Dennis M.

Klinman Use of CpG oligodeoxynucleotides as

Debra Currie
Ihsan Gursel
immune adjuvants
Daniela Verthelyi

Authors’ addresses Summary: Synthetic oligodeoxynucleotides (ODNs) containing unmethyl-

Dennis M. Klinman1, Debra Currie1 Ihsan Gursel1 ated CpG motifs directly stimulate human B cells and plasmacytoid
Daniela Verthelyi2 dendritic cells (pDCs), thereby promoting the production of T helper
1
Section of Retroviral Immunology, Division of 1 (Th1) and pro-inflammatory cytokines and the maturation/activation of
Viral Products, Center for Biologics Evaluation professional antigen-presenting cells. These activities enable CpG ODNs to
and Research, Food and Drug Administration, act as immune adjuvants, accelerating and boosting antigen-specific
Bethesda, MD, USA. immune responses by 5–500-fold. These effects are optimized by maintaining
2
Division of Therapeutic Proteins, Center for close physical contact between the CpG DNA and the immunogen. Animal
Biologics Evaluation and Research, Food and challenge models establish that protective immunity can be accelerated and
Drug Administration, Bethesda, MD, USA. magnified by coadministering CpG DNA with vaccines. Ongoing clinical
studies indicate that CpG ODNs are safe and well tolerated when administered
Correspondence to: as adjuvants to humans, and in some cases, they increase vaccine-induced
Dennis M. Klinman immune responses.
Building 29A, Room 3D10
Division of Viral Products
CBER, FDA
8800 Rockville Pike
Bethesda, MD 20892 Introduction
USA
Tel.: þ1 301 827 1707 Yamamoto et al. (1, 2) were the first to report that synthetic
Fax: þ1 301 496 1810 oligodeoxynucleotides (ODNs) with sequences patterned after
E-mail: klinman@cber.fda.gov those found in bacterial DNA could activate natural killer (NK)
Acknowledgements cells to secrete interferon-g (IFN-g). They hypothesized that
The assertions herein are the private ones of the authors palindromic sequences present in the ODNs contributed to this
and are not to be construed as official or as reflecting the stimulation. In collaboration with Art Krieg (3, 4), my lab
views of the Food and Drug Administration at large. This
work was supported in part by a grant from DARPA and demonstrated that specific sequence motifs present in bacterial
MIPR MM8926. DNA consisting of an unmethylated CpG dinucleotide flanked
by two 50 purines (optimally GpA) and two 30 pyrimidines
were responsible for triggering this ‘innate’ immune response.
CpG motifs are approximately 20 times less common in mam-
malian than microbial DNA, due to differences in frequency of
utilization and methylation pattern of CpG dinucleotides in
eukaryotes versus prokaryotes (5, 6).
The release of unmethylated CpG DNA from bacteria during
an infection can serve as a ‘danger signal’, stimulating the
Immunological Reviews 2004 innate immune system of the host (7). Bacterial DNA and
Vol. 199: 201–216
Printed in Denmark. All rights reserved
synthetic oligodeoxynucleotides expressing unmethylated
CpG motifs trigger an immunostimulatory cascade that culmin-
Copyright ß Blackwell Munksgaard 2004
ates in the maturation, differentiation, and proliferation of
Immunological Reviews
0105-2896 multiple immune cells, including B lymphocytes and T

201
Klinman et al  CpG ODNs as immune adjuvants
lymphocytes, NK cells, monocytes, macrophages, and
dendritic cells (DCs) (4, 8–11). Together, these cells secrete
cytokines and chemokines that create a pro-inflammatory
[interleukin-1 (IL-1), IL-6, IL-18, and tumor necrosis factor-a
(TNF-a)] and T helper 1 (Th1)-biased (IFN-g and IL-12)
immune milieu (4, 10–12). Neither mammalian DNA nor
control ODNs in which the critical CpG dinucleotide is elimin-
ated by inversion or methylation elicit these immunostimul-
atory effects (4, 13) (Table 1).
Molecular mechanism underlying CpG-induced immune
activation
The innate immune system recognizes pathogen-associated
molecular patterns expressed by a diverse group of infectious
microorganisms (14). The Toll-like receptor (TLR) family is
involved in this recognition process (15, 16). Akira et al. (17)
established that TLR9 in mice is responsible for the recognition
of CpG motifs by immune cells, a finding subsequently con-
firmed for humans (18, 19). B cells and plasmacytoid dendri-
tic cells (pDCs) are the dominant human cell types that express
TLR9 (13, 17, 18, 20).
Cells lacking TLR9 do not respond to CpG DNA but can be
made responsive by transfection with gene constructs encoding
that receptor (17, 18). Unlike most members of the TLR family,
TLR9 is expressed within the cell rather than on the cell surface.
CpG DNA is rapidly internalized by immune cells, and it interacts
with TLR9 present in endocytic vesicles (17). This interaction is
highly specific, with endosomal swelling being abrogated by
elimination of the CpG motif by inversion or methylation
(17, 18). The interaction of TLR9 with CpG ODN triggers the
swelling and acidification of the vesicle and the generation of
reactive oxygen species (18, 21, 22). This sequence of events is
critical to CpG-mediated signaling, as agents that inhibit endo-
somal maturation or acidification (such as chloroquine and
wortmannin) block immune activation (21, 22).
Table 1. Immunostimulatory effect of CpG DNA
Fold increase in cytokine-secreting cell number
IL-6
Bacterial DNA 3.2
0.2
Mammalian DNA 0.8
0.2
CpG ODN 5.5
1.1
CpG ODN (methylated) 0.9
0.2
CpG ODN (DNAse Rx’d) 1.3
0.2
GpC ODN 1.2
0.3
BALB/c spleen cells were incubated with 50 mg/ml of heat denatured Escherichia coli DNA, calf thymus DNA, or with 1 mM of stimulatory or control
phosphorothioate oligodeoxynucleotides. The effect on cytokine production was determined after 10 h by enzyme-linked immunospot assay. Data
represent the fold increase in the number of cytokine-secreting cells over background. Results represent the mean
SD of at least three independent
experiments.
202 Immunological Reviews 199/2004
Downstream, TLR9 interacts with MyD88, which recruits
IL-1 receptor-associated kinase 4 (IRAK4) to activate TNF
receptor associated factor 6 (TRAF6). TRAF6 associates with
transforming growth factor-b-associated kinase-1-binding
proteins 1 and 2 (TAB-1 and TAB-2), culminating in the
activation of several transcription factors including nuclear
factor (NF)-kB, activating protein-1, CCAAT/enhancer bind-
ing protein, and cyclic adenosine monophosphate-responsive
element-binding protein (23–26). These elements directly
upregulate cytokine/chemokine gene expression (26, 27).
Not surprisingly, dominant negative versions of MyD88,
IRAK, and TRAF6 inhibit CpG ODN-mediated cellular acti-
vation, and TLR9 knockout mice fail to mount an immune
response when exposed to CpG ODNs (26, 27).
Species specificity of CpG motifs
TLR9 molecules expressed by different species have diverged
over evolutionary periods. Due to this divergence, the precise
sequence motif (CpG dinucleotide plus flanking regions) that
is optimal for stimulating immune cells from one species
frequently differs from those in other species (28). For exam-
ple, the TLR9 molecules present in mice differ from those in
humans by 24% at the amino acid level (17). In addition, the
cell populations that express TLR9 may differ between species.
In mice, immune cells of the myeloid lineage (including
monocytes, macrophages, and myeloid DC) express TLR9
and respond to CpG stimulation, whereas in humans these
cell types do not express TLR9 and cannot be directly activated
by CpG ODNs (19, 20, 29–31).
At least three structurally distinct classes of CpG ODNs have
been described in primates (32–35). ‘K’ type ODNs (also referred
to as ‘B’ type) encode multiple CpG motifs on a phosphorothio-
ate backbone. They activate pDCs and trigger B cells to proliferate
and secrete (32, 33, 36) (Table 2). Most studies of CpG activity
utilize K-type phosphorothioate ODNs. This class of ODNs was
IL-12 IFN-g IgM
3.8
0.4 4.7
2.3 3.9
1.1
1.1
0.2 0.8
0.3 0.7
0.2
8.3
1.7 4.7
1.1 4.2
1.6
1.2
0.3 0.8
0.2 1.1
0.2
0.8
0.2 1.1
0.2 0.9
0.2
1.3
0.3 1.2
0.3 1.3
0.3
 Klinman et al  CpG ODNs as immune adjuvants

Table 2. Comparison of D-, K-, and C-type oligodeoxynucleotides (ODNs)

ODN type Example Structural characteristics Immunomodulatory activity
D GGTGCATCGATGCAGGGGGG Mixed phosphodiester/ APC maturation;
phosphorothioate backbone preferentially stimulates
single CpG motif (bold); pDC to secrete IFN-a
CpG flanking region forms a
palindrome (underlined);
poly G tail at 3’ end
K ATCGACTCTCGAGCGTTCTC Phosphorothioate backbone; pDC maturation;
multiple CpG motifs (bold); preferentially supports
5’ motif most stimulatory the production of TNF-a
and IL-6;
triggers B-cell activation,
including the production
of IgM
C TCGTCGTCGTTCGAACGACGTTGAT Phosphorothioate backbone; Stimulates B cells and pDC;
multiple CpG motifs (bold); induces production of
TCG dimer at 5’ end; IL-6 and IFN-a
CpG motif imbedded in a
central palindrome
(underlined)

