2023 12 19 572350v1 Full

bioRxiv preprint doi: https://doi.org/10.1101/2023.12.19.572350; this version posted December 19, 2023.
The copyright holder for this preprint

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
available under aCC-BY-NC-ND 4.0 International license.
1 CDCA7 is a hemimethylated DNA adaptor for the nucleosome remodeler HELLS

2
3 Authors
4 Isabel E. Wassing1†, Atsuya Nishiyama2*†, Moeri Hiruta3, Qingyuan Jia1, Reia
5 Shikimachi3, Amika Kikuchi3, Keita Sugimura2, Xin Hong2, Yoshie Chiba2, Junhui Peng4,
6 Christopher Jenness1‡, Makoto Nakanishi2, Li Zhao4, Kyohei Arita3*, Hironori Funabiki1*
7
8
9 Affiliations
1
10 Laboratory of Chromosome and Cell Biology, The Rockefeller University, New York, NY
11 10065, USA
2
12 Division of Cancer Cell Biology, The Institute of Medical Science, The University of Tokyo,
13 Tokyo, Tokyo 108-8639 Japan
3
14 Structural Biology Laboratory, Graduate School of Medical Life Science, Yokohama City
15 University, Yokohama, Kanagawa 230-0045, Japan
4
16 Laboratory of Evolutionary Genetics and Genomics, The Rockefeller University, New York, NY
17 10065, USA
18
19 †: Equal contributions
20 ‡: Current address; Dstillery, New York, NY 10016, USA
21 *: Corresponding authors
22 Atsuya Nishiyama, uanishiyama@g.ecc.u-tokyo.ac.jp
23 Kyohei Arita, aritak@yokohama-cu.ac.jp
24 Editorial correspondence: Hironori Funabiki, funabih@rockefeller.edu
25
bioRxiv preprint doi: https://doi.org/10.1101/2023.12.19.572350; this version posted December 19, 2023. The copyright holder for this preprint
26 Abstract
27 Mutations of the SNF2 family ATPase HELLS and its activator CDCA7 cause
28 immunodeficiency-centromeric instability-facial anomalies (ICF) syndrome, characterized by
29 hypomethylation at heterochromatin. The unique zinc-finger domain, zf-4CXXC_R1, of CDCA7
30 is widely conserved across eukaryotes but is absent from species that lack HELLS and DNA
31 methyltransferases, implying its specialized relation with methylated DNA. Here we demonstrate
32 that zf-4CXXC_R1 acts as a hemimethylated DNA sensor. The zf-4CXXC_R1 domain of
33 CDCA7 selectively binds to DNA with a hemimethylated CpG, but not unmethylated or fully
34 methylated CpG, and ICF disease mutations eliminated this binding. CDCA7 and HELLS interact
35 via their N-terminal alpha helices, through which HELLS is recruited to hemimethylated DNA.
36 While placement of a hemimethylated CpG within the nucleosome core particle can hinder its
37 recognition by CDCA7, cryo-EM structure analysis of the CDCA7-nucleosome complex suggests
38 that zf-4CXXC_R1 recognizes a hemimethylated CpG in the major groove at linker DNA. Our
39 study provides insights into how the CDCA7-HELLS nucleosome remodeling complex uniquely
40 assists maintenance DNA methylation.
41 Introduction
42 DNA methylation is a broadly observed epigenetic modification in living systems, playing diverse
43 functions in transcriptional regulation, transposable element silencing, as well as innate immunity
44 (1-4). As genomic DNA methylation profiles dynamically change during development, aging, and
45 evolution, alterations in DNA methylation patterns are linked to transgenerational epigenetic
46 changes, speciation, and diseases such as cancers and immunodeficiency (5-9). One such disease
47 is immunodeficiency–centromeric instability–facial anomalies (ICF) syndrome. ICF patient cells
48 exhibit hypomethylation of heterochromatic regions, particularly at the juxta-centromeric
49 heterochromatin of chromosome 1 and 16 (10, 11). Mutations in four genes are known to cause
50 ICF syndrome; the de novo DNA methyltransferase DNMT3B, the SNF2-family ATPase HELLS
51 (also known as LSH, SMARCA6 or PASG), the HELLS activator CDCA7, and the transcription
52 factor ZBTB24, which is critical for the expression of CDCA7 (12-16). In addition, compound
53 mutations of UHRF1, a critical regulator of maintenance DNA methylation, cause atypical ICF
54 syndrome (17), supporting a further causal relationship between defective DNA methylation and
55 the disease. The importance of HELLS and its plant ortholog DDM1 in DNA methylation has
56 been established in vertebrates and in plants (18-25), and it has been suggested that the
57 nucleosome remodeling activity of HELLS/DDM1 facilitates DNA methylation (26, 27).
58 However, it remains unclear why a role in promoting DNA methylation is uniquely carried out by
59 HELLS/DDM1 among several other coexisting SNF2-family ATPases with similar nucleosome
60 remodeling activity, such as SNF2 (SMARCA2/4), INO80, and ISWI (SMARCA1/5) (28).
61 In eukaryotes, DNA methylation is primarily observed as 5-methylcytosine (5mC),
62 commonly in the context of CpG sequences, where both cytosines in the complementary DNA
63 strands are symmetrically (i.e., fully) methylated. 5mC methylation mechanisms can be
64 functionally classified as maintenance methylation or de novo methylation (29). Whereas de novo
65 methylation, which is commonly mediated by DNMT3-family proteins, does not depend on
66 preexisting 5mC on the template DNA, maintenance methylation, mediated by DNMT1-family
67 proteins, occurs at hemimethylated CpGs, which are generated upon replication of fully
68 methylated DNA. So far, the SRA domain of UHRF1 is the only established eukaryotic protein
69 module that specifically recognizes hemimethylated CpGs (30-32). Through its E3 ubiquitin
70 ligase activity, UHRF1 recruits and activates the maintenance DNA methyltransferase DNMT1
71 (33-38). During DNA replication, UHRF1-mediated dual mono-ubiquitylation of the PCNA-
72 associated factor PAF15 promotes DNMT1 activity to support DNA replication-coupled
73 maintenance DNA methylation (37). Additionally, when hemimethylated CpGs elude the
74 imperfect replication-coupled maintenance methylation mechanism, DNMT1 can catalyze
75 maintenance methylation far behind the replication fork. It has been suggested that this
76 replication-uncoupled maintenance DNA methylation acts as a backup mechanism, which is most
77 clearly observed in late-replicating/heterochromatin regions and is supported by UHRF1-
78 mediated histone H3 dual mono-ubiquitylation, which activates DNMT1 (16, 37, 39). It was also
79 shown that HELLS accelerates replication-uncoupled maintenance DNA methylation at late-
80 replicating regions in HeLa cells (39). Furthermore, it has been reported that HELLS can assist
81 the recruitment of UHRF1 and DNMT1 to chromatin and promote H3 ubiquitylation (25). While
82 the observed HELLS-UHRF1 interaction may underlie the importance of HELLS in replication-
83 uncoupled maintenance methylation (25), it remains unclear how HELLS is effectively recruited
84 to sites of hemimethylation in this process.
85 The abundance of nucleosomes, which drastically distort the DNA that wraps around the
86 core histone octamer, affects the accessibility/activity of many DNA-binding proteins (40),
87 including DNA methyltransferases (41-45). The location of hemimethylated DNA within the
88 nucleosome core particle (NCP) also inhibits its detection by the SRA domain of UHRF1 (46). In
89 vivo, nucleosomal barriers to DNA methylation can be alleviated by the SNF2-family ATPase
90 HELLS in vertebrates and DDM1 in plants (26). Although DDM1 can remodel the nucleosome
91 on its own (47, 48), we have previously demonstrated that HELLS alone is inactive and must bind
92 CDCA7 to form the CDCA7-HELLS ICF-related nucleosome remodeling complex (CHIRRC),
93 which exerts DNA-dependent ATPase and nucleosome remodeling activities (27). In Xenopus
94 egg extracts, CDCA7 is critical for recruiting HELLS to chromatin, but not vice versa. HELLS
95 also interacts with CDCA7 in human cells (49). The molecular basis of HELLS-CDCA7
96 interaction and CDCA7-chromatin interaction has not yet been established.
97 CDCA7 is characterized by its unique zinc-finger domain zf-4CXXC_R1, which is
98 broadly conserved in eukaryotes (28) (fig. S1). CDCA7 homologs with the prototypical zf-
99 4CXXC_R1 domain, containing eleven highly conserved signature cysteine residues and three
100 ICF disease-associated residues, are almost exclusively identified in species that also harbor
101 HELLS/DDM1 and maintenance DNA methyltransferases (DNMT1/MET1 or DNMT5), whereas
102 CDCA7 is almost always lost in species that lack detectable genomic 5mC, such as Drosophila,
103 Tribolium, Microplitis, Caenorhabditis, Schizosaccharomyces, and Saccharomyces (28). This
104 coevolution analysis suggests that zf-4CXXC_R1 domain became readily dispensable in species
105 that lack methylated DNA (28). However, the function of zf-4CXXC_R1 remains to be defined.
106 Here, we demonstrate that the zf-4CXXC_R1 domain of CDCA7 is a sensor for hemimethylated
107 DNA. Our results help explain how CDCA7 could confer the unique role of HELLS in
108 maintenance DNA methylation.
109
110 Results
111 Inhibiting maintenance DNA methylation enriches HELLS and CDCA7 on chromatin
112 Although CDCA7 coevolved with HELLS and the maintenance DNA methyltransferases (28),
113 their mechanistic link remained unclear. The first hint emerged when we observed that HELLS
114 preferentially accumulated on sperm chromatin after incubation in interphase DNMT1-depleted
115 Xenopus egg extracts (∆DNMT1) (Fig. 1A). Adding sperm nuclei to egg extracts promotes
116 functional nuclear formation, upon which DNA replication is rapidly executed between 30-60 min
117 after incubation (50). DNA synthesis on the highly methylated sperm chromosomal DNA
118 transiently generates hemimethylated DNA, which immediately induces maintenance DNA
119 methylation by UHRF1 and DNMT1 (35, 37, 38). Therefore, when maintenance methylation is
120 inhibited, hemimethylated DNA is expected to accumulate during DNA replication. Indeed, the
121 accumulation of higher molecular weight H3 species, characteristic for mono- and di-
122 ubiquitylated H3, in the DNMT1-depleted extract is in line with the absence of maintenance
123 methylation (Fig. 1A). We thus speculated that the observed enhanced enrichment of HELLS on
124 chromatin in ∆DNMT1 extracts was caused by the accumulation of hemimethylated DNA.
125 Alternatively, as it has been reported that UHRF1 and HELLS interact (25), this HELLS
126 enrichment on ∆DNMT1 extract could be caused by chromatin enrichment of UHRF1, which
127 directly binds hemimethylated DNA (30-32). To distinguish between these possibilities, we used
128 recombinant mouse DPPA3 (mDPPA3), which binds to UHRF1 and inhibits its association with
129 chromatin (51-53). In control egg extracts, DNMT1, UHRF1, HELLS and CDCA7e (a sole
130 CDCA7 paralog present in Xenopus eggs) transiently associated with chromatin in S phase (40-60
131 min after sperm nucleus addition to egg extracts) (Fig. 1B). In the presence of mDPPA3, DNMT1
132 and UHRF1 failed to associate with chromatin, while CDCA7e and HELLS exhibit robust and
133 continuous chromatin accumulation during the time course (Fig. 1B). These results support the
134 idea that CDCA7e and HELLS are enriched on highly hemimethylated chromatin generated upon
135 DNA replication in the absence of active maintenance DNA methylation. Consistent with this
136 idea, chromatin association of CDCA7e and HELLS was suppressed when DNA replication was
137 inhibited by geminin (fig. S2)(54).
138
139
140
141 CDCA7 zf-4CXXC_R1 domain selectively binds hemimethylated DNA

