Autophagy

ISSN: 1554-8627 (Print) 1554-8635 (Online) Journal homepage: http://www.tandfonline.com/loi/kaup20

Autophagy Promotes Ferroptosis by Degradation

of Ferritin

Wen Hou, Yangchun Xie, Xinxin Song, Xiaofang Sun, Michael T Lotze, Herbert
J. Zeh III, Rui Kang & Daolin Tang

To cite this article: Wen Hou, Yangchun Xie, Xinxin Song, Xiaofang Sun, Michael T Lotze,
Herbert J. Zeh III, Rui Kang & Daolin Tang (2016): Autophagy Promotes Ferroptosis by
Degradation of Ferritin, Autophagy, DOI: 10.1080/15548627.2016.1187366

To link to this article: http://dx.doi.org/10.1080/15548627.2016.1187366

Accepted author version posted online: 31

May 2016.
Published online: 31 May 2016.

Submit your article to this journal

View related articles

View Crossmark data

Full Terms & Conditions of access and use can be found at

http://www.tandfonline.com/action/journalInformation?journalCode=kaup20

Download by: [University of Nebraska, Lincoln] Date: 02 June 2016, At: 20:55
 ACCEPTED MANUSCRIPT

Autophagy Promotes Ferroptosis by Degradation of Ferritin

Wen Hou1, Yangchun Xie1, Xinxin Song1, Xiaofang Sun2, Michael T. Lotze1, Herbert J. Zeh III
1
, Rui Kang1, and Daolin Tang1,2*

1
Department of Surgery, University of Pittsburgh Cancer Institute, University of Pittsburgh,
Downloaded by [University of Nebraska, Lincoln] at 20:55 02 June 2016

2
Pittsburgh, Pennsylvania 15213, USA; The Center for DAMP Biology, The Third Affiliated

Hospital of Guangzhou Medical University, Guangzhou, Guangdong, 510510, China.

*
Correspondence to: Daolin Tang (e-mail: tangd2@upmc.edu)

Key words: autophagy, ferroptosis, ferritinophagy, ferritin, iron, lipid, NCOA4, pancreatic

cancer

Abbreviations: Atg, autophagy-related; CQ, chloroquine; Fe2+, ferrous iron; FTH1, ferritin,

heavy polypeptide 1; GSH, glutathione; MAP1LC3/LC3, microtubule-associated protein 1 light

chain 3; MDA, malondialdehyde; MEFs, mouse embryonic fibroblasts; NCOA4, nuclear

receptor coactivator 4; STS, staurosporine; WT, wild type

Abstract

Macroautophagy/autophagy is an evolutionarily-conserved degradation pathway that

maintains homeostasis. Ferroptosis, a novel form of regulated cell death, is characterized by a

1
ACCEPTED MANUSCRIPT
 ACCEPTED MANUSCRIPT

production of reactive oxygen species from accumulated iron and lipid peroxidation. However,

the relationship between autophagy and ferroptosis at the genetic level remains unclear. Here, we

demonstrated that autophagy contributes to ferroptosis by degradation of ferritin in fibroblasts

and cancer cells. Knockout or knockdown of Atg5 (autophagy related 5) and Atg7 limited

erastin-induced ferroptosis with decreased intracellular ferrous iron levels, and lipid

peroxidation. Remarkably, NCOA4 (nuclear receptor coactivator 4) was a selective cargo

Downloaded by [University of Nebraska, Lincoln] at 20:55 02 June 2016

receptor for the selective autophagic turnover of ferritin (namely ferritinophagy) in ferroptosis.

Consistently, genetic inhibition of NCOA4 inhibited ferritin degradation and suppressed

ferroptosis. In contrast, overexpression of NCOA4 increased ferritin degradation and promoted

ferroptosis. These findings provide novel insight into the interplay between autophagy and

regulated cell death.

Autophagy is an evolutionarily-conserved degradation pathway that maintains homeostasis.1

In many cases, induction of autophagy promotes cell survival in response to environmental

stressors such as nutritional starvation and energy depletion.2 In some cases, excessive and

impaired autophagy may contribute to cell death.3 Thus, defining the context-dependent function

of autophagy in the regulation of cell death is important.

