Int J Biol Med Res.

2024; 15(1): 7712-7717

Int J Biol Med Res www.biomedscidirect.com

Contents lists available at BioMedSciDirect Publications

International Journal of Biological & Medical Research

BioMedSciDirect Journal homepage: www.biomedscidirect.com International Journal of
Publications BIOLOGICAL AND MEDICAL RESEARCH

Original article
ADENOMATOUS POLYPOSIS COLI (APC) GENE MUTATION IN A POPULATION OF
PROSTATE CANCER PATIENTS IN OSUN STATE, NIGERIA
a
Olubunmi Ebenezer Esan, bYetunde Sophia Akinbo, cOlalekan Adegoke Aremu , dAbiola Adeyemi Adefidipe,
e
Frederick Olusegun Akinbo
Department of Medical Laboratory Science, University of Benin, Benin City, Nigeria
Department of Medicine, University of Utah, Salt Lake City, USA
Department of Morbid Anatomy and Forensic Medicine, Obafemi Awolowo University Teaching Hospital, Ile-Ife, Nigeria”

ARTICLE INFO ABSTRACT

keywords It has been reported that the tumour suppressor gene germline adenomatous polyposis coli is
APC mutation mutated in many tumours particularly in prostate. This study was conducted to determine the APC
prostate cancer patients gene mutations in prostate cancer patients in Osun State, Nigeria. Previously diagnosed paraffin wax
Osun State. tissue blocks with prostate cancer between 2014 and 2019 were selected for this study. Biodata
information was obtained from the patient's request form and the laboratory surgical logbook.
Sections were cut and stained for heamatoxylin and eosin staining technique to validate the
diagnosis of prostate cancer previously reported. Sections for molecular analysis were dewaxed and
macerated for DNA extraction. The APC-F “GGCAAGACCCAAACACATAATAG” and APC-R
“GGAGATTTCGCTCCTGAAGAA” primers were used in the polymerase chain reaction and sequenced.
The Big Dye terminator v3.1 cycle sequencing kit was used for sequencing the amplified fragments
on an Applied Biosystems Genetic Analyzer 3130xl sequencer machine. This study observed
mutations in the APC gene in some prostate cancer patients in Osun State, Nigeria. The mutations
observed in this study involved the alanine nucleotides, glycine and an alanine-glycine nucleotide
complex indicating the silent and missense mutations. In order to diagnose prostatic cancer early,
manage and treat patients, routine genomic screening of males over 40 years is advocated.

c Copyright 2023 BioMedSciDirect Publications IJBMR -ISSN: 0976:6685. All rights reserved.