142 CDCA7-family proteins are defined by the presence of the unique zf-4CXXC_R1 domain, in
143 which all three identified ICF-disease associated residues are highly conserved (fig. S1) (28).
144 Since CDCA7e recruits HELLS to chromatin in Xenopus egg extracts but not vice versa (27), we
145 explored a possibility that CDCA7e directly recognizes hemimethylated DNA via the zf-
146 4CXXC_R1 domain. To test this hypothesis, beads coupled with unmethylated, hemimethylated,
147 or fully methylated DNA at CpG sites were incubated with Xenopus egg extracts. As expected,
148 UHRF1 and ubiquitylated H3 were preferentially enriched on hemimethylated DNA beads (Fig.
149 2A). Strikingly, CDCA7e was markedly enriched on hemimethylated DNA over unmethylated or
150 fully methylated DNAs (Fig. 2A). When 35S-labeled X. laevis CDCA7e produced in reticulocyte
151 lysates was assessed for its DNA binding in vitro, wildtype CDCA7e but not CDCA7e with any
152 of the ICF disease-associated mutations (R232H, G252V, or R262H) selectively associated with
153 hemimethylated DNA (Fig. 2B, Table S1). Direct and specific binding of CDCA7e to
154 hemimethylated DNA was further confirmed by electrophoretic mobility shift assay using
155 purified recombinant protein and double-stranded oligo-DNA containing a single hemimethylated
156 CpG site (Fig. 2C and D).
157 This hemimethylated DNA-specific binding was also observed for human CDCA7. Using
158 the recombinant zf-4CXXC_R1 domain of human CDCA7 (Fig. 2E and fig. S3A), we found that
159 the cysteine-rich segment (aa 264-340 in hCDCA7 NP_665809) of the zf-4CXXC_R1 domain
160 alone does not exhibit any detectable DNA binding capacity (fig. S3B). Adding an N-terminal
161 extension (aa 235-263) to the cysteine-rich segment weakly increased binding to the oligo-DNA
162 with a hemimethylated CpG (fig. S3C). However, extending the cysteine-rich segment to include
163 the evolutionarily conserved C-terminus, which contains two predicted alpha helices, conferred
164 highly selective hemimethylation-dependent DNA binding (Fig. 2E, fig. S1 and S3A). Altogether
165 these results demonstrate that the zf-4CXXC_R1 domain of CDCA7 acts as a hemimethylated
166 DNA-binding module.
167
168 CDCA7 recognizes a hemimethylated CpG at the major groove of linker DNA
169 Since CDCA7 stimulates nucleosome remodeling activity of HELLS, we asked how the
170 nucleosome could affect recognition of hemimethylated CpG by CDCA7. To address this
171 question by biochemical and structural approaches, we generated the recombinant zf-4CXXC_R1
172 domain of human CDCA7 (hCDCA7264-371 C339S). The C339S substitution was included to
173 improve protein homogeneity during purification while maintaining robust hemimethylated CpG-
174 specific binding (fig. S3D); C339 is not broadly conserved in CDCA7 family proteins and is
175 substituted to serine in Xenopus CDCA7e (fig S1). (28). Native gel electrophoresis demonstrated
176 that the nucleosome-hCDCA7264-371 C339S complex was readily observed when a
177 hemimethylated CpG was positioned at the linker DNA either at its 5’-end or 3’-end (Fig. 3A and
178 table S2). However, the complex formation was undetectable when the hemimethylated CpG was
179 located within the NCP (Fig. 3A).
180 To gain structural insight into CDCA7-hemimethylated DNA interaction, cryogenic
181 electron microscopy (cryo-EM) single particle analysis was conducted on hCDCA7264-371 C339S
182 in complex with a mono-nucleosome carrying a hemimethylated CpG at the 3’-linker DNA (fig.
183 S3, fig. S4, S5, Table S2, and Table S3). The initial cryo-EM map showed a density around the
184 major groove of the hemimethylated CpG in the linker DNA, although the density was ambiguous
185 due to the flexibility of the complex (fig. S4). 3D variability analysis and 3D classification
186 generated a cryo-EM map of 3.18 Å resolution for the NCP, where core histones and the
187 phosphate backbone of DNA were clearly resolved, and local refinement and local classification
188 generated a 4.83 Å resolution map for an extra cryo-EM density located outside of the linker
189 DNA (Fig. 3B, fig. S4, S5). This extra density is thought to be hCDCA7264-371 bound to linker
190 DNA, as it aligns reasonably well with the AlphaFold2 (AF2)-predicted structure of the zf-
191 4CXXC_R1 domain of human CDCA7 (Fig. 3C) (55, 56). First, a notable protrusion of the extra
192 cryo-EM density matches the characteristic C-terminal alpha-helix of hCDCA7 predicted by AF2
193 (Fig. 3C, orange). Second, fitting the AF2-predicted model of hCDCA7 model structure into the
194 cryo-EM map predicts that the protein surface facing the DNA backbone is positively charged
195 (Fig. 3D). Furthermore, in this structure model, the side chain of R304 and R274, mutated in ICF
196 patients, respectively point toward the DNA backbone and the DNA major groove where the
197 hemimethylated CpG resides (Fig. 3E), consistent with the observed abrogation of
198 hemimethylated CpG binding upon mutating these residues (Fig. 2B, 2D).
199
200 Characterization of the HELLS-CDCA7 interaction interface
201 Our previous coevolution analysis has shown that the evolutionary preservation of CDCA7 is
202 tightly coupled to the presence of HELLS; while CDCA7 and HELLS were frequently lost from
203 several eukaryote lineages, all the tested eukaryotic species that encode CDCA7 also have
204 HELLS (28). As this suggests an evolutionarily conserved function involving both CDCA7 and
205 HELLS, we reasoned that the HELLS-CDCA7 interaction interface is likely also conserved in
206 these species. We employed AF2 structure prediction of HELLS-CDCA7 complex using
207 sequences of HELLS/DDM1 and CDCA7 homologs from diverse eukaryotic species to identify
208 likely CDCA7-HELLS interaction domains (55, 56). In all tested cases (X. laevis HELLS-
209 CDCA7e, H. sapiens HELLS-CDCA7, H. sapiens HELLS-CDCA7L, Ooceraea biroi (clonal
210 raider ant) HELLS-CDCA7, Nematostella vectensis (starlet sea anemone) HELLS-CDCA7, and
211 Arabidopsis thaliana DDM1-CDCA7), AF2 predicted the interaction of an N-terminal alpha helix
212 of CDCA7 (aa 74-105 of X. laevis CDCA7e) with an N-terminal alpha helix of HELLS/DDM1
213 (aa 63-96 of X. laevis HELLS), as well as multiple segments within the SNF2_N domain of
214 HELLS/DDM1 (Fig. 4A, B and fig. S6). The N-terminal putative CDCA7-binding alpha helix of
215 HELLS corresponds to the previously annotated CC2 (coiled-coil2) segment, while it has been
216 reported that the deletion of the preceding CC1 activates human HELLS by releasing its
217 autoinhibition (57). AF2 also predicted an additional shorter CDCA7-binding interface in X.
218 laevis and H. sapiens HELLS (aa 163-172 in X. laevis HELLS) (Fig. 4A, B and fig. S6A-D). The
219 putative interacting alpha helices of CDCA7 and HELLS/DDM1 are evolutionarily conserved in
220 divergent green plant and animal species (Fig. 4C, D, fig. S6C-G and fig. S7), whereas sequence
221 conservation of the second CDCA7-binding interface in HELLS is less clear (Fig. 4E).
222 To experimentally validate these HELLS-CDCA7 binding interfaces, 35S-labeled X. laevis
223 HELLS or CDCA7e proteins with or without these segments were incubated with Xenopus egg
224 extracts to allow for binding to endogenous HELLS/CDCA7e proteins. Co-immunoprecipitation
225 experiments demonstrate that deleting the first predicted CDCA7-binding interface of HELLS (aa
226 63-96) abolished HELLS-CDCA7e interaction, whereas deleting the second interface of HELLS
227 (aa 163-172) also reduced CDCA7e binding, albeit to a lesser extent (Fig. 4F). This result
228 suggests that the N-terminal CC2 of HELLS acts as a critical CDCA7-binding interface.
229 Conversely, deleting the predicted HELLS-binding interface in CDCA7e (aa 74-105) abolished
230 HELLS interaction (Fig. 4G). The result was also confirmed by using full-length or truncated
231 versions of recombinant FLAG-tagged CDCA7e (fig. S8); all mutants lacking the N-terminal
232 alpha helix abolished HELLS binding, whereas the N-terminal portion that includes this alpha
233 helix but lacks zf-4CXXC_R1 retains robust HELLS binding. Altogether these data support the
234 AF2 predicted model in which CDCA7 and HELLS interact via their evolutionarily conserved N-
235 terminal helices. We name these helices in CDCA7 and HELLS respectively HLBH (HELLS-
236 binding helix) and C7BH (CDCA7-binding helix).
237
238 CDCA7 recruits HELLS to hemimethylated DNA
239 The experiments above showed that HELLS and CDCA7 are enriched on chromatin with
240 hemimethylated DNA (Fig. 1), and that CDCA7 directly binds to hemimethylated DNA (Fig. 2
241 and 3). To test if HELLS accumulation onto hemimethylated DNA depends on CDCA7,
242 unmethylated or hemimethylated DNA beads were incubated with mock IgG-depleted (∆MOCK)
243 or CDCA7e-depleted (∆CDCA7e) interphase egg extracts. Depletion of CDCA7e did not co-
244 deplete HELLS from egg extracts, but dramatically reduced the binding of HELLS to
245 hemimethylated DNA (Fig. 5A). Furthermore, when 35S-labeled HELLS was incubated with egg
246 extracts, it preferentially bound to hemimethylated DNA over unmethylated DNA (Fig. 5B). This
247 hemimethylated DNA-specific binding was abolished by CDCA7 depletion or deleting the
248 CDCA7-binding helix from HELLS (C7BH: ∆63-96) (Fig. 5B, Table S1). Based on these
249 observations, we conclude that CDCA7 recruits HELLS to the hemimethylated DNA.
250
251 The role of HELLS and CDCA7 in UHRF1-mediated histone H3 ubiquitylation
252 Studies using ICF patient-derived cells and cell lines, as well as targeted depletion/knockout in
253 culture cells, suggested that HELLS and CDCA7 are especially required for maintaining DNA
254 methylation at heterochromatic, late-replicating regions (15, 39, 49, 58). It was also suggested
255 that HELLS/DDM1-dependent methylation is mediated by DNMT1/MET1 (plant DNMT1) (25,
256 59). However, we did not detect any measurable impact of CDCA7e or HELLS depletion on
257 maintenance DNA methylation of sperm or erythrocyte nuclei in Xenopus egg extracts as
258 monitored by the incorporation of S-[methyl-3H]-adenosyl-L-methionine (35) (fig. S9). The
259 apparent absence of a role for HELLS and CDCA7e in bulk maintenance DNA methylation could
260 be explained by their function in replication-uncoupled maintenance methylation specifically,
261 which is mediated by UHRF1-dependent H3 ubiquitylation (37). Indeed, it has been shown in
262 HeLa cells that HELLS facilitates UHRF1-mediated H3 ubiquitylation (25), and promotes the
263 replication-uncoupled maintenance methylation at late-replicating regions (39). However, no
264 obvious effect of CDCA7e or HELLS depletion on H3 ubiquitylation was observed when
265 hemimethylated DNA beads were exposed to egg extracts (fig. S10A), even after inducing
266 nucleosome assembly on hemimethylated DNA by preincubating beads in egg extract lacking
267 maintenance methylation (fig. S10B and C). The failure to detect a requirement for CDCA7e and
268 HELLS in H3 ubiquitylation on hemimethylated DNA beads could arise from the specific
269 chromatin environment established on DNA beads in egg extract; nucleosome density as well as
270 the presence or absence of specific histone variants and/or modifications (60, 61) are likely
271 specific to the use of an exogenous DNA substrate and conceivably impact the requirement for
272 CDCA7e and HELLS in H3 ubiquitylation.
273 Therefore, we next attempted to examine the potential role of CDCA7e and HELLS in H3
274 ubiquitylation on native chromatin after DNA replication. For this purpose, we first induced the
275 accumulation of hemimethylated CpG on sperm nuclei by replicating sperm chromatin in the
276 presence of mDPPA3 (Fig. 6A). These sperm nuclei containing hemimethylated DNA were
277 subsequently transferred to fresh egg extracts with or without aphidicolin, which inhibits DNA
278 replication. As expected, UHRF1 readily and transiently associated with these chromatin
279 substrates and promotes H3 ubiquitylation even in the presence of aphidicolin, demonstrating that
280 UHRF1-mediated H3 ubiquitylation was uncoupled from DNA replication (Fig. 6A). In this
281 experimental context, depletion of CDCA7 or HELLS mildly reduced H3 ubiquitylation and
282 DNMT1 association (Fig. 6B and C). Altogether, these results are in line with the idea that
283 CDCA7 recruits HELLS to hemimethylated chromatin to facilitate replication-uncoupled
284 maintenance methylation.
285
286 Discussion
287 Among several SNF2-family ATPases that can remodel nucleosomes, HELLS/DDM1 plays a
288 unique role in DNA methylation (28). It has also been reported that HELLS promotes replication-
289 uncoupled maintenance DNA methylation by facilitating histone H3 ubiquitylation (25). Our
290 present study revealed a previously missing molecular link between HELLS and the maintenance
291 methylation pathway; CDCA7, which recruits HELLS to hemimethylated CpG via its unique zf-
292 4CXXC_R1 domain.
293 Assisted by AF2 structural prediction, we demonstrated that two evolutionarily conserved
294 alpha helices at the N-terminal regions of CDCA7 and HELLS are responsible for their
295 interaction. It has been shown that HELLS on its own is catalytically inactive (27, 62). Deleting
296 the N-terminal alpha helix CC1 of human HELLS preceding the CDCA7-binding helix
297 (C7BH/CC2) activates the ATPase and nucleosome remodeling activities of HELLS (57).
298 Similarly, the N-terminal region of Arabidopsis DDM1 harboring CC1 and CC2 form an
299 autoinhibitory (AutoN) domain (Fig. 4D) (48). Consistent with its proposed autoinhibitory
300 function, the AF2 models predict that the highly acidic CC1 of Arabidopsis DDM1 associates
301 with the basic cleft that captures DNA on the nucleosome core particle (NCP) (fig. S6G-I) (48);
302 this CC1 placement should interfere with DDM1 binding to the nucleosome. Intriguingly, the
303 AF2 model predicts that the binding of CDCA7 is insufficient to affect CC1 association with the
304 DNA-binding cleft of DDM1 (fig. S6G). It is thus possible that the plant CDCA7 recruits DDM1
305 to hemimethylated DNA but is not essential for DDM1 activation, although it remains to be tested
306 if the plant CDCA7 binds DDM1. For animal HELLS homologs, CC1 and CC2 are predicted to
307 form a long continuous helix (Fig. 4 and fig. S6C-F), while the acidic feature of the autoinhibitory
308 CC1 is evolutionarily conserved (Fig. 4D). Future studies are needed to test whether binding of
309 CDCA7 activates HELLS/DDM1 by displacing the CC1 from the DNA-binding cleft.
310 While mutations of DNMT3B (ICF1), ZBTB24 (ICF2), CDCA7 (ICF3) and HELLS
311 (ICF4) cause ICF syndromes, the genomic DNA methylation pattern in the de novo DNA
312 methyltransferase-defective ICF1 patient cell lines are distinct from ICF2-4 cell lines, in which
313 CpG-poor regions with heterochromatin features are particularly hypomethylated (58). This
314 observation potentially indicates the importance of the ZBTB24-CDCA7-HELLS axis, but not de
315 novo DNA methylation, to establish stably inherited DNA methylation at these regions.
316 Additionally, coevolution analysis demonstrated that CDCA7 and HELLS have stronger
317 evolutionary links to DNMT1 than to DNMT3 (28). These findings suggested a function for
318 CDCA7 and HELLS in DNA maintenance methylation at hemimethylated DNA, which are now
319 consolidated by our demonstration that CDCA7 zf-4CXXC_R1 domain specifically recognizes
320 hemimethylated CpG, the substrate of DNMT1. The fact that ICF disease-associated mutations in
321 CDCA7 abolish its hemimethylated DNA binding supports the functional importance of
322 hemimethylation detection by CDCA7.
323 Since DNA methyltransferases cannot methylate DNA on the NCP (41-45), we previously
324 postulated that CDCA7-HELLS promotes DNA methylation by sliding and exposing DNA from
325 the NCP for DNA methyltransferases (27). Our biochemical study showed that the zf-4CXXC_R1
326 domain of CDCA7 can recognize a hemimethylated CpG when placed at the linker DNA but not
327 at a position within the NCP. However, since the positioning of the hemimethylated CpG was not
328 tested exhaustively, we cannot rule out the possibility that the zf-4CXXC_R1 domain binds
329 hemimethylated CpG within the NCP at a different location. Indeed, our cryo-EM structure
330 suggests that the zf-4CXXC_R1 domain recognizes hemimethylated CpG in the major groove of
331 B-form DNA, without requiring any apparent contact with the minor groove. This contrasts with
332 the SRA domain of UHRF1, which extensively engages both the major and minor grooves (30-
333 32). As histones contact the minor groove all along the NCP (63), it is tempting to speculate that
334 CDCA7 may be more amenable to detecting hemimethylated CpGs in the context of nucleosomes
335 than UHRF1. Although not detected in our structure at the current resolution, it is also possible
336 that specific recognition of hemimethylated CpG by CDCA7 may require DNA distortion in a
337 way that is impossible on the NCP, similar to UHRF1 and DNMT1 (30-32, 64). While detailed
338 structural and mechanistic understanding requires further investigation, we envision that the
339 recruitment and activation of HELLS to hemimethylated DNA via CDCA7 unwraps DNA from
340 the NCP, and may additionally increase the accessibility of the histone H3 N-terminal tail that
341 otherwise associates with linker DNA (65-68), thereby promoting its recognition by UHRF1 (69,
342 70). In this way, the binding of hemimethylated CpGs by CDCA7 may promote methylation
343 within DNA normally found within the NCP.
344 We note several limitations in this study. First, since it has been shown that binding of
345 UHRF1 to histone H3 di- or tri-methylated at lysine 9 (H3K9me2/3) facilitates DNA methylation
346 at heterochromatin (39, 71), the role of CDCA7 in maintenance methylation in the context of
347 heterochromatic nucleosomes remains to be tested. Second, although this study focused on the
348 role of CDCA7 in maintenance methylation, it is possible that hemimethylated DNA sensing by
349 CDCA7 also plays an important role outside of this process. Indeed, DNA methylation in insects
350 is largely associated with gene bodies and not with heterochromatic transposable elements (72-
351 75), apparently contradicting the suggested specialized role of CDCA7-HELLS in maintaining
352 DNA methylation at heterochromatin. It will be important to test the functional significance of
353 CDCA7-hemimethylated CpG binding in other processes where HELLS and/or CDCA7 play
354 roles, such as DNA repair, resolution of DNA-RNA hybrids, and macroH2A deposition (49, 62,
355 76-82). Third, the low resolution of our current cryo-EM structure of the CDCA7-nucleosome
356 complex prevented us from dissecting the structural basis for hemimethylated CpG recognition by
357 CDCA7 at atomic resolution. Fourth, although our data clearly show that CDCA7 selectively
358 binds to DNA with a single hemimethylated CpG over unmethylated or symmetrically methylated
359 CpG, further investigations are needed to test if CDCA7 has more optimized substrates. The
360 binding may be affected by DNA sequence, density and spacing of hemimethylated CpG, or other
361 modifications, such as 5-hydroxymethylcytosine.
362
363 Materials and Methods
364 Xenopus egg extracts

