The stimulation of osteogenic differentiation of mesenchymal stem

cells and vascular endothelial growth factor secretion of endothelial

cells by b-CaSiO3/b-Ca3(PO4)2 scaffolds

Chen Wang,1 Kaili Lin,2 Jiang Chang,2 Jiao Sun1

1
Shanghai Biomaterials Research & Testing Center, Shanghai Key Laboratory of Stomatolog, Ninth People’s Hospital,
Shanghai Jiaotong University School of Medicine, Shanghai 200023, People’s Republic of China
2
Shanghai Institute of Ceramics, Chinese Academy of Sciences, Shanghai 200050, People’s Republic of China

Received 30 April 2013; revised 16 June 2013; accepted 9 July 2013

Published online 2 August 2013 in Wiley Online Library (wileyonlinelibrary.com). DOI: 10.1002/jbm.a.34880

Abstract: Porous b-CaSiO3/b-Ca3(PO4)2 (b-CS/b-TCP) compos-
ite scaffolds have been previously shown to promote bone
formation in vivo. However, the mechanisms underlying such
beneficial effects remain unclear. In this study, we recreated
an extracellular environment using the extracts of b-CS/b-TCP
composites developed in our previous in vivo study, and
investigated the effects of the extracts on osteogenic differen-
tiation of rat bone marrow-derived mesenchymal stem cells
(rBMSCs) and its related mechanisms. The angiogenic poten-
tial of the extracts was also evaluated using human umbilical
vein endothelial cells (HUVECs). In the absence of osteogenic
supplements, the osteogenic differentiation of rBMSCs was
detected by alkaline phosphatase (ALP) activity assay and the
messenger RNA expression of a panel of osteoblast markers.
The results showed that the soluble ions of porous b-CS/b-
TCP composites were capable of promoting cell viability,
directly inducing cell differentiation. The increase in phos-
phorylation of AMP-activated protein kinase (AMPK) and
ERK1/2 were observed in rBMSCs cultured in b-CS/b-TCP
composite extracts. The ALP expression, calcium deposition,
and ERK1/2 phosphorylation of rBMSCs, which was pro-
moted by ions released from b-CS/b-TCP composites, were
blocked by an AMPK inhibitor, Compound C. These results
indicate that bioactive ions extracted from b-CS/b-TCP com-
posites could stimulate the osteogenic differentiation of
rBMSCs via the AMPK-Erk1/2 pathway. Interestingly, the
secretion of vascular endothelial growth factor and the viabil-
ity of HUVECs were shown to be enhanced in the presence of
extracts from the b-CS/b-TCP composite scaffolds. Our find-
ings suggest that 50 or 80% wt. CS could promote bone
regeneration by stimulating osteogenesis and angiogenesis.
C 2013 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 102A: 2096–
V
2104, 2014.
Key Words: calcium silicate, tricalcium phosphate, bioactive
ions, osteogenic differentiation, AMPK

How to cite this article: Wang C, Lin K, Chang J, Sun J. 2014. The stimulation of osteogenic differentiation of mesenchymal
stem cells and vascular endothelial growth factor secretion of endothelial cells by b-CaSiO3/b-Ca3(PO4)2 scaffolds. J Biomed
Mater Res Part A 2014:102A:2096–2104.

INTRODUCTION growth factor-b (TGF-b).12 Furthermore, we developed

The technological advances of bone tissue engineering have
made it an attractive therapeutic strategy with great poten-
tial for repairing tissue defects. Interests in this research
field mainly focused on biodegradable scaffolds and seed
cells. For an ideal scaffold, not only favorable biocompatibil-
ity and bioconductivity, but also high osteogenic potential
are needed.1–5 In recent years, calcium (Ca)- and silicon
(Si)-containing bioceramics have begun to be explored as
potential materials for bone regeneration.6–10 These biocer-
amics more effectively promote osteogenesis in vivo than
the b-Ca3(PO4)2 (b-TCP) that has been widely used in clin-
ics.2,11 Our recent study found that compact b-CaSiO3/b-
TCP (b-CS/b-TCP) composite disks were able to promote
osteoblast-like cells to synthesize the functional proteins,
bone morphogenetic protein-2 (BMP-2), and transforming
porous b-CS/b-TCP composites as potential scaffolds in
hard tissue regeneration and bone tissue engineering. The
in vivo study demonstrated that these composite scaffolds
with 50 and 80 wt % b-CS stimulated rapid bone formation
and were able to degrade progressively at a rate matching
the regeneration of new bone in a critical size defect in a
rabbit femoral condyle model.13 These preliminary studies
indicated that the porous b-CS/b-TCP composite scaffolds
may be served as a more suitable scaffold for bone tissue
engineering. However, the effects of the soluble products
released from the scaffolds on the microenvironment in vivo
and, consequently, related mechanisms that interact with
mesenchymal stem cells (MSCs) and endothelial cells (ECs)
remain an open issue which is important for extensive clini-
cal applications.

Correspondence to: J. Sun; e-mail: jiaosun59@yahoo.com

Contract grant sponsor: Major Program of National Natural Science Foundation of China; contract grant number: 81190132