Introduction
Globally, prostate cancer is the second-most common cancer. It is
the fifth-leading cause of cancer-related death in men. Prostate
cancer (PCa) is the most common cause of cancer death among
African men (1). PCa is the most common cancer among males,
resulting in over 1,193,715 new cases and 375,000 fatalities each
year (2). It is the most common cancer disease in men in 84 countries,
occurring more commonly in developed countries (3). This disease
presents more aggressively among African men and it is uncertain
whether the increased aggression is an inherent biological
characteristic found in African patients or is a result of late-stage
diagnosis, which could affect disease treatment (4). The
epidemiology of prostate cancer provides some evidence that its
genesis is probably a combination of hereditary and environmental
factors (5). Specifically, epidemiological studies have established that
a family history of prostate cancer significantly increases risk (6).
It has been reported that the tumour suppressor gene germline
adenomatous polyposis coli is mutated in many tumours (7). APC
protein promotes β-catenin degradation by binding to axin and
directly binding to β-catenin. Mutant APC binds to β-catenin but not
* Corresponding Author : Dr.Frederick Olusegun Akinbo
Department of Medical Laboratory Science
School of Basic Medical Sciences University of Benin Benin City, Nigeria.
E-mail: fredrick.akinbo@uniben.edu
c Copyright 2023 BioMedSciDirect Publications. All rights reserved.
to axin which causes inefficient phosphorylation, incomplete
degradation, and accumulation of β-catenin (8). APC gene
mutations were initially reported in familial adenomatous
polyposis in 1991. The progression from adenoma to cancer is
believed to involve multistage carcinogenesis with the
accumulation of APC, KRAS, and TP53 gene mutations (9). In the
presence of WNT ligands, or a mutation in the APC gene, β-catenin
is no longer degraded and can accumulate in both the cytosol and
the nucleus, where it activates target gene expression primarily via
interaction with the TCF/LEF DNA binding transcription factors
(10). The loss of APC function is thought to activate downstream
components of the canonical WNT signaling pathway (11, 12).
Numerous genetic mutations, together with epigenetic and gene
expression adjustments or alterations, have been shown to raise
the chance of developing prostate cancer (13, 14, 15). There are
several genes that, when mutated, increase the likelihood of
developing prostate cancer, among which is the APC gene (16).
Modern research has centered on figuring out the genetic causes of
prostate cancer. Information is lacking on APC gene mutation
among prostate cancer patients in Osun State. Against this
background, this study was conducted to determine the APC gene
mutations in prostate cancer patients in Osun State, Nigeria.
 Olubunmi Ebenezer Esan et al. Int J Biol Med Res. 2024; 15(1): 7712-7717
7713
MATERIALS AND METHODS
Study design
The specimens used in this study were obtained from the
Histopathology Laboratory's archives at the Obafemi Awolowo
University Teaching Hospital (OAUTH), Ile-Ife, Osun State.
Previously diagnosed paraffin wax tissue blocks with prostate
cancer between 2014 and 2019 were selected for this study. Biodata
information was obtained from the patient's request form and the
laboratory surgical logbook.
Sample size of this research was determined using the formula:
N=Z2P(1-P)/d2, (17)
When N=Sample size
Z=Statistic for the level of confidence 95% which is
conventionally 1.96
P=Estimated prevalence (0.1875)
N=Required sample
D=Accepted Error (0.05)
N=1.9(2)X0.1875(1-0.1875)/0.05(2)
N=234 Samples
A total of 234 paraffin wax tissue blocks diagnosed with
prostate cancer were retrieved from the Histopathology Laboratory
of the hospital and used in this study.
Ethical Clearance
The protocol for this study was approved by the Ethics and
Research Committee of the Osun State Ministry of Health, Osogbo,
Osun State, Nigeria.
Specimen collection and processing
Sections were cut at 3µ on a rotary microtome to validate the
diagnosis of prostate cancer on the selected paraffin wax blocks
from the Histopathology Laboratory archives of the OAUTH. The
sections were stained using the previously described method by
Avwioro (18). Briefly, the sections were dewaxed in 2 changes of
