1846

Journal of Food Protection, Vol. 75, No. 10, 2012, Pages 1846–1850
doi:10.4315/0362-028X.JFP-12-115
Copyright G, International Association for Food Protection

Research Note

Prevalence and Molecular Characteristics of Vibrio spp.

Isolated from Preharvest Shrimp of the North Western Province
of Sri Lanka
MADURA SANJEEVANI GONSAL KORALAGE,1 THOMAS ALTER,2* DUANGPORN PICHPOL,3 ECKHARD STRAUCH,4
KARL-HANS ZESSIN,5 AND STEPHAN HUEHN2

Downloaded from http://meridian.allenpress.com/jfp/article-pdf/75/10/1846/1686186/0362-028x_jfp-12-115.pdf by Brazil user on 06 January 2023

1Government Veterinary Office, Walikanda 51070, Polonnaruwa, Sri Lanka; 2Institute of Food Hygiene, Freie Universität, 14163 Berlin, Germany;
3Faculty of Veterinary Medicine, Chiang Mai University, Chiang Mai 50100, Thailand; 4Federal Institute for Risk Assessment, 14195 Berlin, Germany;
and 5Postgraduate Studies in International Animal Health, Freie Universität, 10117 Berlin, Germany

MS 12-115: Received 8 March 2012/Accepted 10 June 2012

ABSTRACT
This study investigated the prevalence and molecular characteristics of Vibrio spp. in farmed shrimp (Penaeus monodon) in
Sri Lanka. A total of 170 shrimp samples (100 g of whole shrimp each) taken from individual ponds from 54 farms were collected
1 week prior to harvest from the North Western Province of Sri Lanka. Overall, 98.1% of the farms and 95.1% of the ponds were
positive for Vibrio spp. in shrimp; at the pond level, V. parahaemolyticus (91.2%) was most common, followed by V.
alginolyticus (18.8%), V. cholerae non-O1/non-O139 (4.1%), and V. vulnificus (2.4%). Multiple Vibrio spp. were detected in
20.6% of the ponds. None of the V. parahaemolyticus isolates (n ~ 419) were positive for the virulence-associated tdh
(thermostable direct hemolysin) and trh (TDH-related hemolysin) genes. V. cholerae was confirmed by the presence of ompW,
and all isolates (n ~ 8) were negative for the cholera toxin (ctxA) gene. V. cholerae isolates were serogrouped by PCR and
identified as V. cholerae non-O1/non-O139. All four V. vulnificus strains, isolated from different ponds of two geographical
regions, showed pathogenic potential; they belonged to vcgC sequence type, type B 16S rRNA genotype and contained a pilF
polymorphism associated with human pathogenicity. The results of this study revealed the ubiquitous nature of vibrios in farmed
shrimp. To minimize the potential risk of Vibrio infections due to handling or consumption of raw or undercooked seafood
products, good manufacturing practices as well as proper handling and processing should be addressed.

