Metabolic Brain Disease

https://doi.org/10.1007/s11011-019-00508-y

ORIGINAL ARTICLE

Effect of cholestasis and NeuroAid treatment on the expression

of Bax, Bcl-2, Pgc-1α and Tfam genes involved in apoptosis
and mitochondrial biogenesis in the striatum of male rats
Mohammad Nasehi 1 & Sepehr Torabinejad 2 & Mehrdad Hashemi 2 & Salar Vaseghi 1 & Mohammad-Reza Zarrindast 3,4,5

Received: 17 April 2019 / Accepted: 16 October 2019

# Springer Science+Business Media, LLC, part of Springer Nature 2019

Abstract
Cholestasis means impaired bile synthesis or secretion. In fact, it is a bile flow reduction following Bile Duct
Ligation (BDL). Cholestasis has a main role in necrosis and apoptosis. Apoptosis is a form of programmed cell
death that has intrinsic and extrinsic pathways. The intrinsic pathway is mediated by Bcl-2 (B cell lymphoma-2)
proteins which integrate death and survival signals. Bcl-2 has anti-apoptotic and Bax has pro-apoptotic effects. Also,
striatum is one of the brain regions that has high expressions of Bcl-2 proteins. Moreover, Tfam and Pgc-1α are
involved in mitochondrial biogenesis. On the other hand, NeuroAid, is a drug that has neuroprotective and anti-
apoptosis effects. In this study, using quantitative PCR, we measured the expression of all these genes in the
striatum of male rats following BDL and NeuroAid administration. Results showed, BDL increased the expression
of Bax and Tfam and decreased the expression of Bcl-2. NeuroAid restored the effect of BDL on the expression of
Bax, while did not alter the effect of BDL on Bcl-2. In addition, it increased the expression of Tfam that was
previously elevated by BDL and raised the expression of Tfam in normal rats. Both BDL and NeuroAid, had no
effect on Pgc-1α. In conclusion, cholestasis increased the expression of Bax and decreased the expression of Bcl-2,
and this effect may have related to enhanced susceptibility of mitochondrial pathways following oxidative stress.
Tfam expression was increased following cholestasis and this effect may have related to cellular compensatory
mechanisms against high accumulation of free radicals or mitochondrial biogenesis failure. Furthermore, NeuroAid
may play a role against apoptosis and can be used to increase mitochondrial biogenesis.

Keywords Cholestasis . Bcl-2 . Bax . Tfam . Pgc-1α . NeuroAid

Introduction

Bile secretion is one of the most important functions of

* Mohammad Nasehi
the liver, which sometimes disturbed and leads to the liver
Nasehi@iricss.org disease (Ghonem et al. 2015). One of the main causes of
liver damages is Bile Duct Ligation (BDL) (Wang 2015).
1 BDL develops pathologic conditions following biliary
Cognitive and Neuroscience Research Center (CNRC), Tehran
Medical Sciences, Islamic Azad University, P.O. Box 13145-784, hepatic fibrosis, including increased necrosis and liver cell
Tehran, Iran apoptosis (Aktas et al. 2014). Also, it induces cholestasis
2
Department of Genetics, Tehran Medical Sciences, Islamic Azad (Wang 2015). Cholestasis is a bile flow reduction following
University, Tehran, Iran intrahepatic or extrahepatic bile duct obstruction or impair-
3
Department of Pharmacology School of Medicine, Tehran University ment of hepatocyte secretion (Lleo et al. 2017). It induces
of Medical Sciences, Tehran, Iran liver damage and fibrosis in Primary Biliary Cirrhosis (PBC)
4
Institute for Cognitive Science Studies (ICSS), Tehran, Iran and Primary Sclerosing Cholangitis (PSC) (Lleo et al.
5 2017). Also, cholestasis has an important role in hepatocyte
Department of Neuroendocrinology, Endocrinology and Metabolism
Research Institute, Tehran University of Medical Sciences, necrosis and apoptosis (Li and Apte 2015; Shipovskaya and
Tehran, Iran Dudanova 2018).