xylene, hydrated in descending grades of alcohol, and taken to
water. Hydrated sections were stained in Cole's haematoxylin for 10
min, rinsed in water and differentiated in 1% acid alcohol briefly.
Stained sections were rinsed in water, blued in running tap water
for 10 min and counterstained in 1% aqueous eosin for 3 min.
Stained sections were rinsed in water, dehydrated in ascending
grades of alcohol, cleared in 2 changes of xylene and mounted in
DPX. Sections were examined microscopically, and the previous
diagnosis of prostate cancer was validated.
DNA extraction
Multiple serial sections were cut from the paraffin wax tissue
blocks, dewaxed in xylene, hydrated and ground in sterile mortar
and pestle for DNA extraction, 500 µl of extraction buffer was added
in an Eppendorf tube. Thirty-three microliter of 20% Sodium
Dodecyl Sulphate (SDS) was added, vortexed for a short time, and
incubated in a water bath at 65°C for 10 min and 10 µl of 5 M
potassium acetate was added, vortexed, and centrifuged at 10,000 g
for 10 min at room temperature. A second Eppendorf tube was used
to collect the supernatant, 300µl of cold isopropanol was added,
gently mixed, and then the tube was maintained at -20°C for 60 min.
The mixture was centrifuged at 13,000g for 10 min, and the
supernatant was carefully decanted. The DNA pellet was then
centrifuged at 10,000 g for 10min and rinsed in 500 µl of 70%
ethanol. The DNA pellet was air-dried at room temperature
following ethanol decantation. The pellet was then re-suspended in
50 µl of Tris EDTA buffer (19).
Polymerase Chain Reaction
PCR sequencing preparation cocktail for all PCR consisted of 10
µl of 5x GoTaq colourless reaction, 3 µl of 25mM MgCl2, 1 µl of 10
mM of dNTPs mixed, 1 µl of 10 pmol each primers (Table1) and 0.3
units of Taq DNA polymerase (Promega, USA) made up to 35 µl with
sterile distilled water 15μl DNA template. PCR was carried out in a
GeneAmp 9700 PCR System Thermalcycler (Applied Biosystem Inc.
USA) with a PCR profile for each primer.
Table 1: Forward and Reverse Primers
Primer Primer sequence PCR Profile
APC-F GGCAAGACCCAAACACATAATAG Denaturation at 94°C
for 5 min; followed by
a 30 cycle consisting
of 94°C for 30 s, 48°C
for 30s and 72°C for
1 min; and final
termination at 72°C
for 10 min.
APC-R GGAGATTTCGCTCCTGAAGAA
The PCR sequencing preparation cocktail for all PCRs contained
10nl of a 5x GoTaq colorless reaction, 3 µl of 25 mM MgCl2, 1µl of a
10 mM dNTPs mix, 1µl of each 10 pmol primer, and 0.3 units of Taq
DNA polymerase (Promega, USA) made up to 35µl with sterile
distilled water and 15 µl DNA template. A PCR profile for each
primer was used during the PCR process in an Applied Biosystems
Gene Amp 9700 PCR System Thermal cycler (USA). The gel was
electrophoresed at 120V for 45 min before being photographed and
viewed under ultraviolet trans-illumination. By comparing the
mobility of a 100 bp molecular weight ladder with experimental
samples run alongside it in the gel, the sizes of the PCR products
were calculated.
 Olubunmi Ebenezer Esan et al. Int J Biol Med Res. 2024; 15(1): 7712-7717
The amplified fragments were ethanol filtered to eliminate the
PCR reagents after gel integrity. In a new, sterile 1.5-l Eppendorf
tube, each 40-l PCR amplified product received 7.6 µl of Na acetate
3M and 240 µl of 95% ethanol. The mixtures were properly mixed
by vortexing, and the tubes were then kept at -20°C for 30 min. After
centrifuging for 10 min at 13,000 g and 4°C, the supernatant was
decanted and the pellet cleansed by adding 150 µl of a 70% ethanol
mixture, at 7,500g centrifuged at 4°C for 15 min. Before sequencing,
supernatant was aspirated and dried in the fume hood at ambient
temperature for 15 min. The DNA pellet was resuspended in 20 µl of
sterile distilled water and stored at -20°C. The purified fragment
was quantified using a nanodrop of model 2000 from Thermo
Scientific and tested on a 1.5% Agarose gel run at 110V for 1hr to
confirm the presence of the purified product.
Sequencing
The Big Dye Terminator v 3.1 cycle sequencing kit was used for
sequencing the amplified fragments on an Applied Biosystems
Genetic Analyzer 3130xl sequencer per the manufacturer's
instructions. For all genetic studies, MEGA 6 and Bio-Edit tools were
utilized. A run blast analysis using the NCBI data website indicated