Foodborne outbreaks due to Vibrio-contaminated
seafood (including shrimp) have been reported from both
tropical and temperate countries, such as Thailand (9),
Indonesia (21), Mexico (5), and Chile (6). The ubiquitous
nature of Vibrio spp. and their close association with shrimp
in hatcheries and grow-out ponds make them an important
issue in public health (5). Crustacean culture plays an
important role in the world’s aquaculture industry, with
shrimp being the most popular aquaculture product. Shrimp
are a valuable resource of the aquaculture sector in Sri
Lanka, largely designated for export to the United States,
Japan, and the European Union countries. Previous studies
identified high prevalences of Vibrio spp. in shrimp and the
shrimp culture environment in Sri Lanka and India (15, 18).
However, usually only 1 to 3% of environmental Vibrio
parahaemolyticus strains carry the virulence genes tdh/trh
that can produce thermostable direct hemolysin (TDH) or
TDH-related hemolysin (TRH) (15, 25, 28). Nonetheless,
single studies showed higher prevalences of trh (z) tdh (2)
strains in fish (up to 19%) (32).
* Author for correspondence. Tel: z49-30-838-62550; Fax: z49-30-838-
62552; E-mail: thomas.alter@fu-berlin.de.
The presence of Vibrio cholerae, V. vulnificus, and V.
parahaemolyticus in shrimp cultures cannot be avoided as
they belong to the natural microflora of the estuarine waters
(4, 11). V. cholerae was identified in aquaculture and envi-
ronmental samples associated with shrimp production from
different Southeast Asian regions (15, 18). Most of the
environmental strains of V. cholerae are non-O1/non-O139
and rarely carry cholera toxin genes (14).
V. vulnificus is a leading cause of seafood-related human
infections and is responsible for more than 95% of seafood-
related deaths (usually associated with handling or consumption
of raw and undercooked seafood), despite its low prevalence in
such matrices (19, 34). V. vulnificus is more frequently isolated
from estuarine waters than coastal marine waters, possibly due
to the lower salinity of estuarine habitats (32).
Thus, data are needed about the presence of Vibrio spp.
in seafood, with particular reference to potentially virulent
strains. The present study was carried out in a large shrimp
production area in the North Western Province of Sri Lanka.
The objectives of this study were to determine the
prevalence of Vibrio spp. and the molecular characteristics
of Vibrio spp. in shrimp raised in shrimp farm ponds, in
order to evaluate the risks for producers and consumers
from handling and consumption of seafood.
J. Food Prot., Vol. 75, No. 10 VIBRIO SPP. IN SHRIMP PREVALENCE AND CHARACTERISTICS
FIGURE 1. Location of sampled shrimp farms in the North
Western Province of Sri Lanka. 1, Chillaw; 2, Mundalama; 3,
Madurankuliya; 4, Kalpitiya; 5, Puttalam.
MATERIALS AND METHODS
Samples and data collection. This study was carried out
from November 2010 to March 2011. A total of 170 black tiger
shrimp (Penaeus monodon) samples from 54 shrimp farms were
obtained. These farms were located in five areas of the Puttalam
District in the North Western Province of Sri Lanka (Fig. 1).
Each farm consisted of 1 to .20 ponds. One week before
harvest, 100-g shrimp samples (five to eight shrimps, depending
on the individual weight) were collected randomly from harvest
ponds of the farms, and shrimp from individual ponds were
pooled to one sample. Shrimp were caught from the feeding trays
or casting nets and carried in sterile plastic bags to avoid cross-
contamination. Samples were immediately transported to the
laboratory in coolers at 4 to 8uC. If shrimp of one pond were
positive for Vibrio spp., the whole farm was reported as positive
for Vibrio spp.
To characterize environmental and production factors, water
pH (pH-Meter, Hanna Instruments, Smithfield, RI) and water
salinity (Salinity Refractometer S/Mill-E, Atago, Tokyo, Japan) of
the corresponding ponds were tested at sampling. Inquiries were
made regarding stocking density (number of postlarvae per square
meter) and use of probiotics at each farm.
Bacterial isolation and characterization. Bacteriological
analysis was carried out within 3 h after collection. Whole shrimp