365 At the Rockefeller University, Xenopus laevis was purchased from Nasco (female, LM00535MX)
366 or Xenopus 1 (female, 4270; male, 4235); and all vertebrate animal protocols (20031 and 23020)
367 followed were approved by the Rockefeller University Institutional Animal Care and Use
368 Committee. In Fig. 1A; Fig. 2A; Fig. 4F and G; Fig. 5; fig. S9 and fig. S10, freshly prepared
369 crude cytostatic factor (CSF) metaphase-arrested egg extracts were prepared as previously
370 published (Murray, 1991). To prepare interphase extracts, 0.3 mM CaCl2 was added to CSF
371 extract containing 250 ng/μl cycloheximide.
372 At the Institute of Medical Science, University of Tokyo, X. laevis was purchased from Kato-S
373 Kagaku and handled according to the animal care regulations at the University of Tokyo. In Fig.
374 1B, Fig. 6, fig. S2 and fig. S7, clarified cytoplasmic extracts were used. Crude interphase egg
375 extracts were prepared as described previously (37, 83), supplemented with 50 μg/ml
376 cycloheximide, 20 μg/ml cytochalasin B, 1 mM dithiothreitol (DTT), 2 μg/ml aprotinin, and 5
377 μg/ml leupeptin and clarified by ultracentrifugation (Hitachi, CP100NX, P55ST2 swinging rotor)
378 for 20 min at 48,400× g. The cytoplasmic extracts were aliquoted, frozen in liquid nitrogen, and
379 stored at –80°C. The clarified cytoplasmic extracts were supplemented with an energy
380 regeneration system (2 mM ATP, 20 mM phosphocreatine, and 5 μg/ml creatine phosphokinase).
381
382 Chromatin isolation
383 Xenopus sperm nuclei (3000-4000 per μl) was added to interphase extract and incubated at 22 °C.
384 Extract was diluted five- to ten-fold in chromatin purification buffer (CPB; 50 mM KCl, 5 mM
385 MgCl2, 2 % sucrose, 20 mM HEPES-KOH, pH 7.6) supplemented with 0.1 % Nonidet P-40 (NP-
386 40). With the exception of Fig. 1A, CPB was additionally supplemented with 2 mM NEM and 0.1
387 mM PR-619. Diluted extracts were layered onto a CPB-30% sucrose cushion and centrifuged at
388 15,000× g for 10 min at 4 °C. The chromatin pellet was recovered in 1x Laemmli sample buffer,
389 boiled and Western blotting was performed against the indicated proteins.
390
391 Antibodies and western blotting
392 Xenopus CDCA7e, HELLS, PAF15, DNMT1 and UHRF1 were detected with rabbit polyclonal
393 antibodies previously described (27, 35, 37). Rabbit polyclonal histone H3 antibody (ab1791) was
394 purchased from Abcam. Rabbit polyclonal histone H4 antibody (Cat #61521) was purchased from
395 Active Motif. In Fig. 1A; Fig. 2A; Fig. 5; and fig. S10, antibodies were used in LI-COR Odyssey
396 blocking buffer at the following dilutions: affinity purified anti-CDCA7e (2 µg/ml), affinity
397 purified anti-HELLS (3.5 µg/ml), anti-UHRF1 serum (1:500), anti-H3 (1:1000); anti-H4 (1:1000).
398 Primary antibodies were detected with IRDye® secondary antibodies (Cat #926-32211; Cat #926-
399 68070, LI-COR BioSciences) and subsequently imaged and quantified on an Odyssey Infrared
400 Imaging System. In Fig. 1B, Fig. 6, fig. S2 and fig. S7, anti-DNMT1 (1:500) and anti-UHRF1
401 (1:500) sera were used in 5% Milk in PBS-T; anti-PAF15 (1:500), anti-CDCA7e (1:500) and anti-
402 HELLS (1:500) sera were used in Sol 1 (Toboyo, Can Get Signal® Immunoreaction Enhancer
403 Solution). Primary antibodies were detected with HRP-conjugated secondary antibodies (rabbit
404 IgG-, Protein A-, or mouse IgG-conjugated with HRP, Thermo Fisher Scientific) and ECL
405 detection reagent (Amersham). After exposure to the wrapped membrane, X-ray film was
406 developed.
407
408 Immunodepletion
409 To immunodeplete CDCA7e or HELLS from extracts used for DNA beads pull-down
410 experiments, 37.5 µg affinity purified anti-CDCA7 or anti-HELLS antibodies was coupled to 150
411 µl Protein A Dynabeads (Thermo Fisher Scientific) and used to deplete 100 µl extract at 4 oC for
412 45 min. To immunodeplete DNMT1 from extract used for chromatin isolation experiments, 85 µl
413 serum was coupled to 25 µl Protein A Dynabeads (Thermo Fisher Scientific) and used to deplete
414 33 μL extract in three separate rounds at 4 oC, each for 1 h. Prior to depletion, antibody-coupled
415 Dynabeads were washed extensively in sperm dilution buffer (5 mM HEPES, 100 mM KCl, 150
416 mM sucrose, 1mM MgCl2, pH 8.0). To immunodeplete CDCA7e or HELLS from extract used for
417 chromatin isolation experiments, 170 µl of antiserum was coupled to 40 µl of recombinant Protein
418 A Sepharose (rPAS, GE Healthcare). Antibodies bound beads were washed extensively in CPB
419 and supplemented with 4 µl fresh rPAS. Beads were split into two portions, and 100 µl of extract
420 was depleted in two rounds at 4°C, each for 1 h. Mock depletion was performed using purified
421 preimmune rabbit IgG (Sigma-Aldrich).
422
423 Immunoprecipitations
424 For coimmunoprecipitation from Xenopus egg extracts, anti-HELLS and anti-CDCA7e antibodies
425 (25 μg) were coupled to 100 μl Protein A Dynabeads for 1 h at RT. Antibodies were crosslinked
426 to the beads with PierceTM BS3 (Thermo Fisher Scientific), following the manufacturer’s protocol.
427 Antibody beads were washed extensively in sperm dilution buffer (5 mM HEPES, 100 mM KCl,
428 150 mM sucrose, 1 mM MgCl2, pH 8.0). To test CDCA7 and HELLS interactions, CDCA7e or
429 HELLS wildtype or interface mutants were expressed and radiolabeled with EasyTagTM L-[35S]-
430 Methionine (Perkin Elmer) using the TnT Coupled Reticulocyte Lysate System (Promega)
431 according to the manufacturer’s instructions. HELLS and CDCA7 mutants were cloned into pCS2
432 vector by Gibson assembly. Immunoprecipitation was performed in 50 μl interphase egg extracts
433 supplemented with 250 ng/ μl cycloheximide and 0.08 μl of the indicated 35S-labeled CDCA7 and
434 HELLS TnT lysates per μl of extract. Extract was added to the beads and incubated on ice for 1 h
435 with flicking every 20 min. The extract was diluted with 10 volumes CSF-XB (100 mM KCl, 1
436 mM MgCl2, 50 mM sucrose, 5 mM EGTA, and 10 mM HEPES, pH 8.0) and beads were
437 recovered on a magnet. Beads were washed and recovered three times with 150 μl CSF-XB with
438 0.1 % Triton X-100. Beads were resuspended in 1x Laemmli buffer, boiled and supernatants were
439 resolved by SDS-PAGE. Gels were fixed in fixative (1:2:7 glacial acetic acid:methanol:H2O),
440 dried and exposed on a PhosphorImager screen. Control immunoprecipitation was performed
441 using purified preimmune rabbit IgG (Sigma-Aldrich).
442 DNA pull-down assays

443 To generate hemimethylated pBlueScript DNA substrates, a PCR-linearized pBlueScript template
444 was methylated by the CpG methyltransferase M.SssI according to manufacturer’s protocol (Cat
445 #EM0821, Thermo Fisher Scientific). DNA synthesis across the methylated linearized
446 pBlueScript template was subsequently performed in Q5® High-Fidelity 2X Master Mix (New
447 England Biolabs, Inc.) using a 5’ biotinylated primer (5’-
448 /5Biosg/CGTTCTTCGGGGCGAAAACTCTCAAGG -3’) purchased from Integrated DNA
449 Technologies. The reaction mix was purified using the QIAquick PCR purification kit (QIAGEN)
450 and the resultant hemimethylated DNA product was subsequently purified from the reaction mix
451 by conjugation to streptavidin M280 dynabeads (Invitrogen). DNA was coupled to streptavidin
452 beads at ~2 μg DNA/5 μl bead slurry in bead coupling buffer (50 mM Tris-Cl, 0.25 mM EDTA,
453 0.05% Triton X-100, pH 8.0) supplemented with 2.5% polyvinyl alcohol and 1.5 M NaCl for at
454 least 2 h at RT. After conjugation, DNA-streptavidin beads were collected and incubated in 50
455 mM Tris-Cl, 0.25 mM EDTA, 0.05% Triton X-100 with 1 mM biotin for at least 30 min. DNA
456 beads were extensive washed in sperm dilution buffer (5 mM HEPES, 100 mM KCl, 150 mM
457 sucrose, 1 mM MgCl2, pH 8.0) prior to performing any pull-down assay. For nonmethylated
458 BlueScript DNA substrates, the above protocol was performed using unmethylated linearized
459 pBlueScript template during DNA synthesis. Fully-methylated pBlueScript DNA substrates were
460 generated by methylating the nonmethylated pBlueScript DNA substrates by CpG
461 methyltransferase M.SssI (Thermo Fisher Scientific) prior to DNA-bead conjugation. 200 bp
462 ultramers with Widom 601 nucleosome positioning sequence (Table S1) (84) were purchased
463 from Integrated DNA Technologies and conjugated to streptavidin M280 Dynabeads as described
464 above at ~1 μg DNA/5 μl bead slurry. Methylation status of all DNA substrates was confirmed by
465 restriction digest with BstUI (New England Biolabs, Inc.).
466 For DNA bead pull-downs analyzed by western blot (Fig. 2A, Fig. 5A, fig. S10) DNA beads were
467 incubated in interphase Xenopus egg extract. The extract was diluted with 10 volumes CSF-XB
468 and recovered on a magnet for 5 min at 4 °C. Beads were washed and recovered three times with
469 150 μl CSF-XB with 0.1% Triton X-100. Beads were resuspended in 1x Laemmli buffer, boiled
470 and supernatants were resolved by SDS-PAGE. Western blotting was performed against the
471 indicated proteins. To assess protein binding by autoradiography (Fig. 2B; Fig. 4F-G and Fig.
472 5B), indicated proteins were expressed and radiolabeled with EasyTagTM L-[35S]-Methionine
473 (Perkin Elmer) using the TnT Coupled Reticulocyte Lysate System (Promega) according to the
474 manufacturer’s instructions. 35S-labeled Xkid (85) or Xkid-DNA binding domain was used as a
475 DNA loading control. The C-terminally GFP tagged DNA-binding domain of Xkid (Xkid-DBD,
476 amino acids 544–651) was cloned into pCS2 vector by Gibson assembly. To assess the
477 recruitment of HELLS to hemimethylated DNA in egg extract using autoradiography (Fig. 5B),
478 DNA bead pull-down was performed in Interphase Xenopus egg extract supplemented with 0.1 μl
35
479 S-labeled HELLS and 0.03 μl 35S-labeled Xkid-DBD per μl of extract. Beads were washed and
480 recovered three times with 150 μl CSF-XB with 0.1 % Triton X-100. Beads were resuspended in
481 1x Laemmli buffer, boiled and supernatants were resolved by SDS-PAGE. Gel was fixed in
482 fixative (1:2:7 glacial acetic acid:methanol:H2O), dried and exposed on a PhosphorImager screen.
483 To assess the in vitro binding of CDCA7e ICF mutants to hemimethylated DNA by
484 autoradiography (Fig. 2B), DNA bead pull-down was performed in binding buffer (10 mM
485 HEPES, 100 mM NaCl, 0.025 % Triton X-100, 0.25 mM TCEP, pH 7.8) supplemented with 0.2
486 μl 35S-labeled CDCA7 and 0.05 μl 35S-labeled Xkid per μl binding buffer. Beads were washed
487 and recovered three times with binding buffer supplemented with 0.1% Triton X-100. Beads were
488 resuspended in 1x Laemmli buffer, boiled and resolved by gel electrophoresis. All DNA pull-
489 downs were performed at 20 oC.
490 Detection of DNA methylation maintenance in Xenopus egg extract

