Catalog

085-2021-Anh.pdf ······································································································································· 1
086-2021-Anh..pdf ······································································································································ 9
086-2021-Anh.pdf ····································································································································· 17
087-2021-Anh.pdf ····································································································································· 25
088-2021-Anh.pdf ····································································································································· 33
089-2021-Viet.pdf ····································································································································· 41
090-2021-Viet.pdf ····································································································································· 49
091-2021-Viet.pdf ····································································································································· 61
092-2021-Anh.pdf ····································································································································· 69
092-2021-Viet.pdf ····································································································································· 81
093-2021-Viet.pdf ····································································································································· 91
094-2022-Anh.pdf ····································································································································· 99
095-2022-Anh.pdf ··································································································································· 111
096-2022-Anh.pdf ··································································································································· 121
097-2022-Anh.pdf ··································································································································· 127
098-2022-Anh.pdf ··································································································································· 135
099-2022-Anh.pdf ··································································································································· 143
100-2022-Anh.pdf ··································································································································· 153
101-2022-Anh.pdf ··································································································································· 163
102-2022-Anh.pdf ··································································································································· 169
103-2022-Anh.pdf ··································································································································· 177
104-2022-Anh.pdf ··································································································································· 185
105-2022-Anh.pdf ··································································································································· 195
106-2022-Anh.pdf ··································································································································· 203
107-2022-Viet.pdf ··································································································································· 213
108-2022-Viet.pdf ··································································································································· 221
109-2022-Viet.pdf ··································································································································· 231
110-2022-Viet.pdf ··································································································································· 239
111-2022-Viet.pdf ··································································································································· 251
112-2022-Viet.pdf ··································································································································· 259
113-2022-Viet.pdf ··································································································································· 267
114-2022-Viet.pdf ··································································································································· 275
115-2023-Anh.pdf ··································································································································· 283
116-2023-Viet.pdf ··································································································································· 289
117-2023-Viet.pdf ··································································································································· 297
118-2023-Viet.pdf ··································································································································· 305
119-2023-Anh.pdf ··································································································································· 313
120-2023-Anh.pdf ··································································································································· 323
7/5/2021 Vol. 11 No. 3 (2021): July | Journal of Advanced Veterinary Research

Journal of Advanced Veterinary Research

Home / Archives / Vol. 11 No. 3 (2021): July

Vol. 11 No. 3 (2021): July

Published: 2021-07-01

Original Research

Surgical Anatomy for Desmotomy of the Superior and Inferior Check Ligaments in Donkeys
Asmaa Abo Bakr, Nabil A. Misk, Ahmed Ibrahim, Abdelraheim Attaai
127-135

 PDF

Ultrastructure of Hepatocyte and Liver Ontogeny of the Indo-Pacific Seahorse Hippocampus barbouri Jordan & Richardson 1908
Sinlapachai Senarat, Rangsima Sujittosakul, Jes Kettratad, Supanut Pairohakul, Gen Kaneko, Wannee Jiraungkoorskul
136-140

 PDF

Effects of Lysine Supplemented on Growth, Apparent Nutrient Digestibility, and Slaughter Yield of Noi Broilers from 56–84 Days of Age
Nguyen Thi Anh Thu, Lam Thai Hung, Ly Thi Thu Lan, Nhan Hoai Phong, Juan Boo Liang, Le Thanh Phuong, Nguyen Trong Ngu
141-146

 PDF

Gross, Histological and Scanning Electron Studies on the Bulbourethral Gland of Donkey (Equus asinus) during Different Seasons
Alaa Sayed Abou-Elhamd, Aziza Selim, Yousria Abdel Rahman
147-157

 PDF

Occurrence of Endoparasites in Wild Songbirds from Illegal Wildlife Trade

Stacy Wu, Ronaldo José Piccoli, Izabel Carolina Vargas Pinto Gogone, Carolina Melchior do Prado, Anderson Luiz de Carvalho, Silvia Cristina Osaki, Nelson Luis de Mello
Fernandes
158-161

 PDF

The Influence of Individual Factors on the Characteristic and Production of Frozen Semen of Bali Cattle
Angelina Novita, Gatot Ciptadi, Sri Wahjuningsih, Anny Amaliya, Wiwied Sawitri, Trinil Susilawati
162-166

 PDF

Clinico-Pathological Responses of Sheep to Graded Levels of Brachiaria decumbens Diets

Kalai Vaani Muniandy, Eric Lim Teik Chung, Mohd Farhan Hanif Reduan, Bura Thlama Paul, Mimi Syazwani Jaapar, Muhammad Hazziq Mohd Hamdan, Faez Firdaus
Abdullah Jesse
167-173

 PDF

https://www.advetresearch.com/index.php/AVR/issue/view/43 1/3
 Journal of Advanced Veterinary Research Volume 11, Issue 3 (2021) 141-146

Journal of Advanced Veterinary Research

https://advetresearch.com

Effects of Lysine Supplemented on Growth, Apparent Nutrient Di-

gestibility, and Slaughter Yield of Noi Broilers from 56–84 Days of Age
Nguyen Thi Anh Thu1, Lam Thai Hung1, Ly Thi Thu Lan1, Nhan Hoai Phong1,
Juan Boo Liang2, Le Thanh Phuong3, Nguyen Trong Ngu4*
1
School of Agriculture and Aquaculture, Tra Vinh University, 126 Nguyen Thien Thanh, Tra Vinh City, Vietnam.
2
Institute of Tropical Agriculture and Food Security, Putra University, Malaysia.
3
Emivest Feedmill Vietnam Co., Ltd.
4
College of Agriculture, Can Tho University, Can Tho City, Vietnam.

ARTICLE INFO ABSTRACT

A total of 192 Noi broilers at 56 days of age were allotted in a completely randomized design consisting
of four treatments and four replicates to evaluate the effect of dietary lysine added on body weight
Original Research
gain (BWG), feed conversion ratio (FCR), apparent nutrient digestibility (AND), and carcass characteris-
tics. Treatments included a control with 0.8% lysine in the diet and three experimental treatments
02 April 2021 (Lys+0.1; Lys+0.2; Lys+0.3) with lysine added at 0.1, 0.2, and 0.3%, respectively. Crude protein (CP) was
Received:
15%, and metabolizable energy was 3,000 kcal/kg of feed. At 77 days of age, for each replicate, one
male and one female chicken were selected for the estimation of AND by using Fe2O3 marker. The
chickens were fed ad libitum and vaccinated against common diseases. The results showed that lysine's
10 June 2021
Accepted:
addition to the diet at 0.2–0.3% significantly improved the BWG and FCR (P<0.05). Furthermore, the
addition of 0.1–0.3% lysine to the diet resulted in a significant increase in apparent CP digestibility and
overall amino acid digestibility (P<0.05) but did not affect the apparent digestibility of Ca and P of Noi
Keywords: broilers. Finally, concerning the breast weight and yield of both male and female chickens, whereas the
male broilers' dressing improved with the addition of 0.3% lysine to the diet, the breast yield of their
Noi broilers female counterparts bettered when supplemented with 0.2% lysine.
Digestibility
Lysine

J. Adv. Vet. Res. (2021), 11 (3), 141-146

of lysine has been proven to contribute to a higher meat yield

Introduction
Chickens, whose meat accounts for more than 20% of
Vietnam's livestock meat products, have been a vital food
source for humans (Vietnam Animal production, 2020). Back-
yard chickens are mainly raised in Vietnam and comprise a
higher percentage of total chickens than industrial chicken
breeds (Van Duy et al., 2015). The demand for indigenous
broilers in Vietnam has been on the rise, and the Noi broiler
breed is the top choice of consumers (Khoa et al., 2019).
A balanced diet is an essential factor for the growth of
chickens and economic efficiency. However, to achieve the
best development of chickens and metabolic factors, protein
needs to be provided in the diet to ensure the entire balance
of the amino acid (AA) requirements for the chickens. Thus,
special attention is paid to the diet's lysine content since it is
the first limiting AA used to calculate the remaining AAs in the
diet (Mack et al., 1999; Baker et al., 2002; Baker, 2003). Besides,
Araújo et al. (2005) and Corzo et al. (2005) also indicated that
the addition of AA at different levels in the diet affects the
growth and quality of chicken meat. Furthermore, the addition
*Corresponding author: Nguyen Trong Ngu
E-mail address: ntngu@ctu.edu.vn
of chicken breast (Hickling et al., 1990; Moran and Bilgili,
1990). Other findings on broilers have also noted that addi-
tional lysine in the diet leads to better crude protein (CP) di-
gestibility and AA as well as meat yield (Tao et al., 1971;
Hickling et al., 1990; Selle et al., 2007; Hung and Ngu, 2017;
Lam Thai Hung, 2019). This study aimed to evaluate the effects
of extra lysine in the diet on body weight gain (BWG), appar-
ent nutrient digestibility (AND), and carcass characteristics.
Materials and methods
Experimental design
A total of 192 Noi broilers at 56 days old were arranged in
a completely randomized design with four treatments and
four replicates (12 chickens per replicate with equal ratios of
males and females). Treatments included a control (with 0.8%
lysine) and three experimental diets (Lys+0.1, Lys+0.2, and
Lys+0.3) added to the control treatment with lysine levels of
0.1, 0.2, and 0.3%, respectively. The experimental diets con-
tained CP of 15% and metabolizable energy (ME) of 3,000
kcal/kg of feed. The experiment was carried out on chickens
from 56 to 84 days of age, and they were raised on rice husks
in an area of 3 m2/plot surrounded by a net. Chickens received

ISSN: 2090-6277/2090-6269/ © 2011-2021 JAVR. All rights reserved.

 Nguyen Thi Anh Thu et al. /Journal of Advanced Veterinary Research 11 (3) (2021) 141-146

similar care and were fed ad libitum. The feeding and drinking
troughs were individually designed for each experimental unit.
All chickens were vaccinated against diseases following a com-
mon procedure.
At 77 days of age, one male and one female chicken were
selected in each experimental unit to identify AND. The chick-
ens in this experiment were raised in cages with an area of
40x50x40 cm that had a plastic tray for collecting manure.
Chicken feed intake (FI) was limited to 80% of the actual need,
and the chickens were fed at 6:00 and 14:00 daily. The AND
was indirectly determined by the Fe2O3 marker, which was
mixed into the diet at a rate of 0.1%. The chickens were fed
for four days, and then fecal samples were taken for three
days. All daily fecal samples were collected and stored in a
freezer (-20°C). At the end of the experiment, the fecal samples
were thawed and mixed well, then dried at 60oC and ground
to analyze the chemical components in one sample in each
experimental unit.
Diets
Diets consisted of yellow corn, soybean meal, rice bran,
synthetic AA, dicalcium phosphate, shell, salt, vitamin premix,
and micromineral premix (Table 1 and Table 2). The ratios of
Data collection
The identified indicators included FI, BWG, FCR, and AND.
The chicken BWG was determined by subtracting the early-
stage weight from the final-stage weight. FCR was calculated
by the amount of FI (g) over BWG (g). Besides, AND was de-
termined basing the difference in the content of the non-di-
gestible marker in feces and feed calculated by the formula:
Apparent nutrient digestibility (%)
Where N. feed: nutrient in feed, N. feces: nutrient in feces,
Fe. feed: Fe2O3 in feed, and Fe. feces: Fe2O3in feces.
Data analysis
Data were analyzed by the General Linear Model on
Minitab 16.0 software. The mean difference between the treat-
ments was compared using Tukey's test, with α <0.05.
Results

AA methionine+cystine and threonine were calculated accord-
ing to the ideal AA pattern proposed by Baker (2003). The
chemical compositions of feed and manure were analyzed
based on the method by AOAC (2000), and the AA levels in
feed and feces were analyzed by high-performance liquid
chromatography (AOAC, 2006).
Effects of levels of dietary lysine on body weight gain and feed
efficiency of Noi chickens
Feed intake, BWG, and FCR of Noi broilers at 56–84 days
of age are presented in Table 3. The results showed that the FI
was not significantly different (P>0.05), unlike the daily BWG

Table 1. Chemical composition of feedstuffs

Chemical composition (% of feed)
Feedstuffs
DM ME, kcal/kg CP Lys Met+Cys Thr Ca P
Yellow corn 85.81 3,335 6.94 0.25 0.369 0.234 0.21 0.31
Soybean meal 87.94 2,631 44.87 0.949 1.277 2.124 0.4 0.69
Rice bran 87.86 2,624 12.01 0.61 0.22 1.17 0.375 1.58
Note: DM: dry matter, ME: metabolizable energy, CP: crude protein, lys: lysine, Met+Cys: Methionine + Cystine and Thr: threonine, Ca: calcium, and P:
phosphorus.

Table 2. Experimental diets

Diets
Feedstuffs
Control Lys+0.1 Lys+0.2 Lys+0.3
Yellow corn (%) 66.79 67.07 67.34 67.67
Soybean meal (%) 19.5 19.05 18.6 18
Rice bran (%) 9.85 9.85 9.85 9.85
Lysine (%) 0.35 0.49 0.59 0.7
Methionine* (%) 0.06 0.13 0.21 0.29
DCP (%) 1 1 1 1
Shell (%) 1.76 1.76 1.76 1.76
Premix** (%) 0.25 0.25 0.25 0.25
Salt (%) 0.4 0.4 0.4 0.4
Nutritional value of diets
ME (kcal/kg of feed) 2,999 2,996 2,994 2,989
CP (%) 15 15 15 15
Lysine (%) 0.8 0.9 1 1.1
Methionine (%) 0.57 0.64 0.72 0.79
Threonine (%) 0.68 0.67 0.67 0.73
Tryptophan (%) 0.27 0.26 0.26 0.25
Calcium (%) 1.01 1.01 1.01 1.01
Phosphorus (%) 0.7 0.69 0.69 0.68

Note: Control: lysine 0.8%; Lys+0.1: additional 0.1% lysine, Lys+0.2: additional 0.2% lysine, Lys+0.3: additional 0.3% lysine, DCP: dicalci phosphate,
ME: metabolizable energy, CP: crude protein, *: supplemented for need of methionine+cysteine, **: vitamin premix and micro mineral premix.

142
 Nguyen Thi Anh Thu et al. /Journal of Advanced Veterinary Research 11 (3) (2021) 141-146

and FCR (P<0.05). The daily BWG in the control treatment was
14.9 g/bird/day, which increased gradually with lysine added
to the diet at levels of 0.1, 0.2, and 0.3% and peaked at 0.3%
lysine (16.38 g/bird/day). The addition of lysine to the diet at
0.2% (FCR at 3.95) and 0.3% (FCR at 3.81), also significantly
improved the feeding efficiency on Noi broilers and 0.1% (FCR
at 4.12) as opposed to the lysine level in the diet in the control
treatment (FCR at 4.22).
Effects of levels of dietary lysine on nutrient apparent digestibil-
ity of Noi chickens
The apparent digestibility of CP, Ca, P, and AA of Noi broil-
ers at 56–84 days of age is shown in Table 4. The findings
showed that the apparent CP digestibility in the treatments
differed significantly (P<0.01) compared to the control with
no addition of lysine (0.8% lysine). In particular, the control
treatment had a lower apparent digestibility of CP (64.02%)
than the others with lysine addition at levels of 0.1, 0.2, and
0.3% (68.00, 69.58, and 68.72%, respectively). The apparent di-
gestibility of indispensable AAs (glycine, histidine, leucine, ly-
sine, and valine) and the dispensable AAs and the average AA
digestibility improved when lysine was added at 0.1, 0.2, and
0.3% to the diet. However, apparent digestibility of P, Ca, argi-
nine, cysteine, methionine, phenylalanine, and threonine was
not affected when lysine was added to the diet (P>0.05).
Effects of lysine levels in the diets on carcass composition and
internal organ ratio of Noi broilers
Table 5, presents the carcass composition and the chicken
internal organ ratio at 84 days of age. As shown, the weight
of breast meat (BM) of the male and female chickens in the
control treatment (70.75 g and 75.25 g/bird, respectively) was
significantly lower than the figures for those being fed 0.3%
lysine supplemented diets (90 g/bird for males and 102 g/bird
for females). In addition, the dressing ratio of male chicken,
which was 64.82% in the control treatment, increased gradu-
ally through the experimental treatments with Lys+0.1
(66.81%), Lys+0.2 (67.9%), and Lys+0.3 (69.54%). The latter
showed significant differences compared with the control
treatment. The results also indicated that the breast yield of
female chickens (12.36% in the control treatment) tended to
increase when adding lysine, especially with 0.2% and 0.3% ly-
sine added (13.88% and 13.86%, respectively). Finally, the BM
yield of males registered an increase from 11.51% in the con-
trol treatment to 13.67% with an addition of 0.3% lysine. No
differences were found in internal organ ratios in all treat-
ments.

Table 3. Effect of lysine levels of diets on Noi boiler growth and FCR
Treatments
Terms P/SEM
Control Lys+0.1 Lys+0.2 Lys+0.3
Initial BW (g/bird) 496 498 510 513 0.074/4.93
Daily feed intake (g/bird) 62.83 64.25 62.38 62.5 0.609/1.08
Daily BWG (g) 14.90b 15.59ab 15.78ab 16.38a 0.005/0.23
FCR (g of feed/g of BWG) 4.22a 4.12a 3.95b 3.81b 0.000/0.04
Final BW (g/bird) 914c 935bc 952ab 972a 0.001/7.84
Note: FCR: feed conversion ratio; BW: bodyweight; BWG: bodyweight gain; Lys+0.1: 0.1% additional lysine in the diet; Lys+0.2: 0.2% additional lysine
in the diet; Lys+0.3: 0.3% additional lysine in the diet.

Table 4. Effects of dietary lysine levels on nutrient apparent digestibility of Noi broilers
Treatments
Terms P/SEM
Control Lys+0.1 Lys+0.2 Lys+0.3
CP digestibility 64.02b 68.00a 69.58a 68.72a 0.000/0.63
Calcium digestibility 47.64 46.41 49.62 48.92 0.486/1.52
Phosphorus digestibility 45.48 47.81 48.67 47.93 0.700/1.98
Indispensable AA digestibility, %
Arginine 86.47 84.96 88.95 88.17 0.052/0.96
Cystine 68.79 71.54 71.07 73.77 0.680/2.85
Glycine 64.58b 78.57a 73.92a 78.98a 0.000/1.64
Histidine 82.57b 83.80b 86.47ab 88.91a 0.004/1.03
Isoleucine 66.90b 82.45a 80.27a 80.24a 0.000/1.12
Leucine 78.72b 86.40a 84.06a 85.36a 0.000/0.85
Lysine 83.26b 86.74ab 86.99a 87.77a 0.016/0.88
Methionine 89.68 89.37 88.43 90.74 0.271/0.78
Phenylalanine 83.37 87.04 86.85 85.16 0.193/1.26
Threonine 78.8 81.85 80.69 80.77 0.260/1.03
Valine 62.56b 65.29b 78.66a 75.48a 0.000/1.18
Dispensable AA digestibility
Alanine 63.69b 68.33ab 67.32ab 72.05a 0.029/1.66
Aspartic 60.43c 74.14b 79.43a 75.46ab 0.000/1.19
Glutamic 70.36c 80.13b 86.97a 83.45ab 0.000/1.10
Serine 75.76b 86.92a 81.98ab 90.80a 0.002/2.11
Tyrosine 69.51b 75.72ab 84.23a 84.71a 0.004/2.59
Overall AA digestibility 73.96c 79.81b 81.35ab 82.49a 0.000/0.48
Note: Control: lysine 0.8% in the diet; CP: crude protein; Lys+0.1: 0.1% additional lysine in the diet; Lys+0.2: 0.2% additional lysine in the diet; Lys+0.3:
0.3% additional lysine in the diet

143
 Nguyen Thi Anh Thu et al. /Journal of Advanced Veterinary Research 11 (3) (2021) 141-146

Table 5. Carcass composition and internal organ ratio of Noi broilers at 84 days old
Treatments
Terms Sex P/SEM
Control Lys+0.1 Lys+0.2 Lys+0.3
Female 865 940 883 948 0.266/33.6
Live weight (g/bird)
Male 1,003 1,043 1,008 1,068 0.640/40.3
Female 573 633 583 649 0.093/22.5
Carcass weight (g/bird)
Male 650 696 684 743 0.310/33.1
Female 70.75b 82.00ab 81.00ab 90.00a 0.026/3.76
Breast weight (g/bird)
Male 75.25b 91.00ab 86.50ab 102a 0.043/5.71
Female 126 151 132 149 0.103/7.76
Thigh weight (g/bird)
Male 147 155 154 173 0.191/7.96
Female 66.26 67.4 66.08 68.48 0.262/0.91
Dressing (%)
Male 64.82b 66.81ab 67.90ab 69.54a 0.049/1.06
Yield (% of carcass weight)
Female 12.36b 12.93ab 13.88a 13.86a 0.016/0.33
Breast
Male 11.51b 13.09ab 12.63ab 13.67a 0.028/0.44
Female 21.9 23.8 22.66 22.91 0.369/0.73
Thigh
Male 22.63 22.25 22.44 23.22 0.622/0.54
Female 0.453 0.444 0.411 0.416 0.795/0.04
Heart
Male 0.466 0.438 0.439 0.469 0.775/0.03
Female 2.071 2.821 1.863 1.949 0.553/0.51
Liver
Male 2.029 2.331 1.98 2.245 0.067/0.09
Female 2.368 2.295 2.79 2.474 0.572/0.26
Gizzard
Male 2.332 2.045 2.517 2.012 0.197/0.18
Female 0.285 0.191 0.209 0.178 0.406/0.05
Spleen
Male 0.192 0.184 0.135 0.184 0.751/0.04
Note: Control: 0.8% additional lysine in the diet; Lys+0.1: 0.1% additional lysine; Lys+0.2: 0.2% additional lysine; Lys+0.3: 0.3% additional lysine

g/bird/week versus 43.6 g/bird/week, respectively). This study

also was similar to the conclusion of Hickling et al. (1990) that
Discussion
lysine supplementation, which exceeded 118% of NRC stan-
The FI was similar among the treatments because they
dard to the diet of a 1–6 week-old Ross x Arbor Acres chickens,
were raised in the same temperature, humidity, care, and the
resulted in BWG reaching 2,240 g/bird and FCR reaching 1.79.
same ME and CP in the feed. Although broilers can regulate
This result improved when comparing with lysine addition ac-
FI when a balanced diet is deficient with lysine, methionine,
cording to the NRC standard with BWG of 2,227 g/bird and
and tryptophan (Picard et al., 1993), the amount of lysine
FCR of 1.81 g. Similarly, adding 11 g/kg lysine gave rise to a
added to the diet was high compared to the actual need. The
higher BWG of 899 g/bird and a lower FCR of 1.64, compared
results are consistent with Lam Thai Hung (2019), who re-
with BWG of 823 g/bird and FCR 1.79 when adding 10 g/kg
ported that when lysine is added at the levels of 0.9, 1.0, and
to the diet of Cobb chickens at 7–28 days old (Selle et al.,
1.1% to the H'mong chicken diet at 1-28 days old with similar
2007). Also, when lysine at 0.9, 1.0, and 1.1% was added to the
ME, no difference in FI was observed. Similarly, in the results
diet of Arbor Acres chickens at 22–42 days of age, the figure
of Hung and Ngu (2017), the raising of Ac chickens at 1–4
for BWG at the final stage was 2,756, 2,735, and 2,722 g/bird
weeks of age with lysine supplementation at levels of 1.00,
(Tang et al., 2007).
1.05, 1.10, 1.15, and 1.20% and ME 2,900 kcal/kg of feed man-
Apparent CP digestibility in the treatments supplemented
ifested no differences in FI with 99.17, 104.6, 111.9, 104.5, and
with lysine was significantly higher than that in the control as
103.9 g/bird/week, respectively. Furthermore, adding lysine at
apparent AA digestibility was improved. Apparent CP di-
a rate of 11 g/kg to the diet of Cobb chickens at 7–28 days of
gestibility was enhanced with lysine addition because each AA
age resulted in FI of 1,476 g/bird, marginally higher than the
in the diet was better digested. According to Fuller (2004), AA
figure for 10 g/kg diet (1,473 g/bird) (Selle et al., 2007).
is the smallest unit for protein synthesis; thus, the digestion
The treatment Lys+0.3 showed an increase in BWG at
of proteins in the animal body means AA digestion.
16.38 g/bird/day as opposed to 14.9 g/bird/day in the control
The results of CP apparent digestibility in the present
treatment. This was because lysine is the first limiting AA in
study concurs with that of Mountzouris et al. (2010). When ap-
the chicken diet, which is used as the basis for calculating the
parent ileum digestibility was determined by Cr2O3 marker in
remaining AAs in the diet (Mack et al., 1999; Baker et al., 2002).
male Cobb chickens at 29–42 days of age, apparent CP di-
Therefore, with extra lysine, the diet AAs were better balanced,
gestibility was 69% when 10 g lysine/kg was included in the
thereby facilitating chicken absorption. Along with improved
diet. However, this result was lower than those reported by
efficiency of the use of feed in the diet also came better FCR.
Amad et al. (2011) and Jamroz et al. (2003). As for the former,
In particular, the FCR of Noi broilers, when supplemented with
when determining apparent ileum digestibility by Cr2O3 on
0.2% and 0.3% lysine, showed 3.95 and 3.81 g of feed/g of
Cobb 500 male chickens at 21 days of age with a diet contain-
BWG, respectively. This finding was lower than that in the con-
ing lysine 1.43%, apparent CP digestibility was yielded at
trol treatment and the treatment Lys+0.1 with the FCR of 4.22
76.6%. With the diet containing lysine 1.26%, apparent CP di-
and 4.12 g of feed/g of BWG, respectively.
gestibility was 75.3% at 42 days of age. Concerning the study
The results are also consistent with those of Hung and
of Jamroz et al. (2003), as Cr2O3 was used to determine AND
Ngu (2017), who reported that adding 1.1% lysine to the Ac
on Hybro HI-YR chickens with a diet containing lysine at
chicken diet led to higher BWG than did a 1.0% addition (52.4

