The Effect of Acmsd Gene Overexpression in The

Kynurenine Pathway On The Expression Levels of

Ido1 and Ifn-γ in Inflammatory Conditions: An In
Vitro Study
Marzieh Rostaminejad
Shiraz University of Medical Sciences
Abdolmohamad Rostami
Thomas Jefferson University - Center City Campus: Thomas Jefferson University
Abbas Behzad-Behbahani
Shiraz University of Medical Sciences
Gholam Reza Rafiei Dehbidi
Shiraz University of Medical Sciences
Tahereh Kalantari (  kalantari.taahereh@gmail.com )
Shiraz University of Medical Sciences https://orcid.org/0000-0002-3602-7710

Research Article

Keywords: Acmsd, Ido1, kynurenine pathway, neurodegenerative diseases

Posted Date: September 9th, 2021

DOI: https://doi.org/10.21203/rs.3.rs-834721/v1

License:   This work is licensed under a Creative Commons Attribution 4.0 International License.
Read Full License

Page 1/15
Abstract
The kynurenine pathway (KP) can be involvement of in the pathogenesis of neurodegenerative diseases
and excessive neurotoxic metabolite production. The aim of this study was to evaluate the effects of
overexpression of murine 2-amino-3-carboxymuconate-6-semialdehyde decarboxylase (Acmsd) gene in
inflammatory conditions in RAW 264.7 cell line learn more about the effect of this gene on inflammatory
conditions and the KP cycle. The coding sequence of the Acmsd gene was cloned into pCMV6-AC-IRES-
GFP expression vector with a green fluorescent protein (GFP) marker. In order to simulate inflammatory
conditions, RAW 264.7 macrophage cells were stimulated by Lipopolysaccharide (LPS) 24 hours before
transfection, and transfected by Polyethyleneimine (PEI) with constructed plasmids expressing the
Acmsd gene. The effect of Acmsd gene expression level on murine Interferon-gamma (Ifn-γ) and
Indoleamine 2,3-dioxygenase 1 (Ido1) gene expression level was investigated by Real-Time PCR.
According to the results of this study, good transfection efficiency was observed after 72 hours, and
Acmsd expression level increased 29-fold (P < 0.001) in transfected LPS-stimulated cells compared to the
control group (LPS-stimulated cells that were not transfected). Additionally, increased Acmsd expression
level significantly down-regulated Ifn-γ (P < 0.001) and Ido1 (P < 0.01) expression level in transfected LPS-
stimulated cells compared to LPS-stimulated cells. In conclusion, Acmsd overexpression in inflammatory
conditions can be reduced the expression levels of Ido1 gene, and its regulator, Ifn-γ. Consequently, it may
be considered as a novel regulatory factor in the KP pathway.

1. Introduction
The kynurenine pathway (KP) in mammalian cells plays a major role in tryptophan (TRP) catabolism and
approximately 95% of TRP degradation occurs by KP [1]. This pathway begins with the oxidation of L-
tryptophan to N-formylkynurenine by one of three enzymes: Indoleamine 2,3-dioxygenase 1 (IDO1),
Indoleamine 2,3-dioxygenase 2 (IDO2), or tryptophan 2,3-dioxygenase (TDO2) [2, 3]. IDO1 is one of the KP
rate- restricting enzymes that lipopolysaccharides (LPS) and especially interferon gamma (IFN-γ) can
regulate in inflammatory conditions [4, 5]. Then, N-formylkynurenine is converted to kynurenine (KYN) by
formamidase. The KYN breakdown process is performed by three different enzymes. KYN is converted to
Kynurenic acid (KYNA) by Kynurenine aminotransferases (KAT I, II, III), a neuro-protective metabolite. Also,
KYN can be converted to 3-Hydroxykynurenine (3-HK), a neuronal metabolite, by Kynurenine
monooxygenase (KMO). In another branch, KYN is converted to anthranilic acid (AA) by a kynureninase
(KYNU). 3-HK to 3-Hydroxyanthranilic acid (3-HAA), another neurotransmitter KP, is produced by KYNU. 3-
HAA can also be produced from AA oxidation on the other branch of KP. 3-HAA is transformed into 2-
amino-3-carboxymuconate semialdehyde (ACMS), which is converted to two final principal metabolites of
KP, by 3-Hydroxyanthranilate dioxygenase (3-HAO). ACMS is converted by a spontaneous reaction to
Quinolinic acid (QUIN), which is a neurotoxic metabolite and an N-methyl-D-aspartate receptor (NMDA)
agonist. ACMS can be converted by 2-amino-3-carboxymuconate-6-semialdehyde decarboxylase
(ACMSD) to Picolinic acid (PIC), which is a neuro-protective metabolite. Finally, QUIN is converted by