Apoptosis is a form of programmed cell death that occurs
in multicellular organisms and results in impaired cells remov-
al (Pistritto et al. 2016). It usually occurs through two path-
ways: the extrinsic pathway and the intrinsic pathway
(Pistritto et al. 2016). The extrinsic pathway is a death
receptor-dependent pathway triggered by the interaction be-
tween cell surface exposed death receptors, which belongs to
the superfamily of TNFR (Tumor Necrosis Factor Receptor)
and their respective protein TNF family ligands (Guicciardi
and Gores 2009). While, the intrinsic pathway is a
mitochondria-dependent pathway triggered by various stress
conditions such as toxins, impaired DNA and free radicals
(Green and Kroemer 2004). It should be noted that, these
two pathways are linked and molecules in one pathway can
influence the other (Igney and Krammer 2002). Also, apopto-
sis may occur through an additional pathway that involves T
cell mediated cytotoxicity and perforin-granzyme-dependent
killing of the cell (Elmore 2007). The perforin/granzyme path-
way can induce apoptosis via both granzyme B or granzyme
A. The extrinsic, intrinsic, and granzyme B pathways con-
verge on the same terminal, or execution pathway that is ini-
tiated by the cleavage of caspase-3 and leads to DNA frag-
mentation, cytoskeletal and nuclear proteins degradation and
apoptotic bodies formation. However, the granzyme A path-
way activates a parallel, caspase-independent cell death path-
way through single stranded DNA damage (Martinvalet et al.
2005).
The intrinsic pathway is regulated by the Bcl-2 (B cell
lymphoma-2) family of proteins, that integrates both death
and survival signals (Giam et al. 2008; Hockenbery et al.
1993). Bcl-2 proteins depending on the composition of typical
BH domains have been classified in one anti-apoptotic group
and two pro-apoptotic groups (Lomonosova and Chinnadurai
2008). The anti-apoptotic Bcl-2 proteins play an important
role in maintaining the integrity of the OMM (Outer
Mitochondrial Membrane) (Renault and Chipuk 2014). On
the other hand, pro-apoptotic Bcl-2 proteins by releasing mi-
tochondrial IMS (Inter-Membrane Space) proteins, activate
caspases (the cell death proteases) (Renault and Chipuk
2014). For example, Bcl-2 and Mcl-1 (myeloid cell leuke-
mia-1), are the members of anti-apoptotic Bcl-2 proteins
(Singh et al. 2015; Wang et al. 2018). While, Bax (BCL-2
Associated X protein), is one of the pro-apoptotic Bcl-2 pro-
teins inserts into the OMM and facilitates IMS protein releas-
ing, that in turn leads to activating caspases (Han and Cong
2017). Two other genes we have studied about are Tfam and
Pgc-1α. Tfam (mitochondrial transcriptional factor A), is a
critical protein that regulates mitochondrial transcription initi-
ation by binding to mitochondrial DNA (mtDNA) (Campbell
et al. 2012). Also, mitochondrial biogenesis needs Tfam to
protect mtDNA from ROS (Reactive Oxygen Species)
(Theilen et al. 2017). In a related study, overexpressing
Tfam ameliorated mitochondrial disease by increasing
Metab Brain Dis
mtDNA copy number (Nishiyama et al. 2010). It’s important
to note that, reduced functional mtDNA abundance leads to
many different diseases including Parkinson’s disease and
Alzheimer’s disease (Coskun et al. 2012; Suomalainen and
Isohanni 2010). Moreover, Pgc-1α (Peroxisome proliferator-
activated receptor γ coactivator-1α) is known as a master
regulator of mitochondrial biogenesis. The aberrant regulation
of Pgc-1α is involved in many cancers (Wang et al. 2019). It
has a main role in the upregulation of antioxidant pathway
(Bouitbir et al. 2012). Also, as like as Tfam, plays an impor-
tant role in different neurological diseases including
Parkinson’s disease (Rasouri et al. 2007).
Parkinson’s disease (PD) induces various motor and cog-
nitive deficits by damage to the dopamine neurons in the stri-
atum and inducing apoptosis in the substantia nigra pars
compacta (Modo et al. 2017). Striatum, is one of the brain
regions that has high expressions of Bcl-2 proteins, especially
in its ventral region (Fudge and Haber 2002). Upregulating
Bcl-2 levels in the striatum of rodents is associated with the
increased gray matter (Moore et al. 2000). Also, the level of
pro-apoptotic proteins is increased in the striatal neurons of
postmortem Parkinson’s brain (Singh and Dikshit 2007). In
the striatum, especially in its dorsal region, genetic deletion of
Tfam induces various physiological processes in dopaminer-
gic neurons and reduces the release of dopamine (Good et al.
2011). Moreover, changes in the level of Bcl-2 expression and
Bax activity observed in the striatal dopaminergic neurons in
PD (Hartmann et al. 2002). It seems that factors that are in-
volved in apoptotic pathways and mitochondrial biogenesis
may have an important role in degenerating striatal neurons
(Nagatsu 2002). Many studies have reported the role of cho-
lestasis in brain damages (Li et al. 2019; Rivera-Mancia et al.
2009; Sheen et al. 2014). BDL-induced brain injury has been
used as a model of hepatic encephalopathy (Huang et al. 2010;
Javadi-Paydar et al. 2013). Cholestasis is related to enhanced
generation of ROS and increased oxidative stress (Ljubuncic
et al. 2000); this increased oxidative stress is a systemic phe-
nomenon that negatively affects all tissues and organs, includ-
ing the brain (Assimakopoulos et al. 2008; Huang et al. 2009).
It has been reported that intrahepatic cholestasis of pregnancy
(ICP) leads to central nervous system injury in fetuses (Li et al.
2019). Previous studies have demonstrated that in both devel-
oping and adult BDL rats, spatial memory deficits have been
observed (Huang et al. 2009; Javadi-Paydar et al. 2013). On
the other hand, cholestasis can influence the level of proteins
involved in apoptosis. For example, intrahepatic cholestasis of
pregnancy alters the expression of Bax and Bcl-2 (Wang et al.
2003). Bax level and apoptotic body index in cholestatic liver
are higher than normal condition (Karavias et al. 2003). Since
the striatum has high expressions of Bcl-2 proteins, we studied
about the striatal level of these proteins following cholestasis.
As we know, striatum is an important brain region that coor-
dinates multiple aspects of cognition, including both motor
Metab Brain Dis
and action planning, decision-making, motivation, reinforce-
ment and reward perception (Yager et al. 2015). Moreover, it
should be noted that, there are no many studies about the effect
of cholestasis on expression level of proteins involved in ap-
optosis in different brain regions, such as the striatum.
NeuroAid, a Traditional Chinese Medicine (TCM), has
shown anti-apoptotic and neuroprotection effects in several
studies (Tsai et al. 2015). In previous research, NeuroAid
prevented necrosis and apoptosis of neurons until three hours
after ischemia in rats (Quintard et al. 2011). Also, NeuroAid
has a critical role in preventing apoptosis and stimulating the
generation of new neural cells (Heurteaux et al. 2010).
According to the mentioned findings, the goal of this study
is to investigate the effect of cholestasis and NeuroAid treat-
ment on the expression of Bax, Bcl-2, Pgc-1α and Tfam genes
involved in apoptosis and mitochondrial biogenesis in the
striatum of male rats.
Material and method
Animals
In this research, male Wistar rats weighing 220-240 g collect-
ed from the Faculty of Pharmacology, University of Tehran.
All rats were transferred to the lab and were placed in
Plexiglas cages. During the experiments, rats received enough
water and food, and the cages were cleaned every three days.
The temperature in the lab was 22 ± 3 °C. For one week, rats
were allowed to adapt themselves to the environment. Each rat
was used only once, and four rats were placed in each group.
All tests were performed throughout the daylight. Our exper-
imental protocol was approved by the Research and Ethics
Committee of the School of Advanced Technologies in
Medicine, Tehran University of Medical Sciences and were
done in accordance with the National Institutes of Health
Guide for the Care and Use of Laboratory Animals (NIH
publications No. 80–23).
Experimental groups
Rats were divided into four groups: control group,
sham-NeuroAid group, BDL group and BDL-NeuroAid
group. Rats in the control group were treated with nor-
mal food and water. By placing rats in the sham-
NeuroAid group the effect of surgery-induced stress
with NeuroAid intake was investigated. In the BDL
group, BDL was created in all rats by bile duct obstruc-
tion. None of rats in this group received NeuroAid. But
rats in the BDL-NeuroAid group, in addition to bile
duct obstruction, received NeuroAid administration.
BDL surgery
Rats were anesthetized by intraperitoneal injection of keta-
mine hydrochloride 10% (50 mg/kg) and xylazine 2%
(50 mg/kg). After anesthesia, the abdominal surface of rat
was split and then, by using non-absorbent suture, two nodes
were biped together at two points in the bile duct. The gap
between the two nodes was cut by a scissor to ensure the
accuracy of bile duct destruction. In order to restore the he-
mostasis of each rat and compensate for the loss of blood,
100 units of insulin were injected intraperitoneal. Then, each
rat was individually placed in a Plexiglas cage to reach full
level of consciousness (Reza Zarrindast et al. 2013).
Additionally, the operative mortality was less than 5%.
NeuroAid administration
NeuroAid was injected intraperitoneal at the dose of
0.4 mg/ml, 1 ml/kg into each rat (Nasehi et al. 2019; Tsai
et al. 2015). In our recent research, NeuroAid at the dose of
0.4 mg/kg increased the expression of BAX, BAD, and BCL-
XL in sleep-deprived rats (Nasehi et al. 2019). All injections
began on the day after surgery and continued every other day
until the 28th day after surgery (14 injections). In fact, we set
28 days to inject NeuroAid to evaluate both neuroprotective
effect of this drug and alterations in the expression of genes,
during long-term cholestasis. For example, previous study has
reported that the expression of anti-inflammatory IL-10
(Interleukin-10) is markedly up-regulated at 12 days after cho-
lestasis, but not at 28 days after that (Tormos et al. 2013).
Also, the result of another study showed that administration
of N(G)-nitro-L-arginine methyl ester (L-NAME), a nonselec-
tive nitric oxide synthase (NOS) inhibitor, did not affect the
beneficial effect of naltrexone on cholestasis-induced memory
impairment on the day 21 in male rats, while reversed this
effect on the day 28 (Javadi-Paydar et al. 2013).
Extracting the striatum
One day after the last injection, rats were anesthetized by
chloroform and their heads were separated by guillotine. A
scissor given a longitudinal cut from the scalp. The skull
was cut from the spinal cord to remove the whole brain. To
extract the striatum, the shear in the first groove was applied to
the frontal lobe. Then another cut from the side of the second
groove was given. After this cut, the external cortex of the
brain, the myelinated parts, and the nucleus accumbens were
removed by the surgical blade to extract the striatum.
Total RNA isolation and cDNA synthesis
Total RNA was isolated from rats’ striatum by using Trizol
(Qiagen, Germany) and the relevant protocol. Then, the
 Metab Brain Dis