that all APC partial sequences were between 99-100% identical to
Homo sapiens APC regulator of WNT signaling pathway (APC),
transcript variant 1, mRNA. The sequences obtained for APC gene
were submitted to the NCBI gene bank and accession numbers
allotted were: (G1) OK357100-(G1) OK357106); (G2) OK357107-
(G2) OK357112; (G) OK 357113 and (G3) OK357114-(G3)
OK357120.
Plate 1: Gel electrophoresis for APC genes region of prostate
cancer tissue
RESULTS
The aligned edited APC partial gene sequences generated from
the selected tissue blocks revealed the presence of potential SNPs
(single Nucleotide Polymorphism) along the sequenced fragment. A
total of six potential mutations were recorded along the sequenced
fragments and these mutations varied in functions ranging from
silent mutation to missense mutation. Although all mutations were
point (Transition) mutations, three of these mutations were silent
mutations, as the effect of a nucleotide change didn't cause a change
in the amino acid sequence and were recorded at positions (on the
aligned sequence) 163, 579, and 903. The other three were
missense mutations as the nucleotide change resulted in a change in
amino acid and was recorded at positions 430, 626, and 766 (Table
2). The presence of an A-G (Alanine-Glycine) mutation was
identified in position 163 with 10 individuals having the nucleotide
A and 11 individuals having the nucleotides G (Figure 1a).
7714
All samples from group 1 and samples 3, 4 and 5 from group 3
had the A (Alanine) nucleotide while all samples from group 2 and
samples 7, 8 ,12 and 19 from group 3 had the G (Glycine) nucleotide.
This A-G (Alanine-Glycine) mutation, however, is a silent mutation
as both the A and G both coded for the same amino acid glutamine.
Another mutation along the partial sequenced APC gene was a T-C
(Threonine-Cysteine) mutation recorded at position 430. This T-C
(Threonine-Cysteine) mutation with 20 individuals having the T
nucleotide and only sample 43 having the C nucleotide is a missense
mutation. Individuals with the T nucleotide translated to amino
acid serine while those with the C nucleotides translated to proline
(Figure 1b).
The APC partial gene sequence was recorded at position 579.
This G-A (Glycine-Alanine) mutation occurred with a frequency of
11 individuals having the G nucleotide while 10 individuals have the
A nucleotide. All samples from group 1 and samples 3, 4, 5 from
group 3 including sample 22 from group 2 had the G (Glycine)
nucleotide while all samples from group 2 (sample 22) and samples
7, 8, 12 and 19 from group 3 had the G (Glycine) nucleotide. Also,
this A-G (Alanine-Glycine) mutation is a silent mutation as both the
A and G both coded for the same amino acid Leucine. Similar
mutation along the partial sequenced APC gene was noticed in the
T-C (Threonine-Cysteine) mutation recorded at position 626. This
T-C mutation with 18 individuals having the T nucleotide and only 3
individuals from group 1 (samples 1, 23 and 31) with the C
nucleotide is a missense mutation. Individuals with the T
nucleotide translated to amino acid Isoleucine while those with the
C nucleotides translated to threonine (Figure 1c).
At position 766, A-G (Alanine-Glycine) mutation was recorded
with 20 individuals having the nucleotide A and only sample 2 from
group 1 had the nucleotides G. This A-G (Alanine-Glycine) mutation
is a missense mutation as individuals with the A nucleotide
translated to amino acid Lysine while that with the G nucleotide
translated to amino acid glutamic acid (Figure 1d).
The final mutation identified along the partial sequenced APC
gene was located at position 903. This mutation is a T-C (Threonine-
Cysteine) mutation having a frequency of 19 individuals having the
G nucleotide and 2 individuals have the C nucleotide. This T-
C(Threonine-Cysteine) mutation is also a silent mutation as both
the T and C both coded for the same amino acid Phenylalanine
(Figure 1e).
The phylogenetic tree has two major clusters from sample 27 to
sample 22 is a major cluster and from sample 4 to sample 1 is
another major cluster. First cluster contained mainly groups 3 and 2
while second cluster contained mainly groups 1 and 3 (Figure 2).
Table 2: Gene alterations observed in prostate cancer tissue
blocks.
 Olubunmi Ebenezer Esan et al. Int J Biol Med Res. 2024; 15(1): 7712-7717