491 DNA methylation of replicating sperm or erythrocyte nuclei in egg extract was assayed by the
492 incorporation of 3H-SAM (S-[methyl-3H]-adenosyl-L-methionine; Perkin Elmer, NET155H).
493 Demembranated sperm nuclei were prepared as published previously (86). Erythrocyte nuclei
494 were prepared from blood collected from dead adult male Xenopus laevis frogs that were
495 sacrificed for testis dissection, following the protocol published previously (87), with the addition
496 of an extra dounce homogenization step prior to pelleting the nuclei over the 1M sucrose cushion.
497 Erythrocyte nuclei were stored at -20 o C in 50% glycerol STMN buffer (10 mM NaCl, 10 mM
498 Tris pH 7.4, 3 mM MgCl2, 0.5% NP-40). Sperm or erythrocyte nuclei were replicated in cycling
499 egg extract (3000 nuclei/μl extract) supplemented with 250 ng/μl cycloheximide and 0.335 μM
3
500 H-SAM (82.3 Ci/mmol) for 1 h at 20 oC. Replication was inhibited by the addition of 200 nM of
501 recombinant GST-tagged nondegradable geminin (fig. S9, an expression plasmid provided by W.
502 Matthew Michael) (54) or 500 nM of 6His-geminin (fig. S2, a gift from Tatsuro Takahashi). The
503 reaction was stopped by the addition of 9 volumes of CPB. Genomic DNA was purified using a
504 Wizard Genomic DNA Purification Kit (Promega) according to the manufacturer’s instructions.
505 Chromatin pellets were resuspended in scintillation fluid (ScintiVerse; Thermo Fisher Scientific)
506 and quantified using a liquid scintillation counter (Perkin Elmer, Tri-Carb® 2910 TR).
507
508 Protein purification
509 For FLAG×3-tagged full-length mDPPA3 or xCDCA7e expression in insect cells, Baculoviruses
510 were produced using a BestBac v-cath/chiA Deleted Baculovirus Cotransfection kit (Expression
511 system) following the manufacturer’s instructions. Proteins were expressed in Sf9 insect cells by
512 infection with viruses expressing 3xFLAG-tagged mDPPA3 or xCDCA7e for 72 h at 27 °C. Sf9
513 cells from a 750 ml culture were collected and lysed by resuspending them in 30 ml lysis buffer,
514 followed by incubation on ice for 10 min. A soluble fraction was obtained after centrifugation of
515 the lysate at 15,000× g for 15 min at 4 °C. The soluble fraction was incubated for 4 h at 4 °C with
516 250 µl of anti-FLAG M2 affinity resin equilibrated with lysis buffer. The beads were collected
517 and washed with 10 ml wash buffer and then with 5 ml of EB [20 mM HEPES-KOH (pH 7.5),
518 100 mM KCl, 5 mM MgCl2] containing 1 mM DTT. Each recombinant protein was eluted twice
519 in 250 µl of EB containing 1 mM DTT and 250 µg/ml 3×FLAG peptide (Sigma-Aldrich). Eluates
520 were pooled and concentrated using a Vivaspin 500 (GE Healthcare).
521 cDNA of human CDCA7 encoding residues 264-371, 235-340 and 264-340 were sub-cloned into
522 modified pGEX4T-3 plasmid (Cytiva) engineered for N-terminal GST and a small ubiquitin-like
523 modifier-1 (SUMO-1) fusion tag (88). The protein was expressed E.coli strain Rosetta 2 (DE3)
524 (Novagen). The cells were grown at 37 ºC in Luria-Bertani medium (LB) containing 50 µg/ml
525 ampicillin and 34 µg/ml chloramphenicol until reaching on optical density of 0.7 at 660 nm, and
526 then cultured in 0.2 mM IPTG for 15 h at 15 °C. The cells were lysed by sonication in 40 mM
527 Tris-HCl (pH 8.0) buffer containing 300 mM NaCl, 0.1 mM DTT (or 0.5 mM TCEP for CDCA7
528 residues 235-340 and 264-340), 30 µM zinc acetate, 10% (W/V) glycerol and a protease inhibitor
529 cocktail (Nacalai). After removing the debris by centrifugation, the supernatant was loaded onto
530 Glutathione Sepharose 4B (Cytiva). After GST-SUMO tag was removed by SUMO-specific
531 protease, the sample was loaded onto HiTrap Heparin column (Cytiva). Finally, the protein was
532 further purified using size-exclusion chromatography Hiload 26/600 S75 (Cytiva).
533
534 Electrophoresis mobility shift assay
535 10 µl of samples were incubated for 30 min at 4 °C in a binding buffer [20 mM Tris-HCl (pH 7.5)
536 containing 150 mM NaCl, 1 mM DTT, 0.05 % NP-40 and 10% (w/v) glycerol] and
537 electrophoresis was performed using a 0.5 × Tris-Acetate buffer [20 mM Tris-Acetic acid
538 containing 0.5 mM EDTA at constant current of 8 mA for 100 min in a cold room on a 7.5%
539 polyacrylamide gel purchased from Wako (SuperSepTM). 0.5, 1.0 and 2.0 equimolar excess of the
540 CDCA7 264-371 were added to the sample solution including 0.5 µM hemi-, full- and un-
541 methylated DNA (upper: 5’- CAGGCAATCXGGTAGATC, lower: 5’-
542 GATCTACXGGATTGCCTG, where X indicates cytosine or 5-methylcytosine). 3.0, 5.0 and 10.0
543 equimolar excess of the CDCA7 264-340 and 235-340 were added to the sample solution
544 including the 0.5 µM DNAs.
545 For analyzing the interaction with reconstituted nucleosomes, 0.5, 1.0, 2.0 and 5.0 equimolar
546 excess of the CDCA7 264-371 or 0.77, 1.54 and 3.85 equimolar excess of Flag×3-xCDCA7WT
547 or Flag×3-xCDCA7R232H were added to 0.1 µM nucleosomes in 10 µl reaction solution
548 (binding buffer: 20 mM Tris-HCl (pH 7.5), 50 mM NaCl, 1 mM DTT, 10 % Glycerol, 0.05 %
549 NP-40) and electrophoresis was performed using a 0.5 × TBE buffer [(45 mM Tris-borate and 1
550 mM EDTA ) at constant current of 10 mA for 95 min in a cold room on a 7.5% polyacrylamide
551 gel. To analyze the interactions, DNA was detected and analyzed by staining with GelRedTM
552 (Wako) and the ChemiDoc XRS system (BIORAD), respectively.
553
554 Nucleosome reconstruction
555 Recombinant human histone H2A, H2B, H3.1 and H4 proteins were produced in Escherichia coli
556 and purified using gel filtration chromatography and cation exchange chromatography as reported
557 previously (89). The histone proteins were refolded into a histone octamer. All DNA including a
558 single hemimethylated CpG were based on the Widom601 nucleosome positioning sequence (84).
559 For preparation of DNA with a hemimethylated CpG at the 5’-linker, the Widom601 sequence
560 was amplified using the primers (Table S2). For preparation of DNA with a hemimethylated site
561 in the 3’-linker and nucleosomal DNA, the Widom601 sequence was amplified with BsmBI site
562 at the 3’-region and digested by BsmBI (Table S2). The fragment was ligated with
563 oligonucleotides including a single hemimethylated CpG (Table S2). The DNAs were purified
564 with anion-exchange chromatography, HiTrap Q HP (Cytiva). The histone octamers were
565 reconstituted into nucleosome with purified DNAs by salt dialysis method and the nucleosomes
566 were purified with anion-exchange chromatography, HiTrap Q HP. The purified nucleosomes
567 were dialyzed against 20 mM Tris–HCl buffer (pH 7.5), containing 1 mM DTT and 5% glycerol.
568 The nucleosomes were frozen in liquid nitrogen and stored at −80°C.
569
570 Cryo-EM data collection and data processing
571 3 µL of the human CDCA7264-371 in complex with the nucleosome harboring a single
572 hemimethylated CpG in the 3’-linker DNA was applied onto the glow-discharged holey carbon
573 grids (Quantifoil Cu R1.2/1.3, 300 mesh). The grids were plunge-frozen in liquid ethane using a
574 Vitrobot Mark IV (Thermo Fisher Scientific). Parameters for plunge-freezing were set as follows:
575 blotting time, 3 sec; waiting time, 3 sec; blotting force, -10; humidity, 100 %; and chamber
576 temperature, 4 °C. Data was collected at RIKEN BDR on a 300-kV Krios G4 (Thermo Fisher
577 Scientific) with a K3 direct electron detector (Gatan) with BioQuantum energy filter. A total of
578 4,000 movies were recorded at a nominal magnification of ×105,000 with a pixel size of 0.83 Å,
579 in a total exposure of 60.725 e−/Å2 per 48 frames with an exposure time of 2.2 sec. The data were
580 automatically acquired by the image shift method of the EPU software (Thermo Fisher
581 Scientific), with a defocus range of −0.8 to −1.6 μm.
582
583 Data processing
584 All Data were processed using cryoSPARC v4.2.1 and v4.4.0 (90). The movie stacks were motion
585 corrected by Patch Motion Correction. The defocus values were estimated from the Contrast
586 transfer function (CTF) by Patch CTF Estimation. Micrographs under 8 Å CTF resolution were
587 cut off by Curate Exposures, and 3,973 micrographs were selected. A total of 1,881,583 particles
588 were automatically picked using Blob Picker. Particles (1,583,471) were extracted using binning
589 state (3.31 Å/pixel) and these particles were subjected to 2D Classifications. Particles were further
590 curated by Heterogeneous Refinement using the maps derived from cryoSPARC Ab-Initio
591 Reconstruction as the template. The selected suitable class containing 854,921 particles were
592 classified by several round of Heterogeneous Refinement. Finally, 3D reconstruction using
593 672,791 particles was performed by Non-uniform-refinement, and a 2.9 Å resolution map was
594 obtained according to the gold-standard Fourier shell correlation (FSC) = 0.143 criterion. For
595 further classification, 3D Variability and 3D Classification were conducted, obtaining the maps at
596 3.3 Å resolution which includes the map corresponding to the linker DNA region. Non-uniform-
597 refinement was performed using the particles selected by 3D Variability and 3D Classification
598 (82,876 and 94,542 particles, respectively) (88) and a 3.2 Å resolution map was obtained (fig.
599 S4).
600 The focused mask corresponding to linker DNA containing the hemimethylated CpG bound by
601 hCDCA7 was created for Local refinement. Local refinement improved the map at 4.83 Å
602 resolution (154,998 particles) (fig. S5).
603 The structure of nucleosome moiety was created using PDB ID: 3LZ0. Linker DNA was
604 generated using program Coot (91) and the structure of the nucleosome combined with linker
605 DNA was refined with program PHENIX (92). A structure model of human CDCA7264-371, was
606 generated from AlphFold2 (AF-Q9BWT1-F1). The model was manually fitted to the focused
607 map, taking into account the surface potential of the protein and characteristic C-terminal α-helix
608 of hCDCA7. Details of the data processing are shown in fig. S4, S5 and table S3. The protein
609 structures were visualized using Pymol (The PyMOL Molecular Graphics System, Version 2.2,
610 Schrödinger, LLC.) and UCSF ChimeraX (Version 1.5)
611
612 Prediction of the interactions between HELLS and CDCA7
613 We collected protein sequences of HELLS and CDCA7 from five species, including H. sapiens,
614 X. laevis, O. biroi, N. vectensis, and A. thaliana. We then ran AlphaFold2 (version 2.2.2) (93) to
615 predict the interactions between HELLS and CDCA7 in the five different species. For each
616 prediction, we selected the best model for further structural analysis. We implemented a cutoff
617 distance of 5 Å between non-hydrogen atoms to extract the interface residues between HELLS
618 and CDCA7. The same cutoff was also applied to compute the pDockQ (94) metric for each of
619 the five predictions. A pDockQ of greater than 0.23 indicates an acceptable predicted model,
620 while a pDockQ of greater than 0.5 indicates a confident predicted model (94). To evaluate the
621 convergence of the interface, we used MAFFT (95) to align the HELLS and CDCA7 protein
622 sequences, respectively. The sequence alignments were visualized using MVIEW (96). The
623 protein structures were visualized using Pymol (The PyMOL Molecular Graphics System,
624 Version 2.1, Schrödinger, LLC.)
625
626 Statistical Analysis
627 Cryo-EM data collection statistics are available in Table S3.
628
629 References
630
631 1. O. Deniz, J. M. Frost, M. R. Branco, Regulation of transposable elements by DNA
632 modifications. Nat Rev Genet 20, 417-431 (2019).
633 2. J. Casadesus, D. Low, Epigenetic gene regulation in the bacterial world. Microbiol Mol
634 Biol Rev 70, 830-856 (2006).
635 3. T. Dimitriu, M. D. Szczelkun, E. R. Westra, Evolutionary Ecology and Interplay of

636 Prokaryotic Innate and Adaptive Immune Systems. Current biology : CB 30, R1189-
637 R1202 (2020).
638 4. A. L. Mattei, N. Bailly, A. Meissner, DNA methylation: a historical perspective. Trends
639 Genet 38, 676-707 (2022).
640 5. E. A. Miska, A. C. Ferguson-Smith, Transgenerational inheritance: Models and
641 mechanisms of non-DNA sequence-based inheritance. Science 354, 59-63 (2016).
642 6. M. V. C. Greenberg, D. Bourc'his, The diverse roles of DNA methylation in mammalian
643 development and disease. Nat Rev Mol Cell Biol 20, 590-607 (2019).
644 7. A. Nishiyama, M. Nakanishi, Navigating the DNA methylation landscape of cancer.
645 Trends Genet 37, 1012-1027 (2021).
646 8. K. D. Robertson, DNA methylation and human disease. Nat Rev Genet 6, 597-610 (2005).
647 9. R. Lowe, C. Barton, C. A. Jenkins, C. Ernst, O. Forman, D. S. Fernandez-Twinn, C. Bock,
648 S. J. Rossiter, C. G. Faulkes, S. E. Ozanne, L. Walter, D. T. Odom, C. Mellersh, V. K.
649 Rakyan, Ageing-associated DNA methylation dynamics are a molecular readout of
650 lifespan variation among mammalian species. Genome Biol 19, 22 (2018).
651 10. M. Ehrlich, K. Jackson, C. Weemaes, Immunodeficiency, centromeric region instability,
652 facial anomalies syndrome (ICF). Orphanet J Rare Dis 1, 2 (2006).
653 11. M. Vukic, L. Daxinger, DNA methylation in disease: Immunodeficiency, Centromeric
654 instability, Facial anomalies syndrome. Essays Biochem 63, 773-783 (2019).
655 12. R. S. Hansen, C. Wijmenga, P. Luo, A. M. Stanek, T. K. Canfield, C. M. Weemaes, S. M.
656 Gartler, The DNMT3B DNA methyltransferase gene is mutated in the ICF
657 immunodeficiency syndrome. Proc Natl Acad Sci U S A 96, 14412-14417 (1999).
658 13. M. Okano, D. W. Bell, D. A. Haber, E. Li, DNA methyltransferases Dnmt3a and Dnmt3b
659 are essential for de novo methylation and mammalian development. Cell 99, 247-257
660 (1999).
661 14. J. C. de Greef, J. Wang, J. Balog, J. T. den Dunnen, R. R. Frants, K. R. Straasheijm, C.
662 Aytekin, M. van der Burg, L. Duprez, A. Ferster, A. R. Gennery, G. Gimelli, I. Reisli, C.
663 Schuetz, A. Schulz, D. Smeets, Y. Sznajer, C. Wijmenga, M. C. van Eggermond, M. M.
664 van Ostaijen-Ten Dam, A. C. Lankester, M. J. D. van Tol, P. J. van den Elsen, C. M.
665 Weemaes, S. M. van der Maarel, Mutations in ZBTB24 are associated with
666 immunodeficiency, centromeric instability, and facial anomalies syndrome type 2. Am J
667 Hum Genet 88, 796-804 (2011).
668 15. P. E. Thijssen, Y. Ito, G. Grillo, J. Wang, G. Velasco, H. Nitta, M. Unoki, M. Yoshihara,
669 M. Suyama, Y. Sun, R. J. Lemmers, J. C. de Greef, A. Gennery, P. Picco, B. Kloeckener-
670 Gruissem, T. Gungor, I. Reisli, C. Picard, K. Kebaili, B. Roquelaure, T. Iwai, I. Kondo, T.
671 Kubota, M. M. van Ostaijen-Ten Dam, M. J. van Tol, C. Weemaes, C. Francastel, S. M.
672 van der Maarel, H. Sasaki, Mutations in CDCA7 and HELLS cause immunodeficiency-
673 centromeric instability-facial anomalies syndrome. Nature communications 6, 7870
674 (2015).
675 16. M. Unoki, Chromatin remodeling in replication-uncoupled maintenance DNA methylation
676 and chromosome stability: Insights from ICF syndrome studies. Genes Cells 26, 349-359
677 (2021).
678 17. M. Unoki, G. Velasco, S. Kori, K. Arita, Y. Daigaku, W. K. A. Yeung, A. Fujimoto, H.
679 Ohashi, T. Kubota, K. Miyake, H. Sasaki, Novel compound heterozygous mutations in
680 UHRF1 are associated with atypical immunodeficiency, centromeric instability and facial
681 anomalies syndrome with distinctive genome-wide DNA hypomethylation. Hum Mol
682 Genet 32, 1439-1456 (2023).
683 18. D. S. Dunican, H. A. Cruickshanks, M. Suzuki, C. A. Semple, T. Davey, R. J. Arceci, J.