optical density (A 260/280 and A 260/230) and the concen-
tration of extracted RNA were measured by nanophotometer
device (BioTeck, USA). Extracted RNAs were used to syn-
thesis of single strand cDNA by the cDNA synthesis kit
(SinaClon, Iran) and its protocol. The amount of RNA input
to the kit was 1500 ng and the concentration of cDNA was
equal to 75 ng/μl.
Oligonucleotide set design
In this study, Bcl-2, Bax, Tfam and Pgc-1α selected as targets
and GAPDH (Glyceraldehyde-3-phosphate dehydrogenase)
selected as internal reference gene. The sequences of these
genes obtained from NCBI database and primer sets designed
by GeneRunner software and analyzed in Basic Local
Alignment Search Tool to avoid secondary structure and ho-
mology with other genome region.
of the primers individually. At the end, the standard curve for
each primer, based on the obtained values of Ct in contrast to
the used dilutions, was drawn. Using the obtained curve line
gradient and this relation “E = 10 (-1/slope) – 1” (E: reaction
efficiency, slope: curve line gradient), reaction efficiency for
each primer were measured.
Statistical analysis
All analyses were performed by Statistical Package for the
Social Sciences software (SPSS Inc. v. 22). The statistical
operations included mean ratio (M), Standard Deviation
(SD), Determination coefficient (R2), Confidence Intervals
(95% CI) and Standard Error of Mean (SEM). To evaluate
differences between gene expression of groups, two sample
t-test was used. P˂0.05 considered as statistically significant.

Real time PCR

The cDNAs were diluted 1 to 5 with distilled water. Therefore,
the final cDNA concentration for the PCR reaction was 15 ng/
μl. Then, all the primers were diluted to a concentration of
0.2 pmol/μl. At the end, the Master Mix (RealQ Plus 2x
Master Mix Green, AMPLIQON, Denmark), cDNA and
primers in the 96 wells of Applied Biosystems (USA
StepOnePlus Real Time PCR) are added, and at this stage,
done according to the protocol of Master Mix (Table 1).
Plate design was carried out using two repetitions of each
sample to increase accuracy. Primary denaturation carried
out at 95 °C for 15 min and 40 cycles, including denaturation
at 95 °C for 15 s and the annealing phase at 64 °C for 60 s.
Relative gene expression levels were calculated by Pfaffl
method. For drawing standard curves proliferation, at first
the cDNAs of the control group mixed together and dilutions
of 0.6, 3, 15 and 75 ng/μl were prepared. Then, the Real Time
PCR reaction was repeated twice, for each dilution with each
Results
Expression of Bcl-2 and Bax, genes involved
in apoptosis
Two sample t-test analysis showed that, Bcl-2 expression in
the BDL group was significantly lower than in the control
group (P < 0.5), which indicates BDL decreased the expres-
sion of Bcl-2. NeuroAid administration did not change the
expression of Bcl-2 gene, because there was no statistical
difference between the BDL and BDL-NeuroAid groups,
and the sham-NeuroAid group compared to control group.
Despite Bcl-2, the expression of Bax increased following
BDL, and consequently there was a significant difference be-
tween the BDL and control group (P < 0.001). However, ad-
ministration of NeuroAid restored the expression of Bax (P <
0.001). Therefore, compared to BDL group, the expression of
Bax was lower in BDL-NeuroAid group. There was no

Table 1 Characteristics of the primers used in the Real-time PCR assay. F: forward primer, R: reverse primer

Genes Primers Length (nucleotides) Products Length (nucleotides) Primer Sequences 5′— > 3’ Melting Points

Gapdh F: 22 121 F: AAGTTCAACGGCACAGTCAAGG F: 61.58

R: 22 R: CATACTCAGCACCAGCATCACC R: 61.32
Bax F: 21 135 F: CAGGACGCATCCACCAAGAAG F: 61.28
R: 21 R: TGCCACACGGAAGAAGACCTC R: 62.31
BcI-2 F: 24 134 F: ATCGCTCTGTGGATGACTGAGTAC F: 61.99
R: 24 R: AGAGACAGCCAGGAGAAATCAAAC R: 60.81
Pgc-1 α F: 21 149 F: CCCGCGAACATATTCGAGAAG F: 59.21
R: 20 R: TCGTTGTCAGTGGTCACGTC R: 60.25
Tfam F: 24 128 F: AGAAAGCACAAATCAAGAGGAGAG F: 59.00
R: 24 R: CAATTTCCCTTGAGGTGACTCATC R: 59.60
Metab Brain Dis
significant difference in the Bax expression between sham-
NeuroAid and control groups (Figs. 1 and 2).
Expression of Tfam and Pgc-1α, genes involved
in mitochondrial biogenesis
Two sample t-test analysis showed that, the expression of Tfam
in the BDL group was more than in the control group (P <
0.001). In addition, administration of NeuroAid increased it, in
such a way that the expression of Tfam in BDL-NeuroAid group
was even more than in BDL group (P < 0.001). NeuroAid even
increased the expression of Tfam in sham-NeuroAid group
compared to control group (P < 0.001). Expression of Pgc-1α
did not change in all groups (Figs. 3 and 4).
Discussion
The goal of this study was to discover the effect of cholestasis
and NeuroAid treatment on the expression level of Bax, Bcl-2,
Pgc-1α and Tfam genes involved in apoptosis and mitochon-
drial biogenesis in the striatum of male rats. As we mentioned,
cholestasis can induce brain injuries and cognitive dysfunc-
tions (Rivera-Mancia et al. 2009; Sheen et al. 2014). A corre-
lation between cholestasis and oxidative stress in the rats’
brain has been reported (Chroni et al. 2006). Cholestasis by
the increase in ROS accumulation leads to the oxidative stress,
that in turn, induces brain damage (Assimakopoulos et al.
2008; Huang et al. 2009; Ljubuncic et al. 2000). Also, BDL
in adult and developing rats impairs spatial memory perfor-
mance (Huang et al. 2009; Javadi-Paydar et al. 2013).
Moreover, it has been revealed that cognitive functions in
the eight arm maze and the T-maze tests, and locomotor func-
tion in the open field test are impaired following BDL in mice
Fig. 1 The relative expression of Bax gene in different groups. (The
relative gene expression of the control group is 1). *P < 0.5, **P < 0.01
and ***P < 0.001 different from the control group and #P < 0.5, ##P <
0.01 and ###P < 0.001 different from the BDL group (n = 4, in each
group)
Fig. 2 The relative expression of Bcl-2 gene in different groups. (The
relative gene expression of the control group is 1). *P < 0.5, **P < 0.01
and ***P < 0.001 different from the control group and #P < 0.5, ##P <
0.01 and ###P < 0.001 different from the BDL group (n = 4, in each
group)
(Magen et al. 2009). On the other hand, striatum is a critical
brain region that involved in coordinating multiple aspects of
cognition, including motor and action planning, decision-
making, motivation and reward perception (Yager et al.
2015). Striatum is also involved in learning and memory per-
formance; while, it may have metabolic requirements and re-
sponses to experiences that differ from those in other brain
regions, such as the hippocampus (Newman et al. 2017). It’s
important to note that, striatum has high expressions of Bcl-2
proteins (Fudge and Haber 2002). In the striatum, especially in
its dorsal region, genetic deletion of Tfam leads to various
physiological processes in dopaminergic neurons and attenu-
ates the release of dopamine (Good et al. 2011). As it was
mentioned, changes in the level of Bcl-2 expression and Bax
activity observed in the striatal dopaminergic neurons in PD
(Hartmann et al. 2002). Also, there are no many studies about
the effect of cholestasis on the induction of apoptosis in brain
regions, especially in the striatum. Therefore, since the chole-
stasis can influence the level of pro-apoptotic proteins, we
Fig. 3 The relative expression of Pgc-1α gene in different groups. (The
relative gene expression of the control group is 1). *P < 0.5, **P < 0.01
and ***P < 0.001 different from the control group and #P < 0.5, ##P <
0.01 and ###P < 0.001 different from the BDL group (n = 4, in each
group)