2096 C 2013 WILEY PERIODICALS, INC.

V

MSCs, which are able to differentiate into various types
of cells, play an important role in bone defect repair,14–16
and they have typically been used as cell source in bone tis-
sue engineering. For successful bone scaffolds, it is neces-
sary to comprehensively understand the effects of
biomaterials on MSCs which give rise to bone-forming cells.
Various reports have showed that Ca-Si-based bioceramics
enhance marrow-derived stem cell proliferation and activate
the expression of related osteogenic genes in vitro.17,18
However, how these compounds affect pathways to regulate
the osteogenic differentiation of MSCs has not been eluci-
dated. More recently, osteogenic differentiation has been
directly correlated to metabolic activity of MSCs.19,20 Our
previous study has found that expression and phosphoryla-
tion of AMP-activated protein kinase (AMPK), which is an
energy-sensing kinase,21 were upregulated by the b-CS/
poly-D,L-lactide-glycolide (PDLGA) scaffolds.22 In this context,
we hypothesized that specific soluble products of the
porous b-CS/b-TCP composite scaffolds were also capable of
impacting the extracellular environment in a way that indu-
ces AMPK signals to promote bone regeneration.
To test this hypothesis, we used rat bone marrow-
derived mesenchymal stem cells (rBMSCs) and recreated an
extracellular environment using the extracts of porous b-
CS/b-TCP composite scaffolds (with 50 and 80 wt % b-CS)
developed in our previous in vivo study.13 We first focused
on the effects of the b-CS/b-TCP composites on the osteo-
genic differentiation of rBMSCs at both the gene and the
protein levels in the absence of osteogenic supplements to
assess the feasibility of using such scaffolds for bone engi-
neering. Furthermore, the roles of the AMPK-Erk1/2 signal-
ing pathway involved in the regulation of osteogenic
differentiation of rBMSCs were investigated.
Angiogenesis is a key process in bone regeneration and
it highly relies on the EC function.23 In our previous study,
angiogenesis was observed in the 50% CS group at 4 weeks
after implantation.13 However, the angiogenic potential of
the b-CS/b-TCP composites has not yet been investigated.
Therefore, in this study, we also explored the effect of the
b-CS/b-TCP composites on human umbilical vein endothelial
cells (HUVECs).
MATERIALS AND METHODS
Ethics statement
The experimental protocols were approved by the Animal
Care and Experiment Committee of Ninth People’s Hospital
affiliated with the School of Medicine, Shanghai Jiao Tong
University.
Materials
The porous b-CS/b-TCP composite (50 wt % b-CS and 80
wt % b-CS) and b-TCP scaffolds (Shanghai Bio-Lu Bio-
materials, Shanghai, China) were prepared as described pre-
viously.10,13,24,25 The three kinds of porous bioceramic
cylinders (34 mm 3 6 mm) had a uniform macropore size
and highly interconnected pores. Samples were sterilized by
gamma radiation at 25 KGY before use.
JOURNAL OF BIOMEDICAL MATERIALS RESEARCH A | JUL 2014 VOL 102A, ISSUE 7
ORIGINAL ARTICLE
Preparation of extracts of the biomaterials
The extracts of three types of porous scaffolds were pre-
pared by soaking the scaffolds in low-glucose Dulbecco’s
modified Eagle’s medium (L-DMEM, Hyclone, USA) or endo-
thelial cell medium (ECM, Sciencell, USA) according to the
International Organization for Standardization (ISO 10993-
12). The ratio of the scaffolds to the medium was 100 mg/
mL. After incubation at 37 C for 24 h, the supernatant was
collected. The elemental concentrations of Ca, Si, and phos-
phorus (P) in the extracts were determined by inductively
coupled plasma optical emission spectroscopy (ICP-OES;
VISTA-PRO, Agilent, USA). The pHs of the extracts were
measured with a pH test-meter (Denver UB-7, Yao Hua,
China).
Cell preparation and culture
The rBMSCs were derived from the femora of 4-week-old
Sprague–Dawley rats as described previously.26,27 Briefly,
rats were sacrificed by cervical dislocation. Bone marrow
aspirates were collected and suspended in L-DMEM supple-
mented with 10% FBS, 100 U/mL penicillin, and 100 mg/
mL streptomycin (Hyclone, USA). The cells were plated in a
10-cm tissue culture dish (Corning, USA) and cultured in a
5% CO2 atmosphere at 37 C. The cells were used for experi-
ments from the second to third passages.
HUVECs were obtained as described previously, with
written informed consent of the donors.28 Briefly, the umbil-
ical vein was rinsed with phosphate-buffered saline (PBS)
containing 100 U/mL penicillin/streptomycin, then incu-
bated with 0.1% collagenase I (Sigma, St. Louis, MO) for 15
min at 37 C. The cells were subsequently collected and
grown in ECM (Sciencell, San Diego, USA). HUVECs were
used in these experiments from the third to sixth passages.
Cell viability assays
The cell viability was quantitatively assessed with an 3-(4,5-
dimethylthiazol-2-yl)22,5-diphenyl tetrazolium bromide
(MTT) colorimetric assay. Cells (3.1 3 104 cells/cm2) were
seeded in a 96-well plate and cultured in the different
extracts for 24 h. The MTT (Sigma) was added to each well,
and cells were incubated at 37 C for 4 h. The formazan
crystals were dissolved with dimethyl sulfoxide (Sigma), and
the absorbance was measured using a microplate reader
(Labsystems Dragon Wellscan MK3, Finland) at wavelengths
of 570 and 630 nm.
Alkaline phosphatase staining and activity assay
The rBMSCs were seeded in six-well plates and cultured in
different extracts. At day 10 after passage, alkaline phospha-