7715

Figure 1d: Nucleotide alignment that showed the region of SNP

mutations along the APC gene in tissue of prostate cancer
patients.

Figure 1a: Nucleotide alignment that showed the region of SNP

mutations along the APC gene in tissue of prostate cancer
patients.

Figure 1e: Nucleotide alignment that showed the region of SNP

mutations along the APC gene in tissue of prostate cancer
patients.

Figure 1b: Nucleotide alignment that showed the region of SNP

mutations along the APC gene in tissue of prostate cancer
patients.

The phylogenetic tree has two major clusters from sample 27 to

Figure 1c: Nucleotide alignment that showed the region of SNP
sample 22 and from sample 4 to sample 1. First cluster contained
mutations along the APC gene in tissue of prostate cancer
mainly groups 3 and 2 while the second cluster consisted mainly of
patient
groups 1 and 3.

Figure 2: Phylogenetic studies showing the relationship among

samples along the APC gene.
 Olubunmi Ebenezer Esan et al. Int J Biol Med Res. 2024; 15(1): 7712-7717
DISCUSSION
The understanding of the genetic events involved in the initial
onset and progression of prostate cancer has reportedly advanced
quite quickly due to advances in molecular technologies (20). The
development of our knowledge of the genetic, biochemical, and
metabolic anomalies of prostate cancer at various phases of the
disease's progression has made it easier to identify new potential
therapy targets (21). To our knowledge, this study is the first study
to determine the APC gene mutation in prostate cancer patients in
Osun State, Nigeria.
It has been reported that men with APC gene mutation are at
higher risk of developing prostate cancer (22). Apart from the
molecular changes observed at the somatic level in prostate tumor
cells, there are also variants at the germ line level, which means that
they exist in every cell in a man's body from the time of conception
and increase the likelihood of prostate cancer developing early in
life. Men who have a family history of prostate cancer, particularly
first-degree cases, are at a higher risk of developing the illness since
it may be a genetic condition (23). In this study, APC gene mutations
were observed at amino acid positions 163, 430, 579, 621, 766, and
903. In addition, a T-C(Threonine-Cysteine) mutation was found at
position 430, an A-G(Alanine-Glycine) mutation at location 163, a G-
A(Glycine-Alanine) mutation at position 579, and a T-C (Threonine-
Cysteine) mutation at position 621. A-G(Alanine-Cysteine) and T-
C(Threonine-Cysteine) mutations are found at positions 766 and
903, respectively. This observation is at variance with the report of
Umeda et al. (8), which observed mutations with heterozygosity
and focal nuclear translocation of β-catenin in prostate cancer
patients in Japan. The reasons for the difference in this study and
that of other authors may be attributed to aging and dietary habits
as well as geographical locations.
The phylogenetic tree computed with edited sequences
amplified with APC specific primers clustered having two major
branches. This phylogenetic tree indicated high level of group
variation with group1 entirely in one branch whereas group 2 is in
another branch however, group 3 cuts across both branches. The
first branch consisted of a close relationship between samples 27,
12, 13, 15, 17, 18 and 11 (all in group 2) and this subbranch were
closely related to reference sequence LT855219, LT855215,
LT855223 and LT855224. Within this branch is another sub-branch
consisting of group 3 samples 8, 7 and 19 with sample 22 (group 2)
out grouping itself from the clusters. Sample 22 differs from other
members of this group with a G-A mutation at position 579. The
second major branch in the tree is made up of a cluster sample 4, 3
and 5 of group 3 which is closely related to sample 42 of group 1 and
a second subbranch consisting of a cluster between sample 36 and
sample 2, sample 23 and sample 31 and is closely related to sample
1 (all in group 1). Sample 1, 31 and 23 differs from the rest members
of this branch with a C:T mutation in position 626. Groups 2 and 3
were closely related compared to group 1 recording a genetic
difference of 0.000970. however, group 2 differs from group 1 with a
7716
genetic difference of 0.002758 while group 3 differs from group 1
with a genetic difference of 0.002186. This finding is consistent
with the report of Breyer et al. (24) that observed familial mutation
on the APC genes of prostate cancer.
Conclusion
This study observed APC gene mutation in some prostate
cancer patients in Osun State, Nigeria. The mutations observed in
this study involved the alanine nucleotides, glycine, and an alanine-
glycine nucleotide complex indicating the silent and missense
mutations.
Acknowledgments
We sincerely appreciate the Management of the Obafemi
Awolowo University Teaching Hospital, Ile-Ife, Osun State, Nigeria
for allowing us to use their archival tissue blocks from the
Histopathology Laboratory for this study. Our profound gratitude
goes to the Head of the Department, Consultant Pathologists,
Deputy Director (MLS), and members of staff of the Department of
Histopathology, Obafemi Awolowo University Teaching Hospital,
Ile-Ife, Osun State for their cooperation and assistance in using
facilities.
References
[1] Temilola DO, Wium M, Paccez J, Salukazana AS, Rotimi SO, Otu HH, Carbone
GM, Kaestner L, Cacciatore S, Zerbini LF. Detection of Cancer-Associated Gene
Mutations in Urinary Cell-Free DNA among Prostate Cancer Patients in South
Africa. Genes. 2023; 14:1884. doi.org/10.3390/ genes14101884.
[2] International Agency for Research on Cancer, World Cancer Report 2014,
ed.Stewart BW and Wild CP: International Agency for Research on Cancer.
2014.
[3] Sung H, Ferlay J, Siegel RL. Laversanne M. Soerjomataram I, Jemal A, Bray F.
(2021). Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and
Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin.
2021:71: 209–249.
[4] Powell IJ. Epidemiology and Pathophysiology of Prostate Cancer in African-
American Men. J. Urol. 2007; 177: 444–449.
[5] Schulman CC, Zlotta AR, (2003). Prevention of Prostate Cancer: The Role of
Diet: Prostate Cancer. Doi.org/10.1016/B978-012286981-5/50022-7
[6] Lange EM. 2010. Identification of genetic risk factors for prostate cancer:
analytic approaches using hereditary prostate cancer families. In Male
reproductive cancers: epidemiology, pathology and genetics (ed. Foulkes WD,
Cooney KA), Springer, New York. 2010; 203-228.
[7] Wachsmannova L, Mego M, Stevurkova V, Zajac V, Ciemikova S. Novel
strategies for comprehensive mutation screening of the APC gene.
Neoplasma. 2017; 64: 338-343.
[8] Umeda K, Kosaka T, Nakamura K, Takeda T, Mikami S, Nishihara H, Oya M.
(2020). A Japanese patient with ductal carcinoma of the prostate carrying an
adenomatosis polyposis coli mutation: a case report. Diagnostic Pathol. 15:
102-105.
[9] Zhang L, Shay JW. (2017). Multiple roles of APC and its therapeutic
implications in colorectal cancer. J National Cancer Inst. 109(8):djw332.
[10] Eastman Q, Grosschedl R (1999) Regulation of LEF-1/TCF transcription
factors by Wnt and other signals. Curr Opin Cell Biol 11: 233–240.
[11] Clevers H (2006) Wnt/beta-catenin signaling in development and disease.
Cell. 127: 469–480.
 Olubunmi Ebenezer Esan et al. Int J Biol Med Res. 2024; 15(1): 7712-7717