Page 2/15
Quinolinate phosphoribosyltransferase (QPRT) to nicotinamide adenine dinucleotide (NAD+) [1, 6].
(Fig. 1)

The KP pathway can lead to the formation of active neuronal metabolites that can play an important role
in neural pathways, neuroprotection, or immune modulation [7, 8]. KP is a major regulator of the immune
system and is an effective mechanism in reducing immune responses and stimulating immune tolerance
[9, 10]. The enhancement of IDO1 can lead to reduce T helper type 1 (Th1) cell proliferation and induce
differentiation of regulatory T cells (Treg) [9]. Some studies have shown that activation of IDO1 in human
macrophages with an inflammatory cytokine such as IFN-γ leads to the pathophysiological concentration
of QUIN as a neurotoxic and gliotoxic KP metabolite [11–13]. In recent years, studies have shown that the
KP is implicated in Neurodegenerative disorders pathogenesis and Multiple sclerosis (MS).
Neurodegenerative disorders are comprised of Alzheimer’s disease (AD), Parkinson’s disease (PD),
Huntington’s disease (HD), and Amyotrophic lateral sclerosis (ALS) [7, 8, 14]. Impaired balance of
neurotransmitters in KP may lead to nerve damage and decreased neurogenesis in the brain [15].
Accordingly, returning the balance of TRP and its metabolites to normal often leads to a reduction in
disease progression [16, 17]. The control of KP enzymes, which play a major part in the production of
neurotoxic and neuroprotective metabolites, is hence essential for the exacerbation or improvement of
these diseases [18]. Because these diseases are incurable and there are only symptomatic treatments for
them [19], further studies on new therapies, including overexpression or inhibition of KP enzymes, could
offer new approaches to the current treatment of these diseases [17]. Accordingly, since ACMSD plays a
key role in the production of PIC or NAD + through QUIN synthesis, it can therefore be very biomedically
important [20, 21]. In this study, we focused on the overexpression of the murine Acmsd gene and
investigated its effect on inflammatory conditions, when KP is activated, by measuring murine Ido1 and
its regulator, Ifn-γ, in macrophage cells.

2. Materials And Methods

2.1 Synthesis of Acmsd gene
The coding sequence (CDS) of the Acmsd gene containing 1010 nucleotides was synthesized by
ShineGene (China). This sequence also contained the BamHI and XbaI restriction enzyme sites and was
eventually cloned into the pUC57 vector.

2.2 Polymerase Chain Reaction (PCR) for amplification of

Acmsd gene
To amplify the Acmsd gene, specific primers with suitable restriction sites for BamHI and XbaI restriction
enzymes were designed following sequences using Oligo Primer Analysis Software version 7 (Molecular
Biology Insights, Colorado, USA) and synthesized by SinaClon co. (Tehran, Iran) (Table 1).

Page 3/15
 Table 1
primer sequences and PCR condition of Acmsd gene.
Gene Primer sequences (5’to 3’) PCR condition Product size