tase (ALP) staining was carried out using a BCIP/NBT ALP
kit (Beyotime, Shanghai, China). Briefly, the cells were fixed
with 4% paraformaldehyde, then incubated in a mixture of
nitro-blue tetrazolium and 5-bromo-4-chloro-3-indolyl-phos-
phate.29 The ALP activity was measured using an ALP
Detection Kit (Jiancheng Technology, Nanjing, China), and
normalized to the total protein content (determined using
the BCA method, as described previously).18
2097
TABLE I. Primers Used for Real-Time RT-PCR
Target Gene Forward Primer Sequence (50 -30 )
b-Actin TTCAACACCCCAGCCATGT
RUNX-2 GCTTCTCCAACCCACGAATG
ALP CGGAAGTGAGGCAGGTAG
OCN GTGCCGTCCATACTTTCG
Alizarin Red S staining
The rBMSCs were cultured in six-well plates with different
extracts for up to 14 days. The extracellular matrix calcifica-
tion was observed using Alizarin Red S staining as
described previously.30 In brief, the cells were fixed with
4% paraformaldehyde for 15 min at room temperature and
then incubated in 1% w/v Alizarin Red S (pH, 4.1–4.5) for
20 min.
Real-time polymerase chain reaction
The osteoblastic gene transcription of RUNX-2, ALP, and
OCN was detected by real-time polymerase chain reaction
(PCR). Briefly, the total RNA of rBMSCs was extracted using
the TRIZOL reagent (Invitrogen, USA). Complementary DNA
(cDNA) was synthesized from 1.0 mg of total RNA using the
PrimeScript 1st Strand cDNA Synthesis kit (TaKaRa, Japan)
according to the manufacturer’s instructions. Quantitative-
PCR was performed with a Bio-Rad sequence detection sys-
tem (MyiQ2, USA) using a real-time PCR kit (SYBR Premix
EX Taq, TaKaRa). The housekeeping gene b-actin was used
to normalize results. The primer sequences used in this
study are listed in Table I.
Western blot analysis
Total cellular protein extracts were prepared as described
previously.28 Briefly, cells were washed twice with ice-cold
PBS and then lysed on ice for 30 min in lysis buffer (50 mM
Tris-HCl, 150 mM NaCl, 1% NP-40, 0.1% sodium dodecyl
sulfate [SDS] [Applygen, Beijing, China]) containing 1 mM
phenylmethylsulfonyl fluoride (Sigma, St. Louis, MO) and a
phosphatase-inhibitor cocktail (Sigma, St. Louis, MO). Pro-
teins from the lysate were separated by SDS-polyacrylamide
gels (separation gels, 8–12%) and electro-transferred onto
nitrocellulose membranes (Amersham Biosciences, USA).
The membranes were incubated with anti-p-ERK1/2, ERK1/
2 (1:1000, rabbit polyclonal antibodies, Bioworld Technol-
ogy, USA); anti-RUNX-2 (1:500, mouse monoclonal antibody,
Abcam, USA); or anti-p-AMPK, AMPK, or b-actin (1:1000,
rabbit polyclonal antibodies, CST, USA) overnight at 4 C and
then incubated with horseradish peroxidase-conjugated sec-
ondary antibodies for 1 h at 37 C. The antigen–antibody
complexes were visualized using an ECL chemiluminescence
reagent (Millipore, USA).
Enzyme-linked immunosorbent assay
HUVECs were plated at a density of 5.0 3 104 cells/cm2 in
six-well plates and harvested 24 h after being cultured in
the different extracts. The expression of vascular endothelial
growth factor (VEGF) in the culture medium was deter-
mined using enzyme-linked immunosorbent assay (ELISA)
2098 WANG ET AL.
Reverse Primer Sequence (50 -30 )
GTGGTACGACCAGAGGCATACA
GAACTGATAGGACGCTGACGA
AGAGCCCACAATGGACAG
GACCACATTGGCTTCCAG
kits (R&D Systems, Minneapolis, MN) according to the man-
ufacturer’s instructions.
Statistical analysis
Data were expressed as means 6 standard deviation from
three separate experiments. Statistically significant differen-
ces (p < 0.05) among the various groups were measured
using one-way ANOVA. All statistical analyses were con-
ducted using the SPSS 11.0 software.
RESULTS
The ionic concentration and pH value of the extracts
The ionic concentrations of Ca, P, and Si used in the three
extracts are listed in Table II. When compared with L-
DMEM and b-TCP, the 50% CS and 80% CS scaffolds
released much higher amounts of Ca and Si ions into the
media during the immersion period. Additionally, the con-
centration of P ions in the L-DMEM and b-TCP was approxi-
mately 40 ppm but decreased to approximately 10 ppm in
the b-CS/b-TCP composite groups. The composite scaffolds
with higher content of b-CS released higher amounts of Ca
and Si ions and lower amounts of P ions into the extracts.
As summarized in Table II, the pHs of the 50% CS and 80%
CS were 7.61 6 0.02 and 7.77 6 0.025, respectively, which
were only slightly higher than those recorded for the L-
DMEM and b-TCP (7.27 6 0.075 and 7.39 6 0.021,
respectively).
rBMSCs viability
To assess any biological effect of the extracts on rBMSCs,
cell viability was assayed after the cells were exposed to dif-
ferent extracts (b-TCP, 50% CS, and 80% CS) for 24 h. As
shown in Figure 1, rBMSCs cultured in the media supple-
mented with the b-TCP extracts did not show any significant
change in cell viability, whereas in the media supplemented
with 50% CS and 80% CS extracts, cell viability increased
significantly (p < 0.05). No statistically significant differences
were observed between the 50% CS and the 80% CS
groups.
TABLE II. Elemental Concentration of Si, Ca, and P Measured
by ICP Analysis and pH Value of Material Extracts
Measured Concentration (6SD) (mg/mL) and pH
Si Ca P pH
L-DMEM <1.0 61.5 6 0.5 40.9 6 0.3 7.27 6 0.075
b-TCP <1.0 57.2 6 0.9 38.2 6 0.7 7.39 6 0.021
50% CS 74.2 6 0.4 89.8 6 0.2 12.4 6 0.4 7.61 6 0.020
80% CS 80.6 6 0.5 95.9 6 1.0 10.4 6 0.3 7.77 6 0.025
STIMULATION OF OSTEOGENIC DIFFERENTIATION OF MSC