7717

[12] MacDonald BT, Tamai K, He X (2009) Wnt/beta-catenin signaling: [21] Lunardi A, Ala U, Epping MT, Salmena L, Clohessy JG, Webster KA, Wang G,
components, mechanisms, and diseases. Dev Cell. 17: 9–26. Mazzucchelli R, Bainconi M., Stack E.C., et al. A co-clinical approach
[13] Adeola HA Soares, N.C.; Paccez, J.D.; Kaestner, L.; Blackburn, J.M.; Zerbini, L.F.; identifies mechansims and potential therapies for androgen deprivation
Luiz, F.; Zerbini, L.F. Discovery of Novel Candidate Urinary Protein Biomarkers resistance in prostate cancer. Nature Genet. 2013; 45:747–755
for Prostate Cancer in a Multiethnic Cohort of South African Patients via [22] Lehrer S, McCurdy LD, Stock RG, Kornreich R, Stone NN, C Eng C (2000).
Label-Free Mass Spectrometry. Proteom.-Clin. Appl. 2015; 9: 597–609. Body mass, age, and the APC I1307K allele in Ashkenazi Jewish prostate
[14] Adeola, H.A.; Smith, M.; Kaestner, L.; Blackburn, J.M.; Zerbini, L.F. Novel cancer patients. Cancer Genet Cytogenet. 122(2): 131-133.
Potential Serological Prostate Cancer Biomarkers Using CT100+ Cancer [23] Castro-Mujica M. (2022). Clinical implications of the molecular biology of
Antigen Microarray Platform in a Multi-Cultural South African Cohort. prostate cancer: Review article. Rev Fac Med Hum. 22(3):597-613.
Oncotarget. 2016; 7:13945–13964. [24] Breyer JP, Avritt TG, McReynolds KM, Dupont WD, Smith JR. Confirmation
[15] Jaratlerdsiri, W.; Jiang, J.; Gong, T.; Patrick, S.M.; Willet, C.; Chew, T.; Lyons, R.J.; of the HOXB13 G84E germline mutation in familial prostate cancer.
Haynes, A.-M.; Pasqualim, G.; Louw, M.; et al. African-Specific Molecular Cancer Epidemiol Biomarkers Prev. 2012; 21:1348–1353.
Taxonomy of Prostate Cancer. Nature. 2022; 609: 552–559.
[16] Cooney KA. (2017). Inherited predisposition to prostate cancer: fromgene
discovery to clinical impact. Trans American Clin Climatol Assoc. 128: 14-23.
[17] Naing L, Winn T, Rusli BN. Practical Issues in Calculating the Sample Size for
Prevalence Studies. Arch Orof Sci. 2006; 1: 9-14.
[18] Avwioro OG. (2015). Histochemistry and Tissue Pathology in; Principle and
Technique. Third edition, Claverianun Press, Ibadan, Nigeria. 133-168.
[19] Khan S, Dowst H, Huang Q, Noor AB, Godoy G, Zarrin-Khameh N, Castro P,
Scheurer ME, Hilsenbeck SG, Mims MP, Mitsiades N. Role of adenomatous
polyposis coli (APC) gene in SPOP-mutant prostate cancer and clinical
outcomes. J Clin Oncol. 2023; 41: doi/pdf/10.1200/JCO.2023.41.6_suppl.
[20] Morais CL, Herawi M, Toubaji A, Albadine R, Hicks J, Netto GJ, De Marzo AM,
Epstein JI, Lotan TL. PTEN loss and ERG protein expression are infrequent in
prostatic ductal adenocarcinomas and concurrent acinar carcinomas.
c Copyright 2023 BioMedSciDirect Publications IJBMR -ISSN: 0976:6685.
Prostate. 2015; 75:1610–1619. All rights reserved.