Fig. 4 The relative expression of Tfam gene in different groups. (The
relative gene expression of the control group is 1). *P < 0.5, **P < 0.01
and ***P < 0.001 different from the control group and #P < 0.5, ##P <
0.01 and ###P < 0.001 different from the BDL group (n = 4, in each
group)
studied about the role of cholestasis in the induction of apo-
ptosis in the striatum.
Decrease in Bcl-2 and increase in Bax expression
in the striatum following cholestasis
As the results showed, the expression of Bcl-2 and Bax in-
creased following cholestasis. BDL (Bile Duct Ligation) has
been carried out as an experimental procedure for decades
(Tag et al. 2015). Also, BDL is one of the main causes of liver
damages and cholestasis (Wang 2015). Cholestasis damages
sinusoidal endothelial cells and impairs hepatic microcircula-
tion (Kloek et al. 2012). It has been revealed that bile acids
accumulation in liver leads to apoptosis (Li et al. 2011).
Furthermore, cholestasis plays a critical role in hepatocyte
necrosis and apoptosis (Shipovskaya and Dudanova 2018).
As we mentioned before, Bcl-2 family proteins have impor-
tant roles in mediating apoptosis (Giam et al. 2008;
Lomonosova and Chinnadurai 2008). Bcl-2 is one of the
anti-apoptotic proteins and Bax is one of the pro-apoptotic
proteins (Cong et al. 2016; Jagani et al. 2016). It has been
revealed that Bcl-2, may act as an antioxidant, and may also
prevent releasing mitochondria activators of caspases which
mediate apoptosis (Hetz 2010). Since the apoptosis occurs
following cholestasis, we measured the alteration of Bcl-2
and Bax expression rates as genes involved in apoptosis fol-
lowing cholestasis. The results of the current study showed
that, the expression of Bcl-2 decreased and the expression of
Bax increased following cholestasis. Consistent with our
study, changes in Bcl-2 and Bax expressions following BDL
have been observed in other studies. In previous research,
apoptosis occurred in the rat placenta by changes of the Bcl-
2 and Bax expressions expression following maternal obstruc-
tive cholestasis during pregnancy (OCP) (Perez et al. 2006). It
should be noted that enhanced apoptosis in the OCP placentas
Metab Brain Dis
was related to the activation of mitochondrial pathway
through enhanced susceptibility of this pathway by increased
Bax/Bcl-2 mRNA ratio (Perez et al. 2006). In other research,
cytoplasmic Bax translocated to the mitochondria at an early
stage following BDL and induced apoptosis by releasing Cyt c
(Cytochrome c) into the cytoplasm (Oh et al. 2003). In addi-
tion, P53 (gene that has a role in regulating cell cycle) accu-
mulates in the nucleus in acute BDL and its overexpression
increases Bax expression in various cells and induces apopto-
sis (Xiang et al. 1998). Notably, P53 besides inducing Bax
transcription, can directly repress Bcl-2 gene expression
(Hemann and Lowe 2006). Moreover, previous studies have
reported that cells undergoing apoptosis succumb to oxidative
stress (Schafer et al. 2009). Furthermore, oxidative stress is
induced by a wide array of death stimuli such as apoptotic
signals (Wang et al. 2017).
The increasing effect of cholestasis on the expression of
Bax and its decreasing effect on the expression of Bcl-2,
which was observed in this study, may have related to en-
hanced susceptibility of mitochondrial pathway. It is probable
that these changes are due to overexpression of P53 following
acute BDL that causes subsequent apoptosis. It should be
noted that, as a result of BDL, the Bax expression was in-
creased, while the Bcl-2 expression was reversely decreased.
Therefore, the results indicated that Bax/Bcl-2 ratio was in-
creased due to BDL. Interestingly, NeuroAid decreased the
Bax expression, while had no effect on the Bcl-2 gene.
Thus, it decreased the Bax/Bcl-2 ratio.
Increase in Tfam (not Pgc-1α) expression
in the striatum following cholestasis
As the results showed, the expression of Tfam increased fol-
lowing cholestasis, while the expression of Pgc-1α did not
change. Tfam and Pgc-1α are involved in mitochondrial bio-
genesis. Tfam is a nuclear gene binds to the sequence pro-
moters within the mitochondria (Parisi and Clayton 1991). It
plays multiple roles in mtDNA maintenance and stabilization
(Kang et al. 2007). It has been revealed that Tfam is a calcium
regulator and mediates ROS production (Kunkel et al. 2018).
Tfam is also critical for mitochondrial biogenesis to protect
mtDNA from oxidative stress (Theilen et al. 2017). On the
other hand, Pgc-1α is a master regulator of mitochondrial
biogenesis (Wang et al. 2019). It modulates energy homeosta-
sis, adaptive thermogenesis and glucose metabolism
(Puigserver and Spiegelman 2003). Also, it has an important
role in oxidative stress, too (Peng et al. 2017). Previous studies
proved that Pgc-1α regulates Tfam activity in response to
various stress conditions including oxidative stress and oxida-
tive liver injury (Nisoli et al. 2004; Tiao et al. 2011; Wu et al.
1999). Moreover, free radicals and oxidative stress have a role
in the pathogenesis of cholestatic liver injury (Parola et al.
1996; Sokol et al. 1993). In addition, cholestasis deranges
Metab Brain Dis
oxidative repair enzymes, which convert free radicals into less
toxic or non-toxic forms (Lee and Wei 2005). Thus, the ex-
pression of Tfam and Pgc-1α may have been changed follow-
ing cholestasis-induced apoptosis and oxidative stress, with
this important explanation that Tfam activity is regulated by
Pgc-1α. In this study, Tfam expression was increased follow-
ing cholestasis. A related study showed that, Tfam deficiency
following cholestasis induces hepatocerebral mtDNA deple-
