Vol 4 Issue 8

E-ISSN: 0975-5241 (Online)
P-ISSN: 2231-2196 (Print)

Internationally Indexed,
Peer Reviewed, Multidisciplinary
Scientific Journal
ICV: 4.18
“Let the Science be your passion”
International Journal of Current Research and Review (IJCRR)
Vol 04 / Issue 8 / April 2012

Frequency: Fortnightly
Language: English
1 International Journal of Current Research and Review www.ijcrr.com

Vol. 04 issue 08 April 2012
I
J Editorial Board
C
Dr. Prof. Dato‘ Deputy Vice Chancellor, Research & Innovation
Proom Promwichit Division, Masterskill University College of
Health Sciences, Cheras, Malaysia
Dr. Nahla Salah Eldin Faculty, University of Alexandria, Alexandria,
Barakat Egypt
Dr. Ann Magoufis Director, Ariston College, Shannon, Ireland
Dr. Pongsak Faculty, Ubon Ratchathani University, Warin
R
Rattanachaikunsopon Chamrap, Ubon Ratchathani, Thailand
Dr. Chellappan Dean, School of Pharmacy, Masterskill
Dinesh University College of Health Sciences, Cheras,
Malaysia
Dr. R. O. Ganjiwale HOD, Department of Pharmacognosy, I.P.E.R.
Wardha, Maharashtra
Dr. Shailesh Wader HOD, Department of Pharmaceutical Chemistry,
R Dr. Alabi Olufemi

Mobolaji
Dr. Joshua Danso
Owusu-Sekyere
Dr. Okorie
IPER, Wardha, MH, India
Faculty, Bowen University, Iwo, Osun-State,
Nigeria
Faculty, University of Cape Coast, Cape Coast,
Ghana
Faculty, University of Nigeria Nsukka, Enugu
ISSN 0975-5241
Ndidiamaka Hannah State
IC Value of Journal: 4.18 Dr. Parichat Faculty, Ubon Ratchathani University, Warin
Phumkhachorn Chamrap, Ubon Ratchathani, Thailand
“Let the science be your passion” Dr. Manoj Charde Dean, NRI Group of Post Graduate Studies,
Bhopal
Dr. Shah Murad HOD, Pharmacology and Therapeutics, Lahore
Mastoi Medical and Dental College, Lahore, Pakistan
Vol 4 / Issue 8 / April 2012

I
J About International Journal of Current Research and Review (ijcrr)
International Journal of Current Research and Review (ijcrr) is one of the popular
C
monthly international interdisciplinary science journals. ijcrr is a peer reviewed
indexed journal which is available online and in print format as well. References
ehave shown that within short span of time, citations for ijcrr are increasing with
noticeable pace. ijcrr indexing agencies are in the process of calculating current
impact factor for the journal.
Indexed in: Copernicus, Revistas Médicas Portuguesas, BOAI, DOAJ, Google

Scholar, Ulrich, Open-J-Gate, NEWJOUR, ResearchGATE
R Aims and Scope:

ijcrr is a monthly indexed international journal publishing the finest peer-reviewed
research and review articles in all fields of Medical and Paramedical
sciences. ijcrr follows stringent guidelines to select the manuscripts on the basis of
its originality, importance, timeliness, accessibility, grace and astonishing
conclusions. ijcrr is also popular for rapid publication of accepted manuscripts.
Mission Statement:
R
To set a landmark by encouraging and awarding publication of quality research and
review in all streams of Medical and Paramedical sciences.
About the editors:

ijcrr management team is very particular in selecting its editorial board members.
Editorial board members are selected on the basis of expertise, experience and their
contribution in the field of Science. Editors are selected from different countries and
“Let the science be your passion” every year editorial team is updated. All editorial decisions are made by a team of
full-time journal management professionals.
ijcrr Award for Best Article:

ijcrr editorial team monthly selects one ‗Best Article‘ for award among published
Vol
Vol42/ /Issue
Issue812
/ April
/ Dec2012
2010 articles.
Administrative Office: IJCRR Administrative Office, 148, IMSR Building, Near

NIT Complex, Ayurvedic Layout, Umrer Road, Sakkardara, Nagpur, Nagpur-24,
editor@ijcrr.com, www.ijcrr.com

I S.
N.
Title
Index
Authors Page
No.
1 A Study on Co Relation between Abhishek Sharma,
J
Straight Leg Angle and Functional Urvi Bhavsar 6
Disability in Low Back Pain
2 Use of Antimicrobial Prophylaxis in Apurva Agrawal,
Surgical and Medical Intensive Care Barna Ganguly 10
Units – A Comparative Study
3 Scenario of Biomedical Waste Rumisa Nazir, G. A.
Management in the Major Hospitals of Bhat 16
C
Srinagar City
4 Patients‘ Perception on Hospital D. Karthikeyan, M.
Services with Special Reference to Thurunarayanasamy 23
Behavior of Doctors in Villupuram
District
5 Dna Barcoding, Phylogenetic Diversity Sachithanandam V.,
Studies of Etroplus Suratensis Fish from Mohan P.M., 33
Pooranankuppam Brackish Water, Muruganandam N.,
R
Puducherry Chaaithanya I.K.,
Arun Kumar P, Siva
Sankar R
6 Is Skeletal Muscle ‗A Target τrgan‘ in Prathamesh Haridas
Long Term Uncontrolled Diabetes Kamble, Sunil 43
Mellitus? A Comparative and Bhamre
Correlative study of Type I and Type II
Diabetes
R
7 In-Silico Studies on P43 Protein from Tarun Kumar Bhatt
Plasmodium Falciparum 49
8 Comparative Microbiologic Analysis of Mythireyi D, M G
Subgingival Plaque Samples in Type II Krishnababa, 55
Diabetic and Non – Diabetic Patients with Kalaivani
Chronic Periodontitis by Polymerase Chain
Reaction
“Let the science be your passion” 9 Experimental Behaviour of a Pyramid S.Kalaivani,
Type Solar Still Coupled and Decoupled S.Rugmini 63
to an Electrical Temperature Controller Radhakrishnan,
B.Selvakumar,
Vol 4 / Issue 8 / April 2012 M.Indhumathy
10 Geomagnetic Storms Associated with P.L. Verma
IV-Radio Bursts and their Relation with 77
Solar and Interplanetary Parameters

I S. Title
Index
Authors Page
N. No.
11 Phytochemicals Analysis of Colecus Iffat Khan, Kirti Jain
J 12
13
Arometicus Benth
Toxicological Evaluation of Aqueous
Leaf Extract of Senna Alata in Pregnant
Wistar Rats
A Comparative Study to assess the
Changes in the Conduction of Median
Yakubu M. T.,
Adeshina A. O.,
Ibrahim, O. O. K.
Dhaval Desai, Chintan
Shah, Harshit Soni2,
85
89
110
Nerve at Wrist Joint in apparently Hasmukh Patel1,
C
asymptomatic computer users with that Komal Soni
in general population
14 Design of a Compact CPW Fed H. M. Ramesh, K.
Hexagon Shaped Slot Antenna for Wi- Balaji, D.Ujwala, 119
Max Application B.Harish, Ch. Vijay
Sekhar Babu, K.Naga
Mallik
15 Bioequivalence and Highly Variable Vikram Lohar, Harsh
R
Drugs: An Overview Patel, Arvind Singh 124
Rathore, Sandeep
Singhal, Ashish
Kumar Sharma, Parul
Sharma
16 An Economic Analysis of Crop V. Kalaiselvi
Diversification in Tamil nadu 147
R
17 Oil-Water Separation using Fly Ash Chintan Pathak, V. K.
Zeolite Treatment Srivastava 155
18 Wireless Technology in Service of P.P.Patil, Abhijit
Society- A Case Study Of Snakebite A.Patil, B T Jadhav 168
19 Production and Optimization of Single T. Murugan, D.
Cell Oil by Oleaginous Bacteria Isolated Saravanan, 175
“Let the science be your passion” from Oil Contaminated Environments R.Balagurunathan
20 Study of the Reasons of the Mohammad Javad
Radiographic Images Repetition in Keikhai Farzaneh, 185
Sistan and Baluchestan‘s Treatment Reza Afzalipour,
Vol 4 / Issue 8 / April 2012 Centers Mojtaba Vardian,
Mahdi Shirin Shandiz,
Mohammad zarei

A STUDY ON CO RELATION BETWEEN STRAIGHT LEG
ANGLE AND FUNCTIONAL DISABILITY IN LOW BACK
PAIN
Abhishek Sharma1, Urvi Bhavsar2

ijcrr
Vol 04 issue 08 1
SPB Physiotherapy College, Surat,Gujarat
Category: Research 2
Masoom Hospital, Surat, Gujarat
Received on:28/01/12
Revised on:17/02/12 E-mail of Corresponding Author: drabhi2700@gmail.com
Accepted on:07/03/12
ABSTRACT
Back ground and Purpose: Low back Pain is a major cause of functional disability in India. It is because
of trauma, degeneration or any pathology related to back. Low back pain is the most challenging job of
physiotherapist to deal with it. The aim of the study was to study SLR angle, the angle at which the pain
increases in severity or radiating starts, and functional disability. The second was to know severity of
disability in routine functions of low back pain patients. Research Design: Co-relation method using
Karl Pearson. Material and Methods: Personal interview of 30 patients with Low Back Pain was taken
by using to know about the level of functional disabilities and Straight Leg Raise (SLR) angle was
measured. Co-relation between both Roland and Morris questionnaire and Straight Leg Raise (SLR)
Results: The co-relation between SLR angle and functional disability as measured by RM questionnaire
is partial negative. The co-relation co-efficient is -0.75. Conclusion: SLR angle is indicative of the
functional disabilities. The patient with more disability has less SLR angle
____________________________________________________________________________________
Key Words: Roland and Morris questionnaire, lower back region) is made up of five vertebrae
Straight Leg Raise (SLR) angle, Low back Pain (L1-L5)5,8,17. In between these vertebrae lie fibro
cartilage discs (intervertebral discs), which act
INTRODUCTION as cushions, nerves runs from the spinal cord
Low back pain or lumbago is a common through foramina within the vertebrae, providing
musculoskeletal disorder affecting 80% of muscles with sensations and motor associated
people at some point in their lives. It is an messages. Stability of the spine is provided
extremely common human phenomenon which through ligaments and muscles of the back,
occurs because of trauma, degeneration or any lower back and abdomen. Small joints those
pathology related to back. It can be either acute, prevent as well as direct motion of the spine are
sub acute or chronic in duration19. Low back called facet joints (zygapophysial joints).Low
pain (LBP) is defined as chronic after 3 months, back pain is more persistent among people who
unless pathoanatomic instability persists. A previously required time off from work because
slower rate of tissue repair in the relatively of low back pain, those who expect passive
avascular intervertebral disk may impair the treatments to help, those who believe that back
resolution of some persistent painful cases of pain is harmful or disabling or fear that any
chronic LBP (cLBP) 18. The lumbar region (or movement whatever will increase their pain, and

people who have depression or anxiety3,4.This angle was used to measure at which pain
dysfunction leads to disability to perform any reproduces or radiating pain starts.
household activites, grooming and almost all Collection of Data
daily activities. A disability is any long-term Roland and Morris developed a questionnaire
limitation in activity resulting from a condition for evaluating patients with low back pain1,16.
or health problem. Disability mainly occurs in This can be used to determine the level of
performing daily activities as dressing, patient disability and can help measure outcome
grooming, lifting, etc. following therapeutic intervention. The
Questionnaire is usually paired with a visual
Purpose of the Study analogue scale (VAS) for pain rating ranging
The first aim of the study was to study SLR from no pain at all to unbearable pain. There are
angle, the angle at which the pain increases in total 24 questions, each has 1 point. If the
severity or radiating starts, and functional answer is yes the score is 1 and for no score is
disability. The second was to know severity of 0.Total score = SUM (Points for all 24
disability in routine functions of low back pain statements).Interpretation-Minimum score: 0
patients. Maximum Score: 24. The higher the score the
more severe the disability associated with low
METHODOLOGY back pain. A score of 0 indicates no disability
Research Design: Simple Random Sampling and β4 severe disabilities. A score ≥ 14 indicates
Method .Co-relation method using Karl Pearson a patient in poor outcome group. Explain the
Source of Data: Patients with pathological patient the ROLAND AND MORRIS
back pain QUESTIONNAIRE. As they read a sentence
Inclusion Criteria: Age group: 30 to 65 years that describes them today, put tick against it. If
of age.Sex: Male and female. sentence does not describe them, then leave the
Patients with pathological back pain like space blank and go on to the next one.
herniated disc, spinal Stenosis, STRAIGHT LEG RAISING (SLR) 2,4,5,6,19:
spondylolisthesis, Sciatica, etc. Unilateral SLR test test is positive if pain
extends from the back down into the leg in the
Exclusion Criteria: Patients with mechanical sciatic nerve distribution. With the patient in
back pain, osteoporosis, any spinal deformity, supine position, the hip is medially rotated and
Ankylosis spondilitis. adducted, the knee is extended, and the examiner
flexes the hip until the patient complains of the
Sampling Technique and Sample Size pain or tightness in back region or back of the
All subjects who fulfilled the inclusion criteria leg. With the patient in supine position, the
were selected for the study which counts to a therapist passively flexes the hip until the
total of 30 patients symptom comes, this angle is measured by
Data Collection Method Goniometer.The fulcrum of goniometer is
Personal interview method by using Roland and placed at greater trochanter; the moveable arm
Morris questionnaire and measurement of of the goniometer is placed along the shaft of the
Straight Leg Raise (SLR) angle. femur. The angle between fixed arm and
Outcome measures: movable arm is measured. The score of every
RM (Roland and Morris questionnaire) scale patient and SLR angle should be noted and
was used to measure score of RM index.SLR analyzed.
DATA ANALYSIS journals and books from where the literature for
The collected data were subjected to Karl this research article has been reviewed
Pearson Correlation Co-efficient method. ETHICAL COMMITTEE CLEARANCE:
There was no ethical committee formed in the
RESULTS institution during the time in which research was
The co-relation co-efficient is -0.75.It shows performed.
moderately or partial negative co-relation CONFLICT OF INTEREST: None.
between functional disability and SLR angle
REFERENCES
DISCUSSION 1. Brouwer S., Reliability and stability of
There is partial negative co-relation between Roland and Morris Disability
SLR and functional disability. That means, both Questionnaire was checked. Disability
variables are inversely related to each other. As 2004 Feb; 26(3):162-5.
a functional disability is more, the SLR angle is 2. Capra F, Vanti C, Donati R, Tombetti S,
less. The pain produces at a lower angle because O'Reilly C, Pillastrini P.Validity of straight
of more disability .The study also relates low leg raise with sciatic pain with or without
back pain and functional disability. We can lumbar pain using Magnetic resonance
make the society aware about the disabilities imaging as standard Reference. Journal of
9,10,11,12,14
due to the back pain and explain them Manipulative and Physiological
to take care about the daily activities. Low back Therapeutics. 2011; 34(4):231-8.
pain is the most common problem in this era for 3. Krause N, Ragland DR.Occupational
physiotherapist to deal with. disability due to low back pain: a new
interdisciplinary Classification based on a
CONCLUSION phase model of disability. Spine. 1994
The study concluded that there is a partial May; 19(9):1011-20.
negative correlation between functional 4. Lutz GK, Butzlaff M, Schultz-Venrath U.
disability and SLR angle that is patient with Looking back on back pain: trial and error
more disability has less SLR angle.SLR of diagnoses in the 20th century. Spine
.1976 Aug.; 28(16):1899-905.
ACKNOWLEDGEMENTS 5. Bernard E.Finneson.Low Back Pain.
We are sincerely grateful to the god who McMinn Publishers.1998; 2nd Edition.
showered blessings for our research. We are 6. Atul Patel, ABNA A. OGLE. Diagnosis
thankful to our principal for his help in every and Management of Low Back Pain.
walk of our research. We would like to mention Family Physician. 2000 Mar 15;
special thanks to my entire faculty who were 61(6):1779-1786
always a standing rock for our great work. We 7. Stratford, P.W., Binkley, J.M., & Riddle,
are privilege to thank our patients without whom D.L.Development and initial validation of
this research was not been possible. We the back pain functional scale. Health
acknowledge the immense help received from Services Research, 2000. 25 (16), 2095-
the scholar whose articles are cited and included 2102
in references of this manuscript. We are grateful 8. B.D.Chaurasia.Clinical Anatomy.CBS
to authors/editors/publishers of all those articles, Publishers; 1996,3rd edition.

9. Debbie Ehrmann Feldman. Risk Factors for 14. A Kopec The Quebec Back Pain Disability
the Development of Low Back Pain in Scale: conceptualization and development.
Adolescence. Oxford Journals, American Journal of Clinical Epidemiology.1996. ;
Journal of Epidemiology: 2000.154(1); 30- 49(2):151-161.
36 15. John Fran. Preventing disability from
10. Robbert Braton.Assessment and work-related low-back pain. Canadian
Management of Acute Low Back Pain. medical journal.1998 ; 158:1625-3.
America Physician. 1999; 60(8):2299- 16. Stratford PW et al. A comparison study of
2306. the back pain functional scale and Roland
11. Scientific approach of the assessment and Morris Questionnaire. North American
management of activity-related spinal Orthopedic Rehabilitation Research
disorders. A Monograph for clinicians. Network. Journal of Rheumatology. 2000
Report of the Quebec Task Force on Spinal Aug; 27(8):1928-36.
Disorders. Spine. 1987; 12(7):S1–59. 17. Web supports-
12. BK Mahajan.Methods in www.pubmed.com.www.google.com.
Biostatistics.Jaypee; 6th Edition. 18. A. F. Mannion, M. Müntener.et
13. Maurits van Tulder.Exercise Therapy for al.Comparison of three active therapies for
Low Back Pain; A Systematic Review chronic low back pain: results of a
Within the Framework of the Cochrane randomized clinical trial with one‐ year
Collaboration Back Review Group .SPINE. follow‐ up.Journal of Rheumatology
2000.; 25(21): 2784 –2796. (2001) 40 (7): 772-778.

USE OF ANTIMICROBIAL PROPHYLAXIS IN SURGICAL
AND MEDICAL INTENSIVE CARE UNITS – A
COMPARATIVE STUDY
Apurva Agrawal1, Barna Ganguly2

ijcrr
1
Vol 04 issue 08 Department of Pharmacology, Geetanjali Medical College, Udaipur, Rajasthan
2
Category: Research Department of Pharmacology, Pramukhswami Medical College, Karamsad, Gujarat
Revised on:16/03/12 E-mail of Corresponding Author: apuragr@yahoo.co.in
ABSTRACT
Aims: To study the extent and pattern of use of antibiotics for prophylaxis in medical and surgical
intensive care units. Subjects and Methods: 100 patients each from SICU and MICU were included in
the study. Case record files were analyzed daily until discharge from ICU or a maximum of 21 days.
Details of all antibiotics prescribed for prophylaxis were recorded in a proforma, which were then
analyzed using relevant statistical tests. Results: 65% patients in MICU and 99% in SICU received
antibiotics (p value <0.0001). Among patients who received antibiotics, 37% in MICU and 73% in SICU
received them for prophylaxis (p value <0.0001). Average duration of prophylaxis was 2.58 days in
MICU and 3.14 days in SICU. 19 (79.14%) patients in MICU and 48 (66.67%) patients in SICU received
prophylaxis for more than 24 hours (p value = 0.3690). 15 (62.5%) patients in MICU and 31 (43%)
patients in SICU received combination of antibiotics for prophylaxis (p value = 0.156). Third generation
cephalosporins were the most commonly prescribed antibiotics for prophylaxis in both ICUs.
Conclusion: Widespread use of antimicrobial prophylaxis in ICUs with broad spectrum antibiotics and
antibiotic combinations, with duration longer than recommended has emerged as area of concern in
present study. Such surveillance studies help in recognition of areas requiring special attention, which can
guide the formulation of antibiotic prescription policies at individual ICU level.
____________________________________________________________________________________
Keywords: Antibiotic, antimicrobial resistance, major infections in critically ill patients. [2]
ICU. Antibiotic prophylaxis is highly effective in
some clinical settings, but in others, it accounts
INTRODUCTION for misuses of antimicrobials, and may even be
Infections are a frequent problem in Intensive deleterious. [3] A number of studies have justified
Care Units (ICUs) and thus antibiotics are antibiotic prophylaxis in dirty or contaminated
frequently used. Although antibiotics represent surgical procedures, where the incidence of
one of the most frequently prescribed classes of wound infections is high, but such use must not
drugs among all hospitalized patients, total be extended beyond 24 hours. [3] These include
antibiotic consumption is much higher in the less than 10% of all surgical procedures. In clean
ICU than in general hospital wards. [1] Besides surgical procedures, which account for
treatment of infections, antibiotics in ICU are approximately 75% of the total, antibiotics
administered as prophylaxis to prevent or limit should not be routinely used as the expected

incidence of wound infection is less than 5%. willing to give consent and patients with age less
Except a very few conditions, non surgical than 18 years were excluded from the study.
antibiotic prophylaxis is not routinely indicated. Collection of data:
Although awareness of the consequences of Permission was taken from Institutional Human
antibiotic misuse is increasing, overprescribing Research Ethics Committee before starting the
remains widespread. Overuse of antibiotics and study. A total of 200 patients were included
poor compliance with infection control measures randomly, 100 from each ICU. As patients
have been identified as the two major reasons admitted in ICU are critically ill, written
for increasing antimicrobial resistance. [4] informed consent was taken from the relatives of
the patients. Case record files of the included
Studies on antibiotic prescription practices in patients were analyzed daily until their discharge
ICUs have been done in some countries, [1,5] but from ICU or a maximum of 21 days. Treatment
information regarding studies done in Indian was considered prophylactic if there was no
ICU setting is extremely limited. Antibiotic evidence of infection and the drug was used to
recommendations based on studies performed at prevent infection. Details of all antibiotics
a few selected centers may not be applicable and prescribed for prophylaxis were recorded in a
may not be generalized to all ICU settings. predecided proforma, including group of drug,
Singh N et al has suggested that research in route of administration, dose and duration of
individual ICU is essential in guiding antibiotic treatment.
prescription practices. [6] As antibiotic policy for
ICU in our Hospital was in developmental phase Statistical analysis:
and we needed to know the potential areas of Data was analysed on Microsoft excel 2007.
concern, a cross sectional study was done, to Mean and frequencies were calculated in the two
study the extent and pattern of use of antibiotics groups. Chi square test was used to compare
for prophylaxis in medical and surgical intensive proportions and p value of < 0.05 was
care units. considered as significant.
MATERIAL AND METHODS RESULTS

The Hospital, in which this study was In MICU 65 (65%) patients were prescribed
conducted, is a 550 bedded tertiary care hospital. antibiotics either single or in combination while
There are two adult ICUs, medical and surgical in SICU 99 (99%) patients were prescribed
ICU, each ICU is a 12 bedded unit. In surgical antibiotics (p value <0.0001). In MICU
ICU (SICU) majority of patients admitted are antibiotics consisted 15% of total drugs
because of road traffic accidents and surgical (excluding intravenous fluids) prescribed while
patients admitted after various surgical in SICU 23.54% of total drugs prescribed (p
procedures. In medical ICU majority of patients value <0.0001). Out of 65 patients who received
admitted are because of respiratory, cardiac or antibiotics in MICU, 24 (37%) received them for
multiorgan failure. prophylaxis, while in SICU 72 (73%) out of 99
Inclusion and exclusion criteria: patients received antimicrobial prophylaxis (p
Patients admitted in SICU and MICU, of age value <0.0001). In MICU 4.6% received
above 18 years, irrespective of sex were surgical prophylaxis and 33.8% received non
included in the study from October 2007 to surgical prophylaxis. In SICU 37% received
October 2009. Patients whose relatives were not

surgical prophylaxis and 36% non surgical ten times greater in ICU wards than in other
prophylaxis. wards. [1] In our study also, antibiotics were
Average duration of antimicrobial prophylaxis in frequently prescribed, 65% patients in MICU
MICU was 2.58 days and in SICU 5.24 days. and 99% in SICU received antibiotics. Though
Antimicrobial prophylaxis for more than 24 use of antibiotics in MICU was in accordance
hours was given in 19 (79.14%) patients in with that reported by Roder BL et al and
MICU and in 48 (66.67%) patients in SICU (p Bergmans DCJJ et al in their studies, [1,7]
value = 0.3690). In 13 (54.2%) patients in antibiotic use in SICU was far more prevalent,
MICU and in 32 (44.4%) patients in SICU much higher than found in other studies. [1,7,8]
antimicrobial prophylaxis was used for more Similarly prophylactic use of antibacterials was
than 48 hours (p value = 0.5549). significantly less in MICU as compared to
Third generation cephalosporins were the most SICU; it was also less than reported by studies
commonly prescribed antibiotics for prophylaxis done in other countries, [1,5] where more than half
in both ICUs (62.5% and 83.33% in MICU and of the patients received antimicrobial
SICU respectively) followed by metronidazole prophylaxis. The picture in SICU was different,
(45.83%) in MICU and metronidazole (19.44%) where out of total patients who received
and amikacin (19.44%) in SICU. Frequency of antibiotics, 73% received antimicrobial
different groups of antibiotics used for prophylaxis, a figure much higher than found in
prophylaxis in MICU and SICU is given in above mentioned studies. The incidence of non
Table I & II respectively. Comparison of most surgical prophylaxis was almost similar in the
commonly used antibiotic groups in both ICUs two ICUs, as more surgical patients are admitted
is given in Table III. in SICU; surgical prophylaxis is mostly
Out of those patients who received antimicrobial responsible for this difference.
prophylaxis, 15 (62.5%) patients in MICU while Many guidelines are available for surgical
31 (43%) patients in SICU received combination prophylaxis which recommend 1st generation
of antibiotics (p value = 0.156). Most common cephalosporin as first choice and for not more
combination used in MICU was 3rd generation than 24 hours. [3,9] Concerning non-surgical
cephalosporin with metronidazole, while in prophylaxis, excluding a few specific conditions
SICU 3rd generation cephalosporin with like neutropenia, there is evidence for only two
aminoglycoside was the most common approaches that are oral decontamination and
combination used for prophylaxis. selective digestive decontamination (SDD). [10-12]
Among patients who received antibiotics for Observations in our study were far away from
prophylaxis, 6 (25%) patients in MICU and 22 these recommendations. Inappropriate
(30.55%) patients in SICU, later received antibiotics were prescribed for lengthy periods
empirical therapy for suspected infection despite (mean duration 2.58 days in MICU and 3.14
of antimicrobial prophylaxis (p value = 0.7954). days in SICU), and in too many patients. Instead
of 1st generation cephalosporins which are
DISCUSSION recommended for surgical prophylaxis, 3rd
As patients in ICUs are critically ill and more generation cephalosporins were the most
susceptible to nosocomial infections, more commonly used antibiotics in both ICUs.
frequent use of antibiotics in these units is Antibiotic combinations were frequently used in
expected. In a study done by Roder BL et al, both ICUs for prophylactic purpose. Providing
total antibiotic consumption was approximately broad spectrum coverage to patients might be a
reason for high prevalence of use of antibiotic their risks and susceptibilities to various
combinations. Oral decontamination and SDD infections, as well as predominant pathogens and
were never used in this study for non surgical their antimicrobial resistance varies between
prophylaxis. Use of antibiotic prophylaxis in different ICUs, such surveillance studies and
non-surgical patients except a few specified research help in recognition of areas of special
conditions is not recommended by any concern which can guide the formulation of
guidelines. This practice increases the chances antibiotic prescription policies at individual ICU
of development of antibiotic resistance and level.
induces a false sense of confidence in clinicians
who consequently pay less attention to the ACKNOWLEDGEMENT
possibility of occult infection. [5] This possibility We acknowledge the immense help received
correlates with the finding in our study that out from the scholars whose articles are cited and
of total patients who received antimicrobial included in references of this manuscript. We
prophylaxis, 6 (25%) patients in MICU and 22 are also grateful to authors / editors / publishers
(30.55%) patients in SICU later received of all those articles, journals and books from
empirical antibiotics for suspected infection where the literature for this article has been
despite of antimicrobial prophylaxis. Adherence reviewed and discussed.
to internationally accepted guidelines has been
found low in other studies also. [5,13] REFERENCES
There were some limitations in present study. 1. Roder BL, Nielsen SL, Magnussen P,
Relatively small number of patients was studied Engquist A, Frimodt-Moller N. Antibiotic
in both intensive care units. As clinicians were usage in an intensive care unit in a danish
not included in the present study frame, we can university hospital. J Antimicrob Chemother
not conclude on the reasons responsible for 1993;32:633-42.
nonadherence of antibiotic prescription practices 2. Mangram AJ, Horan TC, Pearson ML,
to internationally accepted guidelines. Silver LC, Jarvis WR. Guideline for
prevention of surgical site infection, 1999.
CONCLUSION Hospital Infection Control Practices
In the current scenario when antimicrobial Advisory Committee. Infect Control Hosp
resistance is growing in intensive care units and Epidemiol 1999;20(4):250-78.
nosocomial infections are becoming more and 3. Chambers HF. General principles of
more difficult to treat, appropriate and cautious antimicrobial therapy. In: Brunton LL,
use of antibiotics particularly in intensive care editor. Goodman & gilman‘s the
units becomes a necessity so that we can use pharmacological basis of therapeutics. 11th
these wonder drugs in future also. Present study ed. New York: McGraw-Hill; 2006. p. 1095-
has provided a baseline data of the prophylactic 110.
use of antibiotics in intensive care units of a 4. Goldmann DA, Weinstein RA, Wenzel RP
tertiary care teaching hospital. Liberal use of et al. Strategies to prevent and control the
antibiotics for surgical and non surgical emergence and spread of antimicrobial-
prophylaxis, with broad spectrum antibiotics and resistant microorganisms in hospitals. a
antibiotic combinations, and for long durations, challenge to hospital leadership. JAMA
has emerged as areas of concern in present 1996 Jan 17;275(3):234–40.
study. As characteristics of patient population,
5. Malacarne P, Carlotta R, Bertolini G. 10. Marino PL. The ICU book. 3rd ed.
Antibiotic usage in intensive care units: a Philadelphia (PA), USA: Lippincott
pharmaco-epidemiological multicentre Williams & Wilkins; 2007. p. 63-80.
study. J Antimicrob Chemother 11. Bergmans DCJJ, Bonten MJM, Gaillard CA
2004;54(1):221-4. et al. Prevention of Ventilator-associated
6. Singh N, Yu VL. Rational empiric antibiotic Pneumonia by Oral Decontamination. A
prescription in the ICU – clinical research is Prospective, Randomized, Double-blind,
mandatory. Chest 2000;117(5):1496-9. Placebo-controlled Study. Am J Respir Crit
7. Bergmans DCJJ, Bontena MJM, Gaillardc Care Med 2001 Aug;164(3):382-8.
CA et al. Indications for antibiotic use in 12. Ulrich C, Harinck-de Weerd JE, Bakker NC,
ICU patients: a one-year prospective Jacz K, Doornbos L, de Ridder VA.
surveillance. J Antimicrob Chemother Selective decontamination of the digestive
1997;39:527-35. tract with norfloxacin in the prevention of
8. Hartmann B, Junger A, Brammen D et al. ICU-acquired infections: a prospective
Review of antibiotic drug use in a surgical randomized study. Intensive Care Med
ICU: management with a patient data 1989;15(7):424-31.
management system for additional outcome 13. van Kasteren MEE, Kullberg BJ, de Boer
analysis in patients staying more than 24 AS, Mintjes-de Groot J, Gyssens IC.
hours. Clin Ther 2004 June;26(6):915-24. Adherence to local hospital guidelines for
9. Lampiris HW, Maddix DS. Clinical use of surgical antimicrobial prophylaxis: a
antimicrobial agents. In: Katzung BG, multicentre audit in Dutch hospitals. J
editor. Basic and clinical pharmacology. Antimicrob Chemother 2003;51:1389-96.
11th ed. Boston Burr Ridge (IL): The
McGraw-Hill Companies; 2009. p. 827-41.
Table I: Group wise distribution of antibiotics used for prophylaxis in MICU (n = 24)
S. No. Group of antibiotic Name / Generation of antibiotic No. of patients
(%) (%)
1. Penicillin Amoxicillin 4 (16.67)
(41.66%) Amoxicillin-Clavulanate 2 (8.33)
Ampicillin 2 (8.33)
Cloxacillin 2 (8.33)
2. Cephalosporin III Generation Cephalosporin 15 (62.50)
(62.50%)
3. Fluoroquinolone Levofloxacin 1 (4.17)
(4.17%)
4. Aminoglycoside Gentamicin 1 (4.17)
(4.17%)
5. Tetracycline Doxycycline 3 (12.50)
(12.50%)
6. Other Metronidazole 11 (45.83)
(45.83%)
* Some patients received more than one drug, and therefore the total percentage exceeds
100%.

Table II: Group wise distribution of antibiotics used for prophylaxis in SICU (n = 72)
S. No. Group of antibiotic Name / Generation of antibiotic No. of patients
(%) (%)
1. Penicillin Amoxicillin – Clavulanate 1 (1.39)
(13.89%) Ampicillin – Sulbactum 1 (1.39)
Cloxacillin 6 (8.33)
Piperacillin – Tazobactum 2 (2.78)
2. Cephalosporin II Generation Cephalosporin 6 (8.33)
(83.33%) III Generation Cephalosporin 54 (75.00)
3. Fluoroquinolone Levofloxacin 10 (13.89)
(20.83%) Ciprofloxacin 4 (5.55)
Ofloxacin 1 (1.39)
4. Aminoglycoside Amikacin 14 (19.44)
(27.77%) Neosporin 6 (8.33)
5. Antifungal Fluconazole 1 (1.39)
(1.39%)
6. Other Metronidazole 14 (19.44)
(22.22%) Teicoplanin 2 (2.78)
* Some patients received more than one drug, and therefore the total percentage exceeds 100%
Table III: Comparison of frequency of various antibiotics used for prophylaxis in MICU & SICU
S. No. Name of Antibiotic MICU (n=24) SICU(n=72) P value

1. Penicillins 10 10 0.0090
2. Cephalosporins 15 60 0.0639
3. Fluoroquinolones 1 15 0.1138
4. Aminoglycosides 1 20 0.0325
5. Metronidazole 11 14 0.0225
* P value calculated by chi square test

SCENARIO OF BIOMEDICAL WASTE MANAGEMENT IN
THE MAJOR HOSPITALS OF SRINAGAR CITY
Rumisa Nazir, G. A. Bhat

ijcrr P. G. Department of Environmental Science / Centre of Research for Development,
Vol 04 issue 08 University of Kashmir, Srinagar, J & K
Category: Research
Revised on:03/03/12 E-mail of Corresponding Author: Rumisanazir@yahoo.com
ABSTRACT
In order to assess the biomedical waste management; the practices currently operative and compliance
with Regulatory Notification for Biomedical Waste (Management and Handling) Rules, 1998, under the
Environment (Protection Act 1986), Ministry of Environment and Forestry, Govt of India; the level of
awareness regarding biomedical waste management and handling rules among the hospital staff; training
imparted to the waste handlers and other particulars regarding risk associated with the handling of
biomedical waste, the present study was carried out during May-July 2010 which involved the use of
questionnaire method, in-depth interview and personal observation to crosscheck the authenticity of
information gathered. During the study, the existing practices of biomedical waste management appeared
to be unsatisfactory; hospitals did not conform to the Biomedical Waste (Management and Handling)
Rules, 1998. Waste segregation was found not practiced by the hospitals surveyed and knowledge
regarding biomedical waste management was found highest among the doctors i.e. 94.3% and 96% at
SKIMS and SMHS hospital respectively indicating that people with higher qualification possessed more
awareness regarding the prescribed rules. No specific training and awareness programs on biomedical
waste management were organized by the hospital authorities.
____________________________________________________________________________________
Keywords: Biomedical waste, Segregation, carries a higher potential for infection than any
Knowledge, Training, Hospital, existing other type of waste. Waste is an unavoidable
practices. byproduct of human activities, pervading our
environment for centuries and will continue to
INTRODUCTION contaminate it. Therefore it is essential to have
Hospitals are service oriented institutes that safe and reliable methods for waste
provide medical facilities vital for our life and management, focussing both on effective
health. In the healthcare process, waste is training and supervision. Waste management
generated which usually includes sharps, human includes responsible planning of collecting,
tissues or body parts and other infectious transporting, processing, and disposing waste
materials (Baveja et al., 2000), also referred to material (Campbell, 1988; Stamenkovic, 2007).
as Hospital Solid Waste‖ and ―Biomedical Within waste management, the healthcare waste
Waste‖ (Manohar et al., 1998). It is a real management is a process that helps to ensure
problem of living nature and human world as it proper hospital hygiene and safety of healthcare

workers and communities (Belkin et al.,1982; its compliance with Regulatory Notification for
Baram, 1989).The primary sources of Biomedical Waste (Management and Handling)
biomedical waste are hospitals, laboratories, Rules, 1998, under the Environment (Protection
diagnostic centres, blood banks, veterinary Act 1986), Ministry of Environment and
hospitals, nursing homes, clinics. Non- Forestry, Govt. of India; the level of awareness
infectious waste forms nearly 85% of the waste among the hospital staff; training imparted to the
generated by a hospital and the remaining 10% waste handlers and other particulars regarding
are hazardous (Pruss and Townend, 1998). risk associated with waste handling at two major
Inappropriate and inadequate handling of hospitals of Srinagar, Kashmir known for their
biomedical waste may have a serious and advanced diagnostic and surgical specialties.
significant impact on the public health and the The study lasted for a period of 3 months.
environment. Sound management of biomedical
waste needs to be given priority and made an MATERIAL AND METHODS
integral feature of healthcare services. There is a Data regarding the current biomedical waste
need to sensitize the top level waste managers management practices, level of awareness
by making them aware of not only the various regarding biomedical waste management and
types of waste, but also its generation, handling rules prescribed therein was collected
collection, containment, handling, storage, by the questionnaire method. The design of the
transportation, treatment and final disposal. The questionnaire was based on the survey
proper segregation at source is an essential questionnaire of World Health Organization
element of the successful waste management (WHO) with editorial changes and was framed
programme (pandit, 1999). If the infectious according to the objective needs of the study. It
component gets mixed with the general non- was served to hospital administrators, doctors,
infectious waste, the entire mass becomes nurses, sanitary staff and hospital engineers.
potentially infectious (Nugget, 2010). Onsite personal observation of the management
Waste management has become a critical issue practices were carried out for confirmation and
both at national and international level. In July as a supplement to information gathered by the
1998, the Government of India Environment questionnaire.
Protection Act 1986 (Rule 29 of 1986) issued a Formal interview was conducted to find whether
Notification on Biomedical Waste (Management the training is being imparted to the waste
and Handling), Rules 1998, indicating the rules handlers and other particulars regarding risk
for the management and handling of biomedical associated with the waste handling. Authenticity
waste. It defined ―biomedical waste‖ as any of information so obtained was crosschecked
waste, which is generated during the diagnosis, through personal observation. The study was
treatment or immunization of human beings or conducted with the prior approval of the subjects
animals or in research activities pertaining and institutions.
thereto or in the production or testing of STUDY AREA
biological and including categories mentioned in The historical Srinagar city is the summer
Schedule I (1998). capital of Jammu And Kashmir State,
Looking into the existing scenario of biomedical surrounded by hills on east and north eastern
waste management in the country it was planned side loc
to undertake a study to assess the current E
practices of biomedical waste management and longitude. Altitude of Srinagar varies from 1580
m in the low lying vicinity of River Jhelum and While in SKIMS, sharps were disinfected
1620m on the eastern hill slopes with an average properly and finally incinerated.
elevation of about 1586m above mean sea level Waste storage area at SKIMS was of a size
(Bates, 2005). The city lies on both side of river appropriate to the quantities of waste produced
Jhelum, which swirls through the heart of the but did not have secured bins to eliminate the
Srinagar city. possibility of access to the waste by rodents,
For the present study two hospitals were selected flies, or other natural scavengers. The waste was
which have different characteristics in terms of placed in an open area before disposal at SMHS
their size, treatment technology and the type of hospital, so it was easily accessible to
patients catered. The two study stations were: unauthorized personnel and animals. The
Sheri Kashmir Institute of Medical Sciences transportation of waste to the storage site was
(SKIMS), Soura done manually in SMHS hospital, while in
It is a tertiary care hospital, catering to the SKIMS trolleys and pipeline system (Chute) was
average socio-economic class of people and employed.
provides a total of 600 beds. Biomedical waste was autoclaved and
Shri Maharaja Hari Singh Hospital (SMHS), incinerated (Type Brick Kiln; capacity 125
Karan Nagar kg/hr) onsite, at SKIMS. Ash so obtained was
It is a teaching hospital associated to buried in onsite ash pits, neither lined from
Government Medical College, Srinagar and is below nor sealed above. Liquid waste was
the biggest general hospital in terms of bed treated in the treatment plant and flushed into
capacity (750). the sewers (Fig.1). SMHS hospital treats its
biomedical waste at Common Biomedical Waste
RESULTS Treatment Facility (CBWTF), Lassipora
Current biomedical waste management Pulwama, Kashmir, while the liquid waste was
practices flushed directly into the River Jhelum.
The important inferences regarding the various The level of awareness among the hospital
components of the waste management hierarchy staff
like segregation, packaging, storage, collection, Knowledge regarding biomedical waste
transportation and disposal were drawn and then management and rules prescribed therein at
the framework of compliance was assessed. SKIMS and SMHS hospital was found highest
Barring SKIMS, the waste was not segregated at among the doctors in the tune of 94.3% and 96%
source as prescribed in the Biomedical Waste respectively. Sanitary staff scored the least
Management Rules, 1998 (Table 1). Due to poor which indicates that the authority neither
segregation practices, the general waste gets informed them in the form of instructions nor
mixed up with the infectious waste. Hospitals did they supervised their biomedical waste
were using uncovered plastic bins for waste management practices (Fig. 2).
collection provided with same kind of color Training and other particulars regarding risk
coded labelled polybags. Polybags were not in the waste handling
sealed properly and its integrity was found not to Although 10% waste handlers were aware of
be preserved. In SMHS hospital, waste sharps risks involved in biomedical waste handling,
were contained without being subjected to 7.27% had received special training on this
disinfection in open trays or in any of the bins. aspect. While 18.18% of waste handlers suffered
from skin infections but none reported it to the
higher authorities. 3.63% of waste handlers technical problems associated with it (Bashir,
stated about being immunized (Table 2). 2009). Then the waste was carried to the onsite
Out of 100 waste handlers which were incinerator plant. In SMHS hospital, waste was
interviewed at SMHS hospital, 4% of waste collected manually and trolleys meant fo the
handlers were aware of risks involved in same were not used at all. Part of the waste was
biomedical waste handling. None has received taken to the CBWTF and part to the municipal
special training on this aspect, 5% suffered from site at Achan Syedpora for its disposal. Barring
eye and skin infection and none reported to SKIMS, liquid waste from the other hospital was
higher authority. None was found immunized flushed into the River Jhelum without any
against the infections (Table 3). treatment. Observation similar to the present
investigation have also of course been made by
DISCUSSION the Purvi et al., (2006) in Gujarat, India.
Biomedical waste seems to have received very Doctors outscored nurses and sanitary staff in
little attention in waste management process in knowledge regarding biomedical waste
Srinagar city, Kashmir. Neither the government management and rules prescribed
nor hospital authority pays proper attention to its therein.Doctors rated 94.3% in SKIMS, 96% in
management. Biomedical waste is disposed off SMHS hospital with regard to
randomly leading to unhealthy and hazardous knowledge.Sanitary staff exhibited poor
environment affecting people living within the knowledge in the tune of 26.6% and
vicinity of health institutions in particular and 25% respectively.This was indicative of the fact
city dwellers in general. that the sanitary staff was never given even a
The study revealed that the hospitals do not capsule training with regard to biomedical waste
practice segregation, which was due to lack of management.Continuous awareness regarding
trained waste handlers and proper supervision. biomedical waste management was needed to be
As a result of failure to follow segregation promoted.
protocols and infrastructure, the waste as a It was found that the waste handlers were not in
whole is potentially infectious. Rijal et al., receipt of special training on biomedical waste
(2007) observed segregation far from handling which was prerequisite and necessary
satisfactory in most of the healthcare to ensure an understanding of the risks that
institutions. Such a practice of non-segregation wastes pose, to know how to manage waste etc.
may increase the costs of final disposal of the Waste handlers were found suffering from
waste. infections with no reporting to higher
Hospitals under study were found not to be authorities. Reportedly, very few waste handlers
complying with the specifications for storage were found immunized against the infections.
facilities. Untreated waste in SKIMS was Hence implementation of a waste management
transported to the collection point through policy, training and motivation must be given
pipeline system, which consists of a network of paramount importance to meet the current needs
pipelines from various floors within the and standards of biomedical waste management
hospital.The vertical conduit allows the waste to (Sharma and chauhan, 2008).
be collected at a central collection point by
means of gravity, thus preventing the horizontal CONCLUSION
movement of waste through the hospital The management of biomedical waste in the
corridors. But, there are some hygienic and study centres do not conform to the Biomedical
waste (Management and Handling) Rules, 1998. authors are also grateful to
It seemed that no significant action has been authors/editors/publishers of all those articles,
taken by the hospital authorities in compliance journals and books from where the literature for
with the rules. The resistant attitude of hospital this article has been reviewed and discussed.
staff, lack of technical knowhow, and lack of
skilled manpower could be responsible for the REFERENCES
non-compliance of biomedical waste 1. Baram, M. 1989. Hospital management of
management rules. medical waste: legal framework and policy
In order to achieve an effective and sustainable issues, Ch. IV: Perspectives on Medical
biomedical waste management system in the Waste, Albany, NY: The Nelson A.
hospitals, the following suggestions were put Rockfeller Institute of Government, State
forward for consideration: University of New York.
(i) Segregation practices were needed to be 2. Bashir, F. 2009. Study of solid waste
imposed within hospitals to separate management at SKIMS. School of health
infectious waste, which will result in a sciences IGNOU.
clean solid waste stream. 3. Bates, E.C. 2005. A Gazetteer of Kashmir.
(ii) Demonstrative programs should be Pp: 352.
conducted for employees who are in 4. Baveja, G., Muralidhar, S., Aggarwal, P.,
direct contact with the biomedical waste 2000. Hospital Waste Management- an
in order to provide an understanding of overview. Hospital Today 5 (9), 485-486.
risks and importance of health and 5. Belkin, N.L. 1982. Do reusable or disposal
safety measures during handling. gowns give better protection against
(iii) Periodic meetings of staff involved with infection? Laundry News, 8 (2): 10, 17-18.
the waste management be conducted in
order to discuss problems and provide 6. Campbell, D. 1988. Hospital Waste
suggestions. Management in Canada, proceeding of the
(iv) Strict enforcement of law will help in national workshops on hospital waste
improving the overall biomedical waste incineration and hospital sterilization, U.S.
management scenario in Srinagar city. EPA, San Francisco, C.A.
7. Manohar, D., Reddy, P.R., Kotaih, B., 1998.
ACKNOWLEDGEMENT Characterization of solid waste of a
We acknowledge with thanks the (i) superspeciality hospital – a case study. Ind. J.
administrative staff of SKIMS and SMHS Environ. Health 40 (4), 319-326.
hospital, Srinagar, India for granting 8. Nugget, Hospital Waste Management and Bio-
permission and cooperation during the study degradable Waste, Government of India, Press
period and (ii) Scientists of State Pollution Information Bureau,
Control Board for their support and invaluable http://pib.nic.in/infonug/infaug,99/i3008991.ht
help that provided this study much of its pace ml-downloaded on 25.04.2010.
and momentum. The noted patience of 9. Pandit, N.A. 1999. Study of biomedical waste
respondents is also highly appreciated. Authors management in teaching hospitals of Kashmir,
acknowledge the immense help received from P.hd thesis, Dept. of Hospital Administration,
the scholars whose articles are cited and SKIMS.
included in reference of this manuscript. The
10. Pruss, A., Townend, W.K. 1998. Teacher‘s practices in Kathmandu valley. Proceedings of
Guide: Management of wastes from healthcare the International Conference on Sustainable
activities. Geneva, WHO. Pp: 160. Solid Waste Management. Pp: 142- 47.
11. Purvi, M., sheth, K.N., Desai, H. 2006. 13. Sharma, S., Chauhan, S.V.S. 2008. Assessment
Characterization and management of of biomedical waste management in three apex
biomedical waste in SAE hospital, Anand- a Government hospitals of Agra, 29(2): 159-162.
case study, Electronic journal of 14. Stamenkovic, M., Kralj, D. 2007. Healthcare
environmental, agricultural and food and waste management, WSEAS Int.
chemistry, 5 (6): 1579-4377, 1583-89. Conference on energy planning, energy saving,
12. Rijal , K., Despande, A. 2007. Critical environmental education, Arcachon, France.
evaluation of biomedical waste management Pp: 116-19.
Table 1 Segregation of biomedical waste as per BMW Rules, 1998
Color Coding Waste Category

Yellow Cat. 1, Cat. 2 & Cat 3
Red Cat. 3, Cat. 6 & Cat 7
Blue/White Cat. 4 & Cat 7
Black Cat. 5 & Cat 9
Table 2 Training of waste handlers and particulars regarding risk involved in waste handling at
SKIMS
S. No Training and other particulars No. of waste handlers %

(n=110)
1. Received special training in BMW handling 08 7.27
2. Aware of risk involved in BMW handling 11 10
3. An injury/ puncture /infection 20 18.18
4. Accident reporting to higher authority 0 0
5. Immunization 04 3.63
Table 3 Training of waste handlers and particulars regarding risk involved in waste handling at
SMHS Hospital
S. No Training and other particulars No. of waste handlers %