(100-g sample pooled from an individual pond) were blended by a
sterile stainless steel commercial blender (Ivory, Gandimathi, India).
From homogenates, 25 g was enriched in 225 ml of alkaline peptone
water (Merck, Darmstadt, Germany) containing 2% NaCl (pH 8.6)
and was incubated at 37uC for 24 h. After enrichment, thiosulfate
citrate bile salt sucrose agar (BD Difco, Le Pont de Claix, France)
was used for cultivation, and cultures were incubated at 37uC for
24 h. Four to five presumptive colonies were transferred to lysogeny
broth agar (Merck) containing 1% NaCl (pH 7.5) and were
1847
incubated at 37uC for 24 h. After incubation, isolated colonies were
Gram stained and tested for oxidase and motility.
Vibrio spp. confirmation by multiplex PCR. After DNA
extraction (boiling method), a multiplex PCR was performed based
on protocols previously described (13, 33). Primers for the
detection of V. cholerae, V. parahaemolyticus, and V. vulnificus
are described by Tarr et al. (33); primers for the detection of V.
alginolyticus were used according to Di Pinto et al. (13). V.
cholerae was additionally verified by ompW detection according to
the protocol described by Nandi et al. (23). Primers are shown in
Table 1.
Molecular characterization. Following species identifica-
Downloaded from http://meridian.allenpress.com/jfp/article-pdf/75/10/1846/1686186/0362-028x_jfp-12-115.pdf by Brazil user on 06 January 2023
tion, Vibrio isolates were characterized in detail by molecular
methods. Detection of virulence-associated tdh and trh genes in V.
parahaemolyticus was performed by PCR according to Honda and
Iida (16). As control strains, V. parahaemolyticus DSM10027
(ATCC 17802) and V. parahaemolyticus RIMD 2210633 were
used. V. cholerae O1 and O139 serogrouping was carried out using
the protocol and primers described by Rivera et al. (27). In
addition, ctxA detection was performed (20). For that, V. cholerae
1360 and V. cholerae 1576 were used as control strains (3). To
detect potential virulence factors in V. vulnificus isolates, pilF, vcg,
and 16S rRNA genes were analyzed. Polymorphism of the pilF
gene has been suggested to correlate with serum resistance, a
potential virulence factor of V. vulnificus (29). The gene pilF
(required for pilus type IV assembly) was amplified with the
primers PilFF and PilFR (29), yielding a 917-bp fragment carrying
the whole pilF gene. The fragment was sequenced with internal
primers VvPil-F2 and VvPilF-R2 deduced from pilF sequences
(accession FJ756476). The 16S rRNA genotype has been
implicated as a marker for clinical strains of V. vulnificus (34). A
real-time PCR was performed according to Vickery et al. (34) to
discriminate between 16S rRNA genotype A and B. The vcg
(virulence correlated gene) locus has been suggested to differen-
tiate between environmental isolates and clinical isolates of V.
vulnificus (30, 31). The vcg C-type allele correlates with strains of
clinical origin, and the E-type correlates with strains of
environmental origin. PCR primers that distinguish between the
two groups have been published previously (31). The primer pair
P1-P3 was used for the vcg C-type allele and the pair P2-P3 for the
E-type. PCR was performed as described by Rosche et al. (31). All
primers used in the assays are summarized in Table 1.
RESULTS AND DISCUSSION
In almost all shrimp farms (53 of 54), Vibrio spp. were
detectable in shrimp samples. At the farm level, the highest
prevalence was found for V. parahaemolyticus (98.1%),
followed by V. alginolyticus (34.6%), V. cholerae non-O1/
non-O139 (13.5%), and V. vulnificus (7.4%). The high
Vibrio farm prevalence corresponds to similar studies
carried out in South East Asia (15). During our study
period, unusually heavy rains and floods prevailed, which
lowered the salinity of the lagoon water and, additionally,
prevented the farmers from changing pond water. This could
have increased organic material within the ponds by
accumulation of feed waste and fecal matters. Both factors
(low salinity, high nutrient concentration) usually favor the
growth of Vibrio spp. (7).
At the pond level (n ~ 170), 95.1% of the ponds were
positive for Vibrio spp. V. parahaemolyticus was predom-
1848 KORALAGE ET AL. J. Food Prot., Vol. 75, No. 10