684 Greally, I. R. Adams, R. R. Meehan, Lsh regulates LTR retrotransposon repression
685 independently of Dnmt3b function. Genome Biol 14, R146 (2013).
686 19. D. S. Dunican, S. Pennings, R. R. Meehan, Lsh Is Essential for Maintaining Global DNA
687 Methylation Levels in Amphibia and Fish and Interacts Directly with Dnmt1. Biomed Res
688 Int 2015, 740637 (2015).
689 20. K. Myant, A. Termanis, A. Y. Sundaram, T. Boe, C. Li, C. Merusi, J. Burrage, J. I. de Las
690 Heras, I. Stancheva, LSH and G9a/GLP complex are required for developmentally
691 programmed DNA methylation. Genome Res 21, 83-94 (2011).
692 21. W. Yu, C. McIntosh, R. Lister, I. Zhu, Y. Han, J. Ren, D. Landsman, E. Lee, V. Briones,
693 M. Terashima, R. Leighty, J. R. Ecker, K. Muegge, Genome-wide DNA methylation
694 patterns in LSH mutant reveals de-repression of repeat elements and redundant epigenetic
695 silencing pathways. Genome Res 24, 1613-1623 (2014).
696 22. A. Vongs, T. Kakutani, R. A. Martienssen, E. J. Richards, Arabidopsis thaliana DNA
697 methylation mutants. Science 260, 1926-1928 (1993).
698 23. A. Miura, S. Yonebayashi, K. Watanabe, T. Toyama, H. Shimada, T. Kakutani,
699 Mobilization of transposons by a mutation abolishing full DNA methylation in
700 Arabidopsis. Nature 411, 212-214 (2001).
701 24. K. Dennis, T. Fan, T. Geiman, Q. Yan, K. Muegge, Lsh, a member of the SNF2 family, is
702 required for genome-wide methylation. Genes Dev 15, 2940-2944 (2001).
703 25. M. Han, J. Li, Y. Cao, Y. Huang, W. Li, H. Zhu, Q. Zhao, J. J. Han, Q. Wu, J. Li, J. Feng,
704 J. Wong, A role for LSH in facilitating DNA methylation by DNMT1 through enhancing
705 UHRF1 chromatin association. Nucleic Acids Res 48, 12116-12134 (2020).
706 26. D. B. Lyons, D. Zilberman, DDM1 and Lsh remodelers allow methylation of DNA
707 wrapped in nucleosomes. Elife 6, (2017).
708 27. C. Jenness, S. Giunta, M. M. Muller, H. Kimura, T. W. Muir, H. Funabiki, HELLS and
709 CDCA7 comprise a bipartite nucleosome remodeling complex defective in ICF syndrome.
710 Proc Natl Acad Sci U S A 115, E876-E885 (2018).
711 28. H. Funabiki, I. E. Wassing, Q. Jia, J. D. Luo, T. Carroll, Coevolution of the CDCA7-
712 HELLS ICF-related nucleosome remodeling complex and DNA methyltransferases. Elife
713 12, (2023).
714 29. F. Lyko, The DNA methyltransferase family: a versatile toolkit for epigenetic regulation.
715 Nat Rev Genet 19, 81-92 (2018).
716 30. K. Arita, M. Ariyoshi, H. Tochio, Y. Nakamura, M. Shirakawa, Recognition of hemi-
717 methylated DNA by the SRA protein UHRF1 by a base-flipping mechanism. Nature 455,
718 818-821 (2008).
719 31. G. V. Avvakumov, J. R. Walker, S. Xue, Y. Li, S. Duan, C. Bronner, C. H. Arrowsmith,
720 S. Dhe-Paganon, Structural basis for recognition of hemi-methylated DNA by the SRA
721 domain of human UHRF1. Nature 455, 822-825 (2008).
722 32. H. Hashimoto, J. R. Horton, X. Zhang, M. Bostick, S. E. Jacobsen, X. Cheng, The SRA
723 domain of UHRF1 flips 5-methylcytosine out of the DNA helix. Nature 455, 826-829
724 (2008).
725 33. M. Bostick, J. K. Kim, P. O. Esteve, A. Clark, S. Pradhan, S. E. Jacobsen, UHRF1 plays a
726 role in maintaining DNA methylation in mammalian cells. Science 317, 1760-1764
727 (2007).
728 34. J. Sharif, M. Muto, S. Takebayashi, I. Suetake, A. Iwamatsu, T. A. Endo, J. Shinga, Y.
729 Mizutani-Koseki, T. Toyoda, K. Okamura, S. Tajima, K. Mitsuya, M. Okano, H. Koseki,
730 The SRA protein Np95 mediates epigenetic inheritance by recruiting Dnmt1 to methylated
731 DNA. Nature 450, 908-912 (2007).
732 35. A. Nishiyama, L. Yamaguchi, J. Sharif, Y. Johmura, T. Kawamura, K. Nakanishi, S.

733 Shimamura, K. Arita, T. Kodama, F. Ishikawa, H. Koseki, M. Nakanishi, Uhrf1-
734 dependent H3K23 ubiquitylation couples maintenance DNA methylation and replication.
735 Nature 502, 249-253 (2013).
736 36. M. Mancini, E. Magnani, F. Macchi, I. M. Bonapace, The multi-functionality of UHRF1:
737 epigenome maintenance and preservation of genome integrity. Nucleic Acids Res 49,
738 6053-6068 (2021).
739 37. A. Nishiyama, C. B. Mulholland, S. Bultmann, S. Kori, A. Endo, Y. Saeki, W. Qin, C.
740 Trummer, Y. Chiba, H. Yokoyama, S. Kumamoto, T. Kawakami, H. Hojo, G. Nagae, H.
741 Aburatani, K. Tanaka, K. Arita, H. Leonhardt, M. Nakanishi, Two distinct modes of
742 DNMT1 recruitment ensure stable maintenance DNA methylation. Nature
743 communications 11, 1222 (2020).
744 38. S. Ishiyama, A. Nishiyama, Y. Saeki, K. Moritsugu, D. Morimoto, L. Yamaguchi, N. Arai,
745 R. Matsumura, T. Kawakami, Y. Mishima, H. Hojo, S. Shimamura, F. Ishikawa, S.
746 Tajima, K. Tanaka, M. Ariyoshi, M. Shirakawa, M. Ikeguchi, A. Kidera, I. Suetake, K.
747 Arita, M. Nakanishi, Structure of the Dnmt1 Reader Module Complexed with a Unique
748 Two-Mono-Ubiquitin Mark on Histone H3 Reveals the Basis for DNA Methylation
749 Maintenance. Mol Cell 68, 350-360 e357 (2017).
750 39. X. Ming, Z. Zhang, Z. Zou, C. Lv, Q. Dong, Q. He, Y. Yi, Y. Li, H. Wang, B. Zhu,
751 Kinetics and mechanisms of mitotic inheritance of DNA methylation and their roles in
752 aging-associated methylome deterioration. Cell Res 30, 980-996 (2020).
753 40. C. Zierhut, C. Jenness, H. Kimura, H. Funabiki, Nucleosomal regulation of chromatin
754 composition and nuclear assembly revealed by histone depletion. Nat Struct Mol Biol 21,
755 617-625 (2014).
756 41. M. Felle, H. Hoffmeister, J. Rothammer, A. Fuchs, J. H. Exler, G. Langst, Nucleosomes
757 protect DNA from DNA methylation in vivo and in vitro. Nucleic Acids Res 39, 6956-
758 6969 (2011).
759 42. M. Okuwaki, A. Verreault, Maintenance DNA methylation of nucleosome core particles.
760 The Journal of biological chemistry 279, 2904-2912 (2004).
761 43. A. K. Robertson, T. M. Geiman, U. T. Sankpal, G. L. Hager, K. D. Robertson, Effects of
762 chromatin structure on the enzymatic and DNA binding functions of DNA
763 methyltransferases DNMT1 and Dnmt3a in vitro. Biochem Biophys Res Commun 322,
764 110-118 (2004).
765 44. H. Takeshima, I. Suetake, H. Shimahara, K. Ura, S. Tate, S. Tajima, Distinct DNA
766 methylation activity of Dnmt3a and Dnmt3b towards naked and nucleosomal DNA. J
767 Biochem 139, 503-515 (2006).
768 45. A. Schrader, T. Gross, V. Thalhammer, G. Langst, Characterization of Dnmt1 Binding
769 and DNA Methylation on Nucleosomes and Nucleosomal Arrays. PloS one 10, e0140076
770 (2015).
771 46. Q. Zhao, J. Zhang, R. Chen, L. Wang, B. Li, H. Cheng, X. Duan, H. Zhu, W. Wei, J. Li,
772 Q. Wu, J. D. Han, W. Yu, S. Gao, G. Li, J. Wong, Dissecting the precise role of H3K9
773 methylation in crosstalk with DNA maintenance methylation in mammals. Nature
775 47. J. Brzeski, A. Jerzmanowski, Deficient in DNA methylation 1 (DDM1) defines a novel
776 family of chromatin-remodeling factors. The Journal of biological chemistry 278, 823-828
777 (2003).
778 48. S. C. Lee, D. W. Adams, J. J. Ipsaro, J. Cahn, J. Lynn, H. S. Kim, B. Berube, V. Major, J.
779 P. Calarco, C. LeBlanc, S. Bhattacharjee, U. Ramu, D. Grimanelli, Y. Jacob, P. Voigt, L.
780 Joshua-Tor, R. A. Martienssen, Chromatin remodeling of histone H3 variants by DDM1
781 underlies epigenetic inheritance of DNA methylation. Cell 186, 4100-4116 e4115 (2023).
782 49. M. Unoki, H. Funabiki, G. Velasco, C. Francastel, H. Sasaki, CDCA7 and HELLS
783 mutations undermine nonhomologous end joining in centromeric instability syndrome. J
784 Clin Invest 129, 78-92 (2019).
785 50. C. E. Shamu, A. W. Murray, Sister chromatid separation in frog egg extracts requires
786 DNA topoisomerase II activity during anaphase. The Journal of cell biology 117, 921-934
787 (1992).
788 51. C. B. Mulholland, A. Nishiyama, J. Ryan, R. Nakamura, M. Yigit, I. M. Gluck, C.
789 Trummer, W. Qin, M. D. Bartoschek, F. R. Traube, E. Parsa, E. Ugur, M. Modic, A.
790 Acharya, P. Stolz, C. Ziegenhain, M. Wierer, W. Enard, T. Carell, D. C. Lamb, H. Takeda,
791 M. Nakanishi, S. Bultmann, H. Leonhardt, Recent evolution of a TET-controlled and
792 DPPA3/STELLA-driven pathway of passive DNA demethylation in mammals. Nature
794 52. K. Hata, N. Kobayashi, K. Sugimura, W. Qin, D. Haxholli, Y. Chiba, S. Yoshimi, G.
795 Hayashi, H. Onoda, T. Ikegami, C. B. Mulholland, A. Nishiyama, M. Nakanishi, H.
796 Leonhardt, T. Konuma, K. Arita, Structural basis for the unique multifaceted interaction of
797 DPPA3 with the UHRF1 PHD finger. Nucleic Acids Res 50, 12527-12542 (2022).
798 53. Y. Li, Z. Zhang, J. Chen, W. Liu, W. Lai, B. Liu, X. Li, L. Liu, S. Xu, Q. Dong, M. Wang,
799 X. Duan, J. Tan, Y. Zheng, P. Zhang, G. Fan, J. Wong, G. L. Xu, Z. Wang, H. Wang, S.
800 Gao, B. Zhu, Stella safeguards the oocyte methylome by preventing de novo methylation
801 mediated by DNMT1. Nature 564, 136-140 (2018).
802 54. J. A. Wohlschlegel, B. T. Dwyer, S. K. Dhar, C. Cvetic, J. C. Walter, A. Dutta, Inhibition
803 of eukaryotic DNA replication by geminin binding to Cdt1. Science 290, 2309-2312
804 (2000).
805 55. J. Jumper, R. Evans, A. Pritzel, T. Green, M. Figurnov, O. Ronneberger, K.
806 Tunyasuvunakool, R. Bates, A. Zidek, A. Potapenko, A. Bridgland, C. Meyer, S. A. A.
807 Kohl, A. J. Ballard, A. Cowie, B. Romera-Paredes, S. Nikolov, R. Jain, J. Adler, T. Back,
808 S. Petersen, D. Reiman, E. Clancy, M. Zielinski, M. Steinegger, M. Pacholska, T.
809 Berghammer, S. Bodenstein, D. Silver, O. Vinyals, A. W. Senior, K. Kavukcuoglu, P.
810 Kohli, D. Hassabis, Highly accurate protein structure prediction with AlphaFold. Nature
811 596, 583-589 (2021).
812 56. M. Mirdita, K. Schutze, Y. Moriwaki, L. Heo, S. Ovchinnikov, M. Steinegger, ColabFold:
813 making protein folding accessible to all. Nat Methods 19, 679-682 (2022).
814 57. W. Nartey, A. A. Goodarzi, G. J. Williams, Cryo-EM structure of DDM1-HELLS chimera
815 bound to nucleosome reveals a mechanism of chromatin remodeling and disease
816 regulation. bioRxiv, 2023.2008.2009.551721 (2023).
817 58. G. Velasco, G. Grillo, N. Touleimat, L. Ferry, I. Ivkovic, F. Ribierre, J. F. Deleuze, S.
818 Chantalat, C. Picard, C. Francastel, Comparative methylome analysis of ICF patients
819 identifies heterochromatin loci that require ZBTB24, CDCA7 and HELLS for their
820 methylated state. Hum Mol Genet, (2018).
821 59. A. Zemach, M. Y. Kim, P. H. Hsieh, D. Coleman-Derr, L. Eshed-Williams, K. Thao, S. L.
822 Harmer, D. Zilberman, The Arabidopsis nucleosome remodeler DDM1 allows DNA
823 methyltransferases to access H1-containing heterochromatin. Cell 153, 193-205 (2013).
824 60. H. Tagami, D. Ray-Gallet, G. Almouzni, Y. Nakatani, Histone H3.1 and H3.3 complexes
825 mediate nucleosome assembly pathways dependent or independent of DNA synthesis. Cell
826 116, 51-61 (2004).
827 61. G. Almouzni, M. Mechali, Assembly of spaced chromatin promoted by DNA synthesis in
828 extracts from Xenopus eggs. EMBO J 7, 665-672 (1988).
829 62. J. Burrage, A. Termanis, A. Geissner, K. Myant, K. Gordon, I. Stancheva, The SNF2
830 family ATPase LSH promotes phosphorylation of H2AX and efficient repair of DNA
831 double-strand breaks in mammalian cells. J Cell Sci 125, 5524-5534 (2012).
832 63. K. Luger, A. W. Mader, R. K. Richmond, D. F. Sargent, T. J. Richmond, Crystal structure