(n=100)
1. Received special training in BMW handling 0 0
2. Aware of risk involved in BMW handling 4 4
3. An injury/ puncture /infection 5 5
4. Accident reporting to higher authority 0 0
5. Immunization 0 0

Fig.1. Flow diagram of sewage treatment plant, SKIMS.
Fig.2. Level of awareness among the hospital staff at SKIMS and SMHS Hospital

PATIENTS‟ PERCEPTION ON HOSPITAL SERVICES WITH
SPECIAL REFERENCE TO BEHAVIOR OF DOCTORS IN
VILLUPURAM DISTRICT
D. Karthikeyan, M. Thurunarayanasamy
ijcrr
Vol 04 issue 08 Commerce Wing DDE, Annamalai University, Annamalai Nagar
Category: Research
Revised on:07/03/12 E-mail of Corresponding Author: karthikeyan14390@gmail.com
ABSTRACT
This study aims to examine the patient perception of hospital services in villupuram district. A total of
600 respondents were selected in the study area in and out patients were included in the study to know
their perceptions towards the public and private health facilities. The major reason of choosing the public
health facility was inexpensiveness, infrastructure, and proximity of health facility. From the analysis of
the respondents regardless of their social status have expressed the same ‗poor‘ views, but there is a
significant difference in the degree of poor opinion across respondents categories by age, sex, education
and occupation. It is finally concluded that behavior of doctors is significantly better in private hospitals
compared to Government hospitals in villupuram district.
____________________________________________________________________________________
INTRODUCTION professional standards and neglecting the

Studies of patient satisfaction towards health importance of patient perception and opinions in
services, health personnel and resources assessments of medical services, It has gained
constitute important elements in the extent to greater prominence over the past 25 years In
which health services meet consumers‘ any field, including medicine, customers‘
expectations and needs. In recent years, patient‘s perception on any service providing paramount
opinion is increasingly considered to be a useful importance and it is necessary for continual
component in the determination of care service improvement.3
outcomes. Users‘ perceptions are now Statement of the Problem
considered to be important source of information Last three decades provision of health care was
in screening for problems and developing an dominated by Govt - run Hospitals. Owing to
effective plan of action for quality improvement population explosion and consequent pressure
in health care organization1. Quality of health on hospital infrastructure, Government hospitals
care is the degree of performance in relation to a could not cater to the needs of ever-growing
defined standard of interventions known to be patient population. With the result, patients
safe and that have the capacity to improve health belonging to middle class and upper middle
within available resources. It can also be defined class started switching to private health care
as meeting the health needs at the lowest cost providers in getting quality medical service.
and within regulations2. Traditionally quality of The newer diseases, life style diseases caused by
health care has been measured using environmental degrade warrant a heavy demand

on health care services. Besides Government details regarding the selected hospitals were
hospitals, and private hospitals have begun obtained from the Deputy Direct of Health
health care needs proliferating to cater to the services, Villupuram. There are 575 public
mounting health care space. It is also apparent sector health establishments namely
that there is a growing dissatisfaction among the Government hospitals, Primary Health Centres
patient clients about the services provided by (PHCs) and Health Sub-Centres (HSCs) in the
health care service providers. district. There are and 143 private sector health
Studies of patients‘ perception towards health establishments are namely private hospitals,
personnel, health services and resources are nursing homes and clinics. Stratified random
important to determine whether they meet sampling was adopted for the selection of
patients‘ expectations and needs and to judge hospitals.
patient satisfaction. This information can be Sampling Technique for Selection of
used by hospital management in the Hospitals and respondents
improvements of programs and the problems With regard to the selection of hospitals more
identified by the patients. This will further than 50 bedded hospital from both private and
provide a detailed picture of the patients‘ government hospital in the study area will be
experience at the hospital from which the selected, ten hospital from the government and
hospital management can direct and focus their ten from the private sector by using stratified
resources for better service in the future.. In this random sampling technique. Thirty patients
context this study proposed patients‘ perception from each such sample hospital will be selected
doctors on hospital services with in Villupuram using convenience sampling technique. Thus,
District. the sample size of the patients of Government
Objective of the study hospitals amounts to 300 and 300 patients from
private hospitals. Thus, the total sample size of
1. To measure the patients‘ perception on
the patients for this would be 600; it consists
behavior of health personal in select hospitals
both in and out patients
in the study area.
RESULTS AND DISCUSSION

METHODOLOGY The reliability analysis calculates the following:
Period of the study item to total correlation, alpha if deleted and
The required primary data would be collected overall Cronbach‘s alpha coefficient. The
from the selected respondents during three Cronbach‘s alpha coefficient is widely used
months period, from May 2011 to July 2011. measure to find out the reliability and validity of
Secondary data will be collected for ten years a scale items. A scale items with Cronbach‘s
period from 2002 to 2011 alpha value of 0.70 and above is considered as
Sources of data reliable and valid in the acceptable level.
Primary data will be collected through George and Mallery (2003) provide the
questionnaires as well as through personal. following rules of thumb: ― > 0.90 – Excellent,
Secondary data will be collected from published > 0.80 – Good, > 0.70 – Acceptable‖ (p. βγ1).
books, journals, and other documents As a rule of thumb, the cutoff value for item to
Sampling Design total correlation is 0.30 and above, and alpha if
The survey is proposed to conduct only on the deleted value should be less than overall
target population of the selected hospitals. The Cronbach‘s alpha coefficient for any item to be
retained in the scale. However, if alpha if socio-economic categories of respondents. This
deleted value is less than overall Cronbach‘s is carried to know whether the respondents
alpha, and item to total correlation is a bit less regardless of the difference in socio-economic
than 0.30 (>= 0.25), then the item can be characteristics have perceived the behavior of
considered for retaining in the measurement doctors and nurses in similar manner or not. If
scale. there is similarity in the perception regardless of
Next to reliability analysis, data pertaining to the socio-economic characteristics then final
behavior of doctors are exposed to principal perceived status based on the entire sample
components of factor analysis with varimax regarding the doctors‘ as well as nurses‘
rotation to identify the primary behaviours of behavior will be irrefutable and conclusive. The
doctors. The perceived status of primary results of the analysis are tabulated and
behaviours are then compared across different discussed in the remaining part of this chapter.
Table .1 Results of Reliability Test for Scale Items Measuring Behaviour of Doctors
Item No
Item to
Alpha if
Description of Scale Items Total
Deleted
Correlation
1 The level of communication between patient and doctors 0.3657 0.7846
2 Time spend by doctors with patient 0.5546 0.7631
3 Advice given by doctor about ways to avoid illness 0.4579 0.7738
4 Explanation given by doctors about the cause of disease 0.4921 0.7696
Explanation given as reason for different medical test to be
5 0.3889 0.7819
made
6 Care taken by doctor to check everything 0.4331 0.7767
7 Providing information about condition and treatment 0.5373 0.7637
The level of understanding on language and medical terms
8 0.4590 0.7737
used by doctors
9 Trust worthiness, reliability and honesty of doctors 0.6060 0.7548
Routine preliminary test taken prior to admission of the
10 0.3261 0.7890
patient
Cronbach‘s Alpha Reliability Coefficient 0.7913
Source: Primary Data
From Table 1, which presents the reliability doctors‘ behaviors. The eigenvalue produced
analysis for items in the scale measuring by the factor analysis is nothing but variance
behavior of doctors, it understood that ‗item to explained in (extracted from) the actual original
total correlation‘ for all items is above 0.30 and data by an underlying factor. The size of the
alpha if deleted value is below the overall eigenvlaue determines how many factors are
Cronbach alpha coefficient of 0.7913. Hence, extractable (valid) from the actual data.
all 10 items in the scale used in the present study According to Kaiser Rule, a factor with
for measuring behavior of doctors towards eigenvalue of one or above is considered as a
patients are reliable and valid. valid factor.
Table 5.2 and 5.3 provides the results of factor
analysis of the items in the scale measuring

TABLE NO .2 Eigenvalues of Factors Underlying Behaviour of Doctors
Cumulative % of
Factors Eigenvalue % of Total Variance
Total Variance
1 3.54 35.36 35.36
2 1.46 14.58 49.93
3 1.02 10.19 60.13
4 0.85 8.47 68.60
5 0.73 7.34 75.94
6 0.64 6.43 82.38
7 0.61 6.10 88.47
8 0.51 5.14 93.61
9 0.39 3.89 97.51
10 0.25 2.49 100.00
Source: Primary Data
In Table 5.2, it can be seen that the eigenvalue reveals that there are three factors underlying the
of first, second and third factors is above one, behaviours of doctors and these three factors can
explaining 35.56 per cent, 14.58 per cent and be extracted for further analysis. To know the
10.19 per cent of the variance in the actual data. characteristics of each one of the valid factors,
All these factors together could posses 60.13 per loadings of items in the scale with these factors
cent of the essence of actual data. This further are used.
TABLE NO.3 Factor Loadings of Items with Extracted Factors Underlying Behaviour of Doctors
(After Varimax Rotation)
Item No
Description of Scale Items Factor 1 Factor 2 Factor 3
7 Providing information about condition and treatment 0.8581 -0.0154 0.1670
2 Time spend by doctors with patient 0.8204 0.0363 0.1692
9 Trust worthiness, reliability and honesty of doctors 0.6042 0.2693 0.3322

The level of communication between patient and
1 0.6694 0.1701 -0.1276
doctors
Routine preliminary test taken prior to admission of
10 -0.0190 0.8618 0.0517
the patient
3 Advice given by doctor about ways to avoid illness 0.1152 0.8196 0.1682
6 Care taken by doctor to check everything 0.3400 0.4540 0.1869

Explanation given as reason for different medical test
5 0.0653 0.1150 0.8104
to be made
The level of understanding on language and medical
8 0.2432 0.1070 0.7134
terms used by doctors

Explanation given by doctors about the cause of
4 0.3247 0.2850 0.4981
disease
Explained Variance 2.5207 1.8295 1.6627
% of Total Variance 25.21 18.30 16.63
Cumulative % of Total Variance 25.21 43.50 60.13
Providing Preliminary
informatio test prior to Giving reasons
n about admission & for conducting
Factor Label
condition Advising different
and patients to medical test
treatment avoid illness
Source: Primary Data. Boldfaced are high factor loadings.
From Table 5.3, which provides the loadings of with highest loadings, the first, second and third
items in the scale with each one of the extracted factors is identified as the factors possessing the
factors, it is understood that the first factor is behaviours of the doctors in respect of
highly loaded with items 7 (Providing ―Providing information about condition and
information about condition and treatment), 2 treatment‖, ―conducting Preliminary test prior to
(Time spend by doctors with patient), 9 (Trust admission & advising patients to avoid illness‖,
worthiness, reliability and honesty of doctors) and ―Giving reasons for conducting different
and 1 (The level of communication between medical test‖. The perceived status of above
patient and doctors), second factor is loaded these three primary behaviours of doctors is
with items 10 (Routine preliminary test taken evaluated based on the entire sample as well as
prior to admission of the patient), 3 (Advice across sub-sample groups based on their socio-
given by doctor about ways to avoid illness) and economic characteristics.
6 (Care taken by doctor to check everything), The mean of the entire sample is compared with
and third factor has high loadings of items 5 ‗γ‘, the value for neutral range using one-sample
(Explanation given as reason for different t-test to statistically identify the opinion range.
medical test to be made), 8 (The level of The independent sample t-test and one-way
understanding on language and medical terms ANOVA is used to compare the means of two
used by doctors) and 4 (Explanation given by groups and more than two groups respectively.
doctors about the cause of disease). Further, the Table 5.4 presents the mean opinion level of
loading of items 7 and 2 with first factor, items entire sample about primary behaviours of
10 and 3 with second and item 8 with third doctors in both private and government
factor is very high. Hence, based on the items hospitals.

TABLE NO .4 Behvariour of Doctors Based on Entire Sample
Factors Underlying
Mean SD t Value
Behaviour of Doctors
Providing information about condition and treatment 3.13 0.89 3.69***
Preliminary test prior to admission & Advising

3.05 0.87 1.40
patients to avoid illness
Giving reasons for conducting different medical test 2.92 0.87 -2.16**
**Significant at 5% level; ***Significant at 1% level.
An observation of the table shows that the mean in the sample have expressed neutral opinion
level of opinion of the entire sample with about ―Preliminary test prior to admission &
―providing information about condition and Advicing patients to avoid illness‖ (Mean =
treatment‖ (Mean = γ.1γ), is significantly higher 3.05, t value is insignificant). Hence, it is found
than the neutral level (t-value = 3.69, p < 0.01) that behavior of doctors in providing
whereas the opinion of the total sample information about condition and treatment is
regarding ―giving reasons for conducting good, giving reasons for conducting different
different medical test‖ (Mean = β.9β) is medical test is poor and conducting routine
significantly less than neutral level (t = -2.16, p preliminary test prior to admission and advising
< 0.05). On the other hand, the all respondents patients to avoid illness is neither poor nor good.
TABLE NO. 5 Comparison of Perceived Status of Doctors‟ Behaviours among Patient Groups by
Age
Factors Underlying Age (in Years)

F Value
Behaviour of Doctors 18-30 31-40 41-50 51-60 > 50
Providing information
3.48 2.99 3.01 3.16 3.11 5.18***
about condition and
(0.82) (1.09) (0.93) (0.69) (0.84)
treatment
Preliminary test prior to
3.19 3.07 2.93 3.15 3.00 1.87
admission & Advising
(0.67) (0.92) (0.86) (0.94) (0.87)
Giving reasons for
3.03 3.03 2.66 3.20 2.83 7.65***
conducting different
(0.83) (0.66) (0.96) (0.75) (0.95)
medical test
Figure in brackets are standard deviation; Degrees of freedom = 4, 595 for F values.
Table value for 4, 595 df @10 = 1.95, @5%= 2.35; @1% = 3.35
**Significant at 5% level; ***Significant at 1% level
As shown in Table 5.5, the mean scores across treatment‖, β.9γ to γ.19 for ―Conducting routine
age groups ranges from 2.99 to 3.45 for preliminary test prior to admission & Advising
―Providing information about condition and patients to avoid illness‖ and from β.66 to γ.β0
―Giving reasons for conducting different ―Giving reasons for conducting different
medical test‖. From significant F value of 5.18 medical test‖ differ by age while their opinion
(p < 0.01) and 7.65 (p < 0.01), it is understood about ―Conducting routine preliminary test prior
that the opinion of the respondents about to admission & Advising patients to avoid
behavior of doctors regarding ―Providing illness‖ is independent of the age.
information about condition and treatment‖ and
TABLE NO. 6 Comparison of Perceived Status of Doctors‟ Behaviours among

Patient Groups by Sex
Factors Underlying Sex
t Value
Behaviour of Doctors Male Female
Providing information about condition and 3.10 3.18 1.08
treatment (0.92) (0.85)
Preliminary test prior to admission & Advising 3.11 2.97 2.02**
patients to avoid illness (0.88) (0.84)
Giving reasons for conducting different medical 2.95 2.88 1.01
test (0.82) (0.94)
Figure in brackets are standard deviation; Degrees of freedom = 598 for t values.
Table value for 598 df @10 = 1.64, @5%=1.96; @1% = 2.58. **Significant at 5% level
From the comparison of opinion about medical test‖. At the same time, regarding
behaviour of doctors between male and female doctors‘ behavior in respect of ―Conducting
patients, results of which are presented in Table routine preliminary test prior to admission &
5.6, it is evident that both male and female Advising patients to avoid illness‖, the level of
regardless of the difference in sex have opinion of female group is significantly less than
perceived similarly about ―Providing that of male counterparts (t-value = 2.02, p <
information about condition and treatment‖ and 0.01).
―Giving reasons for conducting different
TABLE NO.7 Comparison of Perceived Status of Doctors‟ Behaviours among Patient Groups by
Education
Educational Status F Value
Factors Underlying
Behaviour of Doctors School Under
Illiterates Graduate
level Graduate
Providing information about 2.77 3.19 3.14 3.31 9.60***

condition and treatment (0.83) (0.80) (1.09) (0.73)
Preliminary test prior to admission

2.68 3.07 3.12 3.19 9.85***
& Advising patients to avoid
(0.83) (0.89) (0.86) (0.82)
illness
Giving reasons for conducting 2.58 3.02 2.99 3.01 7.94***

different medical test (1.07) (0.89) (0.73) (0.80)
Table value for 3, 596 df @10 = 2.09, @5%=2.61; @1% = 3.81. ***Significant at 1% level

When the opinion of the respondents compared much below 3 only for illiterates. Hence, it is
across categories by education using one-way found that perceived status of doctors‘ behavior
ANOVA test, results of which are depicted in among patients is poor according to illiterates
Table 5.7, it is understood that there is a and differ significantly from other educational
significant difference in the mean level of groups in this regard.
opinion across groups by educational status.
Table 5.8 presents the results of test comparing
This is because, F values, 9.60, 9.85 and 7.94 for
the mean perception between patient group in
the difference in group means are all significant
urban and rural areas.
at 1 per cent level. However, mean scores are
TABLE NO. 8 Comparison of Perceived Status of Doctors‟ Behaviours among

Patient Groups by Location
Factors Underlying Location
t Value
Behaviour of Doctors Urban Rural
Providing information about condition and 3.21 3.08 1.76*

treatment (0.84) (0.92)
Preliminary test prior to admission & Advising 3.06 3.05 0.15

patients to avoid illness (0.84) (0.88)
Giving reasons for conducting different medical 3.02 2.85 2.25**

test (0.81) (0.91)
Table value for 598 df @10 = 1.64, @5%=1.96; @1% = 2.58. *Significant at 10% evel;
significant at 5% level
From the results presented in the table, the mean and this level of opinion is significantly than that
level of opinion is significantly higher for urban of rural patient group. At the same time,
group regarding ―Providing information about regarding ―Conducting routine preliminary test
condition and treatment‖ (Mean = γ.β1 Vs γ.08 prior to admission & Advising patients to avoid
and t-value = 1.76, p < 0.10) and ―Giving illness‖, both urban and rural group have
reasons for conducting different medical test‖ perceived as neither poor nor good.
(Mean = 3.02 Vs 2.85 and t-value = 2.25, p < Table 5.9 provides mean opinion across
0.05)) compared to that of rural counterparts. respondent categories with different
That is, urban patients perceive ―Providing occupational status about behaviours of doctors
information about condition and treatment‖ as in hospital towards patients.
good and ―Giving reasons for conducting
different medical test‖ as neither good nor bad

TABLE NO.9 Comparison of Perceived Status of Doctors‟ Behaviours among Patient Groups by
Occupation
Occupational Status
Agriculturist
Unemployed
Professional
Business
Factors Underlying
Salaried
F Value
Behaviour of Doctors
Providing information
2.91 3.09 3.34 3.31 3.14 5.35***
about condition and
(0.82) (1.10) (0.84) (0.73) (0.85)
treatment
Preliminary test prior to
2.86 3.07 3.23 3.01 3.08 3.71***
admission & Advising
(0.93) (0.96) (0.75) (0.76) (0.84)
Giving reasons for
2.74 3.12 3.03 3.05 2.82 4.46***
conducting different
(0.96) (0.71) (0.75) (0.96) (0.93)
medical test
Table value for 4, 595 df @10 = 1.95, @5%= 2.35; @1% = 3.35. ***Significant at 1% level
According to the table, the mean perception of

the agriculture group against all three factors and 4.46 for the different in group means against all
that of unemployed against ―Giving reasons for three factors are significant at 1 per cent level.
conducting different medical test‖ is below the So, it is found that there is a significant
neutral level (below 3.0). The mean scores for difference in the perceived status of doctors‘
other occupational groups ranges between 3.01 behavior in hospitals among patients with
(for professional group regarding ―preliminary different occupational status.
test prior to admission & Advising patients to Regarding behavior of doctors in private and
avoid illness‖) and γ.γ4 (for salaried in respect government hospitals, the opinion of the patients
of ―Providing information about condition and is compared and results of the comparative
treatment‖. Further, F values 5.γ5, γ.71 and analysis are reported in Table 5.10.
Table 10 Comparison of Perceived Status of Doctors‟ Behaviours among Patient Groups by Sector
Factors Underlying Sector
t Value
Behaviour of Doctors Private Government
Providing information about condition and 3.41 2.86 7.84***
treatment (0.67) (1.00)
Preliminary test prior to admission & 3.31 2.79 7.79***
Advising patients to avoid illness (0.90) (0.75)
Giving reasons for conducting different 3.35 2.50 13.57***
medical test (0.64) (0.87)
Table value for 598 df @1% = 2.58 .***Significant at 1% level
As reported in the table, the behavior of doctors & advising patients to avoid illness‖, and
in government hospital is found to be poor as ―Giving reasons for conducting different
mean perception of the patients, which ranges medical test‖. The perceived status of above
between 2.50 and 2.86, is much less then neutral these three primary behaviours of doctors is
level (value of 3) against all three factors. At the evaluated based on the entire sample as well as
same time, mean perception of the patient group across sub-sample groups based on their socio-
belong to private hospitals ranging from 3.31 to economic characteristics. From analysis of the
γ.40 is well above γ (neutral level) and in ‗good‘ respondents regardless of their social status have
range. Moreover, the t-values, 7.84, 7.79 and expressed the same ‗poor‘ views, but there is a
13.57 for the difference in mean opinion level significant difference in the degree of poor
between private and government hospital patient opinion across respondents categories by age,
groups with regard to ―Providing information sex, education and occupation. It is finally
about condition and treatment‖, ―Conducting concluded that behavior of doctors is
routine preliminary test prior to admission & significantly better in private hospitals compared
Advising patients to avoid illness‖ and ―Giving to that of those in Government hospitals in the
reasons for conducting different medical test‖ villupuram district.
are significant at 1 per cent level. Therefore, it
is concluded that doctors‘ behavior in REFERENCES
Government hospital is poor whereas it is good 1. Krupat, E., Rosenkranz, S. L., Yeager, C. M.,
in private hospitals. Barnard, K.,Putnam, S. M., & Inui, T. S.
(2000). The practice orientations of
CONCLUSION physicians and patients: The effect of doctor–
In this study, an attempt was made to know patient congruence on satisfaction. Patient
whether the respondents regardless of the Education and Counseling, 39(1), 49–59.
difference in socio-economic characteristics 2. Bureau ofIndian Standard. Quality
have perceived the behavior of doctors. The Management and Quality System Elements:
perceived status of primary behaviours is then Guidelines for Services : IS : 14004 (part - 2),
compared across different socio-economic 1992.
categories of respondents, based on the items 3. Torres E. J. and Guo K. L., β004, ―Quality
with highest loadings, the first, second and third improvement techniques to improve patient
factors is identified which are ―Providing satisfaction‖ International Journal of Health
information about condition and treatment‖, Care Quality Assurance Vol. 17, No. 6, pp.
―conducting Preliminary test prior to admission 334-338.

DNA BARCODING, PHYLOGENETIC DIVERSITY STUDIES
OF ETROPLUS SURATENSIS FISH FROM
POORANANKUPPAM BRACKISH WATER, PUDUCHERRY
Sachithanandam V.1, Mohan P.M.1, Muruganandam N.2, Chaaithanya I.K.2,
Arun Kumar P3, Siva Sankar R3
1
ijcrr Department of Ocean Studies and Marine Biology, Pondicherry University,
Vol 04 issue 08 Andaman
2
Regional Medical Research Centre (ICMR), Andaman
Department of Ecology and Environmental Sciences, Pondicherry University,
Received on:29/01/12 Puducherry
Revised on:16/02/12
E-mail of Corresponding Author: pmmtu@yahoo.com
ABSTRACT
Etroplus suratensis is known for the high commercial value fish available in South India. The
identification of the species of this fish cumbersome and inaccurate in different life stages of the fish.
Therefore, DNA sequence of cytochrome Oxidase subunit I gene was analysed for the species
identification and phylogenetic relationship of the species. The average genetic distance of conspecifics
species value was found to be 0.005%. The present work suggests that COI sequence provides sufficient
information on phylogenetic and evolutionary relationship to distinguish the Etroplus suratensis species,
the brackish waters species of pearl spots, unambiguously. Further, this work revealed that every species
having individual genetic distances depended upon the environmental stress and water quality, which play
an important role for its minor morphometric variations. Therefore, it was concluded that a DNA COI
barcoding tool can be used for fish identification by non technical personnel (other than taxonomist).
____________________________________________________________________________________
Keywords: DNA barcoding, COI, brackish of more than US$ 3/kg2. These fish is available
water, Pooranankuppam and Etroplus suratensis throughout the year. The average production is
about 1000 kg/ha/year over 8-10 month grow-
INTRODUCTION out period.
The chromids or the pearl-spots (Family: Morphometric studies are not only essential to
Cichlidae) form an important group among the understand the taxonomy but also the health of a
brackish water fishes of the tropics. One of the species (including reproduction) in an
genus Etroplus contains E. suratensis fish is environment. The morphometric features of the
inhabitant in fresh water and brackish water in fish are unique to the species whereas the
southern India. E. suratensis has many desirable variations in its feature are probably related to
features which make them ideal fishes for the habit and habitat3.
aquaculture like wide salinity tolerance, ability Morphometric measurements have been widely
to breed in confined waters, fast rate of growth, used to discriminate populations of various fish
good body weight, tasty flesh, highly adaptable species4-6. Fishes are considered to be
feeding habits, robust, sturdy body1. phenotypically more variable than most other
Experimental cultures of this species show its vertebrates, having relatively higher within-
potential for polyculture and integrated farming population coefficients of variation of
with poultry. In addition to export, it has high phenotypic characters. Genetic polymorphism or
demand in the local market and fetches a price environmental factors may induce
morphological variability among spatially vulnerability to exploitation of tropical reef
separated fish populations7, and phenotypic fishes19.
plasticity in fish morphology has been As the morphometric measurements could lead
documented for various species, including to misidentification of the species in different
cichlids8,9. E. suratensis is known to have life stages of fish especially E. suratensis, which
variations in various morphological features would affect the conservation strategy and the
which are dependent on the geographical market value of the same. Molecular taxonomy
partition. Further environmental comparisons of appears to be the best tool for the species
these estuaries would be worthwhile in identification and advantageous over the other
understanding the evolution of such variations. method of taxonomy, so the effort was taken to
In addition, genetic investigations of the identify the E. suratensis through molecular
variation and differentiation involving more taxonomy.
estuarine samples of E. suratensis will be useful
in substantiating the conclusions. The genotypic METHODS
and phenotypic variation of species is a pre- Study Area, Sample collection and
requisite in conserving them. DNA barcoding is preservation:
highly efficient method in the analysis of genetic Fishes were collected from local fish landings at
divergences among species as well as for intra Pondicherry brackish area of Pooranankuppam
species-level identifications10. (Fig.1). The identification of fishes was done as
Among the marine living organisms of the Indo- described in FAO14. A piece of muscle in the
West Pacific, Teleosts are among the best- lateral line was collected and stored in 95%
described, even though their systematics and ethyl alcohol at -20 C for DNA extraction. The
taxonomy still need considerable research DNA Isolation and PCR condition work was
effort11,12. Southeast Asia has been identified as carried out in Department of Ocean studies and
one of the world‘s biodiversity hotspots based Marine Biology centre at Port Blair, Andaman
on both plant and animal diversity13. Many time and Nicobar Islands.
taxonomic ambiguities exist due to Molecular Taxonomy:
morphological and meristic similarities. Modern Total DNA extracted from 0.25g of muscle by
taxonomic work includes analysis of a host of the standard proteinase-K/ phenol-chloroform-
other traits, including anatomy, physiology, isoamyl alcohol-ethanol method20. PCR
behaviour, genes, and geography, yet amplification of a 650bp DNA fragment coding
morphological traits remain cornerstone14. COI gene of the mitochondrial (mt) DNA
In such circumstances, DNA barcodes has genome was amplified using published primer
revealed that this could be helpful even for set11. PCR components and conditions for 50 l
larval stage fish taxonomical identification15. To reaction were as described in our previous
facilitate DNA barcode identification of fishes, work21. The PCR product was resolved in 1%
regional working groups are conjoining under Agarose gel and visualized using Gel Doc
the Fish Barcode of Life (FISH-BOL) System, to confirm the presence of amplified
initiative16, which seeks to establish a barcode product sized 650 bp. Nucleotide sequencing
reference sequence library for all fishes17. The was performed using BigDye Terminator Cycle
phylogenetic systems, in combination with Sequencing kit, following manufacturer‘s
conservation genetics, provide a critical frame instructions (Applied Bio-systems, Foster City,
work for understanding diversity18 and predict CA, USA).
Sequence Analysis: The NJ and K2P genetic distances were created
The DNA sequences of phenotypically identified to provide a graphic representation of the
fishes were assembled using the SeqMan II patterns of divergences. Two distinct clad with
version 5.03 (DNASTAR). The sequence of two sub clad of the same species were
Etroplus suratensis reference sequences recognized with more than 90% bootstrap value.
retrieved from the NCBI GenBank were aligned These two sub clad formation was identified
using Clustal W pair-wise and multiple based on the independent assemblages of close
alignment of MEGA version 4.122. Sequence related species with differences in region and
divergence was calculated using the Kimura 2- environmental closeness. The results clearly
parameter (K2P) model23 and the mid-point shows that every species having individual
rooted Neighbour-joining (NJ) tree of K2P genetic distances depended upon survival of any
distances was created to provide a graphic species adaptation of the environmental stress
representation of the species divergence24 (Fig. and its water quality, which play an important
2). role of significant values of the genetic distances
internally and morphometric minor variations
RESULTS externally.
DNA barcoding is a unique concept with many
innovative attributes undertakes continuous DISCUSSION
improvement in taxonomy. The estimated Fishes are largest group of vertebrates, which
Etroplus suratensis species DNA sequences exhibits remarkable diversity of morphological
were submitted to GenBank under the attributes and biological adaptations25. In these
mentioned accession number in Table 1. NCBI circumstances fish taxonomist facing a large
BLASTn result revealed that 21 reference problems while the identification of fishes. To
sequences were matched with maximum identity overcome this problem, a morphology- based
of Etroplus suratensis of Puducherry as identification combined with molecular based
described in Table 2. The average genetic approach for the species identification using
distance within the species (K2P) is 0.005. DNA barcoding would be an ideal tool26. This
The species genetic evolutionary pair wise tool is an efficient method for species-level
distance proximity was calculated by the species identification of the mitochondrial Cytochrome c
similarity of genetic base pair. The Etroplus Oxidase I (COI) gene27. Mitochondrial DNA
suratensis DOSMB species closely related to the (mtDNA) has been widely employed in
species (FJ237544 – 0.006: GU5666028 – phylogenetic studies of animals because it
0.006: FJ347966 – 0.006 and AY263870 – evolves much more rapidly than nuclear DNA,
0.009) in the Indian waters and USA resulting in the accumulation of differences
respectively (Table 3). The nucleotide between closely related species 28-30.
composition of Etroplus suratensis from the This study provides the interspecific
present studied species is A = 23.4%, T = heterogeneity which enhanced the efficiency of
29.9%, G = 18.6% and C = 28.1%. The average species identification through bar coding. This
nucleotide composition of E. suratensis among was proved in Australian marine fishes11,
the species level is noted as A = 23.48%, T = freshwater fish barcoding from Canadian31 and
30.08%, G = 18.1% and C = 28.36% (Table 4, carangid fishes from Indian waters32. The
Fig.3). variations of phenotypic character of species are
unique and it is probably related to the habit and
habitat among the variants of this species33. also informed that every species having
Genetic variation of the green chromid has not individual genetic distances depended upon the
been studied previously of the genus E. environmental stress and water quality which
suratensis in Indian waters. play an important role for its minor
In the studies of bar coding, it has been reported morphometric variations. Moreover, the mtDNA
that K2P values between two species should be COI gene based identification provides high
greater than 0.0227,34 and in e.g. Indian mosquito resolution in species identification in fishes.
DNA barcoding average K2P values is 0.032935.
The present bar code exhibited K2P pair wise ACKNOWLEDGMENTS
genetic distances variation among the species The Authors express their sincere acknowledges
level is 0.005. However, such variation has to Prof. J. A. K. Tareen, Vice-Chancellor of
greater impact on the survival of the haplotypes Pondicherry University and the constant help
and its evolution. and encouragement of Dr. P. Vijayachari,
The efficiency of species identification by Director, Regional Medical Research Centre
molecular method was enhanced by the (ICMR), Port Blair for the extension of facility
interspecific heterogenetic relationship during this study. The manuscript valuable
displayed36. Based on the above investigation it review and commands supported by Chandal Lal
is clearly evident that the E. suratensis identified and Sayi Dev. We express thanks to the
in Puducherry waters represented the haplotypes Pondicherry University and Central Marine
species morphometrically, the other part of the Living Resources and Ecology (CMLRE) for
India and USA waters. However, bar code funding this work. Authors acknowledge the
results suggested that they are genetically varied. immense help received from the scholars whose
Since, this species identified as haplotypes it articles are cited and included in references of
may be of low level differences in this manuscript. The authors are also grateful to
morphometrically because of low genetic authors/ editors/ publishers of all those articles,
distances. Results of phylogenetic and journals and books from where the literature for
evolutionary relationship of present study were this article has been reviewed and discussed.
supported by earlier studies11. Further, it has also
confirmed that the DNA barcoding help to REFERENCES
recover phylogenetic information and to 1. Hora, S. L and PilIay, T. V. R. (1962).
understand the relationship with the species as Hand·book on the fish culture in the
well as Order level36. The present study also Indo·Pacific region. FAO Fish. BioI. Tech.
supported that mtDNA COI barcode region pp. 14:124.
offers best species identification, which is most 2. James, C. M. (2000). Potential of marine
applicable and comparable with the mtDNA 12S fish farming in India:
- 16S rRNA region sequences37. www\Grp\Grouper\Research\Economics\20
00\2103.htm pp. 1-3.
CONCLUSION 3. Mauro José Cavalcanti., Leandro Rabello
The study concludes that the fish which Monteiro and Paulo Roberto Duarte Lopes.
identified morphometrically and DNA barcoding (1999). Landmarkbased Morphometric
method using COI gene sequence are one and Analysis in Selected Species of Serranid
same species of E. suratensis, the brackish Fishes (Perciformes: Teleostei) Zool.stud.
waters species of pearl spots. Further, this result 38: pp. 287294.
4. Elliott, N. G., Haskard, K. and Koslow J. A. 12. Knowlton, N. (2000). Molecular genetic
(1995). Morphometric analysis of orange analyses of species boundaries in the sea,
roughy (Haplostethus atlanticus) off the Hydrobiologi 420: 73–90.
continental slope of southern Australia. 13. Myers, N., Mittermeier, R. A., Mittermeier,
Journal of Fish Biology 46, 202-220. C. G., Fonseca G. A. B. and Kent, J. (2000).
5. Uiblein, F. (1995). Morphological Biodiversity hotspots for conservation
variability between populations of priorities. Nature 403: 853–858.
Neobythites stefanovi (Pisces: Ophidiidae) 14. Fish Base. (2004). FishBase. World Wide
from deep Red Sea and Gulf of Aden. Web electronic publication www.
Marine Ecology Progress Series 124: 23-29. Fishbase.org.
6. Hurlbut, T. and Clay, D. (1998). 15. Packer, L., Gibbs, J., Sheffield, C. and
Morphometric and meristic differences Hanner, R. (2009). DNA barcoding and the
between shallow and deep-water populations mediocrity of morphology. Molecular
of whitehake (Urophycis tenuis) in the Ecology Resources, 9: 42–50.
southern Gulf of St. Lawrence. Canadian 16. Swartz, E. R., Mwale, M. and Hanner, R.
Journal of Fisheries and Aquatic Sciences (2008). A role for barcoding in the study of
55: 2274-2282. African fish diversity and conservation.
7. Carvalho, G. R. (1993). Evolutionary South African Journal of Science, 104: 293–
aspects of fish distribution: genetic 298.
variability and adaptation. Journal of Fish 17. Ward, R. D., Hanner, R. H. and Hebert, P.
Biology 43 (Supl. A), 53-73. D. N. (2009). The campaign to DNA
8. Wimberger, P. H. (1991). Plasticity of jaw barcode all fishes, FISH-BOL. Journal of
and skull morphology in the neotropical Fish Biology, 74: 329–356.
cichlids Geophagus brasiliensis and G. 18. Jean-Pierre Fe´ral. (2002). How useful are
steindachneri. Evolution 45, 1545-1561. the genetic markers in attempts to
9. Wimberger, P. H. (1992). Plasticity of fish understand and manage marine biodiversity?
body shape. The effects of diet, Journal of Experimental Marine Biology
development, family and age in two species and Ecology, 268: 121– 145.
of Geophagus (Pisces: Cichlidae). 19. Simon Jennings., John, D. R., Nicholas, V.
Biological Journal of the Linnaean Society C. and Polunin. (1999). Predicting the
45, 197-218. Vulnerability of Tropical Reef Fishes to
10. Suneetha Gunawickrama, K.B. (2007). Exploitation with Phylogenies and Life
Morphological heterogeneity and population Histories. Conservation Biology., 13: 1466-
differentitation in the green chromid 1475.
Etroplus suratensis (pisces: Cichlidae) in Sri 20. Sambrook, J., Fritsch E. F. and Maniatus, T.
Lanka, Ruhuna journal of Science, 2: 70-81. (1989). Molecular Cloning: A Laboratory
11. Ward, R. D., Zemlak, T. S., Innes, B. H., Manual, second edition. Cold spring Harbor
Last, P. R. and Hebert, P. D. N. (2005). Laboratory press, Cold Spring harbour, New
DσA barcoding Australia‘s fish species, York.
Philos. Trans. R. Soc. B., 360: 1847–1857. 21. Sachithanandam, V., Mohan, P. M., Dhivya,
P., Muruganandam, N., Baskaran, R.,
Chaaithanya, I. K. and Vijayachari, P.
(2011). DNA barcoding, phylogenetic
relationships and speciation of Genus: Mindell, editor. Avian molecular evolution
Plectropomus in Andaman coast Journal of and systematics, New York: Academic
research in Biology 3: 179-183. Press. pp. 214–247.
22. Tamura, K., Dudley, J., Nei, M. and Kumar, 31. Hubert, N., Hanner, R., Holm, E., Mandrak,
S. (2007). MEGA4: Molecular Evolutionary N.E., Taylor, E., Burridge, M., Watkinson,
Genetics Analysis (MEGA) software version D., Dumont, P., Curry, A., Bentzen, P.,
4.0. Molecular Biology and Evolution 24: Zhang, J., April, J. and Bernatchez, L.
1596-1599. (2008). Identifying Canadian freshwater
23. Kimura. (1980). A simple method for fishes through DNA barcodes. PLos ONE, 3:
estimating evolutionary rate of base 2490–2490.
substitutions through comparative studies of 32. Persis, M., Reddy, A. C. S., Rao, L. M.,
nucleotide sequences. Journal of Molecular Khedkar, G. D., Ravinder, K. and
Evolution 15: 111–120. Nasruddin, K. (2009). COI (cytochrome
24. Saitou, N. and Nei, M. (1987). The oxidase-I) sequence based studies of
neighbour-joining method: A new method Carangid fishes from Kakinada coast, India.
for reconstructing phylogenetic trees. Molecular Biology Report. 36: 1733-1740.
Molecular Biology and Evolution 4: 406- 33. Manimegalai, M., Karthikeyeni, S., Vasanth,
425. S., Arul, G. S., Siva, V. T. and Subramanian,
25. Nelson, J. S. (2006). Fishes of the World, P. (2010). Morphometric Analysis – A tool
fourth ed. John Wiley & Sons, Hoboken, NJ. to identify the different variant in a fish
26. Steinke, D., Zemlak, T. S., Boutillier, J. A. species E. Maculatus. International journal
and Hebert, P. D. N. (2009). DNA barcoding of Environmental Sciences, 1: 1-17.
of Pacific Canada‘s fishes. Mar. Bio 156: 34. Hebert, P. D. N., Cywinska, A., Ball, S. L.
2641–2647. and DeWaard, J. R. (2003b). Biological
27. Hebert, P. D. N., Ratnasingham, S. and identifications through DNA barcodes. Proc
DeWaard, J. R. (2003a). Barcoding animal R Soc Lond B Biol Sci 270: 313–321.
life: Cytochrome c oxidase subunit 1 35. Kumar, N. P., Rajavel, A. R., Natarajan R.
divergences among closely related species. and Jambulingam, P. (2007). Morphology,
Proc R Soc Lond B Biol Sci 270: S596– Systematics, Evolution DNA barcodes can
S599. distinguish species of Indian Mosquitoes
28. Brown, W. M., George, M. and Wilson, A. (Diptera: Culicidae). Journal of medical
C. (1979). Rapid evolution of animal Entomol 44: 1-7
mitochondrial DNA. Proc Natl Acad Sci 36. Lievens, S., Goormatching, S. and Holsters,
USA 76: 1967–1971. M. (2001). A critical evaluation of
29. Moore, W. S. (1995). Inferring phylogenies differential display as a tool to identify
from mtDNA variation: Mitochondrialgene genes involved in legume nodulation:
trees versus nuclear-gene trees. Evolution, looking back and looking forwared. Nucl.
49: 718–726. Acids Res, 29: 3459 – 3468.
30. Mindell, D. P., Sorenson, M. D., 37. Ward, R. D., Holmes, B. H., White, W. T.
Huddleston, C. J., Miranda, H. C. and and Last, P. R. (2008). DNA barcoding
Knight, A., et al. (1997). Phylogenetic Australian chondrichthyans results and
relationships among and within select avian potential uses in conservation. Marine and
orders based on mitochondrial DNA. In: DP Freshwater Research 59: 57-71
Table 1 Etroplus suratensis species and their mtDNA COI Sequences GenBank accession Number
Sl No Name of the species Common Name NCBI GenBank Number

1 Family:Cichlidae - Pearl spots - chromids JN228382
Etroplus suratensis
Table 2 BALSTn SEARCH REQUEST AND RESULTS COI PUBLIC RECORDS DATABASE:
Table 2a Identification Summary:

Taxonomic Level Taxon Assignment Probability of Placement (%)
phylum Chordata 100
class Actinopterygii 100
order Perciformes 100
family Cichlidae 100
genus Etroplus 100
species Etroplus suratensis 99.1
Table 2b A species level match has been made

Sl. Order Family Genus Species Specimen
σo‘s Similarity
(%)
1 Perciformes Cichlidae Etroplus suratensis 99.07
4 Characiformes Characidae Pseudocorynopoma doriae 85.23
5 Perciformes Haemulidae Pomadasys hasta 82.33
10 Characiformes Alestidae longipinnis longipinnis 82.31
11 Characiformes Alestidae longipinnis longipinnis 82.27
12 Perciformes Cichlidae Paretroplus damii 82.25
13 Perciformes Cichlidae Etroplus maculatus 82.22
14 Characiformes Alestidae longipinnis 82.19
15 Beloniformes Hemiramphidae Hyporhamphus quoyi 82.18
16 Perciformes Lutjanidae Lutjanus johnii 82.18
17 Beloniformes Hemiramphidae Hyporhamphus limbatus 82.18

Table 3 Kimura two parameter Genetic distances
Sl.No Species Name/ GenBank No‟s K2P Country
1 Etroplus suratensis DOSMB 0.000 Pondicherry
2 FJ237544-Etroplus suratensis 0.006 India" 10.02 N 76.13 E
3 FJ347966 Etroplus suratensis 0.006 India" 10.02 N 76.13 E
4 GU566028-Etroplus suratensis 0.006 Kerala, India"
5 AY263870 Etroplus suratensis 0.007 USA
Average Interspecific K2P Distances is 0.005
Table 4 Nucleotide composition:

Sl. No Species Names and GenBank nos. T% C% A% G%
1 Etroplus suratensis DOSMB 29.9 28.1 23.4 18.6
2 FJ237544 Etroplus suratensis 30.4 28.4 23.4 17.9
3 AY263870 Etroplus suratensis 30.2 28.0 23.6 18.2
4 FJ347966 Etroplus suratensis 30.5 28.2 23.4 17.9
5 GU566028 Etroplus suratensis 29.4 29.1 23.6 17.9
Average base pair composition 30.08 28.36 23.48 18.1
Fig 1 Study Area

Fig 2 Kimura two parameter (K2P) Genetic distances Values
Fig 3 Nucleotide composition of E. suratensis with references sequences species.

69 Etroplus suratensisDOSMB
AY263870-Etroplus suratensis
100 FJ237544-Etroplus suratensis
GU566028-Etroplus suratensis
FJ347966-Etroplus suratensis
DQ119195-Herotilapia multispinosa
100 HQ654752-Parachromis managuensis

100 HQ654751-Parachromis managuensis
GU817266-Australoheros facetus ssp
HQ956111-Scorpaeniformes sp.
54
FJ583406-Forcipiger flavissimus
100
74
70 HM882986-Hepsetus odoe
HM882985-Hepsetus odoe
100
HM882978-Hepsetus odoe
HQ573341-Perciformes sp.
Fig 4 Neighbour-Joining (NJ) Method for Phylogenetic analysis and Evolutionary relationships of
E. suratensis with NCBI references sequence The bootstrap test (1000 replicates) is shown next to
the branches length is = 0.41765812 [Felsenstein 1985]. The evolutionary distances were computed
using the Maximum Composite Likelihood method. Codon positions included were 1st+2nd+3rd.
Phylogenetic analyses were conducted in MEGA4 [Tamura, et al 2007].