144
 Nguyen Thi Anh Thu et al. /Journal of Advanced Veterinary Research 11 (3) (2021) 141-146
11.68%, apparent CP digestibility was shown at 82.5%. With a
diet containing lysine at 10.15%, apparent CP digestibility was
at 81.3% at 32 days of age. On the contrary, this result is
higher than the that in the study of Garcia et al. (2007), which
used the Celitmarker to determine apparent ileum digestibility
on 308 male Ross chickens at 22–49 days old with a diet con-
taining 1.22% lysine, whose apparent CP digestibility was
yielded at 60.7%.
Also indicated in this work is that the addition of 0.1–0.3%
lysine did not affect the apparent digestibility of Ca and P. This
probably because the digestibility and absorption of P is in-
fluenced by the source of P in efficient or inefficient form
(Angel et al. 2002) and also by interaction with digestion and
absorption of Ca (Tamim and Angel, 2003). Meanwhile, the di-
gestibility and absorption of Ca depend on its efficiency; for
example, 20–30% was from corn but 60–70% from limestone
(Tamim and Angel, 2003; Tamim et al., 2004). Besides, di-
gestibility and absorption of Ca and P are also influenced by
vitamin D and the parathyroid glands of chickens (Veum,
2010).
Average apparent AA digestibility in the control treatment
(73.96%) was significantly lower than that in the treatments
(79.81, 81.35, 82.49%) with an extra 0.1, 0.2, and 0.3% lysine,
respectively. The addition of lysine limits its deficiency during
biosynthesis, which helps improve AA digestibility. The figure
of apparent AA digestibility in this study agrees with that of
Tao et al. (1971), whose result registered an increase from
78.2% to 80.3% in apparent AA digestibility as determined by
Cr2O3 when adding 0.25% lysine to the diets of male broilers
with BW 1.3–1.8 kg/bird. However, apparent AA digestibility
in this study is lower than the findings of Ravindran et al.
(2005) as the percentage of apparent AA digestibility on male
Cobb chickens with diets from various ingredients was 80% at
42 days of age.
Breast meat is an important element related to carcass
quality. This study showed that the proportion of BM weight
tended to increase significantly with the increasing levels of
lysine in the diet. Research by Lohakare et al. (2005) showed
that AAs in the male Ross chicken diet greatly influenced car-
cass characteristics. Our findings are consistent with those of
Tang et al. (2007) conducted on the Arbor Acres chicken with
three lysine levels (low, medium, and high), which showed that
high levels of lysine in the diet improved BM weight at 56 days
of age. Also, the report of Kidd et al. (1998) indicated that the
BM weight of chickens from 0–50 days old fell with low lysine
content in the diet; the yield of BM decreased considerably
when reducing lysine from 1.05% to 0.85% (Acar et al., 1991).
Conclusion
The addition of lysine to the diet at 0.2–0.3% improved the
BWG and FCR of Noi broilers, and the addition of 0.1–0.3% ly-
sine increased the apparent digestibility of CP and overall AA.
Still, it did not affect the apparent digestibility of Ca and P of
Noi broilers. Moreover, 0.3% lysine added to the diet improved
the breast weight and yield of male and female chickens, the
dressing of male chickens, and the breast yield of the female
chickens increased when supplemented with 0.2% lysine.
Acknowledgement
This research was funded by Tra Vinh University under
grant number 167/HĐ.HĐKH-ĐHTV.
Conflict of interest
The authors declare that they have no conflict of interest.
References
Acar, N., Moran Jr, E.T., Bilgili, S.F., 1991. Live performance and carcass
yield of male broilers from two commercial strain crosses re-
ceiving rations containing lysine below and above the estab-
lished requirement between six and eight weeks of age. Poult.
Sci. 70, 2315-2321.
Amad, A.A., Männer, K., Wendler, K.R., Neumann, K., Zentek, J., 2011.
Effects of a phytogenic feed additive on growth performance
and ileal nutrient digestibility in broiler chickens. Poult. Sci.
90, 2811-2816.
Angel, R., Tamim, N.M., Applegate, T.J., Dhandu, A.S., Ellestad, L.E.,
2002. Phytic acid chemistry: influence on phytin-phosphorus
availability and phytase efficacy. J. Appl. Poult. Res. 11, 471-
480.
AOAC, 2000. Official Methods of Analysis of AOAC International: 17th
ed. AOAC International, USA.
AOAC, 2006. Official Methods of Analysis. 18th ed. Assoc. Off. Anal.
Chem., Gaithersburg, MD.
Araújo, L.F., Junqueira, O.M., Araújo, CS da S., Barbosa, L.C.G.S., Or-
tolan, J.H., Faria, D.E. de, Stringhini, J.H., 2005. Energy and ly-
sine for broilers from 44 to 55 days of age. Braz. J. Poult. Sci.
7, 237-241.
Baker, D.H., 2003. 13 ideal amino acid patterns for broiler chicks.
Amino acids in animal nutrition. 223.
Baker, D.H., Batal, A.B., Parr, T.M., Augspurger, N.R., Parsons, C.M., 2002.
Ideal ratio (relative to lysine) of tryptophan, threonine,
isoleucine, and valine for chicks during the second and third
weeks posthatch. Poult. Sci. 81, 485-494.
Corzo, A., Kidd, M.T., Burnham, D.J., Miller, E.R., Branton, S.L., Gonza-
lez-Esquerra, R., 2005. Dietary amino acid density effects on
growth and carcass of broilers differing in strain cross and sex.
J. Appl. Poult. Res. 14, 1-9.
Van Duy, N., Moula, N., Do Duc, L., Pham Kim, D., Dao Thi, H., Bui Huu,
D., Vu Dinh, T., Farnir, F., 2015. Ho Chicken in Bac Ninh Province
(Vietnam): From an indigenous chicken to local poultry breed.
Int. J. Poult. Sci. 14, 521-528.
Fuller, M.F., 2004. The encyclopedia of farm animal nutrition. Ab-
erdeen: CABI.
Garcia, V., Catala-Gregori, P., Hernandez, F., Megias, M.D., Madrid, J.,
2007. Effect of formic acid and plant extracts on growth, nu-
trient digestibility, intestine mucosa morphology, and meat
yield of broilers. J. Appl. Poult. Res. 16, 555-562.
Hickling, D., Guenter, W., Jackson, M.E., 1990. The effects of dietary
methionine and lysine on broiler chicken performance and
breast meat yield. Can. J. Anim. Sci. 70, 673-678.
Hung, L.T., Ngu, N.T., 2017. Effects of dietary lysine on growth per-
formance, carcass composition and immunological responses
to influenza vaccination in Ac chickens. Int. J. Emerging Tech-
nol. Adv. Eng. 7, 421-426.
Jamroz, D., Orda, J., Kamel, C., Wiliczkiewicz, A., Wertelecki, T., Sko-
rupinska, J., 2003. The influence of phytogenic extracts on per-
formance, nutrient digestibility, carcass characteristics, and
gut microbial status in broiler chickens. J. Anim. Feed Sci. 12,
583-596.
Khoa, D.V.A., Tuoi, N.T.H., Nguyen, N.T., Thuy, N.T.D., Okamoto, S.,
Kawabe, K., Shimogigri, T., 2019. Some quantitative genetic
traits in Vietnamese indigenous Noi chicken from 0 to 28 days
old. Biotechnol. Anim. Husb. 35, 141-151.
Kidd, M.T., Kerr, B.J., Halpin, K.M., McWard, G.W., Quarles, C.L., 1998.
Lysine levels in starter and grower-finisher diets affect broiler
performance and carcass traits. J. Appl. Poult. Res. 7, 351-358.
Lam Thai Hung. 2019. Using efficiency of lysine and metabolizable en-
ergy of H'mong broilers from 0 to 28 days of age. J. Anim.
Husb. Sci. Tech. 249, 69-74.
Lohakare, J.D., Choi, J.Y., Kim, J.K., Yong, J.S., Shim, Y.H., Hahn, T-W.,
Chae, B.J., 2005. Effects of dietary combinations of vitamin A,
E and methionine on growth performance, meat quality and
immunity in commercial broilers. Asian-Australas. J. Anim. Sci.
18, 516-523.
Mack, S., Bercovici, D., De Groote, G., Leclercq, B., Lippens, M., Pack,
M., Schutte, J.B., Van Cauwenberghe, S., 1999. Ideal amino acid
profile and dietary lysine specification for broiler chickens of
20 to 40 days of age. Br. Poult. Sci. 40, 257-265.
Moran, J.E.T., Bilgili, S.F., 1990. Processing losses, carcass quality, and
meat yields of broiler chickens receiving diets marginally de-
145
 Nguyen Thi Anh Thu et al. /Journal of Advanced Veterinary Research 11 (3) (2021) 141-146
ficient to adequate in lysine prior to marketing. Poult. Sci. 69,
702-710.
Mountzouris, K.C., Tsitrsikos, P., Palamidi, I., Arvaniti, A., Mohnl, M.,
Schatzmayr, G., Fegeros, K., 2010. Effects of probiotic inclusion
levels in broiler nutrition on growth performance, nutrient di-
gestibility, plasma immunoglobulins, and cecal microflora
composition. Poult. Sci. 89, 58-67.
Picard, M.L., Uzu, G., Dunnington E.A., Siegel, P.B., 1993. Food intake
adjustments of chicks: short term reactions to deficiencies in
lysine, methionine and tryptophan. Br. Poult. Sci. 34, 737-746.
Ravindran, V., Hew, L.I., Ravindran, G., Bryden, W.L., 2005. Apparent
ileal digestibility of amino acids in dietary ingredients for
broiler chickens. Anim. Sci. 81, 85-97.
Selle, P.H., Ravindran, V., Ravindran, G., Bryden, W.L., 2007. Effects of
dietary lysine and microbial phytase on growth performance
and nutrient utilisation of broiler chickens. Asian-Australas. J.
Anim. Sci. 20, 1100-1107.
Tamim, N.M., Angel, R., 2003. Phytate phosphorus hydrolysis as influ-
146
enced by dietary calcium and micro-mineral source in broiler
diets. J. Agric. Food Chem. 51, 4687-4693.
Tamim, N.M., Angel, R., Christman, M., 2004. Influence of dietary cal-
cium and phytase on phytate phosphorus hydrolysis in broiler
chickens. Poult. Sci. 83, 1358-1367.
Tang, M.Y., Ma, Q.G., Chen, X.D., Ji, C., 2007. Effects of dietary metab-
olizable energy and lysine on carcass characteristics and meat
quality in Arbor Acres broilers. Asian-Australas. J. Anim. Sci.
20, 1865-1873.
Tao, R., Belzile, R.J., Brisson, G.J., 1971. Amino acid digestibility of rape-
seed meal fed to chickens: effects of fat and lysine supple-
mentation. Can. J. Anim. Sci. 51, 705-709.
Veum, T.L., 2010. Phosphorus and calcium nutrition and metabolism.
Phosphorus and calcium utilization and requirements in farm
animals, 94-111.
Vietnam Animal production, 2020. Animal production statistics in Viet-
nam, 01/10/2018.
Journal of Animal Husbandry Sciences and Technics (JAHST)
Editor in-Chief
Dr. DOAN XUAN TRUC
Vice-Editors in-Chief
Assoc. Prof. Dr. NGUYEN DANG VANG
Assoc. Prof. Dr. NGUYEN VAN DUC
Secretary:
Assoc. Prof. Dr. NGUYEN VAN DUC
Editorial members:
Dr. NGUYEN QUOC DAT
Assoc. Prof. Dr. HOANG KIM GIAO
Prof. Dr. NGUYEN DUY HOAN
Prof. Dr. DUONG NGUYEN KHANG
Assoc. Prof. Dr. NGUYEN THI KIM KHANG
Assoc. Prof. Dr. DO VO ANH KHOA
Assoc. Prof. Dr. DO DUC LUC
Prof. Dr. LE DINH PHUNG
Publishing Manager:
MSc. NGUYEN DINH MANH
U Nguyen Thi Thuy. Effects of vitamin and tributyrin supplementation in diet
Permission: Ministry of Information and
Communications of the Socialist
Republic of Vietnam 119/GP-
BTTTT date 26/1/2010
ISSN: 1859 - 476X
Publish: monthly
Office: Floor 4, 73 Hoang Cau, O Cho Dua,
Dong Da, Ha Noi
Telephone: 024.36290621
Fax: 024.38691511
E - mail: tapchichannuoi@hoichannuoi.vn
Website: www.hoichannuoi.vn
Account Name: Hoi Chan nuoi Viet Nam
Account Number: 1300 311 0000 40
Bene bank: Join Stock Commercial Bank
for Foreign Trade of Vietnam
(VietcomBank) - So Giao dich
branch
For VND 0011004132953
For USD 0011372112418
Swift code: 2296620 BFTVVNVX-011
Print 1000 copies, Size 19x27cm at Hoang Quoc
Viet Technology and Science Joint stock company.
Complete and legal copyrighting in August 2021.
Copyright©2020 by AHAV
No. 268 (Aug, 2021)
ANIMAL GENETICS AND BREEDING
Trung Quoc Nguyen, Son Quang Do, Lan Thi Phuong Nguyen and Thinh
Hoang Nguyen. Genetic diversity analysis of six vietnamese indigenous
chicken varieties using mtDNA D-Loop region 2
Pham Doan Lan and Nguyen Van Ba. Genetic polymorphisms of DGAT1 and
CAPN1 genes, candidate genes related to beef quality, in some crossbred
cattle populations in Dak Lak 9
Pham Huynh Thu An, Nguyen Thao Nguyen, Ngo Thi Minh Suong, Tran
Anh Ngoc and Nguyen Thi Kim Khang. Evaluating the carcass yields and
meat quality of noi crossbred chickens 14
Do Duc Luc and Ha Xuan Bo. Using female hybrid pigs between GF337 and
GF24 as a sow for reproduction 20
Nguyen Ba Trung, Le Nu Anh Thu and Pham Thi Kim Phuong. Allele
and genotypic frequencies of genes associated to body conformation in
kazakhstan kushum horses 24
Nguyen Ba Trung and Pham Thi Kim Phuong. Polymorphism in LCORL,
MSTN, and DMRT3 genes associated to body conformation and locomotion
traits in kushum horses 29
Nguyen Khanh Van, Vu Thi Thu Huong, Hoang Thi Au and Pham Doan
Lan. Influence of cryopreservation and developmental stages of embryos on
saanen goat embryos during cold storage in Vietnam 35
ANIMAL FEEDS AND NUTRITION
on growth and feather pecking of Ben Tre noi chicken
Nguyen Thi Thuy. Effects of probiotic supplementation in low CP diet on
40
growth and E.coli in feces of Grimaud duck 45
Tran Duc Hoan, Doan Thi Thao, Nguyen Thi Thu Huyen and Nguyen Thi
Khanh Linh. Effect of probiotic actisaf on growth performance, some large
intestinal bacterium counts and small intestinal morphology in chickens 51
ANIMAL PRODUCTION
Nguyen Thi Thu Hien. Applications of PMSG and hCG in assisted
reproductive technology in animals 57
Luu Huynh Anh, Trinh Thi Hong Mo, Ta Nguyen Dang Quang, Tran Hoang
Diep, Nguyen Hong Xuan and Nguyen Trong Ngu. Comparison of the effects
of two poultry housing types on reproductive performance of tre chicken 64
Ngoc Tan Nguyen and Trong Nhan Kim. Effect of VEGF (Vascular Endothelial
Growth Factor) on the maturation of bovine oocytes derived from small
follicles 69
Ngoc Tan Nguyen and Thi Nhu Binh Thach. Effect of human chorionic
gonadotropin (hCG) on the meiotic resumption of bovine oocyte in vitro 74
Tran Thanh Tuan, Dang Hoang Dao, Le Thuy Binh Phuong and Duong
Nguyen Khang. A survey on goat farming in small scale households of Ho
Chi Minh city, Vietnam 79
Nguyen Ba Trung. Effect of temperature-humidity index on physiological
parameters in imported purebred cows of red angus and red brahman reared
in households of Dong Thap province 83
Ngo Thanh Trung, Tran Thi Chi, Vu Hai Yen, Vu Thi Loan, Ta Thi Hong Quyen
and Su Thanh Long. A study of cryopreservation of phuquoc dog sperms after
separated through bovine serum albumin medium column 91
Pham Van Quyen and Hoang Thi Ngan. The research results about beef cattle
at ruminant research and development center 98
SCIENTIFIC NEWS
Assoc. Prof. Dr. Nguyen Van Duc. Goat production in Vietnam 105
Dr. Nguyen Khanh Van. Successful cloned I pig breed from an ear tissue
somatic cell 109
 ANIMAL PRODUCTION

COMPARISON OF THE EFFECTS OF TWO POULTRY HOUSING

TYPES ON REPRODUCTIVE PERFORMANCE OF TRE CHICKEN
Luu Huynh Anh1, Trinh Thi Hong Mo2, Ta Nguyen Dang Quang1, Tran Hoang Diep3,
Nguyen Hong Xuan4 and Nguyen Trong Ngu1*
Submitted: 08 Nov 2020 - Revised: 27 Nov 2020
Accepted: 30 Dec 2020
ABSTRACT
This study was conducted to evaluate the effects of closed and open-sided houses on the
reproductive performance of Tre chickens at 36-45 weeks of age. The results showed that feed
consumption of chickens between closed and open-sided houses was different (P<0.05), with an
average of 55.5 g/head/day in closed and 50.0 g/head/day in open-sided houses. In addition, the
laying rate of chickens in closed was higher than in open-sided houses (42.5 and 34.6%, respectively).
Egg weight, fertile egg ratio, and the hatchability rate of eggs from closed houses were significantly
higher than those from open-sided houses. A higher culling rate of chickens in the open-sided type
(0.37%) than closed one (0.25%) was also recorded. Overall, Tre layers in the closed houses were
superior in terms of reproductive performance; however, further research on economic efficiency
should be taken before applying this system widely.
Keywords: Closed house, egg production, open-sided houses, Tre chicken.

1. INTRODUCTION1 information on the effectiveness of raising Tre

chickens in closed houses for egg production is
Tre chicken is one of the indigenous breeds
still limited. Therefore, the present study was
in Vietnam with the characteristics of small size,
undertaken to compare the two housing types on
delicious meat, high adaptability to natural
the reproductive performance of laying hens in
conditions, and good resistance to diseases
36-45 weeks old.
(Nguyen Thi Thu Hien and Le Thi Ngoc, 2014).
Traditionally, this chicken breed was raised in 2. MATERIALS AND METHODS
open-sided houses for egg and meat production.
However, with the high demands for product 2.1. Materials
consumption, an intensive system for keeping The study of Tre chicken was carried out
these chickens are currently of interest. In closed for ten weeks with the ages from 36 to 45 weeks
houses, there are ventilation cooling and exhaust old at a chicken farm in Phu Kiet, Tien Giang
fans that allow easy control of temperature province. The implementation period was from
and humidity. This significantly contributes August 2020 to October 2020.
to preventing disease and is convenient for 2.2. Methods
management, care, and mitigating the effects of the
The experiment consisted of two treatments
surrounding environment, thereby improving egg
of open-sided and closed house types to
production. The closed system has been popular
investigate the differences in the reproductive
for other chicken breeds, especially in broilers
and commercial egg-laying hens. Nevertheless, parameters of Tre chickens. The total number
for local ones such as the Tre chicken breed, the of experimental chickens in the closed houses
was 11,896 hens arranged in 8 rows of 100 cages,
1
Can Tho University, Vietnam with an average of 1,487. The open-sided houses
2
Tay Do University, Vietnam contained 10,104 birds with three houses, and
3
Tien Giang University, Vietnam the number of chickens in each place being 4,487;
4
Can Tho University of Technology, Vietnam
3,069 and 2,548, respectively. The rearing density
*
Corresponding Author: Assoc. Prof. Nguyen Trong Ngu,
College of Agriculture, Can Tho University, Vietnam; Phone: for both types was 16 chickens/cage (ratio of 1
+0084.989828295; Email: ntngu@ctu.edu.vn male/7 females).

64 JAHST No. 268 (Aug, 2021)

ANIMAL PRODUCTION

2.3. Collected parameters affects the health, behavior, and reproduction of

- Temperature inside the chicken houses. chickens. The extreme high or low temperatures
can be detrimental to the growth, development,
- Feed consumption during ten laying
and reproductive capacity of chickens because
weeks.
they can cause stress and negative effects
- Indicators of reproductive performance: on health and reduce efficiency in poultry
egg production, egg weight, fertile egg ratio, (Aengwanich and Simaraks, 2004). The changes
hatchability rate, and culling rate. in the temperature inside the house should
2.4. Statistical analysis be considered a priority when designing the
The data were processed using Microsoft poultry houses. It is optimal for the chicken
Excel 2016, and the analysis of variance was health and yields in terms of egg quantity and
done by General Linear Model (GLM) procedure quality, feed conversion ratio, body weight gain,
of Minitab software version 16.0. and mortality rate.
3.2. Effect of poultry houses on feed
3. RESULTS AND DISCUSSIONS
consumption
3.1. The temperature of the two open-sided and Table 2. Feed consumption (g/bird/day) in houses
closed houses
Layer age Types of house
It is shown in Table 1 that most of the time, (week) SEM P
Closed Open-sided
the temperature of the closed poultry houses
36 58.0 51.3 1.04 0.001
was consistently lower and more stable than
37 57.1 49.9 0.81 0.001
that of the open-sided poultry houses (P<0.05).
38 57.0 51.4 0.72 0.001
Specifically, at 8 a.m, the temperature in closed
39 55.2 49.5 2.05 0.070
houses ranged from 26.0oC to 26.7oC, while in
40 48.8 49.7 1.09 0.584
open-sided houses, the temperature was higher
41 51.7 49.9 1.08 0.264
and fluctuated in the range from 28.0-28.4oC. At
42 53.2 50.0 0.31 0.001
2 p.m, the temperature in both types increased,
43 51.0 50.2 0.39 0.196
with open-sided poultry houses registering a
44 61.5 49.3 1.97 0.001
higher temperature rise (31.8-33.3oC), while the
45 61.7 48.6 0.91 0.001
temperature of the closed poultry houses was
around 26.7-27.6oC. 36-45 55.6 50.0 1.02 0.003
Table 2 shows a significant difference
Table 1. Average temperature (oC) in 2 houses
(P<0.05) in feed consumption of Tre chickens
Layer Types of house between closed and open-sided houses with
Time age Open- SEM P an average consumption of 55.51 g/head/
(week) Closed sided day and 49.97 g/head/day in closed and open-
36-38 26.50 28.10 0.12 0.001 sided houses, respectively. According to
39-42 26.70 28.40 0.29 0.007 Hameed et al. (2012), there is a difference in the
8a.m
43-45 26.00 28.00 0.11 0.001 microclimate environment between closed and
36-45 26.40 28.16 0.07 0.001 open-sided houses. In the closed house system,
36-38 27.20 33.00 0.33 0.001 the microclimate is adjusted when necessary,
39-42 27.60 33.30 0.56 0.001 while the open-sided house climate depends
2p.m
43-45 26.70 31.80 0.44 0.001 on the natural conditions of the surrounding
36-45 27.23 32.77 0.19 0.001 environment. In industrial broiler or layer
Climate plays a vital role in affecting poultry production, the control of proper farming
health. Climatic factors include temperature, conditions can help maximize the potential of
relative humidity, air composition, air velocity, chicken breeds. Oloyo (2018) suggested that the
movement, and light (Olanrewaju et al., 2006; temperature above 26.7°C in the house, combined
Mendes et al., 2013; Holik, 2015 ). Temperature is with the high relative humidity, adversely
the most important environmental factor which affected the efficiency of feed consumption,

JAHST No. 268 (Aug, 2021) 65

 ANIMAL PRODUCTION

feathers, pigmentation, and weight gain of the higher than that of the closed houses, leading to
chickens. Furthermore, at the temperature range lower feed consumption and chicken laying rate.
of 35-37.8°C, the yield of chickens was inferior 3.3.2. Egg weight
regardless of changes in relative humidity.
Egg weight is one of the essential criteria to
Sterling et al. (2003) concluded that environment
evaluate egg quality, which affects hatchability.
temperature was highly correlated with several
The hatchability rate is highest when the egg
yield indicators, including feed and water intake,
weight is around the average of each breed. The
body weight, egg production, feed conversion,
and egg weight. farther it is from the average weight, the lower the
hatchability rate is (Bui Huu Doan et al., 2011).
3.3. Effect of poultry house on reproductive
performance Table 4. Egg weight (g) of Tre chickens in houses
3.3.1. Egg-laying rate Layer age Types of house
(week) SEM P
Closed Open-sided
Table 3. Egg-laying rate (%) of layers in 2 houses
36 37.6 36.5 0.78 0.362
Layer age Types of house 37 37.7 36.2 0.53 0.115
(week) SEM P
Closed Open-sided 38 37.6 36.8 0.33 0.176
36 46.9 36.8 0.49 0.001 39 37.7 36.3 0.49 0.103
37 47.5 38.5 0.64 0.001 40 37.8 36.2 0.35 0.033
38 46.4 37.3 0.54 0.001 41 37.9 36.5 0.79 0.268
39 46.5 36.1 1.05 0.001 42 37.7 36.6 0.58 0.278
40 45.3 33.0 0.66 0.001 43 38.3 35.3 0.54 0.018
41 39.4 33.5 0.57 0.001 44 38.0 36.5 0.40 0.057
42 40.0 33.8 0.55 0.001 45 38.5 37.3 0.36 0.083
43 38.2 34.5 0.53 0.001 36-45 37.9 36.4 0.16 0.001
44 36.9 32.3 1.04 0.010 The results in Table 4 show that house
45 37.5 30.2 1.02 0.001 type had a significant effect (P<0.05) on the egg
36-45 42.5 34.6 0.62 0.001 weight. Specifically, the average egg weight over
The egg-laying rate is an evaluation ten weeks in the closed cage was 1.5g higher
criterion of laying eggs on all poultry flocks than that of the open-sided pen (37.9 and 36.4g,
from purebred breeds, grandparent breeds, respectively). The difference was probably due
parent breeds to commercial breed flocks (Bui to the influence of chicken feed consumption and
Huu Doan et al., 2011). The laying rate was heat stress in the house. According to Samara
relatively low and unstable in the open-sided et al. (1996), high temperature significantly
houses, ranging from 30.15-38.46% to 36.87- reduces eggshell weight, density, and thickness.
47.51% in closed houses (Table 3). This result An increase in egg breakage and a decrease
is similar to Balnave (1998) reported that high in eggshell thickness due to heat stress were
temperature affects the performance of laying reported in the previous study. Additionally,
hens due to the reduction of feed consumption. Ebeid et al. (2012) concluded that heat stress
According to Smith and Oliver (1972), lower egg reduced egg weight (3.24%), eggshell thickness
production and poor eggshell quality are caused (1.2%), eggshell weight (9.93%), and eggshell
by low feed consumption and high temperature. (0.66%). According to Webster and Czarick
When temperature ranged from 21-38°C, egg
(2000), should there be a temperature change,
production and egg weight decreased by 40-
the chicken will consume less or more of the
50% at 38°C. The study of Oloyo (2018) also
required amount of nutrients; as a result, the egg
demonstrated that the house temperature
size will vary greatly.
affects the reproductive performance of Leghorn
chickens, but there is no significant difference in 3.3.3. Fertile egg rate
the surveyed temperatures. In the current study, In chicken farming, acute heat stress occurs
the temperature of the open-sided houses is when chickens deal with sudden changes in