the first to be discovered, and their phosphorothioate backbone
decreases susceptibility to DNAse digestion, resulting in a longer
in vivo half-life than phosphodiester ODNs.
‘D’ type ODNs (also referred to as ‘A’ type) are constructed
using a mixed phosphodiester/phosphorothioate backbone
and contain a single hexameric purine/pyrimidine/CG/purine/
pyrimidine motif flanked by self-complementary bases capable
of forming a stem-loop structure capped at the 30 end by a
poly G tail (32). The poly G tails on individual D type ODNs
can interact, leading to the formation of ‘G tetrads’ and ODN
clusters (35). D ODNs trigger the maturation of antigen-
presenting cells (APCs) and directly induce the secretion of
IFN-a from pDCs (32, 33).
‘C’ type ODNs resemble K type in being composed entirely
of phosphorothioate nucleotides. C ODNs were originally
described as expressing a TCGTCG at the 50 end, and fre-
quently contain an internal K-type motif (such as GTCGTT)
imbedded in a palindrome sequence. This class of ODN is
capable of directly stimulating B cells to secrete IL-6 and
pDCs to produce IFN-a (thus combining the stimulatory
properties of D- and K-type ODNs) (Table 2) (34, 35).
Studies comparing the activity of peripheral blood mono-
nuclear cells (PBMCs) from humans with those from rhesus
macaques, chimpanzees, and orangutans indicate that different
primate species respond to the same broad classes of CpG ODN
(37–39). In contrast, rodents respond poorly to some but not all
CpG ODNs that are highly active in primates (17, 18, 35, 40).
Thus, efforts to determine whether CpG ODN may be of
therapeutic benefit are typically initiated in mice and then
followed by studies involving non-human primates in which
CpG ODNs that stimulate human immune cells are evaluated.
Specificity of CpG recognition by human PBMCs
A variety of different CpG ODNs have been developed for
human use (11, 32, 33, 41). Careful study of various K type
ODNs indicates that the sequence, number, and location of
CpG motifs influences the magnitude of the resultant response.
As seen in Table 3, ODNs containing a single CpG motif elicit
only 1/4 of the maximum responses stimulated by ODNs
expressing multiple (3) motifs (P < 0.01). Moreover, ODNs
containing several different motifs were significantly more
stimulatory than those expressing the same motif multiple
times (P < 0.01) (Table 4).
The location of CpG motifs within an ODN is also import-
ant. Those containing a strongly stimulatory CpG motif at the
50 end triggered significantly greater immune activation than
those containing a less active motif in the same position (63
versus 19%) (P < 0.01) (Table 5). This positional effect was
observed in multiple assays of immune function, including
proliferation, immunoglobulin M (IgM), IL-6, and IFN-indu-
cible protein-10 (IP-10) production. In contrast, substituting a
stronger CpG motif at more 30 sites had less effect on immune
stimulation (Table 5). Evidence that CpG location, number, and
diversity all influence immunostimulatory activity is consistent
with data showing that human PBMCs recognize and respond
to a diverse array of CpG ODNs (32, 33, 36). These findings
have important implications for the rational design of K-type
ODNs for use as immune adjuvants. To maximize the response
of an outbred population, ODNs containing three to four
different motifs should be utilized, with the most stimulatory
CpG motif being placed at the 50 end of an ODN.
However, the rules regarding the number and position of
CpG motifs may not apply to other types of ODNs. Studies in

Immunological Reviews 199/2004 203

Klinman et al  CpG ODNs as immune adjuvants

Table 3. Stimulatory effect of increasing the total number of CpG motifs present in an oligodeoxynucleotide (ODN)
% maximal response
Total number of CpG motifs Proliferation IL-6 IgM IP-10 Average
1 30
3 27
2 25
2 21
1 25
4
2 54
16 38
5 59
14 39
7 47
9*
3 73
13 57
7 84
12 50
11 66
13*y
4 62
7 68
2 88
5 63
1 70
11*y
5 53
4 56
5 46
2 41
4 49
7*
The level of immune activation induced by 1 mM of 32 different ODNs was monitored in peripheral blood mononuclear cells from 6 donors and levels
in culture supernatants were measured by ELISA, while proliferation was measured by 3H-thymidine incorporation. To facilitate comparison between
donors, the maximum response in each assay was set to 100, and the relative strength of each ODN then calculated by the formula:
Response to ODN  background
Maximum response  background  10000. The average and SD for each group is shown.
*Significantly greater than one motif, P < 0.01.
ySignificantly greater than two motifs, P < 0.01.

Table 4. Stimulatory effect of increasing the heterogeneity of CpG motifs present in an oligodeoxynucleotide (ODN)
% maximal response
Total number of different CpG motifs Proliferation IL-6 IgM IP-10 Average
1 27
2 26
3 19
4 21
3 23
4
2 40
16 44
5 50
14 42
7 44
4*
3 63
4 51
5 78
2 56
4 62
10*y
4 69
7 55
2 74
5 63
1 65
7*y
5 48
6 50
3 42
4 48
54
3*
Twenty-two ODNs were synthesized that contained one to five different CpG motifs. The level of immune activation induced by 1 mM of each ODN was
measured using peripheral blood mononuclear cells from six to ten donors. The average level of immune stimulation induced by each group of ODNs is
shown.
*Signficantly greater than one motif, P < 0.01.
ySignificantly greater than two different motifs, P < 0.01.

our lab suggest that the addition of multiple CpG motifs into from all donors. This heterogeneity was not due to interassay
D-type ODNs does not improve their activity. This may reflect variability, as the response of PBMCs from the same individuals to
the more complex structure of D- and C-type ODNs in which the same ODNs was reproducible over time (43). In our hands,
the critical CpG motif lies within a self-complementary region. mixtures containing three or more selected K or D ODNs were
capable of activating immune cells from virtually all donors
(44, 45). Ongoing studies will determine whether such mixtures
Variation in CpG recognition
are more efficient than complex ODNs (that contain multiple
Detailed studies of large numbers of normal donors indicate that
different CpG motifs) in activating a heterogeneous population.
the response of PBMCs from different individuals to CpG stimu-
lation is heterogeneous (33, 42–44). No single ODN was found
to be maximally stimulatory in all assays or on immune cells Contribution of CpG motifs to vaccine
Vaccination remains the single most effective method for pre-
Table 5. Effect of CpG motif position on the stimulatory activity of an
oligodeoxynucleotide (ODN) venting infectious disease. CpG DNA improves the functional
Site Motif Proliferation IL-6 IgM IP-10 Average
activity of professional APCs and triggers the production of
0 cytokines and chemokines that support the development of
5 Strong 70
9 67
5 63
7 64
7 63
7*
50 Weak 21
1 16
3 18
2 21
1 19
2 adaptive (antigen-specific) immune responses. These consid-
50 Control 26
5 23
5 21
3 13
1 21
6 erations led many labs to examine whether CpG ODNs could
30 Strong 49
8 45
6 42
6 44
10 45
2
30 Weak 42
7 65
9 36
4 40
5 46
11 boost the immune response elicited by vaccines.
ODNs were synthesized containing a strong, weak, or control (non-CpG)
motif at the most 50 end or further downstream(30 ). The level of immune
activation induced by 1 mM of each ODN was measured in peripheral CpG ODNs improve the immunogenicity of protein antigens
blood mononuclear cells from six donors. The average level of immune
stimulation induced by all ODNs with a specific motif at each site is shown. Early experiments showed that adding CpG ODN to conven-
*Significant difference between strong versus weak motifs, P < 0.02. tional protein antigens, such as ovalbumin (OVA), boosted

204 Immunological Reviews 199/2004


Table 6. Effect of CpG oligodeoxynucleotide (ODN) on the
immunogenicity of a co-administered protein
Treatment IgG anti-OVA titer G1:G2a ratio IFN-g
OVA 15 8.8
OVA þ CpG ODN 47 2.8
OVA þ GpC ODN 26 7.7
(OVA þ CpG ODN)ALUM 205
(OVA)ALUM 35
(OVA þ GpC ODN)ALUM 27
(OVA  CpG ODN)IFA 290 2.1
(OVA  GpC ODN)IFA 67 13.3
(OVA)IFA 44 7.8
(OVA þ CpG ODN)LIPO 542
(OVA þ GpC ODN)LIPO
OVA  avidin/biotin  CpG ODN 180 1.5
OVA  avidin/biotin  GpC ODN 12
BALB/c mice were immunized and boosted with 20 mg of ovalbumin
(OVA) plus 50 mg of ODN. The ODNs were either mixed in the same
syringe, conjugated to the OVA via biotin–avidin bridges, or emulsified in
incomplete Freund’s adjuvant (IFA). Three weeks after treatment, antigen-
specific serum antibody titers were determined by ELISA. At the same
time, the number of cells stimulated to secrete (IFN-g)/106 splenocytes
was monitored by enzyme-linked immunospot assay.
antibody production by approximately threefold (Table 6). In
those experiments, both the OVA and ODN could freely
diffuse from the site of injection. We reasoned that the
adjuvant-like effect of CpG ODNs might be improved, if
their proximity to antigen was maintained. Toward that
end, ODN and OVA were emulsified in incomplete Freund’s
adjuvant (IFA). As predicted, co-localizing CpG ODNs with
OVA through use of this emulsion boosted IgG anti-OVA
production by 10-fold (Table 6), an effect not observed with
OVA in IFA alone (46).
A similar increase in adjuvanticity was achieved by cross-
linking CpG ODN to OVA using biotin–avidin bridges
(Table 6). This adjuvant effect was eliminated by treating the
complexes with DNase, demonstrating that the effect was due
to the presence of DNA. Moreover, control ODN (lacking
the critical CpG dinucleotide) had no significant effect on
immunogenicity, demonstrating that the adjuvant effect was
CpG dependent.
Multiple other laboratories also observed that CpG ODNs have
adjuvant-like properties. Consistent with our results, those labs
found that activity was improved by linking ODN directly to
antigen (11, 47) or co-encapsulating them in liposome vesicles
(48). In this context, a conjugate containing ODN plus antigen is
preferentially taken up by professional APCs, resulting in signifi-
cantly higher CTL responses than unconjugated mixtures of
protein plus ODN (49). This effect appears to be mediated by
DNA-binding receptors expressed by APCs (49). Such findings
confirm the intuitive expectation that optimal stimulation occurs
when antigen and adjuvant are presented to the immune system
in close spatial and temporal proximity.
Klinman et al  CpG ODNs as immune adjuvants
Effect of CpG ODNs on antibody isotype
CpG ODNs induced a shift in the isotype of antibody elicited
following immunization. For example, OVA alone elicited a
1.6 primarily IgG1 antibody response (IgG1:IgG2a ratio of 8.8)
3.9
1.8 (Table 6). Addition of CpG ODN to the OVA resulted in a
17.6 significant increase in the production of IgG2a antibodies,
1.8
1.4 increasing the IgG2a:IgG1 ratio by ninefold (Table 6). A similar
8.8 shift in isotype profile was observed when a variety of other
antigens, including polysaccharide antigens, were co-adminis-
24.1 tered with CpG ODN (11, 50–52) (Table 7). The enhanced
ratio of IgG2a:IgG1 in mice is correlative with a Th1 response
and is consistent with studies showing that protein plus CpG
ODNs indeed induce potent Th1 responses (53, 54).
Effect of CpG ODNs on cytokine production
The effect of CpG ODNs on antigen-specific cytokine-produ-
cing cells was also examined. Co-administration of CpG ODNs
with OVA increased the number of spleen cells actively secret-
ing IFN-g in vivo by twofold compared to mice immunized
with OVA alone (50) (Table 6).To establish that this effect was
antigen specific, cells from immunized mice were re-stimu-
lated in vitro with OVA. There was a significant dose-related
increase in IFN-g production by cells from mice immunized
with CpG ODN plus antigen. In contrast, splenocytes from
animals immunized with OVA plus control ODN showed no
increase in IFN-g production. In addition to enhancing anti-
body and Th1 responses, CpG ODNs have also been shown to
activate DCs, resulting in improved presentation of soluble
proteins to class I-restricted T cells and induction of CTLs (55).
Subsequent studies established that CpG ODN boosted
the response to other protein or peptide-based vaccines
(11, 50, 53, 56, 57). This adjuvant effect appears to have
three components: (i) a CpG-induced enhancement in APC
function, (ii) a CpG-dependent induction of a cytokine/che-
mokine microenvironment supportive of antigen-specific
immunity, and (iii) an improvement in antigen uptake
mediated by DNA-binding receptors on APCs (this final effect
being CpG independent) (49).
CpG ODNs increase the magnitude of vaccine-induced
responses
Additional studies established that CpG ODNs could boost the
response elicited by conventional vaccines. This effect is of
particular relevance for pathogens in which a strong Th1
response is needed. When CpG ODNs were co-administered
with vaccines against influenza virus, measles virus, lympho-
cytic choriomeningitis virus, hepatitis B surface antigen
Immunological Reviews 199/2004 205
Klinman et al  CpG ODNs as immune adjuvants