IS SKELETAL MUSCLE „A TARGET ORGAN‟ IN LONG
TERM UNCONTROLLED DIABETES MELLITUS? A
COMPARATIVE AND CORRELATIVE STUDY OF TYPE I
AND TYPE II DIABETES
Prathamesh Haridas Kamble1, Sunil Bhamre2
ijcrr 1
Dept. of Physiology; B.J.Medical College, Pune
Vol 04 issue 08 2
Dept. of Microbiology; B.J.Medical College, Pune
Category: Research
E-mail of Corresponding Author: dr.prathamesh81@gmail.com
Revised on:16/02/12
ABSTRACT
Background and Objective: Diabetes Mellitus is the most common endocrinal disorder worldwide.
Long term uncontrolled diabetes is associated with complications of eyes, kidney, heart, blood vessels
and nerves. Studies have been carried out to see the effect of diabetes on skeletal muscle strength but the
results are conflicting; while very few studies have considered the muscle endurance. Moreover, the
correlation of glycosylated haemoglobin levels (HbA1c) with handgrip strength (HGS) and hand grip
endurance (HGE) has not been studied. So the present study was carried out in 100 type I diabetics and
164 type II diabetics to compare the HGS and HGE with 100 and 160 normal healthy non diabetic
subjects respectively. Also the objective of this study was to determine the relation of HbA1c with HGS
and HGE. Research Methodology: HGS and HGE were measured using Handgrip dynamometer.
HbA1c was assessed by cation - exchange resin method using Monozyme‘s Glycohemin kit on
Transasia‘s semiautoanalyzer. Outcome of Study: Results of the study showed that type I & II diabetics
had significantly lower HGS than non diabetics. HGE was lower in type II diabetics while it was
significantly higher in type I diabetics as compared to controls. This study also indicated that HGS and
HGE had no significant correlation with HbA1c. Thus present study reveals that uncontrolled diabetics
are at a risk of decreased muscle strength and endurance and the magnitude of affection is highly
individual specific. Thus there is a need for development of strategies in the form of strict glucose control
and resistant training exercise program to slow or prevent rapid decline in muscle function in diabetics.
____________________________________________________________________________________
Keywords: Handgrip strength, Handgrip prevalence rate of Diabetes Mellitus (DM) for
endurance, glycosylated haemoglobin, diabetes. all ages was about 2.8 % in 2000 and projected
to be 4.4 % in 2030 [1]. The chronic
INTRODUCTION hyperglycemia and its associated metabolic
Diabetes mellitus is the most common endocrine deregulation, is associated with potential long
disorder. It is a syndrome of impaired term complications that can affect various
carbohydrate, fat and protein metabolism which tissues like kidney, eye, heart, blood vessel and
is characterized by hyperglycemia caused by nerve. [2] There is a new concept to explain
either reduced insulin secretion or decreased these long term complications of DM called as
sensitivity of tissues to insulin. The worldwide ‗hyperglycemic memory‘ which proposes that if
a cell remains in hyperglycemic environment for
certain duration, then it adapts to work in the A) Group I, B) Group II.
hyperglycemic state. [3] Meticulous control of A) Group I: Based on detailed history and
blood glucose can decrease the symptoms and physical examination, subjects were further
improve the diseased condition. Even after the divided into two sub-groups: (i) Type I diabetic
return of plasma glucose to normal or near group: Comprised of 100 male subjects in the
normal level, the progression of long term age group of 31-45 years, having duration of
diabetic complications still continues. [4] Thus, diabetes between 5-10 years, regularly visiting
measurement of glycosylated hemoglobin the diabetic clinic and taking regular insulin
(HbA1c), which provides the information about therapy, were selected. (ii) Control I group: For
the average blood glucose concentration over comparison, a separate group of 100 healthy
preceding 6-8 weeks, is a good indicator of long subjects, with no history of diabetes or disorder
term complications of diabetes mellitus. of defective sugar metabolism, was selected.
The possibility that the skeletal muscle is also a They belonged to the same age group and nearly
target organ for diabetic complication was had the same height, built, socioeconomic status
suggested by Sayer A A et al who found reduced and ethnic group, as that of type I diabetic group
muscle strength and impaired physical function subjects.
in Type 2 diabetes. [5] There have been many B) Group II: Similarly, on the basis of detailed
studies of handgrip strength in diabetic patients history and physical examination, subjects were
with conflicting results. Many reports have further divided into two sub-groups (i) Type II
suggested possible patho-physiological diabetics group: 164 males, belonging to age
mechanism also. Reduction in handgrip strength group of 41-55 years, having duration of
is generally found in diabetics. [6, 7, 8] It seems diabetes between 5-10 years, regularly visiting
that reduction in handgrip strength has a linear the diabetic clinic and taking only oral anti
relationship with severity of diabetes which in diabetic drugs regularly, were included. (ii)
turn is in linear relationship with functional Control II group: A group of 160 healthy non
ability of daily living activities. However, at the diabetic male subjects in the age group of 41-55
present time there are no reports of functional years and having nearly the same height, weight,
limitations in daily activities ascribable to built, ethnicity and socioeconomic status were
diabetes. The present study attempts to compare selected.
handgrip strength and handgrip endurance in Subjects, who were left handed, involved in
type I, type II diabetics and normal subjects regular handgrip exercise or constant method of
(controls), to evaluate whether there is any working with handgrip or suffering from asthma,
correlation between glycosylated haemoglobin chronic obstructive pulmonary diseases,
(HbA1c) and magnitude of reduction in hand congestive cardiac failure, Myasthenia gravis
grip strength and endurance in type I and type II and hypothyroidism, were excluded from the
diabetic patients. study. Also factors that interfere with HbA1c
test results like diagnosed cases of
MATERIAL AND METHODS hyperbilirubinemia and chronic alcoholism were
The present study was carried out in the diabetic excluded from the study.
clinic in Indira Gandhi Government Medical After selection, written informed consent was
College and Mayo hospital, Nagpur. The obtained from all the participants. Then
Institutional Ethics Committee approved the anthropometric measurements like standing
study. The study was divided into two groups: height and weight were taken. Early morning 5
cc fasting blood sample was obtained under all for Group 2 (type II DM and control II) it was
aseptic precautions. Serum was separated and 48.1 and 46.4. There was no significant
fasting blood sugar and glycosylated difference in the age of Group 1 and Group 2.
haemoglobin levels (HbA1c %) were estimated. Thus both the groups were age matched.
Blood sugar levels were assessed by glucose There was no significant difference in height,
oxidase biosensor method using glucometer and weight, BSA and BMI; indicating that the
glycosylated haemoglobin levels (HbA1c %) groups were homogenous in this respect.
were assessed by cation - exchange resin method Fasting and post meal blood sugar levels were
using Monozyme‘s Glycohemin kit on higher in type I and type II diabetics than
Transasia‘s semiautoanalyzer. respective controls.
Handgrip strength was determined by using For HbA1c the normal reference value is < 6 %.
handgrip dynamometer. The use of this [4] It was observed that for both type I and type
instrument was illustrated to participants prior to II diabetics, HbA1c was on a statistically higher
testing. Handgrip dynamometer was given in the side than controls indicating poor control of long
right hand of subjects in standing position and term blood sugar levels.
arm by their side, not touching the body and The handgrip strength (HGS) was significantly
were asked to squeeze the dynamometer with as lower in type I and type II diabetics as compared
much force as possible, taking care to squeeze to controls. Handgrip endurance (HGE) was
only once for each measurement. 3 trials were significantly higher in type I diabetic subjects as
performed with a pause of about 10- 20 seconds compared to controls, while for type II diabetics,
between each trial to avoid the effect of fatigue. HGE was lower than the controls.
Best amongst the 3 measurements was noted. Table II depicts the correlation of Handgrip
The handgrip endurance was also measured. The strength and Handgrip endurance with various
subjects were asked to maintain 80% of their parameters. It indicated that there was no
handgrip strength for as long as they could and statistically significant correlation existing
time in seconds was recorded using a stop between HGS and HGE with any of the
watch. parameters of present study for both Group I and
Group II diabetics. This shows that the
STATISTICAL METHODS magnitude of skeletal muscle strength and
The statistical analysis of observations was endurance changes produced due to uncontrolled
carried out. Mean and standard deviation were diabetes were based upon individual
calculated and significance of difference was susceptibility of subjects.
tested statistically by the unpaired student‘s ―t
test‖ at P ≤ 0.05. Correlation coefficient (r) was DISCUSSION
calculated and tested for statistical significance. The present study has demonstrated that both
type I and type II diabetic subjects had lesser
RESULTS muscle strength than non diabetics. This finding
Table no. 1 shows the various parameters and is consistent with the findings of Park SW [6],
their mean values and standard deviations for Savas S [7] and Lord SR [8].The probable
both type I diabetics and type II diabetics and explanations for this finding are: (1) diabetes is
their respective control groups. associated with increased systemic inflammatory
The mean age of Group 1 (type I DM and cytokines such as tumor necrosis factor α and
control I) was 37.8 years and 37.9 years, while interleukin-6. These cytokines have a
detrimental effect on muscle function. [9,10, 11] their lower endurance as compared to non
(2) Uncontrolled diabetics are associated with diabetics.
glycation of skeletal muscle proteins such as In the present study, there was no
actin and myosin leading to a significant linear correlation of glycosylated hemoglobin
reduction in vitro speed of actin and myosin (HbA1c %) with handgrip strength and handgrip
filament. [12] (3) Cotter M 1989 [13], Klueber endurance for both type I and type II diabetics.
KM 1989 [14] and Medina -Sanchez M 1991 These findings suggest that in uncontrolled
[15] demonstrated a significant and selective diabetics skeletal muscle weakness is produced
atrophy of type II b fibers in diabetic rats but the magnitude of affection depends upon
although this mechanism remains unclear in individual subject's susceptibility to the
human (4) As suggested by Anderson H 1996 glycemic changes as well as the irregularities in
[16] motor neuronal neuropathic processes give the treatment compliance of each subject. Thus
rise to peripheral neuropathy which might be considering these two factors the linear
associated with decreased muscle strength in correlation might not have been observed.
type I and type II diabetic subjects, and (5) long
term uncontrolled diabetes leads to metabolic CONCLUSION
consequences like muscle protein catabolism From the present study it is clear that if the
and inadequate energy use, which results in blood sugar level in diabetics remains
potential reduction in muscle strength. uncontrolled then they are at risk of decreased
Handgrip endurance in the present study was skeletal muscle strength and its magnitude of
significantly longer in type I diabetics than non affection is highly individual specific. It is
diabetics, while for type II diabetics it was important because the accelerated loss of muscle
significantly shorter than the controls. Though strength may lead to functional limitation and
the mechanism of this finding is unclear in physical disability and morbidity. We need to
humans, in experimental diabetic rats it has been develop strategies to slow or prevent rapid
demonstrated that prolonged increased or declines in muscle function in high risk
decreased blood insulin levels lead to a change population of adults with diabetes to decrease
in the composition of muscle fiber type. morbidity. Every potential way such as strict
Hypoinsulinemia shifts the muscle fiber glucose control and resistive training exercise
composition towards red muscle fiber also programs should be introduced.
known as fatigue resistant fibers [10, 11] and
hyperinsulinemia induces an increase in the ACKNOWLEDGEMENTS
number of white muscle fibers which are least We acknowledge the immense help received
fatigue resistant. Thus due to hypoinsulinemia from the scholars whose articles are cited and
seen in type I diabetics, there is an increased included in references of this manuscript. We
proportion of fatigue resistant red muscle fibers are also grateful to authors / editors / publishers
which might be responsible for increased of all those articles, journals and books from
handgrip endurance in them. While type II where the literature for this article has been
diabetes is a condition characterized by insulin reviewed and discussed.
resistance and high blood insulin levels. So this
prolonged hyperinsulinemia induced-easy
fatigable white muscle fiber composition of in
case of type II diabetics, might be the reason for
REFERENCES 9. Temelkova-Kurktschiev T, Henkel E,
1. Rathmann W, Giani G. Global prevalence of Koehler C, Karrei K, Hanefeld M.
diabetes: estimates for the year 2000 and Subclinical inflammation in newly detected
projections for 2030. Diabetes Care. 2004; Type II diabetes and impaired glucose
27(10):2568-9. tolerance. Diabetologia. 2002; 45(1):151.
2. Alberti KG, Zimmet PZ. Definition, 10. Visser M, Pahor M, Taaffe DR, Goodpaster
diagnosis and classification of diabetes BH, Simonsick EM, Newman AB, et al.
mellitus and its complications. Part 1: Relationship of interleukin-6 and tumor
diagnosis and classification of diabetes necrosis factor-alpha with muscle mass and
mellitus provisional report of a WHO muscle strength in elderly men and women:
consultation. Diabet Med. 1998; 15(7):539- the Health ABC Study. J Gerontol A Biol
53. Sci Med Sci. 2002; 57(5):M326-32.
3. Wright A. Metabolic memory in type 1 11. Helmersson J, Vessby B, Larsson A, Basu S.
diabetes. Br J Diabetes Vasc Dis. 1998; Association of type 2 diabetes with
9:254-257. cyclooxygenase-mediated inflammation and
4. Foster DW. Diabetes Mellitus. In: Fauci AS, oxidative stress in an elderly population.
Martin JB, Kasper DL, Hauser S. (eds), Circulation. 2004; 109(14):1729-34.
Harrison‘s Principles of Internal Medicine. 12. Ramamurthy B, Hook P, Jones AD, Larsson
2011. Volume 2, (pp.2078-2080.) New L. Changes in myosin structure and function
York; McGraw Hill. in response to glycation. FASEB J. 2001;
5. Sayer AA, Dennison EM, Syddall HE, 15(13):2415-22.
Gilbody HJ, Phillips DIW, Cooper C. Type 13. Cotter M, Cameron NE, Lean DR,
II Diabetes, muscle strength and impaired Robertson S. Effects of long-term
physical function. Diabetic Care. 2005; 28 streptozotocin diabetes on the contractile
(10): 2541-2542. and histochemical properties of rat muscles.
6. Park SW, Goodpaster BH, Strotmeyer ES, Q J Exp Physiol. 1989; 74(1):65-74.
de Rekeneire N, Harris TB, Schwartz AV, et 14. Klueber KM, Feczko JD, Schmidt G,
al. Decreased muscle strength and quality in Watkins JB 3rd. Skeletal muscle in the
older adults with type 2 diabetes: the health, diabetic mouse: histochemical and
aging, and body composition study. morphometric analysis. Anat Rec. 1998;
Diabetes. 2006; 55(6):1813-8. 225(1):41-5.
7. Savas S, Koroglu BK, Koyuncuoglu HR, 15. Medina-Sanchez M, Rodriguez-Sanchez C,
Uzar E, Celik H, Tamer NM. The effects of Vega-Alvarez JA, Menedez-Pelaez A,
the diabetes related soft tissue hand lesions Perez-Casas A. Proximal skeletal muscle
and the reduced hand strength on functional alterations in streptozotocin-diabetic rats: a
disability of hand in type 2 diabetic patients. histochemical and morphometric analysis.
Diabetes Res Clin Pract. 2007; 77(1):77-83. Am J Anat. 1991; 191(1):48-56.
8. Lord SR, Caplan GA, Colagiuri R, Colagiuri 16. Andersen H, Poulsen PL, Mogensen CE,
S, Ward JA. Sensori-motor function in older Jakobsen J. Isokinetic muscle strength in
persons with diabetes. Diabet Med. 1993; long-term IDDM patients in relation to
10(7):614-8. diabetic complications. Diabetes.1996;
45(4):440-5.
Table no. I- Various parameters and their mean values and standard deviations for type I and type
II diabetics and their respective control groups
Sr. Variable Group 1 Group 2

No Type I DM Control I signific Type II DM Control II signific
ance ance
1 Age (years) 37.8 ± 1.7 37.9 ±1.5 NS 48.1 ± 1.5 46.4 ± 6.8 NS
2 Height (cm) 162.4 ±4.4 163.5±5.8 NS 163.3 ±6.6 160.4 ±3.4 NS
3 Weight (Kg) 59 ±10.7 61.1 ±5.01 NS 58.5 ±6.3 57.8 ±3.4 NS
4 BSA (m2) 1.61 ±0.13 1.64 ±0.08 NS 1.62 ± 0.1 1.57 ± .06 NS
5 BMI (Kg/m2) 22.3 ±4.05 22.8 ±2.01 NS 22 ±2.5 22.9 ±0.95 NS
6 BSL –F(mg/dl) 203 ±69.4 92.3±7.7 S*** 146 ±60.3 91.8 ±5.3 S***
7 BSL- PP(mg/dl) 322 ±75.9 127.5 ±7.8 S*** 242.3 ±76.6 118.2 ±4.4 S***
8 HbA1c (%) 9.3 ±1.5 4.3 ±1 S*** 9.1 ±1.7 4 ±0.6 S***
9 HGS (Kg) 39 ±2.9 56.1 ±2.8 S*** 44.3 ±10.3 55.7 ±2.3 S***
10 HGE (Sec) 11.2 ±1.9 9.9 ±1.5 S*** 9.5 ±1.1 10.7 ±4.6 S***
Table no. II- Correlation between various parameters and Handgrip strength (HGS) and Handgrip
endurance (HGE) of type I and type II diabetics
Parameters Hand grip Strength (Kg) Hand grip Endurance (sec)

Type I DM Type II DM Type I DM Type II DM
(r- value) (r- value) (r- value) (r- value)
Age (years) -0.03 NS -0.03 NS -0.34 NS 0.21 NS
Duration of diabetes (years) -0.23 NS -0.023 NS -0.03 NS 0.12 NS
NS
Height (cm) -0.11 -0.11 NS 0.006 NS
0.17 NS
NS
Weight (Kg) 0.44 0.44 NS 0.44 S**
-0.12 NS
BSA (m2) 0.27 NS
0.27 NS 0.27 NS
-0.016 NS
BMI (Kg/m2) 0.48 NS
0.48 NS 0.48 S**
-0.24 NS
BSL – F (mg/dl) -0.13 NS
-0.13 NS -0.19 NS
0.05 NS
BSL – PP (mg/dl) -0.05 NS
-0.05 NS -0.03 NS
0.04 NS
NS
HbA1c (%) -0.04 -0.04 NS -0.19 NS
-0.16 NS
NS
HGS (Kg) - - -0.68 0.09 NS
HE (sec) 0.09 NS 0.09 NS - -

IN-SILICO STUDIES ON P43 PROTEIN FROM PLASMODIUM
FALCIPARUM
Tarun Kumar Bhatt
ijcrr Department of Biotechnology, Central University of Rajasthan, Kishangarh

Vol 04 issue 08
Category: Research
Received on:20/03/12 E-mail of Corresponding Author: tarunbhatt1982@gmail.com
Revised on:23/03/12
ABSTRACT
Eukaryotic Aminoacyl-tRNA synthetases exist in large complex consists of different tRNA synthetases
with auxiliary proteins. P43 is one of the three non-synthetases proteins found in multi-synthetases
complex. P43 has been shown to involve in various biological processes like tRNA transport from
nucleus, apoptosis etc. Homologous sequence of P43 is also found in Plasmodium falciparum (PfP43). In
this study, homology modeling, structure validation and active site determination methods were used to
perform structural characterization of P43. Results show the overall three-dimensional structure of P43
with proper Ramachandran plot. Also, Active site residues were nicely located onto the structure of P43.
In addition, structural comparison between P43 of human and parasite origin provided information on
subtle differences in overall structures of proteins. Our results suggest that elucidation of PfP43 structure
is critical in developing anti-malarial drugs.
____________________________________________________________________________________
Keywords: P43, Homology modeling, molecules of the parasite which could be

Plasmodium targeted as potential drug target.
Aminoacyl-tRNA synthetases (aaRSs) are
INTRODUCTION conserved class of proteins which play important
Plasmodium falciparum is the causative agent of role in protein synthesis machinery of all living
epidemic disease malaria. Many developing organism. In eukaryotes, aaRSs are found in the
countries are suffering from socio-economic form of multi-synthetases complex (MSC),
burden of this fatal parasitic disease. Several comprises of 9-10 different tRNA synthetases
drugs have been identified against malaria and 3 non-synthetases proteins5. P43 is part of
parasite but prime concern remains are the rapid the non-synthetases component of MSC. Protein
development of drug resistance among parasites. P43 has been shown to involve in different
In addition, P. falciparum adapts different biological processes which include trafficking of
strategies to overcome immune responses1-4 and tRNA, involvement in autoimmune disease,
because of it, effective vaccine against parasite inhibition of formation of new vascular tissue in
has not been developed. Taking into metastatic carcinoma and in stability to MSC6-9.
consideration all the facts discussed above, there In addition, the important function of P43 comes
is regular need of identifying new protein into play as precursor of EMAPII (Endothelial
Monocyte Activating Polypeptide) domain.
EMAPII is involved in acute inflammation and CHIMERA11. Images were processed at higher
play crucial role in apoptotic processes10. This resolution in PNG format.
aaRSs family of proteins have been identified in
Plasmodium along with the homolog of P43 RESULTS AND DISCUSSION
(PfP43). Nothing much has been done in The three-dimensional structure of PfP43
characterization of this protein but PfP43 was domain is highly compact in nature and it is
found to be secretory in nature during parasite typically EMAPII like domain. Structure is the
asexual life cycle in human. Pro-inflammatory mixture of alpha helices and beta sheets where
property of PfP43 might play an important role beta sheets are predominantly occupying the
in modulating host immune response and could most of the space (fig.1). In addition there are
be vital in malaria patho-physiology. In this several loops hanging out of the core part of
work, we have utilized the quick and effective structure probably involved in making contact
method of solving three-dimensional structure of with interacting molecules which include both
PfP43 using homology modeling. Comparative protein and nucleic acid in case of P43. Panel B
studies with human counterparts along with the of fig.1 shows the surface topology of PfP43
identification of active site of the protein P43 where most of the surface is positively charges
could pave the way in identifying new effective with intermittent negative charged patches,
drug-like molecules against deadly malaria indicative of nucleic acid binding ability of
parasite. PfP43. However, one side of the PfP43domain is
highly negative in nature typically nucleic acid
MATERIALS AND METHODS binding site whereas other side is mixture of
The sequence of PfP43 was obtained using both negative and positively charged residues
NCBI Blast by taking human counterpart as which might be interacting with other proteins
template. Other information of PfP43 was based on charge complementarily.
extracted from PLASMODB using PF14_04013 Ramachandran plot of the modelled PfP43
as accession number. 1E7Z and 1FL0 pdb suggest that most of the amino acid residues are
structures were used as a template for homology in allowed region of three-dimensional space
modeling. Identification of template structures and thus validate the homology modeling (fig.3).
was carried out using NCBI BlastP where search Further, structural comparison between P43 of
parameters were restricted to PDB (Protein Data human and Plasmodium was performed. Overall
Bank). Sali‘s Modeller and Swiss Model Server the both the proteins share common fold and
were used to build the in-silico structure of domain topology but there are few structural
PfP43. Online facility of sequence submission differences like secondary structure of beta sheet
and locally downloaded program of Modeller, present in PfP43 whereas absent in human
both were used to construct three-dimensional counterpart, subtle changes in three-dimensional
structure of P43 domain. RAMPAGE online space of helices and loops (fig.2). These
server was used for structure validation which structural differences could become basis of
gives output of Ramachandran plot describing drug development strategy as small differences
maximum allowed amino acids present in in three-dimensional space are enough for an
modelled structure. Active site prediction was inhibitor to bind with variable affinity.
performed with CASTp using modelled structure Computed Atlas of Surface Topography of
of PfP43 domain. Images were created using Proteins (CASTp) provided the predicted active
site location within PfP43. The amino acid
residues which make the active site pocket are acknowledge the immense help received from
coloured in green and there 3D-space locations the scholars whose articles are cited and
are highlighted both in ribbon and surface included in references of this manuscript. The
diagram (fig.4). The active site volume and area authors are also grateful to authors / editors /
are 149 Ao and 176.9, good enough to publishers of all those articles, journals and
accommodate one or two bases in case on books from where the literature for this article
nucleic acid and two or three amino acids in case has been reviewed and discussed.
of proteins.
REFERENCES
CONCLUSION 1. Smith JD, Chitnis, CE, Craig AG, Roberts
To understand the mechanism of enzyme DJ, Hudson-Taylor DE, Peterson S, Pinches
reaction or binding of two protein molecules, R, Newbold CI and Miller LH. Switches in
structural information play a Very critical role, expression of Plasmodium falciparum var
and to get the structure of proteins using X-ray genes correlate with changes in antigenic
crystallography or NMR or Electron microscopy and cytoadherent phenotypes of infected
is very expensive and time consuming process. erythrocytes. Cell, 1995, 82:101–110.
Thereby, we adopted relatively cheap and fast 2. Florens L, Liu X, Wang Y, Yang S,
method of solving three-dimensional structure Schwartz O, Peglar M, Carucci DJ, Yates
using molecular modeling. Homology modeling JR, 3rd, and Wub Y. Proteomics approach
of PfP43 provided the much needed structural reveals novel proteins on the surface of
information required to understand involvement malaria-infected erythrocytes. Mol.
of this protein in many biological processes. For Biochem. Parasito 2004, l135:1–11.
example, occurrence of highly negative patches 3. Gazzinelli RT, and Denkers EY. Protozoan
on one side of protein led us to speculate the encounters with Toll-like receptor signalling
tRNA binding region which is necessary for the pathways: implications for host parasitism.
function of transport of tRNA molecules out of Nat. Rev. Immunol. 2006, 6:895–906.
the nucleus as well as for the stable formation of 4. Jangpatarapongsa K, Chootong P,
multi-synthetases complex. Note only that, Sattabongkot J, Chotivanich K,
remaining area of protein in three-dimensional Sirichaisinthop J, Tungpradabkul S, Hisaeda
space with variable charge distribution might be H, Troye-Blomberg M, Cui L, and
responsible for binding to other cellular factors Udomsangpetch R. Plasmodium vivax
engaged in apoptosis or inflammatory pathways. parasites alter the balance of myeloid and
In the end, structural differences between plasmacytoid dendritic cells and the
PfP43and human counterparts might pave the induction of regulatory T cells. Eur. J.
way for in-silico screening which might lead to Immunol. 2008, 38:2697–2705.
malaria specific drug like molecules discovery. 5. Kerjan P, Cerini C, Semeriva M, Mirande
M. The multienzyme complex containing
ACKNOWLEDGEMENT nine aminoacyl-tRNA synthetases is
I would like to thank Central University of ubiquitous from Drosophila to mammals.
Rajasthan, Department of Biotechnology for Biochem Biophys Acta 1994, 1199:293-297.
providing resources to conduct these studies. I 6. Han JM, et al. Aminoacyl-tRNA synthetase
also thank Deepti Joshi for her help in interacting multifunctional protein 1/p43
performing homology modeling. Authors controls endoplasmic reticulum retention of
heat shock protein gp96: Its pathological 10. Ko HS, et al. Accumulation of the authentic
implications in lupus-like autoimmune parkin substrate aminoacyl-tRNA synthetase
diseases. Am J Pathol 2007, 170:2042–2054. cofactor, p38/JTV-1, leads to
7. Liu B, et al. Cell surface expression of an catecholaminergic cell death. J Neurosci
endoplasmic reticulum resident heat shock 2005, 25:7968–7978.
protein gp96 triggers MyD88-dependent 11. Pettersen EF, Goddard TD, Huang CC,
systemic autoimmune diseases. Proc Natl Couch GS, Greenblatt DM, Meng EC and
Acad Sci USA 2003, 100:15824–15829. Ferrin TE. UCSF Chimera - A Visualization
8. Park SG, et al. Dose-dependent biphasic System for Exploratory Research and
activity of tRNA synthetase-associating Analysis, J Comput Chem. 2004, 25:1605-
factor, p43, in angiogenesis. J Biol Chem 1612.
2002, 277:45243–45248.
9. Lee YS, et al. Antitumor activity of the
novel human cytokine AIMP1 in an in vivo
tumor model. Mol Cells 2006, 21:213–217.
Figure 1: Three-dimensional structure of PfP43. Left panel showing modelled structure

in ribbon form whereas right panel display hydrophobicity surface in different directions
Figure 2: Structural comparison between human and
Plasmodium protein P43 domain AIMPII
Figure 3: Ramachandran plot of modelled P43 structure

242- S R L N V L V G Y V EQVE I H PDAD T LY C LK I NLG EDKP RD I C S G LRN K KNAEDL
292- L N K Y V L V L A N LKEKSL RGKK SHGMVLCG S F DEKVE L LVP P NGV K I GER I L
342- F H N M D P N V I P DKNLS S DKEK NP F F H I QP HL I LKDGVAHYK DTKW I S SQGD
392- I T C V L N Q G T I S
Figure 4: Predicted active site of P43. Upper panel showing the protein sequence of
modelled P43 structure where active site residues are labelled in green. Lower panel
shows the active site pocket of P43 in 3D space in ribbon and surface diagram.

COMPARATIVE MICROBIOLOGIC ANALYSIS OF
SUBGINGIVAL PLAQUE SAMPLES IN TYPE II DIABETIC AND
NON – DIABETIC PATIENTS WITH CHRONIC
PERIODONTITIS BY POLYMERASE CHAIN REACTION
Mythireyi D1, M G Krishnababa2, Kalaivani3

ijcrr 1
Dept of Periodontics, SRM Dental College, SRM University, Chennai
Vol 04 issue 08 2
Dept of Periodontics, Sathyabama Dental College, Sathyabama University, Chennai
Dept of Periodontics, Tamilnadu Government Dental College and Hospital
Received on:08/03/12 Dr M G R University, Chennai
Revised on:16/03/12
E-mail of Corresponding Author: vinayvela@rediffmail.com
ABSTRACT
Background: Although Immuno inflammatory relationship between periodontal diseases and diabetes
mellitus is acknowledged, the difference in putative periodontal microorganisms between diabetic and
non diabetic individuals is not well established. Aim: To compare the prevalence of two putative
periodontal pathogens namely Aggregatibacter actinomycetemcomitans and Porphyromonas gingivalis
in Type II Diabetic and Non Diabetic patients with chronic periodontitis by Polymerase chain reaction
Materials and Method: Sixty subjects were selected from the Department of Periodontics, Tamilnadu
Government Dental College and Hospital, Chennai – 03. 30 Type II diabetic patients with chronic
periodontitis were categorized as Group I and 30 Non diabetic patients with chronic periodontitis were
categorized as Group II based on American Dental Association classification 1997 and American
Academy of Periodontology classification 1999. Two sites- 1 healthy site and 1 diseased site were chosen
in each patient, Group I H, II H – healthy site samples and Group I D, II D- diseased sites samples.
Subgingival plaque was collected, DNA isolation was done & the presence of A.actinomycetemcomitans
& P.gingivalis DNA was determined by PCR. The PCR products were sequenced and confirmed. The
data was statistically analysed. Results: A.actinomycetemcomitans was detected in 6.7 %, 6.7%, 13.3%,
10% in Groups I H, II H, I D, II D respectively. P.gingivalis was detected in 40%, 46.7%, 46.6%, 53.3%
in Groups I H, II H, I D, II D respectively. When comparisons were made between Groups I H & II H and
Groups I D & II D for the two organisms, no statistically significant difference was obtained
Conclusion: The present study shows no statistically significant difference in the prevalence of
A.actinomycetemcomitans and P.gingivalis in Type II Diabetic and Non Diabetic patients with chronic
periodontitis.
____________________________________________________________________________________
Keywords: Aggregatibacter negative oral infection that leads to gingival

actinomycetemcomitans, Porphorymonas inflammation, destruction of periodontal tissues,
gingivalis, Diabetes, Periodontitis, Polymerase loss of alveolar bone and eventual exfoliation of
chain reaction teeth in severe cases 11. Certain organisms within
the microbial flora of dental plaque are the
INTRODUCTION major etiological agents of periodontitis.
Chronic inflammatory periodontal disease Traditional thinking / paradigms have
(periodontitis) is primarily an anaerobic Gram maintained that periodontitis is an oral disease
and that the tissue destructive response remains Group I H - 30 Healthy sites of Type II Diabetic
localized within the periodontium. Whereas patients with chronic periodontitis
studies by Cohen DW et al 19704, Mattila KJ Group I D - 30 Diseased sites of Type II
et al 19898 have indicated that periodontitis may Diabetic patients with chronic periodontitis
produce a number of alterations in systemic Group II H - 30 Healthy sites of Non Diabetic
health. patients with chronic periodontitis
Diabetes mellitus is a metabolic disorder Group II D - 30 Diseased sites of Non Diabetic
characterized by altered glucose tolerance or patients with chronic periodontitis
impaired lipid and carbohydrate metabolism 1. The criteria for selection of patients with Type 2
It has been suggested that a positive correlation Diabetes was based on American Diabetes
exists between diabetes and periodontal Association classification (1997)1 and for
destruction based on the fact that loss of Chronic periodontitis and Chronic periodontitis
periodontal attachment occurs more frequently modified by Diabetes, the American Academy
and more extensively in moderately and poorly of Periodontology classification (1999)2 was
controlled diabetic patients than those under utilized.
good control. INCLUSION CRITERIA
Diabetes mellitus influences prevalence and Age 30 – 60 yrs, Either sex, At least 3 sites
severity of periodontal disease. Although host with PPD 7 mm, CAL >1mm, At least 2
immune inflammatory response plays an sites with PPD ≤ γmm, Type β Diabetic
important role, it is the microflora that‘s proved patients (Group I), Systemically healthy
to be the etiological agent in periodontitis individuals (Group II)
EXCLUSION CRITERIA
AIM Patients with systemic disease other than
The aim of the present study was to compare the Type 2 diabetes(Group I), Patients with
prevalence of two putative periodontal systemic disease (Group II), Antibiotic
pathogens namely Aggregatibacter therapy for the past 6 months, Smokers,
actinomycetemcomitans and Porphyromonas Periodontal therapy for the past 1 year
gingivalis in Type II Diabetic and Non Diabetic Following Institutional Ethical Committee
patients with Chronic periodontitis by Approval, selection of subjects was done.
Polymerase chain reaction. Informed consent was obtained and a thorough
medical and dental history was taken. Intra-oral
MATERIALS AND METHOD examination was done using mouth mirror and
SUBJECT SELECTION William‘s periodontal probe. Periodontal
Sixty subjects were screened and selected from evaluation was done by measuring the Plaque
the out patient Department of Periodontics, Index, the Gingival Bleeding Index, Probing
Tamilnadu Government Dental College and Pocket depth( PPD) and Clinical Attachment
Hospital, Chennai – 600 003. 30 Type II level(CAL).
diabetic patients with chronic periodontitis were Collection of subgingival plaque sample and
categorized as Group I (Study group) and 30 polymerase chain reaction
Non diabetic patients with chronic periodontitis Two plaque samples were taken from the most
patients were categorized as Group II (Control diseased site and a healthy site from each patient
group). Within each group sub categorization with individual sterile Gracey curettes. The
was done as follows: plaque was dislodged into a vial containing
200 l of sterile lysis solution (10mm tris, 1.0 PCR products by automated DNA sequencer.
mm EDTA , 1.0% Tris X – 100, pH 78), sealed The data was collected and statistically
and stored at -20oC. Subgingival plaque samples analyzed.
was boiled for 10min, cooled to room STATISTICAL ANALYSIS
temperature, centrifuged at 10,000 rpm for 3 min Pearson‘s chi square test was used to calculate
and the supernatant was stored at -20ºC till the overall p value
assay. 10µl of the supernatant was directly used The statistical package SPSS V18 (Statistical
as template in PCR. Package for Social Science, Version 18) was
Primers utilized in this study used for statistical analysis. In the present study,
Aggregatibacter actinomycetemcomitans (Aa) < 0.05 was considered as the level of
Forward primer : 5‘ significance.
CAGCAAGCTGCACAGTTGCAAA – γ‘
Reverse primer : 5‘ RESULTS
CATTAGTTAATGCCGGGCCG TCT – γ‘ In the present study A.actinomycetemcomintans
(Kraig E et al / Infect Immun 1900, 58 : 920 – was detected in 6.7% Type II diabetic patients
929) with chronic periodontits -healthy sites (2 out of
Porphyromonas gingivalis (Pg) 30 healthy sites), 13.3% Type II diabetic patients
Forward primer : 5‘ with chronic periodontits -diseased sites(4 out
ATAATGGAGAACGCAGG AA -3 of 30 diseased sites), 6.7% Non diabetic patients
Reverse primer : 5‘ - with chronic periodontits - healthy sites (2 out
TCTTGCCAACCAGTTCCA TTGC – γ‘ of 30 healthy sites) and10.0% Non diabetic
(Dickinson et al / J Bacteriol 1998 ; 170 ; 1658 patients with chronic periodontits -diseased
– 1665) sites(3 out of 30 diseased sites).
10 µl of the PCR master mixture was pipette In the present study P.gingivalis was detected in
into micro centrifuge tubes. 1.0 l of forward 40% Type II diabetic patients with chronic
primer, 1.0 l of reverse primer, 3.0 l of periodontits - healthy sites (12 out of 30 healthy
template DNA and 5.0 l of nuclease free water sites, 46.6% Type II diabetic patients with
was added and mixed thoroughly. The micro chronic periodontits -diseased sites( 14 out of 30
centrifuge tubes were placed in thermocycler diseased sites), 46.7% Non diabetic patients with
and cycling conditions were set. PCR was chronic periodontits - healthy sites(14 out of 30
performed for 35 cycles of Denaturation at 95oC healthy sites) and 53.3% Non diabetic patients
for 1 min, Primer Annealing at 55oC for 30 sec, with chronic periodontits -diseased sites (16 out
Primary extension at 72oC for 1 min, Final of 30 diseased sites
extension was 72oC for 10 min. The PCR
product was detected by 2% Agarose gel DISCUSSION
electrophoresis. After the completion of the The clinical parameters used in this study were
electrophoresis, gel was taken to the Gingival Bleeding Index, Plaque Index, Probing
transilluminator and observed under UV-light. Pocket Depth and Clinical Attachment level
(Biorad gel documentation) similar to the study by Yuan K et al 200113.
The PCR product of 238 bp Earlier studies employed curettes or paper points
A.actinomycetemcomitans and131 bp for subgingival plaque collection. Sampling by
P.gingivalis were given to MWG – paper point is less invasive than by curette but
BIOTECH, GERMANY for sequencing the may result in an underestimation of tightly
adherent bacteria in subgingival sites5, 12.Hence rate for A.actinomycetemcomitans which is in
in this study curettes were used for sample concurrent to the study by Yuan K et al 200113.
collection. This may be explained by the conclusion drawn
Although various diagnostic techniques are from the studies by Rhodenburg JP et al 19909 ,
available to analyse the microbial population of Slots J et al 199010 that the prevalence of
subgingival plaque, PCR technique was opted as A.actinomycetemcomitans was age related and
it can detect organisms of less than 100 cells3. decreased with increasing age.
In the present study, PCR procedure followed by A.actinomycetemcomintans is more responsible
Yuan et al 200113 was used. Mandel et al 19907 for aggressive periodontitis whereas P.gingivalis
detected 7% A.actinomycetemcomitans, 13% P. contributes to chronic periodontitis. Since our
gingivalis in diseased sites of NIDDM patients subjects were all adults beyond 30 years of age,
by culture. Zambon et al 198813 employed it is speculated that the contribution of
culture and ELISA assays and detected A.actinomycetemcomitans to the periodontitis
P.gingivalis in 75% NIDDM subjects. In the we examined was minimal. There was no
present study, 13.3% and 46.6% diseased sites in statistically significant difference in the
Type II Diabetic patients with chronic detection rates of the 2 tested microorganisms
periodontitis and 10.0% and 53.3% of diseased The plausible reasons are
sites in Non Diabetic patients with chronic 1) There was no difference in the contribution
periodontitis were positive for of the microbiological pathogens in patients
A.actinomycetemcomitans and P.gingivalis with Type II diabetic patients with chronic
respectively. periodontitis and in Non diabetic patients
Our microbiological data revealed higher with chronic periodontitis.
detection rates when compared with the results 2) The PCR assay is limited in the ability to
of others (except Zambon et al). This may be differentiate large or small amounts of the
due to the higher sensitivity of PCR, PCR is same pathogen.
more sensitive than culture, immunofluroesence 3) Other microflora rather than our targeted
and DNA probes for which sensitivities are 2 x microorganism such as P.intermedia,
102, 2 x 105, 2 x 104, 2 x 103 respectively6,14. In a C.rectus and Capnocytophaga species
PCR study by Yuan et al 200113, 6.7% and (since they are also regarded as important
64.8% of diseased sites in Type II diabetic pathogen in periodontitis of NIDDM
subjects and 5.7% and 66.7% of diseased sites in patients13 )could be an etiological agent in
Non diabetic patients were positive for Type II diabetic patients with chronic
A.actinomycetemcomitans and P.gingivalis periodontitis and Non diabetic patients with
respectively. The discrepancy in results, may be chronic periodontitis.
because a large sample size of 150 patients was
chosen by Yuan et al 200113 when compared to CONCLUSION
the small sample of 30 patients chosen in this The search for the etiologic agent of periodontal
study. Also, different authors have analyzed the diseases has been in progress for over a century.
microorganism distribution in different In this study it was found that the composition
population and races. periodontal microflora in periodontal disease
When comparing the prevalence rates of sites of Type II diabetic patients with chronic
A.actinomycetemcomitans and P.gingivalis, the periodontitis was similar to that found in non
results in our study showed a lower detection diabetic patients with chronic periodontitis.
However, the significantly higher detection rate lesions. Oral Microbiol Immunol 1996;
of P.gingivalis in diseased sites further confirms 11;266 -273
the possible pathogenic role of this bacteria for 4. Cohen DW, Friedman LA, Shapiro J, Kyle
both groups studied. GC, Franklin S Diabetes mellitus and
A.actinomycetemcomintans may not be a periodontal disease Two year longitudinal
causative pathogen in Type II diabetic patients observations Part I J Periodontol 1970 , 41;
with chronic periodontitis and non diabetic 709 -712
patients with chronic periodontitis. 5. Hartroth B, Jeyfabrt I, Comado G Sampling
Also, PCR assay provides only a binary results of periodontal pathogens by paper points :
i.e it detects the presence/absence of the Evaluation of basic parameters Oral
microorganism and cannot differentiate positive Microbiol Immunol 1999; 14; 326 -330
result s quantitatively. Therefore the difference 6. Maiden MFJ, Tanner A, Mc Ardle S,
may exist in the quantitative composition of Nagpauer K, Goodson JM Tetracycline
periodontal microorganism present in Type II fibre therapy monitored by DNA probe and
diabetic patients with chronic periodontitis and culture methods J Periodont Res 1991
non diabetic patients with chronic periodontitis. ;26;452-459
Hence further studies with a large sample size 7. Mandell RL, Dirienzo T, Kent R, Joshipura
and diagnostic technique to quantitatively K,Haber J Microbiology of healthy and
analyse the composition of microorganisms may diseased periodontitis sites in poorly
be needed. controlled insulin dependant diabetes J
Periodontol 1992;63; 274- 279
ACKNOWLEDGEMENT 8. Mattila KJ, Nieminen MS, Valtonen W,
Authors acknowledge the immense help Rasi VP, Kesaniemi YA, Syrjala SL
received from the scholars whose articles are Association between dental health and
cited and included in references of this myocardial infarction BMJ 1989 ;298;779-
manuscript. The authors are also grateful to 782
authors / editors / publishers of all those articles, 9. Rodenburg JP, Van Winkelhoff AJ, Winkel
journals and books from where the literature for EG, Goene RJ, Abbas F, de Graff J
this article has been reviewed and discussed. Occurrence of Bacteroides gingivalis,
Bacteroides intermedius and Actinobacillus
REFERENCES actinomycetemcomitans in severe
1. American Diabetes Association . Report of periodontitis in relation to age and treatment
the Expert Committee on the Diagnosis and history J Clin Periodontol 1990; 17; 392-399
Classification of Diabetes mellitus Diabetes 10. Slots J, Feik D, Rams JE Actinobacillus
Care 2001: 24 (Suppl 1 ) S5 –S20 actinomycetemcomitans and Bacteroides
2. Armitage GC: Periodontal diagnosis and intermedius in human periodontitis Age
classification of periodontal diseases relationship and mutual association J Clin
Periodontology 2000 :2004; 34;9 -21 Periodontol 1990; 17;659 -662
3. Ashimoto A, I Bakker I Slots : Polymerase 11. Socransky SS and Haffajee AD The
chain reaction detection of 8 putative bacterial etiology of destructive periodontal
periodontal pathogens in subgingival plaque disease current concepts J Periodontol
of gingivitis and advanced periodontitis 1992;63;4;322-331

12. TannerAC, Goodson JM Sampling of mellitus by Polymerase chain reaction
microorganisms associated with periodontal Periodont Res 2001; 36;18-24
disease Oral Microbiol Immunol 1986; 1; 15 14. Zappa u, Reinking – Zappa M ,Graf H,
-22 Comparison of serological and DNA probe
13. Yuan K, Chang CJ, Hsu pc, Sun HS, Tseng analysis for detection of suspected
CC, Wang Jr Detection of putative periodontal pathogens in subgingival plaque
periodontal pathogens in non insulin samples Arch Oral Biol 1990; 35;161-164.
dependant diabetes mellitus and diabetes
Table 1: Comparison of Distribution of Aa in Healthy Sites among Type II Diabetic and Non
Diabetic patients with Chronic periodontitis
Aa Diabetic Healthy n = 30 Non Diabetic Healthy n = 30

Present Absent Present Absent
Count % Count % Count % Count %
2 6.7% 28 93.3% 2 6.7% 28 93.3%
P value 0.64 ( not significant )
Table 2: Comparison of Distribution of Pg in Healthy Sites among Type II Diabetic and Non
Pg Diabetic Healthy n = 30 Non Diabetic Healthy n = 30

12 40% 18 16% 14 46.7% 16 53.3%
Table 3: Comparison of Distribution of Aa in Diseased Sites among Type II diabetic and Non
Aa Diabetic Diseased n = 30 Non Diabetic Diseased n = 30

14 13.3% 26 86.7% 3 10% 27 90%
Table 4: Comparison of distribution of Pg in diseased sites among Type II Diabetic and Non
Pg Diabetic Diseased n = 30 Non Diabetic Diseased n = 30

14 46.6% 16 53.3% 16 53.3% 14 46.6%

Fig.1 : Distribution of Aa among Fig.2 : Distribution of Pg among
Groups I H, II H Groups I H, II H
6.70% 6.70%
46.70%
7% 48%
6% 46%
5%
44%
4%
42% 40.00%
3%
40%
2%
1% 38%
0% 36%
Diabetic Healthy Non Diabetic Healthy Diabetic Healthy Non Diabetic Healthy
Fig.3 : Distribution of Aa among Fig.4 : Distribution of Pg among

Groups I D, II D Groups I D, II D
13.30% 53.30%
14% 54%
10.00%
12% 52%
10%
50%
8% 46.60%
48%
6%
46%
4%
2% 44%
0% 42%
Diabetic Diseased Non Diabetic Diseased Diabetic Diseased Non Diabetic Diseased

238 bp
Photograph No.1: Electrophoresis showing the amplified product of A.actinomycetemcomitansM –

100 bp Ladder Lane 1, 2 – Positive for A.actinomycetemcomitans (238 bp) Lane 3, 4 – Negative for
A.actinomycetemcomitans Lane 5 Blank Control
131 bp
Photograph No.2: Electrophoresis showing the amplified product of P.gingivalis M – 100 bp Ladder
,Lane 1, 2, 3, 4 – Positive for P.gingivalis (131 bp)

EXPERIMENTAL BEHAVIOUR OF A PYRAMID TYPE
SOLAR STILL COUPLED AND DECOUPLED TO AN
ELECTRICAL TEMPERATURE CONTROLLER
S.Kalaivani1, S.Rugmini Radhakrishnan2, B.Selvakumar3, M.Indhumathy1
1
Department of physics, Vivekanandha College of Arts and Sciences for Women,
ijcrr Tiruchengode, Tamilnadu
2
Department of physics, Avinashilingam University for Women, Coimbatore,
Vol 04 issue 08
Tamilnadu
Department of physics, Jansons Institute of Technology, Karumathampatti,
Received on:08/02/12 Coimbatore, Tamilnadu
Revised on:20/02/12
E-mail of Corresponding Author: drskvani@gmail.com
ABSTRACT
In this communication, an experimental investigation of the behaviour of a pyramid type solar still
coupled and decoupled to an electrical temperature controller unit has been presented. The main
advantage of the pyramid type solar still is that the maximum radiation can penetrate inside the basin
from electrical temperature controller. The main objective oh this present paper is to study the behaviour
of the still performance with and without of electrical temperature by analyzing the internal and external
heat transfer co-efficient.In general the still performance is reasonable with a good daily output including
nocturnal output. The addition of electrical temperature controller where capable of enhancing the
productivity with heat retention causing continued evaporation
____________________________________________________________________________________
Key words: Solar still, water collection, and climate of σew Delhi, India (latitude β8ºγ5‘ σ,
temperature controller. longitude 77 º1β‘E). By comparing theoretical
values of hourly yield with experimental data it
INTRODUCTION has been observed that Dunkle‘s model gives
Mahmoud I.M. Shatat and K. Mahkamov (2010) better agreement between theoretical and
described the performance of a multi stage water experimental results. Dunkle‘s model has been
desalination still connected to a heat pipe used to evaluate the internal heat transfer
evacuated tube solar collector with aperture area coefficient for both single and double slope
of 1.7 m². The multi stage solar still water passive solar stills. With the increase in water
desalination system was designed to recover depth from 0.01 m to 0.03 m there was\a
latent heat from evaporation and condensation marginal variations in the values of convective
processes in four stages. heat transfer coefficients. It was also observed
V.K. Dwivedi et al., (2008) has made an attempt that on annual basis output of a single slope
to evaluate the internal heat transfer coefficients solar still is better as compared with double
of single and double slope passive solar stills in slope solar still.
summer as well as winter climatic conditions for M.K. Phadatare et al., (2007) made an attempt
three different water depths (0.01, 0.02, and 0.03 to study the effect of water depth on the internal
m) by various thermal modes. The experimental heat and mass transfer in a single basin single
validation of distillate yield using different slope plastic solar still. The experimental still
thermal models was carried out for composite was fabricated from Plexiglas. The bottom and
all sided of the still are made from a sheet of is studied. A small experimental still was
black Plexiglas. The cover is made from a constructed to determine the factors affecting the
transparent Plexiglas of the same thickness. The nocturnal production of solar stills. The
solar still was sealed to reduce the leakage of experimental results indicate that a substantial
vapour to the surroundings. The study covers the increase of product water could be obtained
influence of different environmental and from the continuous addition of warm water to
operational parameters on the still productivity. the still. This increase was found to be a
The operational parameter such as depth of function of flow rate, feed-water temperature,
water in the basin is varied from 2 cm to 12 cm evaporating and condensing areas and ambient
to find out its influence on internal heat and temperature.
mass transfer and hence the productivity of the Nikola Nijegorodor et al., (2003) described two
still. The maximum distillate output of 2.1 solar thermal –electrical methods to purify water
L/m2/day was obtained with water depth in still by distillation. In this first method air saturated
basin 2 cm. The maximum efficiency of the with water vapour is removed from a basin type
experimental still varied from 10% to 34%. The still by using a low power exhaust fan, and is
results indicated that with increase in depth of passed through a condenser where the latent heat
basin water, still productivity decreases of water vapour is used to pre heat the
Salah Abdallah et al., (2007) developed an mineralized water for the basin. This also results
experiment work to improve the single slope in lower temperature for the glazing and a faster
solar still performance through increasing the rate of evaporation from the basin. The net effect
production rate of distilled water. Design in an increased thermal efficiency of the still
modifications were introduced to the more than twice the thermal efficiency of the
conventional solar still, involving the installation conventional still. In the second design a
of reflecting mirrors on all interior sides, condenser collector is used to boil water in the
replacing the flat basin by step-wise basin, and absorber tube. A low power vacuum pump is
by coupling the conventional solar still with a employed to lower the boiling temperature of
sun tracking system. The inclusion of internal water by about 10ºc. The yield of distillate from
mirrors improved the system thermal the still is nearly double.
performance up to 30%, while step-wise basin M.Boukar and A. Harmim (2001) has studied the
enhanced the performance up to 180% and effect of desert climatic conditions on the
finally the coupling of the step-wise basin with performance of a simple basin solar still and a
sun tracking system gave the highest thermal similar one coupled to a flat plate collector. A
performance with an average of 380%. three months round study showed that the
The accumulated production of the deep-basin productivity of the simple basin and similar
solar still and that of the tilted tray solar still coupled to a flat plate solar collector strongly
with longitudinal baffles are compared by depends on the solar radiation and ambient
Badawi W.Tleimat et al., (2003). The temperature
comparisons show that evaporation in the deep The effect of intermittent flow of waste hot
basin still continues during the entire 24 hour water in the basin of solar stills on its
period while the tilted tray still ceases to performance has been discussed by Madhuri et
produce a relatively short time after sunset. Thus al., (2001) as well as the effect of various
nocturnal production is maximum for the deep parameters- duration of flow of hot water, flow
basin type and nearly zero for the tilted tray still rate and water depth. It is concluded that for
higher yield, the waste hot water should be fed modified still will be more efficient. The use of
into the basin during off-sunshine hours. The PV and packed bed systems means higher
results have also been compared with those of efficiency than the passive still, as the modified
Tiwari and Malik and sodha et al. still produces large quantities of fresh water in
A single basin solar still with basin area of August for a saline water depth of 0.01 m by
0.98*0.98 m was constructed from galvanized using glass wool insulation 0.05 m thick and
iron sheets and an inclined glass cover. The still glass spheres as a packed bed with 0.0213 m bed
was provided with 525 W electrical heating length.
tapes, fixed under the still for indoor steady state Multiple linear regression equations relating to
operation. The variations of basin temperature ambient, air temperature, wind speed and solar
and evaporation rate were measured during both radiation were developed by A.N. Minasian et
indoor and outdoor operation. Transient analysis al., (1992) to estimate the productivity of a still.
of the still requires the evaluation of The study shows that condensation process
evaporative, convective and radiative heat inside the stills is achieved during the period
transfer coefficients. The Dunkle model, which between sunset and sunrise. Results reveal that
has been widely used for the prediction of the the average wall‘s contribution in supplying
evaporative coefficient, was found to be over fresh water is about 56%, whereas base
predicting evaporation rates. The models contribution is about 31%. It is concluded,
developed in this work were found to provide therefore, that setting many stills on a number of
better prediction for the evaporation rate separated holes will give higher output rather
measured in this work and this work was than setting a single still on one large hole of the
investigated by Ahmad Taleb Shawaqfeh et al., same volume.
(2000). H.M. Ali (1991) has been studied a mathematical
A techno-economic analysis of multi-stage model to predict the performance of the solar
stacked tray (MSST) solar still coupled with a still using forced convection inside the solar still
solar collector through a heat exchanger has to enhance the productivity of the still. It shows
been developed by R.S. Adhikari et al., (2000). that the productivity increases about 60% more
The study also includes a discussion on the than that of a natural convection solar still. Good
sensitivity of cost of unit mass of distilled water agreement between the theoretical and
in references to the useful life of distillation experimental results is obtained. Enhancing
chamber, cost of solar collector and other mass transfer co-efficient due to forced
associated parameters. convection has a major role in the productivity
Faten H. Fahmy et al., (1998) has presented a enhancements.
new way to realize continuous operation of a S.A. Lawrence and G.N.Tiwari (1991) have
solar desalination system to produce fresh water been studied the thermal modeling based on heat
using solar energy for a dual purpose. To realize and mass transfer relations of a green house
the continuity of still operation daily and integrated with a solar still. An experiment was
overnight, the batteries are discharged during the carried out for a typical greenhouse in Port
night at a suitable rate to feed an electric heater. Moresby. The following observations were
The electric heater is designed to generate the made. (i) There is a reasonable agreement
required heat for desalination during the night. between theoretical and experimental results and
This modified still is provided with a packed bed (ii) the amount of distilled water obtained is
layer installed in the bottom of the basin to assist sufficient to grow the plants‘ inside the
the system during the day and at night, i.e., this greenhouse.
2. Construction details for both pyramid solar using the cushion supports at the interface
still and temperature controller between the top cover and the sides of sliding
Pyramid solar still of base area 0.85m x 0.85m is support for uniform landing. Bottom of the still
designed. The still is filled with the water to a is insulated using sawdust, while the side is
height of 0.05m. Top of the system is covered by insulated with glass wool. The specification of
a 3 mm transparent glass pyramid cover with a different parts of the still is given below.
height of 0.30m at the middle. It is air tightened
Fig (1) Cross sectional view of pyramid solar still

1. Top cover 4. Water storage basin 7. Still inlet
2. Water collection segment 5. Still outlet 8. Wooden box
3. Glass Wool Insulation 6. Sawdust insulation
2.1 CONSTRUCTION OF interconnected and used as one end of input

ELECTRICAL TEMPERATURE power supply. Pug-in 1 is used as another
CONTROLLER end of power supply input. Also a
Electrical backup made up of Temperature connection is taken from Plug-in 1 and it is
controller, Heater coil and Thermocouple. connected to one end of the coil. Plug-in N0
Temperature controller has various plug-in is connected to another end of coil. Plug-
from number 1 to number 20. For inn‘s 1β and 1γ are connected to
temperature controller setting plug-in 1, 2, thermocouples. Heater coil is made up of
N1, C, N0, 12 and 13 are used. Temperature stainless steel and is placed inside the solar
of the controller unit can be kept at any still. Sensor thermocouple should be placed
temperature by using set key function (4 near to the heater coil. Schematic
digit display), which has two buttons to representation of electrical backup circuit
increase and decrease the temperature. with temperature controller is shown in Fig
Connections from plug-in 2 and C are (3.2).