FIGURE 1. The viability of rBMSCs cultured for 24 h with different
extracts. Cells cultured in L-DMEM were set as the control group. The
viability is significantly higher than that of L-DMEM group (@) and
the b-TCP group (#) (p < 0.05).
The osteogenic differentiation of rBMSCs cultured with
b-CS/b-TCP extracts
Soluble products from the b-CS/b-TCP composites were
tested for potential effects on cell differentiation by examin-
ing the ALP activity. Interestingly, the rBMSCs in all groups
exhibited a time-dependent increase in the ALP activity
even when cultured in the media without osteogenic factors.
Moreover, the ALP activity of the rBMSCs in media supple-
mented with the b-CS/b-TCP composite extracts was signifi-
cantly higher at day 10 than that of the media
supplemented with the b-TCP extract and L-DMEM
(p < 0.001) (Fig. 2).
To further investigate the effects of the soluble products
from the b-CS/b-TCP composites on osteogenic differentia-
tion, real-time PCR was used to compare several markers
related to osteoblastic differentiation in the rBMSCs cul-
tured with the b-CS/b-TCP composite extracts versus the b-
TCP extract and L-DMEM. The markers identified were
RUNX-2, ALP, and OCN (Fig. 3). In the b-CS/b-TCP composite
groups, RUNX-2 and ALP expression profiles showed an
early increase at day 3, after which a significant upregula-
tion at day 10 was detected. Overall, culture in the presence
of the b-CS/b-TCP composites resulted in significantly
higher RUNX-2 and ALP messenger RNA (mRNA) than the
b-TCP and control at days 3 and 10 (p < 0.005). The mRNA
levels of OCN exhibited no significant differences among the
four groups at day 3, whereas at day 10, the expression of
OCN was significantly enhanced in rBMSCs cultured in
media supplemented with the b-CS/b-TCP extracts com-
pared with those cultured with b-TCP extract and L-DMEM
(p < 0.005).
The activation of AMPK-dependent pathways in rBMSCs
by b-CS/b-TCP extracts
To explore whether AMPK was involved in the regulation of
osteogenic differentiation observed in the rBMSCs cultured
with the b-CS/b-TCP composite extracts, we used Western
blot analysis to examine the expression of key molecules in
JOURNAL OF BIOMEDICAL MATERIALS RESEARCH A | JUL 2014 VOL 102A, ISSUE 7
ORIGINAL ARTICLE
the AMPK signaling pathway. As shown in Figure 4, p-AMPK
and p-ERK1/2 were increased in the rBMSCs cultured in
media supplemented with the b-CS/b-TCP extracts for 3
days, whereas the expression of total AMPK and total
ERK1/2 was not changed. It is notable that protein levels of
RUNX-2 were also enhanced in the b-CS/b-TCP composites
compared to the b-TCP and control.
To determine whether the activation of AMPK and
ERK1/2 is necessary for the observed stimulation of rBMSC
osteogenic differentiation, we inhibited the AMPK and
ERK1/2 signaling pathways (using Compound C and
PD98059, respectively), whereas the rBMSCs were being
subjected to the 50% CS extract induction. The ALP staining
showed that cells cultured in the 50% CS extract without
Compound C and PD98059 were intensively stained on day
10 [Fig. 5(A)]. However, ALP activity was weakened greatly
upon the addition of Compound C and PD98059. Moreover,
at 14 days, accumulated mineralized matrix deposition was
detected by Alizarin Red S staining in cells that had been
cultured with the 50% CS extract. Treatment with Com-
pound C and PD98059 resulted in a significant inhibition of
extracellular calcium deposition [Fig. 5(B)].
Based on these results, we further examined whether
AMPK might mediate the osteogenic differentiation of
rBMSCs through the ERK1/2 pathway upon stimulation
with 50% CS extract. As shown in Figure 5(C), Compound C
blocked the expression of p-ERK1/2 and RUNX-2 at 3 days.
The viability and VEGF secretion of HUVECs
To investigate the effect of the extracts on EC proliferation,
which is a hallmark event of angiogenesis, the viability and
VEGF secretion of HUVECs were evaluated 24 h after culture
with b-CS/b-TCP extracts. As shown in Figure 6(A), the pro-
liferation of the HUVECs was enhanced by the extracts of b-
CS/b-TCP. In addition, the VEGF content in the supernatant
was obviously higher in the b-CS/b-TCP composite groups
than in the b-TCP and ECM groups (p < 0.05) [Fig. 6(B)].
FIGURE 2. The ALP activity of rBMSCs cultured with different extracts.
Cells cultured in L-DMEM were set as the control group. The activity
is significantly different from the L-DMEM group (@) and the b-TCP
group (#) (p < 0.001).
2099
FIGURE 3. The gene expression profiles of osteogenic differentiation-related genes of rBMSCs cultured with different extracts. A: RUNX-2, (B)
ALP, and (C) OCN. Cells cultured in L-DMEM were set as the control group. The results are significantly different from the L-DMEM group (@)
and the b-TCP group (#) (p < 0.005).
DISCUSSION
For the regeneration of hard tissues, including bone and
tooth, recent research has focused on biomaterials combining
FIGURE 4. The activation of AMPK-ERK1/2 pathway in the osteogenic
differentiation of rBMSCs. The expression profile of key proteins in
the AMPK-ERK1/2 pathway in rBMSCs cultured for 3 days with differ-
ent extracts. Cells cultured in L-DMEM were set as the control group.
[Color figure can be viewed in the online issue, which is available at
wileyonlinelibrary.com.]
2100 WANG ET AL.
osteoconductivity with osteoinductivity. Our previous study
has shown that porous b-CS/b-TCP composite scaffolds with
varied ratios can be used to promote the repair of critical-
sized bone defects.13 However, as a scaffold for bone engi-
neering, how the soluble products released from the compo-
sites impacted their microenvironments in vivo, as well as
interaction among the composites, MSCs and ECs remained
unanswered. Recently, we have found that the bioactive ions
from b-CS/PDLGA scaffolds induced rBMSC osteogenic differ-
entiation via AMPK/Erk1/2 signaling pathway and promoted
HUVECs function.22 Nevertheless, further study would be nec-
essary to explore in detail whether b-CS/b-TCP scaffolds have
similar effects on rBMSCs and HUVECs. In this study, we simu-
lated the extracellular environment in vivo using the extracts
of porous b-CS/b-TCP composite scaffolds and investigated
whether these extracts were capable of directly inducing the
osteogenic differentiation of the rBMSCs. As hypothesized,
our results indicate that bioactive ions released from the b-
CS/b-TCP composite scaffolds may stimulate the osteogenic
differentiation of rBMSCs by activating the AMPK-Erk1/2
pathway and VEGF secretion of ECs.
The chemical composition of these scaffolds is one of
the main factors that affects cell functions. Increasing evi-
dence in the literature suggests that the soluble ionic prod-
ucts from degradable bioceramics are crucial to the process
of osteogenesis in vitro and in vivo.2,31,32 The ICP-OES data
STIMULATION OF OSTEOGENIC DIFFERENTIATION OF MSC
 ORIGINAL ARTICLE