tion syndrome (Stiles et al. 2016). In other research in rats,
decreased Tfam protein levels following BDL, induced sig-
nificant reduction in mtDNA copy number (Tiao et al. 2009).
On the contrary, previous study reported an increase in the
expression of Tfam, two weeks after BDL. However, it also
reported a decrease in the expression of Tfam, four weeks after
BDL. (Arduini et al. 2011). These findings reveal that short-
term cholestasis can increase the level of this expression.
Nevertheless, there is an exactly opposite impact due to
long-term cholestasis. On the other hand, in our study, the
expression of Pgc-1α did not change following cholestasis.
In previous study, Pgc-1α level was downregulated following
prolonged chronic cholestasis, because of reduced mitochon-
drial biogenesis and mitochondrial oxidative stress (Serviddio
et al. 2004). It seems that following mitochondrial biogenesis
impairment induced by expression changes of Tfam (Tiao
et al. 2009), the level of Pgc-1α reduced, as well (de
Andrade et al. 2015). On the contrary, in some conditions,
Pgc-1α level is increased by mitochondrial dysfunction as a
compensatory mechanism (Tiao et al. 2009). In addition, the
expression of Pgc-1α is highly persuadable by the tissue en-
ergy demands (Puigserver and Spiegelman 2003). Oxidative
stress impairs normal function of the cells, and cells need more
energy for maintaining their correct function (Balaban 2009;
Kohlhaas et al. 2010). Furthermore, stimulating ROS that
leads to oxidative stress is involved in upregulating glycolytic
activity, which needs more energy (Shi et al. 2009).
Thus, we suggest that, increased Tfam level following cho-
lestasis may have related to cellular compensatory mecha-
nisms against the high rate of oxidative stress. Tfam is critical
for mitochondrial biogenesis to protect mtDNA from ROS
and has protective effects in mitochondria following oxidative
stress. It has been suggested that, if ROS levels rise, cells may
raise the level of Tfam to prevent impairment of the mitochon-
dria (in short-term cholestasis), but when cholestasis lasts lon-
ger, ROS levels rise more, and consequently the function of
Tfam may be suppressed and even the regulatory effect of
Pgc-1α on Tfam will not be enough to maintain the high
expression of Tfam. Hence, in the current study, if the exper-
iment had lasted for more weeks following BDL, the expres-
sion of Tfam would have been suppressed and downregulated.
However, this study showed that cells can protect their mito-
chondria by raising the level of Tfam expression even for four
weeks. On the other hand, although in many studies Pgc-1α
decreased following BDL, in some researches it increased.
This inconsistent effect may have related to the role of oxida-
tive stress. In some oxidative stress conditions depending on
its limit, Pgc-1α level is not decreased following BDL. In fact,
it may have increased and reach to its rate in normal condition
for preventing high destructive effects of free radicals. As we
know, Pgc-1α has an antioxidant effect through controlling
the expression of antioxidant enzymes. Thus, in this study,
the possible decrease in Pgc-1α level may have disappeared
by its antioxidant activity. Also, in some mitochondrial dys-
function conditions, Pgc-1α may have increased by cells as a
compensatory mechanism. This compensatory mechanism
that is induced to cope with the oxidative stress destructive
effects, may lead to the increase in Pgc-1α to its normal rate.
Moreover, Pgc-1α has a critical role in providing fuel homeo-
stasis and glucose uptake in conditions that have need high
energy, such as oxidative stress. Since Pgc-1α mediates glu-
cose uptake and provides fuel for cell homeostasis, needing
more energy of striatal neurons in the oxidative stress may
increase the rate of Pgc-1α expression to its normal rate.
The effects of NeuroAid on the expression of Bax,
Bcl-2, Pgc-1α and Tfam
As the results showed, NeuroAid restored the effect of chole-
stasis on the expression of Bax. It raised the expression of
Tfam in the sham-NeuroAid group compared to the control
group, and in the BDL-NeuroAid group compared with both
BDL and the control groups. However, it could not have any
effects on the expression of Bcl-2 and Pgc-1α. NeuroAid is a
Chinese drug used in stroke recovery that consisted of 9 herbs
and 5 animal components (Han et al. 2017). It enhances the
endogenous repair processing by its neurorestorative and
neuroproliferative effects (Suwanwela et al. 2018). Previous
studies have proved that NeuroAid prevents death of threat-
ened neuronal tissues (Heurteaux et al. 2010; Quintard et al.
2011). The anti-apoptotic effect of NeuroAid has been re-
vealed, as well (Tsai et al. 2015). In addition, NeuroAid acts
as an antioxidant (Quintard et al. 2011). Previous report de-
clared that hippocampal oxidative stress caused by free radi-
cals following global ischemia was decreased by NeuroAid
treatment (Friberg et al. 2002). Also, NeuroAid decreases the
activity of apoptotic pathways by reducing Bax activity in the
CA1 pyramidal neurons (Quintard et al. 2011).
Thus, the decrease in Bax expression following NeuroAid
administration in BDL rats is associated with repressive effect
of NeuroAid on apoptosis pathways. This reduction may have
related to oxidative stress alleviation induced by neuroprotec-
tive and neurorestorative effects of NeuroAid. Moreover, re-
duced susceptibility of mitochondrial pathways following
NeuroAid administration may be another reason for the de-
crease in Bax. In regard to the increase in the expression Tfam
in groups with NeuroAid treatment (sham-NeuroAid and
BDL-NeuroAid), NeuroAid alters the expression of Tfam in