Fig (2) Electrical temperature controller
Since controller switch is connected to input temperature falls below the set value, circuits is
power supply, once when the fixed temperature switched on and the current flows through the
is attained, the circuit collapses. As a result coil, hence it starts heating.
power supply is shut down. When the
Fig. (3) Experimental Set Up Of The Fig. (4) Electrical Temperature Controller
Pyramid Cover Solar still
Fig. (5) Experimental Set Up Of The Pyramid Cover Solar Still

Coupled With Electrical Temperature Controller

3.Thermal Analysis Of The Still Decoupled With Electrical Thermal Controller
Sample calculation of the thermal analysis of the constructed pyramid cover solar still is as
follows.
Radiative loss coefficient (hrw)
hrw = [(Tw + 273)2 + (Tg + 273)2] [Tw + Tg + 546]
Convective loss coefficient (hcw)
1/ 3
(Pw Pg ) (Tw 273)
hcw = 0.884 Tw Tg
268.9 x 10 3 Pw
Evaporative loss coefficient (hew)
Pw Pg
hew = 16.273 x 10-3hcw
Tw Tg
3.1 External heat transfer
Since the system is well insulated at the bottom and sides the computation of external heat
transfer only radiative and convective losses are considered
The radiative heat transfer co-efficient is given by,
(Tg 273) 4 (Tsky 273) 4
hra = g
(Tg Tamb )
3.2 Determination Of Thermal Efficiency ( )

The thermal efficiency of the still is also observed as well as predicted decoupled with electrical
thermal controller.
Predicted Efficiency
Me x L
pre = x 100
(t) x A x t
Observed Efficiency
Me x L
obs = x 100
(t) x A x t

3.3 PHYSICAL AND CHEMICAL ANALYSIS OF WATER BEFORE AND AFTER SOLAR
DESALINATION
Table(1) Physical examination
S.No. Test results for tap water Test results of solar

Physical parameters
sample distillate sample
1. Appearance Clear Clear
2. Colour (Pt – Co Scale) Colourless Colourless
3. Odour None None
4. Turbidity NT Units 2 1
5. Total dissolved solids (mg / ) 118 25
6. Electrical conductivity 168 36
(micromho/cm)
Table (2): Chemical examination
S.No. Test results for tap water Test results of solar

Chemical parameters
sample distillate sample
1. pH 7.48 7.45
2. Alkalinity pH 0 0
3. As CaCO3 42 9
4. Total hardness as CaCO3 45 11
5. Calcium as Ca 12 3
6. Magnesium as Mg 4 1
7. Sodium as Na 15 3
8. Potassium as K 1 0
9. Iron as Fe 0 0
10. Manganese as Mn 0 0
11. Free Ammonia as NH3 0 0
12. Albuminoid Ammonia as NH3 0 0
13. Nitrite as NO2 0 0
14. Nitrate as NO3 2 1
15. Chloride as Cl 22 4
16. Fluorid as F 0.2 0
17. Sulphate as SO4 6 2
18. Phosphate as PO4 0 0

The physical and chemical analysis for the tap water and distilled water were made at the Regional
Laboratory of Tamil Nadu Water Board (TNWB), Coimbatore. The samples were tested for colour,
turbidity, total dissolved solids, electrical conductivity, pH, alkalinity chloride, fluoride, sulphate,
phosphate and the results are tabulated in the tables (3.17-3.18)
3.4 Techno – Economic Analysis
The simple techno – economic analysis (Tiwari and Yadav, 1987) of the effectiveness of solar
distillation systems considers the capital cost of the system ‗P‘ and the rate of capital recovery ‗C‘. The
first annual cost of the system A can be determined by the following formula.
(1 r)n
A = Pr
(1 r)n 1
Still coupled with electrical thermal controller:

Cost of the Electrical thermal controller = Rs.1000
with heating coil of 1500W
If usage of electrical back up is 1 hour/day
Then, The approximate usage of electricity, unit/month =45 units
Therefore , For unit /day =1.5 units
Units of electricy utilized for 3 ½ hours /day =5.25 units
for 1 unit electricity, Electricity Board charges= Rs.6.50
Therefore for 5.25 units /day = 5.25 units x 6.50
=Rs.34.125
Cost of 5.25 units/month =Rs.1023.75/month
Cost of 5.25 units/year =Rs.12455.625 /year
Total annual cost of the still without electrical =Rs.995

temperature controller per year
Total annual cost of the still when coupled with electrical =Rs.1000 +995+12455.625
temperature controller per year
= Rs.14450.625
The distillate output yield for both solar which is exposed to solar energy is highly
radiation utilizing solar still and still with economical and profitable.
electrical temperature controller is more or less Graphical Analysis
same. But the Cost of the solar still utilizing The graphs are plotted between the various
electricity for evaporation is 15 times greater observed parameters such as solar insolation,
than that of the solar still with the use of solar efficiency, distillate output, temperature profiles
radiation. This analysis shows that solar still of various junctions etc, during selected sunny
days of experimentations.

Fig (4.1) shows the variation of temperature the morning hours and starts to decrease late in
profiles with time, still decoupled with electrical the afternoon because of decrease in solar
thermal controller. The cover temperature of the insolation.
still increases as the day progresses because of Figure (4.8) shows the histogram for water
the increased evaporation of water from basin temperature with respect to distillate output for
and consequent condensation of water vapour at the Pyramid still decoupled with electrical
the bottom surface of the top cover. Ambient thermal controller.
temperature variation depends on atmospheric Figure (4.9), (4.10), (4.11) shows the histogram
condition. The temperature of water and glass for water temperature with respect to distillate
cover increases in the morning hours to output for the Pyramid still coupled with
maximum values around noon time before they electrical thermal controller.
start to decrease late in the afternoon. This is due The histogram for water temperature with
to the increase of solar insolation in the morning respect to distillate output for the Pyramid still
and the decrease in the afternoon. decoupled and coupled with electrical thermal
Distillate output with respect to time increases in controller is found out Table (3.15) .This shows
the morning and then decreases in the afternoon that both studies give approximately distillate
because of varying solar insolation. It is found output for corresponding temperatures.
out in the Fig (4.2) In general Still performance which is decoupled
The variation of insolation with respect to time with electrical thermal controller is reasonable
shown in the Figure (4.3) it increased linearly with a good daily output. The still coupled with
with time and reached the maximum value from electrical thermal controller is cost effective,
12 noon to 2 p.m. and then decreased. Radiation even though it gives daily output similar to the
received during this study is in the range of 0 to conventional still.
1200 W/m2
The variation of the average efficiency with CONCLUSION
respect to no. of days is drawn in Figure (4.4) Solar still with pyramid cover is investigated for
Average efficiency is varied according to solar its performance in this study for a number of
insolation and water collection for different days. Temperature profiles of water, ambient,
days. cover, air, absorbent, amount of distillate output
Figure (4.5) shows the variation of the average including nocturnal output were observed. The
insolation with respect to no. of days. Average performance of the still with and without
insolation is varying for different days. electrical thermal controller is analyzed, for
The water temperature and distillate output with augmenting the productivity. The instantaneous
respect to time decoupled with electrical thermal and daily efficiency were calculated. Heat
controller is shown in fig (4.6). Water transfer coefficients were computed. Numerical
Temperature and the distillate yield increases in calculations are carried out for comparing the
the morning hours and starts to decrease late in observed values of heat transference with
the afternoon because of decrease in solar theoretical values. Techno economic analysis is
insolation estimated for the system reliability. The quality
Figure (4.7) shows the variation of temperature of distilled water yield is examined by a physical
profile and distillate output with respect to time and chemical properties test carried out on a
decoupled with electrical thermal controller. collected sample of water in the Regional
Temperature and the distillate yield increases in
Laboratory, Tamilnadu Water Supply and 7. Madhuri and Tiwari G.N.( 2001),
Drainage Board, Coimbatore. Performance of solar still with intermittent
flow of waste hot water in the basin,
REFERENCES Desalination, Vol. 52, Issue 3, Pp. 345-357
1. Dwivedi V.K. Tiwari G.N. (2008), 8. Ahmad Taleb Shawaqfeh and Mohammed
Comparison of internal heat transfer Mehdi Farid (2000). New development in
coefficients in passive solar stills by the theory of heat and mass transfer in solar
different thermal modes: An experimental stills, Solar Energy Vol. 55, Issue 6, Pp.
validation , Desalination, Vol. 246, Issue. 1- 527-535
3, Pp 304-318 9. Adhikari R.S. Ashvini kumar and Grag H.P.
2. Phadatare M.K. and verma S.K.(2007), (2000) ,Techno- economic analysis of a
Influence of water depth on internal heat and multi- stage stracked tray(MSST) solar still,
mass transfer in a plastic solar still, Desalination, Vol. 127, Issue.1-1, Pp 19-26
Desalination, Vol. 217, Issue.1-3, Pp 267- 10. Faten H. Fahmy (1998), Efficient Design of
275 Desalination System Using Photovoltaic and
3. Salah Abdallah, Omar Badran and Mazen Packed Bed Systems , Energy Sources, Part
M. Abu-Khader(2007), Performance of a A: Recovery, Utilization, and Environmental
modified design of single slope solar still, Effects, Vol. 20, Issue 7 , Pp 615 – 629
Desalination, Vol. 219, Issue 1-3, Pp 222- 11. Minasian A.N., Al-Karaghouli A.A., Hasan
230 M. and Shakir A. (1992), Utilization of solar
4. Badawi W. Tleimat and Everett D. Howe earth waterstills for desalination for ground
(2003), Nocturnal production of solar water, Energy conversion management, Vol.
distillers, Solar Energy, Vol.10, Issue. 2, Pp. 49, Issue 2, Pp 107-110
61-66 12. Ali H.M. (1991), Mathematical model of the
5. Nikolai Nijegorodov, Pushpendra K. Jain solar still performance using forced
and Stig Carlsson (2003), Thermal- convection with condensation process
electrical, high efficiency solar stills, outside the still, Energy conversion
Renewable Energy Vol. 4, Issue 1, management, Vol. 1, Issue 5/6, Pp. 709-712
Pages123-127 13. Lawerence S.A. and Tiwari G.N. (1991),
6. Boukar M and Harmim A. (2001), Effect of performance of a green house cum solar still
climatic conditions on the performance of a for the climatic condition of Port Moresby,
simple basin solar still: a complete study, Energy conversion management, Vol. 1,
Desalination, Vol. 137, Issue. 1-3, Pp. 15-22 Issue. 2, Pp. 249-255

Temperature profile (°C) 70
60
50
40
30
20
10
0
Time of the day
Room Water Absorbant Air Top cover
Fig. (4.1) Time Vs Temperature profile (16.12.10)
250
200
Distillate output (ml)
150
100
50
Time of the day
Fig. (4.2) Distillate Output Vs. Time (Date: 09.01.2011)

Fig. (4.3) Insolation vs. Time (Date: 20.01.2011)
30
Average efficiency
25
20
15
10
(%)
5
0
1 2 3 4 5 6 7 8 9 10 11 12
Number of days
Fig.(4.4) Number of Days Vs. Average Efficiency
1000
Average insolation
800
600
400
(W / m2)
200
0
1 2 3 4 5 6 7 8 9 10 11 12
Number of days
Fig. (4.5) Number of Days Vs. Average Insolation

Fig. (4.6) Water Temperature / Distillate Output Vs. Time (Date: 08.11.2011)
60 0.25
Temperature profiles (°C)
Distillate output (kg)

50 0.2
40
0.15
30
0.1
20
10 0.05
0 0
Time of the day
Distillate output Room Water Air Absorbant Top cover
Fig. (4.7) Temperature Profile / Distillate Output Vs. Time (Date : 03.02.2011)
Fig. (4.8) Water Temperature Vs. Distillate Output (Date : 11.02.2011)

(With solar energy)
Fig. (4.9) Water Temperature Vs. Distillate Output
(With electrical energy)( Date: 02.03.2011)
150
Distillate output
100
(ml)
50
0
49 50 50 50
Water Temperature (°C)

(With electrical energy) (Date: 03.03.2011)

(With electrical energy) (Date: 06.03.2011)

GEOMAGNETIC STORMS ASSOCIATED WITH IV-RADIO
BURSTS AND THEIR RELATION WITH SOLAR AND
INTERPLANETARY PARAMETERS
P.L.Verma
ijcrr Department of Physics Govt. Vivekanand P.G.College Maihar Distt Satna M.P.
Vol 04 issue 08
Category: Research
E-mail of Corresponding Author: verma2003@yahoomail.com
Revised on:01/03/12
ABSTRACT
I have studied geomagnetic storms (Dst ≤-75nT), associated with Type IV radio bursts, observed during
the period 1997 to 2007 with solar and interplanetary parameters. We have observed 33 geomagnetic
storms associated with type IV radio bursts, out of which most of the geomagnetic storms (85.00%) are
intense or sever geomagnetic storms. All the geomagnetic storms are found to be associated with halo and
partial halo coronal mass ejections (CMEs).The association rates of halo and partial halo CMEs are 27
(81.82%) and 06 (18.18%) respectively .All the type IV radio bursts associated geomagnetic storms are
found to be associated with X-ray solar flares of different categories .The association rates of
geomagnetic storms with different types of flare related CMEs are found 08 (24.24)% X class flare
related CMEs,15 ( 45.46% ) M class flare related CMEs ,08 (24.24 )% C class flare related CMEs and
02(6.06)% B class flare related CMEs. Some of the type IV radio bursts associated geomagnetic storms
are found to be associated with magnetic clouds 13 (39.39 %).Majority of the geomagnetic storms are
found to be related with interplanetary shocks 31 (93.94) .We have inferred that geomagnetic storms are
closely related to interplanetary magnetic fields. We have determined positive co-relation with correlation
coefficient 0.70 between magnitude of geomagnetic storms and maximum value of IMF and 0.77 between
magnitude of geomagnetic storms and magnitude of maximum value of southward component of
interplanetary magnetic fields (IMF Bz).
____________________________________________________________________________________
Keywords –Coronal mass ejections, X-ray solar disturbances and these disturbances cause
flares, radio bursts, solar wind plasma geomagnetic disturbances at the earth. The
parameters and geomagnetic storms. recurrent storm activity is due to coronal holes
that cause fast solar wind streams
INTRODUCTION [1].Geomagnetic storms which are characterized
The solar disc exhibits a variety of drastic solar by a prolonged period in which the horizontal
features, many of which have a direct influence component of geomagnetic field is depressed in
on interplanetary space and earth‘s the mid to low latitudes in the range of several
magnetosphere. Coronal mass ejections tens to several hundred nT with such periods
associated with solar flares, filaments, and type lasting from one-half to several days and are
II and type IV radio burst are the most energetic classified as recurrent (periodic) and non
solar features which derive solar wind recurrent (sporadic). Recurrent geomagnetic
storms occur most frequently in the declining multiple FSH CMEs show complex solar wind
phase of the solar cycle when equatoward flows and complex geomagnetic storms which
extensions of the polar coronal holes are are probably the result of halo CMEs interacting
prominent [2, 3]. The non recurrent (sporadic) in interplanetary space. 15% events are found to
geomagnetic storms are caused by interplanetary be associated with partial halo gradual CMEs
disturbances driven by fast coronal mass emerging from the east limb. Michalek, and
ejections (CMEs) and typically involve an Gopalswamy et al [10] have studied
encounter with both interplanetary shock wave geomagnetic storms with properties of halo
and the CME that drive it. Since the CME rate coronal mass ejections (H-CMEs) and concluded
tracks the sun spot cycle [4], the non recurrent that only fast halo CMEs (with space velocity
geomagnetic storms occur most frequently near higher than 1000 km/s) an originating from the
solar maximum.Landi and Moreno et al (5) have western hemisphere close to the solar centre
investigated the role of the coronal mass could cause intense geomagnetic storms.
ejections in producing non recurrent Gopalswamy et al [11] have studied
geomagnetic storms in period 1969-1974. They geoeffectiveness, speed, solar source, and flare
have concluded that coronal mass ejections association of a set of 378 halo coronal mass
associated with chromospheric flares, ejections (CMEs) of solar cycle 23 (1996-2005).
accompanied by type IV radio emission, are the They have compiled the minimum Dst values
most effective in perturbing the geomagnetic occurring within 1 - 5 days after the CME onset.
field. Webb et al (6) have studied geomagnetic They have compared the distribution of such Dst
storms with halo coronal mass ejections and values for the subset of halo CMEs as disk
concluded that halo coronal mass ejections are halos, limb halos, and back side halos CMEs.
very much effective in producing geomagnetic Defining that a halo CME is geoeffective if it is
storms.Yurchyshyn [7] have analyzed data for followed Dst < -50 nT, moderately geoeffective
major geomagnetic storms and found a if -50nT < Dst < -100nT, and strongly
relationship between hourly averaged magnitude geoeffective if Dst < -100nT, they have found
of the Bz component of IMF and projected that the disk halos are followed by strong
speed of CMEs launched from the central part of geomagnetic storms, limb halos are followed by
the solar disk. They have concluded that CMEs moderate storms, and back side halos are not
with V> 1000 Km/s are capable of furnishing. followed by significant storms.
Lepping (8) has studied geomagnetic storms Experimental Data
with southward directed magnetic field; they In this investigation hourly Dst indices of
have determined that intense geomagnetic geomagnetic field have been used over the
storms are caused by intense southward directed period 2003 through 2007 to determine onset
magnetic field. They have found high co-relation time, maximum depression time, magnitude of
between Bz and Dst index. Zhag et al [9] have geomagnetic storms. This data has been taken
studied major geomagnetic storms for the period from the NSSDC omni web data system which
1996-2000 with coronal mass ejections and been created in late 1994 for enhanced access to
concluded that 59% major geomagnetic storms the near earth solar wind, magnetic field and
are associated with front side halo (FSH) CMEs plasma data of omni data set, which consists of
and 22% are associated with multiple FSH one hour resolution near earth, solar wind
CMEs. The events which are associated with magnetic field and plasma data, energetic proton
fluxes and geomagnetic and solar activity The data of X ray solar flares radio bursts,
indices. The data of coronal mass ejections prominences and other solar data, solar
(CMEs) have been taken from SOHO – large geophysical data report U.S. Department of
angle spectrometric, coronagraph (SOHO / commerce, NOAA monthly issue and solar STP
LASCO) and extreme ultraviolet imaging data
telescope (SOHO/EIT) data. To determine (http://www.ngdc.noaa.gov/stp/solar/solardatase
disturbances in interplanetary magnetic fields, rvices.html.) have been used. The data of
hourly data of interplanetary magnetic field has interplanetary shocks has taken from shocks
been used and these data has also been taken arrival derived by WIND group from WIND
from omni web data observations, ACE list of transient and
(http;//omniweb.gsfc.nasa.gov/form/dxi.html)). disturbances.
Table-1-Association of Geomagnetic Storms with IV-Radio Bursts with Coronal Mass Ejections, X -
Ray Solar Flares and Magnetic Clouds for the Period of 1997-2007
Geomagnetic
Storms CMES S0lar Flares Radio burts Magnetic Clouds
typ
Onset Magnit es Start Start
S. time in ude in Start time H/ time in Start time Typ time in Qualit
NO. Date dd(hh) nT in dd(hh) P dd(hh) Class in dd(hh) e dd(hh) y
1 22.11.97 22(10) -106 19(12.27) H 19(14) C-16 19(20.17) IV 22(15) 3
2 07.11.98 07(11) -139 05(02.02) H 05(03) C-54 05(20.15) IV na na
3 08.11.98 08(20) -126 05(20.24) H 05(19) M-84 05(20.15) IV 08(23) 1
4 24.05.00 24(00) -151 22(01.50) H 22(01) C-63 22(01.28) IV na na
5 08.06.00 08(15) -89 06(15.54) H 06(15) X-23 06(14.49) IV na na
6 17.09.00 17(20) -197 16(05.18) H 16(04) M-59 16(04.33) IV 18(02) 3
7 10.11.00 10(07) -102 08(04.50) H 08(06) C-52 08(22.51) IV na na
8 27.03.01 27(21) -86 24(20.50) H 24(20) M-17 24(20.20) IV na na
9 31.03.01 31(04) -379 28(01.27) H 28(02) M-17 28(11.13) IV na na
10 11.04.01 11(15) -269 09(15.54) H 09(15) M-79 09(15.58) IV 12(08) 2
11 18.04.01 18(01) -106 15(14.06) P 15(13) X-144 15(14.06) IV na na
12 28.10.01 28(01) -142 25(15.26) H 25(15) X-13 25(15.05) IV na na
13 31.10.01 31(14) -104 30(03.30) P 30(03) C-60 30(13.50) IV 31(21) 3
14 05.11.01 05(19) -297 04(16.35) H 04(16) X-10 04(16.12) IV na na
15 17.04.02 17(11) -149 15(03.50) H 15(03) M-12 15(04.32) IV 18(04) 1
16 01.08.02 01(23) -105 29(23.30) P 29(23) C-42 29(11.00) IV 01(12) 3
17 02.06.03 02(02) -85 31(02.30) H 31(02) M-93 31(02.18) IV na na
18 16.06.03 16(10) -136 14(05.30) P 14(05) M-15 15(23.45) IV na na
19 28.10.03 28(06) -384 27(08.30) P 27(08) M-27 27(08.19) IV na na
20 20.11.03 20(02) -461 18(08.05) H 18(09) M-45 18(08.11) IV 20(11) 2
21 22.07.04 22(00) -106 20(13.31) H 20(12) M-86 20(12.26) IV 22(15) 3
22 07.11.04 07(20) -376 04(09.54) H 04(09) C-63 04(08.49) IV 08(03) 2

23 07.01.05 07(12) -94 05(15.30) H 05(04) B-82 04(11.03) IV na na
24 16.01.05 16(20) -117 15(06.30) H 15(06) M-86 15(22.33) IV na na
25 21.01.05 21(19) -103 19(08.29) H 19(08) X-13 19(08.12) IV na na
26 15.05.05 15(05) -293 13(17.12) H 13(16) M-80 13(17.03) IV 15(06) 2
27 20.05.05 20(04) -101 16(13.50) P 16(13) C-12 16(13.50) IV 20(07) 2
28 29.05.05 29(22) -150 26(15.06) H 26(13) B-75 26(21.44) IV na na
29 10.07.05 10(11) -100 07(17.06) H 07(16) M-49 07(13.10) IV na na
30 17.07.05 17(06) -77 14(10.54) H 14(10) X-12 14(10.23) IV na na
31 24.08.05 24(08) -219 22(01.31) H 22(01) M-26 22(01.00) IV na na
32 11.09.05 11(02) -127 09(19.48) H 09(19) X-62 09(19.48) IV na na
33 14.12.06 14(21) -143 13(02.54) H 13(02) X-34 13(02.47) IV 14(23) 3
Table-2- Association of Geomagnetic Storms Associated with IV-Radio Bursts with Interplanetary
shocks and Interplanetary Magnetic Field for the Period of 1997-2007
Geomagnetic IMFBz
Storms Shocks IMF (nT) (nT)
Magnitude
Magnitude of
Onset Start of maximum
S. time in Magnitude time in Start time maximum Start time IMFBz in
NO. Date dd(hh) in nT dd(hh) in dd(hh) IMF in nT in dd(hh) nT
1 22.11.97 22(10) -106 22(09) 21(19) 27.1 22(20) -12.8
2 07.11.98 07(11) -139 07(08) 07(19) 35.4 07(22) -19.7
3 08.11.98 08(20) -126 08(05) 07(20) 35.4 07(20) -11.6
4 24.05.00 24(00) -151 24(17) 23(15) 32.1 23(16) -24.1
5 08.06.00 08(15) -89 08(09) 08(05) 24.9 08(13) -6.9
6 17.09.00 17(20) -197 17(17) 17(14) 39.5 17(15) -23

7 10.11.00 10(07) -102 10(06) 10(05) 17.8 10(08) -8
8 27.03.01 27(21) -86 27(01) 27(15) 25.1 27(19) -8.4
9 31.03.01 31(04) -379 31(00) 30(21) 47.1 31(03) -44.7

10 11.04.01 11(15) -269 11(14) 11(09) 34.5 11(18) -20.5
11 18.04.01 18(01) -106 18(00) 17(23) 23.8 17(20) -19.6
12 28.10.01 28(01) -142 28(03) 27(22) 19.5 27(22) -14.5
13 31.10.01 31(14) -104 31(14) 31(18) 13.9 31(19) -13
14 05.11.01 05(19) -297 06(02) 05(12) 65.6 06(18) -64
15 17.04.02 17(11) -149 17(11) 17(07) 30.4 17(07) -18.1
16 01.08.02 01(23) -105 01(05) 01(01) 14.4 01(02) -13.2
17 02.06.03 02(02) -85 na 01(22) 11.4 02(04) -8.9
18 16.06.03 16(10) -136 na 15(17) 14.4 16(09) -9.7
19 28.10.03 28(06) -384 28(02) 28(01) 19.2 28(01) -10.2

20 20.11.03 20(02) -461 20(07) 20(05) 55 20(11) -50.9
21 22.07.04 22(00) -106 22(10) 22(14) 18.9 22(19) -15.5

22 07.11.04 07(20) -376 07(02) 07(12) 47.8 07(22) -44.9
23 07.01.05 07(12) -94 07(09) 07(07) 20.6 07(20) -18.5
24 16.01.05 16(20) -117 17(07) 17(07) 35.3 16(08) -5.1

25 21.01.05 21(19) -103 21(17) 21(15) 29.5 22(18) -2.6
26 15.05.05 15(05) -293 15(02) 15(01) 54.2 15(05) -38
27 20.05.05 20(04) -101 20(04) 20(06) 15 20(02) -9.1
28 29.05.05 29(22) -150 19(09) 29(01) 19.2 30(05) -16.1
29 10.07.05 10(11) -100 10(03) 10(02) 25.2 10(10) -13.9
30 17.07.05 17(06) -77 17(01) 17(12) 14.6 17(21) -8.7
31 24.08.05 24(08) -219 24(06) 24(04) 52.2 24(05) -38.3

32 11.09.05 11(02) -127 11(01) 10(21) 18.2 11(00) -6.4
33 14.12.06 14(21) -143 14(14) 14(11) 17.9 14(22) -14.7
DATA ANALYSIS AND RESULTS partial halo CMEs have been found 27(81.82%)
In this study I have observed 33 geomagnetic and 06(18.18%) respectively .From the further
storms associated with type IV type radio bursts, analysis it is observed that ,CMEs which are
occurred during the period 1997 to 2007.I have associated with geomagnetic storms associated
divided observed geomagnetic storms in three with type IV radio bursts are related with X-ray
categories, geomagnetic storms Dst ≤-75nT solar flares of different categories and majority
>100 nT as moderate, Dst≤-100 nT >200nT as of them are M class solar flares . The association
intense and Dst≤-200 nT as severe .It is found rates of geomagnetic storms associated with type
that most of most of the type IV associated IV radio bursts with different types of flare
geomagnetic storms (85.00%) are intense or related CMEs are found 08(24.24)% X class
severe geomagnetic storms .I have 33 flare related CMEs,15( 45.46% ) M class flare
geomagnetic storms in list out of which 28 related CMEs ,08(24.24 )% C class flare related
geomagnetic storms have been found to be CMEs and 02(6.06)% B class flare related
associated with intense or severe geomagnetic CMEs respectively .The data analysis of
storms .The association rates of moderate, observed geomagnetic storms associated with
intense and severe geomagnetic storms have type IV radio bursts and magnetic clouds, some
been found 15.15%,60.60% and 24.25% of the geomagnetic storms associated with type
respectively. From the data analysis of observed IV radio bursts have been found to be associated
geomagnetic storms associated with type IV with excellent, good and poor quality magnetic
radio bursts and coronal mass ejections, all the clouds 13 (39.39 %). Majority of the
geomagnetic storms associated with type IV geomagnetic storms associated with type IV
radio bursts have been found to be associated radio bursts are found to be related with
with halo and partial halo coronal mass ejections interplanetary shocks 31 (93.94) .From the data
and majority of them are halo coronal mass analysis of geomagnetic storms associated with
ejections. The association rates of halo and type IV radio bursts and interplanetary magnetic

field ,I have found that geomagnetic storms IMF with correlation coefficient 0.70 .Further to
associated with type IV radio bursts are closely see how the magnitude of geomagnetic storms
related to disturbances in interplanetary associated with type IV radio bursts are
magnetic fields and southward component of correlated with maximum value of Jimfbz
interplanetary magnetic field. Further to see how events, a scatter diagram have been plotted
the magnitude of geomagnetic storms associated between the magnitude of geomagnetic storms
with type IV radio bursts are correlated with the associated with type IV radio bursts and
maximum values of Jimf events, a scatter maximum value of Jimfbz events in fig.2. From
diagram have been plotted between the the fig it is clear that maximum geomagnetic
magnitude of geomagnetic storms associated storms associated with type IV radio bursts
with type IV radio bursts and maximum value of which have large magnitude are associated with
Jimf events in fig.1.From the fig it is clear that such Jimfbz events which have relatively large
maximum geomagnetic storms associated with maximum values .Positive correlation with
type IV radio bursts which have large correlation coefficient 0.77 have also been found
magnitude are associated with such Jimf events between and magnitude of geomagnetic storms
which have relatively large maximum value. I associated with type IV radio bursts and
have determined positive co-relation between maximum value of southward component (IMF
magnitude of geomagnetic storms associated Bz) .
with type IV radio bursts and maximum value of
Figure-1 Shows Scatter plot between magnitudes of geomagnetic storms associated with type IV
radio bursts and magnitude of maximum value of IMF showing positive correlation with
correlation coefficient 0.70.

Figure-2 Shows Scatter plot between magnitudes of geomagnetic storms associated with type IV
radio bursts and magnitude of maximum value of IMFBz showing positive correlation with
correlation coefficient 0.77.
CONCLUSION component of IMF Bz with correlation

From our study, most of the radio bursts related coefficient 0.77.These results shows that
geomagnetic storms have been identified as geomagnetic storms associated with type IV
intense or severe geomagnetic storms and radio burst are mainly caused by coronal mass
associated with coronal mass ejections (CMEs) ejections related with X- ray solar flares and
related to different types of X ray solar flares. related with X-ray solar flares and their
Majority of the geomagnetic storms associated interplanetary manifestations (interplanetary
with type IV radio bursts are found to be related shocks and magnetic clouds).Further it is
with interplanetary shocks and some of them are concluded that disturbances in interplanetary
found to be related with magnetic clouds. Large magnetic fields are closely related to
positive co-relation have been determined geomagnetic storms associated with type IV
between magnitude of geomagnetic storms radio bursts .
associated with type IV radio bursts and
maximum value of IMF with correlation ACKNOWLEDGEMENT
coefficient 0.70 and magnitude of geomagnetic The author would like to thank Prof. P.K
storms associated with type IV radio bursts and Shukla, S.K.Nigam and B.P.Chandra for
magnitude of maximum value of southward valuable suggestions. The author is grateful to

OMNIWEB and SOHO data group whose data 6. Webb, D.F. Cliver, E.W. Crooker N.U. J.
have been used in this study. Geophys Res. 105, 7491, 2000.
7. V. Yurchyshyn, Astrophys. J., 614, 1054,
REFERENCES 2004.
1. Crooker N.U. and E.W. Cliver. J. 8. Wu. C.C. and R.P. Lepping. J. Atm. Sol -
Geophys. Res. 99 A12 23, 383, 1994. Terr. Phys. 67, 283, 2005.
2. Webb D.F. Revs. Geophys, (Supply) 33, 9. G. Zhang K.P. Dere et al Astrophysical
577, 1995 Journal, 582, 520 – 533, 2003
3. Y. Kamide J. Geophys. Res. V. 103, NO. 10. Michalek, G. Gopalswamy, N. Lara, A :
A8PP - 17705 - 17, 728, 1998 Yashiro, S Space. Weather, Volume 4,
4. Webb, D.F. and R.A. Howard. J. Geophys Issue 10th, citel ID S10003, 2006.
Res, 99, 4201, 1994. 11. N. Gopalswamy, S.Yashiro, S. Akiyama, J.
5. R. Landi and G. moreno J. Geophys. Res Geophys. Res Vol. 112, A06112, dio :
Vol. 103 No. A20, 553 – 20 –559 – 1998. 1029/2006 JA 012149, 2007.

PHYTOCHEMICALS ANALYSIS OF COLECUS
AROMETICUS BENTH
Iffat Khan1, Kirti Jain2

ijcrr 1
Sarojini Naidu Govt. College, Shivaginagar, Bhopal, (M.P.)
Vol 04 issue 08 2
Govt. science and commerce college, Benazir Jahangirabad, Bhopal, (M.P.)
Category: Research
Revised on:23/02/12 E-mail of Corresponding Author: iffatkhan85@yahoo.com
ABSTRACT
Coleus aromaticus Benth. Of the family Lamiaceae is a large succulent aromatic herb used for flavoring
drinks and medicine. The leaves are considered as carminative, digestive, anthelmintic and diuretic. The
present study is dealt with the phytochemicals analysis of the leaf extracts. The leaf extracts with various
solvents like petroleum ether extract, Ethanolic extract and Aqueous extract were prepared and both
qualitative and quantitative tests for phytochemicals were done.It showed the presence of
saponins,carbohydrates, tannins,flavonoids,proteins,triterpenoids in various quantities.
____________________________________________________________________________________
Key words: Colecus, Ethanolic , saponins, hypertensation. They are involved in many
phytochemicals. processes including one that helps prevent cell
damage, prevent cancer cell replication, and
INTRODUCATION decrease cholesterol levels.
About two and a half species of flowering plants
belonging to 10,500 genera and about 300 MATERIALS AND METHODS
families are found in nature .of these a number Suitable explants will be taken from the
of genera are source of drugs. Many of the plant authenticated and identified plant taxonomist.
products are important therapeutic agents, which The identified and authenticated species were
are represented by the various phytochemicals collected quantity, dried and powdered for
like saponins,carbohydrates, tannins,flavonoids, further studies.
proteins, triterpenoids. The phytochemicals present in the plant material
The present study is concentrated on colecus was extracted by the distillation method using
arometicus Benth., belongs to family soxhlet apparatus. Different solvent, solvent
Lamiaceae.Although phytochemicals are not systems were used for the sepration of chemicals
classified as nutrients, substances necessary for according to the polarity (petroleum ether
sustaining life, they have been identified as extract, Ethanolic extract, aqueous extract) about
containing properties for aiding in disease 650 g of plant tissue were weighed and shade
prevention.phytochemical are associated with dried for 10 days. The dried materials were
the prevention and treatment of at least four of powdered and 50g of powder sample was
the leading causes of death in the united states- packed in a thimble and kept in soxhlet
cancer,Diabetes,cardiovascular disease, and apparatus. Each of the solvent was taken
separately for the extraction and the powdered 3. Test for tannins and phenolic compound =
material was siphoned by 3 times. The whole To 1ml of the extract, add 2 drops of 5% Fecl3.
apparatus was kept over a heating mantle and Presence of dirty green precipitate indicates the
was heated continuously for 8 hours at boiling presence of tannins and phenolic compound by
ponit of each solvent. The extract was ethanolic extract and aqueous extract.
concentrated to dryness and the residues were 4. Test for saponins =5ml of the extract was
transferred to a pre-weighed sample bottle and shaken with 5ml of distilled water and was
were stored in desiccators for further studies. heated to the boiling point. Froathing indicates
―Phytochemicals screening of different plant the presence of saponins by ethanolic extract and
extracts found by soxhlat method. aqueous extract.
in different media” 5. Total carbohydrate=weighed amount of
Different biochemical parameters like, fresh tissue was homogenized with distilled
saponins,carbohydrates, water. The homogenate was filtered using a two
tannins,flavonoids,proteins,triterpenoids. layered cheese cloth. The filtrate was then
1. Test for flvonoids =Take 1 ml of the extract centrifuged at 10,000g for 15 min. The
and add few magnesium turnings, followed by supernatant was collected and the volume was
the addition of conc.HCL drop. Development of made up to 25 ml using distilled water .an
pink colour indicates the presence of flavonoids aliquot of sample was pippetted out and 4ml
is present by ethanolic extract and aqueous anthrone reagent added. It was then kept in a
extract. boiling water bath for 10 min. The tubes were
2. Terpenoids = Take 2mlof extract, dry and cooled and the absorbance was measured at
dissolve in chloroform. Add a few drops of 530nm. The amount of total carbohydrate
acetic anhydride and conc.H2S04 and keep present was determined using the standard graph
undisturbed for few minutes. Formation of pink of glucose.
colour indicates the presence of terpenids by
petroleum ether extract.
Table:- Phyto chemicals analysis test of leaf extracts of colecus arometicus Benth in Petroleum
ether extract ethanolic extract aqueous extract.
Phytochemical constituents Petroleum ether extract Ethanolic extract Aqueous extract.
Alkaloids - + -
Triterpenoids + - -
tenins & phenolic compound - + +
Saponins - + +
Total carbohydrates - + +
+ = Present - = Absent
RESULTS aromaticus Benth .leaf extract showed the

Phytochemical screening of plant extracts. - presence of only saponins,carbohydrates,
The phytochemical investigation of colecus

tannins,flavonoids,triterpenoids in the soxhlet coriaceae and Gynanadropsis, Mc Graw Hill
method . Book Company, pp:42.
Study showed that the extract of plant contain 3. Am,bujakshi, H.R., Thakkar Heena and
most phytochemicals. Shyamnanda (2009) Anthelmintic activity of
Such as ‗‘ saponins,carbohydrates, Gmelina arborea Roxb leaves extract.
tannins,flavonoids,proteins,triterpenoids‘‘ Internatiopn journal of Pharma. Research
and Development, Vol :1.
DISCUSSION 4. Asha, M.K., prashant, D., Murali,B.,
Phytochemical compound of the plant were Padmaja, R. and Amit, A. (2001)
analyzed. In the analysis of phytochemical Anthelmintic activity of essential oil
compound of colecus arometicus Benth extract of Ocimum sanctum and eugenol,
showed the presence of Fitoterapia, 72: 669-670
‗‘saponins,carbohydrates, 5. Bradford, M.M. (1976) Annual Biochem.P.
tannins,flavonoids,proteins,triterpenoids‘‘ 72.
arometicus used to treat asthma for a long time 6. Chatterjee, K.D. (1967) Parasitology,
with any undesirable side effect . colecus Protozoology and Helmintholgy, 6th Edn.,
arometicus is responsible for its pharmaceutical Guha Ray Sree Saraswaty Press Ltd,
value. Calcutta. Dipak, N. Raut; Subodh C. Pal and
Subhash
CONCLUSION 7. Chandrashekhar C.H., Latha, K.P.,
Phytochemical analysis showed that the Vagdevi<H.M. and Vaiudya, V.P. (2008)
presence of terpenoids and phenolic compounds Anthelmintic activity of the crude extracts of
were responsible for the effects. Phytochemicals Ficus racemosa, 2:100-103.
are also found in colecus arometicus, hence it 8. Dipak, N.Raut; Subodh C.Pal and Subhash
may be the reason for the activity. C. Mandal (2009) Anthelmintic potential of
In short, based on the present study it was Dendrophthoe falcate Etting. (L.F.) Leaf.
abserved that the plant extracts, colecus International journal of Pharmaceutical
arometicus in various phytochemicals like Farnsworth, N.R. and Morris, R.W (1976)
‘saponins,carbohydrates, Higher plants the sleeping gaint of drug
tannins,flavonoids,proteins,triterpenoids‘‘ development American journal of
In view of the above, present study was pharmacology. 147 :46-52
undertaken keeping mainly following objects:- 9. Gamble, J.S. (1918) Flora of the Presidency
Study of phytochemicals of colecus of Madras, Vol.II, pp. 1123-1124
arometicus Benth. 10. Harbone, J.B. (1973) Phytochemical
Secondary metabolite analysis of methods, Chapman and Hall, London, pp.7.
colecus arometicus Benth. 11. Kingdom, A.D. and Balandrin, M.F. (1993)
Huan medicinal agents from plants, Amer
REFERENCES Chem. Symp. ser 534: 1-348.
1. Abelson (1990) Editorial- Science 247 : 513. 12. Mandal (2009) Anthelmintic potential of
2. Ajaiyeoba, E.O., Onocha, P.A. and Dendrophthoe falcate Etting. (L.F.) Leaf.
olarenwaju, O.T. (2001) in vitro Intenational Jounal of Pharmaceutical
anthelmintic properties of Buchholzia Research and Development, Vol-6 Aug/002
13. Manjamalai, A., Sardar Sathyajith Singh, R., 22. Sadasivam, S. and Balasubramanian, T.
Guruvayoorappan, C. and Berlin Grace, (1987) in. to Practical Manual in
V.M. (2010) Analysis of phytocontituents Biochemistry,Tamilnadu, Agriculture
and Anti microbial activity of some mediinal University, Coimbatore, pp. 14-27.
plants in Tamilnadu, India. Global J. 23. Srinivasa Rao, D., Prasada Rao, V. and
Biotech & Biochem., 5(2) : 120 – 128 Samvisiva Rao, K.R.S. (2010)
14. Mayr, V.D., Trutter, C., Santos- Dudga, H., Pharmacological effects of forskolin isolated
Baner and Senchitt, W. (1995) Development from Coleus aromaticus on the lung damage
changes in the phenol concentrations of rats. An international Journal of Advances in
golden delicious apple fruits and leaves. J. Pharmaceutical Sciences. Vol (1) Sep-Oct.
Phyto.Chem., 38(5) : 1151 – 1155. 24. Soodabeh Sacidina, Ahmad Reza Gohari,
15. Minija Janardhanan and John E. Thoppil Fumiyuki kiuchi and Gisho Honda (2005) in
(2004). Herb and spice essential oils vitro anti-epimastigote activity of some
(therapeutic, flavour and aromatic chemicals Iranian medicinal plants. Iranian Jouranl of
of Apiaceae). Discovery publishing house, Pharmaceutical research, 2:101-103
New Delhi. 25. Suil S. Jalalpure, Kallanagoda R.
16. Patra, A., Jha, S., Murthy, N.P. and Alagawadi, Channabasappa S.
Vaibhav, A.D. (2008) Anthelmintic and Mahajanshetty (2006) in vitro Anthelmintic
antibacterial activities of Hygrophila spinosa proerty of various seed oils. Iranian Jouranal
T. Anders. Research J. Pharm and Tech. (4) of Pharmaceutical Research, 4: 281 – 284.
Oct. – Dec. 531 – 532. 26. Thorn, G.W., Adams, R.D., Braunwald, E.,
17. Pelezcar, M.J. (1957) Microbiological Isselbacher, K.J. and Petersdrof, R.G. (!977)
methods by the society of American Harrison‘s Principles of Internal Medicine,
Bacteriologist, Mc Graw Hill Book In : Mcraw Hill Co., New York, pp: 1088-
Company, pp:42. 1089.
18. Perry, B.D. and Randoph, T.F. (1999) 27. Updegroff, D.M. (1969) Anal iochem:
Improving the assessment of the economic Academic Press, New York, 32:420
impact of parasitic diseases and of their 28. Vigar, Z. (1984) Atlas of Medical
control in production animals. Veterinary Parasitology 2nd ed. Singapore. Publishing
parasitolgy., 84:145-168. House; p.216-18.
19. Pessoa, L.M., Moris, S.M., Bevilaqna, 29. Zafar iqbal; Muhammad Lateef; Abdul
L.M.L. and Luciano, J.H.S. ―Anthelmintic Jabar; Muhammad Shoaib Akhtar,
activity of essenbtial oil of Ocimum Muhammad Nisar Khan (2006)
gratissimum Linn. and eugenol against. Anthelmintic activity of Vernonia
Haemonchus controtus‖. Veterinary anthelmintica seeds against.
parasitolgy, Vol: 109 No: 1-2, Oct-16 pp: 59 Trichostrongylid nematodes of sheep.
– 63. Pharmaceutical Biology, Vol.44, pp. 563-
20. Research and Development, Vol-6 567
Aug/0002.
21. Roe, J.H. (1965) Determination of food
carbohydrates D.A.T. Sathgate, Uni.
Cambr., England pp. 258.
TOXICOLOGICAL EVALUATION OF AQUEOUS LEAF
EXTRACT OF SENNA ALATA IN PREGNANT WISTAR
RATS
Yakubu M. T.1, Adeshina A. O.1, Ibrahim, O. O. K.2

ijcrr 1
Phytomedicine, Toxicology and Reproductive Biochemistry Research
Vol 04 issue 08 Laboratory, Department of Biochemistry, University of Ilorin, Ilorin,
Category: Research Nigeria
2
Received on:29/11/11 Department of Pathology, University of Ilorin, Nigeria
Revised on:23/12/11
E-mail of Corresponding Author: tomuyak@yahoo.com
ABSTRACT
Objective: Aqueous leaf extract of Senna alata at 250, 500 and 1000 mg/kg body weight was
evaluated for toxicity in pregnant Wistar rats. Methods: Pregnant rats were grouped into four
(A, B, C and D) of five animals each such that rats in groups A, B, C and D received 0.5 ml of
distilled water, 250, 500 and 1000 mg/kg body weight of the extract respectively, from days
10-18 post-coitus. Results: The extract reduced (P<0.05) the activities of alkaline
phosphatase, aspartate transaminase, alanine transaminase and gamma glutamyl transferase in
the liver and kidney of the animals with increases in heart and serum enzymes. The levels of
haematological parameters, serum albumin, globulin, creatinine, sodium, calcium, chloride
ions, blood urea nitrogen (BUN): creatinine ratio, total cholesterol, triacylglycerol, low- and
high-density lipoprotein cholesterol were decreased by the extract while those of urea, uric
acid, serum total bilirubin, phosphate, potassium, calcium and atherogenic index increased
significantly. The myocardial fibres were normal in the heart while there was varying degree
of necrosis of the tubular epithelial cells in the kidney and hepatic degeneration in the liver.
Conclusion: The extract caused both functional and structural toxicities and therefore not
safe for consumption during pregnancy.
___________________________________________________________________________
Keywords: Senna alata, Fabaceae, bilateral, leathery compound leaves (50-80
Pregnancy, Functional toxicity, Structural cm long) that fold together in the dark.
toxicity, Biomarkers The fruit is a straight pod of about 25 cm
long.2 The seeds are small and square in
INTRODUCTION shape while the inflorescence looks like a
Senna alata (Linn) Roxb. (=Cassia alata yellow candle. The root, stem, stem bark
Linn) which belongs to the Fabaceae and leaves have been separately claimed
family (subfamily Caesalpiniaceae) is to be used to manage hepatitis, scabies,
often variously called Ringworm Bush, pruritis, jaundice, gastroenteritis,
Candlebra Bush, Empress Candle Plant ringworm, ulcer, eczema, burns, wound,
and Ringworm Tree (English), asunwon skin and upper respiratory tract infection,
oyinbo (Yoruba-Western Nigeria) and diarrhoea, constipation, food poisoning
nelkhi or okpo (Igbo-Eastern Nigeria).1 It and poisonous bites.3,4 The leaves have
is native to Mexico and grows in forest been implicated to be used as abortifacient
areas of West Africa. S. alata is an erect, and to hasten labour.1
tropical, annual herb of 0.15 m high with

S. alata have been scientifically evaluated cholesterol were products of Randox
for a variety of pharmacological activities Laboratories, Ltd, United Kingdom. Para-
such as antibacterial, antifungal, nitrophenyl phosphate was a product of
antiparasitic, laxative, antidiabetic, anti- Sigma-Aldrich Chemical, United
inflammatory, analgesic and Kingdom. All other reagents used were of
abortifacient.5-12 The toxicological studies analytical grade and were prepared in
available in the open scientific literature glass-distilled water.
on S. alata thus far have used normal mice Laboratory animals
and rats as models.13, 14 Since the extract Forty rats (Rattus norvegicus) made up of
have been reported to possess abortifacient equal number of males (184.80 ± 4.16 g)
activity in pregnant rats, there is also the and females (163.65 ± 3.11 g) were
need to investigate the toxic implications obtained from the Animal Breeding Unit
of the same doses of extract in pregnant of the Department of Biochemistry,
rats. Therefore, the present study was University of Ilorin, Ilorin, Nigeria. The
aimed at providing information on the animals, housed in aluminium cages that
effect of aqueous leaf extract of S. alata on were placed in well-ventilated room
some functional indices of the liver, heart conditions (temperature: 22 ± 3ºC; 12 h
and kidney of pregnant Wistar rats. We light-dark cycle; humidity: 45%-50%)
also investigated the haematological and were also supplied with rat pellets (Bendel
lipid profile as well as the Feeds and Flour Mill, Ewu, Edo, Nigeria)
histoarchitectural changes in the selected and water ad libitum.
organs of the pregnant animals following Preparation of aqueous leaf extract
the administration of the extract on days The leaves of Senna alata were oven-dried
10-18 post-coitus. at 400C for 72 h to a constant weight using
Uniscope SM9053 Laboratory Oven,
MATERIALS AND METHODS (Surgifriend Medicals, Essex, England).
Materials The dried leaves were then pulverized
Plant materials with an electric blender (Crown Star
The plant sample, obtained from herb Blender CS- 242B, Trident (H.K.) Ltd,
sellers at a market (Oja tuntun) in Ilorin, China) from which 100 g each was
Nigeria was authenticated at the Forestry extracted in 1000 ml of cold distilled water
Research Institute of Nigeria, Jericho, for 48 hours with constant shaking. This
Ibadan, Nigeria. A voucher specimen (FHI was later filtered with Whatmann No. 1
10845) was deposited at the Herbarium of filter paper and thereafter lyophilized
the Institute. (Micromodulyo Freeze Dryer, FS400-05,
Assay kits and other reagents USA) to give a yield of 16.50 g which was
The assay kits for urea, creatinine and uric reconstituted in distilled water to give the
acid were products of Quinica Clinical required doses of 250, 500 and 1 000
Aplicada, S.A Amosta, Spain, while those mg/kg body weight used in this study. The
for albumin, bilirubin, globulin, aspartate doses were as used previously in our study
transaminase (AST), alanine transaminase on the abortifacient activity of the aqueous
(ALT), -glutamyl transferase (GGT), leaf extract of S. alata in pregnant rats.12
sodium, potassium, calcium, chloride, Animal grouping and extract
phosphate, cholesterol, triacylglycerol, administration
low- and high- density lipoprotein

Female rats were paired overnight with the Pasteur pipette and kept frozen overnight
male rats in ratio 1:1 in aluminium cages before being used for the biochemical
that made the animals have free access to analyses. The animals were thereafter
food and water. The day when vaginal dissected; the liver, heart and kidney
plug and spermatozoa (detected with the removed and cleaned of blood by blotting
aid of light microscope) appeared in the in tissue paper. The kidneys were
vaginal smear was considered as day zero decapsulated after which the organs of
of pregnancy. Pregnancy was also interest were weighed separately and
confirmed with the aid of pregnancy strip homogenized in ice-cold 0.25M sucrose
dipped into their urine. The pregnant solution (1:5 w/v). The homogenates were
animals were thereafter completely centrifuged at 1398 g x 15 min to obtain
randomized into four groups (A, B, C and the supernatant, which were then used
D) of five animals each. The distilled within 24 hours for the biochemical
water and the extracts were administered analyses.
orally to the various groups of animals on Determination of biochemical and
days 10 to 18 (organogenetic period) post haematological parameters
coitus on daily basis, using oropharyngeal The procedures adopted for the
cannula as follows: Group A (control) biochemical parameters were as described
received 0.5 ml of distilled water while for alkaline phosphatase16, aspartate and
animals in Groups B, C and D, were alanine transaminases17, gamma glutamyl
treated in the same manner as the control transferase18, total protein19, bilirubin20,
except that they received equal volume of albumin21, urea22, creatinine23, calcium,
the extract containing 250, 500 and 1000 phosphate, uric acid, globulin, potassium,
mg/kg body weight respectively. The sodium and chloride ions24. The blood
animals were humanely handled according urea nitrogen (BUN): creatinine ratio was
to the guidelines of National Institute of computed as the ratio of serum urea to
Health on the Care and Use of Laboratory creatinine. The lipids assayed included
Animals.15 This study was carried out total cholesterol25, low density lipoprotein-
following approval from the Ethical cholesterol26, high density lipoprotein-
Committee on Animal Use and Care of the cholesterol27, triglycerides28 and
29
Department of Biochemistry, University of atherogenic index . The organ-body
Ilorin, Ilorin, Nigeria (Ref: weight ratio was computed using the
UIL/BCH/EC/2008/001). expression of Yakubu et al30. The
Preparation of serum and tissue haematological parameters of
supernatants haemoglobin (Hb), packed cell volume
The animals were anaesthetized in a glass (PCV), red blood cells (RBC), mean
jar containing cotton wool soaked in corpuscular volume (MCV), mean
diethyl ether. The unconscious rat was corpuscular haemoglobin (MCH), mean
quickly removed and the neck area cleared corpuscular haemoglobin concentration
of fur. The jugular veins were cut and (MCHC), white blood cells (WBC),
blood was collected into the test tubes. platelets, neutrophils and lymphocytes
The blood samples were allowed to clot at were analysed using Haematologic
room temperature for 10 min after which Analyzer, Sysmex, KX-21, Japan by
they were centrifuged at 894 g x 10 min. adopting the principles described by Dacie
The resulting serum was collected using and Lewis31.