TABLE 1. Primers and probes used for molecular characterization of Vibrio spp.
Primer Sequence (59 to 39) Target/utility (species)a Reference

Vc-sodB-F AAGACCTCAACTGGCGGTA sodB (Vc) 33

Vc-sodB-F GAAGTGTTAGTGATCGCCAGAGT
VA-F CGAGTACAGTCACTTGAAAGC Collagenase (E03106) (Va) 13
VA-R CACAACAGAACTCGCGTTACC
Vp.flaE-79F GCAGCTGATCAAAACGTTGAGT flaE (Vp) 33
Vp.flaE-934R ATTATCGATCGTGCCACTCAC
Vv.hsp-326F GTCTTAAAGCGGTTGCTGC hsp60 (Vv) 33
Vv.hsp-697R CGCTTCAAGTGCTGGTAGAAG
ompW-F CACCAAGAAGGTGACTTTATTGTG ompW (Vc) 23
ompW-R GAACTTATAACCACCCGCG
Tdh-F GTAAAGGTCTCTGACTTTTGGAC tdh (Vp) 16

Downloaded from http://meridian.allenpress.com/jfp/article-pdf/75/10/1846/1686186/0362-028x_jfp-12-115.pdf by Brazil user on 06 January 2023

Tdh-R TGGAATAGAACCTTCATCTTCACC
Trh-F TTGGCTTCGATATTTTCAGTATCT trh (Vp) 16
Trh-R CATAACAAACATATGCCCATTTCCG
VCO1F2 CAACAGAATAGACTCAAGAA O1 serogroup (Vc) 27
VCO1R2 TATCTTCTGATACTTTTCTAC
VCO139F2 TTACCAGTCTACATTGCC O139 serogroup (Vc) 27
VCO139R2 CGTTTCGGTAGTTTTTCTGG
ctxA-F CTCAGACGGGATTTGTTAGGCACG ctxA (Vc) 20
ctxA-R TCTATCTCTGTAGCCCCTATTACG
PilFF CGATTGGTAGGCAATAGAC pilF (Vv) primers for amplification 29
PilFR GCAACTCAACCTCAAGACG
VvPil-F2 AGGCCAAGCACAAAAAGATCC pilF (Vv) sequencing primers This work
VvPilF-R2 TTCACCAGCGCCACATTACC
Vvu16S51-F CAAGTCGAGCGGCAGCA 16S rRNA (Vv) 34
Vvu16S221-R TCCTGACGCGAGAGGCC
Vvu16SA-P FAM-TGATAGCTTCGGCTCAA-MGB 16S rRNA (Vv) genotype A 34
Vvu16SB-P VIC-CCCGTAGGCATCATGC-MGB 16S rRNA (Vv) genotype B
P1 AGCTGCCGATAGCGATCT vcg C-type allele (Vv) 31
P2 CTCAATTGACAATGATCT vcg E-type allele (Vv)
P3 CGCTTAGGATGATCGGTG Reverse primer for both vcg alleles
a
Vc, V. cholera; Va, V. alginolyticus; Vp, V. parahaemolyticus; Vv, V. vulnificus.

inant, accounting for 91.2%, followed by V. alginolyticus
(18.8%), V. cholerae non-O1/non-O139 (4.1%), and V.
vulnificus (2.4%) (Table 2). Multiple Vibrio spp. were
detectable in 20.6% of the ponds. Most studies demonstrated
a predominance of V. alginolyticus in shrimp or seafood
samples (10, 15), but Chen et al. (8) found V. parahaemo-
lyticus to be the predominant Vibrio sp. in seafood, in
accordance with our data.
A pH of 7.5 to 8.5 in water is considered optimal for the
growth of Vibrio spp. (1). Of the tested ponds, 57.1%
showed a pH in that range, and 42.9% had a pH .8.5.
Water with maximum salinity of 10 ppt allows growth of
V. cholerae, V. parahaemolyticus, and V. vulnificus (17).
Salinity in 46.5% of the ponds ranged from 0 to 10 ppm,
and 53.5% showed a salinity of .10 ppm. Age at sampling
was divided into two strata, with the age of 110 days chosen
as the cut-off point, following Munasinghe et al. (22). The
age of 62.3% of shrimp at sampling was ,110 days; 37.7%
of the shrimp were older when sampled. In 78.2% of the
samples, the weight of individual shrimp was $15 g; and, in
21.8%, the weight was ,15 g. Farmers reported probiotic
use in 40.6% of the ponds. All farmers claimed that they
were not using antimicrobials. In 68.9% of the ponds,
the stocking density was 15 to 25 postlarvae per m2; in