833 of the nucleosome core particle at 2.8 A resolution. Nature 389, 251-260 (1997).
834 64. J. Song, M. Teplova, S. Ishibe-Murakami, D. J. Patel, Structure-based mechanistic
835 insights into DNMT1-mediated maintenance DNA methylation. Science 335, 709-712
836 (2012).
837 65. H. S. Rhee, A. R. Bataille, L. Zhang, B. F. Pugh, Subnucleosomal structures and
838 nucleosome asymmetry across a genome. Cell 159, 1377-1388 (2014).
839 66. A. Stutzer, S. Liokatis, A. Kiesel, D. Schwarzer, R. Sprangers, J. Soding, P. Selenko, W.
840 Fischle, Modulations of DNA Contacts by Linker Histones and Post-translational
841 Modifications Determine the Mobility and Modifiability of Nucleosomal H3 Tails. Mol
842 Cell 61, 247-259 (2016).
843 67. D. Angelov, J. M. Vitolo, V. Mutskov, S. Dimitrov, J. J. Hayes, Preferential interaction of
844 the core histone tail domains with linker DNA. Proc Natl Acad Sci U S A 98, 6599-6604
845 (2001).
846 68. Y. Peng, S. Li, A. Onufriev, D. Landsman, A. R. Panchenko, Binding of regulatory
847 proteins to nucleosomes is modulated by dynamic histone tails. Nature communications
848 12, 5280 (2021).
849 69. B. M. Foster, P. Stolz, C. B. Mulholland, A. Montoya, H. Kramer, S. Bultmann, T. Bartke,
850 Critical Role of the UBL Domain in Stimulating the E3 Ubiquitin Ligase Activity of
851 UHRF1 toward Chromatin. Mol Cell 72, 739-752 e739 (2018).
852 70. R. M. Vaughan, B. M. Dickson, M. F. Whelihan, A. L. Johnstone, E. M. Cornett, M. A.
853 Cheek, C. A. Ausherman, M. W. Cowles, Z. W. Sun, S. B. Rothbart, Chromatin structure
854 and its chemical modifications regulate the ubiquitin ligase substrate selectivity of
855 UHRF1. Proc Natl Acad Sci U S A 115, 8775-8780 (2018).
856 71. X. Liu, Q. Gao, P. Li, Q. Zhao, J. Zhang, J. Li, H. Koseki, J. Wong, UHRF1 targets
857 DNMT1 for DNA methylation through cooperative binding of hemi-methylated DNA and
858 methylated H3K9. Nature communications 4, 1563 (2013).
859 72. A. Zemach, I. E. McDaniel, P. Silva, D. Zilberman, Genome-wide evolutionary analysis
860 of eukaryotic DNA methylation. Science 328, 916-919 (2010).
861 73. S. Feng, S. J. Cokus, X. Zhang, P. Y. Chen, M. Bostick, M. G. Goll, J. Hetzel, J. Jain, S.
862 H. Strauss, M. E. Halpern, C. Ukomadu, K. C. Sadler, S. Pradhan, M. Pellegrini, S. E.
863 Jacobsen, Conservation and divergence of methylation patterning in plants and animals.
864 Proc Natl Acad Sci U S A 107, 8689-8694 (2010).
865 74. R. Libbrecht, P. R. Oxley, L. Keller, D. J. Kronauer, Robust DNA Methylation in the
866 Clonal Raider Ant Brain. Current biology : CB 26, 391-395 (2016).
867 75. I. Ivasyk, L. Olivos-Cisneros, S. Valdes-Rodriguez, M. Droual, H. Jang, R. J. Schmitz, D.
868 J. C. Kronauer, DNMT1 mutant ants develop normally but have disrupted oogenesis.
869 Nature communications 14, 2201 (2023).
870 76. Y. He, J. Ren, X. Xu, K. Ni, A. Schwader, R. Finney, C. Wang, L. Sun, K. Klarmann, J.
871 Keller, A. Tubbs, A. Nussenzweig, K. Muegge, Lsh/HELLS is required for B lymphocyte
872 development and immunoglobulin class switch recombination. Proc Natl Acad Sci U S A
873 117, 20100-20108 (2020).
874 77. C. Spruce, S. Dlamini, G. Ananda, N. Bronkema, H. Tian, K. Paigen, G. W. Carter, C. L.
875 Baker, HELLS and PRDM9 form a pioneer complex to open chromatin at meiotic
876 recombination hot spots. Genes Dev 34, 398-412 (2020).
877 78. G. Kollarovic, C. E. Topping, E. P. Shaw, A. L. Chambers, The human HELLS chromatin
878 remodelling protein promotes end resection to facilitate homologous recombination and
879 contributes to DSB repair within heterochromatin. Nucleic Acids Res 48, 1872-1885
880 (2020).
881 79. M. Unoki, J. Sharif, Y. Saito, G. Velasco, C. Francastel, H. Koseki, H. Sasaki, CDCA7
882 and HELLS suppress DNA:RNA hybrid-associated DNA damage at pericentromeric
883 repeats. Sci Rep 10, 17865 (2020).
884 80. X. Xu, K. Ni, Y. He, J. Ren, C. Sun, Y. Liu, M. I. Aladjem, S. Burkett, R. Finney, X.
885 Ding, S. K. Sharan, K. Muegge, The epigenetic regulator LSH maintains fork protection
886 and genomic stability via MacroH2A deposition and RAD51 filament formation. Nature
888 81. J. Zhou, X. Lei, S. Shafiq, W. Zhang, Q. Li, K. Li, J. Zhu, Z. Dong, X. J. He, Q. Sun,
889 DDM1-mediated R-loop resolution and H2A.Z exclusion facilitates heterochromatin
890 formation in Arabidopsis. Sci Adv 9, eadg2699 (2023).
891 82. A. Osakabe, B. Jamge, E. Axelsson, S. A. Montgomery, S. Akimcheva, A. L. Kuehn, R.
892 Pisupati, Z. J. Lorkovic, R. Yelagandula, T. Kakutani, F. Berger, The chromatin remodeler
893 DDM1 prevents transposon mobility through deposition of histone variant H2A.W. Nat
894 Cell Biol 23, 391-400 (2021).
895 83. S. Kumamoto, A. Nishiyama, Y. Chiba, R. Miyashita, C. Konishi, Y. Azuma, M.
896 Nakanishi, HPF1-dependent PARP activation promotes LIG3-XRCC1-mediated backup
897 pathway of Okazaki fragment ligation. Nucleic Acids Res 49, 5003-5016 (2021).
898 84. P. T. Lowary, J. Widom, New DNA sequence rules for high affinity binding to histone
899 octamer and sequence-directed nucleosome positioning. J Mol Biol 276, 19-42 (1998).
900 85. H. Funabiki, A. W. Murray, The Xenopus chromokinesin Xkid is essential for metaphase
901 chromosome alignment and must be degraded to allow anaphase chromosome movement.
902 Cell 102, 411-424 (2000).
903 86. R. Lebofsky, T. Takahashi, J. C. Walter, DNA replication in nucleus-free Xenopus egg
904 extracts. Methods Mol Biol 521, 229-252 (2009).
905 87. S. E. Humphries, D. Young, D. Carroll, Chromatin structure of the 5S ribonucleic acid
906 genes of Xenopus laevis. Biochemistry 18, 3223-3231 (1979).
907 88. K. Arita, S. Isogai, T. Oda, M. Unoki, K. Sugita, N. Sekiyama, K. Kuwata, R. Hamamoto,
908 H. Tochio, M. Sato, M. Ariyoshi, M. Shirakawa, Recognition of modification status on a
909 histone H3 tail by linked histone reader modules of the epigenetic regulator UHRF1. Proc
910 Natl Acad Sci U S A 109, 12950-12955 (2012).
911 89. K. Mayanagi, K. Saikusa, N. Miyazaki, S. Akashi, K. Iwasaki, Y. Nishimura, K.
912 Morikawa, Y. Tsunaka, Structural visualization of key steps in nucleosome reorganization
913 by human FACT. Sci Rep 9, 10183 (2019).
914 90. A. Punjani, J. L. Rubinstein, D. J. Fleet, M. A. Brubaker, cryoSPARC: algorithms for
915 rapid unsupervised cryo-EM structure determination. Nat Methods 14, 290-296 (2017).
916 91. P. Emsley, B. Lohkamp, W. G. Scott, K. Cowtan, Features and development of Coot. Acta
917 Crystallogr D Biol Crystallogr 66, 486-501 (2010).
918 92. P. V. Afonine, R. W. Grosse-Kunstleve, N. Echols, J. J. Headd, N. W. Moriarty, M.
919 Mustyakimov, T. C. Terwilliger, A. Urzhumtsev, P. H. Zwart, P. D. Adams, Towards
920 automated crystallographic structure refinement with phenix.refine. Acta Crystallogr D
921 Biol Crystallogr 68, 352-367 (2012).
922 93. R. Evans, M. O’Neill, A. Pritzel, N. Antropova, A. Senior, T. Green, A. Žídek, R. Bates,
923 S. Blackwell, J. Yim, O. Ronneberger, S. Bodenstein, M. Zielinski, A. Bridgland, A.
924 Potapenko, A. Cowie, K. Tunyasuvunakool, R. Jain, E. Clancy, P. Kohli, J. Jumper, D.
925 Hassabis, Protein complex prediction with AlphaFold-Multimer. bioRxiv,
926 2021.2010.2004.463034 (2022).
927 94. P. Bryant, G. Pozzati, A. Elofsson, Improved prediction of protein-protein interactions
928 using AlphaFold2. Nature communications 13, 1265 (2022).
929 95. K. Katoh, K. Misawa, K. Kuma, T. Miyata, MAFFT: a novel method for rapid multiple
930 sequence alignment based on fast Fourier transform. Nucleic Acids Res 30, 3059-3066
931 (2002).
932 96. N. P. Brown, C. Leroy, C. Sander, MView: a web-compatible database search or multiple
933 alignment viewer. Bioinformatics 14, 380-381 (1998).
934
935 Acknowledgments
936 We thank Hideaki Konishi for construction of the plasmid expressing Xkid-DBD, W. Matthew
937 Michael and Tatsuro Takahashi for geminin, Tomohiro Nishizawa and Yongchan Lee for
938 supporting cryo-EM analysis, Jason Banfelder, Bala Jayaraman, and The Rockefeller University
939 High Performance Computing (HPC) Center for their support in computation, members of the
940 Funabiki lab for discussion, Yasuhiro Arimura for comments on the manuscript, and The
941 Rockefeller University Comparative Bioscience Centre for animal husbandry. The cryo-EM
942 experiments were performed at the cryo-EM facility of the RIKEN Center for Biosystems
943 Dynamics Research Yokohama.
944
945 Funding:
946 National Institutes of Health grant R35GM132111 (HF)
947 National Institutes of Health grant R35GM133780 (LZ)
948 The Robertson Foundation (LZ)
949 MEXT/JSPS KAKENHI grant JP19H05740 (MN)
950 MEXT/JSPS KAKENHI grant JP19H03143 (AN)
951 MEXT/JSPS KAKENHI grant JP19H05285 (AN)
952 MEXT/JSPS KAKENHI JP19H05741 (KA)
953 The Rockefeller University Women & Science Postdoctoral Fellowship (IEW)
954
955 Author contributions:
956
957 Conceptualization: IW, AN, HF
958 Methodology: IW, AN, KA, JP, HF
959 Investigation: IW, AN, MH, QJ, RS, AK, KS, XH, YC, CJ, KA, HF
960 Visualization: AK, JP, HF
961 Supervision: AN, MN, LZ, KA, HF
962 Writing—original draft: HF, IW, AN, KA, JP
963 Writing—review & editing: HF, IW, AN, KA, QJ
964
965 Competing interests:
966 H.F. is affiliated with Graduate School of Medical Sciences, Weill Cornell Medicine, and the Cell
967 Biology Program at the Sloan Kettering Institute. The authors declare no competing interests.
968
969 Data and materials availability:
970 Cryo-EM maps (EMD-38198 and EMD-38199) were deposited to EMDB and will be released
971 upon publication. All data and materials used in the analyses will be available to any researcher
972 for the purposes of reproducing or extending the analyses. All data are available in the main text
973 or the supplementary materials.
974
975
A Extract Chromatin B
Chromatin
Undepleted
mDPPA3
∆CDCA7e
∆CDCA7e
buffer
∆DNMT1
∆DNMT1
∆HELLS
∆HELLS
∆MOCK
∆MOCK
20 40 60 80 20 40 60 80 Time (min)
180- DNMT1
200
DNMT1 100-
116 HELLS
75-
116
97 HELLS 45- CDCA7
45 100-
H3-Ub3 UHRF1
H3-Ub2 75-
31
H3-Ub
15- H3
21
H3
976
977 Fig. 1 CDCA7 and HELLS accumulate on chromatin upon inhibition of maintenance DNA
978 methylation
979 (A) X. laevis sperm nuclei were incubated with interphase egg extracts depleted with mock IgG
980 (∆MOCK), anti-DNMT1 (∆DNMT1), anti-HELLS (∆HELLS), or anti-CDCA7e (∆CDCA7e)
981 antibodies for 3 h in the presence of cycloheximide. Chromatin was isolated and analyzed by
982 western blotting. (B) X. laevis sperm nuclei were isolated at indicated time points after incubation
983 with interphase Xenopus egg extracts in the presence or absence of 0.5 µM mouse DPPA3
984 (mDPPA3), a protein that inhibits binding of UHRF1 and DNMT1 to chromatin. Chromatin-
985 associated proteins were analyzed by western blotting.
986
987
A Beads pull-down B Beads pull-down

A e Input no DNA un-Me hemi-Me
ct N e i-M e
tra D -M em ll-
M
R232H
G252V
R262H
R232H
G252V
R262H
R232H
G252V
R262H
R232H
G252V
R262H
Ex n o u n h fu
WT
WT
WT
WT
(kD)
xCDCA7e
100 UHRF1
250
55
CDCA7e 150
100
35 H3-Ub2 75
H3-Ub1 xKID
15
H3 50
xCDCA7e
37
25
20
C D
hemimethylated DNA
DNA hemi-Me full-Me un-Me
xCDCA7e WT R232H
xCDCA7e
CDCA7-DNA
complex CDCA7:DNA
complex
Free DNA
Free DNA
E DNA hemi-Me full-Me un-Me