Histological examination The extract at the doses of 250, 500 and
Tissue sections of the liver, heart and left 1000 mg/kg body weight selectively
kidney of the animals were prepared using affected the haematological parameters.
the procedures described by Drury and For example, all the doses of the extract
Wallington32 and Krause33. The tissues decreased (P<0.05) the levels of Hb, PCV,
were stained with hematoxylin/eosin RBC, MCV, MCH, MCHC whereas the
(H&E) and photomicrographs captured at WBC, platelets, neutrophils and
x 400 with a Canon PowerShot A560 lymphocytes increased significantly
Digital Camera, Canon USA Inc., NY, (P<0.05) (Table 8).
USA. While the computed heart-body weight
Statistical analysis ratio was not significantly altered
Data were expressed as the means + SEM (P>0.05), the extract decreased (P<0.05)
of five replicates. Significant differences the liver- and kidney-body weight ratios.
were determined using a one-way analysis Furthermore, compared with their
of variance and Duncan Multiple Range respective controls (Plates 1a, 2a and 3a),
Test at P<0.05. the extract did not produce any
histoarchitectural change in the heart of
RESULTS the animals as the myocardial fibres were
The extract significantly (P<0.05) normal (Plates 1b, c and d). In contrast, the
decreased the activities of ALP, GGT, hepatic degeneration ranged from mild to
AST and ALT in the liver and kidney of severe with the lymphocytes extending
the animals (Tables 1-4). In contrast, the into the lobule in the liver (Plates 2b, c and
activities of these enzymes were increased d) whereas in the kidney, the glomerulus
(P<0.05) by all the doses of the extract in were normal with necrosis of tubular
the heart and serum of the animals (Tables epithelial cells and inflammatory cells
1-4). within the interstitum (Plates 3b, c and d).
The extract also decreased (P<0.05) the
concentrations of albumin, globulin, DISCUSSION
creatinine, sodium, calcium and chloride Aqueous leaf extract of S. alata has been
ion in the serum of the animals whereas acclaimed in folk medicine of Nigeria to
the total bilirubin, urea, uric acid, be used as an abortifacient and to ‗wash
potassium and phosphate increased the uterus‘. This claim however has been
(P<0.05) (Tables 5 and 6). The computed substantiated by adequate scientific data.12
blood urea nitrogen: creatinine ratio in the Previous report by Yakubu et al12 focussed
extract treated animals was lower than the only on maternal and fetal outcomes
distilled water treated control rats (Table without reporting on the safety of the
6). extract in other tissues of the pregnant rats.
In addition, all the doses of the extract Therefore, the present study discusses the
significantly (P<0.05) reduced the serum implications of aqueous leaf extract of S.
concentrations of total cholesterol, alata on selected markers of damage and
triglycerides, low- and high- density histology of the liver, kidney and heart as
lipoprotein cholesterols whereas the well as lipid and haematological profile of
computed atherogenic index increased pregnant rats while adopting the same
significantly (P<0.05) (Table 7). dose regimen (250, 500 and 1000 mg/kg

body weight) used previously in the that the balance between the rate of
abortifacient study. production and destruction has been
ALP, GGT, AST and ALT are important altered. It may also be that the individual
markers of damage to the plasma and total population of the red blood cells
membrane and cytosol.34, 35 The reduction have been adversely affected. The findings
in the activities of ALP in the liver and in this study are similar to that reported
kidney as well as GGT of the animals earlier by Adebayo et al37 on
which was accompanied with Bougainvillea spectabilis leaves.
corresponding increase in the serum Furthermore, the increase in WBC and
enzymes suggest permeability changes factors relating to it suggest that the
arising from damage to the cell membrane immune system has been challenged by
of the organs. The elevated serum GGT, a the extract. These are indications of
more effective indicator of hepatobilliary selective systemic toxicity of the plant
toxicity than the ALP36 further extract.
corroborates the hepatoxicity of the Albumin and globulin are useful indicators
extract. Thus, it is not surprising to have of synthetic function of the liver whereas
reduction in the AST and ALT of the bilirubin could be used to assess excretory
tissues since damage to plasma membrane function of the organ. The decrease in both
will consequentially lead to leakage of the the albumin and globulin by the extract in
cytosolic content, in this instance, the AST the present study may suggest diminished
and ALT. These alterations suggest that synthetic function of the liver arising
the extract is hepato- and nephrotoxic. In probably from hepatocellular injury38,
contrast, the increase in the activity of increased catabolism, abnormal
ALP, GGT, AST and ALT in the heart of distribution and abnormal or excessive
the animals could be due to enhanced loss. The obtained elevated levels of
synthesis of these enzymes. The reason for bilirubin further support hepatotoxicity of
the different pattern of toxicity pattern by the extract arising from an effect on the
the extract on these tissues is not normal excretory function of the liver of
immediately known but may be due to the the pregnant animals.
differences in the drug-metabolizing Changes in the serum concentrations of
enzymes of the tissues. The changes in the creatinine, urea, uric acid and electrolytes
activities of the enzymes will have such as Na+, Ca2+, K+, PO42- and Cl- are
consequential effects on the metabolic indicators of renal function at the tubular
processes that depend on the enzymes. and glomerular levels. The reduced levels
The extract exhibited selective systemic of serum creatinine by the extract suggest
toxicity on the haematological parameters glomerular dysfunction39 while similar
investigated as evidenced by the decrease reduction in the levels of Na+, Ca2+ and Cl-
in red blood cells and factors relating to it indicates decreased tubular reabsorption.40
(haemoglobin, packed cell volume, mean Furthermore, the increased levels of serum
corpuscular haemoglobin and mean urea and uric acid implies that there was
corpuscular haemoglobin concentration) reduction in the glomerular filtration rate
and increase in white blood cells and those of the kidney while the increase in the
factors relating to it (platelets, neutrophils levels of K+, and PO42- suggest tubular
and platelets). The decrease in RBC and damage since the ions are reabsorbed at
factors relating to it may be an indication the distal tubules of the kidney. All these

are indications of renal dysfunction arising index, an index of atherosclerosis and its
probably from interference with metabolic associated heart diseases.42
process of the metabolite, inefficient Organ-body ratio can be used to indicate
filtration by the kidney and obstruction of swelling, atrophy and hypertrophy.43 The
lower urinary tract, impaired glomerular decrease in the liver- and kidney-body
and tubular reabsorption or excretion of weight ratios may be a manifestation of
these ions. This therefore implies the moderate to severe hepatic
impairment or interference in the normal degeneration and extensive degeneration
excretory and reabsorptive functions of the of tubular epithelial cells revealed by
kidney. The serum BUN: creatinine ratio histological examination in the present
measures the amount of nitrogen in the study. In contrast, the absence of
blood, and can also indicate dysfunction significant changes in the heart-body
by either the liver or kidney since urea is weight ratio was also corroborated by lack
produced by the liver and excreted by the of visible histoarchitectural changes since
kidney. Therefore, the low values of the myocardial fibres were normal. The
computed serum BUN: creatinine ratio nephrotoxicity and hepatotoxicity of the
compared to the control suggests that the aqueous leaf extract of S. alata at the
elevated urea in the serum of the animals doses of 250-1000 mg/kg body weight
is a consequence of liver dysfunction. were corroborated by histoarchitectural
Changes in the levels of cholesterol, TAG, alterations in the kidney and liver of the
HDL-C and LDL-C in the serum of the pregnant animals. Therefore, the
animals can serve as useful indicators of toxicological impact of the aqueous leaf
altered lipid metabolism and pre- extract of S. alata in the present study was
disposition of the animals to both functional and structural in the liver
cardiovascular risk.41 The extract affected and kidney whereas it was only functional
the metabolism of lipid in the pregnant in the heart of the animals. The disparity in
animals probably by impairing the normal the histological results of the organs may
biosynthesis of cholesterol and enhancing be attributed to direct involvement of the
lipolysis. The significant decrease in LDL- liver and kidney in the detoxification and
C is understandable since there is a direct eventual elimination of the extract.
relationship between cholesterol and LDL- In conclusion, aqueous leaf extract of S.
C.41 This trend was supported in the alata pose toxicological risk to the organs
present study where both the cholesterol of pregnant rats investigated in the present
and LDL-C of the serum of pregnant rats study. Therefore, the extract may cause
were decreased by the extract of S. alata structural and functional dysfunctions in
leaves. Furthermore, the reduction in the the liver and kidney while the
serum content of HDL-C, the medium by toxicological impact is restricted to
which cholesterol from peripheral tissues functional dysfunction in the heart of the
is transported to the liver to reduce the pregnant animals. The extract could
amount stored in the tissue and the predispose the pregnant animals to
possibility of developing atherosclerotic systemic toxicity and cardiovascular risk.
plague, may not be clinically beneficial as
it may predispose the animals to ACKNOWLEDGEMENT
cardiovascular risk. This is corroborated Authors acknowledge the immense help
by the elevated computed atherogenic received from the scholars whose articles

were cited and included in the references Medicinal Plants Res 2011; 5(2): 176-
of this manuscript. The authors are also 83.
grateful to authors/editors/publishers of all 8. Moundipa PF, Melanie Flore KG,
those articles, journals and books from Bilong Bilong CF, Bruchhaus I. In
where the literature of this article have vitro amoebicidal activity of some
been reviewed and discussed. medicinal plants of Bamun Region
Declaration of Conflict of Interest or of (Cameroon). Afr J Trad Complement
Financial Disclosure: The authors report Alt Med 2005; 2:113-21
no conflict of interest. The authors alone 9. Elujoba A, Ajulo OO, Iweibo GO.
are responsible for the content and writing Chemical and Biological analyses of
of the paper. Nigerian Cassia species for laxative
activity. J Pharm Biomed Anal 1989;
REFERENCES 7: 1453-7.
1. Gill LS. Ethnomedical uses of plants 10. Palanichamy S, Nagarajan S,
in Nigeria. Nigeria: Uniben Press, Devasagayam M. Effect of Cassia
Benin; 1992: 60-1. alata leaf extract on hyperglycemic
2. Martin H, Bindanda MP. Natural rats. J Ethnopharmacol 1988; 22(1):
Medicine in the Tropics I: Foundation 81-90.
text. anamed, Winnenden, Germany 11. Villaseñor IM, Canlas AP, Pascua
2008. MPI, Sabando MN, Soliven LAP.
3. Adedayo O, Anderson WA, Moo- Bioactivity studies on Cassia alata
Young M, Snieckus V, Patil PA, Linn. leaf extracts. Phytother Res
Kolawole DO. Phytochemistry and 2002; 16 suppl.1: S93-S6.
antibacterial activity of Senna alata 12. Yakubu MT, Adeshina AO, Oladiji
flower. Pharm Biol 2001; 39(6): 408- AT, Akanji MA, Oloyede OB, Jimoh
12. GA, Olatinwo AWO, Afolayan AJ.
4. El-Mahmood AM, Doughari JH, Abortifacient potential of aqueous
Chanji FJ. In vitro antibacterial extract of Senna alata leaves in rats. J
activities of crude extract of Nauclea Reprod & Contraception. 2010; 21(3):
latifolia and Daniella oliveri. Sci Res 163-77
Essays 2003; 31(3): 102-5. 13. Sodipo OA, Effraim KD, Emmagun E.
5. Owoyale JA, Olatunji GA, Oguntoye Effects of aqueous leaf extract of
SO. Antifungal and antibacterial Cassia alata on some haematological
activities of an alcoholic extract of indices in albino rats. Phytother Res
Senna alata leaves. J. Appl. Sci. 1998; 12: 431-3.
Environ. Mangt 2005; 9(3): 105-7. 14. Yagi SM, El Tigani S, Adam SEI.
6. Abubacker MN, Ramanathan R, Toxicity of Senna obtusifolia fresh
Kumar TS. In vitro antifungal activity and fermented leaves (kawal), Senna
of Cassia alata Linn. flower extract. alata leaves and some products from
Nat Prod Radiance. 2008; 7(1): 6-9. Senna alata on rats. Phytother Res
7. Sule WF, Okonko IO, Omo-Ogun S, 1998; 12: 324-30
Nwanze JC, Ojezele MO, Ojezele OJ, 15. National Institutes of Health. (NIH).
Alli JA, Soyemi ET, Olaonipekun TO. Guide for the Care and Use of
Phytochemical properties and in-vitro Laboratory Animals. Washington DC,
antifungal activity of Senna alata
Linn. crude stem bark extract. J
USA: National Research Council. 26. Demacker PN, Hymans AG, Brennink
1985; NIH Publication No. 83-127. BJ, Jansen BP, Vantlaar A. 5 methods
16. Wright PJ, Leathwood PD, Plummer for determining low density
DT. Enzymes in rat urine. Alkaline lipoprotein cholesterol compared.
phosphatase. Enzymologia. 1972; Clin. Chem 1984; 30(1): 1797-800.
42(4): 317-27. 27. Albers JJ, Warnick GR, Chenng MC.
17. Reitman S, Frankel S. A colourmetric Quantitative of high density
method for the determination of serum lipoproteins. Lipids. 1978; 13: 926-32.
glutamate-oxaloacetate and pyruvate 28. Fossati P, Precipe L. Serum
transaminase. Am J Clin Path 1957; triglycerides determined
28:56 colourimetrically with an Enzyme that
18. Szasz G. Methods of enzymatic produces hydrogen peroxide. Clin
analysis. Clin Chem 1974; 2: 715-21. Chem 1982; 28(10): 2077-80.
19. Gornall AC, Bardawill CJ, David 29. Panagiotakos BC, Pitsavos J, Skoumas
MM. Determination of serum protein J, Chrysohoou C, Toutouza M,
by means of biuret reaction. J Biol Stganadis CI, Toutouzas PK.
Chem 1949; 177: 751-6. Importance of LDL/HDL ratio as a
20. Evelyn KA, Malloy HT. Micro predicator for coronary heart disease
determination of oxyhaemoglobin, events in patients with heterozygous
methaemoglobin and sulphaemoglobin familiar hypercholesterolemia; A is
in a single sample of blood. J Biol year follow up (1987- 2002). Curr
Chem 1938; 126: 655. Med Res & Opin 2003; 19(2): 89-94.
21. Doumas BT, Watson WA, Biggs HG. 30. Yakubu MT, Akanji MA, Oladiji AT,
Albumin standards and measurement Adesokan AA. Androgenic potentials
of serum albumin with bromocresol of aqueous extract of Massularia
green. Clin Chim Acta 1971; 31: 87- acuminata (G. Don) Bullock ex Hoyl.
92. stem in male Wistar rats. J.
22. Veniamin MP, Varkirtzi C. Chemical Ethnopharmacol .2008; 118(3): 508-
basis of the carbamidodi-acetyl micro- 513.
method for estimation of ure, citrulline 31. Dacie JV, Lewis M. Practical
and carbamyl derivatives. Clin. Chem haematology, 7th edn, Churchill,
1970; 16: 3-6. Livingstone, Edinburg, London, 1995;
23. Blass KG, Thiebert RJ, Lam LK. 12-7.
Study of mechanism of JAFE 32. Drury RAB, Wallington EA.
reactions. Clin Chem 1974; 12: 336- Carleton‘s Histological Technique. 4th
43. edn, New York:NY; Oxford
24. Tietz NW. Clinical Guide to University Press; 1973: 58.
Laboratory Tests. 3rd edn, 33. Krause WJ. The art of examining and
Philadelphia: W.B. Saunders interpreting histologic preparations. A
Company; 1995. student handbook, UK: Partheton
25. Fredrickson DS, Levy RI, Lees RS. Publishing Group; 2001: 9-10.
Fat transport in lipoproteins-An 34. Akanji MA, Adegoke OA, Oloyede
integrated approach to mechanisms OB. Effect of chronic comsumption of
and disorders. N Engl J Med 1967; metabisulphate on the integrity of rat
276(3): 148-56.

cellular system. Toxicol . 1993; Ashwood, ER, Bruns, DE and Sawyer
81:173-9. BG (eds). WB Saunders (6th edn).
35. Shahjahan M, Sabitha KE, Mallika J, 2008; 363-368.
Shyamala-Devi CS. Effect of Solanum 40. Scot GM. Electrolytes and blood
trilobatum against carbon tetrachloride gases. In: Tietz fundamentals of
induced hepatic damage in albino rats. clinical chemistry. Burtis, CA,
Indian J Med Res 2004; 120: 194–8. Ashwood, ER, Bruns, DE and Sawyer
36. Giannini EG, Testa R, Savarino V. BG (eds). WB Saunders (6th edn) .
Liver enzyme alteration: a guide for 2008; 431-440.
clinicians. Canadian Medical Ass J. 41. Yakubu MT, Akanji MA, Oladiji AT.
2005; 172(3): 367-79. Alterations in serum lipid profile of
37. Adebayo OJ, Adesokan AA, Olatunji male rats by oral administration of
LA, Buoro DO, Soladoye AO. Effect aqueous extract of Fadogia agrestis
of ethanolic extract of Bougainvillea stem. Res J Med Plant 2008; 2(2): 66-
spectabilis leaves on haematological 73.
and serum lipid variables in rats. 42. Panagiotakos B, Pitsavos C, Skoumas
Biokemistri, 2005; 17: 45-50. J, Chrysohoou C, Toutouza M,
38. Lakmichi H, Bakhtaoui FZ, Gadhi Stefanadis CI, Toutouzas PK.
CA, Ezoubeiri A, El-Jahiri Y, El- Importance of LDL/HDL ratio as a
Mansouri A, Zrara B, Loutfi K. predicator for coronary heart disease
Toxicity profile of the aqueous ethanol events in patients with heterozygous
root extract of Corrigiola telephiifolia familial hypercholesterolemia: A 15
Pourr. (Caryophyllaceae) in rodents. year follow-up (1987-2002). Curr Med
Evid-Based Compl & Altern Med Res & Opin 2003; 19(2): 89-94.
2011; e-pub ahead of print (DOI: 43. Amresh G, Singh PN, Rao CV.
10.1155/2011/317090. Toxicological screening of traditional
39. Lamb EJ, Price CP. Creatinine, urea medicine Laghupatha (Cissampelos
and uric acid. In: Tietz fundamentals pareira) in experimental animals. J
of clinical chemistry. Burtis, CA, Ethnopharmacol 2008; 116: 454–60.

Table 1: Alkaline phosphatase activity of selected tissues of pregnant rats administered
with aqueous leaf extract of S. alata
_____________________________________________________________________
Alakline phosphatase activity (nm/min/mg protein)
_______________________________
Doses Liver Kidney Heart Serum
Control (Distilled water) 3.85 ± 0.07a 22.18 ±1.65a 4.76 ±0.11a 0.41 ± 0.02a
250 mg/kg body weight 2.02 ± 0.06b 12.00 ±0.82b 6.76 ±0.24b 0.78 ± 0.01b
500 mg/kg body weight 1.48 ± 0.02c 10.50 ±0.12b 7.81 ±0.03b 1.02 ± 0.03c
1000 mg/kg body weight 0.92 ± 0.05d 11.52 ±0.05b 9.02 ±0.06c 1.41 ± 0.02d
Values are means ± SD of five determinations

Test values carrying superscripts different from the control are significantly different
(P<0.05).
Table 2: Gamma glutamyl transferase activity of selected tissues of pregnant rats

administered with aqueous leaf extract of S. alata
_____________________________________________________________________
Gamma glutamyl transferase activity (U/L)
_______________________________
500 mg/kg body weight 11.77 ± 0.28c 12.06 ±0.16c 25.63 ±1.44c 8.76 ± 0.86c
1000 mg/kg body weight 10.59 ± 0.32c 8.14 ±1.01d 38.41 ±3.01d 8.62 ± 0.73c

(P<0.05).

Table 3: Alanine transaminase activity of selected tissues of pregnant rats administered
with aqueous leaf extract of S. alata
_____________________________________________________________________
Alanine transaminase activity (U/L)
_______________________________
1000 mg/kg body weight 140.19 ± 5.09c 45.82 ±4.72d 191.70 ±6.00c 88.51 ± 4.27d

(P<0.05).
Table 4: Aspartate transaminase activity of selected tissues of pregnant rats

administered with aqueous leaf extract of S. alata
_____________________________________________________________________
Aspartate transaminase activity (U/L)
_______________________________
1000 mg/kg body weight 465.28 ± 8.43d 307.86 ±8.09d 64.01 ±8.62c 40.00 ± 2.08c

(P<0.05).

Table 5: Serum liver function indices of pregnant rats administered with aqueous leaf
extract of S. alata
_____________________________________________________________________
Extract (mg/kg body weight)
_______________________________
Indices Control 250 500 1000
Albumin (g/L) 39.00 ± 1.09a 22.00 ±0.89b 21.33 ±1.37b 14.08 ± 0.89c
Globulin (g/L) 17.50 ± 0.55a 14.00 ±1.03b 13.50 ±0.25b 9.18 ± 0.89c
Total bilirubin (g/L) 15.00 ± 0.45a 20.22 ±1.25b 22.05 ±0.67c 24.49 ± 0.59d

(P<0.05).
Table 6: Serum kidney function indices of pregnant rats administered with aqueous leaf
extract of S. alata
_____________________________________________________________________
_______________________________
Urea (mmol/L) 0.70 ± 0.01a 1.20 ±0.22b 1.15 ±0.05c 1.05 ± 0.05d
Creatinine (mmol/L) 19.00 ± 0.91a 14.00 ±0.19b 12.50 ±0.55c 11.50 ± 0.05c
Blood urea nitrogen 1: 27 1:12 1:11 1:11

(BUN):creatinine ratio
Uric acid (mmol/L) 0.03x 10-1 ± 0.79 x 0.05 x 10-1 ± 0.89 x 0.06 x 10-1 ± 0.89 x 0.05 x 10-1 ± 0.52 x
10-3a 10-3b 10-3b 10-3b
Sodium ion (mmol/L) 77.50 ± 2.73a 68.50 ±2.73b 69.00 ± 2.68b 67.00 ± 1.79b
Potassium ion (mmol/L) 1.45 ± 0.01a 1.57 ±0.04b 1.70 ±0.09c 1.73 ± 0.14c
Calcium ion (mmol/L) 1.28 ± 0.24a 1.05 ±0.02b 1.00 ±0.06b 0.95 ± 0.01b
Chloride ion (mmol/L) 0.51 ± 0.01a 0.50 ±0.00a 0.44 ±0.01b 0.26 ± 0.02c
Phosphate ion (mmol/L) 0.51 ± 0.01a 1.50 ±0.02b 0.89 ±0.01c 0.98 ± 0.01c

(P<0.05).
100 International Journal of Current Research and Review
www.ijcrr.com
Table 7: Serum lipid profile of pregnant rats administered with aqueous leaf extract of
S. alata
_____________________________________________________________________
_______________________________
Total cholesterol (mmol/L) 2.13 ± 0.14a 1.20 ±0.11b 1.09 ±0.09c 0.57 ± 0.04d
Triglyceride (mmol/L) 0.59 ± 0.91a 0.38 ±0.05b 0.34 ±0.06b 0.30 ± 0.02c
Low-density lipoprotein 1.02 ± 0.08a 0.81 ± 0.04b 0.62 ± 0.07c 0.51 ± 0.06d
cholesterol (mmol/L)
High-density lipoprotein 2.83 ± 0.23a 1.30 ± 0.09b 1.10 ± 0.13c 0.77 ± 0.19d
cholesterol (mmol/L)
Atherogenic index 0.36 ± 0.13a 0.62 ±0.04b 0.56 ±0.14c 0.66 ± 0.02c
(LDLC/HDLC

(P<0.05).
101 International Journal of Current Research and Review

www.ijcrr.com
Table 8: Haematological parameters of pregnant rats administered with aqueous leaf extract of S. alata
Treatment Doses Hb (g/dl) PCV (%) RBC MCV (fl) MCH MCHC WBC PLAT NEUT LYMP
(mg/kg (x 1012/l) (pg) (g/dl) (x 109/l) (x 109/l) (%) (%)
body
weight
Distilled Control 18.65 ± 53.33 ± 4.25 ± 0.63a 132.33 ± 37.33 ± 32.67 ± 7.77 ± 0.50a 841.00 ± 10.00 ± 90.02 ±
water 2.05a 2.02a 7.57a 3.50a 2.08a 11.01a 0.71a 8.72a
250 15.50 ± 48.33 ± 3.37 ± 0.75b 112.33 ± 23.00 ± 24.00 ± 9.53 ± 0.41b 1013.33 ± 13.10 ± 106.00 ±
2.81b 2.31b 4.97b 0.53b 0.20b 17.03b 0.20b 2.80b
Extract 500 12.90 ± 41.67 ± 3.28 ± 0.37b 113.67 ± 20.33 ± 22.67 ± 10.53 ± 980.60 ± 13.67 ± 127.08 ±
1.13c 2.89c 6.11b 2.52b 0.58b 0.15b 18.85b 0.02b 7.02c
1000 11.70 ± 31.00 ± 3.27 ± 0.55b 103.00 ± 16.67 ± 17.67 ± 13.40 ± 1210.00 ± 16.33 ± 122.67 ±
1.28d 2.65d 4.27c 2.29c 0.13c 0.84c 16.37c 1.06a 6.06c

Test values carrying superscripts different from the control are significantly different (P<0.05).

Table 9: Organ body weight ratio of pregnant rats administered with aqueous leaf extract of S.
alata
_____________________________________________________________________
Organ body weight ratio (%)
_______________________________
Doses Liver Kidney Heart
Control (Distilled water) 4.69 ± 0.24a 0.63 ± 0.09a 0.36 ± 0.03a
250 mg/kg body weight 3.93 ± 0.32b 0.54 ± 0.05b 0.34 ± 0.04a
500 mg/kg body weight 3.66 ± 0.63c 0.55 ± 0.03b 0.35 ± 0.03a
1000 mg/kg body weight 3.69 ± 0.31c 0.54 ± 0.04b 0.35 ± 0.02c

Test values carrying superscripts different from the control are significantly different (P<0.05).
Plate 1a: Photomicrograph of the heart of pregnant rat orally administered with distilled water on
days 10-18 post coitus. The arrow shows normal myocardial fibres (x400) (H & E).

Plate 1b: Photomicrograph of the heart of pregnant rat orally administered with 250 mg/kg body
weight of aqueous leaf extract of S. alata on days 10-18 post coitus. The arrow shows normal
myocardial fibres (x400) (H & E).
Plate 1c: Photomicrograph of the heart of pregnant rat orally administered with 500 mg/kg body

Plate 1d: Photomicrograph of the heart of pregnant rat orally administered with 1000 mg/kg body
PT
PTPT
TPT
H
Plate 2a: Photomicrograph of the liver of pregnant rat orally administered with distilled water on
days 10-18 post coitus. The arrows shows portal tract (PT) containing few lymphocytes and normal
hepatocytes (H) with no degenerative changes (x400) (H & E).

Plate 2b: Photomicrograph of the liver of pregnant rat orally administered with 250 mg/kg body
weight of aqueous leaf extract of S. alata on days 10-18 post coitus. There was mild to moderate
hepatic degeneration (x400) (H & E).
Hepatic
degeneration
Plate 2c: Photomicrograph of the liver of pregnant rat orally administered with 500 mg/kg body
weight of aqueous leaf extract of S. alata on days 10-18 post coitus. The circled spot shows portal
tract with lymphocytes extending into the lobule. The arrow shows severe degeneration of the
hepatocytes (x400) (H & E).

Hepatic
degeneration
Plate 2d: Photomicrograph of the liver of pregnant rat orally administered with 1000 mg/kg body
weight of aqueous leaf extract of S. alata on days 10-18 post coitus. The circled spot shows portal
tract with lymphocytes extending into the lobule. The arrow indicates severe degeneration of the
hepatocytes (x400) (H & E).
GM
Plate 3a: Photomicrograph of the kidney of pregnant rat orally administered with distilled water on
days 10-18 post coitus. The circled spot shows normal glomeruli (GM) and tubules (x400) (H & E).

GM
DTEC
Plate 3b: Photomicrograph of the kidney of pregnant rat orally administered with 250 mg/kg body
weight of aqueous leaf extract of S. alata on days 10-18 post coitus. The circled spot shows normal
glomeruli (GM) while the arrow indicates degenerated tubular epithelial cells (DTEC) (x400) (H &
E).
GM
NTEC
IFI
Plate 3c: Photomicrograph of the kidney of pregnant rat orally administered with 500 mg/kg body
glomeruli (GM) with varying degree of necrosis of tubular epithelial cells (NTEC) and
inflammatory cells within the interstitum (IFI) (x400) (H & E).

GM
DTEC
Plate 3d: Photomicrograph of the kidney of pregnant rat orally administered with 500 mg/kg body
glomeruli (GM) and extensive degeneration of tubular epithelial cells (DTEC) (x400) (H & E).

A COMPARATIVE STUDY TO ASSESS THE CHANGES IN THE
CONDUCTION OF MEDIAN NERVE AT WRIST JOINT
IN APPARENTLY ASYMPTOMATIC COMPUTER USERS WITH
THAT IN GENERAL POPULATION
Dhaval Desai1, 2, Chintan Shah2, Harshit Soni2, Hasmukh Patel1, Komal Soni2
ijcrr 1
Shree Devi College of Physiotherapy, Mangalore
Vol 04 issue 08 2
SPB Physiotherapy College, Surat
Category: Research
Revised on:26/03/12 E-mail of Corresponding Author: dhavalphysio28@gmail.com
ABSTRACT
Background: Nerve Conduction Testing is frequently used by the physiotherapist as an investigation
procedure for Carpal Tunnel Syndrome. Carpal Tunnel Syndrome may develop in Computer users as well
as in General Population those who are using their wrist and finger frequently. Objectives: To compare
the Nerve Conduction changes amongst the two groups of people; those working on computer and general
population who are involved in cooking, masoning, sweeping etc. Methods: 60 individuals were divided
into 2 groups, group A and group B consisting of 30 individuals each. Group A: Individuals without any
symptoms of Carpal Tunnel Syndrome working for > 4 hours per day for > 1 year. Group B: Individuals
belonging to general population not using computer. Analysis was based on the distal motor latency and
sensory nerve action potential taken for the dominant hand. Results: Mean±SD for Distal Motor Latency
for GROUP A was 4.116±0.265ms and for GROUP B was 3.243±1.044ms. Mean±SD for Digit II to
Wrist latency for GROUP A was 2.845±0.252ms and for GROUP B was 2.077±0.556ms. Mean±SD for
Transcarpal to Wrist latency for GROUP A was 1.854±0.289ms and for GROUP B was 1.414±0.252ms.
‗t‘ calculated value for DML, Digit II to wrist and Transcarpal to wrist was 4.43, 6.88 and 6.27
respectively which was statistically significant as it is above the ‗t‘ tabulated value of 1.96.
Conclusion: There is a significant difference in both the Groups for all the parameters. GROUP A
individuals are having more chances for developing Carpal Tunnel Syndrome when compared to GROUP
B individuals.
____________________________________________________________________________________
Keywords: Carpal Tunnel Syndrome, Nerve employed individuals are connected to use of
Conduction Velocity, Computer users and computers while on the job.1 As per a recent
General Population. World Bank's Enterprise Survey of 1,948 retail
stores in India, 19% of the stores use computers
INTRODUCTION for their business. In some states like Kerala,
Computer is an electronic device which is computer use is as high as 40%.2
omnipresent in our society; where more than Repetitive strain injury (RSI); also known as
50% work is carried out by computers occupational overuse syndrome, non-specific
(desktops/laptops). Today computers are widely arm pain or work related upper limb disorder
used with its basic unit like keyboard and mouse (WRULD); is mainly associated with repeated
in different sectors. About 2 of every 5 use of any particular movement like
flexion/extension. RSI includes conditions like high-force manual work is a risk factor for CTS
De-Quervain‘s disease, tennis elbow, carpal in a working population like Slaughter house
tunnel syndrome, etc. worker,8 Grocery store worker,9 Industries,10
Carpal tunnel syndrome (CTS) is described as Dentist11 etc. Hence the study was conducted to
the triad of nocturnal pain, sensory disturbance assess the NCV changes in those people who
in the distribution of the median nerve and work using computers and amongst the general
thenar atrophy.3 A study of employees in 21 population with its main objectives to evaluate
computer companies in Chennai has revealed and compare the median nerve NCV changes at
that one in eight computer professionals runs the wrist in computer workers who work for > 4
risk of CTS and incidence increases with long hours per day with those in general population.
hours at computers.4 Innocuous activities such as
typing and clicking a mouse button could METHODOLOGY
possibly be harmful. Study Design: Cross Sectional Comparative
Motor nerve conduction velocity measurement Study
employing muscle action-potential was first Study Setting: NCV Laboratory of Shree Devi
carried out by Piper (1909) and Munnich College of Physiotherapy, Mangalore
(1916).5 The first usefulness of the median nerve Sample size: 60 individuals
conduction studies in the diagnosis of CTS was Sampling method:
done by Simpson in 1956 where he The study included a sample of 60 individuals.
demonstrated slowing of nerve conduction in Out of that 30 individuals were involved in
CTS. NCV studies with a high degree of computer work for > 4 hours per day from past 1
sensitivity (>85%) and specificity (>95%) year and remaining 30 individuals were from
constitute an important aspect of the diagnosis of general population involved in work like
CTS.6 Nerve conduction change occurs before a cooking, sweeping and masoning were selected
patient develops clinical symptoms of CTS that by using Convenient Sampling.
are severe enough to seek medical attention. Inclusion criteria:
Many asymptomatic employees can in fact be 1) Age: between 20 years to 50 years.
found to have abnormalities in nerve conduction, 2) People using laptop, desktop or both.
so by giving early intervention we can avoid 3) Individual working for > 4 hours/day for
later complication and surgery for them. a year or more.
In general population like sweepers, house 4) Individuals engaged in cooking,
wives, masoning work and so likewise work sweeping, masoning occupations.
where they need to move their wrist and finger 5) Right Hand Dominants
in above mentioned direction are prone to Exclusion criteria:
develop CTS in early or late stage of their life. A 1) Symptomatic Persons (CTS)
study done on general population of middle part 2) People with any other neurological
of Italy, having population of 120,000 found that disorder.
in the 8-year period, 3,142 cases were identified 3) People with any orthopedic problem.
as having CTS. The mean annual crude 4) People who have been operated
incidence was 329 cases per 100,000 person- previously for hand.
years, and the standardized incidence was 276.7 5) Pregnant women.
A repetitive motion of wrist is one of the known
causes to develop CTS. Daily high-velocity and
6) People with inflammatory joint disease. Tools used:
i.e. Rheumatoid arthritis and obese 1. EMG machine (Neuro careTM – 2000,
individuals. computerized EMG with NCV and
Source of data collection: Evoked potentials, Ser. No. 1023.
1) Computer Centers. Manufacture Bio-techTM, India. )
2) House wife, Sweepers and Masons as
General population from Mangalore.
Fig 1: Tool Used in Study - Neurocare 2000 EMG /NCV
Outcome measures: day for > 1 year.

1) Distal Motor Latency of Median Nerve Group B: Consists of 30 individuals belonging
(DML) to general population not using computer but
2) Sensory Latency of Median Nerve, engaged in cooking, sweeping, masoning
namely II digit to wrist latency (DII to W) and occupations.
Transcarpal to wrist latency (TC to W). Following the above procedure the individuals
belonging to all the three groups were tested for
Procedure: the NCV changes of the median nerve for
Prior to procedure individuals who met the dominant hand. The Procedure for measuring
inclusion criteria were assessed and evaluated NCV was conducted as per that mentioned in
thoroughly by using the questionnaire Clinical Neurophysiology, 2nd edition, by UK
(Annexure 1). After signing the consent form Misra & J Kalita.
they were made to participate in study.
Group A: Consists of 30 individuals without
any symptoms of CTS working for > 4 hours per

Fig 2: Motor Conduction Study Fig 3: Group A Person using Computer > 4 hours / day
Fig 4: Sensory Conduction from Digit II to Wrist Fig 5: Group B General Population
Following the recording of the above Unpaired t tests were used to find out
parameters, the obtained scores were tabulated homogeneity of two groups for all the
and compared among both study groups for demographic parameters and to compare the
NCV changes to check the probability of outcome measurement data between two groups.
occurrence of CTS amongst them. Each calculated t-value is compared with t-table
Ethical Consideration: Procedures followed value to test two tailed hypothesis at 0.05 level
were in accordance with the ethical standards of of significance. Data analysis software SPSS
Helsinki Declaration of 1975, as revised in 13.0 version has been used for the data analysis
2000.12 of the present study.
Statistical analysis:
All 60 participants of both groups were analyzed
for NCV changes.

RESULTS
Table 1: shows descriptive statistics of age distribution among both groups.

Descriptive Statistics
Std. Error of
Age (years) N Minimum Maximum Mean Std. Deviation Mean
Group A 30 21.00 35.00 24.9333 3.10654 .56717
Group B 30 21.00 35.00 26.6333 4.39030 .80156
Graph 1: presents comparison of demographic characteristics among both the Groups.
Table 2: shows gender distribution among both the groups.
Group Total
Group A Group B
Female 13 15 28
Gender 43.4% 50.0% 46.6%
Male 17 15 32
56.6% 50.0% 53.4%
Total 30 30 60
100% 100% 100%

Table 3: Unpaired „t‟ test for age and gender
Inde pe nde nt Sam ples Te st
t-test f or Equality of Means
Mean Std. Error

t df Sig. (2-tailed) Dif f erence Dif f erence
A ge -1.731 58 .089 -1.70000 .98192
52.219
Gender 1.025 58 .310 .13333 .13013
58.000
Table 3 presents Unpaired ‗t‘ test which was calculated at 0.05 level of significance to compare both the
groups in terms of age and gender distribution and also to find out the homogeneity of both the groups for
comparison of outcome measures. ‗t‘ calculated value of age and gender distribution across both groups
was -1.731 and 1.025 respectively which was not significant, hence both the groups were comparable.
Table 4: Outcome Measures for Both Groups

Group Statis tics
Std. Error
Group N Mean Std. Deviation Mean
DML A 30 4.1167 .26583 .04853
B 30 3.2437 1.04414 .19063
D II to W A 30 2.8450 .25268 .04613
B 30 2.0773 .55608 .10153
TC to W A 30 1.8540 .28964 .05288
B 30 1.4140 .25220 .04604
Table 4: shows outcome measures for both the groups. Mean±SD for Distal Motor Latency for GROUP
A was 4.116±0.265ms and for GROUP B was 3.243±1.044ms. Mean±SD for Digit II to Wrist latency for
GROUP A was 2.845±0.252ms and for GROUP B was 2.077±0.556ms. Mean±SD for Transcarpal to
Wrist latency for GROUP A was 1.854±0.289ms and for GROUP B was 1.414±0.252ms.