both BDL and normal rats. In addition, it reveals that
NeuroAid might be an effective drug to improve or enhance
the mitochondrial biogenesis. Regarding two other genes, Bcl-
2 and Pgc-1α, there is no research that shows NeuroAid can
change the level of these gene expressions. In current study, it
was not observed any effects on these genes, either.
Eventually, it should be declared that to confirm
cholestasis-induced apoptosis more accurately, it’s better to
apply TUNEL assay and investigate the level of different pro-
teins such as casepase-3 and PARP by Western Blotting (WB),
for example. The limitation of this study was the lack of ex-
periment equipment to assess the level of these proteins, es-
pecially WB. In our future studies, this point will be
considered.
Conclusion
In conclusion, BDL increased the expression of Bax and
Tfam, decreased the expression of Bcl-2, and had no effect
on Pgc-1α. NeuroAid restored the effect of BDL on the ex-
pression of Bax, and raised the expression of Tfam in both
BDL and normal rats. While, it had no effect on Bcl-2 and
Pgc1-α. The increase in Bax and the decrease in Bcl-2 expres-
sion following BDL may have related to enhanced suscepti-
bility of mitochondrial pathways following oxidative stress.
Also, the increase in Tfam may have related to the compen-
satory mechanism of cells against high accumulation of free
radicals or mitochondrial biogenesis failure. The restoration
effect of NeuroAid on Bax may have related to its repressive
effect on apoptosis pathways and oxidative stress. Finally,
NeuroAid has an increasing impact on Tfam expression in
BDL and normal rats. Hence, it can be used to achieve high
levels of Tfam transcription in the future to treat related
diseases.
Funding information There is no providing financial support to this
project.
Compliance with ethical standards The study was carried
out in accordance with ethical standards in all aspects.
Conflict of interest The authors declare that they have no conflict of
interest.
References
Aktas C, Kanter M, Erboga M, Mete R, Oran M (2014) Melatonin atten-
uates oxidative stress, liver damage and hepatocyte apoptosis after
bile-duct ligation in rats. Toxicol Ind Health 30:835–844. https://doi.
org/10.1177/0748233712464811
Arduini A et al (2011) Mitochondrial biogenesis fails in secondary biliary
cirrhosis in rats leading to mitochondrial DNA depletion and
Metab Brain Dis
deletions. Am J Physiol Gastrointest Liver Physiol 301:G119–
G127. https://doi.org/10.1152/ajpgi.00253.2010
Assimakopoulos SF et al (2008) Superoxide radical formation in diverse
organs of rats with experimentally induced obstructive jaundice.
Redox Rep 13:179–184. https://doi.org/10.1179/
135100008X308902
Balaban RS (2009) Domestication of the cardiac mitochondrion for en-
ergy conversion. J Mol Cell Cardiol 46:832–841. https://doi.org/10.
1016/j.yjmcc.2009.02.018
Bouitbir J et al (2012) Opposite effects of statins on mitochondria of
cardiac and skeletal muscles: a ‘mitohormesis’ mechanism involv-
ing reactive oxygen species and PGC-1. Eur Heart J 33:1397–1407.
https://doi.org/10.1093/eurheartj/ehr224
Campbell CT, Kolesar JE, Kaufman BA (2012) Mitochondrial transcrip-
tion factor A regulates mitochondrial transcription initiation, DNA
packaging, and genome copy number. Biochim Biophys Acta 1819:
921–929. https://doi.org/10.1016/j.bbagrm.2012.03.002
Chroni E, Patsoukis N, Karageorgos N, Konstantinou D, Georgiou C
(2006) Brain oxidative stress induced by obstructive jaundice in rats.
J Neuropathol Exp Neurol 65:193–198. https://doi.org/10.1097/01.
jnen.0000200152.98259.4e
Cong H, Du N, Yang Y, Song L, Zhang W, Tien P (2016) Enterovirus 71
2B induces cell apoptosis by directly inducing the conformational
activation of the proapoptotic protein Bax. J Virol 90:9862–9877.
https://doi.org/10.1128/JVI.01499-16
Coskun P, Wyrembak J, Schriner SE, Chen HW, Marciniack C, Laferla F,
Wallace DC (2012) A mitochondrial etiology of Alzheimer and
Parkinson disease. Biochim Biophys Acta 1820:553–564. https://
doi.org/10.1016/j.bbagen.2011.08.008
de Andrade DC, de Carvalho SN, Pinheiro D, Thole AA, Moura AS, de
Carvalho L, Cortez EA (2015) Bone marrow mononuclear cell
transplantation improves mitochondrial bioenergetics in the liver
of cholestatic rats. Exp Cell Res 336:15–22. https://doi.org/10.
1016/j.yexcr.2015.05.002
Elmore S (2007) Apoptosis: a review of programmed cell death. Toxicol
Pathol 35:495–516. https://doi.org/10.1080/01926230701320337
Friberg H, Wieloch T, Castilho RF (2002) Mitochondrial oxidative stress
after global brain ischemia in rats. Neurosci Lett 334:111–114
Fudge JL, Haber SN (2002) Defining the caudal ventral striatum in pri-
mates: cellular and histochemical features. J Neurosci 22:10078–
10082
Ghonem NS, Assis DN, Boyer JL (2015) Fibrates and cholestasis.
Hepatology 62:635–643. https://doi.org/10.1002/hep.27744
Giam M, Huang DC, Bouillet P (2008) BH3-only proteins and their roles
in programmed cell. Death Oncogene 27(Suppl 1):S128–S136.
https://doi.org/10.1038/onc.2009.50
Good CH et al (2011) Impaired nigrostriatal function precedes behavioral
deficits in a genetic mitochondrial model of Parkinson's disease.
FASEB J 25:1333–1344. https://doi.org/10.1096/fj.10-173625
Green DR, Kroemer G (2004) The pathophysiology of mitochondrial cell
death. Science 305:626–629. https://doi.org/10.1126/science.
1099320
Guicciardi ME, Gores GJ (2009) Life and death by death receptors.
FASEB J 23:1625–1637. https://doi.org/10.1096/fj.08-111005
Han SY, Hong ZY, Xie YH, Zhao Y, Xu X (2017) Therapeutic effect of
Chinese herbal medicines for post stroke recovery: a traditional and
network meta-analysis. Medicine (Baltimore) 96:e8830. https://doi.
org/10.1097/MD.0000000000008830
Han X, Cong H (2017) Enterovirus 71 induces apoptosis by directly
modulating the conformational activation of pro-apoptotic protein
Bax. J Gen Virol 98:422–434. https://doi.org/10.1099/jgv.0.000705
Hartmann A et al (2002) Increased expression and redistribution of the
antiapoptotic molecule Bcl-xL in Parkinson's disease. Neurobiol Dis
10:28–32
Hemann MT, Lowe SW (2006) The p53-BCL-2 connection. Cell Death
Differ 13:1256–1259. https://doi.org/10.1038/sj.cdd.4401962
Metab Brain Dis
Hetz C (2010) BCL-2 protein family. Essential regulators of cell death.
Preface Adv Exp Med Biol 687:vii–viii
Heurteaux C et al (2010) Neuroprotective and neuroproliferative activi-
ties of NeuroAid (MLC601, MLC901), a Chinese medicine, in vitro
and in vivo. Neuropharmacology 58:987–1001. https://doi.org/10.
1016/j.neuropharm.2010.01.001
Hockenbery DM, Oltvai ZN, Yin XM, Milliman CL, Korsmeyer SJ
(1993) BCL-2 functions in an antioxidant pathway to prevent apo-
ptosis. Cell 75:241–251
Huang LT, Tiao MM, Tain YL, Chen CC, Hsieh CS (2009) Melatonin