TABLE 2. Prevalence of Vibrio spp. in preharvest shrimp in the North Western Province, Sri Lanka
No. of positive ponds (% prevalence)

Region V. parahaemolyticus V. alginolyticus V. cholerae non-O1/non-O139 V. vulnificus

Chillaw 13/15 (86.7) 2/15 (13.3) 4/15 (26.7) 3/15 (20)

Mundalama 17/17 (100) 2/17 (11.7) 0/17 (0) 1/17 (5.8)
Madurankuliya 21/22 (95.5) 4/22 (18.2) 1/22 (4.5) 0/22 (0)
Kalpitiya 24/28 (85.7) 11/28 (39.3) 0/28 (0) 0/28 (0)
Puttalam 3/15 (20) 13/88 (14.7) 2/88 (2.3) 0/88 (0)
Total 155/170 (91.2) 32/170 (18.8) 7/170 (4.1) 4/170 (2.4)
J. Food Prot., Vol. 75, No. 10 VIBRIO SPP. IN SHRIMP PREVALENCE AND CHARACTERISTICS
31.2%, the stocking density was lower than 15 postlarvae
per m2. The prevalences of different Vibrio spp. were not
related to differences in salinity or pH of pond water.
Neither application of probiotics nor differences in stocking
density, weight, or age at sampling influenced the Vibrio
spp. prevalences significantly (data not shown).
No tdh/trh genes were detectable in the isolated V.
parahaemolyticus strains (n ~ 419). This is in agreement
with most studies that detected zero or very low (1 to 3%)
prevalences of tdh/trh in environmental and seafood-related
strains (15, 24). Nonetheless, using molecular methods such
as colony hybridization, DePaola et al. (12) and Nordstrom
and DePaola (26) achieved a higher detection rate of
pathogenic V. parahaemolyticus compared with detection
rates generated by the traditional streak plating method.
Thus, our approach might have underestimated the true
prevalence of pathogenic V. parahaemolyticus.
The presence of V. cholerae in shrimp cultures cannot
be avoided as it belongs to the natural microflora of the
estuarine waters (4, 11). V. cholerae has been identified
in environmental samples, including shrimp, sediment,
feed, and pond water from Sri Lanka (18), India (15),
and Thailand (11). Most of these studies reported low
prevalences, which is in agreement with our results. In our
study, serogrouping by PCR revealed that all V. cholerae
strains (n ~ 8) were non-O1/non-139. All these isolates
were negative for the ctxA gene. The detection of only V.
cholerae non-O1/non-O139 strains is consistent with
previous reports showing that most V. cholerae strains
isolated from environmental and seafood sources are non-
O1/non-O139 and that over 95% of the strains of these
serogroups are ctx-negative (15, 24).
V. vulnificus prevalence was low in shrimp at the pond
(2.4%) and farm (7.4%) level. These data are supported by
results from India (15). That study also detected a low
prevalence (1 to 4%) of V. vulnificus in shrimp culture
environments. All four V. vulnificus strains isolated in our
study from different farms of two geographical regions
(Chillaw and Mundalama) may be potentially pathogenic to
humans. The pilF sequencing revealed that all four strains
harbored a pilF gene that possesses a short sequence
between positions 536 and 566 of the coding sequence; this
has been associated with resistance against the bactericidal
activity of human serum and is considered to be a potential
virulence factor (29). All four V. vulnificus strains belong to
the 16S rRNA genotype B, an allele which, for reasons not
currently understood, is mostly associated with clinical