Graph 2: presents comparison of outcome measures among both the Groups.
Table 5:„t‟ calculated value for outcome measures of both the groups
Inde pe nde nt Samples Te s t
Levene's Test for

Equality of Variances t-test for Equality of Means
95% Confidence
Interval of the
Mean Std. Error Difference
F Sig. t df Sig. (2-tailed) Difference Difference Low er Upper
DML 9.303 .003 4.438 58 .000 .87300 .19671 .47923 1.26677
4.438 32.744 .000 .87300 .19671 .47266 1.27334
DII to W 16.126 .000 6.884 58 .000 .76767 .11151 .54445 .99089
6.884 40.486 .000 .76767 .11151 .54237 .99296
TC to W .180 .673 6.275 58 .000 .44000 .07012 .29964 .58036
6.275 56.923 .000 .44000 .07012 .29959 .58041
As evident from table 5, ‗t‘ calculated value for DML, Digit II to wrist and Transcarpal to wrist was 4.4γ,
6.88 and 6.β7 respectively which was statistically significant as it is above the ‗t‘ tabulated value of 1.96.
DISCUSSION who were involved in cooking, sweeping,

The study was conducted to examine the masoning, etc.
changes of NCV in computer workers and Distal Motor Latency and Sensory Latency
amongst the general population. The study was (SNAP) from Digit II to Wrist and Transcarpal
done on 30 individuals with a mean age of 24.93 region to wrist in dominant upper extremity
± 3.10 who used computer on daily basis > 4 were evaluated. After retrieving the values, data
hours / day for 1 year or more and remaining 30 was statistically compared using Unpaired ‗t‘
individuals with the mean age of 26.63 ± 4.39 test for comparison of both the groups.
Result showed that there is significant difference  On basis of the acquired results,
in both the GROUPS when compared in terms ergonomic advice can be given to the
of DML, Digit II to Wrist Latency and involved group individuals.
Transcarpal to Wrist Latency. In all the three
outcome parameters, Group A had significantly CONCLUSION
higher latencies as compared to group B. So we Study was done on Computer users and General
can conclude that there are more chances to population involved in cooking, sweeping etc.
develop CTS in GROUP A (Computer users for assessing the NCV abnormalities and thereby
those who use it for > 4 hours / day from past 1 to identify presence of CTS by using parameters
year) compared to GROUP B. This can be like DML (Distal Motor Latency), Latency
attributed to the repetitive action of fingers and from IInd Digit to Wrist and Transcarpal region
abnormal wrist postures seen during typing and to Wrist. The result showed that there is a
mouse operating leading to abnormal stress on significant difference in both the Groups for all
the underlying tissues especially the nerves. the parameters suggesting that among them,
One of the hallmarks of compressive GROUP A individuals i.e. computer operators
neuropathies such as CTS is demyelination, are having more chances for developing CTS
producing the reduction in normal conduction of when compared to GROUP B individuals, i.e.
neural impulses, which appears to result general population.
primarily from the mechanical disruption of
internodal segments, extensive demyelination ACKNOWLEDGEMENTS
and persistent compression eventually resulting First and foremost we would like to thank God
in direct axonal damage and wallerian to bless us enough courage and ability to pursue
degeneration distal to site of injury. this work.
Limitations of the study We are greatly thankful to all the scholars whose
 The study was done on a small sample articles are cited and included in references of
size. this manuscript. We are also grateful to authors/
 Only Electro diagnostic tool was used to editors/ publishers of all those articles, journals
find out CTS. and books from where the literature for this
 Only Median Nerve value was taken in article has been reviewed and discussed. We are
to consideration. thankful to all our subjects who participated with
full cooperation and showed voluntary interest,
Scope of further studies without them this study would not have been
 Comparison of Sensory and Motor nerve possible. Finally we are thankful to all those
conduction velocity of median and who directly or indirectly contributed to this
ulnar nerves can give better result. study.
 Probabilities of occurrence of CTS
based on number of hours spend/day on BIBLIOGRAPHY
computer usage can be compared in 1. United States department of labour,
future. Computer use at work in 2003, August 03,
 Comparison of dominant to non- 2005, available at www.bls.gov.
dominant hand can be done to check 2. Mohammad Amin. World Bank. Are Labour
the probability of occurrence of CTS Regulations Driving Computer Usage in
among them.
India‘s Retail Stores? World Bank Policy 8. Frost P, Andersen JH, Nielsen VK. (1998)
Research Working Paper 4274, July 2007. Occurrence of carpal tunnel syndrome
3. S. Brent Brotzman, Kevin E.Wilk; Clinical among slaughterhouse workers. Scand J
orthopaedic rehabilitation, 2nd edition. Work Environ Health; 24: 285-292.
Mosby. pp 34-39 9. Osorio AM, Ames RG, Jones J, et al. (1994)
4. Ali KM, Sathiyasekaran BW. Computer Carpal tunnel syndrome among grocery
professionals and Carpal Tunnel Syndrome store workers. Am J Ind Med; 25: 229–245
(CTS). Int J Occup Saf Ergon 2006; 12: 10. Bingham RC, Rosecrance JC, Cook TM.
319-325. Prevalence of abnormal median nerve
5. UK Misra, J Kalita, clinical conduction in applicants for industrial jobs.
neurophysiology, 2nd edition, 1st chapter, Am J Ind Med 1996 Sep; 30(3): 355-61.
page: 1-8. 11. Werner RA, Hamann C, Franzblau A, et al.
6. C. K. Jablecki, M. T. Andary, M. K. Floeter (2002) Prevalence of carpal tunnel
and R. G. Miller. Practice parameter: syndrome and upper extremity tendinitis
Electrodiagnostic studies in carpal tunnel among dental hygienists. J Dent Hyg; 76:
syndrome: Report of the American 126–132
Association of Electrodiagnostic Medicine. 12. WMA Declaration of Helsinki - Ethical
Neurology 2002; 58: 1589-1592. Principles for Medical Research Involving
7. Mauro Mondelli, Fabio Giannini, and Human Subjects. 59th WMA General
Mariano Giacchi. Carpal tunnel syndrome Assembly Seoul, Korea, Oct 2008.
incidence in a general population. http://www.wma.net/en/30publications/10po
NEUROLOGY 2002; 58: 289–294. licies/b3/

DESIGN OF A COMPACT CPW FED HEXAGON SHAPED
SLOT ANTENNA FOR WI-MAX APPLICATION
H. M. Ramesh, K. Balaji, D.Ujwala, B.Harish, Ch. Vijay Sekhar Babu,

K.Naga Mallik
ijcrr
Vol 04 issue 08
Department of ECE, K L University
Category: Research
Revised on:25/03/12 E-mail of Corresponding Author: ujwala.dogiparthi@gmail.com
ABSTRACT
A compact Coplanar Waveguide (CPW) fed Hexagon shaped slot antenna is proposed for Wi-Max
application. The proposed antenna has a size of 20mm x 16.5mm x1.6mm and it is designed on Rogers
RT/Duroid substrate with a dielectric constant of 2.2. The proposed antenna resonates at 7.5 GHz and has
a bandwidth of 1.2 GHz, Return Loss (S11) of -51.5dB, Gain 3.7 dBi, VSWR of 1 at 7.5 GHz. The near
field and far field radiation patterns are bi-directional and Omni-directional in E and H planes. The
proposed antenna is used for Wi-Max applications and the antenna has an impedance bandwidth of 86%.
The proposed antenna is simulated using Ansoft High Frequency Structure Simulator (HFSS) version 13
which is based on Finite Element Method and the antenna parameters are analyzed.
____________________________________________________________________________________
KEYWORDS: Co-Planar Waveguide (CPW), In this paper, a compact hexagonal shaped slot
Near-Field, Far-Field, Wi-Max, Slot antenna. antenna is proposed which is useful for Wi-Max
[7-10] application. The proposed antenna is easy
INTRODUCTION to integrate, low profile with less radiation loss
Worldwide Interoperability for Microwave and less dissipation. Since CPW feed
Access (Wi-Max) [1] with IEEE 802.16 standard implemented here is of ungrounded type, there is
is an emerging wireless technology for high data no need of ground plate and this improves the
rate transfer of approximately 75Mb/s. The radiation characteristics. The proposed antenna
design of wideband antenna with compact size, is excited with 50 ohms CPW feed.
low profile, light weight and obtaining beneficial
results for fundamental antenna parameters like ANTENNA DESIGN
Return Loss, VSWR, Gain and Radiation The geometry of the proposed CPW fed
Patterns is a challenge. A slotted patch antenna hexagonal slot antenna is as shown in figure 1.
fed by a CPW structure provides broad
bandwidth with low dispersion and less
radiation. Among planar UWB antennas, slot
antennas are more preferred because of their
higher impedance bandwidth, very good
radiation efficiency and less dispersion [2-6].

The maximum Gain at resonant frequency of 7.5
GHz is 3.73 dBi and the 3D gain plot is shown
in figure 4. The Impedance Bandwidth is 86%.
Figure 1: Proposed Antenna Structure
The proposed antenna is designed on Rogers

RT/duroid 5880 substrate on one layer metallic
side. The relative permittivity of the substrate is
2.2 with a dielectric loss tangent of 0.0009. The
overall size of the antenna is 20 x 16.5 x 1.6 Figure 2: Return Loss – S11 vs. Frequency
mm. The optimum design parameters are shown
in figure 1. The feed line width is 2mm at the
bottom and increasing towards the top and the
width at the top is 3.6 mm. The gap from the
coplanar ground plane to the patch is 1.2mm.
The length and width of the hexagonal slot is 18
x 10.3 mm. The folded slot dimensions are 6 x 1
mm with a gap of 1 mm between them. The
simulation process is carried out using Ansoft
High Frequency Structure Simulator (HFSS).
The excitation given to this antenna is Lumped
port excitation. The Return Loss and Resonant
frequency will vary with the dimensions of the
patch, coplanar ground plane and substrate.
Figure 3: VSWR vs. Frequency
RESULTS AND DISCUSSIONS
The proposed CPW fed hexagon shaped slot
antenna resonates at a single frequency of 7.5
GHz (7 GHz to 8.2 GHz) which has a bandwidth
of 1.2GHz. The Frequency vs. Return Loss plot
is shown in figure 2 and the return loss at the
resonating frequency is -51.5 dB. The VSWR at
7.5 GHz is 1.0 and the plot is shown in figure 3.

Figure 4: 3D Gain Figure 7: Surface current distribution
The Electric field, Magnetic field and Surface

current distributions at 7.5GHz are shown in
figures 5, 6, 7 respectively. Mesh plot is shown
in figure 8.
Figure 8: Mesh Plot
The far field E-Plane and H-Plane Radiation

patterns at resonant frequency 7.5GHz are
Figure 5: E-Field Distribution shown in figures 9 and 10.
.
Figure 9: E-Plane Radiation Pattern at Phi=0
Figure 6: H-Field Distribution deg and Phi=90 deg

At 7.5 GHz
S. No rE Field
At Phi At Theta
Value (V)
(deg) (deg)
1 Total 1.2 -78 176

2 X 0.5 -50 88
3 Y 1.2 -76 178
4 Z 0.6 -90 136
5 Phi 1.1906 0 180
6 Theta 1.1933 -90 176
Figure 10: H-Plane Radiation Pattern at
7 LHCP 0.873 -160 164
Theta=0 deg and Theta=90 deg
8 RHCP 0.8803 -18 164
Table 1 represents the output parameters of the
Table 2: Radiation Field data
antenna like Peak Directivity, Radiated Power,
Radiation Efficiency etc. and obtained a
Radiation Efficiency of 99.9% which shows that CONCLUSION
there is less loss of Radiation.
Table 2 represents the radiated field data at the A 50 Ω CPW fed hexagon shaped folded slot
resonant frequency 7.5GHz at different Theta antenna of compact size 20 x 16.5 x 1.6 mm is
and Phi. From the table, Left hand Circular designed for Wi-Max application with excellent
Polarization (LHCP) and Right hand Circular Return Loss of -51.5 dB and desirable peak gain
Polarization (RHCP) are approximately equal. of 3.7 dBi and acceptable VSWR of 1.0 at the
resonant frequency 7.5 GHz (7GHz - 8.2GHz).
The bandwidth of the designed antenna is 1.2
Value at 7.5
S. No Quantity GHz with an impedance bandwidth of 86%. The
GHz
E-Plane and H-Plane radiation patterns for
1 Max U 0.002 different Phi (0 and 90 deg.) and Theta (0 and 90
2 Peak Directivity 2.376 deg.) values are obtained as quasi Omni-
directional with acceptable Radiation
4 Peak Realized Gain 2.3738 characteristics and desirable Radiation
5 Radiated Power 0.0099908 Efficiency.
6 Accepted Power 0.0099999

ACKNOWLEDGEMENT
7 Incident Power 0.01
The authors would like to acknowledge their
8 Radiation Efficiency 0.99909 gratitude towards the management of
9 Front to Back Ratio 1.0873 Department ECE, K. L. University for their
support during the work. Authors acknowledge
Table 1: Antenna output parameters the immense help received from the scholars

whose articles are cited and included in with band-notched characteristic,"
references of this manuscript. The authors are Electron.Lett. vo1.46, pp.1533-1534, 2010.
also grateful to authors / editors / publishers of 6. Chen x., Zhang W. , Ma R., Zhang J., and
all those articles, journals and books from where Gao J., "Ultra-wideband CPW-fed antenna
the literature for this article has been reviewed with round comer rectangular slot and
and discussed. partial circular patch," IET Microw.
Antennas Propag., vol.1, pp.847-851, 2007.
REFERENCES 7. Lin Dang and et al, "A compact microstrip
1. Rodney B. Water house, ―Kin-Lu Wong‘ slot triple-band antenna for WLAN/WiMAX
―Planar antenna for wireless applications," IEEE Antennas Wireless
communications‖ Wiley – Interscience, Propag. Lett., vol. 9, pp. 1178 - 1181,2010.
2007. 8. Wen-Shan Chen and Kuang-Yuan Ku,
2. Jyh-Ying Chiou, Jia-Yi Sze, and Kin-Lu "Band-rejected design of the printed open
Wong, "A broad-band CPW fed strip-loaded slot antenna for WLAN/WiMAX operation,"
square slot antenna," IEEE Trans. Antennas IEEE Trans. Antennas Propag., vo1.56,
Propag., vo1.51, pp. 719-721,2003. pp.l163-1169, 2008.
3. H. D. Chen, ―Broadband CPW-fed square 9. Yang Zhang, Xin Sun, Jian-xing Wu, Hong-
slot antennas with a widened tuning stub,‖ chun, Gang Zeng, ―Design of a CPW-Fed
IEEE Trans. Antennas Propagation, vol. 51, Compact Slot Antenna for WIMAX/WLAN
pp. 1982-1986, 2003. Applications‖, IEEE 2011.
4. Vi-Cheng Lin, and Kuan-Jung Hung, 10. Pichet Moeikham and Prayoot
"Compact ultrawideband rectangular Akkaraekthalin, ―A Pentagonal Slot
aperture antenna and band-notched designs," Antenna with Two-Circle Stack Patch for
IEEE Trans. Antennas Propag., vo1.54, WLAσ/WiMAX‖, ISPACS, Dec. 7-9, 2011.
pp.3075-3081, 2006.
5. Li Y.S. , Yang X.D., Liu C.Y., and Jiang T.,
"Compact CPW-fed ultrawideband antenna

BIOEQUIVALENCE AND HIGHLY VARIABLE DRUGS: AN
OVERVIEW
Vikram Lohar1, Harsh Patel2, Arvind Singh Rathore1, Sandeep Singhal1,

Ashish Kumar Sharma2, Parul Sharma1
1
ijcrr 2
Faculty of Pharmaceutical sciences, Jodhpur National University, Jodhpur
Vol 04 issue 08 Suresh Gyan Vihar College of Pharmacy, Jaipur
Category: Review
E-mail of Corresponding Author: lohar.vikram@gmail.com
Revised on:08/03/12
ABSTRACT
Bioequivalence studies are the preliminary requirement for generic products to enter in the market. The
manufacturer (generic) must be in limit with that of innovator (branded) formulation (reference listed
drug) within the limits approved by respective governing bodies. As per biopharmaceutical classification
system the drugs falls in the category I to IV on the basis of permeability and solubility data. Drugs
belonging to the category of poor solubility and poor permeability data uphold bioequivalence issues. Due
to this high variability, large sample size may be needed in BE studies to give adequate statistical power
to meet FDA BE limits, and thus designing BE studies for HVDs is challenging. Consequently
development of generic products for HVDs is a major concern for the generic drugs industry. Major
regulatory agencies also considered different approaches for evaluating BE of highly variable drugs.
From 2004 onward the FDA started looking for alternative approaches to resolve this issue, and
eventually found that replicate crossover design and scaled average BE provides a good approach for
evaluating the BE of highly variable drugs and drug products as it would effectively decrease sample size,
without increasing patient risk.
____________________________________________________________________________________
Key words: Bioequivalence, Highly Variable interpretation, and is not literal. In most cases,
Drugs, Pharmacokinetic. generic products are available once the patent
protections afforded to the original developer
INTRODUCTION have expired. When generic products become
Generic drug available, the market competition often leads to
According to the U.S. Food and Drug substantially lower prices for both the original
Administration (FDA), generic drugs are brand name product and the generic forms.
identical or within an acceptable bioequivalent Hatch Waxman Act
range to the brand name counterpart with respect Using bioequivalence as the basis for approving
to pharmacokinetic and pharmacodynamic generic copies of drug products was established
properties. By extension, therefore, generics are by the ―Drug Price Competition and Patent Term
considered (by the FDA) identical in dose, Restoration Act of 1984,‖ also known as the
strength, route of administration, safety, Waxman-Hatch Act. Under Hatch-Waxman Act,
efficacy, and intended use. The FDA‘s use of the one of the following four certifications has to be
word identical is very much a legal made while filing an ANDA: [Food and drug
administration, center for drug evaluation and variable drugs or drug products can be much
research (CDER)]. 1 greater than normally needed for a typical BE
Bioavailability (BA) and bioequivalence (BE) study. For example, to demonstrate BE with
studies provide important information in the 90% power, it was estimated that 136 subjects
overall set of data that ensure the availability of would be required for a drug with 60% within
safe and effective medicines to patients and subject coefficient of variation even if the test
practitioners. BA and BE measures are and reference products were identical. 5
frequently expressed in systemic exposure Traditional Bioequivalence Method
measures, such as area under the plasma For systemically available drug products, FDA
concentration-time curve (AUC) and maximum generally asks applicants to conduct BE studies
concentration (Cmax). These measures of with pharmacokinetic endpoints using a single
systemic exposure are assumed to relate in some dose, crossover design in healthy subjects. The
way to safety and efficacy outcomes that may be processes of study design and workflow of
expressed in biomarkers, surrogate endpoints, or BA/BE studies are presented in brief in Figure 1
clinical benefit end points. 2 and Table 1 describes various study designs
Bioequivalence (BE) is defined as the absence of generally used for BA/BE studies.
a significant difference in the rate and extent to Subjects receive a single dose of test and
which the active ingredient or active moiety in reference products on separate occasions with
pharmaceutical equivalents or pharmaceutical random assignment to the two possible
alternatives becomes available at the site of drug sequences of product administration. Treatments
action when administered at the same molar are separated by a washout period of adequate
dose under similar conditions in an appropriately duration such that the drug of interest can no
designed study 3. BE studies of systemically longer be detected in plasma. The FDA
absorbed drug products are generally conducted generally asks applicants to conduct single dose
by determining pharmacokinetic endpoints to studies rather than multiple dose studies because
compare the in vivo rate and extent of drug single dose studies are generally more sensitive
absorption of a test and a reference drug product to detecting potential differences between
in healthy subjects. A test product is considered products 4. For a product with multiple strengths,
bioequivalent to a reference product if the 90% the highest strength is used in the BE study,
confidence intervals for the geometric mean unless precluded for reasons of safety. The
test/reference ratios of the area under the drug‘s number of subjects in the study should be
plasma concentration versus time curve (AUC) sufficient to ensure adequate statistical power;
and peak plasma concentration (Cmax) both fall most studies enroll from 24 to 36 subjects.
within the predefined BE limits of 80–125% .4 The bioequivalence parameters AUC and Cmax
The width of the 90% confidence interval is are statistically analyzed using the two one-sided
proportional to the estimated drug variability (in tests procedure to determine whether the average
particular, within-subject variability for a values for the measures estimated after
crossover design) and inversely proportional to administration of the test and reference products
the number of subjects participating in the study. are comparable.6 This approach involves the
The BE limits of 80–125% are currently applied calculation of a 90% confidence interval for the
to almost all drug products regardless of the size ratio of the averages of the measures for the test
of within-subject variability. As a result, the and reference products. 7 The choice of the
number of subjects required for a study of highly current 80 to 125% acceptance limits for BE has
been based on expert medical judgment and important differences between test and reference
FDA experience with thousands of drug products in BA and BE studies. These measures
products that a difference of less than 20% in include
drug exposure was not clinically significant for i) Total exposure (AUC0–t or AUC0–∞ for single-
most drugs.8 The 80% limit indicates that the dose studies and AUC0– for steady-state
test product is no less than 80% of the reference, studies),
while the 125% limit indicates that the reference ii) Peak exposure (Cmax), and
product is no less than 80% of the test product (a iii) Early exposure (partial AUC to peak time of
4:5 reference to test ratio is a 5:4 test to the reference product for an immediate-release
reference ratio). drug product). Reliance on systemic exposure
ASSESSMENT OF BIOEQUIVALENCE measures will reflect comparable rate and extent
The assessment of BE of different drug products of absorption, which, in turn, will achieve the
is based on the fundamental assumption that two underlying goal of assuring comparable
products are equivalent when the rate and extent therapeutic effects. Single dose studies to
of absorption of the test/generic drug does not document BE were preferred because they are
show a significant difference from the rate and generally more sensitive in assessing in vivo
extent of absorption of the reference/brand drug release of the drug substance from the drug
under similar experimental conditions as product when compared to multiple dose studies.
defined. As per the different regulatory The following are the circumstances that
authorities, BE studies are generally classified demand multiple-dose study/steady state
as: pharmacokinetics:
1. Pharmacokinetic endpoint studies.  Dose- or time-dependent pharmacokinetics.
2. Pharmacodynamic endpoint studies.  For modified-release products for which the
3. Clinical endpoint studies. fluctuation in plasma concentration over a
4. In vitro endpoint studies. dosage interval at steady state needs to be
The general descending order of preference of assessed.
these studies includes pharmacokinetic,  If problems of sensitivity preclude
pharmacodynamic, clinical, and in vitro studies. sufficiently precise plasma concentration
Pharmacokinetic endpoint studies measurements after single-dose
These studies are most widely preferred to administration.
assess BE for drug products, where drug level  If the intra-individual variability in the
can be determined in an easily accessible plasma concentration or disposition
biological fluid (such as plasma, blood, urine) precludes the possibility of demonstrating
and drug level is correlated with the clinical BE in a reasonably sized single-dose study
effect. The statutory definition of BA and BE, and this variability is reduced at steady state.
expressed in rate and extent of absorption of the  When a single-dose study cannot be
active moiety or ingredient to the site of action, conducted in healthy volunteers due to
emphasizes the use of pharmacokinetic measures tolerability reasons and a single-dose study
to indicate release of the drug substance from is not feasible in patients.
the drug product with absorption into the  If the medicine has a long terminal
systemic circulation. elimination half-life and blood
Regulatory guidance recommends that measures concentrations after a single dose cannot be
of systemic exposure be used to reflect clinically followed for a sufficient time.
 For those medicines that induce their own demonstration of efficacy and safety of the
metabolism or show large intra-individual particular pharmaceutical product. The other
variability. important specifications for pharmacodynamic
 For combination products for which the ratio studies include:
of plasma concentration of the individual  A dose-response relationship should be
substances is important. demonstrated;
 If the medicine is likely to accumulate in the  Sufficient measurements should be taken to
body. provide an appropriate pharmacodynamic
 For enteric coated preparations in which the response profile;
coating is innovative.  The complete dose-effect curve should
Under normal circumstances, blood should be remain below the maximum physiological
the biological fluid sampled to measure drug response;
concentrations.  All pharmacodynamic
Most drugs may be measured in serum or measurements/methods should be validated
plasma; however, in some drugs, whole blood for specificity, accuracy, and
(e.g., tacrolimus) may be more appropriate for reproducibility. Examples of these
analysis. If the blood concentrations are too pharmacodynamic studies include locally
minute to be detected and a substantial amount acting drug products and oral inhalation
(40%) of the drug is eliminated unchanged in the drug products, such as metered dose inhalers
urine, the urine may serve as the biological fluid and dry powder inhalers, and topically
to be sampled (e.g., alendronic acid). applied dermatologic drug products, such as
Pharmacodynamic endpoint studies creams and ointments.
Pharmacokinetic studies measure systemic Bronchodilator drug products, such as albuterol
exposure but are generally inappropriate to metered dose inhalers, produce relaxation of
document local delivery BA and BE. In such smooth muscle of the airways. For these drug
cases, BA may be measured, and BE may be products, a pharmacodynamic endpoint, based
established, based on a pharmacodynamic study, either on increase in forced expiratory volume in
providing an appropriate pharmacodynamic 1 second (FEV1) or on measurement of PD20 or
endpoint is available. Pharmacodynamic PC20 (the dose or concentration, respectively, of
evaluation is measurement of the effect on a a challenge agent) is clinically relevant and may
pathophysiological process, such as a function of be used for BA and BE studies.
time, after administration of two different Clinical endpoint studies or comparative
products to serve as a basis for BE assessment. clinical trials
Regulatory authorities request justification from In the absence of pharmacokinetic and
the applicant for the use of pharmacodynamic pharmacodynamic approaches, adequate and
effects/parameters for the establishment of BE well-controlled clinical trials may be used to
criteria. These studies generally become establish BA/BE. Several international
necessary fewer than two conditions regulatory authorities provide general
1) If the drug and/or metabolite(s) in plasma or information about the conduct of clinical studies
urine cannot be analyzed quantitatively with to establish BE.
sufficient accuracy and sensitivity; In vitro endpoint studies
2) If drug concentration measurement cannot be More recently, a Biopharmaceutics
used as surrogate endpoints for the Classification System (BCS) has categorized
drug substances as having either high or low is evaluated by testing the following null
solubility or permeability and drug products as hypothesis
exhibiting rapid dissolution. According to this H0: [(µT- µR) 2/ 2WR] > Ө
approach, drug substances may be classified into (For given Ө > 0) versus the alternative
four primary groups: hypothesis
1) Highly soluble and highly permeable; H1: [(µT- µR) 2/ 2WR] ≤Ө
2) Highly permeable and poorly soluble; where µT and µR are the averages of the log-
3) Highly soluble and poorly permeable; transformed measure (Cmax, AUC ) for the test
4) Poorly soluble and poorly permeable. and reference products, respectively; usually
Using this BCS approach, a highly permeable, testing is done at level α=0.05; and Ө is the
highly soluble drug substance formulated into a scaled average BE limit. Furthermore,
rapidly dissolving drug product may need only Ө= (ln▲) 2/ 2Wo
in vitro dissolution studies to establish BE. In Where ▲ is 1.β5, the usual average BE upper
addition, in vitro approaches to document BE for limit for the untransformed test/reference ratio
nonbioproblem drugs approved before 1962 of geometric means, and 2Wo =0.25. Note that
remain acceptable as per FDA regulations. rejection of the null hypothesis H0 supports the
Dissolution tests can also be used to reduce the conclusion of equivalence.
number of in vivo studies in other A 95% upper confidence bound for [(µT- µR) 2/
WR] determined in a BE study must be ≤Ө or
2
circumstances, and to
i) Assesses batch-to-batch quality and support equivalently, a 95% upper confidence bound for
batch release; (µT- µR) 2/ Ө 2WR must be ≤0.
ii) Provide process control and quality Additionally, the point estimate (test/reference
assurance; and geometric mean ratio) must fall within [0.80,
iii) Assess the need for further BE studies 1.25]. The test drug must pass both conditions
relative to minor post-approval changes, where before it is judged bioequivalent to the reference
they function as a signal of bioinequivalence. product. 19
The broad spectrum of BA/BE in vitro studies HIGHLY VARIABLE DRUGS AND DRUG
specifications were provided by each regulatory PRODUCTS
authority. 9-18 In bioequivalence evaluation, highly variable
Statistical Analysis of Bioequivalence: drugs are generally defined in the context of
In the analysis of a bioequivalence study, the within-subject variability in bioequivalence
measurements of both Cmax and AUC are parameters Cmax and AUC. The most often-
subject to the following procedure. The used definition of a highly variable drug is a
measurement for each subject is log transformed drug which has a within-subject (synonymous
and the averages, µT and µR, of the test and with ―intra-subject‖) variability of γ0% or more
reference products are calculated. The within in these two bioequivalence parameters.
subject variability of the reference product, FDA‘s τffice of Generic Drugs (τGD)
2
WR, is also calculated. There are two parts to estimates that approximately 10% of the
the proposed bioequivalence criteria, a scaled submitted BE studies from Abbreviated New
average bioequivalence evaluation and a point Drug Applications (ANDAs) showed some
estimate constraint. In order to demonstrate evidence of high variability. Examples exist
bioequivalence both parts must pass. Scaled where a highly variable reference product failed
average bioequivalence for both AUC and Cmax
to demonstrate BE when compared to itself in a between HVDs and HVDPs is especially
BE study using the standard design/sample size. important with modified release dosage forms
As illustrated in Figure 2, because of this high and in formulations of poorly soluble drugs
variability, larger numbers of subjects may be (Biopharmaceutics Classification System classes
needed in bioequivalence studies to give II and IV), where the formulation factors are
adequate statistical power to meet FDA more important. Davit et al. related the
bioequivalence limits. The FDA is currently variabilities of dissolution performance to those
investigating bioequivalence study design of bioequivalence parameters. The results
proposals that can reduce the number of subjects suggested that in about 20% of the highly
needed for a bioequivalence study.19-20 variable cases, the performance of drug
HVDs show variable pharmacokinetics as a formulations could contribute to the high
result of their inherent properties (e.g. variation. 13, 20
distribution, systemic metabolism and The factors described above influence
elimination). A drug may have low variability if bioequivalence parameter variability due to the
it is administered intravenously, whereas it can characteristics of the drug substance, rather than
be highly variable after oral administration. In those of the drug product. Drug product
such cases, the source of the high variability can formulation can also contribute to high
be any of the processes that are involved in the variability in bioequivalence parameters. For
absorption, such as problematic solubility, example, if the rate of drug release from the
gastrointestinal instability, active transport or dosage form is highly variable, this factor may
first-pass metabolism in the gut or liver. Davit et cause high variability in bioequivalence
al. recently reviewed 1010 bioequivalence parameters and may signify a product with lower
studies of 180 drugs, of which 31% (57 of 180) product quality. Figure 3 diagrams the steps
were highly variable.13 involved in bioequivalence evaluation of oral
About 60% of the surveyed drugs were highly dosage form performance and illustrate ways in
variable as a result of the pharmacokinetic which high within-subject variability in
characteristics of the drug substances. Several bioequivalence measures can arise from either
physicochemical and pharmacokinetic factors the drug substance or the drug product.13
were considered that can potentially contribute Identification of Highly Variable Drugs
to the observed high variation, such as low The RMSE (Root Mean Square Error) values of
aqueous solubility, acid liability, low the bioequivalence parameters Cmax and AUC0-t
bioavailability (F), pronounced food effect and was used as an estimate of within-subject
so on. Analysis of the data revealed that variability. Since most of the studies submitted
extensive first-pass metabolism was probably to the DBE (Division of Bioequivalence) used a
the most important factor. Eighty-three percent two-way crossover design; it was not possible to
of the HVDs were subject to extensive first-pass determine the true within-subject variability.
metabolism, whereas the corresponding Therefore, the RMSE was used as an estimate of
proportion in the non-highly variable group was within-subject variability. Since highly variable
21%. In addition, the variability may be caused drugs are defined as drugs with within subject
by the pharmaceutical form in which the drug is variability of 30% or more in bioequivalence
contained. In this case, different formulations of parameters, we considered a drug to have high
the same drug may show different within-subject within-subject variability if the RMSE for either
variabilities (e.g. nadolol). The distinction AUC0-t or Cmax was ≥0.γ.
Although the FDA evaluates AUC∞ in the disposition of the drug substance, we
bioequivalence studies, but did not define a concluded that 61% of the highly variable drugs
highly variable drug as one for which the AUC∞ reviewed in 2003–2005 were likely highly
RMSE≥0.γ because the calculations necessary to variable due to drug substance characteristics.
extrapolate to infinity contribute to the Notably, several drugs in each of the following
variability of this measure. Therefore, we classes were in the consistent and borderline
consider AUC0-t to be a better indicator of highly variable groups: angiotensin converting
variability due to drug substance and/or drug enzyme (ACE) inhibitors, calcium channel
product than AUC∞. blockers, 3-hydroxy-3-methylglutaryl-coenzyme
Table 2 shows the number of bioequivalence A (HMG-CoA) inhibitors, and bisphosphonates.
studies, drug products, and drugs reviewed by All of the ACE inhibitors reviewed during the
the DBE in 2003–2005. During this time period, 2003–2005 period are inactive prodrugs that
the DBE found acceptable 1,010 bioequivalence undergo extensive first-pass metabolism. The
studies. These 1,010 bioequivalence studies calcium channel blockers and HMG-CoA
investigated a total of 524 different drug inhibitors reviewed during this period are also
products, for 180 different drugs. Frequently, known to undergo extensive first pass
there are at least several generic versions of any metabolism. The bisphosphonate drugs reviewed
one reference listed drug under review at the during this period are reported to have absolute
OGD during the same time period. Each new oral bioavailability averaging less than 1%.
generic drug product line is usually the subject Thus, for some potential generic drug products,
of a separate ANDA. Most ANDAs contain at it may be possible to predict whether variability
least two bioequivalence studies, one under in bioequivalence parameters will be high based
fasting conditions and one under fed conditions. on what is known about the physicochemical
A minority of ANDAs contains either one and dispositional characteristics of the drug class
fasting bioequivalence study or one fed in general. 13
bioequivalence study. In 111 of these 1,010 Significance of the HVD Problem;
acceptable studies, the RMSE was ≥0.γ for Although the problem is well known, it is still
either Cmax and/or AUC0-t. As our criteria for very difficult to get hard figures about its extent.
classification as a highly variable drug was that An overview of FDA submissions showed that
the RMSE≥ 0.γ for Cmax and/or AUC0-t, we about 15% of the applications fell into the
concluded that 111 or 11% of these studies were category of HVDs. At first sight, the issue of
of drug products that showed high variability in HVDs did not appear to be so serious, because
bioequivalence parameters. These 111 studies of all submitted applications for HVDs passed the
highly variable drugs were of 101 different drug 0.80–1.25 regulatory criterion.
products, representing 57 different drugs. 13 However, this regulatory experience was not
Determination of whether high variability in shared by other parties involved in generic drug
bioequivalence parameters was consistent development. An overview of the database of a
We further classified drugs for which the RMSE well known Canadian contract research
for Cmax and/or AUC0-t≥0.γ as consistently organization showed a considerably different
highly variable, borderline highly variable, or picture. In a review of 580 studies, 105 fell into
inconsistently highly variable. Table 3 was the highly variable category. The failure rate
subject to extensive first pass metabolism). As was 54%. A very similar figure was reported by
these are properties of, or factors influencing, another large Canadian contract research
organization. It appears that only bioequivalence For example, a lack of a food effect is not
studies meeting the regulatory expectations were considered to be established if the CI is outside
submitted by applicants and, consequently, the the 0.80–1.25 limits. Altogether, if a new drug
regulatory agencies could have underestimated has highly variable features, then to establish
the seriousness of the HVD problem. Some bioequivalence between formulations used in the
studies are not undertaken at all when the very product development process or to demonstrate
heavy financial and logistical difficulties are dose linearity can be a difficult and expensive
confronted. Diliberti presented a case where the challenge. For these reasons, HVDs are not just
within subject variation was 173%for the Cmax a problem for the generic industry but are also a
and 157%for the AUC at time t (AUCt). He source of substantial concern to the innovators.
estimated that at least 598 subjects would be However, compared with generic producers,
needed to meet the 0.80–1.25 criterion with 80% regulatory agencies are rather tolerant to the
power. innovators‘ request for post hoc widening based
The issue of bioequivalence for hvds is not on clinical grounds. Because of this, concerns of
only a problem for the generic industry innovators about large sample sizes are much
It has been implicitly assumed until this point less apparent. 21
that the single role of bioequivalence studies is Proposals from the Literature
to gain marketing authorization for generic As indicated, the bioequivalence criteria in the
products. That is not so. For example, it is very U.S. recommend that the 90% confidence
common that a drug formulation used in early interval of the geometric mean ratio between the
clinical studies is different from that applied in test and reference products fall within 80-125%.
the late, pivotal investigations. In this case, the Over the years, various suggestions have been
innovator company performs a ‗bridging‘ made in an attempt to alleviate the difficulty of
bioequivalence study in order to demonstrate meeting the bioequivalence limits for highly
that the formulation change does not have a variable drugs and drug products.
clinically significant impact. These studies are Various authors have explored the use of
typically powered to meet the 0.80–1.25 replicate designs or group-sequential designs. If
bioequivalence criterion, partly because of the a subject-by-formulation interaction is
convention and partly because at that stage of negligible, the sample size required for a
product development, there are no firm clinical replicate design study can be reduced up to 50%
safety data. of that for a non-replicate design study the
Also, following Hauschke et al. and Steinijans et number of study periods is the same since
al. the paradigm of bioequivalence is used to approximately half the usual number of subjects
evaluate the drugdrug and drug-food is used but they are each studied for twice as
interactions. In the case of drug interactions, the many periods. Therefore, it takes a longer time
lower and upper limits of the bioequivalence to complete a replicate design study, resulting in
ranges could be different from 0.80 and 1.25, an increased chance of subject dropout from the
and alternative ‗effect boundaries‘ could be trial. A group-sequential design may be useful in
allowed on the basis of concentration response cases where there is uncertainty about the
relationships, pharmacokinetic- estimates of variability. Nonetheless, the total
pharmacodynamic models or other available number of subjects employed with this design
information. may be the same as that used for a study without
the group-sequential design if the interim
analysis does not indicate bioequivalence. Also, therefore the determination of bioequivalence
to preserve the overall Type I error rate of 5%, a can often fail because of the wide CI of the
higher level of confidence interval has to be Cmax. 21
used at each stage of the interim analysis.22 Widening of Bioequivalence Limits Based on
Several proposals are available in the literature Reference Variability
to modify the existing bioequivalence criteria for The bioequivalence limits for these methods are
highly variable drugs and drug products. In not determined by the sample size. Rather, they
general, these various criteria are based on either will be scaled based on the within-subject
the reduction of the level of the confidence variability of the reference product. For both
interval or an increase of the width of the Methods 2 and 3 below, a side condition to
equivalence limits, or both. constrain the mean difference between the test
The level of confidence interval reflects the and reference products has also been proposed.
degree of consumer risk (Type I error in Method 1:
statistical terms) that can be tolerated by the The rationale for this approach is that a mean
regulatory agencies. A reduction in the level of difference of 25% is considered small relative to
confidence interval, for example, from 90% to the range of values an individual may experience
85%, implies a possible increase in the when the within-subject variability is high, e.g.,
consumer risk, which would not be in the best 40%. Therefore, the acceptable limits may be
interests of public health. In contrast, the width scaled in relation to the size of within-subject
of equivalence limits represents the allowable variability as follows:
boundary for the ratio (or difference) of the [U, L] = Exp [ WR]
means between products in comparison. Any Where U and L are the upper and lower limits,
adjustment of these limits should be based on respectively; k represents the pth percentile of
consideration of the statistical properties of the the standard normal distribution, Zp; and WR is
data as well as on the clinical characteristics of the estimated within-subject standard deviation
the individual drug. Statistically, widening the (obtained from the ANOVA on the log scale) for
bioequivalence limits can be accomplished the reference. When k = 1, ~ 67% of the
through expansion of the allowable boundary or pharmacokinetic measures (such as AUC)
by scaling the criteria based on the high experienced by an individual will be within the
variability of the reference product. 23-24 range of [U, L]. Table 4 lists the choices of
PROPOSED SOLUTIONS FOR THE limits at k = 1.
PROBLEM OF HVD Method 2:
Relaxation of the Regulatory Requirement: A scaled average bioequivalence criterion has
Health Canada generally expects only that the been proposed
point estimate of the GMR (Geometric Mean [(µT- µR) 2/ 2WR] ≤Ө
Ratio) for the Cmax, but not its 90% CI, should Where µT and µR are the averages of the log-
be between the regulatory limits of 0.80 and transformed measure for the test and reference
1.25. This relaxed requirement applies generally products, respectively; and Ө is the
and is not aimed specifically at HVDs. bioequivalence limit. Comparing Methods 1 and
Nevertheless, it enables satisfactory β, it can be seen that k = Ө -1/2 = (ln1.β5)/ 2Wo
determination of bioequivalence for several where W0 is the cutoff within-subject standard
HVDs because the variation of the Cmax is deviation for scaling. Relationship of k and W0
usually higher than that of the AUC, and are given in Table 5.
Method 3: The number of subjects is fixed by a standard
Derived from the comparison of the distance two-period, crossover study comparing the
measure between the test and reference products, reference product with itself where the study
the following individual bioequivalence criterion fails to meet the 80-125% limit. The confidence
has a reference variance in the denominator, and interval obtained from the reference product in
thus is scaled to the reference variability. this study would become the ―goalposts‖ for the
[(µT- µR) 2 + ( 2WT- 2WR) + 2D]/ 2WR ≤Ө subsequent studies comparing the test with
Where WT is the estimated within-subject reference product, using the same number of
standard deviation for the test product; 2D is the subjects.
subject-by-formulation interaction variance Expansion of Bioequivalence Limits Based on
component; and I is individual bioequivalence Sample Size and Scaling
limit. In addition to fixing the sample size, this method
Although theoretically sound, the individual takes into consideration the producer‘s risk
bioequivalence criterion requires replicate (Type II error) and reference variability.23 the
designs and inclusion of target population in the equation for the allowable limits is:
study. Because of these resource implications, [U, L] = Exp [± (tα + t /β) n -1/2 WR] …….
the FDA has recommended the continued use of (Eq.1)
an average criterion to compare bioavailability Where α and are the consumer and producer
measures.22-27 risks, respectively; 2n is the number of subjects
Direct Expansion of Bioequivalence Limits desired in the study; and t is the percentile of the
Sample size in bioequivalence studies is t-distribution with 2n-2 degrees of freedom.
determined in large part by the bioavailability The current regulatory standard has kept the
parameter with the highest variability. In most consumer risk at a level of no more than 5%
cases, Cmax has higher variability than AUC. while allowing the drug applicant or sponsor to
Thus, widening of the bioequivalence limits for control its own producer risk. Based on Eq. 1,
Cmax has been proposed to reduce the sample for example, assuming a 5% consumer risk and
size needed in the evaluation of bioequivalence 10% producer risk, the proposed bioequivalence
for highly variable drugs/products. The greater limits for a typical sample size of 24 subjects
variability observed with Cmax may result from will be
the fact that this parameter is a single point (0.74, 1.γ5) at WR = 0.3
measurement, which is highly dependent on the (0.61, 1.65) at WR = 0.5
sampling time/frequency and elimination rate of Recent Considerations by Regulatory
the drug. Agencies
The EMEA currently allows for expanded limits Although global harmonization is a general goal,
(e.g., 69.84-143.19%) for Cmax in certain cases to date, bioequivalence has not been accepted as
where no safety or efficacy concern arises, based a topic by the International Conference on
on the consideration of higher variability for this Harmonization (ICH). Nonetheless, the resource
measure as compared to AUC.15 and ethical concerns for highly variable
Expansion of Bioequivalence Limits Based on drugs/products in bioequivalence are generally
Fixed Sample Size recognized by international regulatory agencies.
This method was proposed based on the notion It is thus useful to review the differing
that only a reasonable number of subjects should regulatory approaches before an informed
be required for a bioequivalence study.23, 28 recommendation is made on the topic. The
following outlines the bioequivalence standards However, the add-on subjects cannot be less
used in different regions: than half the number in the original study.
In Canada, for drugs with uncomplicated South Africa accepts an acceptance interval of
characteristics, a 90% confidence limit of 80- 75-133% for Cmax, except for narrow
125% is required for AUC. However, a limit is therapeutic range drugs, when an acceptance
placed only on the means (or point estimate) for interval of 80-125% applies. For highly variable
Cmax) 11. As a result of random variation or a drugs, a wider interval or other appropriate
larger than expected relative difference, the measure may be acceptable, but should be stated
sponsor may add more subjects. If this option is a priori and justified in the protocol.25
chosen, it must be stated in the study protocol. In Evaluation of Bioequivalence with SABE
addition, two criteria must be met before Regulatory authorities appear to move towards
combining is acceptable: adopting the approach of scaled average
1) The same protocol must be used; and bioequivalence (SABE) as a tool for dealing
2) Consistency tests must be met at an alpha with the problem of bioequivalence for HV
error rate of five percent. drugs. Therefore, a brief background of the
The European Agency for the Evaluation of procedure will be summarized.
Medicinal Products (EMEA) has similar The two one-sided tests procedure is generally
bioequivalence standards to those in the FDA, applied for determinations of bioequivalence. In
i.e., 90% confidence limits of 80-125% on AUC practice, BE is evaluated by calculating
and Cmax, with the qualification that these logarithmic quantities. Thus, means and standard
limits may be expanded in certain cases for deviations of the logarithmic data (µ and ) are
Cmax (e.g., 69.84-143.19%) provided that there estimated.
is no safety or efficacy concerns.15 Bioequivalence is declared if the difference
In Japan, the bioequivalence standards also rely between the logarithmic averages is between
on the 90% confidence limits of 80-125% for limits (BELA) which are preset by regulatory
both AUC and Cmax, although wider limits are authorities. Therefore, average bioequivalence
allowed for less potent drugs. Additionally, if (ABE) is accepted if the following criterion is
the confidence limits are outside of 80-125%, satisfied:
bioequivalence may be claimed on the grounds - BELA ≤ μT - μR ≤ BELA
that the study meets. 10 All three conditions The most usually applied regulatory limit is:
listed below: BELA = ln (1.25) (1A)
1) The total number of subjects in the initial This assures the earlier stated expectation that
bioequivalence study is no less than 20 the regulatory limits for the ratio of geometric
(n=10/group), or pooled sample size of the means of metrics are 0.80 and 1.25. In practice,
initial, the 90% confidence interval around the
2) The differences in average values of difference between the estimated logarithmic
logarithmic AUC and Cmax between two averages should be between the regulatory
products are between log (0.9) – log (1.11); and limits.
3) Dissolution rates of test and reference Thus, regulators need to define, in the case of
products are determined to be equivalent under average BE, a single criterion for declaring
all dissolution testing conditions specified. bioequivalence such as that given in Eq. (1A).
Japan allows the addition of subjects to increase For highly-variable drugs, evaluated by scaled
the power of a failed bioequivalence study.
average BE, two quantities must be defined. high variabilities. If the variation of the drug is
They will be discussed below: low, i.e., when it does not exceed the switching
The regulatory criterion suggested for the variation (CVW ≤ CVS) then, following the
application of scaled average BE is: present practice, unscaled average BE should be
-BELS ≤ (μT-μR)/ W ≤ BELS (2) evaluated. However, for HV drugs when the
Here a scaling standard deviation ( W) is related variability is higher than the switching variation
to the within-subject standard deviation of the (CVW > CVS), scaled average BE is applied.
reference formulation ( WR) or, in other views, The mixed regulatory strategy is depicted in
is identical to it. This distinction will be Figure 4 where, for illustrative purposes, SABE
discussed later. equivalent ABEL limits (BELE* ) are plotted.
Tothfalusi et al. suggested that the scaled BE Two different SABE-equivalent ABEL limits
limits (BELS) should be set in the following are shown which correspond to two different
form: values of 0. How to set 0 is the main focus of
BELS = ln (1.β5)/ 0 (βA) this communication.
Here 0 is the first measure which should be The standard deviations ( ) can be converted,
defined by regulators. It will be referred to as the approximately, to the corresponding coefficients
regulatory standardized variation. It defines the of variation:
proportionality factor between the logarithmic CV = 100[exp ( 2)-1)] 1/2 (3)
BE limits and W in the highly-variable region Therefore, for unified and convenient treatment,
(see Figure 4A). 0 uniquely determines BELs the regulatory constants are expressed in terms
and vice versa. For example, when 0 = 0.β94 of coefficients of variation. As an alternative
then BELs is 0.759, and when 0 = 0.β46 then notation, CV0 will be used instead of 0 and the
BELs is 0.907. transformation rule between CV0 and 0, given
Rearranging equation (2), an alternative form is by Eq. γ, will be applied. For example, if 0 =
obtained: 0.294 then CV0 = γ0%, and when 0 = 0.246
-BELs W ≤ μT-μR ≤ BELs then CV0 = 25%. The advantage of this unified
This form represents average bioequivalence notation is that an additional GMR restriction
with expanding limits (ABEL). Consequently, rule also can be expressed in relative terms. The
Eq. 2 and Eq. 2B, i.e. the approaches of SABE 0.80-1.25 GMR restriction criterion becomes a
and ABEL, are (almost) identical. regulatory constraint of 25%. Thus, in our
Using the limits of ABEL helps to understand notation, the proposed mixed approach depends
the properties of SABE from the perspective of on three regulatory constants, CVs, CV0 and
ABE. In this context, the regulatory standardized CVGMR, with typical values of 30%, 30% and
variation ( 0) defines the proportionality factor 25%.19-29
between the logarithmic ABEL limits and W Considerations on the implementation of
(Figure 1A). A representation of ABEL scaled average bioequivalence: the
conveniently illustrates a mixed regulatory recommendations of FDA
strategy that was proposed for applying the As noted earlier, the Advisory Committee for
unscaled and scaled approaches to the Pharmaceutical Sciences discussed the topic
determination of BE (Figure 4). repeatedly. At its meeting, on October 6, 2006,
According to the mixed regulatory strategy, a important presentations were offered on behalf
second regulatory term, the so-called switching of the FDA Working Group on Highly Variable
variation (CVS), separates regions of low and Drugs (16-18). The interim recommendations of
FDA were further clarified on May 22, 2007 at sequences of product administration. This partial
an AAPS/FDA workshop. The current proposals replicate design allows for the estimation of
of FDA and their quantitative characteristics within subject variability for the reference
were published very recently. product. Treatments should be separated by a
FDA has proposed to apply the approach of washout period of adequate duration such that
reference-scaled average BE for determining the the drug of interest can no longer be detected in
BE of HV drugs. This means that W = WR plasma. Subjects recruited for in vivo BE studies
would be adopted for scaling. should be 18 years of age or older and capable
FDA suggests also that the acceptance criteria of giving informed consent unless otherwise
include a constraint on the point estimate for the indicated by a specific guidance. It is the
ratio of geometric means (GMR). It recommends sponsor‘s responsibility to determine the sample
that GMR be limited to the range of 0.80 to 1.25. size needed to achieve the desired power in a
The Advisory Committee concurred with this study; however, the minimum number of
proposal but some members actually favoured a subjects that would be acceptable is 24.
narrower range. The three-period design was selected over a
FDA proposes that both AUC and Cmax should four-period design because of efficiency. The
satisfy the BE acceptance criteria. only advantage of the four period designs is that
FDA recommends that three-period BE studies it allows the calculation of the variability of the
be performed in which the reference product (R] test product. The test product variability is not
is provided twice and the test product (T) is used in the proposed statistical method. Some
given once. Consequently, the possible concern has been raised that an ANDA sponsor
sequences of drug administration are TRR, RRT, may produce a product that has higher
and RTR. variability than the reference product. However,
The FDA Working Group performed under the recommended design, ANDA
simulations in order to ascertain the features of sponsors that design a product of lower
the above proposals. The current FDA variability than the reference product will need a
recommendations include a value of 0 = 0.β5. smaller number of subjects to pass. A
FDA suggests also that unscaled average BE disadvantage of the four-period design is that the
used if the within-subject variability is less than dropout rate for studies increases with the length
30%, and that reference-scaled average BE of the study. Nevertheless, sponsors may use the
applied if the within-subject variability is at least four-period design to demonstrate the BE for
30%. These suggestions correspond to a their highly variable drug products.
switching coefficient of variation of CVS =
30%.19-29 DISCUSSION AND CONCLUSION
Proposed Study Design The impact of Cmax variability on the
For drugs with an expected within-subject determination of bioequivalence, as well as the
variability of 30% or greater, a BE study with possible approaches to resolving this issue has
three-period, reference- replicated, crossover been discussed extensively in the published
design with sequences of TRR, RTR, and RRT literature. Major regulatory agencies have
is proposed. Specifically, subjects receive a provisions in their regulations which can
single dose of the test product once and accommodate the effect of higher variability
reference product twice on separate occasions associated with cmax on the design of
with random assignment to the three possible bioequivalence studies. For example, health
canada does not require any limits on the issues in the BE evaluation of highly variable
confidence interval for cmax, although limits are drugs while achieving the FDA‘s mission of
placed on the point estimates for this parameter. ensuring that all the drugs approved for use in
the EMEA and Medicines Control Council of U.S. are both safe and effective.
South Africa both allow for expanded limits for
cmax in certain cases provided that there are no ACKNOWLEDGMENTS
safeties or efficacy concerns. Similarly, the I am indebted to my esteemed guide Dr. Anil
Japanese division of drugs accepts limits greater Bhandari (Dean, Faculty of Pharmaceutical
than 80 – 1β5%, ―for drugs with Sciences, Jodhpur National University) for his
pharmacologically mild actions‖. Additionally, a excellent guidance, export suggestions,
failed bioequivalence study can utilize additional encouragement, support, lively discussion,
subjects to increase power and the likelihood of constructive criticism, insightful corrections and
meeting be criteria, provided other conditions everlasting interest in pharmacology and.
are met.
This report presents a proposal for the BE REFERENCES
evaluation of highly variable drugs and drug 1. Asif M. Tamboli, Pavan Todkar, Priti Zope,
products. This new approach addresses many of Sayyad FJ. An Overview on
the concerns about the BE of highly variable Bioequivalence: Regulatory Consideration
drugs/products that have been raised for the past for Generic Drug Products. J Bioequiv
several years. The proposed approach adjusts the Availab 2010; 2(4): 086-092.
BE limits of highly variable drugs/products by 2. Biomarkers and Surrogate Endpoints:
scaling to the within subject variability of the Advancing Clinical Research and
reference product in the study. The Applications. National Institutes of Health
recommendation for the use of reference-scaling and the Food and Drug Administration
is based on the general concept that reference Conference. April 15–16, 1999, Bethesda,
variability should be used as an index for setting Maryland.
the public standard expressed in the BE limit. 3. US Code of Federal Regulations Title 21,
Furthermore, for drugs and products that are Section 320.1(e). US Government Printing
highly variable, reference-scaling effectively Office, Washington, DC, 2006.
decreases the sample size needed for 4. US Food and Drug Administration.
demonstrating BE. The additional requirement Guidance for Industry: Bioavailability and
of a point-estimate constraint will impose a limit Bioequivalence Studies for Orally
on the difference between the test and reference Administered Drug Products—General
means, thereby eliminating the potential that a Considerations, March 2003.
test product would enter the market based on a 5. Patterson SD, Zariffa NMD, Montague TH,
bioequivalence study with a large mean Howland K. Non-traditional study designs to
difference. The use of the reference-scaling demonstrate average bioequivalence for
approach necessitates a study design that highly variable drug products. Eur J Pharm
evaluates the reference variability, via multiple Sci 2001; 57:663–670.
administration of the reference treatment to each 6. Schuirmann DJ. A comparison of the two
subject. The recommended 3-period design is one-sided tests procedure and the power
the most efficient way to obtain this information. approach for assessing the equivalence of
The proposed approach will resolve a number of
average bioavailability. J Pharmacokinet 13. Davit BM, Conner DP, Fabian-Fritsch B, et
Biopharm 1987; 15:657–680. al. Highly Variable Drugs: Observations
7. U. S. Food and Drug Administration. from Bioequivalence Data Submitted to the
Guidance for Industry: Statistical FDA for New Generic Drug Applications.
Approaches to Establishing Bioequivalence, AAPS J 2008; 10(1):148–156.
January 2001. 14. Medicines Control Council. Biostudies. June
8. FDA Orange Book, Preface p. viii. 2007. http://www.mccza.com/generic
http://www.fda.gov/cder/ob/ default.htm. Documents/2.06_Biostudies_Jun07_v2.zip.
Accessed on dated Nov. 8, 2011. Accessed on dated Nov. 8, 2011.
9. Therapeutic Goods Administration. CPMP 15. European Medicines Agency. London, 24
Guideline – As adapted in Australia by the May 2007. Doc. Ref. EMEA/
TGA – With Amendment – Note for CHMP/EWP/200943/2007. Committee for
Guidance on the Investigation of Medicinal Products for Human Use
Bioavailability and Bioequivalence (CHMP). Recommendation on the Need for
(CPMP/EWP/QWP/1401/98). Effective 10 Revision of (CHMP).Note For Guidance on
April 2002. http:// the Investigation of Bioavailability and
www.tga.gov.au/docs/pdf/euguide/ewp/1401 Bioequivalence.
98entga.pdf. Accessed on dated Nov. 8, CPMP/EWP/QWP/1401/98.
2011. http://www.ema.europa.eu/docs/en_GB/doc
10. Guideline for Bioequivalence Studies of ument_library/Scientific_guideline/2009/09/
Generic Products (December, 2006). WC500003009.pdf Accessed on dated Nov.
National Institute of Health Sciences. Japan 8, 2011.
NIHS. http://www. nihs.go.jp/drug/be-guide 16. European Medicines Agency. Pre-
(e)/be2006e.pdf. Accessed on dated Nov. 8, Authorisation Evaluation of Medicines for
2011. Human Use London, 24 July 2008. Doc.
11. Canadian Health Protection Branch (HPB), Ref. CPMP/EWP/ QWP/1401/98 Rev. 1.
Health Canada. Guidance for Industry Committee for Medicinal Products for
Conduct and Analysis of Bioavailability and Human Use (CHMP). Draft. Guideline on
Bioequivalence Studies – Part A: Oral the Investigation of Bioequivalence.
Dosage Formulations Used for Systemic http://www.ema.europa.eu/docs/en_GB/doc
Effects. Published by authority of the ument_library/Scientific_guideline/2009/09/
Minister of Health. 1992. Health Products WC500003011.pdf Accessed on dated Nov.
and Food Branch Guidance Document. 8, 2011.
http://www.hc-sc.gc.ca/dhp- 17. Kingdom of Saudi Arabia Saudi Food and
mps/alt_formats/hpfb- Drug Authority Drug Sector.
dgpsa/pdf/prodpharma/bio-a-eng.pdf. Bioequivalence Requirements Guidelines.
Accessed on dated Nov. 8, 2011. Draft. May 2005.
12. Asean Guidelines for the Conduct of http://www.sfda.gov.sa/NR/rdonlyres/6A11
Bioavailability and Bioequivalence Studies. 4B70-4201-46EF-B4C7- 127FD66D3314/
http://www.suregmp.com/forum/file_down_ 0/BioequivalenceRequirementGuidelines.pd
ok.asp?Folder=PDS&DownFile=Bioavailabi f. Accessed on dated Nov. 8, 2011.
lty_Bioequivalence%20Stdies.pdf. 18. Guidance Document for Bioequivalence
Accessed on dated Nov. 8, 2011. Study of Korea Food and Drug
Administration Notification #2008–22 (May 24. Tothfalus L, Endrenyi, L, Midha, KK,
07, 2008). http:// Rawson MJ, Hubbard. JW. Evaluation of the
betest.kfda.go.kr/country/GUIDANCE%20F bioequivalence of highly variable drugs and
OR%20INDUSTRY%20 drug products. Pharm Res 2001; 18:728-
(KFDA_2005).pdf. Accessed on dated Nov. 733.
8, 2011. 25. Medicines Control Council, Department of
19. Haidar SH, Barbara D, Chen ML, Conner D. Health, Republic of South Africa.
Bioequivalence Approaches for Highly Registration of Medicines: Biostudies. 2003
Variable Drugs and Drug Products. Pharm 26. Tothfalus L, Endrenyi L, Midha KK.
Res 2008; 25(1):237-241. Scaling or wider bioequivalence limits for
20. Midha KK, Rawson MJ, Hubbard JW. The highly variable drugs and for the special
bioequivalence of highly variable drugs and case of Cmax. Int J Clin Pharmacol Ther
drug products. Int J Clin Pharmacol Ther 2003; 41:217-225.
2005; 43 (10): 485-98. 27. Tothfalus L, Endrenyi L. Limits for the
21. Tothfalusi L, Endrenyi L, Arieta AG. scaled average bioequivalence of highly
Evaluation of Bioequivalence for Highly variable drugs and drug products. Pharm
Variable Drugs with Scaled Average Res 2003; 20:382-389.
Bioequivalence. Clin Pharmacokinet 2009; 28. Blume H, Midha, KK. Report of Consensus
48 (11): 725-743. Meeting: Bio-international ‘9β. Conference
22. Patterson, SD, Zariffa NMD, Montague TH, on Bioavailability, Bioequivalence and
Howland K. Non-traditional study designs to Pharmacokinetic Studies. Eur J Pharm Sci
demonstrate average bioequivalence for 1992; 1:165-171.
highly variable drug products. Eur J Clin 29. Endrenyi L, Tothfalusi L. Regulatory
Pharmacol 2001; 57:663-670. Conditions for the Determination of
23. Boddy AW, Snikeris FC, Kringle RO, Wei Bioequivalence of Highly Variable Drugs. J
GCG. Oppermann JA, Midha KK. An Pharm Pharmaceut Sci 2009; 12 (1): 138 –
approach for widening the bioequivalence 149.
acceptance limits in the case of highly
variable drugs. Pharm Res 1995; 12:1865-
1868.