ameliorates bile duct ligation-induced systemic oxidative stress and
spatial memory deficits in developing rats. Pediatr Res 65:176–180.
https://doi.org/10.1203/PDR.0b013e31818d5bc7
Huang LT, Chen CC, Sheen JM, Chen YJ, Hsieh CS, Tain YL (2010) The
interaction between high ammonia diet and bile duct ligation in
developing rats: assessment by spatial memory and asymmetric
dimethylarginine. Int J Dev Neurosci 28:169–174. https://doi.org/
10.1016/j.ijdevneu.2009.11.006
Igney FH, Krammer PH (2002) Death and anti-death: tumour resistance
to apoptosis. Nat Rev Cancer 2:277–288. https://doi.org/10.1038/
nrc776
Jagani H, Kasinathan N, Meka SR, Josyula VR (2016) Antiapoptotic
BCL-2 protein as a potential target for cancer therapy: a mini review.
Artif Cells Nanomed Biotechnol 44:1212–1221. https://doi.org/10.
3109/21691401.2015.1019668
Javadi-Paydar M, Ghiassy B, Ebadian S, Rahimi N, Norouzi A, Dehpour
AR (2013) Nitric oxide mediates the beneficial effect of chronic
naltrexone on cholestasis-induced memory impairment in male rats.
Behav Pharmacol 24:195–206. https://doi.org/10.1097/FBP.
0b013e3283618a8c
Kang D, Kim SH, Hamasaki N (2007) Mitochondrial transcription factor
A (TFAM): roles in maintenance of mtDNA and cellular functions.
Mitochondrion 7:39–44. https://doi.org/10.1016/j.mito.2006.11.017
Karavias DD et al (2003) BCL-2 and BAX expression and cell prolifer-
ation, after partial hepatectomy with and without ischemia, on cho-
lestatic liver in rats: an experimental study. J Surg Res 110:399–408
Kloek JJ et al (2012) Cholestasis is associated with hepatic microvascular
dysfunction and aberrant energy metabolism before and during is-
chemia-reperfusion. Antioxid Redox Signal 17:1109–1123. https://
doi.org/10.1089/ars.2011.4291
Kohlhaas M et al (2010) Elevated cytosolic Na+ increases mitochondrial
formation of reactive oxygen species in failing cardiac myocytes.
Ci r c ul a t i on 1 2 1 : 1 6 06 – 1 6 13 . ht t p s : / / do i . o rg/ 1 0 . 11 6 1/
CIRCULATIONAHA.109.914911
Kunkel GH, Chaturvedi P, Thelian N, Nair R, Tyagi SC (2018)
Mechanisms of TFAM-mediated cardiomyocyte protection. Can J
Physiol Pharmacol 96:173–181. https://doi.org/10.1139/cjpp-2016-
0718
Lee HC, Wei YH (2005) Mitochondrial biogenesis and mitochondrial
DNA maintenance of mammalian cells under oxidative stress. Int J
Biochem Cell Biol 37:822–834. https://doi.org/10.1016/j.biocel.
2004.09.010
Li H et al (2019) Relations of neuropeptide Y and heme oxygenase-1
expressions with fetal brain injury in rats with intrahepatic cholesta-
sis of pregnancy. Acta Cir Bras 34:e201900401. https://doi.org/10.
1590/s0102-865020190040000001
Li R, Guo W, Fu Z, Ding G, Zou Y, Wang Z (2011) Hepatoprotective
action of Radix Paeoniae Rubra aqueous extract against CCl4-
induced hepatic damage. Molecules 16:8684–8694. https://doi.org/
10.3390/molecules16108684
Li T, Apte U (2015) Bile acid metabolism and signaling in cholestasis,
inflammation, and Cancer. Adv Pharmacol 74:263–302. https://doi.
org/10.1016/bs.apha.2015.04.003
Ljubuncic P, Tanne Z, Bomzon A (2000) Evidence of a systemic phe-
nomenon for oxidative stress in cholestatic liver disease. Gut 47:
710–716. https://doi.org/10.1136/gut.47.5.710
Lleo A, Marzorati S, Anaya JM, Gershwin ME (2017) Primary biliary
cholangitis: a comprehensive overview. Hepatol Int 11:485–499.
https://doi.org/10.1007/s12072-017-9830-1
Lomonosova E, Chinnadurai G (2008) BH3-only proteins in apoptosis
and beyond: an overview. Oncogene 27(Suppl 1):S2–S19 doi:
https://doi.org/10.1038/onc.2009.39
Magen I, Avraham Y, Ackerman Z, Vorobiev L, Mechoulam R, Berry EM
(2009) Cannabidiol ameliorates cognitive and motor impairments in
mice with bile duct ligation. J Hepatol 51:528–534. https://doi.org/
10.1016/j.jhep.2009.04.021
Martinvalet D, Zhu P, Lieberman J (2005) Granzyme a induces caspase-
independent mitochondrial damage, a required first step for apopto-
sis. Immunity 22:355–370. https://doi.org/10.1016/j.immuni.2005.
02.004
Modo M et al (2017) Magnetic resonance imaging and tensor-based
morphometry in the MPTP non-human primate model of
Parkinson's disease. PLoS One 12:e0180733. https://doi.org/10.
1371/journal.pone.0180733
Moore GJ, Bebchuk JM, Wilds IB, Chen G, Manji HK (2000) Lithium-
induced increase in human brain grey matter. Lancet 356:1241–
1242
Nagatsu T (2002) Parkinson's disease: changes in apoptosis-related fac-
tors suggesting possible gene therapy. J Neural Transm (Vienna)
109:731–745. https://doi.org/10.1007/s007020200061
Nasehi M, Mohammadi A, Ebrahimi-Ghiri M, Hashemi M, Zarrindast
MR (2019) MLC901 during sleep deprivation rescues fear memory
disruption in rats. Naunyn Schmiedeberg’s Arch Pharmacol 392:
813–821. https://doi.org/10.1007/s00210-018-01612-z
Newman LA, Scavuzzo CJ, Gold PE, Korol DL (2017) Training-induced
elevations in extracellular lactate in hippocampus and striatum: dis-
sociations by cognitive strategy and type of reward. Neurobiol Learn
Mem 137:142–153. https://doi.org/10.1016/j.nlm.2016.12.001
Nishiyama S et al (2010) Over-expression of Tfam improves the mito-
chondrial disease phenotypes in a mouse model system. Biochem
Biophys Res Commun 401:26–31. https://doi.org/10.1016/j.bbrc.
2010.08.143
Nisoli E, Clementi E, Moncada S, Carruba MO (2004) Mitochondrial
biogenesis as a cellular signaling framework. Biochem Pharmacol
67:1–15
Oh SH, Yun KJ, Nan JX, Sohn DH, Lee BH (2003) Changes in expres-
sion and immunolocalization of protein associated with toxic bile
salts-induced apoptosis in rat hepatocytes. Arch Toxicol 77:110–
115. https://doi.org/10.1007/s00204-002-0415-x
Parisi MA, Clayton DA (1991) Similarity of human mitochondrial tran-
scription factor 1 to high mobility group proteins. Science 252:965–
969
Parola M, Leonarduzzi G, Robino G, Albano E, Poli G, Dianzani MU
(1996) On the role of lipid peroxidation in the pathogenesis of liver
damage induced by long-standing cholestasis. Free Radic Biol Med
20:351–359
Peng K et al (2017) The interaction of mitochondrial biogenesis and
fission/fusion mediated by PGC-1alpha regulates rotenone-induced
dopaminergic neurotoxicity. Mol Neurobiol 54:3783–3797. https://
doi.org/10.1007/s12035-016-9944-9
Perez MJ, Macias RI, Marin JJ (2006) Maternal cholestasis induces pla-
cental oxidative stress and apoptosis. Prot Eff Ursodeoxycholic Acid
Placenta 27:34–41. https://doi.org/10.1016/j.placenta.2004.10.020
Pistritto G, Trisciuoglio D, Ceci C, Garufi A, D’Orazi G (2016)
Apoptosis as anticancer mechanism: function and dysfunction of
its modulators and targeted therapeutic strategies. Aging (Albany
NY) 8:603–619. https://doi.org/10.18632/aging.100934
Puigserver P, Spiegelman BM (2003) Peroxisome proliferator-activated
receptor-gamma coactivator 1 alpha (PGC-1 alpha): transcriptional
coactivator and metabolic regulator. Endocr Rev 24:78–90. https://
doi.org/10.1210/er.2002-0012