Table 7. CpG oligodeoxynucleotides (ODNs) as immune adjuvants: use with conventional antigens
Antigen Fold_Ab titer Ig profile Cytokine profile References
Ovalbumin >sevenfold (3 weeks) G2a>G1 _IFN-g (50)
Hen eggwhite lysozyme >10-fold (3 weeks) G2a>G1 _IFN-g, _IL-5 (53)
Hepatitis B surface antigen >104 (4 weeks) (60)
Influenza virus 10-fold (4 weeks) Intranasal IgA _IFN-g (134)
Measles virus 20-fold (4 weeks) G2a>G1 _IFN-g, _IL-5 (59)
Tetanus toxoid Threefold (6 weeks) (62)
Brucella >100-fold (3 weeks) G2a>G1 _IFN-g (135)
This table provides an overview of the type and magnitude of immune response elicited when CpG ODNs are co-administered with conventional
protein or vaccine-based antigens.

(HBsAg), or tetanus toxoid, antigen-specific antibody titers
rose by up to three orders of magnitude (56, 58–63)
(Table 7). CpG ODNs also triggered the preferential production
of IFN-g-dependent IgG2a antibodies and facilitated the devel-
opment of antigen-specific CTLs (56, 58–61,64). These effects
culminated in responses that protected normal animals from
pathogens including lymphocytic choriomeningitis virus (63)
and tetanus (62). However, increased immune activity was
not always associated with improved vaccine efficacy. Mice
treated with CpG ODN plus a respiratory syncytial virus (RSV)
protein-based vaccine, for example, were only modestly pro-
tected from viral challenge and were at increased risk of
pulmonary pathology (65).
CpG ODNs accelerate the development of vaccine-induced
responses
Vaccines are typically administered prophylactically to reduce
host susceptibility to infection. However, there are situations
in which the development of protective immunity must be
accelerated, such as when individuals are potentially exposed
to biothreat agents (e.g. workers in anthrax-contaminated
buildings and/or their contacts).
To examine whether CpG ODNs can speed the induction of
protective immune responses, GMP-grade CpG ODNs were
mixed with AVA (the licensed vaccine against anthrax) and
administered to rhesus macaques. The combination of K-type
ODN plus AVA stimulated a sixfold higher antibody response
than AVA alone (66). This combination also rapidly induced
toxin-neutralizing antibodies, exceeding AVA alone by 17-fold
11 days post-immunization (Table 8). To examine the immuno-
protective activity of these antibodies, serum from the vac-
cinated macaques was transferred to normal A/J mice. Serum
from donors vaccinated with AVA þ CpG ODNs provided sig-
nificantly greater protection from anthrax spore challenge than
serum from AVA-vaccinated monkeys (66). Another advant-
age to the co-administration of CpG ODN with AVA was the
higher avidity of the resultant anti-anthrax antibodies (66).
These effects are consistent with the documented ability of
CpG ODNs to promote the functional maturation of profes-
sional APCs (13). In this context, ongoing studies suggest that
other methods of targeting AVA to professional APCs also
result in higher titered, more avid immune responses, and
these findings support the further development of CpG ODN
as an adjuvant for vaccines targeting biothreat pathogens.
CpG ODNs improve mucosal immune responses
As many pathogens gain access to the host through the respira-
tory, gastrointestinal, vaginal, or rectal mucosa, the ability of
CpG ODNs to boost mucosal immunity was examined. Local
delivery of CpG ODNs induced rapid proliferation of the genital
epithelium and caused significant recruitment of inflammatory
cells to the submucosa (67). Administering a combination of
CpG ODNs plus formalin-inactivated influenza virus intranasally
significantly increased flu-specific antibody levels in the serum,
saliva, and genital tract (58). Similarly, intranasal delivery of
CpG ODN plus HBsAg or b-galactosidase stimulated strong
antigen-specific IgA responses throughout the mucosal immune
system and in the serum (68, 69). Spleen cells from intranasally
immunized mice preferentially produced IFN-g rather than IL-4
when re-exposed to antigen in vitro. They also generated MHC-
restricted, antigen-specific CTLs, replicating the effects of par-
enterally injected CpG ODN plus antigen (68).
Table 8. Effect of CpG oligodeoxynucleotides (ODNs) plus AVA
IgG anti-AVA titer
Primary Secondary % survival
Unimmunized <10 5
AVA alone 220 13,800 10
AVA þ CpG ODN 840 94,000 45
Rhesus macaques (5/group) were immunized s.c. with 0.5 ml of AVA alone
or combined with 250 mg of CpG ODNs. Serum immunoglobulin G (IgG)
anti-PA titers were measured by ELISA. To measure the protection con-
ferred by these serum antibodies, 0.1 ml of pooled serum was transferred
to naive A/J mice (20/group). The mice were challenged 1 day later with 30
LD50 of Sterne strain anthrax, and survival was monitored for 3 weeks.