Ferroptosis, a novel form of regulated cell death, is characterized by a production of reactive

oxygen species from accumulated iron and lipid peroxidation. 4_ENREF_4 According to the

original study from Dr. Brent R. Stockwell in 2012, ferroptosis induced by erastin in cancer cells

lacks the morphological and biochemical characteristics of apoptosis, necrosis, and autophagy. 5

2
ACCEPTED MANUSCRIPT
 ACCEPTED MANUSCRIPT

Potent autophagy inhibitors (e.g., bafilomycin A1, 3-methyladenine, and chloroquine [CQ])

cannot prevent erastin-induced ferroptosis in certain cancer cells (e.g., HT-1080 and BJeLR).5

However, whether genetic inhibition of the autophagic pathway regulates the process and

function of ferroptosis is unclear.

Autophagy-related (Atg) genes play a central role in the mediation of autophagy.6 Among

them, Atg5 and Atg7 are critical for the formation of the autophagosome. We first investigated
Downloaded by [University of Nebraska, Lincoln] at 20:55 02 June 2016

whether knockout of Atg5 or Atg7 in immortalized mouse embryonic fibroblasts (MEFs)

regulates ferroptosis. Compared with wild-type (WT) MEFs, knockout of Atg5 or Atg7 inhibited

erastin-induced cell death in atg5-/- or atg7-/- MEFs (Fig. 1A). Staurosporine (STS) is a classical

inducer of apoptosis.7 Knockout of Atg5 or Atg7 enhanced STS-induced cell death (Fig. 1A).

Moreover, knockdown of ATG5 and ATG7 by shRNA in human pancreatic cancer cell lines

(PANC1 and PANC2.03) and the human fibrosarcoma cell line HT-1080 (Fig. 1B) also inhibited

erastin-induced, but increased STS-induced, growth inhibition (Fig. 1C). As expected, both

intracellular ferrous iron (Fe2+) levels and end products of lipid peroxidation (e.g.,

malondialdehyde [MDA]) (Fig. 1D) were significantly decreased in ATG5- or ATG7-deficient

cells (MEFs and HT-1080) following treatment with erastin, suggesting that ATG5- and ATG7-

mediated autophagy contributes to ferroptosis. In contrast, erastin-induced cell death, Fe2+, and

MDA production did not significantly change after treatment with CQ (Fig. 1E), which is similar

to the results of Dr. Stockwell’s study.5 CQ and bafilomycin A1 are not specific inhibitors to

autophagic processes and can inhibit lysosomal processes, as well as endocytic pathways. 8 Thus,

the interpretation of data from studies using autophagy inhibitors should be combined with

genetic approaches to more specifically inhibit the autophagy pathway. 8

3
ACCEPTED MANUSCRIPT
 ACCEPTED MANUSCRIPT

Ferritin is the major intracellular iron storage protein complex, which includes FTL1 (ferritin

light polypeptide 1) and FTH1 (ferritin heavy polypeptide 1).9 Increased ferritin expression

limits ferroptosis.10 Recent studies indicate that increased autophagy can degrade ferritin to

increase iron levels resulting in oxidative injury by the Fenton reaction. 11,12 Remarkably, the

protein level of FTH1 was significantly increased in ATG5-deficient cells (MEFs and PANC1)

with or without erastin treatment (Fig. 1F), suggesting that ATG5-mediated autophagy is
Downloaded by [University of Nebraska, Lincoln] at 20:55 02 June 2016

required for ferritin degradation. MAP1LC3/LC3 (microtubule-associated protein 1 light chain

3), a mammalian homolog of yeast Atg8, has been used as a marker to monitor autophagy. 13

ATG5-mediated lipidation of LC3 is required for the conversion of LC3-I to LC3-II.14,15

Knockout/knockdown of Atg5/ATG5 inhibited erastin-induced LC3-II (Fig. 1F) and GFP-LC3

puncta formation (Fig. 1G). In addition to LC3-II, expression of the autophagy substrate

SQSTM1 (sequestosome 1) was decreased in response to erastin in ATG5 WT, but not ATG5-

deficient cells (Fig. 1F). These findings indicate that increased autophagy flux is associated with

ferroptosis in fibroblasts and cancer cells following erastin treatment.

Given that NCOA4 is a selective cargo receptor for the autophagic turnover of

ferritin,11,12,16_ENREF_17 we next determined whether a change in NCOA4 expression regulates

erastin-induced ferroptosis. The protein level of NCOA4 did not remarkably change following

erastin treatment (Fig. 1F). However, knockdown of NCOA4 by specific shRNA in PANC1 or

HT-1080 cells increased FTH1 expression (Fig. 1H) and limited erastin-induced death (Fig. 1I).