strains. Vickery et al. (34) speculated that strains possessing
type B allele might express a different set of virulence
determinants than those of type A allele. All four V.
vulnificus strains were positive for vcgC by PCR assay and
negative for vcgE, thus corroborating previous results
suggesting that the four strains might be of clinical
significance (30). As previously reported, 90% of isolates
from human cases carry the vcgC sequence type, whereas
87% of environmental strains have the vcgE variant (2, 31).
While approximately equal numbers of vcgC and vcgE
genotypes occur in estuarine waters, the vcgE genotype
predominates significantly in oysters in those waters (35).
1849
Despite the high prevalence of Vibrio spp. in shrimp
cultures, the tested virulence factors for V. parahaemolyti-
cus and V. cholerae were absent. Nonetheless, tdh/
trh-negative V. parahaemolyticus and ctx-negative V.
cholerae can cause mild gastroenteric diseases. Even though
the prevalence of V. vulnificus was very low, all four V.
vulnificus strains isolated in our study from shrimp harbored
potential virulence factors. To minimize the potential risk of
Vibrio infections due to handling or consumption of raw or
undercooked seafood products, good manufacturing practice
as well as proper handling and processing should be
addressed.
Downloaded from http://meridian.allenpress.com/jfp/article-pdf/75/10/1846/1686186/0362-028x_jfp-12-115.pdf by Brazil user on 06 January 2023
ACKNOWLEDGMENTS
Authors are grateful to M. Tongkorn, Faculty of Veterinary Medicine,
Chiang Mai University, Thailand, and J. K. H. Ubeyratne, Veterinary
Research Institute, Peradeniya, Sri Lanka, for their technical assistance.
Financial support was received from the German Academic Exchange
Service, the German Federal Ministry of Education and Research
(VibrioNet project no. 01KI1015D), and the Rockefeller Foundation.
REFERENCES
1. Aberoumand, A. 2010. Occurrence and characterization of potentially
pathogenic Vibrio species in seafood products and mariculture
systems. World J. Fish Mar. Sci. 2:376–382.
2. Baker-Austin, C., E. Lemm, R. Hartnell, J. Lowther, R. Onley, C.
Amaro, J. D. Oliver, and D. Lees. 2012. pilF polymorphism-based
real-time PCR to distinguish Vibrio vulnificus strains of human health
relevance. Food Microbiol. 30:17–23.
3. Beutin, L., L. Bode, T. Richter, G. Peltre, and R. Stephan. 1984.
Rapid visual detection of Escherichia coli and Vibrio cholerae heat-
labile enterotoxins by nitrocellulose enzyme-linked immunosorbent
assay. J. Clin. Microbiol. 19:371–375.
4. Bhaskar, N., and T. M. R. Setty. 1994. Incidence of vibrios of public
health significance in the farming phase of tiger shrimp (Penaeus
monodon). J. Sci. Food Agric. 66:225–231.
5. Cabanillas-Beltran, H., E. Llausas-Magana, R. Romero, A. Espinoza,
A. Garcia-Gasca, M. Nishibuchi, M. Ishibashi, and B. Gomez-Gil.
2006. Outbreak of gastroenteritis caused by the pandemic Vibrio
parahaemolyticus O3:K6 in Mexico. FEMS Microbiol. Lett. 265:
76–80.
6. Cabello, F. C., R. T. Espejo, M. C. Hernandez, M. L. Rioseco, J.
Ulloa, and J. A. Vergara. 2007. Vibrio parahaemolyticus O3:K6
epidemic diarrhea, Chile, 2005. Emerg. Infect. Dis. 13:655–656.