206 Immunological Reviews 199/2004


CpG ODNs improve the immune response of neonatal
animals
The adjuvant-like properties of CpG ODN observed in adult mice
triggered interest in their potential to improve the response of
newborn animals. Due to immaturity of the neonatal immune
system, newborns exposed to foreign antigens are at risk of
mounting an inadequate immune response (70, 71) or of devel-
oping tolerance rather than immunity (72). For example, new-
borns respond poorly when immunized with HBsAg, attenuated
measles virus, or tetanus toxoid (59, 61). Newborn mice also
appear to be at increased risk of developing tolerance to certain
DNA vaccines (72, 73), although successful DNA immunization
of newborn mice has been achieved (74, 75). Several studies
showed that CpG ODN enhanced antibody and CTL responses
when co-administered with antigen to very young mice
(59, 61). The interpretation of these findings is complicated,
however, because animals in these studies were immunized
repeatedly, obscuring the effect of a single early dose of CpG
ODN on subsequent immune responsiveness.
Adjuvant activity of CpG ODNs in non-human primates
Building on the observation that non-human primates respond
to the same CpG ODNs that stimulate human cells, rhesus
macaques were immunized and boosted with a mixture of
OVA plus ODN. Animals immunized with antigen and D ODN
increased their IgG anti-OVA response by 470-fold after pri-
mary (P < 0.05) and by 600-fold after secondary (P < 0.01)
immunization (Table 9). By comparison, K ODN boosted the
IgG antibody response by sevenfold after primary and 35-fold
after secondary immunization when compared to pre-treatment
values (P < 0.05) (37) (Table 9). Macaques immunized with
OVA plus control ODN generated only a fourfold increase in
anti-OVA titer. These findings indicate that D ODN can be
particularly effective at boosting the antigen-specific humoral
response to a co-administered antigen.
Table 9. Antibody titers of rhesus macaques immunized with
ovalbumin (OVA) plus oligodeoxynucleotide (ODN)
IgG anti-OVA serum titer
Primary Secondary
OVA þ control ODN 460 420
OVA þ ‘K’ type CpG ODN 780 1250
OVA þ ‘D’ type CpG ODN 9500 13,800
Macaques were immunized with 4 mg of OVA plus 125 mg of alum and
250 mg of ODNs. Values represent the geometric mean titer determined
by ELISA. The response of animals immunized with OVA plus alum plus
D-type ODN was significantly increased over both other groups
(P < 0.01).
Klinman et al  CpG ODNs as immune adjuvants
CpG ODNs improve the protection conferred by a novel
Leishmania vaccine
Early studies in non-human primates focused on evaluating
the adjuvant activity of K-type ODNs. To compare the activity
of D versus K ODNs, both were administered with a leading
Leishmania vaccine candidate [heat-killed Leishmania vaccine
(HKLV)]. Rhesus macaques immunized with HKLV alone
and then challenged with L. major developed large cutaneous
lesions with a peak surface area of 300
60 mm2 (37). Mon-
keys vaccinated with HKLV plus K ODN also developed large
lesions, although somewhat more slowly than controls. This
finding indicates that not all CpG ODNs improve vaccine-
induced immunity. By comparison, animals immunized with
HKLV plus D ODN had significantly smaller lesions (maximal
size 80
13 mm2, P < 0.05), consistent with a reduced para-
site burden (37, 76) (Fig. 1). PBMCs from these animals also
had significantly more cells that were stimulated by Leishmania
antigens to secrete IFN-g in vitro that did those immunized with
HKLV alone (37).
“D” ODN Increase the Protective Efficacy
of Heat-Killed Leishmania Vaccine
400
350
300
250
200
150
100
50
0
0 1 2 3 4 5
HKLV
HKLV + K ODN
HKLV + D ODN
Fig. 1. Cutaneous lesions in macaques vaccinated with alum-
adjuvanted heat-killed Leishmania vaccine (HKLV) plus
oligodeoxynucleotide (ODN). Rhesus macaques were primed
subcutaneously and boosted 4 weeks later with 250 mg of alum-adjuvanted
HKLV alone (n ¼ 6) or combined with 500 mg of a mixture of D-type or K-
type CpG ODNs. Animals were challenged with 107 metacyclic
promastigotes on week 14. The average size of the lesions on the forehead
(the site of challenge) is shown as the mean area (calculated as mean
diameter/2)2  p. Note that macaques immunized with HKLV plus D
ODNs had significantly smaller lesions (P < 0.01). PBMCs from animals
immunized with HKLV plus CpG ODNs also produced significantly more
IFN-g than animals immunized with HKLV alone (P < 0.05).
Immunological Reviews 199/2004 207
Klinman et al  CpG ODNs as immune adjuvants
CpG ODNs improve the immunogenicity of the hepatitis B
vaccine
To further evaluate the ability of CpG ODNs to act as immune
adjuvants, they were co-administered to non-human primates
with Engerix B (the human hepatitis B vaccine). Three studies
in normal primates were conducted. In the first, macaques
immunized with the hepatitis B vaccine plus CpG ODN devel-
oped 15-fold higher anti-hepatitis B antibody titers than did
animals immunized with vaccine alone (77). In the second,
orangutans (which typically mount poor responses to the
hepatitis B vaccine) generated protective levels of serum
anti-hepatitis B antibodies (>10 mIU/ml) only when vaccinated
with Engerix B plus CpG ODNs (39, 77). In the third study,
the adjuvant activity of D versus K ODNs was compared. After
primary immunization, all macaques vaccinated with Engerix-B
plus D ODN achieved protective serum antibody levels, whereas
only 60–80% of those immunized with Engerix B alone or
Engerix B plus K ODN were similarly protected. When the
monkeys were boosted, the peak antibody response elicited by
inclusion of either K or D ODNs significantly exceeded that of
Engerix B alone (Table 10) (P ¼ 0.012).
CpG ODNs augment the immune response of simian
immunodeficiency virus-infected macaques
HIV-infected patients experience a progressive deterioration in
the number and functional activity of CD4þ T cells, are at
increased risk of opportunistic infection, and respond subop-
timally to vaccination (78–81). For example, their immune
response to Engerix B is significantly reduced, particularly
when disease reaches an advanced stage (82, 83). Yet, retro-
virus infection has less effect on the innate than on the adap-
tive immune system (84). Thus, PBMCs from HIV-infected
subjects and simian immunodeficiency virus (SIV)-infected
macaques continue to respond to CpG ODN stimulation,
despite declines in antigen-specific immunity (84).
The ability of CpG ODNs to boost the immune response of
SIV-infected macaques to Engerix-B was therefore investigated.
Table 10. Effect of K and D oligodeoxynucleotides (ODNs) on the
immunogenicity of Engerix B
Immunization
1 2 3
Normal recipients
Vaccine alone <30 (60) 4300 (100) 9200 (100)
Vaccine þ ‘D’ ODN 940 (100) 8400 (100) 21,700 (100)
Vaccine þ ‘K’ ODN 120 (80) 10,600 (100) 20,500 (100)
SIV-infected recipients (viral load <107)
Vaccine alone <10 (0) <10 (20) <10 (20)
Vaccine þ ‘D’ ODN <10 (0) 320 (100) 430 (100)
Vaccine þ ‘K’ ODN 220 (80) 400 (100) 740 (100)
208 Immunological Reviews 199/2004
Unlike healthy macaques, SIV-infected animals were unable to
mount a protective antibody response when repeatedly vaccin-
ated with Engerix B. Only 20% of these animals ever developed
antibody levels >10 mIU/ml (Table 10). By comparison, the
addition of K or D ODNs to the vaccine boosted antibody titers
to protective levels in all animals with viral loads <107 copies/
ml (84) (Table 10). Although the antibody levels achieved were
significantly lower than that of similarly immunized uninfected
animals, these findings indicate that inclusion of CpG ODNs can
boost the immunogenicity of vaccines in both normal and
immunocompromised hosts.
These results, although supportive of the potential of CpG
ODNs to improve vaccine responses, are complicated by the
finding that different types of ODNs are needed to maximize
the immunogenicity of different vaccines. Thus, while avail-
able data supports clinical development of CpG ODNs as
vaccine adjuvants, only human trials will provide definitive
evidence that specific ODN vaccine combinations offer a
significant benefit over vaccine alone. Initial reports from
phase I clinical trials indicate that co-administration of
K-type ODN with the hepatitis B vaccine results in faster
seroconversion and higher anti-hepatitis B antibody titers
than vaccine alone (85).
Contribution of CpG motifs to the immunogenicity of
DNA vaccines
Vaccine development was revolutionized by the finding that
antigen-encoding DNA plasmids could induce cellular and
humoral immune responses against foreign antigens (86–90).
DNA vaccines are constructed with an antigen-encoding gene
incorporated into a plasmid backbone of bacterial DNA. Their
expression is regulated by a strong mammalian promoter
(86, 91, 92). When injected intramuscularly or intradermally,
DNA vaccines are transcribed, translated, and the protein they
encode presented to the immune system in the context of
self-major histocompatibility complex (MHC) (86, 88, 89).
Although the nature, magnitude, and duration of the immune
response elicited by DNA vaccines is influenced by multiple
factors, intramuscular delivery stimulates a Th1-driven
response characterized by CTL induction and the release of
IFN-g and antigen-specific IgG2a antibodies (86, 93). Early
studies conducted in mice showed that DNA vaccination con-
ferred protection against pathogen challenge (86, 87). Unfor-
tunately, follow-up studies in non-human primates as well as
clinical trials in humans suggest that the magnitude of the
immune response elicited by DNA vaccination is lower than
that achieved with other types of vaccine (94, 95). Ongoing