In contrast, overexpression of NCOA4 by gene transfection in PANC1 cells suppressed FTH1

expression (Fig. 1H) and increased erastin-induced death (Fig. 1I). As expected, the levels of

Fe2+ and MDA were decreased in NCOA4-knockdown cells, whereas the levels of Fe2+ and

4
ACCEPTED MANUSCRIPT
 ACCEPTED MANUSCRIPT

MDA were increased in NCOA4-overexpressing cells (Fig. 1I). Moreover, the levels of

glutathione (GSH) were increased in NCOA4-knockdown cells and decreased in NCOA4-

overexpressing cells (Fig. 1I), confirming that iron and GSH are at the crossroad of redox

metabolism in ferroptosis. Thus, NCOA4-mediated ferritin degradation is involved in

ferroptosis.

In summary, the present study provides important evidence that activation of the autophagy
Downloaded by [University of Nebraska, Lincoln] at 20:55 02 June 2016

pathway promotes ferroptosis by degradation of ferritin in fibroblasts and cancer cells (Fig. 1J).

Consistently, a recent study also shows that induction of autophagy contributes to erastin-

induced ferroptosis in cancer cells.17 Impaired ferroptosis has been identified in various human

diseases such as neurodegenerative diseases,18 ischemia/reperfusion injury,18,19 infectious

diseases,20 and cancers.5,21-25 Further functional characterization of the ATG5-ATG7-NCOA4

autophagic pathway in ferroptosis may provide insight into the treatment of diseases of iron

metabolism.

Acknowledgments

We thank Christine Heiner (Department of Surgery, University of Pittsburgh) for her critical

reading of the manuscript. This work was supported by the National Institutes of Health of the

USA (R01GM115366 and R01CA160417 to D.T.; R01 CA181450 to H.J.Z), the National

Natural Science Foundation of China (31171229 and U1132005 to X.S.), the National Natural

Science Foundation of Guangdong (D.T.), a Science of Guangzhou Key Project (201508020258,

201400000003-4, and 201400000004-4 to X.S.), and a Research Scholar Grant from the

5
ACCEPTED MANUSCRIPT
 ACCEPTED MANUSCRIPT

American Cancer Society (RSG-16-014-01-CDD to D.T.). This project partly used University of

Pittsburgh Cancer Institute shared resources supported by award P30CA047904.

References

1. Klionsky DJ, Emr SD. Autophagy as a regulated pathway of cellular degradation.

Downloaded by [University of Nebraska, Lincoln] at 20:55 02 June 2016

Science 2000; 290:1717-21.

2. Kroemer G, Marino G, Levine B. Autophagy and the integrated stress response.

Molecular cell 2010; 40:280-93.

3. Liu Y, Levine B. Autosis and autophagic cell death: the dark side of autophagy. Cell

death and differentiation 2015; 22:367-76.

4. Xie Y, Hou W, Song X, Yu Y, Huang J, Sun X, Kang R, Tang D. Ferroptosis: process

and function. Cell death and differentiation 2016; 23:369-79.

5. Dixon SJ, Lemberg KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE, Patel DN,

Bauer AJ, Cantley AM, Yang WS, Morrison B, 3rd, Stockwell BR. Ferroptosis: an iron-

dependent form of nonapoptotic cell death. Cell 2012; 149:1060-72.

6. Xie Y, Kang R, Sun X, Zhong M, Huang J, Klionsky DJ, Tang D. Posttranslational

modification of autophagy-related proteins in macroautophagy. Autophagy 2015; 11:28-45.

7. Bertrand R, Solary E, O'Connor P, Kohn KW, Pommier Y. Induction of a common

pathway of apoptosis by staurosporine. Exp Cell Res 1994; 211:314-21.

6
ACCEPTED MANUSCRIPT
 ACCEPTED MANUSCRIPT

8. Klionsky DJ, Abdelmohsen K, Abe A, Abedin MJ, Abeliovich H, Acevedo Arozena A, et

al. Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition).

Autophagy 2016; 12:1-222.

9. Theil EC. Iron, ferritin, and nutrition. Annu Rev Nutr 2004; 24:327-43.

10. Yang WS, Stockwell BR. Synthetic lethal screening identifies compounds activating

iron-dependent, nonapoptotic cell death in oncogenic-RAS-harboring cancer cells. Chem Biol

Downloaded by [University of Nebraska, Lincoln] at 20:55 02 June 2016

2008; 15:234-45.