Acmsd F:CGGGCACGGGATCCATGAAAATTGAC 95°C: 15 min 1073bp

95°C: 15 sec

60°C: 45 sec

R:GACTGCCTCTAGATTATTCAAATAGTTTTCTCTC 72°C: 1 min

72°C: 5 min
Hold 20°C

2.3 Cloning of Acmsd gene

In order to clone the Acmsd gene, pUCm-T Cloning Vector Kit (Bio Basic, Canada) was used. Next, the
Acmsd gene was cloned into the expression plasmid vector pCMV6-AC-IRES-GFP (OriGene, USA) using
the BamHI and XbaI restriction enzymes (Jena Bioscience, Germany) and T4 DNA ligase. Final
confirmation was performed by restriction enzyme digestion, clony PCR and Sanger sequencing.
2.4 Cell line and cell culture
RAW 264.7 cell line (Pasture Institute, Tehran, Iran) was cultured in high glucose Dulbecco`s Modified
Eagle Media (DMEM) supplemented with 10% fetal bovine serum (Gibco, Thermo Fisher Scientific, USA),
100 IU/ml penicillin, and 100 µg/ml streptomycin (Gibco, Thermo Fisher Scientific, USA), and 2mM L-
glutamine (Gibco, Thermo Fisher Scientific, USA) and incubated at 37°C and 5% CO2. To induce
inflammation in RAW 264.7 cell line, 1 µg/ml of Lipopolysaccharide (LPS) (Sigma-Aldrich, USA) was
added to the culture medium and incubated for 24 hours at 37°C and 5% CO2. RAW 264.7 is a murine
macrophage lineage that expresses all the KP enzymes [22].

2.5 Transfection
The cells were seeded onto six-well plates at a density of 1 × 106 cells per well and transfected with
pCMV6-AC-IRES-GFP and pEGFP-C1 (Addgene, USA) control vector by Polyethylenimine (PEI). For this
purpose, 10 µl of PEI 25 kDa (1 mg/ml) (Sigma-Aldrich, USA) and 2.5 µg of plasmid DNA were diluted in
250 µl DMEM media separately and placed for 10 minutes at room temperature. The DNA and PEI were
combined and incubated for an extra 30 minutes at room temperature to form a complex. The media
were replaced with 2 ml of fresh media, and the DNA/PEI mixtures were added to all over the surfaces of
the wells. 6-well plates were, maintained at 37°C and 5% CO2 for 4 hours. After that, 2 ml of pre-warmed
complete medium were added to each well. The ratio of PEI nitrogen residues to DNA phosphate residues
(N/P) was 4:1. After 72 hours, the approximate transfection efficiency was estimated using a
fluorescence microscope.
2.6 Quantitative Real-Time PCR (qPCR)
Page 4/15
Total RNA was extracted using an RNX-plus solution (SinaClon, Iran) in accordance with the
manufacturer’s instructions. Next, first-strand cDNA was synthesized using (Thermo Fisher Scientific,
Lithuania) and used as a template for a reverse transcription-PCR (Table 2). All reactions were performed
in triplicate, and results were normalized to Beta-actin (internal control) using the comparative Ct method
to correct RNA input in reactions, with non-template control for each gene.

Table 2
qPCR reactions on cells that were not treated by LPS, LPS-
stimulated cells, and transfected LPS-stimulated cells to
determine the expression of Ifn-γ, Ido1, and Acmsd genes
Gene Primer sequences (5’to 3’) qPCR condition

Ifn-γ F:CTCTTCCTCATGGCTGTTTC 95°C: 90 sec

R:TCACCATCCTTTTGCCAGTT 95°C: 5 sec

Ido1 F:AAAGCAATCCCCACTGTATC 59°C: 30 sec

R:CCACAAAGTCACGCATCCTC 72°C: 30 sec

Acmsd F:CAACAGCAAGGCAAGGGAGA Hold 4°C

R:GAACTGTGGAAAGAGCTTGG

2.7 Statistical analysis

Statistical data were reported as mean ± standard deviation (SD). qPCR data were analyzed using Prism
8.3 (GraphPad Software, USA) and One-way ANOVA test. Differences were viewed as statistically
significant at P ≤ 0.05. ** P < 0.01, *** P < 0.001.

3. Results
3.1 PCR amplification of Acmsd gene
PCR amplification was performed on pUC57/Acmsd extracted plasmids using specific primers to amplify
a 1037 bp DNA fragment containing Acmsd fragment and restriction enzyme cutting sites. 0.5 µM of
each primer was added to a mixture containing Hot-start Taq DNA polymerase. After the PCR reaction
was done, a 1037 bp band was observed on a 1% agarose gel electrophoresis (Fig. 2).

3.2 Cloning confirmation

The cloned vector was transformed into the Escherichia coli DH5α and a colony PCR method was
performed to confirm the positive colonies (Fig. 3a). Following plasmid extraction, pCMV6-AC-IRES-GFP
plasmids were digested by BamHI and XbaI restriction enzymes and 1010bp fragments of Acmsd gene
were observed on the gel electrophoresis (Fig. 3b). Finally, Sanger sequencing was carried out to validate
the cloning results.
3.3 Transfection
Page 5/15
LPS-stimulated RAW 264.7 cells were transfected with pCMV6-AC-IRES-GFP expression vectors
containing the Acmsd gene, and pEGFP-C1 vectors as control. Accordingly, transfection efficiency was
measured by counting eGFP expressing cells, which revealed the efficiency to be approximately 60–70%
(72 hours after transfection). Unstimulated RAW 264.7 cells as control of transfection were transfected
with same protocol (Fig. 4).