efforts are directed toward improving the immunogenicity of
DNA vaccines intended for human use and combining DNA
vaccines with other methods of antigen presentation to gen-
erate a maximally protective immune response.
Immunostimulatory properties of DNA plasmids: cytokine and
antibody production
DNA vaccines primarily elicit IFN-g- and IgG2a-dominated
immune responses when injected intramuscularly. To examine
whether this reflected the activity of CpG motifs in the bacterial
DNA backbone of these vaccines (11, 96), the ability of bacterial
plasmids (with and without protein-encoding inserts) to induce
cytokine production was studied in vitro. The response elicited by
a vaccine encoding the circumsporozoite protein (CSP) of
Plasmodium yoelli malaria known as 1012/PyCSP (kindly provided
by VICAL, Inc., San Diego, CA, USA) was compared to that of
the plasmid backbone alone (93). When incubated in vitro with
spleen cells from normal mice, the DNA vaccine induced a
fivefold to eightfold increase in the number of cells secreting
IgM, IL-6, IL-12, and IFN-g (Table 11). When spleen cells from
DNA-vaccinated animals were re-stimulated in vitro with immuno-
dominant T-cell epitopes present on the encoded protein, their
production of IFN-g (but not IL-4) significantly increased
(Table 11). This pattern is consistent with CpG-driven immune
activation. Of interest, in vitro stimulation of normal spleen
cells with the plasmid backbone of this vaccine (i.e. devoid
of the antigen-encoding insert DNA) also triggered IFN-g
production.
As plasmid vectors typically contain large numbers of
immunostimulatory CpG motifs, we examined their contribu-
tion to the observed cytokine production. Treating the plasmid
with DNAse or Sss I methylase (the latter selectively methylates
the cytosine of CpG dinucleotides) uniformly eliminated cyto-
kine production, indicating that the DNA, rather than some
unknown contaminant, was responsible for the cytokine
release (Table 11).
Table 11. Immunostimulatory effect of CpG motifs in DNA plasmids
Fold increase in cytokine-secreting cell number
IL-6
1012 vector 5.3
1.1
1012/PyCSP DNA vaccine 5.9
1.3
DNAse-treated 1012/PyCSP 0.9
0.2
20% methylated 1012/PyCSP 4.7
1.3
80% methylated 1012/PyCSP 1.9
0.3
97% methylated 1012/PyCSP 1.2
0.2
BALB/c spleen cells were incubated with 50 mg/ml of plasmid DNA. The effect on cytokine production was determined as described in
Table 1. Note that none of the plasmids induced a significant increase in IL-4 production.
Klinman et al  CpG ODNs as immune adjuvants
The isotype of the antigen-specific antibodies induced by
plasmid DNA vaccination was also examined. Animals immun-
ized with the malaria protein CS.1 emulsified in complete
Freund’s adjuvant primarily produce IgG1 anti-CSP antibodies
(IgG1:IgG2a ratio of 5.6). In contrast, intramuscular injection
of CSP-encoding DNA vaccines preferentially stimulated IgG2a
antibody production (IgG1:IgG2a ratios < 0.7 for three dif-
ferent CSP-encoding plasmids) (Table 12 and data not shown).
As IFN-g promotes IgM to IgG2a isotype switching (97,98),
these findings are consistent with CpG motif-induced IFN-g
production contributing to the preferential production of
IgG2a antibodies in immunized mice.
Co-administration of CpG ODNs improves the
immunogenicity of DNA vaccines
If CpG motifs present in DNA plasmids contribute to vaccine
immunogenicity, then co-administering CpG ODNs should
boost the immune response elicited by DNA vaccines. To
examine this hypothesis, we primed and boosted mice with
4 mg of 1012/PyCSP (a suboptimal vaccine dose that maxi-
mizes the likelihood of detecting a CpG effect) (99). As seen in
Table 12, this suboptimal dose stimulated a detectable but
reduced anti-CSP response. Co-administering 50 mg of CpG
ODNs significantly improved both IgG anti-CSP serum levels
in vivo and CSP-specific IFN-g production in vitro. Control
ODNs lacking immunostimulatory CpG motifs had no effect.
Of interest, co-administering 100 mg of vector alone (with-
out CSP-encoding insert) also improved the immune
response elicited by 1012/PyCSP (99). Presumably, CpG
motifs present in the vector backbone acted as adjuvants in
a fashion similar to the CpG ODNs. This observation raises
the interesting possibility that higher doses of plasmid
vaccine or co-administering multiple DNA vaccines encod-
ing different antigens may boost the immune response to
each element, due to the synergistic immunostimulatory
effect of the additional CpG motifs. However, it is possible
IL-12 IFN-g IgM
7.6
1.4 5.0
1.2 4.6
0.6
8.1
1.9 4.6
1.5 5.2
1.6
1.0
0.1 1.1
0.2 1.2
0.2
7.7
1.6 4.0
0.9 ND
2.2
0.4 2.6
0.4 ND
1.3
0.1 0.9
0.1 0.8
0.2
the legend of
Immunological Reviews 199/2004 209
Klinman et al  CpG ODNs as immune adjuvants
Table 12. Effect of CpG motifs on DNA vaccine immunogenicity
Fold increase
Antibody titer IFN-g
CSP protein in alum 48
50 mg plasmid DNA vaccine 39
50 mg DNAse-treated DNA vaccine 2 1.1
50 mg 80% methylated DNA vaccine 6 1.8
50 mg 97% methylated DNA vaccine 1 0.9
50 mg 97% methylated DNA vaccine þ CpG ODN 19
2 mg plasmid DNA vaccine 3 0.8
2 mg CpG-enriched DNA vaccine 52
50 mg CpG-enriched DNA vaccine 54
2 mg plasmid DNA vaccine þ 50 mg CpG ODN 31
2 mg plasmid DNA vaccine þ 50 mg GpC ODN 4 1.3
BALB/c mice were immunized with 2 or 50 mg of plasmid DNA or 10 mg of
CSP protein. The effect on serum IgG anti-CS.1 antibody titer and on the
number of T cells activated by in vitro following restimulation with antigen is
shown 3 weeks post-immunization.
to overwhelm the system, if an excess of CpG ODN is
administered with high levels of DNA vaccine, uptake of
the vaccine may be inhibited, reducing the resultant immune
response (100).
In addition to their direct effect on cytokine and Ig-secreting
lymphocytes, CpG ODNs also contribute to the development
of an immune response by upregulating cell-surface expres-
sion of MHC class II molecules (3, 101, 102). Originally
demonstrated in B cells, this effect has also been observed
in professional APCs. Indeed, CpG ODNs upregulate the
expression of a variety of costimulatory molecules in DCs,
including CD40 and CD86 (101, 102), with the fraction of
stimulated APC rising as a function of CpG ODN concentra-
tion. Of particular importance, CpG ODN-mediated activa-
tion of these APCs increased their functional capacity, as
reflected by an improved ability to stimulate alloreactive T
cells (101).
Engineering CpG motifs into the plasmid vector improves
vaccine immunogenicity
A more direct approach to assess whether CpG motifs contribute
to the immunogenicity of DNA vaccines involved engineering
additional CpG motifs into the DNA vaccine backbone. This
approach was pioneered by Sato et al. (96), who substituted a
CpG-containing ampR gene for a kanR selectable marker in a
b-galactosidase-encoding plasmid. They found that the re-
engineered plasmid elicited a higher IgG antibody response,
more CTLs, and greater IFN-g production than the original
vector (96). Our lab utilized vectors engineered by VICAL, Inc.,
one of which contained multiple additional AACGTT motifs.
Mice were primed and boosted with 50, 10, or 2 mg of the
210 Immunological Reviews 199/2004
1012/PyCSP or CpG-enriched 2534/PyCSP plasmid. As seen in
Table 12, both vaccines stimulated strong antibody responses at
optimal doses of 50 mg/mouse. However, low doses of 2534/
1.6 PyCSP elicited an IgG anti-CSP response significantly higher than
5.1 a similar dose of 1012/PyCSP. These findings indicate that
additional CpG motifs decreased the amount of vaccine required
to induce antigen-specific antibody production.
4.8
There is evidence that an excess of control ODNs may inhibit
3.9 the uptake of CpG ODNs (100). This effect interferes with the
4.1
4.5 ability of CpG DNA to induce immune stimulation (100).
Recent work confirmed that the immunostimulatory activity
of CpG ODNs could be blocked by certain non-CpG motifs
(103, 104). Evidence suggests that eliminating such suppres-
sive motifs (tandem repeats of GpC) from the plasmid backbone
of a DNA vaccine improved the vaccine’s immunogenicity by
up to threefold (105).
The ability of CpG motifs to augment antibody and cytokine
production in vivo appears to be limited. For example, the
immune response induced by a CpG-optimized plasmid is no
greater than that of a conventional plasmid when both are
administered at high concentration (Table 12) (99). Similarly,
dose–response studies indicate that the ability of CpG ODNs to
stimulate spleen cells to secrete cytokine and Ig in vitro reaches a
plateau and then begins to fall. In this context, there is evi-
dence that adding too many CpG motifs to the backbone of a
plasmid vector may reduce its immunogenicity. In one report,
introducing 16 additional CpG motifs into a DNA vaccine
improved the humoral immune response elicited in vivo,
while introducing 50 such motifs reduced the response
(103). These findings suggest that the maximal stimulatory
effect of CpG motifs may require relatively low doses of DNA.
Moreover, the adjuvant effect of CpG DNA is greatest when
antigen dose is limiting. When large amounts of antigen are
delivered, adjuvanticity is modest.
A recent report documents that DNA vaccines are immuno-
genic when administered to TLR9 knockout mice which do
not respond to CpG motifs (106). While that report does not
examine low doses of vaccine, where CpG motifs have their
greatest effect, the implication remains that CpG-driven
immune activation accounts for only a modicum of DNA
vaccine immunogenicity. The number, placement, and
sequence of CpG motifs may be important. Efforts are under-
way to determine whether different motifs can preferentially
induce specific types of immune response and to identify
regions in the plasmid, where the addition of CpG motifs
provides the greatest benefit (107, 108). These efforts are
likely to yield vectors with significantly improved immuno-
stimulatory capacity for clinical use.

CpG ODN safety
Several safety concerns are raised by the use of CpG ODNs as
vaccine adjuvants. These include the possibility that ODNs
might enhance the immunogenicity of self-proteins at the
site of vaccination, thereby triggering the development of
autoimmune disease, or stimulate the production of cytokines