FIGURE 5. The inhibition of AMPK and ERK pathways on the osteogenic differentiation of rBMSCs. Cells were cultured in the b-TCP and 50% of
CS extracts with or without 1 mM of Compound C and 20 mM of PD98059, respectively. A: ALP expression was stained after the cells were cul-
tured in the above extracts for 10 days. B: The extracellular calcium deposition was visualized by Alizarin Red S stain after the cells were cul-
tured in the above extracts for 14 days. C: The expression profile of key proteins in the AMPK-ERK1/2 pathway after the cells were cultured in
the above extracts for 3 days. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

show that the concentrations of Ca and Si ions increased in porous and compact b-CS/b-TCP composite extracts, which
50% CS and 80% CS extracts compared with those of the b- implies that the CS in the porous composites released more
TCP extracts (Table I). In addition, there are significant dif- bioactive ions into the extracts and their biological effect
ferences in the ionic concentrations of Ca, Si, and P between may be different.12 Furthermore, we noted that the MTT

JOURNAL OF BIOMEDICAL MATERIALS RESEARCH A | JUL 2014 VOL 102A, ISSUE 7 2101

FIGURE 6. Viability (A) and VEGF secretion (B) of HUVECs cultured for
24 h with different extracts. Cells cultured in ECM were set as the con-
trol group. The results are significantly different from the ECM group
(@) and the b-TCP group (#) (p < 0.05).
activity of the rBMSCs treated with the extracts of b-CS/b-
TCP composites was significantly enhanced compared to the
L-DMEM and b-TCP (Fig. 1). This result suggests that solu-
ble ions released from the porous b-CS/b-TCP composites
promote the metabolic activity of rBMSCs and that Si ions
may act synergistically with other ions released from the
scaffolds. This hypothesis is in line with the previous
reports, showing that Ca-Si-based ceramics stimulate cell
proliferation.2,10 In addition to the effect of these soluble
products on cell viability, another key issue is whether they
affect the osteogenic differentiation of MSCs. Hence, we fur-
ther investigated the effect of the soluble ions on the osteo-
genic differentiation of the rBMSCs.
RUNX-2 is a prerequisite for osteogenic differentiation, and
it is identified as the marker of osteogenesis.33,34 This protein
plays an important role in the regulation of the expression of
major osteoblast genes and in maintaining the function of dif-
ferentiated osteoblasts at an early stage. Therefore, in this
study, we focused on the regulation of RUNX-2 as an indicator
of the effects of bioactive ions from the b-CS/b-TCP composites
on the osteogenic differentiation of rBMSCs. In the absence of
2102 WANG ET AL.
osteogenic supplements, the expression of both the RUNX-2
gene and the protein in the b-CS/b-TCP composite groups was
significantly enhanced (when compared to b-TCP and control)
as early as day 3 [Figs. 3(A) and 4]. Furthermore, this increase
was supported by analogous levels of expression of the ALP
gene and ALP activity [Figs. 2 and 3(B)]. It is well known that
proteins are essential for cell functioning, and genes produce
an effect only when they are translated into proteins. The vari-
ation of osteogenic markers in the protein profile suggests that
the extracellular microenvironment induced osteogenic differ-
entiation and extracellular matrix production of the rBMSCs at
an early stage. The production of OCN denotes the onset of
matrix mineralization. Real-time PCR analysis of the OCN
revealed that the rBMSCs, independent of treatment, expressed
similar levels of the OCN up to day 3, with a significant
increase in the b-CS/b-TCP composites at day 10 [Fig. 3(C)]. It
may be that OCN, a late marker of the osteoblastic phenotype,
is only synthesized by mature osteoblasts. In this study, it is
noteworthy that rBMSCs were cultured in media without
osteogenic biomolecules (L-ascorbic acid, glycerophosphate,
and dexamethasone), which is in contrast to some previous
reports in which the MSCs were cultured in an osteogenic
medium.2,29 Our results showed that b-CS/b-TCP composite
scaffolds released a higher quantity of Si and Ca ions, and a
lower quantity of P ions. As an essential element for the devel-
opment of the skeleton and vascellum,11,35 Si has been shown
to enhance osteoblast proliferation and differentiation.36–39
Similarly, Ca is closely related to the osteogenic differentiation
and matrix mineralization of BMSCs and osteoblasts.40,41 Vara-
nasi et al.42 indicated that bioactive glass ions containing sig-
nificantly higher concentrations of Si and Ca, along with
ascorbic acid, enhanced the gene expression of ALP, Runx2,
and OCN and the induction of collagen type 1 synthesis. Fur-
thermore, others studies found that a bioactive glass that does
not contain phosphate-induced osteoblast differentiation and
elevated P levels in the media resulted in downregulation of
osteoblast gene expression.43,44 Our findings are in line with
these results, implying that chemical microenvironment pro-
vided by the extracts of b-CS/b-TCP composites was favorable
to stimulate osteogenic differentiation and may account for the
enhancement of bone regeneration using the scaffolds in vivo.
To further explore how the b-CS/b-TCP extracts regulate
osteogenic differentiation of rBMSCs and stimulate in vivo
bone regeneration, the mechanisms by which cells trans-
duce chemical signals into cell fate commitment were inves-
tigated. AMPK, a key sensor in the regulation of cellular
energy homeostasis, has been shown to be involved in the
osteogenic differentiation of stem cells.20,30,45 Thus, we
investigated the molecular mechanisms of the ionic-induced
osteogenic differentiation of rBMSCs from the perspective of
energy metabolism. The results showed that the soluble
ions of b-CS/b-TCP composites were capable of upregulating
the expression of p-AMPK (Fig. 4). Many downstream sig-
naling molecules are modulated by AMPK.30,46 Among these
molecules is ERK1/2-MAPK, which is important in deter-
mining the commitment of MSCs to osteogenic or adipo-
genic lineages and in regulating RUNX-2 expression.47–49
The activation of ERK1/2 in hAMSCs has been reported to
STIMULATION OF OSTEOGENIC DIFFERENTIATION OF MSC