3.4 Relation between Acmsd, Ifn-γ, and Ido1 genes

expression
To evaluate the effect of increasing Acmsd gene expression on the activity and expression of Ifn-γ and
Ido1 genes in RAW 264.7 stimulated RAW cells, the expression levels of these genes were analyzed by
qPCR with Beta-actin housekeeping gene as an internal control. The qPCR data analysis shows that the
expression levels of Ifn-γ and Ido1 genes were considerably increased in LPS-stimulated cells compared
with unstimulated cells (P < 0.001, and P < 0.01, respectively). Additionally, the expression levels of the
Acmsd gene were significantly decreased in LPS-stimulated cells compared with unstimulated cells (P <
0.001). After transfection, the results showed that the Acmsd expression levels increased 29-fold (P <
0.001) compared to control cells (LPS-stimulated cells). Increased Acmsd expression levels significantly
down-regulated Ifn-γ (P < 0.001) and Ido1 (P < 0.01) expression levels in transfected LPS-stimulated cells
compared to LPS-stimulated cells (Fig. 5).

4. Discussion
TRP is a vital amino acid, and KP results in approximately 95% breakdown of this amino acid.
Neuroactive metabolites of TRP degradation from the KP are concerned with the pathogenesis of a
variety of neurodegenerative disorders such as AD, PD, HD, ALS, as well as autoimmune disorders such as
MS [23]. Nowadays, due to the presence of numerous enzymes in the KP pathway, it has become an
attractive target for the development of new therapies in neurological disorders. KP enzymes are
important because they have located on the branch points of the KP and control neurotoxic and
neuroprotective metabolites production. At the onset of neurodegenerative disorders, plasma and
cerebrospinal fluid (CSF) levels of TRP are significantly reduced in patients, indicating KP activation in
these diseases, followed by a disturbance in the balance of TRP metabolites [7]. There are many studies
in the past decades to clarify the role of KP metabolites and enzymes in the pathogenesis of
neurodegenerative and autoimmune disorders [6, 24]. Accordingly, Heilman et al. (2020) showed that a
high QUIN / PIC ratio was strongly associated with an increase in symptoms in PD patients. They also
believe that the QUIN / PIC ratio is regulated by the Acmsd enzyme and that reducing Acmsd activity can
increase symptoms [25]. In 2013, Wu et al. indicated that the Acmsd enzyme leads to PIC production
instead of QUIN in the KP. They showed that increased levels of Acmsd expression increased PIC
expression in the cerebellum and hippocampus of triple-transgenic mice with Alzheimer's disease.
However, they found that these PIC levels were insufficient to prevent QUIN toxicity. [26]. Moreover, in
2012 Schwarcz et al. propounded that neuroprotective metabolites of KP, such as PIC and KYNA can
neutralize QUIN effects and therefore have neuroprotective properties [27].
Page 6/15
In the present study, we investigated ACMSD as the major enzyme in the metabolic regulation of the KP
pathway. Activation of the ACMSD enzyme leads to PIC conversion. PIC is an endogenous
neuroprotective metabolite and an NMDA receptor antagonist that prevents QUIN-induced neurotoxicity
[26, 28]. Based on literature reviews, the anti-inflammatory functions of PIC and KYNA have proven the
regulatory role of KP metabolites in inflammation and immune responses. KP metabolites can moderate
T cell functions by affecting through pro-inflammatory and anti-inflammatory cytokines. These
proceedings together modulate the immune responses in diverse inflammatory disorders, especially
neurodegenerative diseases [29]. Accordingly, ACMSD can be an attractive treatment option for treating or
improving neurodegenerative disorders by increasing neurotransmitters, particularly QUIN, and decreasing
the level of PIC as a neuroprotective metabolite [30]. This enzyme is the exclusively recognized enzyme
capable of turning ACMS to PIC production and prevent the accumulation of QUIN from ACMS, so the
ACMSD enzyme may contribute a major part to preventing the progression of diseases in which the KP is
active and worsens the disease. Therefore, more experiments are required to verify the function of the
ACMSD enzyme in ameliorating these disorders [20, 31]. To date, less importance has been given to KP
and its enzymatic activity than to the role and importance of ACMSD. Therefore, by measuring Ido1
inflammatory gene and Ifn-γ gene as its regulator, we investigated the effect of Acmsd gene expression