11. Dowdle WE, Nyfeler B, Nagel J, Elling RA, Liu S, Triantafellow E, Menon S, Wang Z,

Honda A, Pardee G, Cantwell J, Luu C, Cornella-Taracido I, Harrington E, Fekkes P, Lei H,

Fang Q, Digan ME, Burdick D, Powers AF, Helliwell SB, D'Aquin S, Bastien J, Wang H,

Wiederschain D, Kuerth J, Bergman P, Schwalb D, Thomas J, Ugwonali S, Harbinski F,

Tallarico J, Wilson CJ, Myer VE, Porter JA, Bussiere DE, Finan PM, Labow MA, Mao X,

Hamann LG, Manning BD, Valdez RA, Nicholson T, Schirle M, Knapp MS, Keaney EP,

Murphy LO. Selective VPS34 inhibitor blocks autophagy and uncovers a role for NCOA4 in

ferritin degradation and iron homeostasis in vivo. Nat Cell Biol 2014; 16:1069-79.

12. Mancias JD, Wang X, Gygi SP, Harper JW, Kimmelman AC. Quantitative proteomics

identifies NCOA4 as the cargo receptor mediating ferritinophagy. Nature 2014; 509:105-9.

13. Kabeya Y, Mizushima N, Ueno T, Yamamoto A, Kirisako T, Noda T, Kominami E,

Ohsumi Y, Yoshimori T. LC3, a mammalian homologue of yeast Apg8p, is localized in

autophagosome membranes after processing. Embo J 2000; 19:5720-8.

7
ACCEPTED MANUSCRIPT
 ACCEPTED MANUSCRIPT

14. Mizushima N, Noda T, Yoshimori T, Tanaka Y, Ishii T, George MD, Klionsky DJ,

Ohsumi M, Ohsumi Y. A protein conjugation system essential for autophagy. Nature 1998;

395:395-8.

15. Ichimura Y, Kirisako T, Takao T, Satomi Y, Shimonishi Y, Ishihara N, Mizushima N,

Tanida I, Kominami E, Ohsumi M, Noda T, Ohsumi Y. A ubiquitin-like system mediates protein

lipidation. Nature 2000; 408:488-92.

Downloaded by [University of Nebraska, Lincoln] at 20:55 02 June 2016

16. Mancias JD, Pontano Vaites L, Nissim S, Biancur DE, Kim AJ, Wang X, Liu Y,

Goessling W, Kimmelman AC, Harper JW. Ferritinophagy via NCOA4 is required for

erythropoiesis and is regulated by iron dependent HERC2-mediated proteolysis. eLife 2015; 4.

17. Torii S, Shintoku R, Kubota C, Yaegashi M, Torii R, Sasaki M, Suzuki T, Mori M,

Yoshimoto Y, Takeuchi T, Yamada K. An essential role for functional lysosomes in ferroptosis

of cancer cells. The Biochemical journal 2016.

18. Skouta R, Dixon SJ, Wang J, Dunn DE, Orman M, Shimada K, Rosenberg PA, Lo DC,

Weinberg JM, Linkermann A, Stockwell BR. Ferrostatins inhibit oxidative lipid damage and cell

death in diverse disease models. J Am Chem Soc 2014; 136:4551-6.

19. Friedmann Angeli JP, Schneider M, Proneth B, Tyurina YY, Tyurin VA, Hammond VJ,

Herbach N, Aichler M, Walch A, Eggenhofer E, Basavarajappa D, Radmark O, Kobayashi S,

Seibt T, Beck H, Neff F, Esposito I, Wanke R, Forster H, Yefremova O, Heinrichmeyer M,

Bornkamm GW, Geissler EK, Thomas SB, Stockwell BR, O'Donnell VB, Kagan VE, Schick JA,

Conrad M. Inactivation of the ferroptosis regulator Gpx4 triggers acute renal failure in mice. Nat

Cell Biol 2014; 16:1180-91.

8
ACCEPTED MANUSCRIPT
 ACCEPTED MANUSCRIPT

20. Matsushita M, Freigang S, Schneider C, Conrad M, Bornkamm GW, Kopf M. T cell lipid

peroxidation induces ferroptosis and prevents immunity to infection. J Exp Med 2015; 212:555-

68.