Table 1: Brief description about various study designs used in BA/BE studies9-18
Design Significance Advantages Disadvantages
Crossover • W hen intra-subject CV (approx. 15%) is • Since the treatments are compared on the same subject, the • Carryover effects and period effects are
usually substantially smaller than that inter-subject variability does not contribute to the error possible due to inappropriate wash-out
inter-subject CV (approx. 30%) variability period
• Generally recommended by all regulatory • Subject randomization causes unbiased determination of • Long duration
authorities treatment effects • Possibility of more drop outs leads to
• Large information based on minimum sample size insufficient power
• Straightforward statistical analysis • σot suitable for long half-life drugs
• σot optimal for studies in patients and
highly variable drugs
Parallel • If the drug has a very long terminal • Design is simple and robust • Subjects cannot serve as their own controls
elimination half-life • Drop outs will be comparatively less for intra-subject comparisons
• Duration of the washout time for the two- • Duration of the study is less than crossover study • Large sample size is required
period crossover study is so long (if .1 • Study with patients is possible • Lower statistical power than crossover
month) • Straightforward statistical analysis • Phenotyping mandatory for drugs showing
• If the intra-subject CV is higher with polymorphism
crossover design
Replicate Useful for the highly variable drugs (intra- • Allows comparisons of within-subject variances for the test • Involves larger volume of blood withdrawn
subject CV $ 30%) and reference products from each subject
• Indicates whether a test product exhibits higher or lower • Longer duration of the entire study
within-subject variability in the bioavailability measures when • Increased possibility of subject drop outs
compared to the reference product • Expensive
• Provides more information about the intrinsic factors
underlying formulation performance
• Reduces the number of subjects needed in the BE study
• The number of subjects required to demonstrate
bioequivalence can be reduced by up to about 50%
• Design increases the power of the study when the variability
in the systemic exposure of the test drug and formulation is
high
Variance • For more than two formulations • Allows to choose between two more candidate test • Statistical analysis is more complicated
balanced • Desirable to estimate the pairwise effects formulations (especially when dropout rate is high)
design with the same degree of precision • Comparison of test formulation with several reference • May need measures against multiplicity
formulations (increasing the sample size)
• Standard design for the establishment of dose
proportionality
Table 2: Number of Bioequivalence Studies of Highly Variable Drugs Reviewed by the Division of
Bioequivalence in the Office of Generic Drugs from 2003–2005. 13
Description Bioequivalence Studies Different Drug Products Different Drugs
Number % of Total Number % of Total Number % of Total
RMSE of AUC0-t 111 11 101 19 57 32
and/or Cmax≥0.γ
RMSE of AUC0-t 899 89 423 81 123 68

and/or Cmax<0.3
Total number of drugs 1010 100 524 100 180 100

studied
Table 3: Classification of Variability in Bioequivalence Parameters of Drugs Reviewed by the

Division of Bioequivalence in the Office of Generic Drugs from 2003–2005. 13
Description Bioequivalence Studies Different Drug Products Different Drugs
Number % of Total Number % of Total Number % of Total
Consistently highly 73 66 62 61 29 51
variable drugs
Borderline highly 12 11 10 10 6 11
variable drugs
Inconsistently highly 26 23 29 29 22 39
variable drugs
Total for which 111 100 101 100 57 100

Cmax and/or AUC0-
t≥0.γ

Table 4: Different k values could be chosen for different drugs depending on their therapeutic
windows.
CV% SD(σWR) Lower Limit Upper Limit
30 0.294 0.75 1.34
35 0.340 0.71 1.40
40 0.385 0.68 1.47
45 0.429 0.65 1.54
50 0.472 0.62 1.60
Table 5: Shows the relationship of k and σW0
σW0 k
0.20 1.116
0.223 1.0
0.25 0.893
0.294 0.759

Figure 1: Brief representation of workflow of bioavailability/bioequivalence study.

Figure 2: A visual representation of some possible results of the statistical analyses of
bioequivalence studies. The three bars represent the widths of hypothetical 90% confidence
intervals from bioequivalence studies of drugs with normal variability (green bar), low
variability (blue bar), and high variability (red bar). A bell-shaped curve is superimposed over
green bar, representing the 90% confidence interval, distributed around the geometric mean
test/ reference ratio (―point estimate‖), for the normal variability drug. For simplification, blue
and red bars, respectively, are used in this diagram to represent confidence interval widths of
low variability and highly variable drugs. The blue and red bars also actually represent the
90% confidence intervals of the bioequivalence study Cmax or AUC test/reference ratios
normally distributed about the point estimate. The FDA concludes that a test and reference
product are bioequivalent if the 90% confidence intervals (expressed as a percent) of the
geometric mean Cmax and AUC test/reference ratios fall within the bioequivalence limits of
80–125%. In this illustration, the 90% confidence interval of the normal variability drug
(green bar) meets bioequivalence limits. The 90% confidence interval of the drug with low
variability meets bioequivalence limits although the point estimate deviates from 1.00. For a
highly variable drug, the 90% confidence interval can exceed bioequivalence limits solely
because of the variability. Using more subjects in the bioequivalence study will cause the
90% confidence interval of a highly variable drug to become narrower.20

Figure 3: A diagram relating solid oral dosage form performance to the in vivo system in a
bioequivalence study. Once ingested, a solid oral dosage form disintegrates, then dissolves
into solution (formulation stage). The dissolved drug is absorbed through the gut wall, enters
the liver through the portal vein, and from the liver goes into the systemic circulation, where
pharmacokinetic measurement is possible. From the systemic circulation, the drug reaches the
site of activity from which one observes a clinical response, where pharmacodynamic or
therapeutic measurement is possible. Although the most accurate way of determining
bioequivalence would be to compare test and reference product performance at the
formulation stage, this is nearly always not possible. Consequently, most bioequivalence
studies of systemically absorbed drugs rely on pharmacokinetic measures, as drug blood
concentrations are thought to directly relate to the amount of drug released from the dosage
form. Therefore, a properly designed in vivo study with pharmacokinetic endpoints can
accurately determine whether a test and reference product is bioequivalent. As the drug moves
from the formulation to the systemic circulation to the site of activity, the pharmacokinetic or
pharmacodynamic response becomes increasingly variable with increasing numbers of steps
between the formulation, pharmacokinetic measurement stage, and pharmacodynamic
measurement stage. For example, for drugs that undergo extensive presystemic metabolism,
the effects of the various biotransformation(s) brought about by various gut wall and/or
hepatic metabolism steps contribute to the variability observed in drug pharmacodynamic
measurements. This figure also illustrates the two sources of variability in bioequivalence
measures—variability due to drug substance pharmacokinetics versus variability due to drug
product performance. If high variability exists due to drug substance pharmacokinetics, it may
be necessary to use large numbers of subjects to achieve an acceptable bioequivalence study.
However, if the high variability is due to the formulation or dosage form performance, this
may reflect either a poor quality test or reference product.13

Figure 4: Mixed regul atory model for the determination of bioequivalence. The logarithmic
BE limits, for determinations of average BE with constant and expanding limits, are shown by
thick lines. If the within-subject variation (CVW) does not exceed the switching variation
(CVS) then unscaled average BE is applied, and the BE limits have a constant level of
±log(1.25). When the within-subject variation is higher than the switching variations then the
limits widen with increasing within-subject variation, and scaled average BE can be applied.
The slope (in the logarithmic scale) of the expansion is determined by the regulatory
standardized variation (CV0). The logarithmic average and the SABE-equivalent BE limits
are shown by thick lines. (A) The regulatory standardized variation equals the switching
switching variation, CV0 = 25% and CVS = 30%. The BE limits have a discontinuity at the
switching variation.19-29

AN ECONOMIC ANALYSIS OF CROP
DIVERSIFICATION IN TAMIL NADU
V. Kalaiselvi
ijcrr
Vol 04 issue 08 Economics Wing, DDE, Annamalai University, Annamalai Nagar.
Category: Research Chidambaram,Tamilnadu
Revised on:23/03/12
E-mail of Corresponding Author: venkimary@yahoo.co.in
ABSTRACT
Crop diversification is considered as a resilience mechanism followed by farmers in different
regions. In the present study, it is shown that there exists crop diversification of crops in
various districts of Tamil Nadu State, India. This is done by constructing a crop
diversification index which provides a basis for ranking the different districts. So in those
regions which are more vulnerable for climatic change, more diversification of crops must be
diversified in order to avoid risk of crop failure and loss of income and employment to the
rural people.
___________________________________________________________________________
INTRODUCTION recent past and farmers were always quick

A society faced with diminishing natural to diversify into higher value crops as
resources and every increasing demand for market opportunities developed.
food consumption and food security due to To improve the incomes, to provide
increase in population growth, agricultural gainful employment and to stabilize the
intensification is the only course of action income flow, diversification of crops
for future growth of agriculture. emerges as a major strategy. In several
Agricultural intensification can be instances cropping systems have been
achieved by changes in cropping pattern or diversified or new cropping systems have
crop diversification. It is certainly an been introduced to retain or to enhance the
important component of the overall value of natural resources principally land
strategy for small farm development. It is and water. There is also the claim that
usually viewed as a risk management diversification tends to stabilize farm
strategy. It also provides for self income at a higher and higher level. This
provisioning in the context of non- happens when the pattern of
monetized traditional system. As market diversification is such as to accommodate
opportunities develop and or risks are more and more rewarding crops. This is
somehow reduced, the enterprise mix particularly important for the small
begins to respond to market forces and it farmers who strive to make their farms,
was this perspective which was more viable (saleth, 1995).
relevant in the context of altered economic The study suggested the establishment of
environment. Agricultural diversification agro processing industries and
really started in the early eighties in India infrastructural facilities, arrangement for
and it has picked up momentum over the crop protection, construction, maintenance

and management of irrigation works, these were carried out during mid 1990s in
research prioritization, distribution of different states of the country. Few studies
quality seeds and seed materials of the on crop diversification were also
specific crops in the specific zone on the conducted in selected district of Tamil
basis of cropping pattern and need of the Nadu (Ajjan and Selvaraj, 1996 and
people of the region. Sunderasan et al., 2002). These evidences
The study suggested that for achieving the showed that there has been a significant
gains of diversification of farming, there is change in the cropping pattern and a shift
an urgent need for further strengthening from low value subsistence crop to high
the required infrastructure pertaining to value market oriented crops in Tamil
input supply system, marketing system Nadu. Since the study results reveal the
and the existing research and extension district wise crop diversification, it will be
programmes to increase the adoption of useful for district level land use planning
advanced production technologies. and effective implementation.
Saini et al., (1996) in their study on the This study relied on secondary data, which
impact of diversification on small farms were collected from various issues of
economy in Kangra district of Himachal Season and Crop Report of Tamil Nadu.
Pradesh observed that the diversification Information on area under 40 crops at
of arable farming systems with district level for the period between 1970-
commercial enterprises such as high 71 and 2005-06 were used to analyze the
yielding milk animals, poultry birds, bee- growth in area, level of diversification and
keeping, floriculture etc, resulted in a ranking the districts based on the
marked increase in the farm income from diversification.
6 to 138 per cent. Similarly the capital and
credit requirement showed an increasing METHODOLOGY
trend with the extent of diversification Measuring Crop Diversification
implying thereby that to diversify the There are several indices, which explain
existing farming systems with the most either concentration or diversification of
systematically, remunerative and activities in a given time and space by a
technically feasible enterprises, adequate single quantitative indicator. Important
facilities should be made available by the indices used to study the corp
financial institutions. diversification are Herfindal Indiex, (HI),
Given the importance of crop Simpson Index (SI), Ogive Index (OI),
diversification under the changing Entropy Index (EI), Modified Entropy
scenarios a study was undertaken to Index (MEI) and Composite Entropy
examine the crop diversification in Index (CEI). Shiyani and Pandya (1998)
Villupuram District, and to suggest and Sundaresan et al., (2002) had applied
suitable policy options for furthering the more than one of the above indices to
diversification towards the sustainability study the diversification of agriculture in
of agriculture in the region. Gujarat and coastal districts of Tamil
A main objective of this paper is to Nadu respectively. Joshi et al., (2004)
examine the patterns of crop used Simpson Index of Diversification to
diversification at the district level in Tamil study the patterns of agricultural
Nadu since 1970-71. There were several diversification in South Asia. Due to the
studies relating to the crop diversification simplicity in computation and direct
towards commercial crops and most of interpretation, the Herfindal index was

employed in this study to examine the Area under Crop i
level of diversification. Modified Entropy Pi
Gross Cropped Area
index was used to rank the districts based
I=1,β….σ
on the degree of diversification.
N=40 (Number of crops grown int eh
The Herfindal Index is a measure of
district during the year).
concentration. It is bounded by Zero and
Area under 40 major crops under different
one: takes a value one when complete
categories (cereals, pulses, oilseeds,
specialization and approaches to zero
commercial crops, vegetables, fruits,
when there is diversification of crops. It
spices and plantations), total cropped area
was computed as given in equation (1);
in 14 composite districts (Kancheepuram,
sum of squares of the acreage proportion
South Arcot, North Arcot, Salem,
of each crop in the total cropped area.
Dharmapuri, Coimbatore, Trichy,
Algebraically,
Thanjavur, Pudukottai, Madurai, Ramnad,
N
HI Pi 2 .......... .....( 1) Tirunelveli, Nilgris and Kanyakumari) and
i 1 state level from 1970-71 to 2005-06 were
Where, used in this study.
RESULTS AND DISCUSSION
Table- 1: Crops selected for the Computation of Diversification Indices

Cereals Pulses
Paddy, Sorghum, Pearl Millet, Finger Balck gram, Horse gram, Green gram, Red
Millet, Kodo millet, Maize and Foxtail millet gram and Bengal gram
Oilseeds Commercial Crops
Groundnut, gingelly, Sunflower Castor and Sugarcane, Cotton and Tobacco
Niger
Vegetables Fruits
Onion, Tomato, Brinjal, Bhendi, Potato, Banana, Mango, Guava and Lemon
Tapioca, Sweet potato and Yam
Spices Plantations
Chillies, Garlic, Turmeric and Coriander Cocount, Cardamom, Coffee and Tea.

Table- 2
SPREAD INDEX OF CROPS AND CHANGE THE SHARE DURING SELECTED PERIODS IN TAMIL NADU

Table- 3
SPREAD INDEX OF CROPS AND CHANGE THE SHARE DURING SELECTED PERIODS IN TAMIL NADU- (Continued)

Table- 4: CROP DIVERSIFICATION AT DISTRICT LEVEL IN TAMIL NADU: HERFINDAL INDEX COEFICENTS

Crop Diversification and Ranking the Similar pattern was also observed in North Arcot
Districts district. In Kanyakumari district, millets, pulses,
Herfindai index is sensitive to the number of cotton, mango and tapioca witnessed a decline in
crops grown in the year and their share to the area under these crops while coconut and banana
total cultivated area in the district. Hence, gained their acreage significantly. These
diversification will not be demonstrated unless changes were adequately strong to diversify the
the change in number of crops cultivated in the crop activities in these districts after the period
year and their share to total cultivated area in the 1990-91.
region is adequately strong to drive the crop Crop activity in Dharmapuri, tirunelveli,
diversification. It is also important to note that Madurai, Coimbatore, Salem and Trichy districts
changes in individual crop acreage as well as in was highly diversified and this fact was
total- cultivated area are taking place supported with the coefficients of 0.08, 0.10,
simultaneously, which determine the varying 0.11, 0.12, 0.13 and 0.13 respectively, for the
level of crop diversification for different regions five years interval starting from 1970-71.
at different points of time. Among the highly diversified districts,
Crop agriculture was found highly diversified at Dharmapuri, Madurai and Salem were moving
the state level. It was understood from Table 4 towards diversification over the years, while
the calculated Herfinidal Index coefficient at Coimbatore and Ramanathapuram became less
State level, showed that the crop diversification diversified.
was high (0.16) during 1970-71 and slowly Crop diversification was moderate in south
moving towards diversification (0.13) during the Arcot presently Cuddalore and Villupuram
recent period (2005-06). However, the Districts and Nilgris districts during 1970-71.
diversification level showed variations at the Nilgris district become less diversified
districts level (Table 2). Among the districts in (specialization), which was indicated by
Tamil Nadu, Thanjavur, Kancheepuram, increasing measure of diversification. However,
Pudukottai, Kanyakumari and North Arcot agriculture in South Arcot has been slowly
districts exhibited less diversification with the diversified over the years. Diversification
index coefficients of 0.54, 0.53, 0.31, 0.29 and pattern in South Arcot was almost similar to that
0.28 respectively, during the period 1970-71. of Dharmapuri district but the change was
Agriculture in Kancheepuram, Kanyakumari and almost similar to that of Dharmapuri district but
North Arcot districts became more diversified as the change was adequate to diversify the crop
the Herfindal coefficients declined to 0.48, 0.13 activities slowly in the district over the years.
and 0.15 respectively for the above districts Diversification pattern in Nilgris district was
during the year 2005-06. Similar trend was found unique in the State.
reported by an earlier study conducted by Districts like Trichy, Thanjavur and Tirunelveli
Sundaresan et al., (2002). But Pudukottai district were diversified at the same rate over the period
has become less diversified which was indicated of three decades. Herfindal Index has shown the
by the measure of diversification varying pattern and the level of crop diversification at
between 0.24 and 0.38 during the above periods. the district level.
Area under minor millets, onion, paddy and
sorghum has declined and there was a significant
growth in area under green gram, sugarcane,
mango and coconut in Kancheerputam distict.
CONCLUSION 4. IFPRI. (2005) toward High-value
Diversification level showed inter- district Agriculture and Vertical Coordination
variations. For effective planning and Implications for Agribusiness and
implementation, agricultural development plans Smallholders: Summary of the New Delhi
may be designed appropriately for each district Symposium, Indian,
based on the nature and extent of crop 5. Joshi, P.K. Ashok Gulati, Pratap S Birthal
diversification and Laxmi Tewari, (2004). Agriculture
Though diversifications reduce the risk at farm Diversification in South Asia. Patterns,
level, it would discourage the specialization. Deteminants and Policy Implciations.
Hence, promotional measures to encourage the Economic and Political Weekly, 12:2457-
commodity clutters and production efficiency 2467.
and necessary. Specialization for instance, 6. Naik, G. and Jain S.K., (2010). Growth,
grapes in Theni district, turmeric in Erode Stability and Acreage response of
district, mango in (Krishnagiri) Dharmapuri and Agricultural Crops: Likely Impact of WTO
Salem districts, maize in Perambalur and Regime. CMA Monograph No. 191 Oxford
Dindigul districts, Chillies in Ramanathapuram and IBH Publishing Co. Pvt. Ltd., New
district, banana in Tiruchirappalli and Tutcorin, Delhi.
tomato in Dharmapuri district, pepper, tea and 7. Shiyani, R.L. and Pandya. H.L. (1998).
coffee in Nilgris can be promoted. Diversification of Agriculture in Gujarat: A
Spatio-Temporal Analysis. Indian Journal of
REFERENCES Agricultural Economics, 53(4): 624-639.
1. Ajjan, N. and Selvaraj, K.N. (1996). Crop 8. Singh, A.J., Jain K.K and Inder Sain. (1986).
Diversification and its Impact in Tamil Diversification of Punjab Agriculture: An
Nadu- A Micro Analysis. Indian Journal of Econometrical Analysis, Indian Journal of
Agricultural Economics, 51 (4):695 Agricultural Economics, 41(4): 529-535.
2. Arora, V.P.S., Srivastava.S.K (1996). 9. Saini, A.S., Sharma K.D., and B.K. Singh
Divesification of cropping Pattern and (1996). ―Impact of Diversification on Small
Foodgrain Mix in India: Pace, Magnitude Farms Economy in Himachal Pradesh‖,
and Implications. Indian Journal of Indian Journal of Agricultural Economics,
Agricultural Economics, 51(4): 699-700. Vol.51, No.4, pp 697-698.
3. Dhawan K.C., singh, B., Prihar,R.S.,
Brars.S.S., and Arora.B.S (1996).
Diversification of Indian Agricultural Vis-à-
vis Food Security. Indian Journal of
Agricultural Economics, 51(4):683-684.

OIL-WATER SEPARATION USING FLY ASH ZEOLITE
TREATMENT
Chintan Pathak, V. K. Srivastava
ijcrr Department of Sciences, School of Technology, Pandit Deendayal Petroleum

University, Gandhinagar
Vol 04 issue 08
Category: Research
Received on:23/03/12 E-mail of Corresponding Author: vks1_999@yahoo.com
Revised on:27/03/12
ABSTRACT
Introduction: A large amount of water is used in the Upstream, Downstream, Petroleum and Automobile
industrial processes and a huge fraction of it comes out as waste after getting polluted by oil and other
toxic substances. Liquid wastes from the Petroleum Industries are relatively less toxic in nature and can
be easily treated by conventional processes. However, solid wastes, especially oily Waste still remains as
major environmental hazards, demanding safer disposal practices. Methodology: Oil contaminated
wastewater is an extremely complex and variable waste of organic compounds ranging up to high
molecular weight tars and bitumen‘s. τily waste disposal is a major threat to the environment since they
ultimately deplete the natural capital and degrade the prisnity of the eco system. This is the challenging
area for petroleum scientist to establish the method by means of which maximum proportion of oil from
the waste can be recovered. Experimental Set-up: There are different Chemical and Biological
Treatment methods available. The Need is to optimize different treatment technologies in a cost effective
method. The purpose of this work is to increase the oil-water separation by using zeolite treatment along
heat treatment. Result and Conclusion: Results show the oil-water phase separation with zeolite
treatment, as compared to fly ash. Heat treatment may be effectively used to treat oily waste as it gives
more separation in shorter duration of time without creating any environmental as well as human health
hazard. Increase in temperature and duration of heating gives more separation and more reduction in
phase separation.
____________________________________________________________________________________

Keywords: Oil, Oily Waste, Oil Spill, Phase literature [1-5] on the development and application
Separation, Environmental Pollution control of the materials for adsorption purification of
petroleum and oil products from water are
INTRODUCTION considered and generalized [6].The purpose of
The increasing requirements in the sphere of this work is to provide a logical overview of fly
environmental protection have induced search for ash synthesized zeolite for oil spill cleanup. Oily
more effective, inexpensive and ecologically safe waste disposal is a major threat to the environment
solutions. Given that, the zeolite is aluminosilicate since they ultimately deplete the natural capital
members of the family - microporous solids and degrade the prisnity of the eco system.
known as ―molecular sieves‖ and have sorptive Potential impacts of oily waste:
and ion-exchange properties; the most important  Presence of oily waste in water bodies affects
pollution of hydrocarbon (HC) (viz. petrochemical the potability of water and also its use for
spills), may find applications in the removal of oil agricultural as well as recreational purposes.
spill, using hydrophobic – oleophilic - high-silica Even traces of oily waste can form a thin film
content - hydro thermally stable – zeolite; on the surface of water body and render it unfit
particularly those, prepared cheaply from fly ash; aesthetically. This can also prevent the natural
while, simultaneously providing a solution to other oxygenation of water bodies and in turn affect
environmental problems. The research will be the ecosystem associated with it.
applicable in wide variety of environmental  Layer of oil on aquatic living bodies affects
pollution control applications. Since cleanup after the metabolic activities.
an oil spill is so ineffective and so difficult, and  Oily waste provides a hostile environment to
does not always fully rehabilitate affected areas. the soil bacteria and prevents the natural
As a challenging task, the author has nutrient transformation cycle in plants and
experimentally investigated the strategy for microorganisms.
synthesis and application of flyash zeolite for oil  Oily waste, when exposed to open atmosphere
spill cleanup. When we think of oil spills, we will disintegrate due to UV rays and will
habitually think of oil tankers spilling their cargo release volatile organic compounds into
in oceans or seas. However, oil spilled on land atmosphere which are carcinogenic
often reaches lakes, rivers, and wetlands, where it compounds in nature. These obnoxious gases
can also cause damage. Oceans and other saltwater create odour nuisance to the nearby habitat.
bodies are referred to as marine environments. There are some treatments given to waste oily
Lakes, rivers, and other inland bodies of water are water, shown in Table-1. Sorbents are materials
called freshwater environments. The term aquatic that soak up liquids. They can be used to recover
refers to both marine and freshwater environments. oil through the mechanisms of absorption,
When oil is spilled into an aquatic environment, it adsorption, or both. Absorbents allow oil to
can harm organisms that live on or around the penetrate into pore spaces in the material they are
water surface and those that live under water. made of, while adsorbents attract oil to their
Spilled oil can also damage parts of the food chain, surfaces but do not allow it to penetrate into the
including human food resources. The severity of material. To be useful in combating oil spills,
the impact of an oil spill depends on a variety of sorbent need to be both oleophilic and
factors, including characteristics of the oil itself. hydrophobic (water-repellant).
Natural conditions, such as water temperature and Although they may be used as the sole cleanup
weather, also influence the behavior of oil in method in small spills, sorbent are most often used
aquatic environments. Various types of habitats to remove final traces of oil, or in areas that cannot
have differing sensitivities to oil spills as well. The be reached by skimmers. Once sorbent have been
most interesting results among those described in used to recover oil, they must be removed from the
water and properly disposed of on land or cleaned containing silica and alumina [9-14], thus
for re-use. Any oil that is removed from sorbent providing a solution to other environmental
materials must also be properly disposed of or problems in addition to application in the removal
recycled. Sorbents can be divided into three basic of oil spills. Zeolite, which are synthesized, show
categories: natural organic, natural inorganic, and some of these above mentioned properties. It has
synthetic. Natural organic sorbent include peat been suggested [10] that zeolite can be useful for
moss, straw, hay, sawdust, ground corncobs, oil spill cleanup due to their oleophilic and
feathers, and other carbon-based products. They hydrophobic characteristics. In addition, there are
are relatively inexpensive and usually readily 3 properties of zeolite that make them
available. Organic sorbent can soak up from 3 to technologically important: they are selective and
15 times their weight in oil, but they do present strong adsorbents, they are selective ion
some disadvantages [6]. Some organic sorbent exchangers and they are catalytically active [7].
tend to soak up water as well as oil, causing them Researches are increasingly focusing on
to sink. Many organic sorbent are loose particles, hydrophobic pure-silica (or high silica) zeolite as
such as sawdust, and are difficult to collect after alternative sorbents for activated charcoal for
they are spread on the water. Adding flotation sorpotion of organic pollutants (such as volatile
devices, such as empty drums attached to sorbent organic compounds) [14].
bales of hay, can help to overcome the sinking Hydrophobic zeolite have a small percentage of
problem, and wrapping loose particles in mesh will aluminum atoms in their crystal structure thereby
aid in collection. Natural inorganic sorbent include shifting their adsorption affinity away from polar
clay, vermiculite, glass, wool, sand, and volcanic molecules, like water, towards non-polar
ash. They can absorb from 4 to 20 times their substances, like organic solvents (i.e. they are
weight in oil [7]. Inorganic substances, like highly organophillic). These zeolite are thermally
organic substances, are inexpensive and readily and hydrothermally stable (upto about 1300 oC)
available in large quantities. Synthetic sorbent and like other aluminosilicates, they have a unit
include man-made materials that are similar to structure with a defined pore size of 0.2-0.9 nm,
plastics, such as polyurethane, polyethylene, and resulting in a high specific surface ares.
nylon fibers. Most synthetic sorbent can absorb as Hydrophobic zeolite also have the advantages like,
much as 70 times their weight in oil, and some little need for safety with regards to fire risk (since
types can be cleaned and reused several times [8]. zeolite are inflammable), co-adsorption with water
Synthetic sorbent that cannot be cleaned after they possible only when the relative humidity is higher
are used can present difficulties because they must than 70 %, can be regenerated with steam [15-16]
be stored temporarily until they can be disposed of or by calcination at high temperature [17-18]. Thus
properly. the possibility of application of flyash synthesised
Adsorbent materials are attractive for some zeolite with desired shapes and sizes of are of
applications because of the possibility of collection great technological value in the oil spill clean-up.
and complete removal of the oil from the oilspill
site. The further advantage is, it can be, in some MATERIAL AND METHODS
case, be recycled. Some important propertise of In order to insure the maximum digestion of silica
good adsorbent includes, hydrophobicity and from fly ash, it has been opined by the previous
oleophilicity, high updatake capacity, high rate of researchers that the microwave can be employed
uptake, retention over time, oil recovery from it for complete heating of fly ash samples as
and reusability. It is interesting to mention that compared to conventional hydrothermal method.
high-quality zeolite with high water- and oil- Based on this, the main objectives (viz., less
adsorpotion and CEC may be readily produced activation and digestion time, maximum silica
from inexpensive flyash (a by-product of thermal digestion, more nucleation and better crystal
power stations) and other solid waste materials
growth of zeolite) of the present research has been funnel. After obtaining the micro-emulsion, 5 gm
planned. of fly ash was added and treated with the heat
Fly ash samples from Bhusaval Thermal Power treatment at different temperature ranges from 25-
Station (BTPS), Bhusaval, Maharashtra, India; 45 oC (Fig.- 1,2,3,4; Table-4) for Petrol and Crude
were collected for the present study. The ash Oil, simultaneously. Similarly, 5 gm of Fly Ash
sampling was done from hoppers and Synthesized Zeolite were also added into the
representative samples were prepared for three micro-emulsion and heat treatment was given at
different fields or hoppers. The 40% pure different ranges from 25-45 oC (Fig.-1,2,3,4;
hydrofluoric acid (HF) from Merck Ltd. was used Table-2 & 3) for Petrol and Crude Oil. Following
for digestion of fly ash by employing microwave. parameters were set-up for taking getting result of
The most general physical properties of zeolite are Oil-Water Phase Separation using Microwave
its bulk density and specific gravity (i.e., Assisted Zeolite Treatment:
somewhere in between 2 to 2.4) which can Isobaric Specific Heat (kJ/kg.k)
correlate with its porosity (i.e., the measure of the Kinematic Viscosity (cP)
pore volume in zeolite) and its most dependent Surface Tension (N/m)
parameter i.e., cation exchange capacity. The type Density (kg/m3)
of zeolite formed is a function of the temperature, Separated study of oil and water were also taken
pressure, concentration of the reagent solutions, on volume basis and weight basis, after every 5
pH, process of activation and ageing period, SiO2 min.
and Al2O3 contents of the raw materials.
RESULT
EXPERIMENTAL SET UP Separation study shows that the fly ash and zeolite,
The samples were collected from the 2 major being the porous material, adsorbing the oil. It is
sources: [1] Petrol from Petrol Pump (HP) and [2] resulted into the increasing density, from which, it
Crude Oil from Exploration site. The density can be determined that an Emulsion after zeolite
which we have used for sample-1, is 737 kg/m3 treatment gives increasing in the viscosity and
and for sample-2, is 825 kg/m3. Fly Ash samples decreasing surface tension. From this it can be
were collected from Thermal Power Station, predicted that as the density increases more
Bhusaval having Density 2-2.3 gm/cc. The Pore towards water density, the oil-water separation
size and surface area of collected fly ash was well may take place. From this study of oil-water
characterized, which is <0.5 nm and >400 m2/g, separation with the help of fly ash and zeolite, it
respectively. Fly Ash was then treated with 40 % has been observed that the separation rate between
pure Hydrofluoric Acid (HF) along with oil and water increases with increases in
Microwave Irradiation. The range of temperature temperature. After the treatment of flyash with
was from 45-110 oC. The time range was 5-15 microwave irradiation into the HF acid, the
min. The physical characteristics of these adsorption capacity increases because of increase
synthesized fly ash zeolites are as follows: in pore size.
Density: 0.2 to 2.3 gm/cc At 25 oC, the emulsion density is around 829
Pore sizes: 0.2 to 0.8 nm kg/m3, after zeolite separation the density is 891
Pore volumes: 0.10 to 0.35 cm3/g kg/m3 and with flyash separation the density is 857
Surface areas: 300–700 m2/g kg/m3. The kinematic viscosity, at 25 oC, of
Oil-Water Emulsion was prepared by addition 90 emulsion is 2.37 cP, with zeolite separation is 12.7
ml of D/W water into 10 ml of Petrol and Crude cP and with flyash separation, 5.5 cP. From the
Oil samples. It was then kept for 24 hrs. for graph-3,4,5,6; it is very clear that almost all the
formulation of micro-emulsion. The micro- parameters (viz.,Kinamatic viscosity and Density),
emulsion which was formed between oil and water shows the oil-water separation is more favorable
phase, is separated with the help of Seperatory for zeolite as compared to flyash.
From the graph-1 & 2, it can be seen that the wt. % 4. σoyes, Robert (β005) ―Unit operations in
up-take of Petrol and Crude Oil, is more using Environmental Engineering‖. γ07, Jaico
zeolite compare to flyash. As temperature publishing house.
increases, it can also be concluded that the Total 5. Kiely uwe (β006) ―Environmental
Wt. % up-take increases. Engineering‖. 718, Irwin McGraw-hill.
6. σoyes, Robert (199γ) ―Pollution Prevention
CONCLUSION Technology Handbook‖. γ0, γ9,105,β06,50β,
The microwave-assisted digestion method for fly Noyes publications, U.S.A.
ash provided comparable or better results to that of 7. Sharma, B. K. (β004) ―Industrial Chemistry‖,
conventional hydrothermal digestion method. The 14 th edition. Goel publishing house.
variations in weight of sample, temperature, and 8. Willard, H. H. (1986) ―Industrial Methods of
time resulted in improved recoveries of several Analysis‖, 6 th edition. CBS publishers.
elements, but generally. In addition, preparation 9. Gupta, v. (β006) ―Break through in oil-water
and time needed for digestion was significantly separation‖. Environment science and
reduced with this method. Engineering, 57-58.
The microwave-assisted method for fly ash did 10. Rao, M. N. and Datta, A. K. (1978)
work better than hydrothermal digestion method. ―Wastewater Treatment‖, β nd edition. Oxford
There is, however, scope for more improvement in and IBP publishing Co. Pvt. Ltd.
future research. The use of hydrofluoric acid was 11. Punmia, B. C. and Jain, A. K. (2005)
absolutely necessary for digestion of fly ash ―Wastewater Engineering‖. Laxmi
because fly ash primarily consists of silicates and publications.
oxides. Most of the elements in ash were 12. Gidde, M. R. and Lad, R. K. (2005)
successfully extracted with hydrofluoric acid. ―Environmental Engineering‖, βnd volume.
The materials prepared by the method have a pore Nirali publication.
structure consisting of micropores as well as 13. Chakravarty, R. N. and Bhaskaran, T. R.
mesopores and macropores. The shape, (197γ) ―Treatment and Disposal of oil
composition, pore structure and mechanical refinery wastes‖, IAWPC volume 10. 1γ7-
properties of the zeolite microspheres make them 153.
interesting for application in areas such as 14. Haruna, J. and Meguro, M. (1992). JP Patent
adsorption for oil-spill cleanup. 04012015.
15. Kuntzel, J.; Ham, R. and Melin, T. (1999).
REFERENCES Chem. Eng. Tech. 22(12), 991.
1. Metcalf and Eddy, Inc. (1999) ―WasteWater 16. Kuntzel, J.; Ham, R. and Melin, T. (1999).
Engineering‖, γ rd Edition. 765-915, TATA Chem. Eng. Tech. 71, 508.
McGraw-Hill publishing company Limited, 17. Otten, W.; Gail, E. and Frey, T. (1992).
New Delhi. Chem. Ing. Tech. 64, 915.
2. Bhatia, S.C. (β00β) ―Handbook of Industrial 18. Ruthven, D.M. (1988). Chem. Eng. Prog. 84,
Pollution and Control‖. β:γ1β, CBS 42.
publishers.
3. Cormack, d. (198γ) ―Responses to oil and
chemical Marine Pollution‖. Applied science
publishers, New York.