on inflammatory conditions and KP cycle. In inflammatory conditions, increased expression of IFN-γ,
followed by increased expression of IDO1, increases the KYN/TRP ratio, which indicates TRP
metabolism. Thus, in this conditions, the expression levels of IDO1 are significantly increased, which
activates the KP and disrupts the balance of neurotoxic and neuroprotective metabolites [23, 32] In this
regard, we examined the expression of Ifn-γ, Ido1 and Acmsd genes in RAW 264.7 unstimulated and LPS-
stimulated mouse cells. According to the results of this study, the expression of Ifn-γ and Ido1 genes in
LPS-stimulated cells was significantly increased compared to unstimulated cells, which indicates
inflammation in these cells. Accordingly, increasing the expression level of Ido1 leads to the degradation
of TRP and activation of the KP pathway. While Acmsd expression levels were significantly reduced in
LPS-stimulated cells compared to non-stimulated cells. Decreased ACMSD expression level due to ACMS
substrate accumulation leads to decreased PIC production and QUIN accumulation and finally indicates
that in inflammatory conditions the severity of the disease may increase with KP activation. A decrease in
ACMSD activity may therefore be neurotoxic [7, 33, 34]. As mentioned before, with the activation of the KP,
the balance of neurotoxic and neuroprotective metabolites is disturbed, and the disease progresses and
gets worse. However, if the balance of metabolites can be restored to normal with the enzymatic
manipulations along the pathway, or by affecting the pathway-starting enzymes, the over-activation of
the KP and the breakdown of TRP may be prevented. In these conditions, a reduction in disease
progression may be observed. Currently, one of the broadest therapeutic goals is to focus on KP pathway
enzymes. Most of the enzymes studied in previous studies included KMOs and KATs, and the ACMSD
enzyme has received less attention [19, 21]. ACMSD may have promising and important effects in two
ways in the course of diseases that are promoted by the KP. Firstly, by converting the ACMS to PIC it
prevents the overproduction of QUIN. Secondly, according to our results, increased Acmsd gene
expression led to decreased Ido1 gene expression and its regulator, Ifn-γ, which means that by decreasing
the Ido1 expression, less TRP is broken down. As a result, it may modulate the intense activity of the KP
Page 7/15
and imbalance of its metabolites. Therefore, in this current research, when we attempted to clarify the role
of Acmsd in inflammatory conditions, we found out overexpression of the Acmsd gene led to a down
regulation in Ifn-γ, and Ido1 expression levels, an important enzyme that causes KP activation and TRP
degradation in RAW 264.7 macrophage cells.

In conclusion, the findings of the present study showed that increasing the expression of Acmsd gene in
inflammatory conditions in macrophage cells leads to a decrease in the expression level of Ido1 and Ifn-γ
genes. The importance of these findings is important because, firstly, the decrease in Ifn-γ expression
indicates a decrease in inflammation in cells, and secondly, because Ifn-γ regulates Ido1 expression,
therefore the expression level of the Ido1 gene also decreases ifn- γ is reduced. Decreased Ido1
expression also reduces TRP degradation and less activation of the KP pathway, which is important in
neurological diseases.

Declarations
Authors’ Contributions

All authors participated in the initial design of the project. MR performed the experiments and prepared
the manuscript with TK. TK supervised the project. AMR, ABB, and MK provided technical helps. GhR
provided technical helps and supervised the experiments. All authors reevaluated the final manuscript
and agreed with this version of publication. None of the authors listed in this manuscript have been hired
by a government agency; all are academics. None of the authors submit this manuscript as an official
agent or on behalf of the government.

Compliance with ethical standards

Funding

This work was funded by Shiraz University of Medical Sciences grant number 97-16749 with the Ethics
committee reference number IR.SUMS.REC.1397.781.

Conflict of interest

The authors declare that there has no conflict of interest.

Acknowledgment

We extend our gratitude to the staff of the Diagnostic Laboratory Sciences and Technology Research
Center of the School of Paramedical Sciences, Shiraz University of Medical Sciences, for their constant
valuable supports and helpful advices.