that increase host susceptibility to other harmful agents. The
ability of CpG DNA to promote the development of auto-
immune disease is supported by studies showing that large
amounts of bacterial DNA can elicit the production of anti-
double-stranded DNA autoantibodies in normal mice and
accelerate the development of autoimmune disease in lupus-
prone animals (109–111). CpG DNA also stimulates the pro-
duction of IL-6 and blocks the apoptotic death of activated
lymphocytes, functions that predispose to the development of
autoimmune disease by facilitating the persistence of self-
reactive lymphocytes (112–115).
To evaluate this safety concern, mice were repeatedly injected
with immunostimulatory doses of CpG DNA. Although the
number of IgG anti-DNA-secreting B cells rose by twofold to
threefold (116) and serum IgG anti-DNA antibody titers rose by
up to 60%, these effects were insufficient to induce or accel-
erate systemic autoimmune disease (116–118).
The situation was somewhat more complex for organ-
specific autoimmune disease, whose induction is promoted
by the type of Th1 response preferentially elicited by CpG
DNA. In an IL-12-dependent model of experimental allergic
encephalomyelitis, animals treated with CpG DNA and then
challenged with myelin basic protein developed autoreactive
Th1 effector cells that caused experimental allergic encephalo-
myelitis (119, 120). In a molecular mimicry model, CpG DNA
co-administered with Chlamydia-derived antigens promoted
the induction of autoimmune myocarditis (121). Finally, in
several arthritis models, systemic administration of CpG
ODNs increased the susceptibility of mice to develop joint
inflammation (122). These findings and others indicate that
CpG motifs may trigger deleterious autoimmune reactions
under certain circumstances. There is also evidence that CpG
ODNs enhance the production of TNF-a. The over-production
of TNF-a can cause life-threatening toxic shock. Indeed,
when CpG ODN was administered with other agents
that promote TNF-a release (such as lipopolysaccharide or
D-galactosamine), severe mortality and morbidity was observed
(123–125).
To examine whether such toxicity is expected under normal
circumstances, CpG ODNs at doses equal to or exceeding that
typically used in adjuvant experiments were injected weekly
Klinman et al  CpG ODNs as immune adjuvants
for 4 months into normal BALB/c mice. All of the animals
remained physically vigorous (126); none became sick, lost
weight, or died. Cohorts of mice killed 1–30 days after the end
of treatment were examined histologically. None showed
macroscopic or microscopic evidence of tissue damage or
inflammation (126). Similarly, no adverse health effects
were reported in studies involving the delivery of CpG ODNs
to non-human primates (37), when hundreds of milligrams of
anti-sense ODNs were administered repeatedly to patients
(127) or when DNA vaccines composed of bacterial plasmids
that contain CpG motifs were administered to normal volun-
teers (84, 128). Thus, while concern remains that CpG ODNs
might have adverse effects under certain conditions, there is
no evidence that even multiple doses of CpG ODNs are directly
toxic to normal animals.
Human clinical experience
CpG ODNs have been used in over a dozen clinical trials
involving more than 500 subjects. These studies include
phase I trials designed to explore the safety and immuno-
modulatory properties of CpG ODNs delivered alone or in
combination with vaccines, antibodies, or allergens and
phase II studies designed to evaluate whether CpG ODNs
may be useful in the treatment of cancer, allergy, or as
immune adjuvants. Limited information concerning the out-
come of these trials has been released.
Two clinical trials in which CpG ODNs were used as vaccine
adjuvants have been described. The first was a double-blind
study in which up to 1 mg of CpG ODNs was co-administered
multiple times with Engerix-B (the licensed hepatitis B vac-
cine). Recipients were healthy, non-immune, adult volunteers.
Vaccine plus CpG ODNs induced a serum IgG anti-hepatitis B
antibody response more rapidly than vaccine alone. The geo-
metric mean titer of anti-hepatitis B antibodies among subjects
treated with CpG ODNs plus vaccine was 13–45-fold higher
than that in recipients of vaccine alone after both primary and
secondary immunization (85, 129).
In the second double-blind study, 1 mg of CpG ODNs was
co-administered with the Fluarix influenza vaccine. Inclusion of
CpG ODNs did not increase the antibody response of naive
recipients, when compared to Fluarix alone, but did significantly
increase anti-HI titers among subjects with pre-existing anti-flu
antibodies. PBMCs from CpG ODN-vaccinated subjects
responded to in vitro re-stimulation by secreting significantly
higher levels of IFN-g than PBMCs from control vaccinees (129).
Adverse events (AEs) were reported for all groups of vaccine
recipients. These were predominantly injection site reactions
Immunological Reviews 199/2004 211
Klinman et al  CpG ODNs as immune adjuvants
(such as pain and erythema) and flu-like symptoms that were
short lived, and the AEs did not interfere with the activities of
daily living. The intensity of the AEs was similar in all groups,
although the frequency of AEs was higher among those
co-vaccinated with CpG ODNs versus vaccine alone. No
serious AEs attributed to use of CpG ODNs were observed.
There were no clinically relevant changes in hematocrit or
white blood cell count among immunized volunteers, nor
were there any changes in liver or renal function. None of the
subjects exposed to CpG ODNs developed signs or symptoms of
autoimmune disease (130).
Conclusions
CpG ODNs stimulate cells that express TLR9, initiating an
immunomodulatory cascade that culminates in the production
of Th1 and pro-inflammatory cytokines and chemokines. CpG
ODNs also improve the antigen-presenting function of DCs,
monocytes, and macrophages, induce the proliferation of
B cells, stimulate the immunoprotective activity of NK cells,
and recruit T cells to the site of ODN administration
(8, 51, 101, 131). These diverse effects of CpG ODN on the
host’s immune milieu underlie their value as vaccine adjuvants.
Findings from multiple labs indicate that the CpG motifs
present in DNA vaccines may serve an immunostimulatory
function, triggering a response that promotes humoral and/or
cell-mediated responses against environmental and plasmid-
encoded antigens. This model is consistent with that of Fearon
and Locksley (132), who postulated that an innate immune
response could create an immune milieu conducive to the
development of antigen-specific immunity. However, there
are limitations to the contribution of CpG motifs to DNA
vaccines. These include the existence of multiple different
types of CpG motifs that have divergent (and in some cases
cross-inhibitory) effects on primate immune cells (13). Differ-
ences in motif recognition between species also complicates
pre-clinical testing of CpG-enhanced DNA vaccines. In addition,
it is likely that CpG motifs are responsible for only a fraction of
the immunogenicity of DNA vaccines, with other factors (such
as efficiency of plasmid uptake by specific cell types and the
level and duration of protein expression) having a major impact
on plasmid function. It should also be noted that CpG ODNs
are typically synthesized from nuclease-resistant phosphor-
othioate-modified nucleotides. By comparison, the phospho-
diester CpG motifs present in DNA vaccines are less
immunostimulatory (on a molar basis), presumably due to
their shorter in vivo half-life.
212 Immunological Reviews 199/2004
There is consistent evidence that CpG ODNs function as
adjuvants when co-administered with conventional protein-
based vaccines, boosting antigen-specific antibody and cell-
mediated immune responses. CpG ODN can both accelerate
and magnify vaccine-specific immunity. These effects could
be of considerable benefit when the rapid induction of a
protective immune response is required (e.g. when con-
fronted by the release of a biopathogen) (133). Yet the
adjuvant effect of CpG ODNs appears to be strongest when
the amount of immunogen being administered is subopti-
mal. This is usually referred to as an ‘antigen-sparing effect’.
When high doses of vaccine are administered, the magnitude
of the immunologic boosting attributable to CpG ODN is
modest.
The utility of CpG ODN is underscored by their ability to
enhance mucosal as well as systemic immunity. This is of
considerable importance for pathogens that gain access to the
host through the respiratory, gastrointestinal, and reproduc-
tive tracts. Several studies show that the co-administration of
CpG ODNs with vaccines significantly increases antigen-
specific IgA levels at mucosal sites and IgG levels systemically
(58, 60, 68). An additional benefit of CpG ODNs is their
ability to boost immunity in groups with reduced immune
function, such as newborns, the elderly, and the immuno-
suppressed.
Pre-clinical studies involving non-human primates confirm
the expectation that CpG ODNs selected for their ability to
stimulate human immune cells are active in vivo. While the
magnitude of this effect varies with the type of antigen and
ODN utilized, studies involving HKLV indicate that CpG
ODNs can convert an otherwise ineffective vaccine to one
that provides significant protection from infection (37),
while studies with Engerix B document that CpG ODNs
facilitate the induction of protective immunity in immuno-
compromised hosts (84).
Clinical studies designed to evaluate the safety and activity of
CpG ODNs in humans are ongoing. Available results suggest
that these agents are safe, and in some cases, boost the immu-
nogenicity of co-administered vaccines. Efforts continue to (i)
identify ODNs of different classes that are optimally active in
humans when co-administered with different vaccines, (ii)
determine how these different classes of ODNs regulate dis-
crete elements of the immune response, (iii) monitor the
long-term safety of CpG ODN, and (iv) establish the optimal
dose, duration, and site(s) of vaccine/ODN delivery. We
expect these efforts to further improve the utility of CpG-
based vaccines for the induction of protective immunity
against infectious pathogens.