R274C/H
G294V
R304H
H. sapiens CDCA7 NP_665809

hCDCA7 264-371
371
142
260
360
111
CDCA7-DNA
Leucine zipper complex
zf-4CXXC_R1
hCDCA7 264-371 free DNA
988
989 Fig. 2 CDCA7 selectively binds hemimethylated DNA
990 (A) Magnetic beads coupled with pBluescript DNA with unmethylated CpGs (un-Me),
991 hemimethylated CpGs (hemi-Me), or fully methylated CpGs (full-Me), were incubated with
992 interphase Xenopus egg extracts. Beads were collected after 60 min and analyzed by western
993 blotting. (B) 35S-labeled X. laevis CDCA7e proteins (wildtype or with the indicated ICF3-patient
994 associated mutation) were incubated with control beads, or beads conjugated 200 bp
995 unmethylated or hemimethylated DNA (Table S1). 35S-labeled Xkid (85), a nonspecific DNA-
996 binding protein, was used as a loading control. Autoradiography of 35S-labeled proteins in input
997 and beads fraction is shown. (C) and (D) Native gel electrophoresis mobility shift assay (EMSA)
998 using recombinant X. laevis CDCA7eWT and CDCA7eR232H. (E) Left: schematic of H. sapiens
999 CDCA7 (isoform 2 NP_665809). Positions of the zf-4CXXC_R1 domain (purple), three ICF3-
1000 patient mutations (cyan), and conserved cysteine residues (yellow) are shown. Right: EMSA
1001 assay using the purified zf-4CXXC_R1 domain (aa 264-371) of H. sapiens CDCA7. For C-E,
1002 double-stranded DNA oligonucleotides with an unmethylated, hemimethylated or fully-
1003 methylated CpG used for protein binding were visualized.
1004
5’
A 3’ 3’ C
hCDCA7 zf-4CXXC_R1
hCDCA7
Linker DNA
1200
1100
Nucleosome + CDCA7
700 Nucleosome
600
500
400
300
200
C-terminal helix of hCDCA7
B
hCDCA7 hCDCA7
D E
hCDCA7
R274
5mC R304
5mC
1005
1006 Fig. 3: Cryo-EM structure of hCDCA7:nucleosome complex
1007 (A) Native gel electrophoresis mobility shift assay analyzing the interaction of hCDCA7264-371
1008 C339S with nucleosomes. (B) A composite cryo-EM map (left) and the model structure of
1009 hCDCA7264-371 C339S (generated from AF2) bound to nucleosome harboring a hemimethylated
1010 CpG at the 3’-linker DNA (right). The map corresponding to CDCA7 is colored purple. (C)
1011 Overlay of AF2 model of hCDCA7264-371 C339S on the cryo-EM map. (D) Electrostatic surface
1012 potential of hCDCA7264-371, where red and blue indicate negative and positive charges,
1013 respectively. Linker DNA is depicted in gray, orange indicates the location of 5-methylcytosine
1014 (5mC). (E) A model structure of hCDCA7264-371 C339S bound to 3’-linker DNA. ICF mutation
1015 residues, R274 and R304, are shown as cyan stick model superimposed on a transparent sphere
1016 model.
1017
A CDCA7-Binding CDCA7-Binding B
Helix (C7BH) Interface 2 X. laevis HELLS AAH97562
163
172
239
579
603
759
838
24
55
63
96 Xl_CDCA7e
SNF2_N Helicase_C zf-4CXXC_R1 HELLS-Binding Helix
CC1 CC2 (HLBH) of CDCA7e
R232C/H
CDCA7-Binding
CC1
G252V
R262H
Autoinhibition Interface 2 of HELLS
105
218
318
332
74
X. laevis CDCA7e OCT95900
HELLS-Binding zf-4CXXC_R1 CDCA7-Binding Helix

Xl_HELLS
Helix (HLBH) of HELLS (C7BH)
HELLS-Binding Helix (HLBH)

C
X. laevis CDCA7e OCT95900 74 105
H. sapiens CDCA7 NP_114148 190 221
H. sapiens CDCA7L NP_061189 210 241
O. biroi CDCA7 XP_011343355 3 34
N. vectensis CDCA7 XP_001626018 57 89
A. thaliana CDCA7 NP_195428 28 61
1500 1000 500 0 MYA

Autoinhibitory CC1 CDCA7-Binding Helix (C7BH)
D
Xl HELLS 24 96
Hs HELLS 24 96
Ob HELLS 39 109
Nv HELLS 72 144
At DDM1 61 131
E Basic patch CDCA7-Binding Interface 2
X. laevis HELLS AAH97562 126 172

H.sapiens HELLS NP_060533 126 174
O. biroi HELLS XP_019888514 129 169
N. vectensis HELLS XP_001638732 196 246
A. thaliana DDM1 NP_201476 142 186
Input IP:IgG IP:α-xCDCA7e Input IP:IgG IP:α-xHELLS

F G
xCDCA7e ∆74-105
xCDCA7e ∆74-105
xCDCA7e ∆74-105
xHELLS ∆163-172
xHELLS ∆163-172
xHELLS ∆163-172
xHELLS ∆63-172
xHELLS ∆63-172
xHELLS ∆63-172
xHELLS ∆63-96
xHELLS ∆63-96
xHELLS ∆63-96
xCDCA7e FL
xCDCA7e FL
xCDCA7e FL
xHELLS FL
xHELLS FL
xHELLS FL
xCDCA7e + xHELLS +
100 100 HELLS

HELLS
70
70
55 CDCA7e
CDCA7e
1018
1019 Fig. 4 Identification of HELLS-CDCA7 interaction interface
1020 (A) Schematics of X. laevis HELLS and CDCA7e. Positions of the signature 11 conserved
1021 cysteine residues and 3 ICF disease-associated mutations in CDCA7e are marked in yellow and
1022 cyan, respectively. CC1 is a coiled-coil domain important for autoinhibition. (B) The best
1023 predicted structure model of X. laevis HELLS-CDCA7e complex by AF2. (C) Sequence
1024 alignment of the putative HELLS/DDM1-binding interface of CDCA7. (D) Sequence alignment
1025 of the putative CDCA7-binding interface 1 in HELLS/DDM1. (E) Sequence alignment of the
1026 putative CDCA7-binding interface 2 in HELLS. (F) Immunoprecipitation by control IgG or anti-
1027 CDCA7e antibodies from Xenopus egg extracts containing 35S-labeled wild-type or deletion
1028 mutant of X. laevis HELLS and CDCA7e. (G) Immunoprecipitation by control IgG or anti-
1029 HELLS antibody from Xenopus egg extracts containing 35S-labeled HELLS and wild-type or
1030 ∆74-105 deletion mutant of CDCA7e. Autoradiography is shown in F and G.
1031
A Beads pull-down
extract no DNA un-Me hemi-Me
∆CDCA7e
∆CDCA7e
∆CDCA7e
∆CDCA7e
∆IMOCK
∆MOCK
∆MOCK
∆MOCK
100 UHRF1
100 HELLS
55
CDCA7e
15 H3
B Beads pull-down
extract no DNA un-Me hemi-Me

∆CDCA7e
∆CDCA7e
∆CDCA7e
∆CDCA7e
∆CDCA7e
∆CDCA7e
∆CDCA7e
∆CDCA7e
∆MOCK
∆MOCK
∆MOCK
∆MOCK
∆MOCK
∆MOCK
∆MOCK
∆MOCK
35
S-HELLS wt ∆63-96 wt ∆63-96 wt ∆63-96 wt ∆63-96
100 35S-HELLS
35 35S-XKID-DBD
1032
1033 Fig. 5 CDCA7 recruits HELLS to hemimethylated DNA
1034 (A) Beads coated with unmethylated or hemimethylated DNA (pBluescript) were incubated with
1035 interphase Xenopus egg control mock IgG-depleted extracts (∆MOCK) or CDCA7e-depleted
1036 extracts (∆CDCA7e) for 30 min. Beads were isolated and analyzed by western blotting. (B) 35S-
1037 labeled HELLS or HELLS ∆63-96 was incubated with beads coated with 200 bp unmethylated
1038 or hemimethylated DNA. Beads were isolated and associated 35S-labeled proteins were
1039 visualized by autoradiography. Nonspecific DNA-binding protein Xkid DNA-binding domain
1040 (Xkid-DBD) was used as a loading control.
1041
A B C
mDPPA3
Sperm ΔMOCK ΔMOCK ΔMOCK ΔMOCK

nuclei
ΔCDCA7e ΔCDCA7e ΔHELLS ΔHELLS
+mDPPA3 ±APH
Methylation OFF ON Chromatin Chromatin

Replication ON ΔMOCK ΔCDCA7e ΔMOCK ΔHELLS
OFF
20 40 60 20 40 60 min 20 40 60 20 40 60 min
Chromatin 180 DNMT1 180 DNMT1

DMSO APH
20 40 60 20 40 60 min 100 100
UHRF1 UHRF1
180 DNMT1
75 75
100 100 100
UHRF1 HELLS HELLS
75 75
75
35 PAF15-Ub2
45 CDCA7e CDCA7e
45
35 H3-Ub2 35 H3-Ub2 35 H3-Ub2

25 H3-Ub 25 H3-Ub 25 H3-Ub
H3 15 H3 15 H3
15
1042
1043 Fig. 6 CDCA7e and HELLS regulate replication-uncoupled maintenance DNA methylation
1044 (A) Xenopus sperm nuclei were incubated for 120 min in interphase Xenopus egg extract in the
1045 presence of 0.5 µM recombinant mDPPA3. Chromatin was isolated and reincubated in interphase
1046 egg extract in the presence or absence of 150 µM aphidicolin (APH). (B, C). Sperm nuclei were
1047 incubated for 120 min in Mock-depleted extracts or either CDCA7e-depleted (B) or HELLS-
1048 depleted (C) extracts supplemented with mDPPA3. Chromatin was isolated and reincubated in
1049 Mock-depleted and either CDCA7e-depleted (B) or HELLS-depleted (C) extracts in the presence
1050 of aphidicolin. Chromatin was then isolated at indicated time points and chromatin-bound
1051 proteins were analyzed by western blotting using indicated antibodies.
Supplementary Materials for

CDCA7 is a hemimethylated DNA adaptor for the nucleosome remodeler
HELLS
Wassing, Nishiyama et al.
*Corresponding authors. Email: funabih@rockefeller.edu, uanishiyama@g.ecc.u-tokyo.ac.jp,

aritak@yokohama-cu.ac.jp
This PDF file includes:
Figs. S1 to S10
Tables S1 to S3
1
ICF3 mutations
X. laevis CDCA7e OCT95900 R232C/H G252V R262H
H. sapiens CDCA7 isoform 1 NP_114148 R353C/H G373V R383H
H. sapiens CDCA7 isoform 2 NP_665809 R274C/H G294V R304H
X. laevis CDCA7e OCT95900 218

* * * 318
H. sapiens CDCA7L NP_061189 343 443
O. biroi CDCA7 XP_011343355 187 287
N. vectensis CDCA7 XP_001626018 211 311
CXXC
Conserved cysteine 1 2 3 4 5 6 7 8 9 10 11
X. laevis CDCA7e OCT95900 H. sapiens CDCA7 isoform 2 NP_665809
R274C/H
R232C/H
G294V
R304H
G252V
R262H
142
260
360
371
105
218
318
332
111
74
Leucine zipper Leucine zipper

C-terminal helix
zf-4CXXC_R1 zf-4CXXC_R1
Fig. S1. Evolutionary conservation of the zf-4CXXC_R1 domain of CDCA7 homologs

ClustalW multi-sequence alignment of CDCA7 zf-4CXXC_R1 domain, characterized by eleven
conserved cysteine (yellow) and three ICF3 patient-associated (cyan) residues. X. laevis,
Xenopus laevis (African clawed frog); H. sapiens, Homo sapiens (human); O. biroi, Ooceraea
biroi (clonal raider ant); N. vectensis, Nematostella vectensis (starlet sea anemone); A. thaliana,
Arabidopsis thaliana (thale cress). Amino acid positions of ICF3 associated mutations in X.
laevis CDCA7e, H. sapiens CDCA7 isoform 1 (NP_114148) and the shorter isoform 2
(NP_665809) are indicated. An arrow indicates the position of cysteine 339 of H. sapiens
CDCA7 isoform 2, the site that was mutated to serine in Fig. 3, fig. S3D, fig. S4 and fig. S5.
Schematics showing the domain composition of X. laevis CDCA7e and H. sapiens CDCA7
isoform 2 are also shown.
1
Chromatin
buffer Geminin
30 60 90 120 30 60 90 120 Time (min)
180- DNMT1
100-
75- HELLS
45- CDCA7
100-
MCM7
75-
15- H3
Fig. S2. DNA replication promotes chromatin association of CDCA7e and HELLS .
X. laevis sperm nuclei were incubated with interphase Xenopus egg extracts in the presence or
absence of 0.5 µM recombinant geminin. At each indicated time point, chromatin was isolated
and analyzed by western blotting.
2
A
264-340 H. sapiens CDCA7 NP_665809
4CXXC
R274C/H
235-263
G294V
R304H
371
142
264
360
235
111
Leucine zipper C-terminal helix
341-371 zf-4CXXC_R1
B C
hemi-Me full-Me un-Me hemi-Me full-Me un-Me
CDCA7-DNA
complex
free DNA
hCDCA7 264-340 hCDCA7 235-340
D
hemi-Me full-Me un-Me
CDCA7-DNA
complex
free DNA
hCDCA7 264-371 C339S
Fig. S3. Characterization of the minimum hemimethylated DNA-binding domain of human

CDCA7.
(A) AlphaFold2-modeled structure of H. sapiens zf-4CXXC_R1 domain and schematic of full-
length H. sapiens CDCA7. Yellow lines indicate the position of conserved cysteine residues.
Orange bar indicates the conserved C-terminal helix. (B-D) Native gel electrophoresis mobility
shift assay for detecting the interaction of hCDCA7 264-340 (B) hCDCA7 235-340 (C), and hCDCA7
264-371 C339S (D) with double stranded DNA oligonucleotides with an unmethylated, hemi-
methylated or fully-methylated CpG.
3
A 4,000 micrographs Heterogeneous Refinement (multiple rounds)
Patch Motion Correction

Patch CTF Estimation
Manually Curate Exposures
(CTF resolution cut off < 8 Å)
854,921 particles
Heterogeneous Refinement
Non-uniform Refinement
146,634 particles
2 0 nm
3,973 micrographs
Blob Picker
09,556 particles
Extract From Micrographs
(360 px → 90 px) 3D Variability
1,583,471 particles
48,173 particles
2D Classification
672,791 particles
(2.9 Å)
5,552 particles
3D Classification
99,138 particles les

Ab-Initio Reconstruction
82,876 particles
(3.3 Å)
98 particles
Non-uniform Refinement
(using particles of the two volumes)
94,542 particles
(3.3 Å)
hCDCA7 bound nucleosome

154,998 particles (3.2 Å)
B hCDCA7 bound nucleosome (3.2 Å)

Gold Standard FSC
90°
Resolution
5.0 Å 3.0 Å
Fig. S4.
Cryo-EM single particle analysis of hCDCA7 bound to nucleosome.
(A) Cryo-EM data particle processing and refinement workflow of hCDCA7264-371 C339S bound
to nucleosome. (B) Local resolution of cryo-EM map of hCDCA7264-371 C339S bound to
nucleosome (left). Fourier shell correlation (FSC) curve of hCDCA7264-371 C339S bound to
nucleosome (right).
4
A Linker DNA Linker DNA

Volume Tools (invert mask)
Particle Subtraction
ma Local Refinement
CDCA7
CDCA7
hCDCA7 bound nucleosom
: 154,998 particles (3.2 Å) CDCA7-Linker DNA (4.8 Å)
Gold Standard FSC

180°
7.0 Å 5.0 Å Resolution
Fig. S5. Refinement workflow for cryo-EM map of linker DNA bound to hCDCA7 density.
(A) Focused refinement of the linker DNA bound by hCDCA7264-371 C339S moiety. Left figure
shows the cryo-EM map of hCDCA7264-371 C339S bound to nucleosome. The mask file is shown
as a green mesh (center) covering the hCDCA7264-371 C339S moiety bound to the linker DNA.
The cryo-EM map corresponding to the hCDCA7264-371 C339S moiety bound to the linker DNA
was improved by local refinement at 4.83 Å resolution (right). (B) Local resolution of the
hCDCA7264-371 C339S moiety bound to linker DNA. (left). FSC curve of hCDCA7264-371 C339S
bound to nucleosome (right)
5
A HELLS CDCA7e B HELLS CDCA7e