66 JAHST No. 268 (Aug, 2021)

ANIMAL PRODUCTION
temperature in a short period, while chronic heat
stress happens over an extended period. Chronic
stress results in deleterious effects on poultry,
such as their growth, production efficiency, egg
Table 5. The ratio of fertile eggs in different types of houses
Number of Number of fertile eggs after
Week hatching eggs 9 days of incubation
old
Closed Open-sided Closed Open-sided
36-40 1,733 1,081 1,593
41-45 1,549 1,096 1,378
36-45 1,641 1,089 1,486
Table 5 shows that the type of house affects
the proportion of fertile eggs (P<0.05) because
heat directly influences the amount of feed and
egg weight, hence the effect of house type on
the rate of a fertile egg. Over the whole period,
the percentage of fertile eggs in closed houses
(90.4%) was higher than in open-sided houses
(87.6%). Practically, the fertilization rate depends
on the ratio of males and females, the nutritional
density, and the resistance of the breed (Nguyen
Van Thien, 1996).
3.3.4. Hatchability rate
Figure 1 shows that the egg hatchability
rate obtained from closed and open-sided
houses was significantly different (P<0.05). Over
the whole period, the average hatchability rate
from hens in closed houses was 6.6% higher
than that in open-sided houses (82.2 and 75.6%,
respectively).
Figure 1. Hatching rate of chicken eggs in two
types of houses
The high hatchability rate has great
economic significance. If the hatchability results
are low, the culling rate in the later nurturing
period will be increased, and the breed quality
JAHST No. 268 (Aug, 2021)
quality, meat quality, embryonic development,
reproductive performance, immunity, and
infected rate in broilers and laying hens (Dai et
al., 2012; Bhadauria et al., 2013).
Ratio of fertile egg
(%) SEM P
Closed Open-sided
970 91.90 89.7 0.01 0.228
935 89.00 85.40 0.01 0.045
925 90.40 87.60 0.01 0.049
is not guaranteed (Nguyen Thi Mai, 2009).
Contrary to the present results, when studying
the ISA Brown chicken breed, Damaziak et al.
(2021) did not find any differences in hatchability
rate between the two types of houses.
3.4. Culling rate
Figure 2 shows that, the culling rate in open-
sided houses was always higher in most monitoring
weeks than in closed houses (P<0.05). At the first
period (36-40 weeks), the average culling rates
of closed and open-sided houses were 0.25 and
0.43%, respectively. In weeks 41-45, these values
were 0.24% for closed and 0.52% for open-sided
houses. Over ten weeks, the average culling rate of
Tre chickens in closed houses was 2.45% compared
to 3.69% in open-sided houses. Causes of the loss
were the poor quality of chicken, such as sickness
and sick chickens that have been treated for a long
time without recovering. This is also supported by
similar findings of Atapattu et al. (2017). However,
in ISA brown chickens, Damaziak et al. (2021)
showed no difference in mortality between the two
types of closed and open houses.
Figure 2. The culling rate of laying hens in two
types of houses
67

4. CONCLUSIONS
During 36-45 weeks of age, Tre laying
hens kept in closed houses were superior in
all reproductive performance indicators. These
results propose an opportunity for Tre’s eggs
production under the intensive system in
closed houses. However, further studies are
recommended for evaluating the economic
efficiency before widespread application.
ACKNOWLEDGMENTS
This study is funded in part by the Can Tho
University Improvement Project VN14-P6 supported
by a Japanese ODA loan.
REFERENCES
1. Aengwanich W. and S. Simaraks (2004). Pathology of
heart, lung, liver and kidney in broilers under chronic
heat stress. Songklanakarin J. Sci. Technol., 26: 417-24.
2. Atapattu N.S.B.M., L.M. Abeywickrama, W.W.D.A.
Gunawardane and M. Munasinghe (2017). A
comparison of production and economic performances
of broilers raised under naturally ventilated open-
house and tunnel ventilated closed-house systems in
Sri Lanka. Tro. Agr. Res. Ext., 20(3-4): 76.
3. Balnave D. (1998). High-temperature nutrition of
laying hens. Proceedings of Australian Poult. Sci.
Symposium: 34-41.
4. Bhadauria P., J.M. Kataria, S. Majumdar, S.K. Bhanja
and G. Kolluri (2013). Impact of hot climate on poultry
production system—A review. J. Poult. Sci. Technol., 2:
56-63.
5. Dai S.F., F. Gao, X.L. Xu, W.H. Zhang, S.X. Song
and G.H. Zhou (2012). Effects of dietary glutamine
and gammaaminobutyric acid on meat colour, pH,
composition, and water- holding characteristic in
broilers under cyclic heat stress. British Poult. Sci.,
53(4): 471-81.
6. Damaziak K., M. Musielak, C. Musielak, J. Riedel and
D. Gozdowski (2021). Reproductive performance and
quality of offsprings of parent stock of layer hens after
rearing in open and closed aviary system. Poult. Sci.,
100(2): 1120-31.
7. Bui Huu Doan, Nguyen Thi Mai, Nguyen Thanh Son
and Nguyen Huy Dat (2011). Indicators used in poultry
research. Ha Noi Agricultural Publishing Houses, Pp
64-68.
8. Ebeid T.A., T. Suzuki and T. Sugiyama (2012). High
temperature influences eggshell quality and calbindin-
68
ANIMAL PRODUCTION
D28k localization of eggshell gland and all intestinal
segments of laying hens. Poult. Sci., 91: 2282-87.
9. Hameed T., M.A. Bajwa, F. Abbas, A.W. Sahota,
M.M. Tariq, S.H. Khan and F.A. Bokhari (2012). Effect
of housing system on production performances of
different broiler breeder strains. Pakistan J. Zool., 44(6):
1683-87.
10. Nguyen Thi Thu Hien and Le Thi Ngoc (2014). Growth
characteristics of mon-che chicken and conditions of
backyard breeding in Ben Cat district, Binh Duong
province. Thu Dau Mot University J., 18(5): 40-47.
11. Holik V. (2015). Management of laying hens under
tropical conditions begins during the rearing period.
Lohmann Information, 50: 16-23.
12. Nguyen Thi Mai (2009). Poultry raising textbook.
Agricultural Publishing House.
13. Mendes A.S., S.J. Paixão, R. Restelatto, G.M. Morello,
D.J. de Moura and J.C. Possenti (2013). Performance
and preference of broiler chickens exposed to different
light sources. J. App. Poult. Res., 22: 62-70.
14. Pham Tan Nha (2018). Effect of the cage position
on growth rate of Luong Phuong chickens. Can Tho
University J. Sci., 54 (7B): 1-5.
15. Olanrewaju H.A., J.P. Thaxton, W.A. Dozier, J.
Purswell, W.B. Roush and S.L. Branton (2006). A
review of lighting programs for broiler production. Int.
J. Poult. Sci., 5: 301-08.
16. Oloyo A. (2018). The use of housing system in the
management of heat stress in poultry production in hot
and humid climate: A review. Poult. Sci. J., 6(1): 1-9.
17. Samara M.H., K.P. Robbins and M.D. Smith (1996)
Interaction of feeding time and temperature and their
relationship to performance of the broiler breeder hen.
Poult. Sci., 75: 34-41.
18. Smith A.J. and J. Oliver (1972). Some nutritional
problems associated with egg production at
high environmental temperatures. I. the effect of
environmental temperature and rationing treatments
in the productivity of pullets fed on diets of different
energy content. Rhodesian J. Agr. Res., 10: 3-20.
19. Sterling K.G., D.D. Bell, G.M. Pesti and S.E. Aggrey
(2003). Relationships among strain, performance and
environmental temperature in commercial laying hens.
J. Appl. Poul. Res., 12: 85-91.
20. Nguyen Van Thien (1996). Quantitative genetics
applied in animal husbandry. Hanoi Agricultural
Publishing House.
21. Webster A.B. and M. Czarick (2000). Temperatures
and performance in a tunnel-ventilated, high-rise layer
house. J. App. Poult. Res., 9: 118-29.
JAHST No. 268 (Aug, 2021)
 Journal of Animal Health and Production

Research Article

Effects of Substituting Taro (Colocasia esculenta) Wastes Silage in Di-

ets on Growth and Nutrient Digestibility In Pigs
Ly Thi Thu Lan1, Lam Thai Hung1, Nguyen Thi Anh Thu1, Huynh Tan Loc2, Juan Boo Liang3,
Nguyen Thiet2, Nguyen Trong Ngu2*
1
Tra Vinh University Vietnam; 2Can Tho University,Vietnam; 3Putra University, Malaysia.

Abstract | Two experiments were conducted to identify the optimal ensiling conditions of taro petiole and leaf (TPL)
mixture and the effects of replacing commercial concentrate with TPL-waste silage on production parameters and nu-
trient digestibility in pigs. Experiment 1 was conducted with a completely randomized design consisting of five treat-
ments and four replicates with different proportions of TPL mixture and taro peel ensiled over 60 days. Experiment 2
involved 12 castrated male Duroc x (Landrace x Yorkshire) pigs of 35 kg being allocated into a completely randomized
block design with three diets: 100% concentrate (Control) and concentrate replaced by 10% (S10) and 20% (S20) of
TPL silage. In Experiment 1, the pH of treatments declined rapidly from day 1-30 but remained stable thereafter.
Dry matter (DM), crude protein (CP), and calcium oxalate (CO) contents of the silages dropped sharply up to day 30
with no significant changes thereafter - except for CO, which continued to fall to below 1% for the treatment of 50%
TPL (TPL50) and those with lower TPL by day 60. The TPL50 for 60 days duration was selected to prepare the TPL
silage for Experiment 2. No significant differences were found among the three treatments in feed intake, body weight
gain, and nutrient digestibility. Similarly, there were no differences in DM, organic matter, CP digestibility, and feed
conversion ratio among treatments. The ratio of TPL mixture at 50% is favorable for ensiling. Concentrate diets can
be replaced with up to 20% taro-waste silage without negative impacts on pig performance and apparent digestibility.

Keywords | Colocasia esculenta, Performance, Petioles and Leaves, Pig, Silage

Received | July 15, 2020; Accepted | August 05, 2020; Published | February 17, 2021
*Correspondence | Nguyen Trong Ngu, Can Tho University,Vietnam; Email: ntngu@ctu.edu.vn
Citation | Lan LTT, Hung LT, Thu NTA, Loc HT, Liang JB, Thiet N, Ngu NT (2021). Effects of substituting taro (colocasia esculenta) wastes silage in diets on
growth and nutrient digestibility in pigs. J. Anim. Health Prod. 9(2): 112-118.
DOI | http://dx.doi.org/10.17582/journal.jahp/2021/9.2.112.118
ISSN | 2308-2801

Copyright © 2021 Ngu et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distri-
bution, and reproduction in any medium, provided the original work is properly cited.

INTRODUCTION
Taro (Colocasia esculenta) is widely cultivated in Dong

P ork production has increased rapidly in recent years in

Vietnam, is now the largest meat industry, and plays
an important role in meeting the increasing demands for
meat in the country. Since feed costs make up approxi-
mately 70% of the total production cost in commercial
pig farming, more and more investigations are being con-
ducted to find ways to cut production costs and increase
productivity (Caicedo et al., 2018a). Various improved
formulations of feed concentrates aimed to achieve eco-
nomic and sustainable growth in the pig industry are being
implemented because of the increasing demand and price
of traditional feed ingredients such as maize, cereals and
soybeans (Caicedo et al., 2017).
June 2021 | Volume 9 | Issue 2 | Page 112
Thap province in the Mekong Delta region of Vietnam.
The main product of taro cultivation is its tubers used as
human food because it contains high contents of protein
and starch (11% and 85-87%, respectively) (Temesgen and
Retta, 2015). The by-products of taro cultivation are leaves,
petioles, and peel (a waste discarded from taro planting by
farmers and taro processing factories). The above by-prod-
ucts are good energy sources for livestock, and with the
appropriate preservation practices, these by-products could
be beneficial to the livestock farming community and re-
lieve the pressure of competition for food between humans
and animals (Mwesigwa et al., 2013).
NE
Academic
US
Publishers

The foliage of taro consisting of petioles and leaves (TPL)
has been used as a feed ingredient, mainly for pigs, because
taro leaves are rich in protein and the petioles being rich in
soluble carbohydrates (Hang et al., 2017). However, calci-
um oxalate (CO) content in the taro petiole is high (Hang
et al., 2017) which may adversely affect the digestion pro-
cess. It has been reported that ensiling, cooking or drying
can lower the oxalate content (Apata and Babalola, 2012).
Taro waste silage, with a combination of other by-prod-
ucts such as banana pseudo-stem, broken rice, and soybean
meal has been successfully used to produce high quality
feed (Sivilai et al., 2016). The objectives of this study were
(i) to evaluate the optimal proportions of TPL mixture
with taro peels for silage making and (ii) to test the effect
of substituting commercial concentrate with TPL silage in
diets on performance and nutrient digestibility in pigs.
MATERIALS AND METHODS
Journal of Animal Health and Production
0.5% salt.
Water was added to the mixtures to achieve around 70%
moisture and the materials were compacted and incubated
in airtight plastic bags of approximately 60 liters in vol-
ume with a total weight of 20 kg for each. The bags were
checked regularly to ensure they were properly secured and
if found to be loose, the bags were opened, re-compact and
re-tied.
Samples were collected from day 1, 30, and 60 after ensil-
ing. Approximately one kg of sample was randomly col-
lected from two bags of each replicate. The collected sam-
ples were individually assessed for their colour and aroma
and stored for later analysis for dry matter (DM), crude
protein (CP), lactic acid, and acetic acid using the methods
of Horwitz (2005), and CO content following the meth-
ods of Savage et al. (2000).

This study consisted of two experiments; the first was to Experiment 2: Animal and dietary treatments
evaluate the optimal proportions of TPL and taro peel to The experiment was carried out at a pig farm in Dong
produce good quality silage which was then used in the Thap province, Vietnam. The animals were cared accord-
second experiment to evaluate the efficacy of substituting ing to the guidelines of the Sub-Department of Animal
Husbandry, Animal Health and Fisheries of Dong Thap
the traditional concentrate diet with different levels of taro
by-products silage on animal performance and nutrient di- province and the approval of Tra Vinh University. A to-
gestibility in pigs. tal of 12 castrated male Duroc x (Landrace x Yorkshire)
grower pigs (35.0±7.8 kg BW) were randomly allocated
Experiment 1: Preparation of materials and to three dietary groups in a completely randomised block
silage making design experiment with four replicates per treatment. The
The TPL was collected from taro growers and the peel taro silage was ensiled following the TPL50 treatment from
from small taro processing factories around Dong Thap experiment 1, and it was used to replace the commercial
province in Vietnam. The materials were brought to Can concentrate diets as followed:
Tho University and processed for the study. In this study, Treatment 1 (Con): 100% concentrate,
TPL consists of 95% petioles and 5% leaves (DM basis) Treatment 2 (S10): 90% concentrate and 10% silage, and
which was used to make silage. The TPL together with the Treatment 3 (S20): 80% concentrate and 20% silage.
taro peels were then chopped to approximately 3 and 5 cm Three concentrates, namely starter, grower and finisher di-
and later dried under sunlight until the dry matter content ets, purchased from a commercial company were used dur-
reached 30% before making the silage. ing the different periods (1-30, 31-60, and 61-90 days) of
the experiment (Table 1).
The silage experiment was conducted using a completely
randomised design which consisted of five treatments with Table 1: Nutritional value of concentrates used in the three
four replicates per treatment. The treatments consisted of feeding phases
the control which contained 96.5% TPL with no taro peel Nutritional value Concentrate in the experiment
and four treatments which replaced TPL with increasing Con_1* Con_2* Con_3*
level of taro peel as follows: Dry matter (%) 86 86 86
Treatment 1 (TPL96): 96.5% TPL + 3% rice bran + 0.5% Crude protein (%) 18 16 14
salt (Control)
ME (kcal/kg of feed) 3,100 3,000 3,000
Treatment 2 (TPL75): 75% TPL + 24.5% taro peel + 0.5%
salt Crude fibre (%) 6 8 8
Treatment 3 (TPL50): 49.5% TPL + 50% taro peel + 0.5% Lysine (%) 1 0.9 0.8
salt Methionine + cysteine (%) 0.6 0.54 0.48
Treatment 4 (TPL25): 24.5% TPL + 75% taro peel + 0.5% Calcium (%) 0.8 0.8 0.8
salt Phosphorus (%) 0.6 0.6 0.6
Treatment 5 (TPL0): 96.5% taro peel + 3% rice bran + *Con_1 = day 1-30; Con_2 = day 31-60; Con_3 = day 61-90

June 2021 | Volume 9 | Issue 2 | Page 113 NE

Academic
US
Publishers
 Journal of Animal Health and Production
The ratio of concentrate and taro silage was calculated end of the experiment (day 60), no mould was observed in
based on a DM basis which was thoroughly mixed before the silage.
been offered to the pigs. The pigs were fed ad libitum twice
a day at 07:00 and 15:00 and the daily feed consumption Table 2: Chemical composition (%/DM) of taro by-
was calculated by the difference between the amount of- products
fered and the residue before new feed was offered the next Taro by-product DM Ash OM CP CO
morning. The pigs were individually kept in cages (4.2x3.4 Petiole and leaf 9.33 16.49 83.51 13.71 5.79
m), and clean drinking water was made available at all
Peel 10.33 9.42 90.58 9.81 2.97
times throughout the 90 day experiment. The pigs were DM: dry matter, OM: organic matter, CP: crude protein, and
vaccinated against swine fever and porcine reproductive CO: calcium oxalate
and respiratory syndrome prior to the start of the exper-
iment. Changes of DM, pH, lactic acid, acetic acid, CP, and CO
in the taro silage during the 3 sampling times (day 1, 30,
The pigs were weighed on day 1, 30, 60, and 90 during the and 60) are presented in Figure 1. The results indicated
experiment to determine body weight gain (BWG). At the drastic changes in the parameters measured. Dry matter
same time, DM intake and feed conversion ratio (FCR, kg content of all treatments reduced (P<0.05) over time with
DM/kg BWG) for each of the above periods were deter- the TPL having the highest DM (47.49% on day 1 and
mined. 96
38.45% on day 60) while TPL0 had the lowest DM con-
tent (30.04% on day 1 and 22.87% on day 60). The pH of
Apparent nutrient digestibility (AND) for the different the silage among the treatments declined rapidly (P<0.05)
treatments was carried out during the last 7 days of each from day 1 (averaged 3.99) to day 30 (averaged 3.12) and
measuring period of the experiment following the method began to stabilise thereafter (averaged 2.86 on day 60). The
of McDonald et al. (2002). All experimental pigs were kept decline in pH was reflected by a rapid increase in the lactic
in their respective individual cages with a concrete floor. acid content among all the treatments initially (day 1 to
Total faeces from individual pigs were collected twice a day, 30) but later slowed down slightly. Similarly, acetic acid
weighed, and mixed with 15 mL of 10% Sulphuric acid to content also increased over time but the values were ap-
inhibit further microbial growth and reduce the loss of am- proximately half of those of the lactic acid. Calcium oxalate
monia, and all faecal samples were immediately stored at content of the silage can be seen to drop dramatically over
-20°C. At the end of 7 days, the frozen faecal samples were time with TPL , TPL , and TPL recorded being the
thawed and then pooled by animal to give 12 samples and lowest (less than0 1%) among 25 50
the treatments while treat-
stored at -20°C pending for analysis. Feed, feed residue, ments with 75% and 96% TPL remained higher than 1%
and faecal samples were analysed for DM, organic matter (averaged 1.78%). Based on the reduction of CO content
(OM), and CP following the method of Horwitz (2005). to less than 1% on day 60, and the stability of CP content
from day 30 onward, TPL50 which was made up by equal
Statistical analysis proportion (1:1) of TPL and peel was selected to prepare
All data processing was based on the General Linear Mod- silage for the follow up feeding trial (experiment 2).
el and performed by Minitab statistical software (Release
16.1 Minitab Inc., State College, PA)(2010). Significant Experiment 2: Effects of supplementing ensiled
differences in mean values were conducted by Tukey test,
taro by-products on performance and feed
with alpha < 0.05.
digestibility in pigs
The effects of replacing commercial concentrate with 10
RESULTS and 20% taro-waste silage on feed intake (FI), growth,
and FCR in pigs are shown in Table 3. The results showed
Experiment 1: Effects of proportions of TPL to that replacing 10% and 20% of the commercial concen-
peel on chemical composition and fermentation trate with taro-waste silage had no effect (P>0.05) on FI,
characteristics of silage growth, and FCR in pigs within the three periods and the
The chemical composition of the fresh taro by-products overall feeding. Although daily BWG of pigs in the S10
used for this study is presented in Table 2. It shows that and S20 were lower (P<0.05) compared to the control diet
TPL had higher CP (13.71% vs. 9.81%) and CO (5.79% during the starter period (day 1-30), this negative effect on
vs. 2.97%) compared to taro peel. On the third day of incu- BWG was temporary and not observed in the latter two
bation, ensiled materials in all treatments appeared green- stages (day 60, day 90) as well as the overall study. Simi-
ish in colour and were accompanied by a slight aroma and larly, there was a slight increase in FCR (poorer) in the S10
by day 30, the colour turned dark brown for all the treat- and S20 treatments as compared to the control diet but they
ments, with no further change in colour thereafter. At the were not significantly different during the three and overall
June 2021 | Volume 9 | Issue 2 | Page 114 NE
Academic
US
Publishers
 Journal of Animal Health and Production
Table 3: Effects of substituting concentrate with 10% (S10) and 20% (S20) taro silage in diets on DM intake, BWG, and
FCR in pigs
Parameter Treatment SEM P
Control S10 S20
DM intake (kg/pig)
Day 1-30 (kg) 1.223 1.122 1.133 0.034 0.185
Day 31-60 (kg) 1.730 1.704 1.657 0.042 0.645
Day 61-90 (kg) 1.827 1.967 1.902 0.056 0.665
Day 1-90 (kg) 1.593 1.598 1.564 0.044 0.711
Initial BW (kg) 34.25 35.13 35.73 1.68 0.83
Final BW (kg) 91.23 88.38 86.28 2.94 0.53
Daily BW gain
Day 1-30 (kg) 0.46a 0.398b 0.374b 0.015 0.019
Day 31-60 (kg) 0.715 0.658 0.635 0.036 0.27
Day 61-90 (kg) 0.725 0.718 0.677 0.042 0.69
Day 1-90 (kg) 0.669 0.626 0.594 0.023 0.15
FCR (kg DM/kg BWG)
Day 1-30 2.66 2.82 3.03 0.135 0.29
Day 31-60 2.42 2.59 2.61 0.16 0.595
Day 61-90 2.52 2.74 2.81 0.10 0.175
Day 1-90 2.53 27.2 2.82 0.131 0.353
a, b
: means with different letters in the same row are significantly different (P<0.05)

Table 4: Effects of replacing of taro silage on apparent nutrient digestibility of pigs