Data availability

Page 8/15
All data used and/or analyzed during this current study are available from the corresponding author on
reasonable requests.

Ethical approval

This article does not contain any studies with human and animals performed by any of the authors.

References
1. Badawy AAB (2020) Kynurenine pathway and human systems. Exp Gerontol 129:110770.
https://doi.org/10.1016/j.exger.2019.110770
2. Badawy AA (2017) Kynurenine Pathway of Tryptophan Metabolism: Regulatory and Functional
Aspects. Int J Tryptophan Res 10:1178646917691938. https://doi.org/10.1177/1178646917691938
3. Vondroušová J, Mikoška M, Syslová K, Böhmová A, Tejkalová H, Vacek L et al (2019) Monitoring of
kynurenine pathway metabolites, neurotransmitters and their metabolites in blood plasma and brain
tissue of individuals with latent toxoplasmosis. J Pharm Biomed Anal 170:139–152.
https://doi.org/10.1016/j.jpba.2019.03.039
4. Bilir C, Sarisozen C (2017) Indoleamine 2,3-dioxygenase (IDO): Only an enzyme or a checkpoint
controller? Journal of Oncological Sciences 3:52–56. https://doi.org/10.1016/j.jons.2017.04.001
5. Yamamoto Y, Yamasuge W, Imai S, Kunisawa K, Hoshi M, Fujigaki H et al (2018) Lipopolysaccharide
shock reveals the immune function of indoleamine 2,3-dioxygenase 2 through the regulation of IL-
6/stat3 signalling. Sci Rep 8(1):15917. https://doi.org/10.1038/s41598-018-34166-4
6. Lovelace MD, Varney B, Sundaram G, Lennon MJ, Lim CK, Jacobs K et al (2017) Recent evidence for
an expanded role of the kynurenine pathway of tryptophan metabolism in neurological diseases.
Neuropharmacology 112(Pt B):373–388. https://doi.org/10.1016/j.neuropharm.2016.03.024
7. Lovelace MD, Varney B, Sundaram G, Franco NF, Ng ML, Pai S et al (2016) Current Evidence for a
Role of the Kynurenine Pathway of Tryptophan Metabolism in Multiple Sclerosis. Front Immunol
7:246. https://doi.org/10.3389/fimmu.2016.00246
8. Tan VX, Guillemin GJ (2019) Kynurenine Pathway Metabolites as Biomarkers for Amyotrophic
Lateral Sclerosis. Front Neurosci 13:1013. https://doi.org/10.3389/fnins.2019.01013
9. Van der Leek AP, Yanishevsky Y, Kozyrskyj AL (2017) The Kynurenine Pathway As a Novel Link
between Allergy and the Gut Microbiome. Front Immunol 8:1374.
https://doi.org/10.3389/fimmu.2017.01374
10. Mellor AL, Lemos H, Huang L (2017) Indoleamine 2,3-Dioxygenase and Tolerance: Where Are We
Now? Front Immunol 8:1360. https://doi.org/10.3389/fimmu.2017.01360
11. Heyes MP, Chen CY, Major EO, Saito K. Different kynurenine pathway enzymes limit quinolinic acid
formation by various human cell types. Biochem J 1997;326 (Pt 2)(Pt 2):351–356.
https://doi.org/10.1042/bj3260351