Quintard H et al (2011) MLC901, a traditional Chinese medicine protects
the brain against global ischemia. Neuropharmacology 61:622–631.
https://doi.org/10.1016/j.neuropharm.2011.05.003
Rasouri S, Lagouge M, Auwerx J (2007) SIRT1/PGC-1: a neuroprotec-
tive axis? Med Sci (Paris) 23:840–844. https://doi.org/10.1051/
medsci/20072310840
Renault TT, Chipuk JE (2014) Death upon a kiss: mitochondrial outer
membrane composition and organelle communication govern sensi-
tivity to BAK/BAX-dependent apoptosis. Chem Biol 21:114–123.
https://doi.org/10.1016/j.chembiol.2013.10.009
Reza Zarrindast M, Eslimi Esfahani D, Oryan S, Nasehi M, Torabi Nami
M (2013) Effects of dopamine receptor agonist and antagonists on
cholestasis-induced anxiolytic-like behaviors in rats. Eur J
Pharmacol 702:25–31. https://doi.org/10.1016/j.ejphar.2013.01.023
Rivera-Mancia S, Montes S, Mendez-Armenta M, Muriel P, Rios C
(2009) Morphological changes of rat astrocytes induced by liver
damage but not by manganese chloride exposure. Metab Brain Dis
24:243–255. https://doi.org/10.1007/s11011-009-9138-5
Schafer ZT et al (2009) Antioxidant and oncogene rescue of metabolic
defects caused by loss of matrix attachment. Nature 461:109–113.
https://doi.org/10.1038/nature08268
Serviddio G et al (2004) Ursodeoxycholic acid protects against secondary
biliary cirrhosis in rats by preventing mitochondrial oxidative stress.
Hepatology 39:711–720. https://doi.org/10.1002/hep.20101
Sheen JM, Chen YC, Tain YL, Huang LT (2014) Increased circulatory
asymmetric dimethylarginine and multiple organ failure: bile duct
ligation in rat as a model. Int J Mol Sci 15:3989–4006. https://doi.
org/10.3390/ijms15033989
Shi DY, Xie FZ, Zhai C, Stern JS, Liu Y, Liu SL (2009) The role of
cellular oxidative stress in regulating glycolysis energy metabolism
in hepatoma cells. Mol Cancer 8:32. https://doi.org/10.1186/1476-
4598-8-32
Shipovskaya AA, Dudanova OP (2018) Intrahepatic cholestasis in non-
alcoholic fatty liver disease. Ter Arkh 90:69–74. https://doi.org/10.
26442/terarkh201890269-74
Singh L et al (2015) Expression of pro-apoptotic Bax and anti-apoptotic
BCL-2 proteins in human retinoblastoma. Clin Exp Ophthalmol 43:
259–267. https://doi.org/10.1111/ceo.12397
Singh S, Dikshit M (2007) Apoptotic neuronal death in Parkinson’s dis-
ease: involvement of nitric oxide. Brain Res Rev 54:233–250.
https://doi.org/10.1016/j.brainresrev.2007.02.001
Sokol RJ, Devereaux M, Khandwala R, O'Brien K (1993) Evidence for
involvement of oxygen free radicals in bile acid toxicity to isolated
rat hepatocytes. Hepatology 17:869–881
Stiles AR et al (2016) Mutations in TFAM, encoding mitochondrial tran-
scription factor A, cause neonatal liver failure associated with
mtDNA depletion. Mol Genet Metab 119:91–99. https://doi.org/
10.1016/j.ymgme.2016.07.001
Suomalainen A, Isohanni P (2010) Mitochondrial DNA depletion
syndromes–many genes, common mechanisms. Neuromuscul
Disord 20:429–437. https://doi.org/10.1016/j.nmd.2010.03.017
Suwanwela NC et al (2018) Effect of combined treatment with MLC601
(NeuroAiDTM) and rehabilitation on post-stroke recovery: the
CHIMES and CHIMES-E studies. Cerebrovasc Dis 46:82–88.
https://doi.org/10.1159/000492625
Metab Brain Dis
Tag CG, Sauer-Lehnen S, Weiskirchen S, Borkham-Kamphorst E, Tolba
RH, Tacke F, Weiskirchen R (2015) Bile duct ligation in mice:
induction of inflammatory liver injury and fibrosis by obstructive
cholestasis. J Vis Exp. https://doi.org/10.3791/52438
Theilen NT, Kunkel GH, Tyagi SC (2017) The role of exercise and
TFAM in preventing skeletal muscle atrophy. J Cell Physiol 232:
2348–2358. https://doi.org/10.1002/jcp.25737
Tiao MM et al (2009) Early transcriptional deregulation of hepatic mito-
chondrial biogenesis and its consequent effects on murine cholestat-
ic liver injury. Apoptosis 14:890–899. https://doi.org/10.1007/
s10495-009-0357-3
Tiao MM et al (2011) Dexamethasone decreases cholestatic liver injury
via inhibition of intrinsic pathway with simultaneous enhancement
of mitochondrial biogenesis. Steroids 76:660–666. https://doi.org/
10.1016/j.steroids.2011.03.002
Tormos AM, Arduini A, Talens-Visconti R, del Barco BI, Nebreda AR,
Sastre J (2013) Liver-specific p38alpha deficiency causes reduced
cell growth and cytokinesis failure during chronic biliary cirrhosis in
mice. Hepatology 57:1950–1961. https://doi.org/10.1002/hep.
26174
Tsai MC, Chang CP, Peng SW, Jhuang KS, Fang YH, Lin MT, Tsao TC
(2015) Therapeutic efficacy of Neuro AiD (MLC 601), a traditional
Chinese medicine, in experimental traumatic brain injury. J
NeuroImmune Pharmacol 10:45–54. https://doi.org/10.1007/
s11481-014-9570-0
Wang DM, Zhu QY, Ding L, Ma D (2003) Relationship between p53, bax
and BCL-2 expression and cell apoptosis in intrahepatic cholestasis
of pregnancy. Zhonghua Fu Chan Ke Za Zhi 38:5–7
Wang GX et al (2017) DeltaNp63 inhibits oxidative stress-induced cell
death, including Ferroptosis, and cooperates with the BCL-2 family
to promote Clonogenic survival. Cell Rep 21:2926–2939. https://
doi.org/10.1016/j.celrep.2017.11.030
Wang K (2015) Molecular mechanisms of hepatic apoptosis regulated by
nuclear factors. Cell Signal 27:729–738. https://doi.org/10.1016/j.
cellsig.2014.11.038
Wang P et al (2019) PGC-1alpha/SNAI1 axis regulates tumor growth and
metastasis by targeting miR-128b in gastric cancer. J Cell Physiol.
https://doi.org/10.1002/jcp.28193
Wang T, Yang Z, Zhang Y, Zhang X, Wang L, Zhang S, Jia L (2018)
Caspase cleavage of Mcl-1 impairs its anti-apoptotic activity and
proteasomal degradation in non-small lung cancer cells. Apoptosis
23:54–64. https://doi.org/10.1007/s10495-017-1436-5
Wu Z et al (1999) Mechanisms controlling mitochondrial biogenesis and
respiration through the thermogenic coactivator PGC-1. Cell 98:
115–124. https://doi.org/10.1016/S0092-8674(00)80611-X
Xiang H, Kinoshita Y, Knudson CM, Korsmeyer SJ, Schwartzkroin PA,
Morrison RS (1998) Bax involvement in p53-mediated neuronal cell
death. J Neurosci 18:1363–1373
Yager LM, Garcia AF, Wunsch AM, Ferguson SM (2015) The ins and
outs of the striatum: role in drug addiction. Neuroscience 301:529–
541. https://doi.org/10.1016/j.neuroscience.2015.06.033
Publisher’s note Springer Nature remains neutral with regard to jurisdic-
tional claims in published maps and institutional affiliations.