Treatment SEM P
Parameter Control S10 S20
Daily DM intake (kg) 1.450 1.713 1.736 0.109 0.21
Daily OM intake (kg) 1.399 1.659 1.685 0.094 0.27
Daily CP intake (kg) 0.303 0.353 0.351 0.022 0.29
DM digestibility (%) 82.10 82.53 81.85 0.99 0.89
OM digestibility (%) 82.55 82.78 82.05 1.02 0.88
CP digestibility (%) 69.10 70.07 67.81 2.37 0.80
DM: dry matter, OM: organic matter, CP: crude protein

periods. can induce burning and irritation to the digestive tract of

It was also indicated that replacing commercial diets with
10 and 20% taro-waste silage did not negatively affect
(P>0.05) DM and nutrient digestibility and as a result di-
gestible DM and nutrient intake in pigs (Table 4).
DISCUSSION
Experiment 1: Chemical composition
fermentation characteristics of silage
Taro by-product is a nutritious vegetative feed resource
with high mineral (16.49% in taro leaf stem mixture), and
CP content (13.71%), but it also contains high levels of
CO (5.79%). The latter has shown to cause a negative im-
pact on calcium absorption (Blaney et al., 1982) and also
June 2021 | Volume 9 | Issue 2 | Page 115
animals (Franceschi and Horner, 1980). Albihn and Sav-
age (2001) reported that the absorbed soluble oxalate into
the body must be eliminated because it has no metabol-
ic use, while insoluble oxalate is excreted in faeces. Taro
peel contains high mineral content (9.42% vs. 16.49%), but
lower CO (2.97% vs. 5.79%) contents as compared to the
TPL. Thus using a mixture of TPL and taro peel enhanced
the mineral content and reduced the oxalate content of the
and silage mixture. In addition, the CO content could be fur-
ther reduced when ensiled, which provided a good silage
that allowed for better nutrient absorption via improved
digestibility (Sivilai et al., 2016).
In the present study, a significant reduction in DM content
over time especially during the initial phase of ensiling
NE
Academic
US
Publishers

Figure 1: Changes of DM (a), pH (b), lactic acid (c), acetic
acid (d), crude protein (e), and calcium oxalate (f ) of taro
silage of different treatments during ensiling
a, b, c
: means with different letters in different collecting days
are significantly different (P<0.05)
process was noted as a result of the rapid growth of mi-
croorganisms and the respiration of the plant materials
that consumed large amounts of oxygen, breaking carbo-
hydrates into carbon dioxide and water. The above process
resulted in an anaerobic environment in the system. In the
next phase of the ensiling process, lactic bacteria (which
only acted under the anaerobic environment provided)
converted soluble carbohydrates into organic acids, carbon
dioxide, water, and hydrogen sulphide, resulting in a grad-
ual reduction of DM. The reduction in DM observed in
this study agreed with the above process which was also
reported previously (Malavanh et al., 2008) that DM of
taro leaves declined when ensiled with sugar cane molasses
and (An and Lindberg, 2004) that there was a decrease in
DM when ensiling sweet potato leaves (SPL) with cassava
root meal, SPL with sweet potato root meal, and SPL with
sugar cane molasses. According to Muck (2010), a success-
ful fermentation will see the number of lactic acid produc-
ing bacteria dominate under the anaerobic conditions in
agreement with the increased lactic acid over time in all the
treatments in the present study. The increased lactic acid
content over time had led to a decreased pH. This, in addi-
tion to the activity of lactic bacteria, may also involve other
microorganisms such as probiotics and fungi that activated
changes in soluble carbohydrates to lactic acid, acetic acid,
and other organic acids capable of inhibiting harmful bac-
teria and enzymes (Russell and Diez-Gonzalez, 1997).
June 2021 | Volume 9 | Issue 2 | Page 116
Journal of Animal Health and Production
Production of glycolate oxidase enzymes was inhibited
by the anaerobic ensiled environment due to the loss of
oxygen (Rooke and Hatfield, 2003) which resulted in the
synthesis of CO being inhibited and the decomposition of
CO. The concentration of CO also affected the availability
of dietary calcium because of the need to excrete soluble
oxalate salts (Hang et al., 2011). The reduction of CO con-
tent in the taro-waste silage is clearly shown in this study
indicating that the ensiled taro waste silage is a safer feed
than if it is used fresh. Although the concentration of CO
in the TPL96 treatment declined about 4-fold (from 8.97%
to 2.42% on day 30 and 2.32% on day 60) the CO content
after 60 ds ensiling still remained the highest among the
treatments. This could be due to the higher CO content in
the initial TPL materials. On the other hand, the concen-
tration of CO of TPL50 treatment declined about 9-fold
from 7.21 to 0.84% over the 60 day fermentation to lower
than 1%, making it a safer feed for animals such as pigs.
The reduction of CO in ensiled TPL was reported to be
due to the increased organic acid content (Hang and Pres-
ton, 2010). A reduction of oxalate in ensiled taro leaves
was also reported previously (Malavanh et al., 2008; Hang
et al., 2016; Hang and Savage, 2018). Hang et al. (2016)
suggested that the stage of ensiling was optimal when the
oxalate content no longer changed. Following this criteria
treatment TPL50 ensiled for 60 day was selected to produce
taro waste silage for experiment 2.
Experiment 2: Animal performance and
digestibility
BWG and FCR are the most important parameters when
evaluating the effect of feeding in livestock, including pig
production because they determine profitability. Results
of this study showed that daily FI, BWG (except for day
1-30), and FCR were not different among treatments dur-
ing the starter (day 1-30), growth (day 31-60), finisher (day
61-90) and overall (day 1-90) periods. The above results
thus indicate that commercial concentrate can be replaced
with up to 20% TPL silage without any negative effects on
growth and overall performance in pigs during production.
This result has three important inferences: firstly, by replac-
ing commercial concentrate with agricultural wastes, there
is a potential to cut feeding cost which made up of 70%
total production cost in most livestock production systems;
secondly, it opens up the opportunity to utilise agricultural
waste, which otherwise will be left unused leading to envi-
ronmental pollution; and third and most importantly, the
use of agricultural waste for livestock feeding can reduce
the competition for food between human and livestock
production.
The overall BWG recorded for this study ranged from 670
g (Control) to 590 g (S20), and as previously mentioned,
they were not statistically different, and was similar to the
NE
Academic
US
Publishers

daily BWG of pigs (Large White x Mong Cai) reported by
Ly et al. (2010) that were fed diets with protein from fish
meal being replaced by ensiled cassava leaves, dry cassa-
va leaves, dry sweet potato vines, and ensiled sweet potato
vines. However, the overall BWG of pigs in the study was
higher than that of the report of Ly et al. (2010) with a re-
ported BWG from 394 to 470 g/pig/day. The results were
similar to the 590 g BWG reported by Hang and Pres-
ton (2010) for crossbred pigs (Mong Cai female x Large
White male) at 65 days of age fed on a supplemental diet
which contained 30% ensiled taro leaves. The results from
the latter seems to suggest the possibility of replacing the
commercial concentrate with higher than the 20% TPL
silage used in the present study in pigs. This hypothesis
merits further investigation in the future.
The BWG obtained in this study was higher than the 443
to 541 g reported by Toan and Preston (2010) when us-
ing processed TPL as feed in the diets of crossbred pigs
(Yorkshire x Mong Cai), but lower than that (840-850 g)
(Caicedo et al., 2018b) when fattening castrated pigs (Pi-
etrain x Duroc x Landrace) with a diet containing 65%
taro tuber silage. The higher BWG reported by the latter
(Caicedo et al., 2018b) is no doubt due to the higher ener-
gy content of the taro tuber as only obtained between 115
to 152 g BWG when using feed ensiled with taro foliage
and banana stem for indigenous Moo Lat pigs (Manivanh
and Preston, 2015). Results of this study are in agreement
with the findings of Caicedo et al. (2018a) and Lezcano
et al. (2017) that partial replacement of feed ingredients
provides the potential to reduce costs in pig production.
It is also worth noting that DM, OM and CP digestibility
of the two taro-waste silage diets was not different from
those of the control diet with an overall 83% for DM and
OM digestibility and 69% for CP digestibility, indicating
that replacing commercial concentrate with up to 20% ta-
ro-waste silage did not adversely affect feed digestibility in
pigs. The digestibility of CP (69%) was in agreement with
the report from An and Lindberg (2004) when feeding
castrated male pigs (Large White x Mong Cai) with diets
containing SPL ensiled with cassava root meal, SPL en-
siled with sweet potato root meal, and SPL with sugar cane
molasses resulting in CP digestibility of 69.8%, 68.7%,
and 71.5% respectively. Higher apparent rectal digestibil-
ity of DM (88.7%), OM (91.8%) and CP (91.9%) were
reported in castrated male fattening pigs (Large white x
Duroc x Pietrain) fed diet with 20% taro tubers meal as
a replacement for yellow corn (Caicedo et al., 2018b), or
when supplementing with 20% ensiled taro DM (91.2%),
OM (93.33%), and CP (85.05%) (Caicedo et al., 2017).
The discrepancy between the results of the above studies
and those in the present study is not surprising because the
former used taro tuber meal while ours used TPL waste.
June 2021 | Volume 9 | Issue 2 | Page 117
Journal of Animal Health and Production
There was a marginal increase in the FCR values of the two
taro silage supplemented diets as compared to the control
during the different feeding periods, but no major differ-
ences were detected (P>0.05). This was similar to what was
reported by Ly et al. (2011) where the FCR of pigs (Large
White x Mong Cai) showed no substantial difference in
results when fed diets containing 0-20% ensiled cassava
KM94 leaves. The overall FCR (kg DM feed/kg BWG)
was 2.53 for the control, 2.72 for S10, and 2.82 for S20. The
FCR obtained in this study was better than those (3.07 to
3.43) for crossbred pigs (Yorkshire x Mong Cai) at two
months of age fed TPL processed with different methods
(Toan and Preston, 2010). Interestingly, the overall FCR
obtained in this study was marginally lower than that re-
ported by Caicedo et al. (2018a) (2.89) who fed castrated
pigs in the fattening stage with a diet containing 65% taro
tubers silage, and that reported by Ly et al. (2010) (3.1-3.4)
when pigs (Large White x Mong Cai) were fed diets hav-
ing fish meal replaced with ensiled cassava leaves, dry sweet
potato vines, and ensiled sweet potato vines.
CONCLUSIONS
It was shown that good silage can be made from various
proportions of TPL and taro peel. Based on the overall en-
siling parameters, particularly the reduction of CO content
by approximately 9-fold, we suggest that the treatment
TPL50 incubated for 60 days is the optimal method of
preparing TPL-taro peel silage. The feeding trial indicat-
ed that commercial concentrates can be replaced with up
to 20% of the TPL50 taro-waste silage without having any
negative impacts on animal performance, thus providing a
potential means to use agricultcultural waste to reduce en-
vironmental pollution and to reduce competition for food
between human and for animal production.
ACKNOWLEDGMENTS
This research is funded by the scientific research grant of Tra
Vinh University under grant number 202/HĐ.HĐKH-
ĐHTV, dated 16/09/2019.
conflict of interest
There are no conflict of interest.
authors contribution
LTTL, NT and NTN contributed to the design of the
study. NT, LTH and NTAT conducted the data collection
and anlysis. LTTL and HTL prepared the first draft. JBL
and NTN criticized and revised the manuscript. All au-
thors have read and approved the final manuscript.
NE
Academic
US
Publishers

REFERENCES
• Albihn P, Savage G (2001). The bioavailability of oxalate from
oca (Oxalis tuberosa). J. Urol. 16: 420-422. https://doi.
org/10.1016/S0022-5347(05)65956-3
• An LV, Lindberg JE (2004). Ensiling of sweet potato leaves
(Ipomoea batatas (L.) Lam) and the nutritive value of sweet
potato leaf silage for growing pigs. Asian-Australasian
J. Anim. Sci. 17: 497-503. https://doi.org/10.5713/
ajas.2004.497
• Apata D, Babalola T (2012). The use of cassava, sweet potato
and cocoyam, and their by-products by non-ruminants.
Int. J. Food Sci. Nutr. 2: 54-62. https://doi.org/10.5923/j.
food.20120204.02
• Blaney B, Gartner R, Head T (1982). The effects of oxalate in
tropical grasses on calcium, phosphorus and magnesium
availability to cattle. J. Agric. Sci. 99: 533-539. https://doi.
org/10.1017/S0021859600031208
• Caicedo W, Rodríguez R and Lezcano P (2017). Characterization
of antinutrients in four silages of taro (Colocasia esculenta (L.)
Schott) for pigs. Technical note. Cuban J. Agric. Sci. 51: 79-
83.
• Caicedo W, Vargas J, Uvidia H, Samaniego E, Valle S, Flores L
(2018a). Effect of taro tubers (Colocasia esculenta (L.) Schott)
silage on the productive performance of commercial pigs.
Technical note. Cuban J. Agric. Sci. 52: 1-5.
• Caicedo W, Sanchez J, Tapuy A (2018b). Apparent digestibility
of nutrients in fattening pigs (Largewhite x Duroc x
Pietrain), fed with taro (Colocasia esculenta (L.) Schott) meal.
Technical note. Cuban J. Agric. Sci. 52: 1-6.
• Hang DT, Hai PV, Savage G (2018). Ensiling Taro (Colocasia
esculenta L.) foliage with cassava flour, rice bran or molasses;
effect on concentration of soluble and insoluble oxalates.
Livest. Res. Rural Dev. Volume: 30, Article number: 119.
Available at: http://www.lrrd.org/lrrd30/7/hangd30119.
html.
• Franceschi VR, Horner HT (1980). Calcium oxalate crystals in
plants. The Botanical Rev. 46: 361-427.
• Hang DT, Preston TR (2010). Effect of processing Taro leaves
on oxalate concentrations and using the ensiled leaves as a
protein source in pig diets in central Vietnam. Livest. Res.
Rural Dev. Volume: 22, Article number: 68. Available at:
http://www.lrrd.org/lrrd22/4/hang22068.htm.
• Hang DT, Binh LV, Preston TR, Savage G (2011). Oxalate
content of different taro cultivars grown in central Viet Nam
and the effect of simple processing methods on the oxalate
concentration of the processed forages. Livest. Res. Rural
Dev. Volume: 23, Article number: 122. Available at: http://
www.lrrd.org/lrrd23/6/hang23122.htm.
• Hang DT, Hai VV, Hai PV, Tra TT, Qui ND, Ngoan LD (2016).
Ileal and total tract digestibility in growing pigs fed ensiled
taro leaves as partial replacement of fish meal, maize and rice
bran. Livest. Res. Rural Dev. Volume: 28, Article number: 102.
Available at: http://www.lrrd.org/lrrd28/6/hang28102.html.
• Hang DT, Hai PV, Hai VV, Ngoan LD, Tuan LM, Savage
G (2017). Oxalate content of taro leaves grown in
Central Vietnam. Foods 6(1): 2. https://doi.org/10.3390/
foods6010002
• Horwitz W (2005). Official methods of analysis of AOAC
June 2021 | Volume 9 | Issue 2 | Page 118
Journal of Animal Health and Production
International. 18th ed. Gaithersburg, MD: AOAC
International.
• Lezcano P, Martínez M, Vázquez A, Pérez O (2017). Main
methods of processing and preserving alternative feeds in
tropical areas: Cuban experience. Cuban J. Agric. Sci. 51:
1-10.
• Ly NT, Ngoan LD, Verstegen MW, Hendriks WH (2010).
Ensiled and dry cassava leaves, and sweet potato vines as
a protein source in diets for growing Vietnamese Large
White× Mong Cai pigs. Asian-Australasian J. Anim. Sci. 23:
1205-1212. https://doi.org/10.5713/ajas.2010.90591
• Ly NT, Ngoan LD, Verstegen MW, Hendriks WH (2011).
Inclusion of ensiled cassava KM94 leaves in diets for
growing pigs in Vietnam reduces growth rate but increases
profitability. Asian-Australasian J. Anim. Sci. 24: 1157-1163.
https://doi.org/10.5713/ajas.2011.10451
• Malavanh C, Preston T, Ogle B (2008). Ensiling leaves of Taro
(Colocasia esculenta (L.) Shott) with sugar cane molasses.
Livest. Res. Rural Dev. Volume: 20, supplement. Available at:
http://www.lrrd.org/lrrd20/supplement/mala1.htm.
• Manivanh N, Preston TR (2015). Protein-enriched cassava
root meal improves the growth performance of Moo Lat
pigs fed ensiled taro (Colocacia esculenta) foliage and banana
stem. Livest. Res. Rural Dev. Volume: 27, Article number: 44.
Available at: http://www.lrrd.org/lrrd27/3/noup27044.html.
• McDonald P, Edwards RA, Greenhalgh JF, Morgan CA (2002).
Animal Nutrition. Longman Group Limited Harlow.
• Minitab, Minitab reference manual, Release 16.2.1 for Windows.
2010: Minitab Inc, USA.
• Muck RE (2010). Silage microbiology and its control through
additives. Rev. Brasileira de Zootec. 39: 183-191. http://
dx.doi.org/10.1590/S1516-35982010001300021
• Mwesigwa R, Mutetikka D, Kugonza DR (2013). Performance
of growing pigs fed diets based on by-products of maize and
wheat processing. Trop. Anim. Health Prod. 45: 441-446.
http://dx.doi.org/10.1007/s11250-012-0237-7
• Rooke JA, Hatfield RD (2003). Biochemistry of ensiling.
Silage Science and Technology (Agronomy Series No. 42).
American Soci. Agro., Madison, WI, 95-139.
• Russell JB, Diez-Gonzalez F (1997). The effects of fermentation
acids on bacterial growth. Adv. Microb. Physiol. 39: 205-
234. https://doi.org/10.1016/S0065-2911(08)60017-X
• Savage G, Vanhanen L, Mason S, Ross A (2000). Effect of
cooking on the soluble and insoluble oxalate content of
some New Zealand foods. J. Food Comp. Anal. 13: 201-206.
https://doi.org/10.1080/10942910903326056
• Sivilai B, Preston T, Kaensombath L (2016). Feed intake,
nutrient digestibility and nitrogen retention by Moo Lath
pigs fed ensiled banana pseudo-stem (Musa spp) and ensiled
taro foliage (Colocasia esculenta). Livest. Res. Rural Dev.
Volume: 28, Article number: 6. Available at: http://www.lrrd.
org/lrrd28/1/boun28006.html.
• Temesgen M, Retta N (2015). Nutritional potential, health
and food security benefits of taro Colocasia esculenta (L.). A
review: Food Sci. Qual. Mana. 36: 23-30.
• Toan NH, Preston TR (2010). Taro as a local feed resource for
pigs in small scale household condition. Livest. Res. Rural
Dev. Volume: 22, Article number: 152. Available at: http://
www.lrrd.org/lrrd22/8/toan22152.htm.
NE
Academic
US
Publishers
 Veterinary World
ISSN: 0972-8988, EISSN: 2231-0916, www.veterinaryworld.org

Volume-14 No.4 April-2021

The articles in Veterinary World are open access articles licensed under the terms of the Creative Commons Attribution 4.0
International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and
reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to
the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver
(http://creativecommons.org/ publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise
stated.

Research (Published online: 02-04-2021)

1. Serological and molecular survey of Leptospira spp. infections in wild boars and red foxes from Southeastern
France
Cédric Roquelo, Angeli Kodjo, Jean-Lou Marié and Bernard Davoust
Veterinary World, 14(4): 825-828

Research (Published online: 02-04-2021)

2. Support vector regression algorithm modeling to predict the parturition date of small - to medium-sized dogs
using maternal weight and fetal biparietal diameter
Thanida Sananmuang, Kanchanarat Mankong, Suppawiwat Ponglowhapan and Kaj Chokeshaiusaha
Veterinary World, 14(4): 829-834

Research (Published online: 05-04-2021)

3. Orally administered β-glucan improves the hemolytic activity of the complement system in horses
Taline Scalco Picetti, Lucas de Figueiredo Soveral, Rovian Miotto, Luana Marina Scheer Erpen, Yasmin Kreutz,
João Antônio Guizzo, Rafael Frandoloso and Luiz Carlos Kreutz
Veterinary World, 14(4): 835-840

Research (Published online: 08-04-2021)

4. Effect of hydroponic green herbage on the productive qualities of parent flock geese
Danis Khaziev, Rinat Gadiev, Chulpan Yusupova, Marina Kazanina and Svetlana Kopylova
Veterinary World, 14(4): 841-846

Research (Published online: 09-04-2021)

5. Dietary polyvinyl alcohol and alginate nanofibers ameliorate hyperglycemia by reducing insulin and glucose-
metabolizing enzyme levels in rats with streptozotocin-induced diabetes
Muhammad Suryadiningrat, Devia Yoanita Kurniawati, Agung Mujiburrahman and Muhammad Thohawi Elziyad
Purnama
Veterinary World, 14(4): 847-853

Research (Published online: 09-04-2021)

6. Possibility of long-term survival of African swine fever virus in natural conditions
Hranush Arzumanyan, Sona Hakobyan, Hranush Avagyan, Roza Izmailyan, Narek Nersisyan and Zaven
Karalyan
Veterinary World, 14(4): 854-859

Research (Published online: 10-04-2021)

7. Serum protein profiles and C-reactive protein in natural canine filariasis
Sariya Asawakarn, Sujin Sirisawadi, Nanthida Kunnasut, Patchana Kamkong and Piyanan Taweethavonsawat
Veterinary World, 14(4): 860-864

Research (Published online: 10-04-2021)

8. First report of tilapia lake virus emergence in fish farms in the department of Córdoba, Colombia
Héctor Contreras, Adriana Vallejo, Salim Mattar, Luis Ruiz, Camilo Guzmán and Alfonso Calderón
Veterinary World, 14(4): 865-872

www.veterinaryworld.org I
Research (Published online: 12-04-2021)
9. Comparison between five coprological methods for the diagnosis of Balantidium coli cysts in fecal samples
from pigs
Juan Carlos Pinilla, Andrea Isabel Pinilla and Angel Alberto Florez
Veterinary World, 14(4): 873-877

Research (Published online: 12-04-2021)

10. By-products of apricot processing in quail feed: Effects on growth performance, carcass characteristics, and
meat physicochemical quality
Fatma Boubekeur, Rafik Arbouche, Yasmine Arbouche and Fodil Arbouche
Veterinary World, 14(4): 878-883

Research (Published online: 13-04-2021)

11. Molecular identification of Trichuris trichiura and Hymenolepis diminuta in long-tailed macaques (Macaca
fascicularis) in Lopburi, Thailand
Wanat Sricharern, Tawin Inpankaew, Sarawan Kaewmongkol, Thitichai Jarudecha and Natnaree Inthong
Veterinary World, 14(4): 884-888

Research (Published online: 13-04-2021)

12. Incidence of avian malaria in hummingbirds in humid premontane forests of Pichincha Province, Ecuador: A
pilot study
Claudia S. Abad, Markus P. Tellkamp, Isidro R. Amaro and Lilian M. Spencer
Veterinary World, 14(4): 889-896

Research (Published online: 14-04-2021)

13. Relationship between plumage color and eggshell patterns with egg production and egg quality traits of
Japanese quails
Ly Thi Thu Lan, Nguyen Thi Hong Nhan, Lam Thai Hung, Tran Hoang Diep, Nguyen Hong Xuan, Huynh Tan Loc
and Nguyen Trong Ngu
Veterinary World, 14(4): 897-902

Research (Published online: 15-04-2021)

14. Prevalence, genetic, and biochemical evaluation of immune response of police dogs infected with Babesia
vogeli
Ahmed Adel Zaki, Marwa Mohamed Attia, Elshaimaa Ismael and Olfat Anter Mahdy
Veterinary World, 14(4): 903-912

Research (Published online: 15-04-2021)

15. Effect of dietary stevia-based sweetener on body weight and humoral immune response of broiler chickens
Ramón Miguel Molina-Barrios, Cielo Rubí Avilés-Trejo, María Esthela Puentes-Mercado, Jesús Raymundo
Cedillo-Cobián and Juan Francisco Hernández-Chavez
Veterinary World, 14(4): 913-917

Research (Published online: 16-04-2021)

16. Association between animal welfare indicators and microbiological quality of beef carcasses, including
Salmonella spp., from a slaughterhouse in Ecuador
María Cevallos-Almeida, Ana Burgos-Mayorga, Carlos A. Gómez, José Luis Lema-Hurtado, Leydi Lema, Iveth
Calvache, Christian Jaramillo, Isabel Collaguazo Ruilova, Evelyn Pamela Martínez and Pamela Estupiñ án
Veterinary World, 14(4): 918-925

Research (Published online: 17-04-2021)

17. Isolation and identification of peste des petits ruminants virus from goats in Egyptian governorates
Sahar Ahmed, Wafaa Abd El Wahab Hosny, Mervat Mahmoud and Mohammed Abd El-Fatah Mahmoud
Veterinary World, 14(4): 926-932

Research (Published online: 17-04-2021)

18. Knowledge, attitude, and practice about rabies prevention and control: A community survey in Nepal
Pushkar Pal, Adisorn Yawongsa, Tej Narayan Bhusal, Rajendra Bashyal and Theera Rukkwamsuk
Veterinary World, 14(4): 933-942

Research (Published online: 19-04-2021)

19. Detection and genetic characterization of "Candidatus Mycoplasma haemomacaque" infection among long-
tailed macaques (Macaca fascicularis) in Thailand using broad-range nested polymerase chain reaction assay
Wanat Sricharern, Supakarn Kaewchot, Sarawan Kaewmongkol, Natnaree Inthong, Thitichai Jarudecha,
Rucksak Rucksaken, Bandid Mangkit, Sakulchit Wichianchot and Tawin Inpankaew
Veterinary World, 14(4): 943-948
www.veterinaryworld.org II
Veterinary World, EISSN: 2231-0916 RESEARCH ARTICLE
Available at www.veterinaryworld.org/Vol.14/April-2021/13.pdf Open Access

Relationship between plumage color and eggshell patterns with egg

production and egg quality traits of Japanese quails
Ly Thi Thu Lan1 , Nguyen Thi Hong Nhan2 , Lam Thai Hung3 , Tran Hoang Diep4 , Nguyen Hong Xuan5 ,
Huynh Tan Loc6 and Nguyen Trong Ngu6

1. Department of Animal Science and Veterinary Medicine , School of Agriculture and Aquaculture, Tra Vinh University, Tra
Vinh City, Vietnam; 2. Department of Animal Science, College of Agriculture, Can Tho University, Can Tho City, Vietnam;
3. Department of Science and Technology, Tra Vinh Province, Tra Vinh City, Vietnam; 4. Department of Animal Science
and Veterinary Medicine , Faculty of Agriculture and Food Technology, Tien Giang University, My Tho City, Vietnam;
5. Department of Food Technology, College of Food Technology and Biotechnology, Can Tho University of Technology,
Can Tho City, Vietnam; 6. Department of Veterinary Medicine, College of Agriculture, Can Tho University, Can Tho City,
Vietnam.
Corresponding author: Nguyen Trong Ngu, e-mail: ntngu@ctu.edu.vn
Co-authors: LTTL: thulan@tvu.edu.vn, NTHN: nthnhan@ctu.edu.vn, LTH: lthung@tvu.edu.vn,
THD: tranhoangdiep@tgu.edu.vn, NHX: nhxuan@ctuet.edu.vn, HTL: tanloc@ctu.edu.vn
Received: 30-08-2020, Accepted: 23-02-2021, Published online: 14-04-2021

doi: www.doi.org/10.14202/vetworld.2021.897-902 How to cite this article: Lan LTT, Nhan NTH, Hung LT, Diep TH,
Xuan NH, Loc HT, Ngu NT (2021) Relationship between plumage color and eggshell patterns with egg production and egg
quality traits of Japanese quails, Veterinary World, 14(4): 897-902.

