difference all the time.
 Heritability is a measure of how much of the variation in a
population is due to genetic factors. Values for the heritability of a
feature range from 0 to 1. A value of 0 means that there is no
influence of genetic factors. A value of 1 means that the feature is
completely due to genetic factors. The Large Munsterlander and
Pudelpointer are two breeds of hunting dog. Table 1 shows the
mean heritability values and standard deviations for two features of
these two breeds of hunting dog.

If a dog breeder wishes to use selective breeding for one of these features, which one should he choose? Use information in Table 1 to explain your answer. [2 marks]

What do the standard deviations suggest about the differences in heritability values for searching between the two breeds of hunting dog? (2 marks)

Do these data support the conclusion that hypochlorite was the most effective at killing this
bacterium? Explain your answer. (3)
 (2)

The scientists measured the forced expiratory volume (FEV1 ) of each patient at regular intervals.
The forced expiratory volume (FEV1 ) is the volume of air forced out of the lungs in the first second
when breathing out. The scientists recorded each patient’s FEV 1 before treatment started and after
60 days of treatment. They then calculated the mean increase in FEV1 for each group. Their results
are shown in the graph. The bars show the standard deviation.

What do the standard deviation bars suggest about the difference in the mean increase in FEV 1
between Group 1 and the other groups? Explain your answer. (2)

What do the data suggest about the ‘placebo effect’ in this investigation? Explain your answer. (2)

On each occasion that a patient’s FEV1 was measured, a doctor repeated the measurement several
times. Explain why. (2)
 A Sri Lankan scientist investigated the effect of human
disturbance on the organisms living on a rocky
seashore. He chose three areas for the study. These
areas had different amounts of human disturbance.

The scientist measured human disturbance by walking

from one end of the beach to the other. He recorded the
number of people he encountered. Figure 1 shows his
What conclusions can you draw about the number of people visiting Site R compared with the number results.
of people visiting the other two sites? Give evidence from Figure 1 to support your answer. (2)

The crimson topaz and the fiery topaz are

hummingbirds.
Biologists investigated whether the crimson topaz and
the fiery topaz are different species of hummingbird,
or different forms of the same species.
They caught large numbers of each type of
hummingbird. For each bird they
• recorded its sex
• recorded its mass
• recorded the colour of its throat feathers
• took a sample of a blood protein.

The table shows some of their results.

Explain how the standard deviation helps in the interpretation of these data.(2)
In hummingbirds throat colour is important in courtship.
Explain the evidence in the table that shows that the
crimson topaz and the fiery topaz may be different
species of hummingbird. (2)