21. Jiang L, Kon N, Li T, Wang SJ, Su T, Hibshoosh H, Baer R, Gu W. Ferroptosis as a p53-

mediated activity during tumour suppression. Nature 2015; 520:57-62.

22. Yang WS, SriRamaratnam R, Welsch ME, Shimada K, Skouta R, Viswanathan VS,
Downloaded by [University of Nebraska, Lincoln] at 20:55 02 June 2016

Cheah JH, Clemons PA, Shamji AF, Clish CB, Brown LM, Girotti AW, Cornish VW, Schreiber

SL, Stockwell BR. Regulation of ferroptotic cancer cell death by GPX4. Cell 2014; 156:317-31.

23. Sun X, Niu X, Chen R, He W, Chen, Kang R, Tang D. Metallothionein-1G Facilitates

Sorafenib Resistance through Inhibition of Ferroptosis. Hepatology 2016.

24. Sun X, Ou Z, Chen R, Niu X, Chen D, Kang R, Tang D. Activation of the p62-Keap1-

NRF2 pathway protects against ferroptosis in hepatocellular carcinoma cells. Hepatology 2016;

63:173-84.

25. Sun X, Ou Z, Xie M, Kang R, Fan Y, Niu X, Wang H, Cao L, Tang D. HSPB1 as a novel

regulator of ferroptotic cancer cell death. Oncogene 2015; 34:5617-25.

9
ACCEPTED MANUSCRIPT
 ACCEPTED MANUSCRIPT

Figure 1. Autophagy promotes erastin-induced ferroptosis. (A) The indicated immortalized

MEFs were treated with erastin and STS for 24 h and cell viability was assayed using a Cell

Counting Kit-8 (Sigma, 96992) (n=3; *, p < 0.05 versus WT group). (B-C) Knockdown of ATG5

and ATG7 by specific shRNA (human ATG5_shRNA sequence:

CCGGCCTGAACAGAATCATCCTTAACTCGAGTTAAGGATGATTCTGTTCAGGTTTTTT
Downloaded by [University of Nebraska, Lincoln] at 20:55 02 June 2016

G; human ATG7_shRNA sequence:

CCGGGCCTGCTGAGGAGCTCTCCATCTCGAGATGGAGAGCTCCTCAGCAGGCTTTTT)

inhibited erastin-induced growth inhibition in the indicated human cancer cell lines (n=3; *, p <

0.05 versus control shRNA group). (D) Indicated MEFs or HT-1080 cells were treated with

erastin for 24 h. Fe2+ and MDA levels were assayed using commercial kits (Abcam, ab83366 and

ab118970) (n=3; *, p < 0.05 versus WT group). (E) MEFs and PANC1 cells were treated with

erastin “Era” in the presence or absence of CQ for 24 h. Fe2+ and MDA levels were assayed

using commercial kits (Abcam, ab83366 and ab118970) (n=3). (F) Western blot analysis

monitoring protein expression in MEFs or PANC1 cells following treatment with erastin for 24

h. (G) The indicated MEFs were transfected with a GFP-LC3 plasmid for 24 h and then treated

with erastin for 24 h. The GFP-LC3 puncta were assayed using image analysis. (H-I) The effects

of knockdown of NCOA4 by shRNA (human NCOA4_shRNA(1) sequence:

CCGGTCAGCAGCTCTACTCGTTATTCTCGAGAATAACGAGTAGAGCTGCTGATTTTT

G; human NCOA4_shRNA(2) sequence:

CCGGTGAACAGGTGGACCTTATTTACTCGAGTAAATAAGGTCCACCTGTTCATTTTT

G), or overexpression of NCOA4 by transfection of human NCOA4 cDNA (OriGene

10
ACCEPTED MANUSCRIPT
 ACCEPTED MANUSCRIPT

Technologies, RC226676) on cell viability, Fe2+, MDA, and GSH levels in the indicated cells

following treatment with erastin for 24 h (n=3; *, p < 0.05 versus control shRNA group or

control cDNA group). (J) Schematic of the mechanism by which autophagy promotes

ferroptosis.
Downloaded by [University of Nebraska, Lincoln] at 20:55 02 June 2016

11
ACCEPTED MANUSCRIPT
 Downloaded by [University of Nebraska, Lincoln] at 20:55 02 June 2016

ACCEPTED MANUSCRIPT

12
ACCEPTED MANUSCRIPT