Abstract
Aim: This study was conducted to identify the diversity of feather color and to determine the relationship between plumage
color and egg yield as well as eggshell patterns and internal egg quality traits of Japanese quails.
Materials and Methods: For investigating phenotypic diversity, a total of 600 quails from five breeding farms were
evaluated to record head feather, shank, and plumage color. An on-station experiment was also conducted on 360 laying
quails to examine the relationship between plumage color and egg production and egg weight during 24 weeks of laying.
Eggs collected during this period were also used for identifying eggshell patterns and examining their relationship with
internal egg quality characteristics.
Results: Plumage color was primarily wild-type, with the highest proportion being 56.3% (p<0.001). Brown color was also
found at a relatively high proportion in the population (16.7%), followed by black color (11.3%). The egg production and
laying rate of quails with wild-type and brown plumage colors also significantly (p=0.001) differed from those of quails
with other plumage types. Egg weight was also higher in these quail groups, especially than that of quails with yellow
plumage color. Four patterns of eggshell were identified, among which spotted and dark eggshells were predominant (45.2%
and 43.1%, respectively); however, patterns did not affect internal egg quality characteristics.
Conclusion: Plumage color was primarily wild-type in both male and female quails. Egg yield over a 24-week laying period
was superior in quails with wild-type and brown plumage colors, whereas a relationship between eggshell patterns and egg
quality traits could not be established.
Keywords: egg yield, feather color, linkage, morphological characteristics.
Introduction have a strong genetic component [2]. Bedhom et al. [3]
One of the important characteristics that help in mentioned that the interaction of specific gene muta-
distinguishing poultry species from other vertebrate tions or combinations of mutations is a major cause
species is the presence of feathers that provide them of change in the plumage color of quails. Sezer and
the ability to fly, disguise, and regulate their tempera- Tarhan [4] have also attempted to link the effects of
ture. The change in the color of feathers in poultry has feather color with growth characteristics in Japanese
attracted the attention of ecologists and evolutionary quails, and they concluded that morphological char-
biologists. Feather colors have been used predomi- acteristics, specifically feather color, contributed sig-
nificantly to the identification process as well as the
nantly in several areas, including sex selection, anal-
selection of quail varieties.
ysis of geographic differences and speciation, and
In addition to plumage color, eggshell and its spot
the evolution of polymorphism [1]. Most of the color
colors are extremely diverse. Sezer and Tekelioglu [5]
changes in the plumage within and between species
demonstrated that the color of quail eggshell varies
Copyright: Lan, et al. Open Access. This article is distributed under from white to blue or green, whereas Taha [6] classified
the terms of the Creative Commons Attribution 4.0 International
License (http://creativecommons.org/licenses/by/4.0/), which
quail eggs as black-spotted eggs with different sizes
permits unrestricted use, distribution, and reproduction in any on brown- or gray-colored eggshell, spotless white
medium, provided you give appropriate credit to the original
author(s) and the source, provide a link to the Creative Commons
eggs, and eggs with small black or blue spots on gray-
license, and indicate if changes were made. The Creative Commons brown-colored eggshell. In contrast, Hassan et al. [7]
Public Domain Dedication waiver (http://creativecommons.org/
publicdomain/zero/1.0/) applies to the data made available in this
classified quail eggs as bright eggs (without spots or
article, unless otherwise stated. very small), dotted eggs (with small spots), spotted
Veterinary World, EISSN: 2231-0916 897

 Available at www.veterinaryworld.org/Vol.14/April-2021/13.pdf
eggs (with large spots), and dark eggs (with a few very
large spots). The variety of eggshell color in quails
has attracted several scientists. Alasahan et al. [8] also
investigated the relationship between color and spots
on eggshell and the internal and external qualities of
eggs. Their results showed that eggshell color and
color of spots had a significant effect on egg quality
characteristics such as eggshell ratio, eggshell index,
albumen index, yolk index, and Haugh unit. Other
studies have focused on the impact of eggshell color
changes on eggshell structure, egg weight reduction,
and hatching parameters [6,7], as well as internal and
external quality characteristics of eggs.
Japanese quails (Coturnix coturnix japonica)
have emerged as a research target due to their rapid
growth, early sexual maturity, high egg production
rate, short reproduction time, minimal requirements
of space and food, easy maintenance, high resistance
against several diseases in poultry, and potential for
meat and eggs [9]. Despite the advantageous domi-
nance over other poultry species, quail-breeding pro-
gram has not been completely exploited, especially in
the Mekong Delta of Vietnam where an approximate
number of 3.19 million quails are being raised every
year primarily for laying purposes [10]. One of the
major issues in our knowledge regarding the selection
of breeding quails is a lack of information on the rela-
tionship of phenotype with egg yield and other related
traits to streamline the production aimed at an optimal
profit.
Therefore, the present study was conducted to
determine the relationship between plumage color and
egg production as well as eggshell patterns and inter-
nal egg quality traits. The results of this study may
serve as a stepping stone for the selection and hybrid-
ization of quails based on phenotypic characteristics
and may also provide useful information for selecting
eggs using eggshell colors.
Materials and Methods
Ethical approval
This study was carried out after obtaining
approval from Can Tho University and Tra Vinh Sub-
Department of Animal Health.
Study period and location
The on-station trial was conducted at the exper-
imental farm of Tra Vinh University, Vietnam (9°55′
N, 106° 20′ E) from February to August 2019.
Identification of phenotypic characteristics of
Japanese quails
The phenotypic diversity of Japanese quails
raised in the Mekong Delta was investigated. Most
of the farm-reared quails are introduced by breeders
in the Mekong Delta in vast numbers for restocking
purposes. Using the commercial lines of Japanese
quails, these quail lines are thereafter generated and
maintained by local breeders for egg production. In
this study, five quail-breeding farms were included
in the survey, among which for each farm, 30 male
Veterinary World, EISSN: 2231-0916
and 90 female quails were randomly selected to
record physical features, including plumage color,
head feather color, and shank color, according to
the classification method described by Tsudzuki and
Wakasugi [11]. A total of 600 quails (150 males and
450 females) were used in this investigation.
Experimental quails and management
On the basis of the diversity of quail feath-
ers in the survey, quails were obtained from one
quail-breeding farm consisting of quails with four
popular plumage types, that is, black, brown, wild-
type, and yellow, with 90 female quails per group.
The laying performance of 360 quails (167±7.8 g)
was recorded during 24 weeks of laying. Quails were
individually maintained in each cage and provided a
commercial diet consisting of 21% crude protein and
2850 kcal of ME/kg from a feed company. Feed and
water were available ad libitum all time, and a lighting
program of 16 h of light/day was applied. Quails were
vaccinated against Newcastle disease and infectious
bursal disease (Gumboro). For the analysis of external
and internal traits, eggs were collected on a given day
in the 4th, 8th, 12th, 16th, 20th, and 24th laying weeks for
weighing and quality measurement.
Egg measurements
In total, 2160 eggs were included for record-
ing egg weight and shell pattern during the experi-
mental period. The categorical classification of the
eggshell patterns of Japanese quails was based on
Hassan et al. [7]. For interior quality characteristics,
one-fourth of the eggs (540 eggs) were analyzed. A
digital display caliper was used to measure the width,
length, yolk diameter, and albumen length and width
of the eggs; yolk weight was measured to an accuracy
of 0.01 g, and the proportion of this parameter was
expressed in percentage corresponding to egg weight.
Yolk color was determined using the La Roche scale
scoring from 1 to 15 [12]. Albumen weight was cal-
culated by subtracting the yolk and shell weight from
the whole egg weight. These data were used to deter-
mine the external and internal quality characteristics
of eggs using the following formulas [13]: Shape
index (%)=(Width [mm]/Length [mm])×100; Shell
ratio (%)=(Shell weight [g]/Egg weight [g])×100;
Albumen weight (g)=Egg weight−(Shell weight+Yolk
weight); Yolk ratio (%)=(Yolk weight [g]/
Egg weight [g])×100; Albumen ratio (%)=(Albumen
weight [g]/Egg weight [g])×100; Yolk index (%)=(Yolk
height [mm]/Yolk diameter [mm])×100; Albumen
index (%)=(Albumen height [mm]/[(Albumen length
[mm]+Albumen width [mm])/2])×100; Haugh
unit=100 log (Albumen height [mm]+7.57−1.7×Egg
weight [g]0.37).
Statistical analysis
All data were subjected to statistical analysis
using the Minitab 16.2 software (State College, PA,
USA) [14]. The Chi-square test was used to evalu-
ate the distribution of morphological characteristics,
898
 Available at www.veterinaryworld.org/Vol.14/April-2021/13.pdf

and a general linear model Yij=μ+Wi+eij was used to
evaluate the relationship between phenotypes and
production and quality traits, where Yij is the pheno-
typic value of the traits, μ is the overall mean, Wi is the
effect of plumage color (black, brown, wild-type, and
yellow), and eij is the random error.
Results
Phenotypic characteristics
The feather color of Japanese quails in the
Mekong Delta was diverse and distributed differently
between female and male quails as well as between
body parts as shown in Table-1. Regarding head
feather color, yellow accounted for the highest pro-
portion (54.0%) in male quails (p=0.001), whereas in
female quails, black plumage color (39.1%, p=0.001)
was predominant over other colors, although the pro-
portion of male quails with this color was the lowest
(2.0%). Furthermore, gray color was found in a high
proportion of male and female quails, with 31.3% and
23.1%, respectively. Moreover, plumage color was
primarily wild-type for both male (44.7%) and female
(60.2%) quails, with the highest average rate being
56.3% (p=0.001). Brown color was also identified at
a relatively high rate in the quail population (16.7%).
Coincidentally, black color had the lowest proportion
in the population (11.3%). In addition, for shank color,
the highest proportion was found for pinkish-brown
(62.7%), followed by yellow (24.3%) for both male
and female quails. Although orangish-gray color
appeared at a high rate (29.3%) in the population
of male quails compared with yellow color (3.3%)
(p=0.001), it still accounted for the lowest percentage
of the total population surveyed.
Relationship between plumage color and
production
Egg production was found to have a close rela-
tionship with plumage color (Table-2). During all
the recorded laying periods, a significant difference
(p=0.001) was observed between the types of brown
and wild-type plumage colors and the other types of
black and yellow colors in the laying weeks. In gen-
eral, there were significant differences in the two types
of brown and wild-type plumage colors on the aver-
age number of eggs (150.4 and 155.4, respectively)
and laying rate (89.5% and 92.5%, respectively). Egg
weight was also higher in these quail groups, especially
in quails with the yellow plumage color. Furthermore,
although the mean shape index significantly differed
in the 12th week between all types of quails, the aver-
age value observed during the 24 weeks of laying was
similar, ranging from 75.6% to 76.7%.
Effects of eggshell patterns on egg quality
characteristics
In terms of eggshell patterns, spotted and dark
eggs accounted for a higher proportion (45.2% and
43.1%, respectively) than bright and little-spotted eggs
(Table-3); however, the patterns did now show any
relationship with internal egg quality traits (p>0.05).
Discussion
Japanese quails in the Mekong Delta were found
to be quite diverse in terms of plumage colors. Mishra
et al. [15] also reported that Japanese quails had breast
colors such as white, brown, and white brown, wherein
the presence of white color was due to a new mutation
of dominant gene activity at a locus in the genome.
According to a previous study conducted by Tsudzuki
and Wakasugi [11], the plumage of quails consists of
colored bands arranged from tail to head with some
common colors such as gray, black, white-gray,
brown, wild-type, and yellow. Wild-type was found to
egg be the most popular plumage color in the quail popu-
lation, and different feather colors were also identified
between male and female quails. The dominant popu-
lation of wild-type quails can be explained by the fact

Table-1: Distribution of feather color in breeding Japanese quails raised in the Mekong Delta.

Color Male (n=150) Female (n=450) Total (n=600)

Number Ratio (%) Number Ratio (%) Number Ratio (%)
Head
Black 3 2.0d 176 39.1a 179 29.8ab
Black stripes 19 12.7c 41 9.1d 60 10.0c
Gray 47 31.3b 104 23.1c 151 25.2b
Yellow 81 54.0a 129 28.7bc 210 35.0a
p‑value 0.001 0.001 0.001
Plumage
Black 26 17.3b 42 9.3d 68 11.3c
Brown 36 24.0b 64 14.2c 100 16.7b
Wild‑type 67 44.7a 271 60.2a 338 56.3a
Yellow 21 14.0b 73 16.2bc 94 15.7bc
p‑value 0.001 0.001 0.001
Shank
Orangish‑gray 44 29.3b 34 7.6c 78 13.0c
Pinkish‑brown 101 67.3a 275 61.1a 376 62.7a
Yellow 5 3.3c 141 31.3b 146 24.3b
p‑value 0.001 0.001 0.001
a,b,c,d
Means bearing different superscripts within a column differ significantly (p<0.05)

Veterinary World, EISSN: 2231-0916 899

 Available at www.veterinaryworld.org/Vol.14/April-2021/13.pdf

Table-2: Relationship between plumage colors and egg production traits.

Parameters Plumage Laying weeks

color
1‑4 5‑8 9‑12 13‑16 17‑20 21‑24 1‑24
Egg Black 17.2±0.54 b
21.2±0.38 b
22.6±0.42 b
22.4±0.49 b
21.2±0.47 b
19.1±0.65 b
124.8±1.54b
production Brown 20.3±0.54a 24.0±0.36a 26.5±0.39a 26.6±0.46a 26.5±0.44a 26.4±0.61a 150.4±1.45a
Wild‑type 22.1±0.54a 24.8±0.37a 27.4±0.40a 27.3±0.47a 26.9±0.45a 26.8±0.62a 155.4±1.48a
Yellow 17.7±0.54b 21.3±0.41b 22.4±0.44b 20.7±0.52b 21.2±0.49b 19.0±0.69b 122.1±1.64b
p‑value 0.001 0.001 0.001 0.001 0.001 0.001 0.001
Laying Black 59.9±2.03b 75.5±1.36b 81.2±1.49b 79.8±1.77b 75.7±1.69b 68.3±2.32b 74.3±0.92b
rate (%) Brown 72.7±1.90a 85.6±1.27a 94.8±1.34a 95.1±1.65a 94.6±1.58a 94.1±2.17a 89.5±0.86a
Wild‑type 79.2±1.95a 88.7±1.30a 97.9±1.43a 97.5±1.67a 95.9±1.61a 95.8±2.22a 92.5±0.88a
Yellow 62.7±2.14b 76.2±1.43b 80.5±1.57b 74.3±1.86b 75.2±1.78b 68.7±2.45b 72.6±0.97b
p‑value 0.001 0.001 0.001 0.001 0.001 0.001 0.001
Egg Black 11.3±0.12b 11.7±0.10ab 11.9±0.10 11.7±0.11ab 11.5±0.15 11.7±0.10 11.6±0.09ab
weight (g) Brown 11.7±0.12a 12.0±0.09a 12.0±0.10 12.0±0.10a 11.8±0.14 12.0±0.10 11.9±0.08a
Wild‑type 11.8±0.12a 11.9±0.10ab 11.9±0.10 11.9±0.10a 11.6±0.14 11.9±0.10 11.8±0.09a
Yellow 11.3±0.13b 11.6±0.11b 11.7±0.11 11.5±0.11b 11.3±0.16 11.6±0.11 11.5±0.10b
p‑value 0.002 0.018 0.128 0.011 0.057 0.096 0.004
Shape Black 75.1±0.72 74.5±1.17 74.8±0.59b 74.9±0.72 74.1±1.03 75.9±0.34 75.6±0.43
index (%) Brown 77.1±0.66 76.2±1.07 77.3±0.58a 76.5±0.65 75.1±0.94 76.7±0.30 76.7±0.42
Wild‑type 76.0±0.68 75.3±1.11 77.1±0.58a 76.3±0.68 75.1±0.97 76.7±0.32 76.2±0.42
Yellow 76.0±0.76 73.6±1.23 74.7±0.60b 75.6±0.75 74.0±1.08 76.8±0.35 75.6±0.43
p‑value 0.233 0.439 0.001 0.396 0.764 0.220 0.237
a,b
Means bearing different superscripts within a column differ significantly (p<0.05)

Table-3: Internal quality characteristics of eggs from different eggshell patterns.

Parameters Eggshell patterns p‑value

Bright Dotted Spotted Dark
Number of eggs 108 145 976 931
Proportion 5.0d 6.7c 45.2a 43.1ab 0.001
Egg characteristics
Shell weight (g) 1.68±0.05 1.62±0.04 1.64±0.02 1.62±0.02 0.649
Shell ratio (%) 14.9±0.45 14.2±0.39 14.2±0.15 14.3±0.15 0.542
Yolk weight (g) 3.51±0.08 3.58±0.07 3.59±0.03 3.58±0.03 0.873
Albumin weight (g) 6.15±0.15 6.3±0.13 6.30±0.05 6.17±0.05 0.216
Yolk ratio (%) 31.0±0.66 31.2±0.57 31.1±0.22 31.5±0.22 0.591
Albumin ratio (%) 54.0±0.96 54.7±0.83 54.6±0.32 54.2±0.33 0.797
Yolk/albumin ratio (%) 58.8±2.02 58.6±1.75 57.7±0.67 58.8±0.70 0.722
Yolk index (%) 40.9±1.12 40.9±0.97 40.6±0.37 40.3±0.38 0.907
Albumin index (%) 9.63±0.43 9.53±0.37 9.10±0.14 9.18±0.15 0.516
Haugh unit 88.7±0.84 88.9±0.72 87.5±0.28 87.7±0.28 0.201
a,b
Means bearing different superscripts within a row differ significantly (p<0.05)

that the wild-type group had lower mortality rates and
higher values of internal and external quality charac-
teristics of eggs than others, including the white, dark
brown, and golden plumage color groups [16]. Another
study reported that wild-type Japanese quails had sig-
nificantly higher slaughter weight than quails of light
brown type [15]. Although some studies have shown
that white quails had the heaviest body weight with
the best carcass traits and meat quality [17-19], this
color was not found in the present study. Altogether,
it is necessary to consider the favorable characteristics
of wild-type quails to improve quail production in the
Mekong Delta.
The differences in some phenotypic traits of quails,
including egg production, laying rate, egg weight, and
shape index, from the four types of plumage colors
were also determined in this study. Interestingly, they
exhibited a close relationship with egg yield during the
24-week laying period. The values of these traits for
quails with brown and wild-type plumage colors were
consistently higher than those for quails with black and
yellow plumage colors. Supporting this finding, egg
production was found to differ significantly according
to different quail phenotypes [20,21]. Egg weight was
also affected by the diversity of plumage colors, where
eggs laid by quails with yellow plumage were lower
in weight than those laid by quails with other plumage
patterns. In the present study, the brown Japanese quail
was superior in terms of egg weight, which is consis-
tent with some previously reported studies [21-23].
These findings support the results obtained by Ashok
and Reddy [24] who reported that there were signifi-
cant differences in egg weight between various types
of quails. Overall, these results may be beneficial to
select appropriate breeding programs for egg-laying
quails in the long term.

Veterinary World, EISSN: 2231-0916 900

 Available at www.veterinaryworld.org/Vol.14/April-2021/13.pdf
Four eggshell color groups were recorded in the
present study, among which spotted and dark eggs
predominated in the population; these findings were
consistent with those of Sezer and Tekelioglu [5].
Basically, egg color forms when it travels through
the hen’s oviduct. When the eggshell begins to form,
epithelial cells at the surface of the eggshell gland
(uterus) begin to synthesize color pigments [25]. The
previous studies [26,27] have also confirmed that egg-
shell color is a genetic transformation of pigments on
the egg surface in the uterus. In addition, Alasahan
et al. [28] classified the color of eggshells into five
different groups, including black-spotted gray-white,
green-spotted gray-white, scattered brown-spotted
gray-brown, brown-spotted light-green, and small
brown-spotted gray-brown. However, they also indi-
cated that the effect of eggshell color on egg weight,
eggshell mass, albumen weight, and yolk weight was
not statistically significant. It was also pointed out that
the shell color of Japanese quail eggs, blue or spotted,
did not appear to affect their quality [29]; however,
it can affect the hatching results and body weight of
the obtained chicks of Japanese quails. Nevertheless,
Taha [6] reported higher egg weight, egg length, and
egg width in the black-spotted quail group than in the
blue-spotted quail group. It is worth noting that the
determination of the best type of eggshell colors in
terms of egg quality is controversial among the pub-
lished data. In the present study, although spotted and
dark eggshells were predominant patterns, the rela-
tionship between eggshell patterns and internal egg
quality traits could not be established.
Conclusion
The plumage color of Japanese quails raised in
the Mekong Delta of Vietnam was primarily wild-
type in both male and female populations. The differ-
ences in these color patterns affected egg yield over a
24-week laying period, with superior values in quails
with wild-type and brown plumage colors, but no rela-
tionship was identified between eggshell patterns and
egg quality traits.
Authors’ Contributions
LTTL, NTHN, and NTN designed the experimen-
tal procedures. LTTL, NTHN, LTH, THD, and NHX
performed the experiments. LTTL, NTHN, HTL, and
NTN interpreted the data and prepared the manuscript.
All authors read and approved the final manuscript.
Acknowledgments
This study was funded by Vietnam
National Foundation for Science and Technology
Development (NAFOSTED) under grant number
106-NN.05-2013.12.
Competing Interests
The authors declare that they have no competing
interests.
Veterinary World, EISSN: 2231-0916
Publisher’s Note
Veterinary World remains neutral with regard
to jurisdictional claims in published institutional
affiliation.
References
1. Roulin, A. (2004) The evolution, maintenance and adaptive
function of genetic colour polymorphism in birds. Biol.
Rev., 79(4): 815-848.
2. Mundy, N.I. (2005) A window on the genetics of evolution:
MC1R and plumage colouration in birds. Proc. Biol. Sci.,
272(1573): 1633-1640.
3. Bed’hom, B., Vaez, M., Coville, J.L., Gourichon, D.,
Chastel, O., Follett, S., Burke, T. and Minvielle, F. (2012)
The lavender plumage colour in Japanese quail is associ-
ated with a complex mutation in the region of MLPH that is
related to differences in growth, feed consumption and body
temperature. BMC Genomics, 13(1): 1-10.
4. Sezer, M. and Tarhan, S. (2005) Model parameters of
growth curves of three meat-type lines of Japanese quail.
Czech J. Anim. Sci., 50(1): 22-30.
5. Sezer, M. and Tekelioglu, O. (2009) Quantification of
Japanese quail eggshell colour by image analysis. Biol.
Res., 42(1): 99-105.
6. Taha, A.E. (2011) Analyzing of quail eggs hatchability,
quality, embryonic mortality and malpositions in relation to
their shell colors. Online J. Anim. Feed Res., 1(6): 267-273.
7. Hassan, H.A., El-Nesr, S., Osman, A. and Arram, G. (2013)
Ultrastructure of eggshell, egg weight loss and hatching
traits of Japanese quail varying in eggshell color and pattern
using image analysis. Egypt. Poult. Sci. J., 34(I): 1-17.
8. Alaşahan, S., Çopur, G.A., Canoğulları, S. and Baylan, M.
(2015) Determination of some external and internal quality
traits of Japanese quail (Coturnix coturnix japonica) eggs
on the basis of eggshell colour and spot colour. Eurasian J.
Vet. Sci., 31(4): 235-241.
9. Akpa, G., Kaye, J., Adeyinka, I. and Kabir, M. (2008) The
relationships between laying age and repeatability of egg
quality traits in Japanese quails (Coturnix coturnix japon-
ica). Int. J. Poult. Sci., 7(6): 555-559.
10. Vietnam, G.S.O. (2020) Vietnam Livestock Statistics:
Number and Products of Animals and Poultry, Department
of Animal Husbandry.
11. Tsudzuki, M. and Wakasugi, N. (1987) “Pansy”: A plum-
age color mutant in Japanese quail. J. Poult. Sci., 24(6):
327-335.
12. Lokaewmanee, K., Mompanuon, S., Khumpeerawat, P. and
Yamauchi, K. (2009) Effects of dietary mulberry leaves
(Morus alba L.) on egg yolk color. J. Poult. Sci., 46(2):
112-115.
13. Nazligül, A., Türkyilmaz, K. and Bardakçioğlu, H.E. (2001)
A study on some production traits and egg quality charac-
teristics of Japanese quail. Turk. J. Vet. Anim. Sci., 25(6):
1007-1013.
14. Minitab. (2010) Minitab Reference Manual, Release 16.2.1
for Windows. Minitab Inc., United States.
15. Mishra, S.K., Khan, A.A., Narayan, R., Singh, S.P.,
Pratap, S.O., Saxena, D., Chaudhuri, D. (2011) Inheritance
of plumage colour variations in a large flock of Japanese
quail. Br. Poult. Sci., 52(6): 686-693.
16. Inci, H., Sogut, B., Sengul, T., Sengul, A.Y. and Taysi, M.R.
(2015) Comparison of fattening performance, carcass
characteristics, and egg quality characteristics of Japanese
quails with different feather colors. Rev. Bras. Zootec.,
44(11): 390-396.
17. Nasr, M.A., Ali, E.S.M. and Hussein, M.A. (2017)
Performance, carcass traits, meat quality and amino acid
profile of different Japanese quails strains. J. Food Sci.
Technol., 54(13): 4189-4196.
18. Dash, S.K., Naik, S., Dubey, P.P., Malhotra, P. and
901
 Available at www.veterinaryworld.org/Vol.14/April-2021/13.pdf
Bansal, B.K. (2018) Effect of plumage colour and esti-
mation of variance components of bi-weekly growth traits
in Japanese quail (Coturnix coturnix japonica). Indian J.
Anim. Sci., 88(10): 1193-1196.
19. Al-Kafajy, F.R., Al-Shuhaib, M.B.S., Al-Jashami, G.S. and
Al-Thuwaini, T.M. (2018) Comparison of three lines of
Japanese quails revealed a remarkable role of plumage color
in the productivity performance determination. J. World
Poult. Res., 8(4): 111-119.
20. Rahman, M., Rasul, K. and Islam, M. (2010) Comparison
of the productive and reproductive performance of differ-
ent color mutants of Japanese quails (Coturnix japonica).
In: Proceedings of the Annual Research Review Workshop.
BLRI, Savar, Dhaka, Bangladesh. p50-56.
21. Cahyadi, M., Fauzy, R. and Dewanti, R. (2019) Egg produc-
tion traits and egg quality characteristics in black and brown
plumage color lines of Japanese quail. Poult. Sci. J., 7(2):
179-184.
22. Chimezie, V., Fayeye, T., Ayorinde, K. and Adebunmi, A.
(2017) Phenotypic correlations between egg weight and
some egg quality traits in three varieties of Japanese quail
(Coturnix coturnix japonica). Agrosearch, 17(1): 44-53.
23. Hassan, A.M., Mohammed, D.A., Hussein, K.N. and
********
Veterinary World, EISSN: 2231-0916
Hussen, S.H. (2017) Comparison among three lines of
quail for egg quality characters. Sci. J. Univ. Zakho, 5(4):
296-300.
24. Ashok, A. and Reddy, P.M. (2010) Evaluation of reproduc-
tive traits in three strains of Japanese quail. Vet. World, 3(4):
169-170.
25. Butcher, G. and Miles, R. (1995) Factors causing poor pig-
mentation of brown-shelled eggs. In: Cooperative Extension
Service Fact Sheet VM94. The Institute of Food and
Agricultural Sciences. University of Florida, Gainesville.
26. King’ori, A. (2012) Poultry egg external characteristics:
Egg weight, shape and shell colour. Res. J. Poult. Sci., 5(2):
14-17.
27. Holbrook, D. (2014) How to Determine a Chick’s Gender
Before it Hatches, Animals Diamond Media, Animals Index.
28. Alasahan, S., Akpinar, G.C., Canogullari, S. and Baylan, M.
(2016) The impact of eggshell colour and spot area in
Japanese quails: II. Slaughter and carcass characteristic.
Rev. Bras. Zootec., 45(9): 509-517.
29. Drabik, K., Batkowska, J., Vasiukov, K. and Pluta, A.
(2020) The Impact of eggshell colour on the quality of table
and hatching eggs derived from Japanese quail. Animals,
10(2): 264.
902
 Journal of Advanced Veterinary Research