7. Caburlotto, G., B. J. Haley, M. M. Lleo, A. Huq, and R. R. Colwell.
2010. Serodiversity and ecological distribution of Vibrio parahae-
molyticus in the Venetian Lagoon, Northeast Italy. Environ.
Microbiol. Rep. 2:151–157.
8. Chen, W. Y., S. J. Yu, C. X. Zhang, J. L. Zhang, C. L. Shi, Y. Hu,
B. A. Suo, H. A. Cao, and X. M. Shi. 2011. Development of a single
base extension-tag microarray for the detection of pathogenic Vibrio
species in seafood. Appl. Microbiol. Biotechnol. 89:1979–1990.
9. Chitov, T., P. Kirikaew, P. Yungyune, N. Ruengprapan, and K.
Sontikun. 2009. An incidence of large foodborne outbreak associated
with Vibrio mimicus. Eur. J. Clin. Microbiol. Infect. Dis. 28:421–424.
10. Chitov, T., S. Wongdao, W. Thatum, T. Puprae, and P. Sisuwan.
2009. Occurrence of potentially pathogenic Vibrio species in raw,
processed, and ready-to-eat seafood and seafood products. Maejo Int.
J. Sci. Technol. 3:88–98.
11. Dalsgaard, A., H. H. Huss, A. H. Kittikun, and J. L. Larsen. 1995.
Prevalence of Vibrio cholerae and Salmonella in a major shrimp
production area in Thailand. Int. J. Food Microbiol. 28:101–113.
12. DePaola, A., J. L. Nordstrom, J. C. Bowers, J. G. Wells, and D. W.
Cook. 2003. Seasonal abundance of total and pathogenic Vibrio
parahaemolyticus in Alabama oysters. Appl. Environ. Microbiol. 69:
1521–1526.
1850 KORALAGE ET AL.
13. Di Pinto, A., G. Ciccarese, G. Tantillo, D. Catalano, and V. T. Forte.
2005. A collagenase-targeted multiplex PCR assay for identification
of Vibrio alginolyticus, Vibrio cholerae, and Vibrio parahaemolyti-
cus. J. Food Prot. 68:150–153.
14. Faruque, S. M., N. Chowdhury, M. Kamruzzaman, M. Dziejman,
M. H. Rahman, D. A. Sack, G. B. Nair, and J. J. Mekalanos. 2004.
Genetic diversity and virulence potential of environmental Vibrio
cholerae population in a cholera-endemic area. Proc. Natl. Acad. Sci.
USA 101:2123–2128.
15. Gopal, S., S. K. Otta, S. Kumar, I. Karunasagar, M. Nishibuchi, and I.
Karunasagar. 2005. The occurrence of Vibrio species in tropical
shrimp culture environments; implications for food safety. Int. J.
Food Microbiol. 102:151–159.
16. Honda, T., and T. Iida. 1993. The pathogenicity of Vibrio
parahaemolyticus and the role of the thermostable direct haemolysin
and related haemolysins. Rev. Med. Microbiol. 4:106–113.
17. Huss, H. H., L. Ababouch, and L. Gram. 2003. Assessment and
management of seafood safety and quality. FAO Fisheries technical
paper no. 444. Food and Agriculture Organization, Rome.
18. Jayasinghe, C. V. L., S. B. N. Ahmed, and M. G. I. U. Kariyawasam.
2008. The isolation and identification of Vibrio species in marine
shrimps of Sri Lanka. J. Food Agric. 1:36–44.
19. Jones, M. K., and J. D. Oliver. 2009. Vibrio vulnificus: disease and
pathogenesis. Infect. Immun. 77:1723–1733.
20. Keasler, S. P., and R. H. Hall. 1993. Detecting and biotyping Vibrio
cholerae-O1 with multiplex polymerase chain reaction. Lancet 341:
1661.
21. Lesmana, M., D. S. Subekti, P. Tjaniadi, C. H. Simanjuntak, N. H.
Punjabi, J. R. Campbell, and B. A. Oyofo. 2002. Spectrum of vibrio
species associated with acute diarrhea in North Jakarta, Indonesia.
Diagn. Microbiol. Infect. Dis. 43:91–97.
22. Munasinghe, M. N., C. Stephen, P. Abeynayake, and I. S.
Abeygunawardena. 2010. Shrimp farming practices in the Puttallam