FIGURE 7. A schematic graph of the possible mechanisms.
be regulated by AMPK.30 Our results clearly showed that
activation of AMPK paralleled the upregulation of p-ERK1/2
and RUNX-2 by 50% of CS extract on day 3, whereas Com-
pound C inhibited the expression of p-ERK1/2 and RUNX-2
[Figs. 4 and 5(C)]. In addition, treatment with the MEK
(PD98059) and AMPK (Compound C) inhibitor was corre-
lated with a reduction in ALP activity and calcium deposi-
tion. Kim et al.30 observed that the AMPK pathway could be
activated by osteogenic media. Our results indicate that bio-
active ions from the b-CS/b-TCP composites may function
analogous to osteogenic media and may induce the osteo-
genic differentiation of rBMSCs through AMPK-Erk1/2 sig-
naling even in the absence of osteogenic supplements.
Bone growth relies on the vascular network to provide
nutrients and remove metabolites. For a biomaterial to be
suitable for bone regeneration, both a high osteogenic
potential and a rapid connection to the vascular network
are needed. A variety of strategies have been developed to
achieve these qualities, including modifications of the scaf-
fold design, localized delivery of potent angiogenic inductive
factors, and in vivo as well as in vitro prevascularization.50
In this study, we investigated the impact of the extracts of
b-CS/b-TCP composites on HUVECs. An interesting observa-
tion is that the treatment with soluble ions released from
the b-CS/b-TCP composite scaffolds for 24 h significantly
increased VEGF secretion [Fig. 6(B)]. VEGF, an angiogenic
JOURNAL OF BIOMEDICAL MATERIALS RESEARCH A | JUL 2014 VOL 102A, ISSUE 7
ORIGINAL ARTICLE
inducer, promotes cell proliferation and migration, which
was also supported by our HUVEC viability results [Fig.
6(A)]. Indeed, strategies in which an implant stimulates the
secretion of endogenous angiogenic growth factors will be
valuable for bone repair. In this study, the observed increase
in VEGF secretion implies that Ca-Si-containing ionic prod-
ucts released from the b-CS/b-TCP composites may induce
the HUVECs to secrete cytokines (such as VEGF), which
may, in turn, have a favorable effect on angiogenesis via
autocrine or paracrine signaling. This effect may account for
the in vivo angiogenesis observed in our previous report.
Taken together, these results suggest that the favorable in
vivo osteogenesis of the b-CS/b-TCP composite scaffolds
may be owing to their positive impacts on osteogenic differ-
entiation and angiogenesis (Fig. 7).
CONCLUSIONS
This study shows that the soluble products of the porous b-
CS/b-TCP composite scaffolds impact the extracellular envi-
ronment and are capable of inducing RUNX-2, ALP, and OCN
synthesis in rBMSCs at both the gene and the protein levels in
the absence of osteogenic supplements. The Ca-Si-containing
ionic products extracted from the b-CS/b-TCP composite scaf-
folds are transduced via the AMPK-Erk1/2 signaling pathway,
stimulating the osteogenic differentiation of rBMSCs. More-
over, the soluble ions from the b-CS/b-TCP composite scaf-
folds have been observed to promote VEGF secretion and the
viability of HUVECs. Our study provides new insights into the
regulatory mechanism by which porous b-CS/b-TCP compos-
ite scaffolds induce the osteogenic differentiation of MSCs and
enhance in vivo bone formation.
ACKNOWLEDGMENT
The authors thank Yunfang Qian and Ruifen Jin for their techni-
cal support.
REFERENCES
1. Cheng L, Ye F, Yang R, Lu X, Shi Y, Li L, Fan H, Bu H. Osteoinduc-
tion of hydroxyapatite/beta-tricalcium phosphate bioceramics in
mice with a fractured fibula. Acta Biomater 2010;6:1569–1574.
2. Huang Y, Jin X, Zhang X, Sun H, Tu J, Tang T, Chang J, Dai K. In
vitro and in vivo evaluation of akermanite bioceramics for bone
regeneration. Biomaterials 2009;30:5041–5048.
3. Liu Q, Cen L, Yin S, Chen L, Liu G, Chang J, Cui L. A comparative
study of proliferation and osteogenic differentiation of adipose-
derived stem cells on akermanite and beta-TCP ceramics. Bioma-
terials 2008;29:4792–4799.
4. Kurashina K, Kurita H, Wu Q, Ohtsuka A, Kobayashi H. Ectopic
osteogenesis with biphasic ceramics of hydroxyapatite and trical-
cium phosphate in rabbits. Biomaterials 2002;23:407–412.
5. Le Nihouannen D, Daculsi G, Saffarzadeh A, Gauthier O, Delplace
S, Pilet P, Layrolle P. Ectopic bone formation by microporous cal-
cium phosphate ceramic particles in sheep muscles. Bone 2005;
36:1086–1093.
6. Ramaswamy Y, Wu C, Zhou H, Zreiqat H. Biological response of