SPONSORED SEARCHES
impact factor of journals veterinary journal

veterinary system journal ranking

Home / Archives / Vol. 11 No. 1 (2021): January

Vol. 11 No. 1 (2021): January

Published: 2021-01-06

Original Research

The Protective Effect of Silymarin against Ochratoxin A Induced Histopathological and Biochemical Changes in Chicks
Stoycho Stoev, Teodora Mircheva, Stefan Denev, Sashka Chobanova, Veselin Ivanov
1-8

 PDF

Pathological Observations in Horses Naturally Infected with Trypanosoma equiperdum in Western Arsi Zone, Ethiopia
Yonas Gizaw, Hagos Ashenafi, Tilaye Demssie, Merga Bekana, Jan Govaere, Getnet Abei
9-16

 PDF

Behavior, Fear Response, Performance, Carcass Characteristics and Economic Efficiency of Fayoumi Chicks Fed Different Levels of Fennel Seeds
Ghada S.E. Abdel-Raheem, Ramadan D. El Shoukary, Rasha Ibrahim Mohamed
17-23

 PDF

Immunohistochemical Distribution of Immunocompetent Cells in Water Buffalo Spleen (Bubalus bubalis).

Eman Rashad, Shaymaa Hussein, Dina W. Bashir, Zainab Sabry Othman Ahmed, Hany El-Habback
24-35

 PDF

The Association between POU1F1 Gene Polymorphisms and Growth as well as Carcass Traits of Noi Native Chickens
Nguyen Thi Anh Thu, Lam Thai Hung, Ly Thi Thu Lan, Nhan Hoai Phong, Huynh Tan Loc, Luu Huynh Anh, Nguyen Trong Ngu
36-40

 PDF

The The Rich Mapping: Be a Supplementary Approach for Anthrax Control at Community Level
Md. Shahjahan Ali Sarker, Md. Ahosanul Haque Shahid, Md. Nazmul Hoque, M. Asaduzzaman Sarker, Md. Bahanur Rahman, SK Shaheenur Islam
41-46

 PDF

Ultrastructure of Ovarian Follicles and Testes in Zebra-snout Seahorse Hippocampus barbouri (Jordan & Richardson, 1908) under Aquaculture
Conditions
Sinlapachai Senarat, Pisit Poolprasert, Jes Kettratad, Woranop Sukparangsi, Sansareeya Wangkulangkul, Gen Kaneko, Wannee Jiraungkoorskul
47-53

 PDF

Case Report

Pyometra with Irreducible Inguinal Herniation of both Uterine Horns and Ovaries in a Boston Terrier Dog
SHOZO OKANO, Kotaro Nishi, Kenichi Maeda, Satomi Iwai
54-56

 PDF
 Journal of Advanced Veterinary Research Volume 11, Issue 1 (2021) 36-40

Journal of Advanced Veterinary Research

https://advetresearch.com

The Association between POU1F1 Gene Polymorphisms and Growth

as well as Carcass Traits of Noi Native Chickens
Nguyen Thi Anh Thu1, Lam Thai Hung2, Ly Thi Thu Lan1*, Nhan Hoai Phong1,
Huynh Tan Loc3, Luu Huynh Anh3, Nguyen Trong Ngu3
1
School of Agriculture and Aquaculture, Tra Vinh University, 126 Nguyen Thien Thanh, Tra Vinh City, Vietnam
2
Science and Technology Department of Tra Vinh Province, 38 Nguyen Thai Hoc, Tra Vinh City, Vietnam
3
College of Agriculture, Can Tho University, Can Tho City, Vietnam

ARTICLE INFO ABSTRACT

Original Research
26 November 2020
Received:
26 December 2020
Accepted:
The study was conducted to detect and analyze the association between single nucleotide polymor-
phisms (SNP) in the POU1F1 (POU class 1 homeobox 1) gene and growth as well as carcass traits in
Noi native chickens. Blood samples were taken at the wings, DNAs were extracted based on the phenol:
chloroform technique and genotypes were analyzed by PCR-RFLP method. The frequencies of CC geno-
types for three polymorphic sites (POU1F1_HhaI SNP, POU1F1_EcoRI SNP, POU1F1_BspHI SNP) were
the highest. The corresponding C allele frequencies were higher than those of T alleles. Of three poly-
morphisms, POU1F1_BspHI SNP was found to be significantly linked with growth and carcass traits.
Chickens bearing TT genotype showed higher body weight at 91 days, carcass weight, breast weight,
and thigh weight than those of chickens with CC genotype. This SNP can be a useful marker for the se-
lection of Noi chicken for improvement of growth and carcass traits.

Keywords:

Body weight, POU1F1

gene, Polymorphic sites,
Vietnamese chicken
J. Adv. Vet. Res. (2021), 11 (1), 36-40
Therefore, knowledge about functional genes helps the selec-
tion of animals with favorable breeding traits and improves
Introduction
growth rates, body weight, and carcass traits (Manjula et al.,
Native breeds of chickens are playing a crucial role in the
2018).
economy in most countries, especially developing and under-
The POU class 1 homeobox 1 is a transcription factor that
privileged countries because of their taste and eggs that are
binds and transactivates promoters of growth hormone, pro-
suitable for domestic consumers’ demand. Besides, many in-
lactin, and thyroid-stimulating hormone chain encoding genes
digenous poultry breeds have good adaptability to climatic
(Bodner et al., 1988; Ingraham et al., 1988; Steinfelder et al.,
conditions and low nutritional regimes (Tiep, 2011). In the
1992). Previous studies examined the POU1F1 of pigs and cat-
Mekong Delta of Vietnam, Noi chicken is popularly raised and
tle and identified its polymorphisms associated with growth
is considered a native breed with dominant characteristics for
traits (Sun et al., 2002; Xue et al., 2006). Most single nucleotide
good meat quality. However, there still exist some deficiencies
polymorphisms (SNPs) are reported to be associated with
such as low growth rate and low heterogeneity of breed
growth-related traits in chickens (Jiang et al., 2004; Nie et al.,
(Quyen and Son, 2008). Therefore, many solutions including
2008; Bhattacharya et al., 2012). In the present study, the ob-
changing husbandry, feeding, and better health protection
jective was to detect POU1F1 polymorphisms and evaluate
have been applied in order to improve their performance.
their association with growth and carcass traits of Noi chicken.
Nonetheless, genetic improvement is a method that should
be considered due to its long-lasting benefits. Recent achieve-
ments of molecular biology techniques such as quantitative Materials and methods
trait locus analysis and candidate genes provide better tools
for identifying functional genes and breeds to improve eco- Feed and bird care
nomically important traits in animals (Zahra et al., 2011).
A total of 192 Noi chickens of 1-day old were raised with
the diet formula (Table 1) according to Hung et al. (2020).
*Corresponding author: Ly Thi Thu Lan Feeding diets were a mix of yellow maize, soybean meal, rice
E-mail address: thulan@tvu.edu.vn bran, synthetic lysine and methionine, dicalcium phosphate,

ISSN: 2090-6277/2090-6269/ © 2011-2021 JAVR. All rights reserved.

 Nguyen Thi Anh Thu et al. /Journal of Advanced Veterinary Research 11 (1) (2021) 36-40

shell, salt, vitamin premix, and mineral premix. The chemical
composition of feedstuffs is presented in Table 2. In the stage
of 1-28 days of age, chickens were brooded on rice husks with
a density of 50 chickens/m2 and then were raised on a cage
floor with a density of 12 chickens/m2. Chickens were fed and
given fresh water ad libitum throughout the experiment.
Chickens were vaccinated via eye drops against Newcastle dis-
ease on the 5th day and infectious bursa on the 7th and 21st
day; via ingestion against Newcastle disease on the 28th day.
Chickens were managed separately by numbering their feet.
Body weight and carcass characteristics
Chickens were weighed individually at 1, 35, 63, and 91
days of age at 6 a.m. before feeding to determine body weight
and daily weight gain. At the end of the experiment, all chick-
ens were slaughtered (at 91 days) to determine carcass, breast
and thigh weight. The corresponding ratios were calculated
based on the description of Faria et al. (2010).
Markers and primers
According to the research by Manjula et al. (2018), three
primers of POU1F1_HhaI, POU1F1_EcoRI, and POU1F1_BspHI
were used to identify mutations g.6758T>C (Exon 5),
g.9432T>C (Intron 5), and g.11041T>C (Exon 6) on the chicken
population in the experiment. The detailed information about
primers is shown in Table 3.
Extraction of feather DNA
Chicken DNAs were isolated by phenol/chloroform
method (Bello et al, 2001). Breast muscles were chopped into
small pieces and mixed with lysis buffer for incubation
overnight at 37oC. In the next step, 300 µL phenol: chloroform:
isoamyalcohol (25:24:1) was added into the sample, mixed and
centrifuged at 10.000 rpm for 5 min. The supernatant was then
transferred into a 2 mL tube and added 700 µL phenol: chlo-
roform, swirled and centrifuged at 10.000 rpm for 5 min. The
supernatant was recovered in a new clean tube with 700 µL
chloroform, swirled and centrifuged at 10.000 rpm for 5 min.
The upper phase was transferred into a new clean tube con-
taining 300 µL 1.2M NaCl; 150 µL 2M sodium acetate and 1000
µL cold ethanol (100%) and mixed gently by the hand and
centrifuged at 10.000 rpm for 5 min to collect DNA pellet. A
total of 1.000 µL ethanol 75% was used for DNA washing, air-

Table 1. Experimental diets of Noi chickens

Diets
Feedstuffs
1-28 day 29-56 day 57-84 day
Yellow maize (%) 56.33 56.13 53.6
Soybean meal (%) 29.28 23.4 16.96
Rice bran (%) 9.53 15.7 25.41
Lysine (%) 0.62 0.54 0.45
Methionine* (%) 0.19 0.18 0.17
DCP (%) 1.6 1.6 1
Shell (kg) 1.8 1.8 1.76
Premix** (%) 0.25 0.25 0.25
Salt (%) 0.4 0.4 0.4
Nutritional value of diets
ME (kcal/kg of feed) 2,900 2.9 2,900
CP (%) 19 17 15
Lysine (%) 1.1 1 0.9
Methionine (%) 0.79 0.72 0.64
Threonine (%) 0.86 0.81 0.78
Tryptophan (%) 0.35 0.31 0.25
Calcium (%) 1.18 1.18 1.03
Phosphorus (%) 0.84 0.89 0.8
DCP: dicalcium phosphate; *: ingredient source from methionine calculated both methionine and cysteine requirement; **: premix including vitamin and
micro-minerals; ME: metabolism energy; CP: crude protein

Table 2. Chemical composition of feedstuffs

Chemical composition (% feed)
Feedstuffs
DM ME, kcal/kg CP Lys Met+cys Thr Ca P
Yellow maize 85.81 3,335 6.94 0.25 0.369 0.234 0.21 0.31
Soybean meal 87.94 2,631 44.87 0.949 1.277 2.124 0.4 0.69
Rice bran 87.86 2,624 12.01 0.61 0.22 1.17 0.375 1.58
DM: dry matter, ME: metabolism energy, CP: crude protein, Lys: lysine, Met+cys: methionine + cysteine; Thr: threonine; Ca: calcium; and P: phosphorus

Table 3. PCR-RFLP primers and restriction enzymes used to identify POU1F1 gene polymorphisms
Markers Location(1) Region Primer (Forward/Reverse) (5'-3') Restriction enzyme Amplicon (bp)
AGTATAGCTCTGTGGTGCAC
POU1F1_HhaI g.6758T>C Exon 5 HhaI 626
TATGCCCTCAGATGTCCCAG
GGGGATTTTGCCACTTTAGGG
POU1F1_EcoRI g.9432T>C Intron 5 EcoRI 442
TGGGTAAGGCTCTGGCACTGT
GGGGTACCACTCAACTTCAG
POU1F1_BspHI g.11041T>C Exon 6 BspHI 750
TAGGGTACCTGCAATGGGGG

37
 Nguyen Thi Anh Thu et al. /Journal of Advanced Veterinary Research 11 (1) (2021) 36-40
dried, and stored in 1x TE buffer solution at pH 8.0.
Genotyping by PCR-RFLP procedure
Three polymorphisms of chicken POU1F1 gene
(POU1F1_HhaI, POU1F1_EcoRI, POU1F1_BspHI) were geno-
typed by polymerase chain reaction-restriction fragment
length polymorphism (PCR-RFLP) method (Table 3). Genotyp-
ing of SNPs in POU1F1 was conducted by the method of Man-
jula et al. (2018).
The PCR was performed with a volume of 10 µL with 50
ng of genomic DNA, 0.25M each primer, 0.25M each dNTP, 1X
PCR buffer, and 1U Taq DNA polymerase. The thermal cycles
were as follows: 94°C for 10 min; 35 cycles of 94°C for 30 s, Ta
each primer ranged from 60°C to 67°C within 30 s, and 72°C
within 30 s; and 72°C within 10 min for the final extension. PCR
products were further digested at 37°C overnight with HhaI,
EcoRI, BspHI restriction enzymes (Table 3). Genotypes of poly-
morphisms were determined under UV light after elec-
trophoresis on 2.0% agarose gel at 80 V, 400 mA within 30
min.
Statistical analysis
Genotype frequencies of the candidate genes were ana-
lyzed by using Microsoft Excel and the method of Rodriguez
et al. (2009) was applied to estimate the Hardy-Weinberg
Equilibrium (HWE). The association between genotypes to
production of chicken was analyzed on the GLM program of
the Minitab 16 software.
Results
Table 4 showed the genotypes, allele frequencies for three
markers (POU1F1_HhaI SNP, POU1F1_EcoRI SNP,
POU1F1U_BspHI SNP) and Chi-Square tests for Hardy-Wein-
berg equilibrium. In POU1F1_HhaI SNP, the CC genotype was
the most frequent (0.89), and the CT genotype was the least
frequent (0.11); the TT genotype did not appear. The CC, CT,
and TT genotype frequencies of POU1F1_EcoRI SNP were 0.51,
0.38, and 0.11, respectively. In POU_BspHI SNP, the frequency
of the TT genotype was 0.17 while the frequency of the CC
and CT genotypes were 0.40 and 0.43, respectively. All SNPs
followed the Hardy-Weinberg equilibrium (P>0.05).
Association of SNPs with growth traits
Table 5 indicated that genotypes of POU1F1_HhaI SNP
and POU1F1_EcoRI SNP were not importantly associated with
any of the growth traits tested in Noi chickens. However,
POU1F1_BspHI SNP was significantly associated with body
weight at 91 days old (BW91) and weight gain from 0 to 13
weeks of age (GR1-91) (P<0.05). In POU1F1_BspHI SNP, the
highest BW91 was found in the TT genotype (1,040 g), while
the lowest was observed in the CC type (946.0 g). Similarly, for
weight gain, GR1-91, the TT animals had a higher weight gain
than the CC animals, while the CT type showed moderate
weight gain.
Table 4. Genotype and gene frequency of POU1F1 SNP polymorphisms in Noi chicken
Genotype frequency
Polymorphic sites
CC CT
POU1F1_HhaI SNP 0.89 0.11
POU1F1_EcoRI SNP 0.51 0.38
POU1F1_BspHI SNP 0.4 0.43
Association of SNPs with carcass characteristics
The results in Table 6 showed that POU1F1_HhaI SNP and
POU1F1_EcoRI SNP were not associated with traits of the car-
cass, breast and thigh weight; and carcass, breast, and thigh
ratio. However, POU1F1_BspHI SNP was clearly associated with
the traits of the carcass, breast and thigh weight. In
POU1F1_BspHI SNP, chickens with the TT, CT, and CC geno-
types were found to obtain the average carcass weight (706.9
g), (655.0 g) and (635.3 g), respectively; the average breast
weight (88.95 g), (84.10 g) and 82.32 g, respectively; the aver-
age thigh weight (159.0 g), (147.7 g) and (143.4 g), respec-
tively.
Discussion
The present study was undertaken to identify polymor-
phisms in the POU1F1 gene that were related to growth, live
weight gain, and carcass traits in Noi chicken. The results
showed that the CC genotype was more frequently observed
than other genotypes in Noi chickens, and the C allele fre-
quency was higher than that of the T allele in all SNPs. Besides,
all SNPs were in Hardy-Weinberg equilibrium in the native Noi
chicken population. This result was similar to the study of
Manjula et al. (2018) in a survey on Korean native chickens.
The authors also found that the frequency of the CC genotype
(ranging from 0.844 to 0.868) as well as the C allele in all three
surveyed polymorphisms was higher than that of the TT geno-
type and T allele in the population. Similarly, the current re-
search results are also supported by Nie et al. (2008) that the
number of individuals with the CC genotype (335/451 chick-
ens) was higher than that of the TT genotype (11/451 chick-
ens) when surveying of the POU1F1_EcoRI SNP polymorphism.
POU1F1 gene is also known as PIT1 that is responsible for
regulating a variety of important biological activities, so it is
considered a potential candidate gene for the productivity
trait. Many studies have shown that the PIT1 gene is related
to carcass and growth traits in pigs (Song et al., 2002 and
Franco et al., 2005) and in cows (Zhao et al., 2004; Xue et al.,
2006). In chickens, a total of 23 SNPs and one 57 bp indel were
identified on the mysterious 2,400 bp gene of the PIT1 gene,
but the genetic effects on the chicken production traits were
not clear (Nie et al., 2005). It has been proved that a non-syn-
onymous SNP at POU domain (A → T, Asn229Ile) has a signif-
icant link to body weight at 8 weeks of age (Jiang et al., 2004).
In addition, Nie et al. (2008) also found 5 polymorphisms
(MR1-MR5) on the PIT1 gene that were significantly associ-
ated with shank diameters, hatch weight, shank length, body
weight, and average daily gain. Research by Jin et al. (2018)
also found the association between PIT1 gene and body
weight, feed intake as well as FCR of chickens, in which TT
genotype of rs13687128 polymorphism and AA genotype in
rs13905622 polymorphism are potential markers. In the poly-
morphism POU1F1_BspHI, Manjula et al. (2018) found that the
CC genotype is more dominant than CT and TT genotypes in
Korean native chickens in terms of body weight and weight
gain. In the current study, three mutations of POU1F1_HhaI,
POU1F1_EcoRI, and POU1F1_BspHI were surveyed on 425 Noi
Allele frequency p-value (Hardy-
TT C T Weinberg)
0 0.94 0.06 0.509
0.11 0.7 0.3 0.131
0.17 0.61 0.39 0.34
38
 Nguyen Thi Anh Thu et al. /Journal of Advanced Veterinary Research 11 (1) (2021) 36-40

Table 5. Association of POU1F1 polymorphisms and growth traits

Genotype of POU1F1_HhaI SNP
Traits(1) p-value
CC (112) CT (14) TT (0)
BW01 31.9±0.27 31.2±0.77 - 0.346
BW35 182.6±2.47 173.6±6.99 - 0.223
BW63 548.2±8.55 545.1±24.2 - 0.9
BW91 960.7±12.9 1,002±36.4 - 0.276
GR1-35 4.43±0.07 4.19±0.21 - 0.27
GR36-63 13.5±0.28 13.8±0.80 - 0.793
GR64-91 15.3±0.30 16.9±0.85 - 0.064
GR1-91 10.4±0.14 10.9±0.91 - 0.267
Genotype of POU1F1_EcoRI SNP
CC (92) CT (68) TT (21)
BW01 31.6±0.30 32.3±0.35 31.6±0.64 0.319
BW35 182.6±2.85 178.1±3.30 182.7±6.08 0.559
BW63 559.4±9.79 551.4±11.3 515.9±20.9 0.173
BW91 972.0±14.3 971.3±16.5 949.2±30.5 0.785
GR1-35 4.44±0.08 4.29±0.10 4.45±0.18 0.471
GR36-63 13.9±0.31 13.8±0.36 12.3±0.67 0.088
GR64-91 15.3 ±0.34 15.6±0.39 16.1±0.72 0.61
GR1-91 10.6±0.16 10.6±0.19 10.3±0.34 0.791
Genotype of POU1F1_BspHI SNP
CC (47) CT (51) TT (20)
BW35 184.4±3.67 179.1±3.52 189.7±5.62 0.256
BW63 543.8±12.1 552.5±11.6 583.0±18.6 0.21
BW91 946.0±17.8b 968.9±17.1ab 1,040±27.4a 0.018
GR1-35 4.43±0.11 4.31±0.10 4.66±0.16 0.208
GR36-63 13.2±0.38 13.8±0.37 14.4±0.57 0.223
GR64-91 14.7±0.46b 15.4±0.45ab 16.8±0.70a 0.055
GR1-91 10.2±0.20b 10.5±0.19ab 11.2±0.30a 0.015
(1) BW01, body weight at one-day-old; BW35, body weight at 35 days old; BW63, body weight at 63 days old; BW91, body weight at 91 days old; GR1-
35, weight gain from 1 to 35 days old; GR36-63, weight gain from 36 to 63 days old; GR64-91, weight gain from 64 to 91 days old; GR1-91, weight gain
from 1 to 91 days old.
a,b Least square mean within a row with different superscript differ significantly (P<0.05).