Table-1: Water treatment methods1
TREATMENT METHODS FUNCTION

1) THERMAL REDUCTION
Multiple hearth incineration Volume reduction & Resource recovery
Fluidized bed incineration Volume reduction
Wet air oxidation Volume reduction
Vertical deep well reactor Stabilization, volume reduction
2) HEAT DRYING
F LASH DRYER
Spray dryer
Weight and volume reduction
Rotary dryer
Multiple hearth dryer
3) DEWATERING
VACCUM FILTER
Centrifuge
Volume reduction
Belt filter press
Filter press
4) THICKENING
GRAVITY THICKENING
Floatation thickening
Centrifugation V OLUME REDUCTION
Gravity belt thickening
Rotary drum thickening
5) ULTIMATE DISPOSAL
INCINERATION
Final disposal
Landfill

OIL-WATER SEPARATION USING ZEOLITE TREATMENT
(Photo No.1: Oil-Water emulsion) (Photo No.2: After zeolite treatment)
(Photo No.3: Side view – accumulation on periphery) (Photo No.4: Side view – accumulation on periphery)

Table-2: Petrol-water separation using Zeolite treatment
Zeolite = Density: 2000 to 2300 kg/m3, Pore sizes: 0.2 to 0.8 nm, Pore volumes: 0.10 to 0.35 cm3/g, Surface areas: 300–700 m2/g
Water (D/W) = 90 ml Sample = 10 ml
Emulsion (10 % Petrol + 90 % Water) Emulsion (10 % Petrol + 90 % Water)

Sample Petrol (HP)
(Without Zeolite) (With Zeolite)
Initial Density (kg/m3) 737 786 786
Temp. (oC) 25 30 35 40 25 30 35 40 25 30 35 40
Design Pressure (atm) 760 760 760
Parameter
Isobaric Specific Heat
1.83 1.82 1.81 1.8 1.89 1.79 1.78 1.78 1.74 1.73 1.72 1.72
(kJ/kg.k)
Kinematic Viscosity
2.67 2.83 3.04 3.4 2.37 3.81 4.56 5.79 12.7 13.6 14.5 15.8
(cP)
Surface Tension (N/m) 0.024 0.0245 0.0251 0.0256 0.0221 0.0261 0.0267 0.0272 0.0296 0.03 0.0304 0.0307
Density (kg/m3) 806 814 823 831 829 838 846 853 891 898 905 913
Time (m) 5
Initial Density of
2000 2000 2000 2000
Zeolite (kg/m3)
Final Density of Zeolite
2100 2200 2400 2400
(kg/m3)
Total Up-take
5 10 20 20
(Wt. %)

Table-3: Crude Oil-water separation using Zeolite treatment
Zeolite = Density: 2000 to 2300 kg/m3, Pore sizes: 0.2 to 0.8 nm, Pore volumes: 0.10 to 0.35 cm3/g, Surface areas: 300–700 m2/g
Water (D/W) = 90 ml Sample = 10 ml
Emulsion (10 % Crude Oil + 90 % Water) Emulsion (10 % Crude Oil + 90 % Water)
Sample Crude Oil
(Without Zeolite) (With Zeolite)
Initial Density (kg/m3) 825 840 840
Temp. (oC) 25 30 35 40 25 30 35 40 25 30 35 40
Design Pressure (atm) 760 760 760
Parameter
Isobaric Specific Heat
1.73 1.72 1.72 1.71 1.72 1.71 1.7 1.7 1.7 1.7 1.69 1.69
(kJ/kg.k)
Kinematic Viscosity
63.8 132 132 711 318 420 450 750 388 495 557 862
(cP)
Surface Tension (N/m) 0.0299 0.0303 0.0303 0.0309 0.0306 0.0309 0.0312 0.0314 0.031 3.13E-02 3.15E-02 3.17E-02
Density (kg/m3) 896 903 910 917 911 918 925 932 921 928 935 942
Time (m) 5
Initial Density of
2000 2000 2000 2000
Zeolite (kg/m3)
Final Density of Zeolite

2150 2275 2495 2678
(kg/m3)
Total Up-take
7.5 13.75 24.75 33.9
(Wt. %)

Table-4: Petrol / Crude Oil-water separation using Fly Ash treatment
Fly Ash = Density: 2000 to 2300 kg/m3, Pore sizes: <0.5 nm, Surface areas: >400 m2/g
Water (D/W) = 90 ml
Sample = 10 ml
Emulsion (10 % Petrol + 90 Emulsion (10 % Crude Oil + 90 % Water)

Sample (With Fly Ash)
% Water) (With Fly Ash)
Initial
Density 786 786
(kg/m3)
Temp. (oC) 27 37 47 57 27 37 47 57
Design
Pressure 760 760
(atm)
Isobaric
Specific Heat 1.86 1.84 1.83 1.81 1.71 1.71 1.7 1.69
(kJ/kg.k)
Kinematic
Viscosity 5.5 7.6 8.9 9.9 349 476 497 798
(cP)
Surface 0.00 0.02 0.0307 0.031 0.0313 0.031
0.029 0.029
Tension (N/m) 28 28
Density
857 865 873 880 913 920 927 934
(kg/m3)
Time (m) 5 5
Initial Density
of Zeolite 2000 2000 2000 2000 2000 2000 2000 2000
(kg/m3)
Final Density
of Zeolite 2060 2120 2240 2258 2100 2120 2340 2500
3
(kg/m )
Total Up-take 5 6 17 25
3 6 12 12.9
(Wt. %)

Graph-1: Petrol Density after Fly Ash & Zeolite treatment
Graph-2: Crude Oil Density after Fly Ash & Zeolite treatment

18
Kinematic Viscosity (Petrol)
16
14 Fly Ash
Zeolite
12 Emulsion
Viscosity (cP)
10
0
25 30 35 40
Temp. (oC)
Graph-1,2,3,4
Graph-3: Petrol Kinematic Viscosity after Fly Ash & Zeolite treatment
Graph-4: Crude Oil Kinematic Viscosity after Fly Ash & Zeolite treatment

Graph-5: Wt. % up-take of Petrol using Fly Ash & Zeolite
Graph-6: Wt. % up-take of Crude Oil using Fly Ash & Zeolite

WIRELESS TECHNOLOGY IN SERVICE OF SOCIETY- A
CASE STUDY OF SNAKEBITE
P.P.Patil1, Abhijit A.Patil1, B T Jadhav2

1
Bharati Vidyapeeth Deemed University, YMIM, Karad
ijcrr 2
Yashwantrao Chavan Institute of Science, Satara (MS)
Vol 04 issue 08
Category: Research
Revised on:24/03/12 E-mail of Corresponding Author: abhijitpatil33@yahoo.com
ABSTRACT
Information communication System plays an important role in the lives of affected Patients of snakebites.
The information systems can be developed which may help to the mankind in emergency by transferring
data. The paper explains the present scenario of Snake bite patients status in the selected sensitive area in
the rural Maharashtra. Survey shows that, the unsatisfactory picture of lack of communication system for
assistance to the affected patients and their further treatment by the hospitals. The paper suggests the
Global Positioning System (GPS) Enabled computing model and the usage of Wireless Technology. The
literature survey shows that, such model may be the need in snake bite affected areas. The Computing
model based on the wireless technology is also useful for making awareness by sharing the information
about the prevention of snake bites and the treatments as first Aid to the community and how does the
data about the victim can be made available and communicated to the further centers such as hospitals.
We mentioned here the advantages and the limitations of the proposed computing model.
The Objective behind the paper is to make use of Information Communication Technology (ICT) to
inculcate the awareness & provide services about prevention of snakebite and treatment directly through
mobile communication system. Method: A prospective analytical study method is used to assess various
risk factors associated with snakebite. Outcome of the study: The paper shows the communication
delays between snakebite patient and hospitals that can be overcome by using wireless technology.
____________________________________________________________________________________
Keywords: GPS, Information System, Wireless Infrastructure. It is found that there is no proper
Communication, Computing Model, ICT, reporting system due to underutilization of
Prevention of Snakebite, Community. information and communication facility to report
about the snakebite victim for immediate
INTRODUCTION treatment. It has been observed that the
Snakebite is an important and serious problem in snakebite patients death has been occurred even
rural Maharashtra. India having 216 species of in the presence of advanced communication
snakes out of that only 52 species of snakes are technology. It is due to absence of emergency
poisonous [3,5]. The time interval between treatment to the patients. Whenever any patient
snakebite and initiation of treatment is more than has suffered by the snakebite in the rural area, it
6 hrs. Public Health Care centers limits the has been seen that most of the cases are dead
communication and information tools of IT due to lack of communication between patient
and treatment system i.e. hospitals. This paper
focus on the use of ICT in snakebite cases in RESEARCH METHODOLOGY
rural Maharashtra [1]. We observed that the Snakebite sample cases were collected and
snakebite cases admitted [2] and referred for studied from the Department of the Dr
higher hospitals due to the unavailability of Shankarrao Chavan Government Medical
antisnake venom (ASV) that would increase the College and Hospital, Vazirabad, Nanded
chances of uncertainty. The paper suggests a District, Maharashtra State, India are shown in
proposed computing model to help and report Table 1.
the location and the instant availability of the
antisnake venom.
Table 1: Snake bites cases per year from 2000-2010
Death from
Year Snakebite cases Percentage (%)
snake bite
2000 460 29 6.30
2001 570 34 5.96
2002 540 33 6.11
2003 609 27 4.43
2004 645 34 5.27
2005 545 25 4.59
2006 625 23 3.68
2007 603 29 4.81
2008 438 14 3.20
2009 450 22 4.89
2010 427 20 4.68
Total 5997 290 53.92
Table 1 shows that, the average death of snakebite patients is 4.90% of total snakebite cases admitted.
Graph 1: Snakebite Patients Vs Death of Patients

Table 2: Quarterly Snake bite Incidence in 2000-2010 yrs
Sr. No. Month (2000-2010) Total Cases Percentage(%)
1 Jan-March 450 7.50

2 April-June 870 14.51
3 July-Sept. 3372 56.23
4 Oct-Dec. 1305 21.76
Total 5997 100
Table 2 shows the quarterly snakebite incidence occurred in rural area of Nanded District in Maharashtra,
India
Graph 2: Quarterly Snakebite Incidence
WIRELESS COMPUTING MODEL HELPS for further processing to get immediate

IN TREATMENT OF SNAKE BITES treatment to save the life of snakebite victim
Internal Mechanism of RAC(Rural
Assistance Center) Computing System:
Incoming call (toll free call) coming from GPS
enabled handset [6,11] to RAC computing
system is handled by GPS Tracking system to
track the location otherwise handled by auto
response machine to capture the name ,address,
query information and store into the database . A
software based knowledge management accept
the general description of snakebite to find out
the type of snakebite and then after further
processing it, display the data about the Fig. 1 : Ambulance having GPS Tracking
antisnake venom [4] and nearest location of the System
hospital to get the immediate treatment. This
data is forwarded to the caller, District Health
Office (DHO) and Tahsil Health Office (THO)

impact communicated through using ICT based
Wireless Computing Model.
RAC interact with the following Units :
i) Local Self Help Group
ii) Farmers
iii) GramPanchayat
iv) Emergency Services and Ambulance
v) Victims: Affected Users
vi) Local Teachers and Volunteers
vii) District & Tahsil Administration
viii) Research Institutions
GPS Enabled RAC comprises a web based

Computing Information Systems which is a
combination of two heterogeneous technologies
viz. Information Communication Technology
(ICT) [8] and Medical Technology (MT). RAC
must work under the control of Regional
Healthcare Center in association with the above
Fig. 2 Flow Diagram : Internal working of mentioned components.
RAC (Rural Assistance Center) Roles and Responsibilities of RAC Units
i) Local Self Help Group:
The Local self help group must be trained with
the primary treatment (First Aid) given after the
snakebite immediately. The Local self help
group should contain two senior women
members, two farmers and a snake friend as a
young farmer. The Regional Health Center in
association with research institution and district
and Tahsil administration should provide the
training of this computing system and give the
updated information to the local self help group
through RAC. When any snakebite incident
happens then a member of Local Self Help
Group should be use this system and informed
Fig 3: Developing awareness among the
so that in emergency
population through RAC (Rural Assistance
ii) Farmers
Center)
The farmers should be aware by the RAC with
Working
the help of Gramapanchyat Authority and
Rural Assistance Center (RAC) is one of the
Trained Teacher through Awareness Programme
GPS and Web based information cell which
about Prevention of Snake bite and First Aid
shares the information about snakebite
Treatment through Web application of RAC.
prevention programmes and awareness amongst
These trained farmers should convey and share
the local users about snakebites and its adverse
these information and precautions amongst the

community. The RAC should display the responsibility to follow the case through GPS
important and Emergency mobile [7] numbers of tracking system and support to the victim so as
close by and local hospitals which provide to save the life.
treatment of Snake bite affected patients. In v) Victims: Affected Person
emergency the farmer should contact the above Victims or Relatives should just dial the toll free
said emergency numbers and follow their number of RAC Computing system and follow
instructions. the instruction and use the data and information
iii) Grampanchyat given by the RAC Computing System.
The Grampanchyat authority (GRamsevek – vi) District & Tahsil Health Administration
Govt. Officio) should display the pictorial District Health Administration has to establish
information prevention and types of snakes and the Emergency Cell regarding the Snake bite
basic First Aid Treatments through posters. treatments through Tahsil in association with the
Conduct awareness Programmes with the help of Medical Research Institutions and Private
School and High Trained Teachers to the Hospitals. It is now the Tahsil Health
students as well as farmers in the village through Administration who should also plan and
interacting with the RAC system execute the instructions received from the
iv) Emergency Services and Ambulance District for the prevention and treatment of
(ESA) snakebite patients in the villages. RAC
Emergency Services and Ambulance (ESA) computing system should be controlled by the
should be made available by Civil Surgeon and Regional Health and District Health
Medical Officer through closest Primary Health Administration by providing the updating
Centers. They should display about various medical information related to antisnake venom.
types of Snakes and their Symptoms. They vii) Research Institutions
should have 24x7x366 emergency ambulance The Research institutions has to share the
service which will work with RAC computing Innovative information about prevention and
system through Wireless Technology [9]. The First aid treatments, post medical treatments by
Ambulance should be wireless technology based making the use of locally available resources
well equipped with few support of Antisnake and advanced technology. Research Institutions
venom. When the Emergency cell receive any must provide the information about advanced
phone call or instruction from RAC computing medicines (Antisnake venom) to the RAC and
system about snakebite patient then it is their update it regularly.

Fig. 3 : Interaction between Rural Assistance Center (RAC) units
RESULT prevention & services for snakebite. It has been

Implementation of RAC Computing will shows found that present manpower in the govt.
the following results hospital studied in this paper is comparatively
Immediate reporting of snakebite victim less due to which communication gap between
Quick & accurate information available the snakebite victims and hospitals is large. This
about antisnake venom stock and the deficiency is removed by making use of this
location of nearest hospital for treatment RAC computing model for the needs of rural
Emergency ambulance and services are society in emergency.
available through this system It has been concluded that the RAC computing
Required report generated and Easy to use model based on wireless technology [10] will be
Helps to aware about prevention of useful to the snakebite victims and society to
snakebite & its treatment save the life by providing the accurate and faster
Highly useful to the rural community information of antisnake venom and nearest
The study shows some limitations: location of the hospital.
Regular data updating is required
ACKNOWLEDGEMENT
High bandwidth will gives better & faster
We are thankful to the Department of the
results.
Dr.Shankarrao Chavan Government Medical
College and Hospital, Vazirabad, Nanded
DISCUSSION AND CONCLUSION
District, Maharashtra State, India
RAC Computing model is helps to create the
awareness among the rural villagers for
Authors acknowledge the immense help outcome of envenomous snake-bite at
received from the scholars whose articles are tertiary care centre in western Maharashtra‖
cited and included in references of this , International Journal of Medicine and
manuscript. The authors are also grateful to Public Health, Vol. 1, Issue 4, Oct-Dec,
authors / editors /publishers of all those articles, 2011, 28-38
journals and books from where the literature for 6. Ruchika Gupta and BVR Reddy, ―GPS and
this article has been reviewed and discussed. GPRS Based cost effective human tracking
system using mobile phones‖,
REFERENCES VIEWPOINT, January-June 2011, volume 2
1. D. P. Punde [β005] : ―Management of snake No.1
bite in Rural Maharashtra―, σational 7. Khondker Shajadul Hasan, Mashiur
Medical Journal of India, Vol. 18 No.2. Rahman, ―Cost Effective GPS-GPRS Based
2. I.F.Inamdar, N. R. Aswar, M. Ubaidula, S. τbject Tracking System‖IMECS β009, Vol-
D. Dalvi [β010]: ― Snake bite : Admissions I,March 18-20,2009,Hong Kong
at a Teritary healthcare center in
Maharrashtra, India‖, SAMJ, Vol. 100 No. 7 8. Yusn,G,Zhang,Z. and Wei Shang
3. Bawaskar H S, Bawaskar P H.‖ Profile of Guan,‖Research and Design of GIS in
snakebite envenoming in western vehicle monitoring system‖ Proceedings of
Maharashtra, IEEE 2006
India‖. Trans R Soc Trop Med Hyg 2002; 9. Brahim G, and Luigi L. (β000) ―
96: 79-84. Understanding GPRS : The GSM Packet
4. David A Warrell,‖ Guidelines for the Radio Service‖, Computer σetworks
Clinical Management of Snake Bite in the Journal,34.5, pg.763-779
South-East Asia Region‖ 10. ―Mobile Phone GPS Tracking-GPS Spy
SEAMEOTROPMED, WHO, Southeast Cam” www.gpsspying.com , Last accessed
Asian Journal of Tropical Medicine & on 12th feb.2012
Public Health, Vol 30, Supplement 1, 1999 11. ―Real time GPS Tracking Solutions‖ ,
5. Virendra C. Patil , Harsha V. Patil , Avinash www.gpsgate.com , Last accessed on 10th
Patil, Vaibhav Agrawal ―Clinical Profile and feb.2012

PRODUCTION AND OPTIMIZATION OF SINGLE CELL OIL
BY OLEAGINOUS BACTERIA ISOLATED FROM OIL
CONTAMINATED ENVIRONMENTS
T. Murugan1, D. Saravanan1 , R.Balagurunathan2
ijcrr 1
PG and Research Department of Microbiology, Sri Sankara arts and Science College,
Vol 04 issue 08 Tamilnadu
Department of Microbiology, Periyar University, Salem, Tamilnadu
Revised on:18/08/11 E-mail of Corresponding Author: snegapoorvam@yahoo.com
ABSTRACT
Natural sources of oils and fatty acids are derived from plants, animals and microorganism. The oils or
lipids, thus produced from microorganisms are known as ―Single Cell τil‖. This present study aimed to
isolate lipid accumulating bacteria for the production and optimization of single cell oil. In this
preliminary investigation three soil samples were collected in around Kanchipuram District, 37 different
bacterial strains were isolated and screened by Sudan black stain of that 3 strains (AOM13, AOM17 &
MEW3) showed maximum lipid accumulation. They were used for lipid production of by shake flask
method. The lipid was extracted by Folch method using cell dry matters. Among 3 strains AOM17 was
identified as the efficient producers which produce about 23% of lipid content. It was confirmed as lipid
by solubility, saponification test. Further the lipid was subjected to antimicrobial activity against human
pathogens by well diffusion method, the strain MEW3 showed good activity against Bacillus sp.,
Staphylococcus aureus and Proteus sp. In optimization, all three strains showed maximum lipid
accumulation at 15.5 g/L of glucose, 0.4 g/L of ammonium sulphate, pH 8 and 96 hours incubation time.
The three potential strains AOM13, AOM17 and MEW3 were identified as Cellulomanas sp.,
Arthrobacter sp., Acromicrobium sp., respectively.
____________________________________________________________________________________
Keywords: Single cell oil, Oil production, to meet the total requirement of lipids. The
oleaginous microbes drawback behind from these sources, a complex
mixture of fatty acids with varying lengths
INTRODUCTION (Docosahexaenoic acid) and degree of
Oils, fats and lipids from the natural compounds unsaturation were obtained and it needs
are serves as sources of energy and are expensive lipid purification. Furthermore, the
considered an important component of our fish or animals oil gets contaminated by
food3.The demand for oils and fats is largely met environmental factors, which leads to typical
form plant and animal sources 19. Natural smell and unpleasant taste 19.
sources of oils and fatty acids are derived from Microorganisms will be the suitable alternatives,
plants, animals and microorganism9, 19. The as they have the ability to convert a number of
demand for oils and fats in general is largely met waste materials into a series of valuable-added
from plants and animals sources3. The main products 3. The oils or lipids, thus produced from
drawback is, these sources alone cannot be able microorganisms are known as ―Single cell oil‖
and the microbes are called ‗Oleaginous Morphologically different bacterial isolates were
microbes‘, since they accumulate more than selected and purified on Nutrient agar slants and
20% of their biomass as lipids 9. The lipid which subsequently analysed for micro morphological
accumulates in oleaginous microorganisms is characteristics.
mainly triacylglycerols16. Oleaginous Screening Methods for Single Cell Oil
microorganism could provide an economically production
feasible source of poly unsaturated fatty acids 15. Sudan black B staining: The isolated strains
Some essential fatty acids (EPA) produced by were stained with Sudan Black B staining 15; 2.
microorganism are a direct precursor for a the smear was fixed in the slide and was flooded
number of biologically active compounds 19 such with Sudan Black B stain for 15 minutes and
as prostaglandins, leukotrienes, thromboxanes rinsed twice in xylene, followed by counter
and other related metabolites. It exhibits stained with diluted safranin for 15 seconds.
regulatory effects on lipoprotein metabolism, Then it was washed with distilled water. The air
blood rheology, vascular tone, leukocyte dried slide was observed under a phase contrast
function, plate activation and cell growth 21. microscope on oil immersion for presence of
blue or grayish coloured fat globules within the
The exploitation of oleaginous microorganism cell.
for the production of single cell oil is value Production of single cell oil
added products that has relevance and All the Sudan black positive isolates were
importance to our nation‘s economy. Most of the studied for the production of lipids. About 2ml
work has so far been, produced single cell oil of 24 hours bacterial culture were inoculated in
mainly from yeasts. Prokaryotic microorganism 100 ml of sterilized Supplemented Nutrient
should now also consider as a lipids with Broth (SNB) medium and placed in a shaker at
potential application in the oil industry. In this 200 rpm for 3 to 5 days at 30º C 20.
view, the present study was aimed for isolation Cell dry matter
and screening for SCO producing bacteria from After three days of incubation, the broth was
different soil samples and to produce single cell centrifuged at 5000 rpm for 15 minutes for
oils in maximum quantity using different carbon separation of pellet. The pellet was washed three
sources based on the optimization of various times with sterile distilled water and dried
factors. overnight at 80ºC 8, 9. Then the biomass was
weighed for the determination of cell dry matter
15
MATERIALS AND METHODS
Collection of Samples Total lipid extraction
For this study, soil samples were collected from Total lipid content of cell dry weight was
three different oil contaminated places in around extracted by Folch methods 9. The cell dry
Kanchipuram District and aseptically transferred matter was extracted with chloroform and
to laboratories for processing. methanol mixture solution (2:1), twice at room
Isolation and Purification of Bacterial Strains temperature by mixing it for 15-20 minutes in a
The samples were serially diluted using sterile shaker and centrifuged at 2000 rpm for 10
distilled water blanks. Spread plated was made minutes. 0.9% Nacl solution was added to the
on Mineral salt agar medium9 and incubated for pellet and vortexed for few seconds, again it was
24-48 hours at room temperature. centrifuged at 2000 rpm for 10 minute. The
lower chloroform layer containing lipid was unbalanced agar media 12, 13, 18. To identify the
obtained and allowed for solvents evaporation to maximum lipid accumulation in potential
determine the lipid weight 9. Based on the strains, the incubated plates were flooded with
percentage of the lipid accumulation from the Sudan black staining solution (0.02 % of Sudan
total cell dry matter 15, different potential black + 96 % Ethanol) for 30 – 60 minutes and
isolates were selected as mentioned in the (Table washed with 96 % ethanol and observed for the
2), and the extracted lipids were stored for maximum stain absorption 18.
further studies. Biosurfactant activity
Confirmation analysis of lipids Hemolysis tests: To observe the hemolytic
Solubility test: A small amount of extracted activity, the potential isolates were inoculated on
lipid from all bacterial isolated were taken in blood agar plates and incubated at 30º C for 72
three test tubes and each of three tubes was hours 20.
added with water, alcohol, chloroform and Emulsification tests: The pure cultures of
vortexed well to detect the solubility nature. potential strains were suspended in test tubes
Saponification test: about 2 ml of 2% NaoH containing 2ml of Mineral salt solution. After 48
solution was added to all the small amount of of incubation, 2 ml of kerosene (hydrocarbon)
lipid extracted from potential isolated and mixed was added to each tube and the mixtures were
well to emulsify the lipid. Positive result vortexed at high speed for 1 minute and were
observed by the formation of soapy solution. allowed to stand for 24 hours to observe
Antibacterial activity of lipids emulsification activity 20.
The single cell oil (lipid) extracted from the Characterization of potential isolates
potential isolates were tested for antimicrobial Micro morphological test such as Gram
activity against human bacterial pathogens by staining, Motility, Spore staining,
well diffusion method. The 18 hours culture of Metachromatic granule staining and biochemical
Bacillus sp., Staphylococcus sp., Escherichia test such as starch hydrolysis, Gelatin
coli and Proteus sp., were swabbed on MHA liquifization, Nitrate reduction and sugar
plates. In each well, the crude lipid (50µl) was fermentation tests, etc., were performed to
added and incubated at 30º C for 24 hours 7. identify the potential bacterial strains.
Selection of potential strains
Based on the dry weight percentage of total lipid RESULTS
extracted from the cell dry matter of isolates, the Isolation and purification of bacterial strains
potential isolates were selected. The isolated A total of 37 morphologically different strains
strain was further used for maximum production were isolated from three samples. Among 37
of single cell oil and optimization studies. isolates, 17 isolates from soil sample-I, 8 isolates
Optimization of single cell oil production from soil sample-II and 12 isolates from soil
To enhance production of single cell oil, the sample-III were isolated and subcultured.
potential strains AOM13, AOM17 and MEW3 Among the 37 isolates 35 strains were showed
were subjected to optimization studies. Gram positive and only 2 strains were showed
Production of SCO was optimized by studying Gram negative (Table 1).
various nutritional factors (such as carbon and
nitrogen) and environmental (such as pH and
incubation time) was incorporated in Minimal
Table-1: Micro-morphological characteristics of isolated strains
Strain no. Gram staining Motility Catalase Oxidase
AOM1 G+ rods M + -
AOM2 G+ rods NM + -
AOM3 G+ rods M + -
AOM4 G+ rods M + -
AOM5 G+ rods M + -
AOM6 G+ rods M + -
AOM7 G+ rods M + -
AOM8 G+ rods M + -
AOM9 G+ rods M + -
AOM10 G- rods M + -
AOM11 G+ rods M + -
AOM12 G- rods M + -
AOM13 G+ rods M + -
AOM14 G+ rods M + -
AOM15 G+ rods M + -
AOM16 G+ rods M + -
AOM17 G+ rods M + -
MEW1 G+ rods M + +
MEW2 G+ rods M + -
MEW3 G+ rods NM + -
MEW4 G+ rods NM + -
MEW5 G+ rods M + -
MEW6 G+ rods M + -
MEW7 G+ rods NM + -
MEW8 G+ rods M + -
VOM1 G+ rods NM + -
VOM2 G+ rods M + -
VOM3 G+ cocci M + -
VOM4 G+ cocci M + -
VOM5 G+ cocci M + -
VOM6 G+ cocci M + -
VOM7 G+ rods NM + -
VOM8 G+ rods M + -
VOM9 G+ rods NM + -
VOM10 G+ rod M + -
VOM11 G+rod M + -
VOM12 G+ rod M + -
Total 35(+) 2(-) 31(M) 6(NM) 37(+) 0 (-) 1 (+) 36 (-)
M- Motile; NM= Non motile; + Positive; - Negative
Screening methods for Single Cell Oil MEW8) and 1 strain from soil sample-III
production isolates (VOM12).
Sudan black B staining: Out of 37 isolates, 6 Production of single cell oil
strains were showed positive. 3 strains from soil The six positive strains namely, AOM2,
sample-I isolate (AOM2, AOM13 & AOM17), 2 AOM13, AOM17, MEW3, MEW8 and VOM12
strains from soil sample-II isolate (MEW3 & were used for the production single cell oil. The
percentage of total lipid content was calculated 18%, 23%, 21%, 16% and 8% respectively
from total cell dry matter and they showed 10%, (Table 2).
Table-2: Production of single cell oil

S. No. Strain no. Total cell dry matter Total lipid dry Total lipid (%
(mg/100ml) weight of w/w of
CDM)
1 AOM2 300 30 10
2 AOM13 200 36 18
3 AOM17 325 75 23
4 MEW3 350 75 21
5 MEW8 350 55 16
6 VOM12 740 60 8
Confirmation for lipids analysis compound by the formation of soapy solution

Solubility test: The extracted lipids were indicating the presence of lipids.
insoluble in water but soluble in alcohol and Antibacterial activity of lipids
chloroform. The crude lipids extracted from potential strain
Saponification test: The NaOH solution MEW3 showed antibacterial activity against
saponifies the lipids presented in the extracted Bacillus sp., Staphylococcus sp., and Proteus sp.
(Table 3).
Table 3: Antimicrobial activity of lipids

Test organisms (zone of inhibition in mm)
Strain no. Bacillus sp. Staph .aureus E.coli Proteus sp.
AOM13 - - - -
AOM17 - 7 - -
MEW3 8 7 - 9
Selection of potential strains

Based on the percentage of dry lipid, three isolates namely AOM13, AOM17and MEW3 was selected as
potential strains (Table 4).
Table 4: Potential strains

Si. No. Strain no. Total cell dry Total lipid dry Total lipid(% of
matter(mg/100ml) weight w/w of CDM)
1 AOM13 200 36 18
2 AOM17 325 75 23
3 MEW3 350 75 21

Optimization of single cell oil production accumulation at increased concentration of
Effect of Nutritional sources glucose (1.6g/L).
Effect of carbon sources: Growth of all strains Effect of Nitrogen sources: In 4 different
was observed in 4 different concentration of concentration of nitrogen source, maximum lipid
glucose. All strains showed maximum lipid accumulation was found at low concentration of
accumulation at 1.55 g/L concentration. Strain nitrogen souce (0.4g/L). The results were given
AOM13 and MEW3 showed maximum lipid in table 5.
Table 5: Effect of Nutritional sources

Strain no. AOM13 AOM17 MEW3
Growth Absorption Growth Absorption Growth Absorption
Nutritional source of stain of stain of stain
(g/100ml)
1.40 Good + Good ++ Good ++
Glucose
Source)
1.50 Good +++ Good ++ Good +++

(C-
1.55 Good +++ Good +++ Good +++

1.60 Good +++ Good +++ Good ++
.040 Good +++ Good +++ Good ++
Source)
(NH4)2
.045 Good +++ Good ++ Good +++

(N-
so4
.500 Good ++ Good +++ Good +++

.550 Good ++ Good ++ Good ++
+++ Maximum lipid accumulation; ++ Moderate lipid accumulation and + weak lipid accumulation
Effect of environmental factors
Effect of pH: All strains showed maximum growth at pH 7. Moderate growth was obtained at pH 6 and
poor growth was obtained at pH 5.
Table 6: Effect of pH
pH of stain of stain of stain
5 Poor - Poor - Poor +
6 Moderate ++ Good ++ Moderate +
7 Good +++ Good +++ Good +++
8 Good ++ Good +++ Good +++
+++ Maximum lipid accumulation; ++ Moderate lipid accumulation; + weak lipid accumulation and - No lipid accumulation
Effect of incubation time: The growth was observed from 24 hours to 96 hours. The increasing hours of
incubation showed strong staining ability which represents the maximum lipid accumulation.

Table 7: Effect of incubation time
Incubation time of stain of stain of stain
24 Good + Poor - Poor -
48 Good ++ Good ++ Good +
72 Good ++ Good +++ Good +++
96 Good +++ Good +++ Good ++
+++ Maximum lipid accumulation; ++ Moderate lipid accumulation; + weak lipid accumulation and - No lipid accumulation
Biosurfactant activity Characterization of potential isolates

Hemolysis tests: Among 3 potential isolates, 2 Based on the cultural characteristics,
strains AOM17 and MEW3 were showed microscopic, and biochemical characteristics
hemolytic activity. (mentioned in Table-8) the three potential
Emulsification tests: All the three strains organisms- AOM13, AOM17 and MEW3 were
studied for emulsification activity, which identified as Cellulomanas sp., Arthrobacter sp.,
doesn‘t show any positive result. Acromicrobium sp., respectively.
Table 8: Characterization of potential strains

Characteristics Strain-AOM13 Strain-AOM17 Strain-MEW3
Colony morphology Smooth, yellow Dirty white, convex Dirty white, convex
pigmented
Temperature β8˚ C β8˚ C β8˚ C
Gram staining G+ ve, rods G+ ve, rods G+ ve, rods
Motility Motile Motile Non-motile
Catalase + + +
Oxidase - - -
Spore staining - - -
Granule staining - - -
Gelatin liquification - - -
Starch hydrolysis - + +
Nitrate reduction - - -
Glucose + + -
Fructose + - -
Maltose + + +
Mannitol + - +
Sucrose + - +
Probable identity Cellulomanas sp. Arthrobacter sp. Acromicrobium sp.

DISCUSSION the 3 strains were taken up for further
Microbial lipophilic compounds called single optimization studies and application studies.
cell oils (SCO), has been the object of research The lipids extracted from cell dry matter were
and industrial interest for many years, due to analyzed for their antimicrobial properties. In
their specific characteristics. Such SCO products previous work, Gram positive and yeast only
are potential for using as alternative sources of showed higher sensitivity to the lipid
animal or plant oils. According to Gouda et al., compounds11 in the present study, the strain
and Patnayak and Sree 2005 single cell oil is MEW3 showed activity against Gram positive
mainly produced by Fungi and Yeasts, Bacteria bacteria and Gram negative bacteria.
for single cell oil production are not well The potential strains were optimized for
explored. In this concern, the present study has maximum lipid production and tested
aimed to isolate and identify single cell oil qualitatively by absorption ability of Sudan
producing bacteria from different oil black stain. The nutritional factors such as
contaminated sites and to optimize for maximum carbon source and nitrogen source and
production. environmental factors such as pH and incubation
For the collection of sample, three different oil time were optimized for maximum production of
contaminated sites were taken and analysed for lipid. This study showed the mild increased
isolation of bacteria from oil reservoirs20. In concentration of glucose enhances the
their present study also totally 37 strains were production of lipid. At 15.5 g/L concentration all
isolated from three different oil contaminated three strains AOM13, AOM17 and MEW3
sites. Of this sample-I contained large amount of showed maximum lipid accumulation when
microbial load when compared with sample-II glucose (carbon source) used. Papanikolaou et
and sample-III. The SCO producers were al. reported 0.5g/L of ammonium sulphate had
screened by sudan black staining and by produced high lipid. In this study, 0.4 g/L had
determination of total lipid content on cell dry showed maximum lipid accumulation when
matter15. In their study also all the 37 strains ammonium sulphate (nitrogen source) used. Hall
were screened by Sudan black stain of that 6 and Ratledge, reported that pH had little
isolates showed positive result for lipid influence on lipid accumulation. In this study pH
accumulation. The production of bacterial SCO had influence the accumulation of lipid. Strain
was done by shake flask method according to AOM17 and MEW3 showed maximum lipid
Gouda et al., 2002. accumulation at pH 8 and strain AOM 13
The lipids were extracted by Foltch method showed maximum lipid accumulation at pH 7.
which is an efficient method to extract the total The effect of incubation time was previously
lipid content from cell dry matter1, 9, 15. After reported by Papanikolaou et al. In this study, all
extraction, based on the percentage of total lipid the potential strains showed maximum lipid
content, 3 isolates were selected. Among 3 accumulation at an increased time of incubation.
strains AOM17 was identified as the efficient After 96 hours of incubation, the lipid
producers which produce about 23% of lipid accumulation remains constant. The three
content. For the confirmation of extracted potential Single cell oil producers, AOM13,
compounds as lipids, lipid analyzing tests were AOM17 and MEW3 were identified as
done and confirmed the presence of lipids. All Cellulomanas sp., Arthrobacter sp.,
Acromicrobium sp., respectively.
CONCLUSION 6. Desai, J. D and. Banat I M. Microbial
The present study can be further analyzed by production of surfactants and their
thin layer chromatography and Gas commercial potential. Microbiol. Mol. Biol.
chromatography. In future, many unknown Rev 1997; 61(1):47-64.
bacteria may result in the strains that are even 7. Fernandes P A V, De Arruda I. R, Santos A
better source of SCO producers than the ones we F, De Arauj A A, Maior A M S and
know. Efficient production techniques with Ximenes E A. Antimicrobial activity of
detailed knowledge of lipid mechanism should surfactants produced by Bacillus subtilis
be developed. This study offers an insight into R14 against Multidrug-resistant bacteria.
exploring the possibility of producing such Brazilian Journal of Microbiology 2007;
valuable added single cell oil at an high amount 38:704 - 9.
and to use it as a supplementary to other edible 8. Gill C, Hall M J and Ratledge C. Lipid
fats or to synthesis lipid based products such as accumulation in an oleaginous yeast
biosurfactant, bioplastics, etc., (Candida 107) growing on glucose in single-
stage continuous culture. Appl. Environ
REFERENCES Microbiol 1977; 33:231- 9.
1. Aggelis G and Komaitis M. Enhancement of 9. Gouda M K, Omar S H and Aouad L M.
single cell oil production by Yarrowia Single cell oil production by Gordonia sp.
lipolytica growing in the presence of DG using agro-industrial wastes. World. J.
Teucrium polium L. aqueous extract. Microbiol. Biotechnol 2008, 24:1703-11.
Biotechnology Letters 1999; 21: 747- 9. 10. Hall M J and Ratledge C. Lipid
2. Arshad M.U, Jamil N, Naheed N and accumulation in an oleaginous yeast
Hasnain S. Analysis of bacterial strains from (Candida 107) growing on glucose under
contaminated and non-contaminated sites for various conditions in a one- and two- stage
the production of biopolymers. Afr. J. continuous culture. Appl. Environ.
Biotechnol 2007; 6(9): 1115- 21. Microbiol 1977; 33:577-84.
3. Azeem A, Neelagund Y.F and Rathod V. 11. Kabara J J, Vrable R and JIE M S F L.
Biotechnological production of oil: fatty Antimicrobial lipids natural and synthetic
acid composition of microbial oil. Plant fatty acids and Monoglycerides. Lipids
foods for human nutrition 1999; 53: 381- 6. 1977; 12(9):753- 9.
4. Bhalla, T.C, Sharma M and Sharma N. 12. Lima T C S, Grisi B M and Bonato M C M.
Microbial production of flavours and Bacteria isolated from a sugarcane agro
fragrances; fats and oils; dyes; bioplastics ecosystem: their potential production of
(PHAs); polysaccharides; pharmacologically polyhydroxyalcanoates and resistance to
active substances from marine microbes; antibiotics. Revista de Microbiologia 1999;
anti-cancer agents and microbial 30:214-24.
biotransformation 2007; 1-34. 13. Papanikolaou S, Chevalot I, Komaitis M,
5. Cooper D.G, Zajic J.E and Gerson D.F. Mare I and Aggelis G. Single cell oil
Production of surface-Active Lipids by production by Yarrowia lipolytica growing
corynebacterium lepus. Appl. Environ. on an industrial derivative of animal fat in
Microbiol. 1979; 37(1): 4-10. batch cultures. Appl. Microbial. Biotechnol
2002; 58: 308-12.
14. Papanikolaou S, Komaitis M and Aggelis G. 18. Sabry S A, Ghanem K M and Yusef H H.
Single cell oil (SCO) production by Production of microbial lipids from beet
Mortierella isabellina grown on high-sugar molasses. Journal of Islamic academy of
content media. Bioresource Technology sciences 1990; 34: 310-13.
2004; 95: 287-91. 19. Sijtsma L, and De Swaaf M E.
15. Patnayak S and Sree A. Screening of Biotechnological production and
bacterial isolates of marine sponges for applications of the -3 polyunsaturated fatty
single cell oil and PUFA. Letters in Appl. acid docosahexaenoic acid. Appl.
Microbial 2004; 40: 358-63. Microbiol. Biotechnol 2004; 64: 146-53.
16. Ratledge C. Fatty acid biosynthesis in 20. Tabatabaee A, Assadi M M, Noohi A A and
microorganisms being used for single cell Sajadian V A. Isolation of biosurfactant
Oil production. Biochine 2004; 86: 807-15. producing bacteria from oil reservoirs.
17. Ribera R G, Sanchez M M and Ramos A. Iranian J. Env. Health Sci. Eng 2005; 2
Production of polyhydroxyalkanoates by (1):6-12.
Pseudomonas putida KT2442 harboring 21. Vali S R, Sheng H Y and Ju Y H. An
pSK2665 in wastewater from olive mills efficient method for the purification of
(alpechin), Electronic Journal of Arachidonic acid from fungal single cell oil
Biotechnology 2001; 4:0717-34658. (ARASCO). JAOCS 2003; 80 (7):725 - 30.

STUDY OF THE REASONS OF THE RADIOGRAPHIC IMAGES
REPETITION IN SISTAN AND BALUCHESTAN‟S TREATMENT
CENTERS
Mohammad Javad Keikhai Farzaneh1, Reza Afzalipour2, Mojtaba Vardian3,
Mahdi Shirin Shandiz1, Mohammad zarei1
1
ijcrr Zahedan Health Promotion Research Center, Zahedan University of Medical
Sciences, Zahedan, Iran.
Vol 04 issue 08 2
Medical Physics Dept, Tehran University of Medical Sciences, Tehran, Iran
Fasa University of Medical Sciences, Fasa, Iran.
Revised on:01/02/12 E-mail of Corresponding Author: mojtaba_rmeng@yahoo.com
ABSTRACT
Background and Objective: the repetition of radiographic images causes increased dose of the patients
and personnel, reduced life of the equipment and wasting the national capitals away. By identifying the
percentage of the repetition of radiographic images and the factors associated with it, we can significantly
make help to reducing the dose of patients, increase the useful life of the equipment, increase the
efficiency of personnel, reduce the dose of personnel and make economy in national costs.
Materials and Methods: in this descriptive study, the radiographic images had been collected for 3
months from nine governmental hospitals in the province of Sistan and Baluchestan and also the reasons
why the radiographic images were not accepted by the experts resident in that center was studied. In this
study, the reasons of the repetition of radiographic images were studied as follows: error in exposure
conditions, error in positioning the patient, lack of adoption between radiation center and cast center,
inappropriate choosing of the film size, movement of the patient, the error resulted from radiography
equipment, error in the process of fixation and emergence, lack of appropriate choosing of the radiation
point on the limb and other cases. Findings: Of the 34287 films used in nine treatment center, 4434 films
were repeated and the overall percentages of the repetition of radiographic images were 12.9% which the
maximum percentage of the repetition of radiographic images was in Amiralmomenin Hospital in Zabol
(26.9%) and the minimum percentage was related to Nabiakram Hospital in Zahedan (6.7%). Of the
factors related to the repetition of radiographic images, the maximum percentage of repetition was related
to the high radiation condition (3.22%) and the minimum amount was related to inappropriate choosing of
the film size (0.21%). The percentage of other factors comprised of choosing the radiation condition
(β.γ8%), error in radiation center (1.88%), error in equipment performance (0.61%), error in the patient‘s
positioning (0.61%), movement of the patient (0.33%), darkroom (1.57%) and other factors (2.08%).
Conclusion : The percentage of the repetition of radiographic images in governmental hospitals in Sistan
and Baluchestan province are in acceptable level in comparison with the statistics issued in other centers,
the percentage of the repetition of radiographic images can be significantly reduced and the national
capitals can be prevented to be wasted away through taking the measures such as regular quality control
of X-ray equipments , training the less experienced personnel and designing the methods of appropriate
choosing of radiation condition.
____________________________________________________________________________________

Keywords: radiography, film, darkroom, consequently reduce the costs imposed on the
radiation condition, radiographic images, Sistan treatment center.
and Baluchestan MATERIALS AND METHODS
In this descriptive design, the radiographic
INTRODUCTION images were collected for three months and have
Due to the fact that X-ray is frequently applied been studied by observation as such as according
to diagnose diseases and to reduce the patient‘s to the overall number of the accepted patients
dose and prevent from wasting the national and the number of applied films, repetition
capitals away, studying the amount and factors fraction was calculated according to the equation
resulted in the repetition of radiographic images below:
are an unavoidable necessity so that Ri=Ai/(Ai+Bi)
inappropriate using of X-ray generators causes Which in this equation:
the over-exposure of patients and personnel in Ri: fraction of repetition in radiographic center
radiology department which is contrary to the Ai: total number of repeated films
ALARA (As Low As Reasonably Achievable) Bi: total number of accepted films
principle (1). In the next stage, to determine the factors related
On the other hand, the repetition of radiographic to the repetition of radiographic images, the
images causes increased amount of time in form of data collection was designed and some
giving services to patients, the patient‘s of the most common factors in the repetition of
dissatisfaction, reduced useful life of the radiographic images have been written down as
equipment and wasting the national capitals below:
away. 1- Error in radiation condition which is led to
Therefore, the factors which are led to the creating a complete dark or white image and this
repetition of radiographic images in treatment error can be investigated having seen the image.
centers should be taken into consideration and 2- Error in patient‘s positioning which can be
the re-exposure of the patient should be investigated by observing the image with
prevented as much as possible. asymmetrical zooming or lack of complete
The significant factors of the repetition seeing of the concerned limb.
radiographic images are as follows: the 3- Lack of appropriate choosing of the radiation
inappropriate radiation factors, the error in the point on the limb and lack of adoption of
apparatus‘s performance, movement of the radiation center with cast center which this error
patient, error in the film size, lack of adoption of can be investigated with seeing the image.
the radiation center and cast center, lack of 4- Inappropriate choosing of the film size.
appropriate adoption of radiation point on the 5- Patient movement, which this error causes the
limb, etc. (2,3). It has been attempted in this fading and lack of clarity of the image
study that the amount of the repetition of 6- Error resulted from the equipment which can
radiographic images are taken into consideration be investigated by studying an image with two
as well as the most significant factors affecting projections in a film and seeing the image of the
on the repetition of images be identified in order patient in the experiments which several
to the appropriate guidelines be presented to radiography are performed to follow up the
reduce the repetition of radiographic images, and performance of the limb.
7- The changes in the appearance of the image in radiography images, absolute frequency, relative
darkroom which this error can be studied by frequency and frequency percentage for the
observing the image, because it can be clearly factors related with according to the mentioned
seen by inappropriate washing of the film or cases are determined and the objectives of the
dislodging the film‘s emulsion due to the roller‘s plan have been realized.
failure.
8- Other factors which can be involved such as FINDINGS AND DISCUSSION
artifact, error in performing the demanded During performing this design, 34287 films were
radiography, etc. used in the concerned hospital. Table 1 shows
In the next stage radiographic images are the percentage of repetition of radiographic
investigated by the experts in radiology in each images in the concerned hospitals.
hospital and will be involved in the special form
according to the above definition. Finally, after
complete the related forms, the repetition of
Table (1): the percentage of repetition radiographic images in the governmental hospitals of
Sistan and Baluchestan province
percentage of repetition films in radiographic

Hospital name
centers
Aliebnabitaleb of zahedan 11.8
Boali of zahedan 14.3
Nabiakram of zahedan 6.7
Taminejtemai of zahedan 14.3
Amiralmomenin of zabol 26.9
Imamkhomeyni of zabol 12.6
Khatam of iranshahr 11.8
Iran of iranshahr 15.2
Imamali of chabahar 7.2
The results achieved in this study indicate that the overall percentage of the repetition films is 12.9%.
The contribution of the percentage of each factors resulted in the repetition for the regarded nine
hospitals has been shown in table 2.
Table (2): the number (percentage) of the repeated images based on the factors resulted in
repetition in governmental hospitals of Sistan and Baluchestan Province
Factors High low Film Patient Proces Radiatio Patient Error of Other
resulted the radiation radiatio size positioni sor and n center move equipment cases
repetition condition n ng darkro ment performance
radiographic conditio om
images n
repetition
Number 1105 827 71 208 540 645 114 209 715
(percentage) (3.22) (2.38) (0.21) (0.61) (1.57) (1.88) (0.33) (0.61) (2.08)

Due to the fact that the range of the percentage of
radiography images repetition in several studies The Amiralmomenin Hospital of Zabol also have a
has been indicated between 0.9% to 27.6% (4-9), it high percentage of exposure repetition which
can be said that the percentage of the repetition in talking with the patients before being exposed and
governmental hospitals of Sistan and Baluchestan the precision of radiologists are necessary to
province are in an acceptable range. This study improve the condition.
indicated that high radiation condition and
inappropriate choosing of film size are the most REFERENCES
and least possible causes for repetition, 1. Clark PA, Hogg P. Reject/repeat analysis and
respectively. Amiralmomenin hospital of zabol and the effect prior film viewing has on a
Nabi -Akram Hospital of Zahedan have the most department‘s reject/repeat rate. Radiography
and least percentage of repetition, respectively. 2003; 9: 127-137.
In the studies performed by Nixon (7) and Morgan 2. Ali asgharzadeh A, Mohseni M. Evaluation of
(9), error in positioning has been indicated as the repeated radiographic films and its causes in
most significant cause in the repetition of Kashan hospital in 2003. J Feiz 2005; 33(9):
radiographic images, while in the current study, 50-56 (Persian).
patent positioning and performance error of the 3. URL:http://www.srp_uk.org/srpcdrom/p4-
equipment are both in sixth grade. 7.doc. Accessed Feb 21, 2009.
The admission statistics in Imamkhomeyni of 4. Jadidi M. Quality assessment of the
Zabol and Khatam of iranshahr Hospitals are radiography films. J Iran Univ Med Sci 2002;
higher than other treatment centers and due to the 30(9): 317- 326 (Persian).
high lifetime of the equipment of Zabol‘s 5. Peer S, Peer R, Giacomuzzi S.M, Jaschke W.
Imamkhomeyni Hospital, providing a new Comparative Reject Analysis in Conventional
equipment for this hospital is necessary. On the Film-screen and Digital Storage Phosphor
other hand, inappropriate filtration of the Radiography. Radiat Prot Dosim 2001; 94 (1-
equipment in Taminejtemai Hospital of Zahedan 2): 69-71.
causes the percentage of the repetition of 6. Lewentant G, Bohndorf K. Analisis of reject
radiography images is high in this center. X-ray films as a quality assurance element in
Therefore, the filtration function of this equipment diagnostic radiology. Rofo 1997; 166: 376-
should be corrected. Finally, due to the results 381.
obtained in this study, the following measures can 7. Nixon PP, Thorogood J, Holloway J, Smith
be effective in reducing the repetition of NJ. An audit of film rejects and repeats in a
radiographic images in governmental hospitals of department of dental radiology. Br J Radiol
Sistan and Baluchestan Hospitals: 1995; 68: 1304-1307.
Providing the auxiliary equipment to make limit 8. Al-Malki MA, Abulfaraj W.H, Bhuiyan S.I,
the regarded limb of the patient, proving the Kinsara AA. A study on radiographic repeat
special charts of choosing the radiation condition rate data of several hospitals in Jeddah. Radiat
for the employees who are less experienced, Prot Dosim 2003; 103: 323-330.
replacing some of the radiography equipments, 9. Morgan TL, Banks DA, Kagan AR. Radiation
regular quality control of the equipments and the therapy port film, a quality assurance study.
processors and continuous training of the Int J Radiat Oncol Biol Physics 1998;
personnel. 42(1):223-227.


Vol 4 Issue 8

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Vol 4 Issue 8

Uploaded by

Copyright:

Available Formats

E-ISSN: 0975-5241 (Online)

P-ISSN: 2231-2196 (Print)

“Let the Science be your passion”

International Journal of Current Research and Review (IJCRR)

Vol 04 / Issue 8 / April 2012

1 International Journal of Current Research and Review www.ijcrr.com

R Dr. Alabi Olufemi

2 International Journal of Current Research and Review www.ijcrr.com

Indexed in: Copernicus, Revistas Médicas Portuguesas, BOAI, DOAJ, Google

R Aims and Scope:

About the editors:

ijcrr Award for Best Article:

Administrative Office: IJCRR Administrative Office, 148, IMSR Building, Near

3 International Journal of Current Research and Review www.ijcrr.com

4 International Journal of Current Research and Review www.ijcrr.com

5 International Journal of Current Research and Review www.ijcrr.com

Abhishek Sharma1, Urvi Bhavsar2

6 International Journal of Current Research and Review www.ijcrr.com

8 International Journal of Current Research and Review www.ijcrr.com

9 International Journal of Current Research and Review www.ijcrr.com

Apurva Agrawal1, Barna Ganguly2

10 International Journal of Current Research and Review www.ijcrr.com

MATERIAL AND METHODS RESULTS

11 International Journal of Current Research and Review www.ijcrr.com

14 International Journal of Current Research and Review www.ijcrr.com

S. No. Name of Antibiotic MICU (n=24) SICU(n=72) P value

* P value calculated by chi square test

15 International Journal of Current Research and Review www.ijcrr.com

Rumisa Nazir, G. A. Bhat

16 International Journal of Current Research and Review www.ijcrr.com

Table 1 Segregation of biomedical waste as per BMW Rules, 1998

Color Coding Waste Category

S. No Training and other particulars No. of waste handlers %

S. No Training and other particulars No. of waste handlers %

21 International Journal of Current Research and Review www.ijcrr.com

22 International Journal of Current Research and Review www.ijcrr.com

INTRODUCTION professional standards and neglecting the

23 International Journal of Current Research and Review www.ijcrr.com

RESULTS AND DISCUSSION

25 International Journal of Current Research and Review www.ijcrr.com

Description of Scale Items Factor 1 Factor 2 Factor 3

7 Providing information about condition and treatment 0.8581 -0.0154 0.1670

2 Time spend by doctors with patient 0.8204 0.0363 0.1692

9 Trust worthiness, reliability and honesty of doctors 0.6042 0.2693 0.3322

6 Care taken by doctor to check everything 0.3400 0.4540 0.1869

26 International Journal of Current Research and Review www.ijcrr.com

% of Total Variance 25.21 18.30 16.63

Cumulative % of Total Variance 25.21 43.50 60.13

27 International Journal of Current Research and Review www.ijcrr.com

Providing information about condition and treatment 3.13 0.89 3.69***

Preliminary test prior to admission & Advising

**Significant at 5% level; ***Significant at 1% level.

Factors Underlying Age (in Years)

TABLE NO. 6 Comparison of Perceived Status of Doctors‟ Behaviours among

Providing information about 2.77 3.19 3.14 3.31 9.60***

Preliminary test prior to admission

Giving reasons for conducting 2.58 3.02 2.99 3.01 7.94***

29 International Journal of Current Research and Review www.ijcrr.com

TABLE NO. 8 Comparison of Perceived Status of Doctors‟ Behaviours among

Providing information about condition and 3.21 3.08 1.76*

Preliminary test prior to admission & Advising 3.06 3.05 0.15

Giving reasons for conducting different medical 3.02 2.85 2.25**

Significant at 5% level; *Significant at 1% level.