Page 9/15
12. Pemberton LA, Kerr SJ, Smythe G, Brew BJ (1997) Quinolinic acid production by macrophages
stimulated with IFN-gamma, TNF-alpha, and IFN-alpha. J Interferon Cytokine Res 17(10):589–595.
https://doi.org/10.1089/jir.1997.17.589
13. Guillemin GJ, Cullen KM, Lim CK, Smythe GA, Garner B, Kapoor V et al (2007) Characterization of the
kynurenine pathway in human neurons. J Neurosci 27(47):12884–12892.
https://doi.org/10.1523/JNEUROSCI.4101-07.2007
14. Tutakhail A, Boulet L, Khabil S, Nazari QA, Hamid H, Coudoré F (2020) Neuropathology of Kynurenine
Pathway of Tryptophan Metabolism. Curr Pharmacol Rep 6:8–23. https://doi.org/10.1007/s40495-
019-00208-2
15. Dehhaghi M, Kazemi Shariat Panahi H, Guillemin GJ. Microorganisms (2019) Tryptophan
Metabolism, and Kynurenine Pathway: A Complex Interconnected Loop Influencing Human Health
Status. Int J Tryptophan Res 12:1178646919852996. https://doi.org/10.1177/1178646919852996
16. Gostner JM, Geisler S, Stonig M, Mair L, Sperner-Unterweger B, Fuchs D (2020) Tryptophan
Metabolism and Related Pathways in Psychoneuroimmunology: The Impact of Nutrition and
Lifestyle. Neuropsychobiology 79(1):89–99. https://doi.org/10.1159/000496293
17. Chen Y, Guillemin GJ. Kynurenine pathway metabolites in humans: disease and healthy States. Int J
Tryptophan Res 2009;2:1–19. https://doi.org/10.4137/ijtr.s2097
18. Jones SP, Franco NF, Varney B, Sundaram G, Brown DA, de Bie J et al (2015) Expression of the
Kynurenine Pathway in Human Peripheral Blood Mononuclear Cells: Implications for Inflammatory
and Neurodegenerative Disease. PLoS One 10(6):e0131389.
https://doi.org/10.1371/journal.pone.0131389
19. Durães F, Pinto M, Sousa E (2018) Old Drugs as New Treatments for Neurodegenerative Diseases.
Pharmaceuticals (Basel) 11(2):44. https://doi.org/10.3390/ph11020044
20. Thirtamara-Rajamani K, Li P, Escobar Galvis ML, Labrie V, Brundin P, Brundin L (2017) Is the Enzyme
ACMSD a Novel Therapeutic Target in Parkinson's Disease? J Parkinsons Dis 7(4):577–587.
https://doi.org/10.3233/JPD-171240
21. Huo L, Liu F, Iwaki H, Li T, Hasegawa Y, Liu A (2015) Human α-amino-β-carboxymuconate-ε-
semialdehyde decarboxylase (ACMSD): a structural and mechanistic unveiling. Proteins 83(1):178–
187. https://doi.org/10.1002/prot.24722
22. Lim CK, Yap MM, Kent SJ, Gras G, Samah B, Batten JC et al (2013) Characterization of the
kynurenine pathway and quinolinic Acid production in macaque macrophages. Int J Tryptophan Res
6:7–19. https://doi.org/10.4137/IJTR.S11789
23. Maddison DC, Giorgini F (2015) The kynurenine pathway and neurodegenerative disease. Semin Cell
Dev Biol 40:134–141. https://doi.org/10.1016/j.semcdb.2015.03.002
24. Boros FA, Vécsei L (2019) Immunomodulatory Effects of Genetic Alterations Affecting the
Kynurenine Pathway. Front Immunol 10:2570. https://doi.org/10.3389/fimmu.2019.02570
25. Heilman PL, Wang EW, Lewis MM, Krzyzanowski S, Capan CD, Burmeister AR et al (2020) Tryptophan
Metabolites Are Associated With Symptoms and Nigral Pathology in Parkinson's Disease. Mov
Page 10/15
 Disord 35(11):2028–2037. https://doi.org/10.1002/mds.28202
26. Wu W, Nicolazzo JA, Wen L, Chung R, Stankovic R, Bao SS et al (2013) Expression of tryptophan 2,3-
dioxygenase and production of kynurenine pathway metabolites in triple transgenic mice and human
Alzheimer's disease brain. PLoS One 8(4):e59749. https://doi.org/10.1371/journal.pone.0059749
27. Schwarcz R, Bruno JP, Muchowski PJ, Wu HQ (2012) Kynurenines in the mammalian brain: when
physiology meets pathology. Nat Rev Neurosci 13(7):465–477. https://doi.org/10.1038/nrn3257
28. Xiao W, Wang RS, Handy DE, Loscalzo J (2018) NAD(H) and NADP(H) Redox Couples and Cellular
Energy Metabolism. Antioxid Redox Signal 28(3):251–272. https://doi.org/10.1089/ars.2017.7216
29. Günther J, Fallarino F, Fuchs D, Wirthgen E. Editorial (2020) Immunomodulatory Roles of Tryptophan
Metabolites in Inflammation and Cancer. Front Immunol 11:1497.
https://doi.org/10.3389/fimmu.2020.01497
30. Pucci L, Perozzi S, Cimadamore F, Orsomando G, Raffaelli N (2007) Tissue expression and
biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase,
a key enzyme in tryptophan catabolism. FEBS J 274(3):827–840. https://doi.org/10.1111/j.1742-
4658.2007.05635.x
31. Fukuoka S, Ishiguro K, Yanagihara K, Tanabe A, Egashira Y, Sanada H et al (2002) Identification and
expression of a cDNA encoding human alpha-amino-beta-carboxymuconate-epsilon-semialdehyde
decarboxylase (ACMSD). A key enzyme for the tryptophan-niacine pathway and "quinolinate
hypothesis". J Biol Chem 277(38):35162–35167. https://doi.org/10.1074/jbc.M200819200
32. Parrott JM, Redus L, Santana-Coelho D, Morales J, Gao X, O'Connor JC (2016) Neurotoxic kynurenine
metabolism is increased in the dorsal hippocampus and drives distinct depressive behaviors during
inflammation. Transl Psychiatry 6(10):e918. https://doi.org/10.1038/tp.2016.200
33. Adams S, Teo C, McDonald KL, Zinger A, Bustamante S, Lim CK et al (2014) Involvement of the
kynurenine pathway in human glioma pathophysiology. PLoS One 9(11):e112945.
https://doi.org/10.1371/journal.pone.0112945
34. Bryleva EY, Brundin L. Kynurenine pathway metabolites and suicidality. Neuropharmacology
2017;112(Pt B):324–330. https://doi.org/10.1016/j.neuropharm.2016.01.034