Table 6. Association of POU1F1 polymorphisms and carcass characteristics

Genotype of POU1F1_HhaI SNP

Traits p-value
CC CT TT
Carcass weight, g 646.5±9.54 680.4±26.9 - 0.238
Breast weight, g 83.3±0.91 87.0±2.58 - 0.18
Thigh weight, g 146.6±1.21 149.5±3.41 - 0.423
Carcass ratio, % 67.2±0.24 67.7±0.68 - 0.553
Breast ratio, % 13.0±0.12 13.0±0.33 - 0.99
Thigh ratio, % 22.9±0.20 22.5±0.55 - 0.421
Genotype of POU_EcoRI SNP
CC CT TT
Carcass weight, g 657.1±10.7 656.9±12.4 627.9±22.8 0.486
Breast weight, g 84.0±1.06 84.2±1.23 84.2±2.26 0.991
Thigh weight, g 147.7±1.36 148.4±1.57 141.7±2.90 0.121
Carcass ratio, % 67.5±0.27 67.5±0.31 66.2±0.57 0.112
Breast ratio, % 12.9±0.12 12.9±0.14 13.5±0.26 0.136
Thigh ratio, % 22.7±0.21 22.9±0.24 22.7±0.44 0.807
Genotype of POU_BspHI SNP
CC CT TT
Carcass weight, g 635.3±13.2b 655.0±12.7ab 706.9±0.27a 0.015
Breast weight, g 82.3±1.34b 84.1±1.29ab 88.9±2.06a 0.029
Thigh weight, g 143.4±1.92b 147.7±1.84b 159.0±2.94a 0.001
Carcass ratio, % 67.1±0.31 67.5±0.30 67.9±0.49 0.358
Breast ratio, % 12.9±0.14 12.9± 0.13 12.8±0.21 0.833
Thigh ratio, % 22.8±0.24 22.8±0.23 22.7 ±0.37 0.966

39
 Nguyen Thi Anh Thu et al. /Journal of Advanced Veterinary Research 11 (1) (2021) 36-40
chickens. The results showed that POU1F1_BspHI polymor-
phism is significantly associated with BW91, GR1-91, carcass
weight, breast weight, and thigh weight, where the TT geno-
type showed association with the highest value from 0 to 13
weeks of age. In chickens, this gene is located on chromosome
1 and plays an important role in controlling growth perform-
ance. Polymorphism in this gene can control the expression
of the aforementioned hormone. Therefore, it can affect the
metabolic activity and skeletal muscle development of chick-
ens. Based on the results in Tables 5 and 6, it can be seen that
the TT genotype is of potential in chicken development con-
cerning the increase in carcass yield and quality.
For the two polymorphisms POU1F1_HhaI and
POU1F1_EcoRI, the current study could not find any associa-
tion with growth traits. Similarly, at the POU1F1_HhaI locus,
Manjula et al. (2018) also found no association of this poly-
morphism with chicken productivity traits. However, for
POU1F1_EcoRI polymorphism, Nie et al. (2008) found its as-
sociation with shank length at 63, 77, 84 days and BW at 84
days, as well as shank diameters at 77 days, where T allele was
shown to be potential for chicken growth. Furthermore, in this
polymorphism, Manjula et al. (2018) found a significant asso-
ciation with body weight and weight gain in Korean native
chickens, where the CC genotype was of potential for chicken
selection with high productivity.
Conclusion
This study indicated that POU1F1_BspHI SNP affects the
growth of native Noi chickens. The POU1F1_BspHI SNP is sig-
nificantly associated with body weight at 91 days old, weight
gain from 0 to 13 weeks of age, and carcass characteristics
(carcass, breast, and thigh weight). This SNP can be used for
improving growth and carcass traits of Noi chickens and is of
interest for testing in other native chicken populations.
Acknowledgement
This research is funded by the scientific research grant of
Tra Vinh University.
Conflict of interest
Authors declare no conflict of interest.
References
Bello, N., Francino, O., Sánchez, A., 2001. Isolation of genomic DNA
from feathers. J. Vet. Diagn. Invest. 13, 162-164.
Bhattacharya, T.K., Chatterjee, R.N., Priyanka, M., 2012. Polymorphisms
of Pit-1 gene and its association with growth traits in chicken.
Poult. Sci. 91, 1057-1064.
Bodner, M., Castrillo, J.L., Theill, L.E., Deerinck, T., Ellisman, M., Karin,
M., 1988. The pituitary-specific transcription factor GHF-1 is
a homeobox- containing protein. Cell 55, 505-518.
Faria, P.B., Bressan, M.C., Souza, X.R., Rossato, L.V., Botega, L.M.G.,
Gama, L.T., 2010. Carcass and parts yield of broilers reared
under a semi-extensive system. Rev. Bras. Cienc. Avic. 12, 153-
159.
Franco, M.M., Antunes, R.C., Silva, H.D., Goulart, L.R., 2005. Association
of PIT1, GH and GHRH polymorphisms with performance and
carcass traits in Landrace pigs. J. Appl. Genet. 46, 195-200.
Hung, L.T., Lan, L.T.T., Phong, N.H., Nhan, N.T.H., Ngu, N.T., 2020. Ef-
fects of lysine supplementation on growth of Noi broilers.
Livest. Res. Rura. Dev. 32.
Ingraham, H.A., Chen, R.P., Mangalam, H.J., Elsholtz, H.P., Flynn, S.E.,
Lin, C.R., Simmons, D.M., Swanson, L., Rosenfeld, M.G., 1988.
A tissue-specific transcription factor containing a home-
odomain specifies a pituitary phenotype. Cell 55, 519-529.
Jiang, R., Li, J., Qu, L., Li, H., Yang, N., 2004. A new single-nucleotide
polymorphism in the chicken pituitary-specific transcription
factor (POU1F1) gene associated with growth rate. Anim.
Genet. 35, 344-346.
Jin, S., He, T., Yang, L., Tong, Y., Chen, X., Geng, Z. 2018. Association of
polymorphisms in Pit-1 gene with growth and feed efficiency
in meat-type chickens. Asian-Australasian J. Anim. Sci. 31,
1685-1690.
Manjula, P., Choi, N., Seo, D., Lee, J.H., 2018. POU class 1 homeobox 1
gene polymorphisms associated with growth traits in Korean
native chicken. Asian-Australasian J. Anim. Sci. 31, 643-649.
Nie, Q.H., Lei, M., Ouyang, J., Zeng, H., Yang, G., Zhang, X., 2005. Iden-
tification and characterization of single nucleotide polymor-
phisms in 12 chicken growth-correlated genes by denaturing
high performance liquid chromatography. Genet. Sel. Evol. 37,
339-360.
Nie, Q.H., Fang, M.X., Xie, L., Zhou, M., Liang, Z.M., Luo, Z.P., Wang,
G.H., Bi, W.S., Liang, C.J., Zhang, W., Zhang X.Q., 2008. The PIT-
1gene polymorphisms were associated with chicken growth
traits. BMC Genet. 9, 20-24.
Quyen, N.V., Son, V.V., 2008. Reproductive performance of Noi chick-
ens in the Mekong Delta. Agr. Rural. Dev. J. 3, 46-48.
Rodriguez, S., Gaunt, T.R., Day, I.N.M., 2009. Hardy-Weinberg equilib-
rium testing of biological ascertainment for Mendelian ran-
domization studies. American. J. Epide. 169, 505-514.
Song, C., Gao, B., Teng, Y., Wang, X., Wang, Z., Li, Q., Mi, H, Jing, R.,
Mao, J., 2005. MspI polymorphisms in the 3rd intron of the
swine POU1F1 gene and their association with growth per-
formance. J. Appl. Genet. 46, 285-289.
Steinfelder, H.J., Radovick, S., Wondisford, F.E., 1992. Hormonal regu-
lation of the thyrotropin beta-subunit gene by phosphoryla-
tion of the pituitary-specific transcription factor Pit-1. Proc.
Natl. Acad. Sci. U.S.A. 89, 5942-5945.
Sun, H.S., Anderson, L.L., Yu, T.P., Kima, K.S., Klindt, J., Tugglea, C.K.,
2002. Neonatal Meishan pigs show POU1F1 genotype effects
on plasma GH and PRL con centration. Anim. Reprod. Sci. 69,
223-237.
Tiep, N.B., 2011. Anti-disease genes in livestock and potential contri-
butions from local Vietnamese breeds. J. Sci. Dev., Hanoi Uni.
Agri. 9, 798-806.
Xue, K., Chen, H., Wang, S., Cai, X., Liu, B., Zhang, C.F., Lei, C.Z., Wang,
X.Z., Wang, Y.M., Niu, H., 2006. Effect of genetic variations of
the POU1F1 gene on growth traits of Nanyang cattle. Yi
Chuan Xue Bao 33, 901-907.
Zahra, R., Masoud, A., Hamid, R.S., Cyrus, A., 2011. Identification of a
single nucleotide polymorphism of the pituitary-specific trans
criptional factor 1 (Pit 1) gene and its association with body
composition trait in Iranian commercial broiler line. African J.
Biotech. 60, 12979-12983.
Zhao, Q., Davis, M.E., Hines, H.C., 2004. Associations of polymor-
phisms in the Pit-1 gene with growth and carcass traits in
Angus beef cattle. J. Anim. Sci. 82, 2229-2233.
40
KHKT Chăn nuôi Số 271 - tháng 11 năm 2021

Tổng biên tập: DI TRUYỀN - GIỐNG VẬT NUÔI

TS. ĐOÀN XUÂN TRÚC Phạm Ngọc Trung, Nguyễn Hữu Tỉnh và Ngô Xuân Đông. Chọn lọc hai dòng lợn nái
Yorkshire và Landrace dựa trên kiểu Gen ESR, FSHB kết hợp chỉ số nái sinh sản tại
Phó Tổng biên tập: Công ty chăn nuôi Nhật Minh 2
PGS.TS. NGUYỄN ĐĂNG VANG Nguyễn Văn Trung, Nguyễn Trọng Ngữ và Phạm Văn Giới. Mối liên kết giữa đa
hình gen OVGP1 và LIF với năng suất sinh sản của lợn Hung và lợn Mẹo 6
PGS.TS. NGUYỄN VĂN ĐỨC
Nguyễn Ngọc Tấn, Phan H u Hương Trinh, Lê Thị Thanh, Trầm Minh Th nh

ữ
à
v Lê T n Lợi. Bi u hiện gen VEGF-R1 trên mẫu mô buồng trứng v phức h p
Thư ký tòa soạn:

à
ấ
ể
à
ợ
Cumulus-t b o trứng heo ở c c giai đo n ph t tri n kh c nhau 11
PGS.TS. NGUYỄN VĂN ĐỨC

ế
à
á
ạ
á
ể
á
Nguyễn Khánh Vân, Phạm Th Kim Yến, Vũ Th Thu Hương và Phạm Doãn Lân.

ị
ị
Ảnh hư ng của tế bào Cumulus đến hi u quả thụ tinh và tạo phôi bò in vitro 17

ở
ệ
Ủy viên Ban biên tập: Tr n Đức Hoàn, Nguyễn Đình Nguyên và Nguyễn Việt Đức. Khả năng sản xuất của

ầ
TS. NGUYỄN QUỐC ĐẠT lợn đực giống Yorkshire nuôi tại Công ty Cổ phần giống chăn nuôi Bắc Giang 23
PGS.TS. HOÀNG KIM GIAO Phạm Văn Quyến, Nguyễn Th Thủy, Hoàng Th Ngân, Nguyễn Văn Tiến, Giang Vi

ị
ị
GS.TS. NGUYỄN DUY HOAN Sal, Bùi Ngọc Hùng, Nguyễn Thanh Tùng, Nguyễn Th Ngọc Anh, Hồ Ngọc Trâm

ị
GS.TS. DƯƠNG NGUYÊN KHANG và Phương Khánh Hồng. Hi n trạng chăn nuôi bò thịt và cơ cấu giống bò thịt tại tỉnh

ệ
Tây Ninh 30
PGS.TS. NGUYỄN THỊ KIM KHANG
PGS.TS. ĐỖ VÕ ANH KHOA
PGS.TS. ĐỖ ĐỨC LỰC DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI
Tr n Th Bích Ngọc, Nguyễn Đình Tường, Dương Th Oanh, Ninh Th Huyền và
GS.TS. LÊ ĐÌNH PHÙNG
ầ
ị
ị
ị
Tr n Hiệp. Ảnh hư ng của tỷ l Lysine tiêu hóa/năng lượng trong khẩu phần ăn của
ầ
ở
ệ
lợn nái ngoại nuôi con đến năng suất sinh sản trong điều ki n chu ng h 39
Xuất bản và Phát hành:

ệ
ồ
ở
Nguyễn Bình Trường và Trương Thanh Trung. Ảnh hư ng các m c bổ sung th c
ThS. NGUYỄN ĐÌNH MẠNH

ở
ứ
ứ
ăn hỗn hợp đến tiêu thụ và tiêu hóa dưỡng chất th c ăn bò lai Wagyu giai đoạn 9-12

ứ
tháng tuổi tại An Giang 44

U Nguyễn Thiết, Trương Văn Khang và Nguyễn Trọng Ngữ. Ảnh hư ng của bổ sung

ở
bột hoa chuối lên lượng ăn vào và tỷ l tiêu hóa dưỡng chất của dê thịt lai 51
ệ
CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC
Nguy n Thị Th y. Ảnh hư ng c a cách cho ăn đến năng suất và hi u quả kinh tế
ễ
ủ
ở
ủ
ệ
trong chăn nuôi gà Nòi chu ng h 56
Giấy phép: Bộ Thông tin và Truyền thông
ồ
ở
Nguy n Hồng Nhung. Hi u quả chăn nuôi vịt thịt nông hộ tại thị xã Long Mỹ, tỉnh
ễ
ệ
Số 257/GP- BTTTT ngày 20/05/2016 Hậu Giang 61
ISSN 1859 - 476X Tr n Ngọc Tiến, Phạm Th Xuân, Khuất Th Tuyên, Nguyễn Th Minh Hường và
ầ
ị
ị
ị
Nguyễn Th Luyến. Khả năng sản xuất của vịt lai thương phẩm (VSDxSTAR53) nuôi
Xuất bản: Hàng tháng
ị
an toàn sinh học tại Thái Bình 66
Toà soạn: Tăng Th Chính, Phùng Đức Hiếu, Nguyễn Th Thanh Lan, Đinh Th Ngọc Thúy
ị
ị
ị
Địa chỉ: Tầng 4, Tòa nhà 73, và Nguyễn Th Diệu Thúy. Sử dụng chế phẩm vi sinh ưa nhi t Sagi bio xử lý chất
ị
ệ
thải rắn chăn nuôi bò sữa thành phân bón hữu cơ tại Sơn La. 71

Hoàng Cầu, Ô Chợ Dừa,
Đống Đa, Hà Nội. Đặng Hồng Quyên, Nguyễn Văn Lưu, Đỗ Th Thu Hường, Nguyễn Th Hạnh và
ị
ị
Nguyễn Công Thành. Năng suất và chất lượng thịt ếch Thái Lan nuôi tại trường Đại
Điện thoại: 024.36290621 học Nông lâm Bắc Giang 76
Fax: 024.38691511 Nguyễn Vĩ Nhân và Nguy n Thị Ngọc Linh. Hoạt tính kháng khuẩn của cao chiết từ
ễ
E - mail: tapchichannuoi@hoichannuoi.vn lá mật gấu trên vi khuẩn Bacillus cereus và Escherichia coli 81
Website: www.hoichannuoi.vn Quan Kim Vy và Tr n Th Thảo. B nh Carré trên chó tại thành phố Vĩnh Long 85
ầ
ị
ệ
Tài khoản:
THÔNG TIN KHOA HỌC VÀ CÔNG NGHỆ
Tên tài khoản: Hội Chăn nuôi Việt Nam
PGS.TS. Nguyễn Văn Đức. Xu hướng chăn nuôi bò sữa, thị trường sữa và các sản
Số tài khoản: 1300 311 0000 40, tại Ngân hàng phẩm sữa 90
Nông nghiệp và Phát triển Nông thôn, Chi nhánh GS.TS. Nguyễn Xuân Trạch. Đạo đ c trong công bố khoa học 92
Thăng Long - Số 4, Phạm Ngọc Thạch, Hà Nội.
ứ
PGS.TS. Nguyễn Văn Đức. Giải pháp thay thế kháng sinh được xác định 96
In 1.000 bản, khổ 19x27 tại Công ty CP KH&CN PGS.TS. Nguyễn Văn Đức. Nước là một trong những yếu tố quan trọng trong ngành
Hoàng Quốc Việt. In xong và nộp lưu chiểu: chăn nuôi lợn 97
tháng 11/2021. PGS.TS. Nguyễn Văn Đức. Protein côn trùng - nhu cầu lớn trong h thống th c ăn
ệ
ứ
và thực phẩm đặc sản của những thế kỷ tới 99
DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI

14. Neves M.L.M.W., Véras A.S.C., Souza E.J.O.D., Ferreira
M.D.A., Filho S.D.C.V., Silva G.S.D., Carvalho F.F.R.D.,
Oliveira D.J.G.D., Lima E.R.D. and Barreto L.M.G.
(2016). Energy and protein requirements of crossbred
cattle in feedlot. Semina: Ciências Agrarias, Londrina,
37(2): 1029-44.
15. Park Y.B. and Cosgrove D.J. (2015). Xyloglucan and its
Interactions with Other Components of the Growing Cell
Wall. Plant Cell Physiol., 56(2): 180-94.
16. Peng H.Q., Khan A.N., Xue B., Yan H.T. and Wang S.Z.
(2018). Effect of different levels of protein concentrates
supplementation on the growth performance, plasma
amino acids profle and mTOR cascade genes expression
in early-weaned yak calves. Asian-Aust J. Anim. Sci.,
31(2): 218-24.
17. Đỗ Văn Quang, Đậu Văn Hải, Doyle P. và Parsons D.
(2011). Ảnh hưởng của các mức bổ sung thức ăn tinh hỗn
hợp đến tăng trọng, tiêu hóa các chất dinh dưỡng của bò
lai Brahman nuôi thịt. Tạp chí NN&PTNT, 1(11.11): 60-66.
18. Nguyễn Văn Tiến, Chế Minh Tùng, Phí Như Liễu,
Hoàng Thị Ngân và Đỗ Văn Quang (2016). Ảnh hưởng
của mức thức ăn tinh (hỗn hợp) trong khẩu phần đến khả
năng sinh trưởng và tỷ lệ tiêu hoá của bò Lai Brahman x
Lai Sind. Tạp chí KHCN Chăn nuôi, 68(10.16): 44-51.
19. Nguyễn Bình Trường và Nguyễn Văn Thu (2019). Khảo
sát hàm lượng xơ trung tính (neutral detergent fiber -
NDF) trong khẩu phần của bò thịt tại tỉnh An Giang. Tạp
chí KHCN Chăn nuôi, 101(7.2019): 57-67.
20. Nguyễn Văn Thu (2020). Ảnh hưởng của bột ngô trong
khẩu phần cỏ voi đến sự thải khí gây hiệu ứng nhà kính,
tỷ lệ tiêu hóa và tích lũy đạm của bò lai Sind. Tạp chí
KHCN Chăn nuôi, 117(11.20): 36-46.
21. Đoàn Đức Vũ (2019). Đánh giá khả năng sinh trưởng của
một số công thức lai bò thịt ba máu. Tạp chí KHCN Chăn
nuôi, 97(03.19): 2-10.
22. Van Soest P.J., Robertson J.B. and Lewis B.A. (1991).
Methods for dietary fiber, neutral detergent fiber and
non-starch polysacharides in relation to animal nutrition,
J. Dairy Sci., 74: 3583-98.

ẢNH HƯỞNG CỦA BỔ SUNG BỘT HOA CHUỐI LÊN LƯỢNG

ĂN VÀO VÀ TỶ LỆ TIÊU HÓA DƯỠNG CHẤT CỦA DÊ THỊT LAI
Nguyễn Thiết2*, Trương Văn Khang1 và Nguyễn Trọng Ngữ1
Ngày nhận bài báo: 10/07/2021 - Ngày nhận bài phản biện: 10/08/2021
Ngày bài báo được chấp nhận đăng: 20/08/2021
TÓM TẮT
Thí nghiệm này được thực hiện nhằm đánh giá ảnh hưởng của bổ sung bột hoa chuối lên
lượng ăn vào và tỷ lệ tiêu hóa dưỡng chất của dê thịt lai. Thí nghiệm được bố trí hai hình vuông
latin 4x4, với 4 giai đoạn và 4 nghiệm thức (NT). Bốn NT gồm: đối chứng (ĐC), bổ sung 1,5% bột
hoa chuối (HC1.5), bổ sung 3% bột hoa chuối (HC3.0), bổ sung 4,5% bột hoa chuối (HC4.5). Các chỉ
tiêu theo dõi là: lượng vật chất khô ăn vào, lượng nước uống, pH dịch dạ cỏ, thể tích nước tiểu và
tỷ lệ tiêu hóa dưỡng chất. Kết quả thí nghiệm cho thấy bổ sung bột hoa chuối không ảnh hưởng
đến lượng thức ăn tiêu thụ, nước uống, thể tích nước tiểu và trọng lượng của dê. Tuy nhiên, lượng
Na và K ăn vào tăng với tỷ lệ bổ sung bột hoa chuối tăng (P<0,05). Kết quả là pH dịch dạ cỏ cũng
tăng khi tỷ lệ bột hoa chuối tăng trong khẩu phần. Tỷ lệ tiêu hóa dưỡng chất cao nhất ở NT HC4.5
và thấp nhất ở NT ĐC. Kết quả từ thí nghiệm hiện tại cho thấy bổ sung bột hoa chuối với tỷ lệ 4,5%
trong khẩu phần của dê thịt đã cải thiện pH dịch dạ cỏ và tỷ lệ tiêu hóa dưỡng chất, đặc biệt là tỷ
lệ tiêu hóa ADF và NDF.
Từ khóa: Bột hoa chuối, dê thịt, tỷ lệ tiêu hóa, pH dạ cỏ.
ABSTRACT
The effects of different levels of banana flower powder supplementation on intakes and
nutrients digestibility in growing crossbred goats
This study was carried out to determine the effects of different levels of banana flower
powder supplementation on intakes and nutrients digestibility in growing crossbred goats. The
study was assigned as two replications of 4x4 Latin square design, consisting of four periods and

2
Trường Đại học Cần Thơ
* Tác giả liên hệ: TS. Nguyễn Thiết, Khoa Phát triển Nông thôn, Trường Đại học Cần Thơ. Điện thoại: 0932147900; Email:
nthiet@ctu.edu.vn

KHKT Chăn nuôi số 271 - tháng 11 năm 2021 51

 DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI

four treatments. The treatments were without supplementation of banana flower powder (ĐC),
supplement with 1.5% banana flower powder (HC1.5), supplement with 3.0% banana flower
powder (HC3.0) and supplement with 4.5% banana flower powder (HC4.5). The parameters were
nutrients and water intake, ruminal pH, urine volume and nutrients digestibility. The results from
this study showed that banana flower powder supplementation did not affect on nutrients and
water intake, urine volume and body weight. However, Na and K intakes increased as the banana
flower powder supplementation increased (P<0.05). Goats supplement with banana flower powder
have improved ruminal pH and nutrients digestibility, particularly between HC4.5 and ĐC groups.
The results from present study indicated that goats consumed with 4.5% banana flower powder
which would improve ruminal pH and followed by nutrients digestibility, particularly ADF and
NDF digestibility.
Keywords: Banana flower powder, crossbred goat, digestibility, ruminal pH.