human bone cells to zinc-modified Ca-Si-based ceramics. Acta
Biomater 2008;4:1487–1497.
7. Ni S, Chang J. In vitro degradation, bioactivity, and cytocompati-
bility of calcium silicate, dimagnesium silicate, and tricalcium
phosphate bioceramics. J Biomater Appl 2009;24:139–158.
8. Wu C. Methods of improving mechanical and biomedical proper-
ties of Ca-Si-based ceramics and scaffolds. Expert Rev Med Devi-
ces 2009;6:237–241.
2103
 9. Carrodeguas RG, De Aza AH, De Aza PN, Baudin C, Jimenez J,
Lopez-Bravo A, Pena P, De Aza S. Assessment of natural and syn-
thetic wollastonite as source for bioceramics preparation. J
Biomed Mater Res A 2007;83:484–495.
10. Ni S, Lin K, Chang J, Chou L. Beta-CaSiO3/beta-Ca3(PO4)2 com-
posite materials for hard tissue repair: In vitro studies. J Biomed
Mater Res A 2008;85:72–82.
11. Xu S, Lin K, Wang Z, Chang J, Wang L, Lu J, Ning C. Reconstruc-
tion of calvarial defect of rabbits using porous calcium silicate
bioactive ceramics. Biomaterials 2008;29:2588–2596.
12. Fei L, Wang C, Xue Y, Lin K, Chang J, Sun J. Osteogenic differen-
tiation of osteoblasts induced by calcium silicate and calcium sili-
cate/beta-tricalcium phosphate composite bioceramics. J Biomed
Mater Res B Appl Biomater 2012;100:1237–1244.
13. Wang C, Xue Y, Lin K, Lu J, Chang J, Sun J. The enhancement of
bone regeneration by a combination of osteoconductivity and
osteostimulation using b-CaSiO3/b-Ca3(PO4)2 composite biocer-
amics. Acta Biomater 2012;8:350–360.
14. Kumar S, Chanda D, Ponnazhagan S. Therapeutic potential of geneti-
cally modified mesenchymal stem cells. Gene Ther 2008;15:711–715.
15. Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R,
Mosca JD, Moorman MA, Simonetti DW, Craig S, Marshak DR.
Multilineage potential of adult human mesenchymal stem cells.
Science 1999;284:143–147.
16. Zong C, Xue D, Yuan W, Wang W, Shen D, Tong X, Shi D, Liu L,
Zheng Q, Gao C, Wang J. Reconstruction of rat calvarial defects with
human mesenchymal stem cells and osteoblast-like cells in poly-
lactic-co-glycolic acid scaffolds. Eur Cell Mater 2010;20:109–120.
17. Li H, Zhai W, Chang J. Effects of wollastonite on proliferation and
differentiation of human bone marrow-derived stromal cells in
PHBV/wollastonite composite scaffolds. J Biomater Appl 2009;24:
231–246.
18. Sun H, Wu C, Dai K, Chang J, Tang T. Proliferation and osteoblastic
differentiation of human bone marrow-derived stromal cells on
akermanite-bioactive ceramics. Biomaterials 2006;27:5651–5657.
19. Sengupta S, Park SH, Patel A, Carn J, Lee K, Kaplan DL. Hypoxia
and amino acid supplementation synergistically promote the
osteogenesis of human mesenchymal stem cells on silk protein
scaffolds. Tissue Eng Part A 2010;16:3623–3634.
20. Kim EK, Lim S, Park JM, Seo JK, Kim JH, Kim KT, Ryu SH, Suh
PG. Human mesenchymal stem cell differentiation to the osteo-
genic or adipogenic lineage is regulated by AMP-activated protein
kinase. J Cell Physiol 2012;227:1680–1687.
21. Hardie DG, Hawley SA, Scott JW. AMP-activated protein kinase—
Development of the energy sensor concept. J Physiol 2006;574:7–15.
22. Wang C, Lin K, Chang J, Sun J. Osteogenesis and angiogenesis
induced by porous beta-CaSiO(3)/PDLGA composite scaffold via
activation of AMPK/ERK1/2 and PI3K/Akt pathways. Biomaterials
2013;34:64–77.
23. Bussolino F, Mantovani A, Persico G. Molecular mechanisms of
blood vessel formation. Trends Biochem Sci 1997;22:251–256.
24. Lin K, Zhai W, Ni S, Chang J, Zeng Y, W Q. Study of the mechani-
cal property and in vitro biocompatibility of CaSiO3 ceramics.
Ceram Int 2005;31:323–326.
25. Lin K, Chang J, Shen R. The effect of powder properties on sinter-
ing, microstructure, mechanical strength and degradability of
beta-tricalcium phosphate/calcium silicate composite bioceramics.
Biomed Mater 2009;4:065009.
26. Polisetti N, Chaitanya VG, Babu PP, Vemuganti GK. Isolation,
characterization and differentiation potential of rat bone marrow
stromal cells. Neurol India 2010;58:201–208.
27. Sun S, Guo Z, Xiao X, Liu B, Liu X, Tang PH, Mao N. Isolation of
mouse marrow mesenchymal progenitors by a novel and reliable
method. Stem Cells 2003;21:527–535.
28. Liu X, Sun J. Endothelial cells dysfunction induced by silica nano-
particles through oxidative stress via JNK/P53 and NF-kappaB
pathways. Biomaterials 2010;31:8198–8209.
29. Yang F, Yang D, Tu J, Zheng Q, Cai L, Wang L. Strontium enhan-
ces osteogenic differentiation of mesenchymal stem cells and in