References
1. Yamamoto S, et al. Antitumor effect of nucleic
acid fraction from bacteria. Proc Jpn Soc
Immunol 1989;48:272–281.
2. Yamamoto S, et al. Unique palindromic
sequences in synthetic oligonucleotides are
required to induce IFN and augment IFN-
mediated natural killer activity. J Immunol
1992;148:4072–4076.
3. Krieg AM, et al. CpG motifs in bacterial DNA
trigger direct B-cell activation. Nature
1995;374:546–548.
4. Klinman DM, Yi A, Beaucage SL, Conover J,
Krieg AM. CpG motifs expressed by bacterial
DNA rapidly induce lymphocytes to secrete
IL-6, IL-12 and IFNg. Proc Natl Acad Sci USA
1996;93:2879–2883.
5. Razin A, Friedman J. DNA methylation and its
possible biological roles. Prog Nucleic Acid
Res Mol Biol 1981;25:33–52.
6. Cardon LR, Burge C, Clayton DA, Karlin S.
Pervasive CpG suppression in animal
mitochondrial genomes. Proc Natl Acad Sci
USA 1994;91: 3799–3803.
7. Wagner H. Bacterial CpG-DNA activates
immune cells to signal ‘infectious danger’.
Adv Immunol 1999;73:329–368.
8. Sun S, Zhang X, Tough DF, Sprent J. Type I
interferon-mediated stimulation of T cells
by CpG DNA. J Exp Med 1998;188:
2335–2342.
9. Stacey KJ, Sweet MJ, Hume DA. Macrophages
ingest and are activated by bacterial DNA.
J Immunol 1996;157:2116–2120.
10. Ballas ZD, Rasmussen WL, Krieg AM.
Induction of NK activity in murine and
human cells by CpG motifs in
oligodeoxynucleotides and bacterial DNA.
J Immunol 1996;157:1840–1847.
11. Roman M, et al. Immunostimulatory DNA
sequences function as T helper-1 promoting
adjuvants. Nat Med 1997;3:849–854.
12. Halpern MD, Kurlander RJ, Pisetsky DS.
Bacterial DNA induces murine interferon-
gamma production by stimulation of IL-12
and tumor necrosis factor-alpha. Cell
Immunol 1996;167:72–78.
13. Gursel M, Verthelyi D, Gursel I, Ishii KJ,
Klinman DM. Differential and competitive
activation of human immune cells by distinct
classes of CpG oligodeoxynucleotides.
J Leukoc Biol 2002;71:813–820.
14. Medzhitov R, Janeway CA. Innate immunity:
the virtues of a nonclonal system of
recognition. Cell 1998;91:295–298.
15. Underhill DM, Ozinsky A. Toll-like receptors:
key mediators of microbe detection. Curr
Opin Immunol 2002;14:103–110.
16. Vasselon T, Detmers PA. Toll receptors: a
central element in innate immune responses.
Infect Immun 2002;70:1033–1041.
17. Hemmi H, et al. A Toll-like receptor
recognizes bacterial DNA. Nature
2000;408:740–745.
18. Takeshita F, et al. Cutting edge: role of
Toll-like receptor 9 in CpG DNA-induced
activation of human cells. J Immunol
2001;167:3555–3558.
19. Bauer S, et al. Human TLR9 confers
responsiveness to bacterial DNA via
species-specific CpG motif recognition.
Proc Natl Acad Sci USA 2001;98: 9237–9242.
20. Hornung V, et al. Quantitative expression of
toll-like receptor 1-10 mRNA in cellular
subsets of human peripheral blood
mononuclear cells and sensitivity to CpG
oligodeoxynucleotides. J Immunol
2002;168:4531–4537.
21. Yi AK, et al. CpG motifs in bacterial DNA
activate leukocytes through the pH-dependent
generation of reactive oxygen species. J
Immunol 1998;160:4755–4761.
22. Hacker H, et al. CpG-DNA-specific activation
of antigen-presenting cells requires stress
kinase activity and is preceded by non-specific
endocytosis and endosomal maturation.
EMBO J 1998;17:6230–6240.
23. Takeshita F, Ishii KJ, Ueda A, Ishigatsubo Y,
Klinman DM. Positive and negative regulatory
elements contribute to CpG oligonucleotide-
mediated regulation of human IL-6
gene expression. Eur J Immunol 2000;30:
108–116.
24. Yamamoto M, et al. Cutting edge: a novel
Toll/IL-1 receptor domain-containing adapter
that preferentially activates the IFN-beta
promoter in the Toll-like receptor signaling.
J Immunol 2002;169:6668–6672.
25. Takeshita F, Klinman DM. CpG
ODN-mediated regulation of IL-12 p40
transcription. Eur J Immunol 2000;30:
1967–1976.
26. Hacker H, et al. Immune cell activation by
bacterial CpG-DNA through myeloid
differentiation marker 88 and tumor necrosis
factor receptor-associated factor (TRAF) 6.
J Exp Med 2000;192:595–600.
27. Aderem A, Ulevitch RJ. Toll-like receptors in
the induction of the innate immune response.
Nature 2000;406:782–787.
28. Rankin R, et al. CpG motif identification for
veterinary and laboratory species
demonstrates that sequence recognition is
highly conserved. Antisense Nucleic Acid
Drug Dev 2001;11:333–340.
29. Kadowaki N, et al. Subsets of human dendritic
cell precursors express different toll-like
receptors and respond to different microbial
antigens. J Exp Med 2001;194:863–869.
30. Krug A, et al. Toll-like receptor expression
reveals CpG DNA as a unique microbial
stimulus for plasmacytoid dendritic cells
Immunological Reviews 199/2004
Klinman et al  CpG ODNs as immune adjuvants
which synergizes with CD40 ligand to induce
high amounts of IL-12. Eur J Immunol
2001;31:3026–3037.
31. Bauer M, et al. Bacterial CpG DNA triggers
activation and maturation of human CD11c(–),
CD123(þ) dendritic cells. J Immunol
2001;166:5000–5007.
32. Verthelyi D, Ishii KJ, Gursel M, Takeshita F,
Klinman DM. Human peripheral blood cells
differentially recognize and respond to two
distinct CpG motifs. J Immunol 2001;
166:2372–2377.
33. Hartmann G, et al. Delineation of a CpG
phosphorothioate oligodeoxinucleotide
for activating primate immune responses in
vitro and in vivo. J Immunol 2000;164:
1617–1624.
34. Hartmann G, et al. Rational design of new
CpG oligonucleotides that combine B cell
activation with high IFN-alpha induction in
plasmacytoid dendritic cells. Eur J Immunol
2003;33:1633–1641.
35. Marshall JD, et al. Identification of a novel
CpG DNA class and motif that optimally
stimulate B cell and plasmacytoid dendritic
cell functions. J Leukoc Biol 2003;73:
781–792.
36. Hartmann G, Krieg AM. Mechanism and
function of a newly identified CpG DNA
motif in human primary B cells. J Immunol
2000;164:944–952.
37. Verthelyi D, et al. CpG oligodeoxynucleotides
as vaccine adjuvants in primates. J Immunol
2002;168:1659–1663.
38. Verthelyi D, Klinman DM. Immunoregulatory
activity of CpG oligonucleotides in humans
and nonhuman primates. Clin Immunol
2003;109:64–71.
39. Davis HL, et al. CpG DNA overcomes
hyporesponsiveness to hepatitis B vaccine
in orangutans. Vaccine 2000;18:
1920–1924.
40. Broide DH, et al. Systemic administration of
immunostimulatory DNA sequences mediates
reversible inhibition of Th2 responses in a
mouse model of asthma. J Clin Immunol
2001;21:175–182.
41. Bauer M, Heeg K, Wagner H, Lipford GB.
DNA activates human immune cells through a
CpG sequence-dependent manner.
Immunology 1999;97:699–705.
42. Bohle B, Orel L, Kraft D, Ebner C.
Oligodeoxynucleotides containing CpG
motifs induce low levels of TNF-alpha
in human B lymphocytes: possible adjuvants
for Th1 responses. J Immunol 2001;166:
3743–3748.
43. Leifer CA, Verthelyi D, Klinman DM. CpG
ODN mixtures optimally activate human
PBMC. Interfaces between innate and adaptive
immunity. Keystone Symp 2001, 22–27.
213
Klinman et al  CpG ODNs as immune adjuvants
44. Leifer C, Verthelyi D, Klinman DM. Human
response to immunostimulatory CpG
oligondeoxynucleotides. J Immunother
2003;26:313–318.
45. Klinman DM, Currie D. Hierarchical
recognition of CpG motifs expressed by
immunostimulatory oligodeoxynucleotides.
Clin Exp Immunol 2003;133:227–232.
46. Klinman DM. Therapeutic applications of
CpG-containing oligodeoxynucleotides.
Antisense Nucleic Acid Drug Dev
1998;8:181–184.
47. Tighe H, et al. Conjugation of protein to
immunostimulatory DNA results in a rapid,
long-lasting and potent induction of cell-
mediated and humoral immunity. Eur J
Immunol 2000;30:1939–1947.
48. Gursel I, Gursel M, Ishii KJ, Klinman DM.
Sterically stabilized cationic liposomes
improve the uptake and immunostimulatory
activity of CpG oligonucleotides. J Immunol
2001;167:3324–3328.
49. Shirota H, et al. Novel roles of CpG
oligodeoxynucleotides as a leader for the
sampling and presentation of CpG-tagged
antigen by dendritic cells. J Immunol
2001;167:66–74.
50. Klinman DM, Barnhart KM, Conover J. CpG
motifs as immune adjuvants. Vaccine
1999;17:19–25.
51. Lipford GB, et al. Immunostimulatory DNA:
sequence-dependent production of
potentially harmful or useful cytokines. Eur J
Immunol 1997;27:3420–3426.
52. Weiner GJ, Liu HM, Wooldridge JE, Dahle CE,
Krieg AM. Immunostimulatory
oligodeoxynucleotides containing the CpG
motif are effective as immune adjuvants in
tumor antigen immunization. Proc Natl Acad
Sci USA 1997;94:10833–10837.
53. Chu RS, Targoni OS, Krieg AM, Lehmann PV,
Harding CV. CpG oligodeoxynucleotides act
as adjuvants that switch on T helper (Th1)
immunity. J Exp Med 1997;186:1623–1631.
54. Chu RS, Askew D, Harding CV. CpG DNA
switches on Th1 immunity and modulates
antigen-presenting cell function. Curr Top
Microbiol Immunol 2000;247:199–210.
55. Askew D, Chu RS, Krieg AM, Harding CV. CpG
DNA induces maturation of dendritic cells with
distinct effects on nascent and recycling MHC-
II antigen-processing mechanisms. J Immunol
2000;165:6889–6895.
56. Davis HL, et al. CpG DNA is a potent enhancer
of specific immunity in mice immunized with
recombinant hepatitis B surface antigen. J
Immunol 1998;160:870–876.
57. Tighe H, et al. Conjugation of
immunostimulatory DNA to the short
ragweed allergen amb a 1 enhances its
immunogenicity and reduces its allergenicity.
J Allergy Clin Immunol 2000;106:124–134.
214 Immunological Reviews 199/2004
58. Moldoveanu Z, Love-Homan L, Huang WQ,
Krieg AM. CpG DNA, a novel immune
enhancer for systemic and mucosal
immunization with influenza virus. Vaccine
1998;16:1216–1224.
59. Kovarik J, et al. CpG oligonucleotides can
circumvent the TH2 polorization of neonatal
responses to vaccines but fail to fully redirect
TH2 responses established by neonatal
priming. J Immunol 1999;162:1611–1617.
60. McCluskie MJ, Davis HL. CpG DNA is a potent
enhancer of systemic and mucosal immune
responses against hepatitis B surface antigen
with intranasal administration to mice. J
Immunol 1998;161:4463–4466.
61. Millan CLB, Weeratna R, Krieg AM, Siegrist CA,
Davis HL. CpG DNA can induce strong Th1
humoral and cell-mediated immune
responses against hepatitis B surface antigen
in young mice. Proc Natl Acad Sci USA
1998;95:15553–15558.
62. Eastcott JW, et al. Oligonucleotide containing
CpG motifs enhances immune response to
mucosally or systemically administered
tetanus toxoid. Vaccine 2001;19:
1636–1642.
63. Oxenius A, Martinic MM, Hengartner H,
Klenerman P. CpG-containing
oligonucleotides are efficient adjuvants for
induction of protective antiviral immune
responses with T-cell peptide vaccines. J Virol
1999;73:4120–4126.
64. Branda RF, et al. Amplification of antibody
production by phosphorothioate
oligodeoxynucleotides. J Lab Clin Med
1996;128:329–338.
65. Prince GA, et al. Immunoprotective activity
and safety of a respiratory syncytial virus
vaccine: mucosal delivery of fusion
glycoprotein with a CpG
oligodeoxynucleotide adjuvant. J Virol
2003;77:13156–13160.
66. Klinman DM, Xie H, Little SF, Currie D, Ivins
B. CpG oligonucleotides improve the
protective immune response induced by the
anthrax vaccination of rhesus macaques.
Vaccine (in press).
67. Ashkar AA, Bauer S, Mitchell WJ, Vieira J,
Rosenthal KL. Local delivery of CpG
oligodeoxynucleotides induces rapid changes
in the genital mucosa and inhibits replication,
but not entry, of herpes simplex virus type 2.
J Virol 2003;77:8948–8956.
68. Horner AA, et al. Immunostimulatory DNA is
a potent mucosal adjuvant. Cell Immunol
1998;190:77–82.
69. McCluskie MJ, Davis HL. Oral, intrarectal and
intranasal immunizations using CpG and non-
CpG oligodeoxynucleotides as adjuvants.
Vaccine 2000;19:413–422.
70. Sterzl J, Silverstein AM. Developmental
aspects of immunity. Adv Immunol 1967;
6:337–459.
71. Hunt DW, Huppertz HI, Jiang HJ, Petty RE.
Studies of human cord blood dendritic cells:
evidence for functional immaturity. Blood
1994;84:4333–4343.
72. Mor G, et al. Induction of neonatal tolerance
by plasmid DNA vaccination of mice. J Clin
Invest 1997;98:2700–2705.
73. Ishii KJ, Weiss WR, Klinman DM. Prevention
of neonatal tolerance by a plasmid encoding
granulocyte-macrophage colony stimulating
factor. Vaccine 1999;18:703–710.
74. Zhang J, Silvestri N, Whitton JL, Hassett DE.
Neonates mount robust and protective adult-
like CD8(þ) T-cell responses to DNA
vaccines. J Virol 2002;76:11911–11919.
75. Bot A, Bot S, Bona C. Enhanced protection
against influenza virus of mice immunized as
newborns with a mixture of plasmids
expressing hemagglutinin and nucleoprotein.
Vaccine 1998;16:1675–1682.
76. von Stebut E, et al. Leishmania major infected
murine langerhans cell-like dendritic cells
from susceptible mice release IL-12 after
infection and vaccinate against experimental
cutaneous leishmaniasis. Eur J Immunol
2000;30:3498–3506.
77. Jones TR, et al. Synthetic
oligodeoxynucleotides containing CpG
motifs enhance immunogenic vaccine in
Aotus monkeys. Vaccine 1999;17:
3065–3071.
78. Pacanowski J, et al. Reduced blood CD123þ
(lymphoid) and CD11cþ (myeloid) dendritic
cell numbers in primary HIV-1 infection.
Blood 2001;98:3016–3021.
79. Azzoni L, et al. Sustained impairment of IFN-
gamma secretion in suppressed HIV-infected
patients despite mature NK cell recovery:
evidence for a defective reconstitution of
innate immunity. J Immunol
2002;168:5764–5770.
80. Chehimi J, et al. Persistent decreases in
blood plasmacytoid dendritic cell number
and function despite effective highly
active antiretroviral therapy and increased
blood myeloid dendritic cells in HIV-
infected individuals. J Immunol 2002;168:
4796–4801.
81. Corbett EL, et al. HIV-1/AIDS and the control
of other infectious diseases in Africa. Lancet
2002;359:2177–2187.
82. Diamant EP, Schechter C, Hodes DS, Peters VB.
Immunogenicity of hepatitis B vaccine in
human immunodeficiency virus-infected
children. Pediatr Infect Dis J 1993;12:877–878.
83. Wong EK, Bodsworth NJ, Slade MA, Mulhall BP,
Donovan B. Response to hepatitis B
vaccination in a primary care setting:
influence of HIV infection, CD4þ lymphocyte
count and vaccination schedule. Int J STD
AIDS 1996;7:490–494.
84. Verthelyi D, et al. CpG oligodeoxynucleotides
protect normal and SIV-infected macaques