SNF2_N Helicase_C
SNF2_N Helicase_C
163-172 346-376
63-96 232-268 398-403 74-105
100
80
PLDDT
60
rank1
rank2
40
rank3
rank4
20 rank5
0 200 400 600 800 1000

Residue index
C CDCA7-binding D
Interface 1 of HELLS HELLS-binding
interface 1 of CDCA7
zf-4CXXC_R1 H. sapiens_CDCA7L
H. sapiens_CDCA7
CDCA7-binding CC1 (autoinhibition)
Interface 2 of HELLS
H. sapiens_HELLS H. sapiens_HELLS
E F
O. biroi_CDCA7
N. vectensis_CDCA7
O. biroi_HELLS N. vectensis_HELLS
G DDM1 autoinhibititory CC1

H I
A. thaliana_CDCA7
A. thaliana_DDM1
A. thaliana_DDM1 DDM1-Nucleosome
(UniProt Q9XFH4 prediction) 7UX9 cryo-EM
Fig. S6. Alphafold2 structure prediction of the CDCA7-HELLS/DDM1 complex

(A, B) AlphaFold2 structure prediction analysis of X. laevis HELLS and CDCA7e. (A) The
predicted aligned error map of the best model, with the minimum inter-chain predicted aligned
error of 1.7 Å. (B) PLDDT scores of the top five predicted models, with the interface highlighted
on top of the figure. The top five predictions were converged (region is shaded in gray), and the
interface has relatively high PLDDT scores, with the average value of 63. (C-H) AlphaFold2
structure prediction of HELLS/DDM1 of indicated species in complex with CDCA7 and CDCA7
paralogs . (I) Left; atomic model of DDM1-nucleosome complex cryo-EM structure (7UX9).
Right; surface electrostatic potential of DDM1. The DNA-binding positively charged groove,
which is predicted to be occupied by the autoinhibitory CC by AlphaFold2 models, is marked
with a pink circle.
6
A Putative DDM1-Binding Helix

O. sativa CDCA7 XP_015615571 41 74
O. sativa CDCA7 XP_015630077 7 40
Z.mays CDCA7 PWZ29044 43 76
Z.mays CDCA7 ONM08514 7 40
C. richardii CDCA7 KAH7433086 6 38
P. patens CDCA7 XP_024375915 17 50
V. corteri CDCA7 XP_002955702 9 42
C. eustigma CDCA7 GAX75209 7 40
M. pusilla CDCA7 XP_003058876 17 50
B. prasinos CDCA7 XP_007513594 25 58
500 0 MYA
B Autoinhibitory CC1 Putative CDCA7-Binding Helix (CC2)
A. thaliana DDM1 61 131

O. sativa DDM1 131 206
Z.mays DDM1 130 204
C. richardii DDM1 33 103
P. patens DDM1 89 161
V. corteri DDM1 40 116
C. eustigma DDM1 22 89
M. pusilla DDM1 31 103
B. prasinos DDM1 105 181
Fig. S7. Evolutionary conservation of putative DDM1-CDCA7 interaction interfaces in

green plants
(A) Sequence alignment of putative DDM1-binding helix of CDCA7 homologs in green plants.
O. sativa, Oryza sativa (rice); Z. mays, Zea mays (corn); C. richardii, Ceratopteris richardii
(fern); P. patens, Physcomitrium patens (moss); V. carteri, Volvox carteri (colonial green alga);
C. eustigma, Chlamydomonas eustigma (unicellular green alga); M. pusilla, Micromonas pusilla
(unicellular green alga); B. prasinos, Bathycoccus prasinos (marine green alga). ((B) Sequence
alignment of the putative autoinhibitory CC1 and the CDCA7-binding CC2 of DDM1 homologs
in green plants.
7
FLAGx3-xCDCA7e
R232C/H
G252V
R262H
pull down
105
218
318
332
74
Extracts
∆74-101
102-332
205-332
Beads
1-204
HLBH zf-4CXXC_R1
WT
WT
1-204
HELLS
102-332 100
205-332
∆74-101
65
45
35 FLAG
25
20
Fig. S8. N-terminal CDCA7 segment lacking the zf-4CXXC_R1 domain is sufficient for
HELLS binding
Wildtype (WT) or truncated versions of recombinant FLAG3-tagged X. laevis CDCA7e proteins
were incubated with Xenopus egg extracts, followed by immunoprecipitation with anti-FLAG
coupled beads. Isolated proteins were analyzed by western blotting using anti-HELLS and anti-
FLAG antibodies.
8
Sperm nuclei Erythrocyte nuclei

H CPM 6000
800
4000
600
3
400
2000
200
0 0
∆MOCK
∆HELLS
∆MOCK
∆HELLS
∆CDCA7
∆CDCA7
∆MOCK
∆HELLS
∆MOCK
∆HELLS
∆CDCA7
∆CDCA7
+ Geminin + Geminin
Fig. S9. CDCA7 and HELLS are not required for global maintenance DNA methylation in
Xenopus egg extracts
X. laevis sperm nuclei (A) or erythrocyte nuclei (B) were incubated with egg extracts for 60 min
with S-[methyl-3H]-adenosyl-L-methionine with or without geminin, which inhibits DNA
replication initiation. Radioactivity associated with chromosomal DNA is measured. Results
include three biological replicates (A) or two biological replicates (B), each of which includes
two technical replicates (shown in the same color). Geminin effectively inhibited DNA
incorporation of 3H, demonstrating that DNA methylation of sperm chromatin depends on DNA
replication.
9
beads pull-down beads pull-down

A C
extract no DNA no-Me hemi-Me extract no DNA no-Me hemi-Me
∆CDCA7e
∆CDCA7e
∆CDCA7e
∆CDCA7e
∆CDCA7e
∆CDCA7e
∆CDCA7e
∆CDCA7e
∆HELLS
∆HELLS
∆HELLS
∆HELLS
∆HELLS
∆HELLS
∆HELLS
∆HELLS
∆MOCK
∆MOCK
∆MOCK
∆MOCK
∆MOCK
∆MOCK
∆MOCK
∆MOCK
100 UHRF1 100 UHRF1
55 55
CDCA7e
CDCA7e
35
0 MIN
H3-Ub2
H3-Ub 35
15 H3
H3
beads pull-down
∆CDCA7e
extract no DNA no-Me hemi-Me

∆MOCK
∆HELLS
∆CDCA7e
∆CDCA7e
∆CDCA7e
∆CDCA7e
100%
50%
10%
∆HELLS
∆HELLS
∆HELLS
∆HELLS
∆MOCK
∆MOCK
∆MOCK
∆MOCK
130
100 HELLS
100 UHRF1
70
15 55 CDCA7e
H4
5 MIN
10
35 H3-Ub2
H3-Ub
H3
B beads pull-down
extract no DNA no-Me hemi-Me
hemimethylated
∆CDCA7e
∆CDCA7e
∆CDCA7e
∆CDCA7e
DNA-beads
∆HELLS
∆HELLS
∆HELLS
∆HELLS
∆MOCK
∆MOCK
∆MOCK
∆MOCK
mDPPA3
UHRF1
100
+mDPPA3 +APH
55 CDCA7e 15 MIN
Methylation OFF ON 35 H3-Ub2
H3-Ub
H3
Fig. S10. CDCA7e and HELLS are not required for histone H3 ubiquitylation on
hemimethylated DNA-beads in Xenopus egg extracts
(A) Beads coated with unmethylated pBlueScript DNA or hemimethylated pBlueScript DNA
were incubated with interphase mock IgG-depleted (∆MOCK), CDCA7e-depleted (∆CDCA7e),
or HELLS-depleted (∆HELLS) Xenopus egg extracts for 60 min. Beads were collected and
analyzed by western blotting. Bottom panel shows effective HELLS depletion. (B, C) Beads
coated with unmethylated pBlueScript DNA or hemimethylated pBlueScript DNA were
incubated with ∆MOCK, ∆CDCA7e, or ∆HELLS egg extracts for 60 min in the presence of 1.3
µM mDPPA3, which inhibits binding of UHRF1 and H3 ubiquitylation. During this
preincubation, nucleosomes assemble on DNA beads without DNA methylation. Beads were
then transferred to corresponding depleted interphase extracts that contained aphidicolin (APH)
but not mDPPA3. After 0-, 5-, or 15-min incubation, beads were collected and analyzed by
western blotting.
10
Table S1. DNA ultramer sequence used for DNA pull-downs

Name Sequence (sense strand)
/5Biosg/TCGGGTTATGTGATGGACCCTATACGCGGGCG
CCCTGGAGAATCCTGCAGCCGAGGCCGCTCAATTGGT
200 bp CGTAGCAAGCTCTAGCACCGCTTAAACGCACGTACGC
unmethylated GCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTC
DNA Widom601 CCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGT
GCATGTATTGAACAGCGAC
/5Biosg/TMGGGTTATGTGATGGACCCTATAMGMGGGMG
CCCTGGAGAATCCTGCAGCMGAGGCMGCTCAATTGGT
200 bp MGTAGCAAGCTCTAGCACMGCTTAAAMGCAMGTAMG
hemimethylated MGCTGTCCCCMGMGTTTTAACMGCCAAGGGGATTACT
DNA Widom601 CCCTAGTCTCCAGGCAMGTGTCAGATATATACATCCTG
TGCATGTATTGAACAGMGAC
*M:5-methylcytosine
**/5Biosg/: 5’ biotin modification
11
Table S2. DNA sequence used for nucleosome reconstruction

Name Sequence (sense strand) and primers
ATCTGGGCCMGCCATATCAGAATCCCGGTGCCGAGGC
CGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAA
CGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAA
GGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATAT
Hemimethylatio ATACATCGAT (160 bp)
n site in 5’-linker
DNA Widom601 Primer
Forward: 5’-
ATCTGGGCCMGCCATATCAGAATCCCGGTGCCGA
GGCCG
Reverse: 5’-ATCGATGTATATATCTGACACGTGC
ATCAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGT
AGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCT
GTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTA
GTCTCCAGGCACGTGTCAGATATATACATCGATCCMGC
AGGCC (157bp)
Hemimethylatio
n in 3’-linker
Primer
DNA Widom601
Forward: 5’- ATCAGAATCCCGGTGCCGAGGCCGC
Reverse: 5’- ATCCGTCTCCATCGATGTATATATC
Oligo nucleotide
Forward: 5’-CGATCCMGCAGGGCAG
Reverse: 5’-CTGCCCTGCGGG
ATCAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGT
AGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCT
GTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTA
GTCTCCAGGCACGTGTCAGATATAMGCATCGATGCAG
G (150 bp)
Hemimethylatio
n in 3’-
Primer
nucleosomal
Forward: 5’- ATCAGAATCCCGGTGCCGAGGCCGC
DNA Widom601
Reverse: 5’-TCTCAGATATCCCGTCTCGCGTATATCTGA
CACGTGCCTG
Oligo nucleotide
Forward: 5’- TAMGCATCGATGCAGG
Reverse: 5’-CCTGCATCGATG
*M:5-methylcytosine
12
Table S3. Cryo-EM data collection statics for hCDCA7:nucleosome
hCDCA7:linker DNA
hCDCA7:nucleosome
(focused map)
EMDB number EMD-38198 EMD-38199
Microscope Krios G4 (RIKEN BDR)
Voltage (keV) 300
Camera K3/BioQuantum
Magnification 105,000
Pixel size at detector (Å) 0.83
- 2
Total electron exposure (e /Å ) 60.725
-
Exposure rate (e /pixel/sec) 18.987
Exposure time (sec) 2.2
Defocus range (μm) 0.6-1.6 (interval: 0.2)
Number of frames 48
Energy filter slit width 15
Micrographs collected (no.) 4,000
Initial particle images (no.) 1,652,465 672,791
Final particle images (no.) 154,998 154,998
Map resolution (Å) FSC threshold 3.18 4.83
Automation software EPU
13

2023 12 19 572350v1 Full

Uploaded by

Copyright:

Available Formats

You might also like

2023 12 19 572350v1 Full

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

2023 12 19 572350v1 Full

Uploaded by

Copyright:

Available Formats

bioRxiv preprint doi: https://doi.org/10.1101/2023.12.19.572350; this version posted December 19, 2023.

The copyright holder for this preprint

1 CDCA7 is a hemimethylated DNA adaptor for the nucleosome remodeler HELLS

141 CDCA7 zf-4CXXC_R1 domain selectively binds hemimethylated DNA

364 Xenopus egg extracts

442 DNA pull-down assays

490 Detection of DNA methylation maintenance in Xenopus egg extract

635 3. T. Dimitriu, M. D. Szczelkun, E. R. Westra, Evolutionary Ecology and Interplay of

683 18. D. S. Dunican, H. A. Cruickshanks, M. Suzuki, C. A. Semple, T. Davey, R. J. Arceci, J.

732 35. A. Nishiyama, L. Yamaguchi, J. Sharif, Y. Johmura, T. Kawamura, K. Nakanishi, S.

832 63. K. Luger, A. W. Mader, R. K. Richmond, D. F. Sargent, T. J. Richmond, Crystal structure

A Beads pull-down B Beads pull-down

E DNA hemi-Me full-Me un-Me

H. sapiens CDCA7 NP_665809

hCDCA7 264-371 free DNA

X. laevis CDCA7e OCT95900

HELLS-Binding zf-4CXXC_R1 CDCA7-Binding Helix

HELLS-Binding Helix (HLBH)

1500 1000 500 0 MYA

E Basic patch CDCA7-Binding Interface 2

X. laevis HELLS AAH97562 126 172

Input IP:IgG IP:α-xCDCA7e Input IP:IgG IP:α-xHELLS

100 100 HELLS

extract no DNA un-Me hemi-Me

Sperm ΔMOCK ΔMOCK ΔMOCK ΔMOCK

Methylation OFF ON Chromatin Chromatin

Chromatin 180 DNMT1 180 DNMT1

35 H3-Ub2 35 H3-Ub2 35 H3-Ub2

Supplementary Materials for

Wassing, Nishiyama et al.

*Corresponding authors. Email: funabih@rockefeller.edu, uanishiyama@g.ecc.u-tokyo.ac.jp,

This PDF file includes:

X. laevis CDCA7e OCT95900 218

X. laevis CDCA7e OCT95900 H. sapiens CDCA7 isoform 2 NP_665809

Leucine zipper Leucine zipper

Fig. S1. Evolutionary conservation of the zf-4CXXC_R1 domain of CDCA7 homologs

hCDCA7 264-340 hCDCA7 235-340

hCDCA7 264-371 C339S

Fig. S3. Characterization of the minimum hemimethylated DNA-binding domain of human

A 4,000 micrographs Heterogeneous Refinement (multiple rounds)

Patch Motion Correction

99,138 particles les

hCDCA7 bound nucleosome

B hCDCA7 bound nucleosome (3.2 Å)

A Linker DNA Linker DNA

Gold Standard FSC

7.0 Å 5.0 Å Resolution

A HELLS CDCA7e B HELLS CDCA7e

0 200 400 600 800 1000

G DDM1 autoinhibititory CC1

Fig. S6. Alphafold2 structure prediction of the CDCA7-HELLS/DDM1 complex

A Putative DDM1-Binding Helix

A. thaliana CDCA7 NP_195428 28 61

B Autoinhibitory CC1 Putative CDCA7-Binding Helix (CC2)

A. thaliana DDM1 61 131

Fig. S7. Evolutionary conservation of putative DDM1-CDCA7 interaction interfaces in

Sperm nuclei Erythrocyte nuclei