Figures

Page 11/15
Figure 1

The central pathway of catabolism of tryptophan. This pathway developed Neurotoxic and
neuroprotective metabolites and can influence the process and exacerbation of neurodegenerative
diseases. Neurotoxic and neuroprotective metabolites are shown in red and green, respectively.

Page 12/15
Figure 2

Acmsd PCR product amplified from the pUC57 vector. Lane 1; 50-1500 bp DNA ladder. Lane 2; Acmsd
PCR product of 1037 bp. Lane 3; Non-template control (NTC).

Figure 3

Gel electrophoresis of Acmsd gene. A; Colony PCR of Acmsd gene. Lane 1: 50-1500 bp DNA ladder. Lane
2 and 3: Two positive of grown colonies of the matrix plates. Lane 4: Positive control (extracted
pUC57/Acmsd plasmid). Lane 5: NTC. B; Double digestion of pCMV6-AC-IRES-GFP/Acmsd vector. Lane 1:
100-10,000 bp DNA ladder. Lane 2: Extracted pCMV6-AC-IRES-GFP/Acmsd plasmid. Lane 3: Positive

Page 13/15
control (Extracted pUC57/Acmsd plasmid). Lane 4: Digested pCMV6-AC-IRES-GFP/Acmsd vector using
BamHI and XbaI restriction enzymes. Lane 5: Undigested plasmid. Lane 6: NTC.

Figure 4

GFP expression of RAW 274.7 cells. Column A represents the LPS-stimulated RAW 264.7 cells transfected
with pCMV6-AC-IRES-GFP expression vectors containing the Acmsd gene, and pEGFP-C1 vectors. Column
B represents the unstimulated RAW 264.7 cells (cells were not treated by LPS) transfected with pCMV6-
Page 14/15
AC-IRES-GFP expression vectors containing the Acmsd gene, and pEGFP-C1 vectors. Control fields were
not transfected with any vectors (Scale bar = 20 μm).

Figure 5

Expression level of Ifn-γ, Ido1, and Acmsd genes in unstimulated, LPS-stimulated, and transfected LPS-
stimulated RAW 264.7 cells. A; Ifn-γ expression levels in unstimulated, LPS-stimulated, and transfected
LPS-stimulated RAW 264.7 cell line. B; Ido1 mRNA expression levels in unstimulated, LPS-stimulated, and
transfected LPS-stimulated RAW 264.7 cell line. C; Acmsd expression levels in unstimulated, LPS-
stimulated, and transfected LPS-stimulated RAW 264.7 cell line. Results are represented as mean ± SD. N
= 3. ** P < 0.01, *** P < 0.001. Control (LPS-stimulated cells) and demonstrated that Acmsd had a 29-fold
change expression after transfection.

Page 15/15