from leishmania infection. J Immunol
2003;170:4717–4723.
85. Halperin SA, et al. A phase I study of the
safety and immunogenicity of recombinant
hepatitis B surface antigen co-administered
with an immunostimulatory
phosphorothioate oligonucleotide
adjuvant. Vaccine 2003;21:2461–2467.
86. Ulmer JB, et al. Heterologous protection
against influenza by injection of DNA
encoding a viral protein (see comments).
Science 1993;259:1745–1749.
87. Sedegah M, Hedstrom R, Hobart P, Hoffman
SL. Protection against malaria by
immunization with plasmid DNA encoding
circumsporozoite protein. Proc Natl Acad Sci
USA 1994;91:9866–9870.
88. Cox GJ, Zamb TJ, Babiuk LA. Bovine
herpesvirus 1: immune responses in mice
and cattle injected with plasmid DNA. J Virol
1993;67:5664–5667.
89. Wang B, et al. Gene inoculation generates
immune responses against human
immunodeficiency virus type 1. Proc Natl
Acad Sci USA 1993;90:4156–4160.
90. Tang D, DeVit M, Johnston SA. Genetic
immunization is a simple method for
eliciting an immune response. Nature
1992;356: 152–154.
91. Wolff JA, et al. Direct gene transfer into
mouse muscle in vivo. Science
1990;247:1465–1468.
92. Manthorpe M, et al. Gene therapy by
intramuscular injection of plasmid
DNA: studies on firefly luciferase gene
expression in mice. Hum Gene Ther
1993;4:419–431.
93. Mor G, et al. Complexity of the cytokine and
antibody response elicited by immunizing
mice with Plasmodium yoelii circumsporozoite
protein plasmid DNA. J Immunol
1995;155:2039–2046.
94. Wang R, et al. Induction of antigen specific
cytotoxic T lymphocytes in humans by a
malaria DNA vaccine. Science 1998;282:
476–480.
95. Calarota S, et al. Cellular cytotoxic response
induced by DNA vaccination in HIV-1
infected patients. Lancet 1998;351:
1320–1325.
96. Sato Y, et al. Immunostimulatory DNA
sequences necessary for effective intradermal
gene immunization. Science 1996;273:
352–354.
97. Snapper CM, Paul WE. B cell stimulatory
factor-1 (IL-4) prepares resting murine
B cells to secrete IgG1 upon subsequent
stimulation with bacterial
lipopolysaccharide. J Immunol
1987;139:10–18.
98. Finkleman FD, Katona IM, Mosmann TR,
Coffman RC. Interferon gamma regulates the
isotype of Ig secreting during in vivo
humoral responses. J Immunol
1988;140:1022–1030.
99. Klinman DM, Yamshchikov G, Ishigatsubo Y.
Contribution of CpG motifs to the
immunogenicity of DNA vaccines.
J Immunol 1997;158:3635–3642.
100. Weeratna R, Brazolot CL, Millan B, Krieg AM,
Davis HL. Reduction of antigen expression
from DNA vaccines by coadministered
oligodeoxynucleotides. Antisense Nucleic
Acid Drug Dev 1998;8:351–356.
101. Jakob T, Walker PS, Krieg AM, Udey MC,
Vogel JC. Activation of cutaneous dendritic
cells by CpG containing
oligodeoxynucleotides: a role for dendritic
cells in the augmentation of Th1 responses
by immunostimulatory DNA. J Immunol
1998;161:3042–3049.
102. Sparwasser T, et al. Bacterial DNA and
immunostimulatory CpG oligonucleotides
trigger maturation and activation of murine
dendritic cells. Eur J Immunol
1998;28:2045–2054.
103. Krieg AM, et al. Sequence motifs in
adenoviral DNA block immune activation by
stimulatory CpG motifs. Proc Natl Acad Sci
USA 1998;95:12631–12636.
104. Gursel I, et al. Repetitive elements
in mammalian telomeres suppress
bacterial DNA-induced immune
activation. J Immunol 2003;171:
1393–1400.
105. Krieg AM, Davis HL. Enhancing vaccines
with immune stimulatory CpG DNA. Curr
Opin Mol Ther 2001;3:15–24.
106. Spies B, et al. Vaccination with plasmid
DNA activates dendritic cells via
TLR9 but functions in TLR9-deficient
mice. J Immunol 2003;171:5908–5912.
107. Kojima Y, et al. Adjuvant effect of multi-CpG
motifs on an HIV-1 DNA vaccine. Vaccine
2002;20:2857–2865.
108. Rodriguez EG, Vazquez DM, Herrera AM,
Duarte CA. Enhanced cell-mediated IFN-
gamma-secreting activity against the HIV-
1IIIB V3 peptide of the TAB9 multiepitope
after DNA vaccine backbone engineering.
Biochem Biophys Res Commun
2003;308:713–718.
109. Gilkeson GS, Riuz P, Howell D, Lefkowith JB,
Pisetsky DS. Induction of immune-mediated
glomerulonephritis in normal mice
immunized with bacterial DNA. Clin
Immunol Immunopathol 1993;68:
283–292.
110. Gilkeson GS, Pippen AM, Pisetsky DS.
Induction of cross-reactive anti-dsDNA
antibodies in preautoimmune NZB/NZW
mice by immunization with bacterial DNA. J
Clin Invest 1995;95:1398–1402.
111. Steinberg AD, Krieg AM, Gourley MF,
Klinman DM. Theoretical and experimental
Immunological Reviews 199/2004
Klinman et al  CpG ODNs as immune adjuvants
approaches to generalized autoimmunity.
Immunol Rev 1990;118:129–163.
112. Klinman DM. Polyclonal B cell activation in
lupus-prone mice precedes and predicts the
development of autoimmune disease. J Clin
Invest 1990;86:1249–1254.
113. Linker-Israeli M, et al. Elevated levels of
endogenous IL-6 in systemic lupus
erythematosus. J Immunol 1991;147:
117–123.
114. Krieg AM. CpG DNA: a pathogenic factor in
systemic lupus erythematosus? J Clin
Immunol 1995;15:284–292.
115. Yi A-K, Hornbeck P, Lafrenz DE, Krieg AM.
CpG DNA rescue of murine B lymphoma
cells from anti-IgM induced growth
arrest and programmed cell death is
associated with increased expression of
c-myc and bcl-xl. J Immunol 1996;157:
4918–4925.
116. Mor G, et al. Do DNA vaccines induce
autoimmune disease? Hum Gene Ther
1997;8:293–300.
117. Katsumi A, et al. Humoral and cellural
immunity to an encoded protein induced by
direct DNA injection. Hum Gene Ther
1994;5:1335–1339.
118. Gilkeson GS, et al. Effects of bacterial DNA
on cytokine production by (NZB/NZW) F1
mice. J Immunol 1998;161:3890–3895.
119. Segal BM, Klinman DM, Shevach EM.
Microbial products induce autoimmune
disease by an IL-12 dependent process. J
Immunol 1997;158:5087–5091.
120. Segal BM, Chang JT, Shevach EM. CpG
oligonucleotides are potent adjuvants for the
activation of autoreactive encephalotogenic
T cells in vivo. J Immunol 2000;164:
5683–5688.
121. Bachmaier K, et al. Chlamydia infections and
heart disease linked through antigenic
mimicry. Science 1999;283:1335–1339.
122. Zeuner RA, Verthelyi D, Gursel M, Ishii KJ,
Klinman DM. Influence of stimulatory and
suppressive DNA motifs on host
susceptibility to inflammatory arthritis.
Arthritis Rheum 2003;48:1701–1707.
123. Sparwasser T, et al. Bacterial DNA causes
septic shock. Nature 1997;386:336–338.
124. Cowdery JS, Chace JH, Yi A-K, Krieg AM.
Bacterial DNA induces NK cells to produce
IFN gamma in vivo and increases the toxicity
of lipopolysaccharides. J Immunol
1996;156:4570–4575.
125. Hartmann G, Krug A, Waller K, Endres S.
Oligodeoxynucleotides enhance LPS-
stimulated synthesis of TNF: dependence on
phosphorothioate modification and reversal
by heparin. Mol Med 1996;2:429–438.
126. Klinman DM, et al. DNA vaccines: safety and
efficacy issues. Springer Semin
Immunopathol 1997;19:245–256.
215
Klinman et al  CpG ODNs as immune adjuvants
127. Yacyshyn BR, et al. Dose ranging
pharmacokinetic trial of high-dose
alicaforsen (intercellular adhesion molecule-
1 antisense oligodeoxynucleotide) (ISIS
2302) in active Crohn’s disease. Aliment
Pharmacol Ther 2002;16:1761–1770.
128. Liu MA. DNA vaccines: a review. J Intern
Med 2003;253:402–410.
129. Klinman DM, et al. Immunotherapeutic
applications of CpG-containing
oligodeoxynucleotides. Drug News Perspect
2000;13:289–296.
130. Klinman DM. CpG DNA as a vaccine
adjuvant. Expert Rev Vaccines 2003;2:
305–315.
216 Immunological Reviews 199/2004
131. Sparwasser T, et al. Macrophages sense
pathogens via DNA motifs: induction of
tumor necrosis factor-a-mediated shock. Eur
J Immunol 1997;27:1671–1679.
132. Fearon DT, Locksley RM. The instructive role
of innate immunity in the acquired immune
response. Science 1996;272:50–53.
133. Klinman DM, Verthelyi D, Takeshita F,
Ishii KJ. Immune recognition of foreign
DNA. a cure for bioterrorism? Immunity
1999;11:123–129.
134. von Hunolstein C, et al. The adjuvant
effect of synthetic oligodeoxynucleotide
containing CpG motif converts the
anti-haemophilus influenzae
type b glycoconjugates into efficient
anti-polysaccharide and anti-carrier
polyvalent vaccines. Vaccine 2001;19:
3058–3066.
135. Al Mariri A, et al. Protection of BALB/c mice
against Brucella abortus 544 challenge by
vaccination with bacterioferritin or P39
recombinant proteins with CpG
oligodeoxynucleotides as adjuvant. Infect
Immun 2001;69:4816–4822.