district of Sri Lanka: implications for disease control, industry
sustainability, and rural development. Vet. Med. Int. 2010:1–7.
23. Nandi, B., R. K. Nandy, S. Mukhopadhyay, G. B. Nair, T. Shimada,
and A. C. Ghose. 2000. Rapid method for species-specific
identification of Vibrio cholerae using primers targeted to the gene
of outer membrane protein OmpW. J. Clin. Microbiol. 38:4145–
4151.
24. Nigro, O. D., A. Hou, G. Vithanage, R. S. Fujioka, and G. F.
Steward. 2011. Temporal and spatial variability in culturable
pathogenic Vibrio spp. in Lake Pontchartrain, Louisiana, USA,
J. Food Prot., Vol. 75, No. 10
following Hurricanes Katrina and Rita. Appl. Environ. Microbiol. 77:
5384–5393.
25. Nishibuchi, M., and J. B. Kaper. 1995. Thermostable direct
hemolysin gene of Vibrio parahaemolyticus: a virulence gene
acquired by a marine bacterium. Infect. Immun. 63:2093–2099.
26. Nordstrom, J. L., and A. DePaola. 2003. Improved recovery of
pathogenic Vibrio parahaemolyticus from oysters using colony
hybridization following enrichment. J. Microbiol. Methods 52:
273–277.
27. Rivera, I. N. G., E. K. Lipp, A. Gil, N. Choopun, A. Huq, and R. R.
Colwell. 2003. Method of DNA extraction and application of
multiplex polymerase chain reaction to detect toxigenic Vibrio
cholerae O1 and O139 from aquatic ecosystems. Environ. Microbiol.
5:599–606.
28. Robert-Pillot, A., A. Guenole, J. Lesne, R. Delesmont, J. M. Fournier,
and M. L. Quilici. 2004. Occurrence of the tdh and trh genes in
Downloaded from http://meridian.allenpress.com/jfp/article-pdf/75/10/1846/1686186/0362-028x_jfp-12-115.pdf by Brazil user on 06 January 2023
Vibrio parahaemolyticus isolates from waters and raw shellfish
collected in two French coastal areas and from seafood imported into
France. Int. J. Food Microbiol. 91:319–325.
29. Roig, F. J., E. Sanjuan, A. Llorens, and C. Amaro. 2010. pilF
polymorphism-based PCR to distinguish Vibrio vulnificus strains
potentially dangerous to public health. Appl. Environ. Microbiol. 76:
1328–1333.
30. Rosche, T. M., E. A. Binder, and J. D. Oliver. 2010. Vibrio vulnificus
genome suggests two distinct ecotypes. Environ. Microbiol. Rep. 2:
128–132.
31. Rosche, T. M., Y. Yano, and J. D. Oliver. 2005. A rapid and simple
PCR analysis indicates there are two subgroups of Vibrio vulnificus
which correlate with clinical or environmental isolation. Microbiol.
Immunol. 49:381–389.
32. Serracca, L., R. Battistini, I. Rossini, M. Prearo, D. Ottaviani, F. Leoni,
and C. Ercolini. 2011. Vibrio virulence genes in fishes collected from
estuarine waters in Italy. Lett. Appl. Microbiol. 53:403–408.
33. Tarr, C. L., J. S. Patel, N. D. Puhr, E. G. Sowers, C. A. Bopp, and
N. A. Strockbine. 2007. Identification of Vibrio isolates by a
multiplex PCR assay and rpoB sequence determination. J. Clin.
Microbiol. 45:134–140.
34. Vickery, M. C., W. B. Nilsson, M. S. Strom, J. L. Nordstrom, and A.
DePaola. 2007. A real-time PCR assay for the rapid determination of
16S rRNA genotype in Vibrio vulnificus. J. Microbiol. Methods 68:
376–384.
35. Warner, E., and J. D. Oliver. 2008. Population structures of two
genotypes of Vibrio vulnificus in oysters (Crassostrea virginica) and
seawater. Appl. Environ. Microbiol. 74:80–85.