vivo bone formation by activating Wnt/catenin signaling. Stem
Cells 2011;29:981–991.
30. Kim EK, Lim S, Park JM, Seo JK, Kim JH, Kim KT, Ryu SH, Suh
PG. Human mesenchymal stem cell differentiation to the osteo-
2104 WANG ET AL.
genic or adipogenic lineage is regulated by AMP-activated protein
kinase. J Cell Physiol 2012;227:1680–1687.
31. Gentleman E, Fredholm YC, Jell G, Lotfibakhshaiesh N, O’Donnell
MD, Hill RG, Stevens MM. The effects of strontium-substituted
bioactive glasses on osteoblasts and osteoclasts in vitro. Bioma-
terials 2010;31:3949–3956.
32. Tsigkou O, Jones JR, Polak JM, Stevens MM. Differentiation of
fetal osteoblasts and formation of mineralized bone nodules by
45S5 bioglass conditioned medium in the absence of osteogenic
supplements. Biomaterials 2009;30:3542–3550.
33. Karsenty G. Transcriptional control of skeletogenesis. Annu Rev
Genomics Hum Genet 2008;9:183–196.
34. Stein GS, Lian JB, Stein JL, van Wijnen AJ, Montecino M, Pratap
J, Choi J, Zaidi SK, Javed A, Gutierrez S, Harrington K, Shen J,
Young D. Intranuclear organization of RUNX transcriptional regu-
latory machinery in biological control of skeletogenesis and can-
cer. Blood Cells Mol Dis 2003;30:170–176.
35. Hing KA, Wilson LF, Buckland T. Comparative performance of
three ceramic bone graft substitutes. Spine J 2007;7:475–490.
36. Jugdaohsingh R, Tucker KL, Qiao N, Cupples LA, Kiel DP, Powell
JJ. Dietary silicon intake is positively associated with bone min-
eral density in men and premenopausal women of the Framing-
ham Offspring cohort. J Bone Miner Res 2004;19:297–307.
37. Forrest H, Nielsen, Rhonda P. Dietary silicon affects bone turnover
differently in ovariectomized and sham-operated growing rats. J
Trace Elements Exp Med 2004;17:137–149.
38. Valerio P, Pereira MM, Goes AM, Leite MF. The effect of ionic
products from bioactive glass dissolution on osteoblast prolifera-
tion and collagen production. Biomaterials 2004;25:2941–2948.
39. Ni S, Chang J, Chou L, Zhai W. Comparison of osteoblast-like cell
responses to calcium silicate and tricalcium phosphate ceramics
in vitro. J Biomed Mater Res B Appl Biomater 2007;80:174–183.
40. Maeno S, Niki Y, Matsumoto H, Morioka H, Yatabe T, Funayama
A, Toyama Y, Taguchi T, Tanaka J. The effect of calcium ion con-
centration on osteoblast viability, proliferation and differentiation
in monolayer and 3D culture. Biomaterials 2005;26:4847–4855.
41. Chang YL, Stanford CM, Keller JC. Calcium and phosphate sup-
plementation promotes bone cell mineralization: Implications for
hydroxyapatite (HA)-enhanced bone formation. J Biomed Mater
Res 2000;52:270–278.
42. Varanasi VG, Saiz E, Loomer PM, Ancheta B, Uritani N, Ho SP,
Tomsia AP, Marshall SJ, Marshall GW. Enhanced osteocalcin
expression by osteoblast-like cells (MC3T3-E1) exposed to bioac-
tive coating glass (SiO2-CaO-P2O5-MgO-K2O-Na2O system) ions.
Acta Biomater 2009;5:3536–3547.
43. Jones JR, Tsigkou O, Coates EE, Stevens MM, Polak JM, Hench
LL. Extracellular matrix formation and mineralization on a
phosphate-free porous bioactive glass scaffold using primary
human osteoblast (HOB) cells. Biomaterials 2007;28:1653–1663.
44. Gupta G, Kirakodu S, El-Ghannam A. Effects of exogenous phos-
phorus and silicon on osteoblast differentiation at the interface
with bioactive ceramics. J Biomed Mater Res A 2010;95:882–890.
45. Steinberg GR, Kemp BE. AMPK in health and disease. Physiol Rev
2009;89:1025–1078.
46. Kim DY, Park YG, Quan HY, Kim SJ, Jung MS, Chung SH. Ginse-
noside Rd stimulates the differentiation and mineralization of
osteoblastic MC3T3-E1 cells by activating AMP-activated protein
kinase via the BMP-2 signaling pathway. Fitoterapia 2012;83:215–
222.
47. Jaiswal RK, Jaiswal N, Bruder SP, Mbalaviele G, Marshak DR,
Pittenger MF. Adult human mesenchymal stem cell differentiation
to the osteogenic or adipogenic lineage is regulated by mitogen-
activated protein kinase. J Biol Chem 2000;275:9645–9652.
48. Khatiwala CB, Kim PD, Peyton SR, Putnam AJ. ECM compliance
regulates osteogenesis by influencing MAPK signaling down-
stream of RhoA and ROCK. J Bone Miner Res 2009;24:886–898.
49. Salasznyk RM, Klees RF, Hughlock MK, Plopper GE. ERK signaling
pathways regulate the osteogenic differentiation of human mes-
enchymal stem cells on collagen I and vitronectin. Cell Commun
Adhes 2004;11:137–153.
50. Rouwkema J, Rivron NC, van Blitterswijk CA. Vascularization in
tissue engineering. Trends Biotechnol 2008;26:434–441.
STIMULATION OF OSTEOGENIC DIFFERENTIATION OF MSC