1. ĐẶT VẤN ĐỀ
Tổng số lượng đàn dê trong cả nước giai
đoạn 2015-2019 tăng trung bình 6,4%/năm, cụ
thể từ 1,78 triệu con lên 2,61 triệu con (Niên
giám Thống kê, 2015 và 2019). Khả năng sản
xuất của dê nói riêng, vật nuôi nói chung
phụ thuộc rất nhiều các yếu tố trong đó dinh
dưỡng là một trong những yếu tố quan trọng.
Chính vì vậy, bên cạnh việc chọn lọc, cải tiến
di truyền thì việc tăng cường nuôi dưỡng với
khẩu phần có mức dinh dưỡng cao, thích hợp
sẽ phát huy tốt hơn tiềm năng di truyền, nâng
cao khả năng sản xuất thịt của chúng. Ở gia
súc nhai lại thường duy trì pH ở dạ cỏ thích
hợp trong khoảng 6,3-6,8 cho hoạt động của vi
khuẩn phân giải xơ (Santra và ctv, 2003). Thức
ăn tinh với tỷ lệ cao sẽ làm tăng năng lượng
của khẩu phần, nhưng sẽ góp phần làm giảm
pH dạ cỏ đặc biệt là nguồn thức ăn tinh đó có
tỷ lệ carbohydate dễ lên men cao (Aikman và
ctv, 2011). Theo báo cáo của Enemark (2008),
pH dạ cỏ giảm dưới mức tối ưu sẽ làm giảm
lượng thức ăn ăn vào, sự phát triển của vi
sinh vật đặc biệt là vi sinh vật phân giải xơ,
và dẫn đến giảm năng suất của gia súc. Natri
carbonate (NaHCO3) thông thường được bổ
sung vào khẩu phần của gia súc nhai lại như
là tác nhân để trung hòa pH dạ cỏ và trở thành
một trong những quy trình tiêu chuẩn trong
chăn nuôi gia súc nhai lại ở nhiều nước trên
thế giới (Santra và ctv, 2003; Dijkstra và ctv,
2012). Tuy nhiên, việc sử dụng các loại thực
vật bản địa để cải thiện chức năng dạ cỏ hiện
nay đang được các nhà nghiên cứu và nhà
dinh dưỡng quan tâm vì sử dụng các loại hóa
chất bổ sung vào khẩu phần có thể dẫn đến
dư lượng trong thịt hay sữa. Các loại thực vật
có hàm lượng khoáng cao có tiềm năng trong
điều hòa sự ổn định pH dạ cỏ. Các nghiên cứu
trước đây đã chỉ ra rằng bột hoa chuối có tiềm
năng sử dụng như là nhân tố đệm ở dạ cỏ do
chứa hàm lường chất khoáng cao như natri,
kali và phốt pho (Ngamsaeng và ctv, 2006;
Kang và Wanapat, 2013). Bổ sung bột hoa
chuối đã cải thiện pH và hiệu quả lên men ở
bò thịt và bò sữa (Kang và ctv, 2014; 2015). Tuy
nhiên, có rất ít thông tin về hiệu quả bổ sung
bột hoa chuối trong khẩu phần của dê thịt, đặc
biệt trong điều kiện chăn nuôi và khí hậu của
Việt Nam. Vì vậy, nghiên cứu hiện tại nhằm
đánh giá các mức độ bổ sung bột hoa chuối
trong khẩu phần của dê thịt lên lượng thức
ăn tiêu thụ và tỷ lệ tiêu hóa dưỡng chất được
thực hiện là cần thiết.
2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU
2.1. Vật liệu
Chuồng nuôi dê thí nghiệm (TN) được
xây dựng thoáng mát sạch sẽ, không bị mưa
tạt gió lùa. Mỗi ô có khoảng cách 0,5m, với
kích thước mỗi ô là 1,2m (dài) x 0,7m (rộng) x
1,7m (cao). Chiều cao từ sàn chuồng đến mặt
đất là 0,7m. Mỗi ô chuồng điều có máng ăn,
máng uống riêng.
Bột hoa chuối: Hoa chuối được lấy từ các
trang trại chuối của nông dân, đây là loại
chuối trồng thu trái và không bán hoa. Sau đó
sẽ được mang về, cắt lát, phơi nắng 2-3 ngày

52 KHKT Chăn nuôi số 271 - tháng 11 năm 2021

DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI

cho khô, giòn và mang đi nghiền. tự do. Đề tài được thực hiện từ tháng 2/2021
Tất cả dê được cho ăn khẩu phần trộn đến tháng 5/2021, tại Khu thực nghiệm chăn
hoàn chỉnh (TMR) giống nhau: 70% bắp ủ nuôi Khoa Phát triển nông thôn – Trường Đại
chua và 30% thức ăn hỗn hợp: thức ăn hỗn học Cần Thơ.
hợp gồm cám gạo, bột bắp, khô đậu nành, bột Thu số liệu: tất cả số liệu thức ăn, nước
đá mịn và rỉ mật đường (Bảng 1). uống và thức ăn thừa sẽ được ghi nhận hàng
Bảng 1. Tỷ lệ các nguyên liệu của khẩu phần (%) ngày, mẫu thức ăn thừa sẽ được lấy mỗi ngày
trong suốt quá trình TN. Vào cuối TN, các
Thành phần ĐC HC1.5 HC3.0 HC4.5 mẫu thức ăn và thức ăn thừa sẽ được trộn lại
Thân lá bắp ủ chua 70,0 70,0 70,0 70,0 và đem đi phân tích các chỉ tiêu DM và CP
Cám gạo tươi 8,0 6,5 5,0 3,5 theo phương pháp của AOAC (1990) và NDF,
Bột bắp 11,3 11,3 11,4 11,4 ADF theo phương pháp của Van Soet và ctv
Khô đậu nành 7,8 7,8 7,7 7,7 (1991). Dê được cân ở thời điểm bắt đầu và kết
Bột đá mịn 0,9 0,9 0,9 0,9 thúc mỗi giai đoạn TN, vào buổi sáng trước
Rỉ mật đường 2,0 2,0 2,0 2,0
khi cho ăn.
Bột hoa chuối 0 1,5 3,0 4,5
Tổng 100 100 100 100 Tỷ lệ tiêu hóa: toàn bộ phân sẽ được thu
liên tục trong 05 ngày cuối của thí nghiệm (từ
Mẫu thức ăn dùng trong TN được sấy để
ngày 12 đến ngày 17 của mỗi giai đoạn). Sau
xác định vật chất khô sau đó được phân tích
khi ghi nhận phân bài thải mỗi ngày, 10% khối
thành phần hóa học.
lượng phân hàng ngày sẽ được lấy và trữ ở -20
Bảng 2. Thành phần hóa học của khẩu phần (%) 0C để phân tích DM, CP, ADF và NDF.
TPHH ĐC HC1.5 HC3.0 HC4.5 Dịch dạ cỏ: dịch dạ cỏ sẽ lấy ở ngày cuối
DM 29,5 30,30 30.5 30,62 cùng của thí nghiệm bằng ống thông thực
CP 16,2 16,1 16,25 16,3 quản và ở thời điểm 0, 3 và 6 giờ sau khi cho
EE 4,3 4,22 4,15 4,07 dê ăn buổi sáng. Sau đó dịch dạ cỏ sẽ được lọc
ADF 28,5 28.3 28.15 27,89 qua hai lớp vải màn và pH sẽ được đo trực
NDF 39,5 39,20 39,11 38,90 tiếp bằng pH kế.
Na+ 0,1 0,11 0,13 0,14
2.3. Xử lý số liệu
K+ 1,7 1,77 1,84 1,91
Cl- 1,06 1,0 1,02 1,05 Tất cả số liệu được biểu diễn dạng trung
bình và sai số chuẩn. Số liệu của các NT được
DM = Vật chất khô; CP = Protein thô; EE = Béo thô;
phân tích phương sai bằng mô hình tuyến tính
ADF = Xơ axít; NDF = Xơ trung tính.
tổng quát của mô hình ô vuông Latin bằng
2.2. Bố trí thí nghiệm phần mềm Minitab 14. So sánh sự sai khác
Thí nghiệm được bố trí theo Ô vuông giữa các NT bằng phép thử Tukey với giá trị
latin 4x4, với 4 giai đoạn và 4 nghiệm thức α=0,05.
(NT) tương ứng với 8 dê lai: NT đối chứng 3. KẾT QUẢ VÀ THẢO LUẬN
(ĐC), NT bổ sung 1,5% bột hoa chuối (HC1.5),
NT bổ sung 3% bột hoa chuối (HC3.0), NT bổ 3.1. Ảnh hưởng lên lượng vật chất khô, muối
sung 4,5% bột hoa chuối (HC4.5). Mỗi giai khoáng, nước uống và thể tích nước tiểu
đoạn TN gồm 17 ngày, bao gồm 10 ngày nuôi Kết quả thí nghiệm cho thấy trọng lượng
thích nghi và 7 ngày thu thập số liệu. Tất cả dê dê thí nghiệm không có sự khác biệt có ý
TN được ăn khẩu phần trộn hoàn chỉnh (TMR) nghĩa thống kê giữa các nghiệm thức (Bảng 3;
với tỷ lệ bột hoa chuối khác nhau, bao gồm P>0,05). Trong khi đó sự thay đổi trọng lượng
70% thân lá bắp ủ chua và 30% thức ăn hỗn dê cao nhất ở nghiệm thức HC4.5 là 5,71% và
hợp. Dê được cho ăn hai lần/ngày vào lúc 07 không khác biệt so với các nghiệm thức còn
giờ sáng và 15 giờ chiều, và được uống nước lại của thí nghiệm. Kết quả này tương tự so

KHKT Chăn nuôi số 271 - tháng 11 năm 2021 53

 DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI

với báo cáo của Buranakarl và ctv (2020) khi cho thấy thành phần Na, K tăng khi tỷ kệ bột
dê thịt ăn các khẩu phần (cỏ Lông Tây với hoa chuối tăng trong khẩu phần (Bảng 2). Điều
các tỷ lệ lá cọ) khác nhau có sự thay đổi khối này dẫn đến lượng Natri và Kali ăn vào khác
lượng 1,39-5,04%. Lượng VCK tiêu thụ trung biệt có ý nghĩa thống kê giữa các NT (Bảng 3;
bình là 31,98-33,42 g/kg BW/ngày và không P<0,05), lượng Natri và Kali ăn vào tăng với
có sự khác biệt có ý nghĩa thống kê giữa các tỷ lệ bổ sung bột hoa chuối tăng. Ngược lại
NT. Theo nghiên cứu của Nguyễn Thiết (2021) lượng Cl ăn vào không khác biệt có ý nghĩa
lượng tiêu thụ VCK của dê thịt lai thấp hơn thống kê giữa các NT. Về mặt sinh lý, khi động
so với TN hiện tại, trung bình 27-28 g/kg BW/ vật sử dụng lượng cao các muối khoáng này
ngày. Kết quả TN này tương tự các nghiên cứu sẽ dẫn đến làm tăng lượng nước uống và sự
trước đây khi sử dụng bột hoa chuối bổ sung bài thải nước tiểu. Tuy nhiên, kết quả của thí
trong khẩu phần cho bò sữa, bò sữa đực hoặc nghiệm cho thấy lượng nước uống và thể tích
trâu đều không làm tăng lượng tiêu thụ VCK nước tiểu của dê thịt giữa các NT khác biết
(Kang và ctv, 2015; Wanapat và ctv, 2018). Các không có ý nghĩa thống kê (Bảng 3; P>0,05).
nghiên cứu trước đây đã chỉ ra rằng bột hoa Điều này có thể do lượng muối khoáng (Na,
chuối có chứa hàm lượng chất khoáng cao như K) ăn vào chưa đủ lớn để có thể ảnh hưởng
natri, kali (Ngamsaeng và ctv, 2006; Kang và làm tăng lượng nước uống của dê thịt ở thí
Wanapat, 2013). Tương tự, thí nghiệm hiện tại nghiệm hiện tại.
Bảng 3. Ảnh hưởng lên lượng vật chất khô, muối khoáng, nước uống và thể tích nước tiểu
Chỉ tiêu ĐC HC1.5 HC3.0 HC4.5 SE P
TL dê TN (kg/con) 32,35 31,85 31,90 32,55 0,54 0,76
Sự thay đổi TL (%) 3,55 3,46 3,70 5,71 0,79 0,18
Lượng VCK tiêu thụ (g/kg BW/ngày) 33,21 33,42 33,32 31,98 0,72 0,48
Lượng Na ăn vào (g/con/ngày) 1,08b 1,17b 1,38a 1,46a 0,02 0,001
Lượng K ăn vào (g/con/ngày) 18,32b 18,78ab 19,54ab 19,91a 0,36 0,02
Lượng Cl ăn vào (g/con/ngày) 11,42 10,61 10,83 10,94 0,20 0,07
Lượng nước uống (g/kg BW/ngày) 25,18 25,78 21,51 24,04 1,87 0,41
Thể tích nước tiểu (g/kg BW/ngày) 42,11 47,45 46,80 46,89 3,44 0,67
3.2. Ảnh hưởng lên pH dịch dạ cỏ và tỷ lệ một trong những yếu tố quan trọng cho chức
tiêu hóa dưỡng chất năng dạ cỏ, đặc biệt là vi sinh vật phân giải
Kết quả TN cho thấy giá trị pH ở thời xơ có thể phát triển tốt ở pH 6.3-6.8 (Santra và
điểm trước khi ăn (0 giờ) khác biệt không có ý ctv, 2003). Kết quả của TN này cho thấy pH
nghĩa thống kê giữa các NT (Bảng 4, P>0,05). dịch dạ cỏ của dê thịt vẫn nằm trong phạm vi
Tuy nhiên, tỷ lệ bổ sung bột hoa chuối tăng này, tuy nhiên tỷ lệ tiêu hóa xơ (ADF, NDF) sẽ
đã làm tăng giá trị pH ở thời điểm 03 và 06 khác nhau khi giá trị pH khác nhau (P<0,05).
giờ sau khi ăn (P<0,05), đặc biệt là giữa NT Bổ sung bột hoa chuối không chỉ cải thiện pH
HC4.5 và ĐC. Giá trị pH được cải thiện khi dạ cỏ mà còn cải thiện tỷ lệ tiêu hóa dưỡng
tăng tỷ lệ bổ sung bột hoa chuối ở TN hiện tại chất ở dê thịt.
có thể do lượng muối khoáng ăn vào (Na+, K+) Bảng 4. Ảnh hưởng lên pH dịch dạ cỏ
cao ở các NT bổ sung bột hoa chuối (Bảng 3).
Các muối khoáng này có thể trung hòa và duy Thời gian ĐC HC1.5 HC3.0 HC4.5 SE P
trì pH dịch dạ cỏ (Kang và ctv, 2015). Theo 0 giờ 6,74 6,85 6,97 7,01 0,08 0,12
Nguyen Thiet và ctv (2020), dê sữa được bổ 3 giờ 6,66b 6,77ab 6,84ab 6,90a 0,05 0,02
sung NaHCO3 với hàm lượng Na ăn vào cao 6 giờ 6,44b 6,51b 6,83a 6,88a 0,07 0,001
đã cải thiện giá trị pH dịch dạ cỏ và tương tự Tỷ lệ tiêu hóa DM, CP, ADF, NDF tăng
so với TN này. Nhìn chung, pH dịch dạ cỏ là khi tỷ lệ bổ sung bột hoa chuối tăng, đặc biệt

54 KHKT Chăn nuôi số 271 - tháng 11 năm 2021

DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI

giữa NT ĐC và HC4.5. Kết quả TN tương tự so 5. Enemark J.M.D. (2008). The monitoring, prevention
and treatment of sub-acute ruminal acidosis (SARA): a
với nghiên cứu trên trâu của Wanapat và ctv review. Vet. J., 176: 32-43.
(2018) và trên bò thịt của Kang và ctv (2017). 6. Grant R.J. and Weidner S.J. (1992). Digestion kinetics
Theo Sung và ctv (2007) cho rằng pH dạ cỏ cao of fiber: influence of in vitro buffer pH varied within
sẽ cải thiện tỷ lệ tiêu hóa VCK và hàm lượng observed physiological range. J. Anim. Sci., 75: 1060-68.
7. Kang S. and Wanapat M. (2013). Using plant source as a
VFA trong dạ cỏ. Tương tự, Grant và Weidner buffering agent to manipulating rumen fermentation in
(1992) cho rằng tỷ lệ tiêu hóa NDF tăng khi pH an in vitro gas production system. Asian-Aust. J. Anim.
dạ cỏ lớn hơn 6,0 và giảm khi pH nhỏ hơn 6,0. Sci., 26(10): 1424-36.
Tóm lại, kết quả của TN cho thấy tỷ lệ tiêu hóa 8. Kang S., Wanapat M. and Cherdthong A. (2014). Effect
of banana flower powder supplementation as a rumen
dưỡng chất, đặc biệt là tỷ lệ tiêu hóa ADF và buffer on rumen fermentation efficiency and nutrient
NDF tăng khi bổ sung bột hoa chuối tăng. Điều digestibility in dairy steers fed on high concentrate diet.
này rất quan trọng đối với các khẩu phần có sử Anim. Feed Sci. Tech., 196: 32-41.
9. Kang S., Wanapat M., Cherdthong A. and Phesatcha K.
dụng tỷ lệ cao thức ăn tinh cho gia súc nhai lại. (2015). Comparison of banana flower powder and sodium
Bảng 5. Ảnh hưởng lên tỷ lệ tiêu hóa (%) bicarbonate supplementation on rumen fermentation
and milk production in dairy cows. Anim. Pro. Sci., 56:
TLTH ĐC HC1.5 HC3.0 HC4.5 SE P 1650-61.
DM 77,64b 78,17ab 78,22ab 81,22a 0,86 0,04 10. Kang S. and Wanapat M. (2017). Improving ruminal
fermentation and nutrient digestibility in dairy steers by
CP 81,03b 81,48ab 81,52ab 84,07a 0,73 0,03
banana flower powder-pellet supplementation. Anim.
ADF 60,88b 61,79ab 61,89ab 67,13a 1,51 0,04 Pro. Sci., 58: 1246-52.
NDF 63,21b 64,08ab 64,16ab 69,10a 1,42 0,03 11. Ngamsaeng A., Wanapat M. and Khampa S. (2006).
Evaluation of local tropical plants by in vitro rumen
4. KẾT LUẬN fermentation and their effects on fermentation end-
products. Pak. J. Nut., 5: 414-18.
Kết quả TN đã chỉ ra rằng bổ sung bột hoa 12. Niên giám thống kê (2015). Nông, lâm nghiệp và thủy
chuối với tỷ lệ 4,5% trong khẩu phần của dê sản, Nhà xuất bản Thống kê, Hà Nội, 413-26.
thịt đã cải thiện pH dịch dạ cỏ từ đó cải thiện 13. Niên giám thống kê (2019). Nông, lâm nghiệp và thủy
tỷ lệ tiêu hóa dưỡng chất đặc biệt là tỷ lệ tiêu sản, Nhà xuất bản Thống kê, Hà Nội, 481-90.
14. Santra A., Chaturvedi O.H., Tripathi M.K., Kumar R. and
hóa ADF và NDF. Ngược lại, bổ sung bột hoa Karim S.A. (2003). Effect of dietary sodium bicarbonate
chuối cho dê thịt không ảnh hưởng đến khối supplementation on fermentation characteristics and
lượng, sự tiêu thụ VCK, nước uống cũng như ciliate protozoal population in rumen of lambs. Small
Rum. Res., 47: 203-12.
sự bài thải nước tiểu.
15. Sung H.G., Kobayashi Y., Chang J., Ha A., Hwang I.H.
LỜI CÁM ƠN and Ha J.K. (2007). Low ruminal pH reduces dietary fiber
digestion via reduced microbial attachment. Asian-Aust.
Nghiên cứu này được tài trợ từ nguồn kinh J. Anim. Sci., 20: 200-07.
phí của Trường Đại học Cần Thơ, mã số T2020-77. 16. Nguyễn Thiết, Nguyễn Văn Hớn, Nguyễn Trọng Ngữ
và Sumpun T. (2021). Đánh giá khả năng thích nghi của
TÀI LIỆU THAM KHẢO dê thịt lai khi uống nước nhiễm mặn lên khả năng tăng
trọng và một số chỉ tiêu sinh hoá máu. Tạp chí KHKT
1. Aikman P.C., Henning P.H., Humphries D.J. and Horn Chăn nuôi, 263: 63-70.
C.H. (2011). Rumen pH and fermentation characteristics
17. Nguyen T., Chanpongsang S., Chaiyabutr N. and
in dairy cows supplemented with Megasphaera elsdenii
NCIMB 41125 in early lactation. J. Dai. Sci., 94: 2840-49. Thammacharoen S. (2020). Effects of dietary cation and
anion difference on eating, ruminal function and plasma
2. AOAC (1990). Official methods of analysis (15th edition),
leptin in goats under tropical condition. Asian-Aust. J.
Washington, DC, 1: 69-90.
Anim. Sci., 33(6): 941-48.
3. Buranakarl C., Thammacharoen S., Semsirmboon S.,
Sutayatram S., Chanpongsang S., Chaiyabutr N. and 18. Van Soest P.J., Robertson J.B. and Lewis B.A. (1991).
Katoh K. (2020). Effects of replacement of para-grass with Methods for dietary fiber neutral detergent fiber,
oil palm compounds on body weight, food intake, nutrient and nonstarch polysaccharides in relation to animal
digestibility, rumen functions and blood parameters in nutrition. J. Dai. Sci., 74: 3583-97.
goats. Asian-Aust. J. Anim. Sci., 33(6): 921-29. 19. Wanapat M., Ampapon T., Phesatcha K. and Kang
4. Dijkstra J., Ellis J.L., Kebreab E., Strathe A.B., Lopez S., S. (2018). Effect of banana flower powder on rumen
France J. and Bannink A. (2012). Ruminal pH regulation fermentation, synthesis of microbial protein and nutrient
and nutritional consequences of low pH. Anim. Feed Sci. digestibility in swamp buffaloes. Anim. Pro. Sci., 59:
Tech., 172: 22-33. 1674-81.

KHKT Chăn nuôi số 271 - tháng 11 năm 2021 55

 TẠP CHÍ KHOA HỌC MỤC LỤC Trang
CÔNG NGHỆ CHĂN NUÔI
TỔNG QUAN
Năm thứ mười sáu
Cải thiện năng suất, chất lượng cây thức ăn gia súc 2
Chịu trách nhiệm và hướng nghiên cứu
xuất bản Nguyễn Văn Quang
TS. Phạm Công Thiếu
DI TRUYỀN - GIỐNG
Tổng biên tập Đánh giá sự phân bố, đặc điểm ngoại hình của gà 22
TS. Ngô Thị Kim Cúc Lông Xước tại tỉnh Hà Giang
Tel: 0989160653 Lê Minh, Nguyễn Hưng Quang,
Hồ Thị Bích Ngọc và Trần Thị Hoan
Phó Tổng biên tập
TS. Chu Mạnh Thắng Đánh giá đặc điểm ngoại hình và khả năng sản xuất 31
của gà Trụi lông cổ tại huyện Quế Phong,
Ban biên tập tỉnh Nghệ An
TS. Nguyễn Văn Quang Dương Thị Phương Lan, Phạm Công Thiếu,
TS. Phạm Doãn Lân Phạm Hải Ninh, Nguyễn Công Định,
TS. Trần Thị Bích Ngọc Ngô Thị Lệ Quyên và Ngụy Khắc Đức
PGS.TS. Lê T. Thanh Huyền
TS. Phạm Văn Giới DINH DƯỠNG VÀ THỨC ĂN
CN. Nguyễn Thị Thanh Xác định mức protein thích hợp trong thức ăn cho 41
CN. Võ Thị Hoài Hương ngan Sen nuôi sinh sản
Trụ sở Nguyễn Văn Duy, Đào Anh Tiến, Mai Hương Thu,
Viện Chăn nuôi Vương Thị Lan Anh và Đỗ Thị Liên
Thụy Phương
Bắc Từ Liêm - Hà Nội CNSH VÀ CÁC VẤN ĐỀ KHÁC
Việt Nam Khả năng sản xuất và chất lượng tinh đông lạnh dạng 55
Tel: (024)37571453 cọng rạ từ tinh dịch của trâu Chiêm Hóa
(024)38385023 - Tuyên Quang
(024)38389267 Nguyễn Hưng Quang, Trần Huê Viên,
Fax: (024)38389775 Trần Thị Hoan, Từ Trung Kiên, Đinh Thị Hồng Chiêm,
Email: Nguyễn Văn Đại, Nguyễn Đức Chuyên
phongdaotaovcn@gmail.com và Tạ Văn Cần
Website:
http://www.vcn.vnn.vn Tình hình nhiễm giun tròn ở đường tiêu hóa của chó 65
nuôi tại tỉnh Trà Vinh và thử nghiệm thuốc tẩy trừ
Giấy phép xuất bản Nguyễn Thị Kim Quyên,
Số: 577/GP-BTTTT Nguyễn Văn Vui và Trương Văn Hiểu
ngày 27-10-2015
Đánh giá hiệu quả điều trị của một số kháng sinh trên 73
ISSN: 1859-0802 đàn heo nhiễm Mycoplasma suis
Chế bản và in tại Bùi Thị Diệu Mai,
Nhà xuất bản Nông Nghiệp Nguyễn Ngọc Hải và Lê Thị Phương Diệp
Hà Nội Đa hình di truyền một số gen liên quan đến sinh sản 80
và sinh trưởng ở lợn Hung và lợn Mẹo
Nguyễn Văn Trung,
Nguyễn Trọng Ngữ và Phạm Văn Giới

1
KHKT Chăn nuôi Số 264 - tháng 4 năm 2021

Tổng biên tập: DI TRUYỀN - GIỐNG VẬT NUÔI

TS. ĐOÀN XUÂN TRÚC Hoàng Thị Thúy, Giang Thị Thanh Nhàn, Phạm Thị Phương Mai, Trần Thị Thu
Thủy, Lê Quang Nam, Đoàn Phương Thúy, Nguyễn Văn Hùng, Trần Xuân Mạnh,
Phó Tổng biên tập: Đoàn Văn Soạn và Phạm Doãn Lân. Mối liên kết giữa đa hình một số gen ứng cử
PGS.TS. NGUYỄN ĐĂNG VANG với khả năng sinh trưởng và dày mỡ lưng của lợn Duroc qua hai thế hệ 2
PGS.TS. NGUYỄN VĂN ĐỨC Đỗ Thị Kim Lành, Nguyễn Thị Ngọc Anh, Nguyễn Văn Thành, Nguyễn Hoài Nam,
Sử Thanh Long và Takeshige Otoi. Tối ưu hoá điều kiện xung điện tạo phôi bò chỉnh
sửa gen Myostatin 7
Thư ký tòa soạn:
Nguyễn Thị Minh Thuận, Phạm Bằng Phương, Trần Văn Phùng, Trần Phú Cường
PGS.TS. NGUYỄN VĂN ĐỨC và Bùi Thị Thơm. Tương quan đa hình di truyền của Gen POU1F1 đến tính trạng sinh
trưởng của dê địa phương Định Hóa 14
Ủy viên Ban biên tập: Nguyễn Bá Trung, Lê Nữ Anh Thư và Phạm Thị Kim Phượng. Xác định kiểu gen
TS. NGUYỄN QUỐC ĐẠT MC1R, ASIP, MATP VÀ TBX3 quy định màu sắc lông ngựa Kushum 19
PGS.TS. HOÀNG KIM GIAO Hoàng Anh Tuấn, Nguyễn Hoàng Thịnh, Phạm Kim Đăng và Bùi Hữu Đoàn. Mối
GS.TS. NGUYỄN DUY HOAN liên kết giữa điểm đột biến G662A kiểu gen GG của gen GH với năng suất sinh sản
GS.TS. DƯƠNG NGUYÊN KHANG của gà Mía 26
PGS.TS. NGUYỄN THỊ KIM KHANG Võ Nguyễn Khánh Vy và Nguyễn Ngọc Tấn. Ảnh hưởng của việc sử dụng dịch nang
PGS.TS. ĐỖ VÕ ANH KHOA noãn, HCG đến sự thành thục nhân tế bào trứng heo 30
PGS.TS. ĐỖ ĐỨC LỰC Nguyễn Văn Trung, Nguyễn Trọng Ngữ và Phạm Văn Giới. Đặc điểm ngoại hình
PGS.TS. LÊ ĐÌNH PHÙNG của hai giống lợn Hung và Mẹo 35
Nguyễn Hoàng Thịnh, Nguyễn Thị Phương Giang và Phạm Hồng Hiển. Năng suất
sinh sản của lợn nái rừng nuôi bán thâm canh 40
Xuất bản và Phát hành:
ThS. NGUYỄN ĐÌNH MẠNH
DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI

U
Hoàng Tuấn Thành, Bùi Th Phượng, Nguy n Th Lan Anh và Nguy n Th Th y Tiên.
ị
ễ
ị
ễ
ị
ủ
Xác định mức ăn phù hợp cho vịt Hòa Lan sinh sản 44
Hồ Thị Bích Ngọc, Lê Minh Châu, Phạm Thị Phương Lan và Mai Hải Hà Thu. Ảnh
hưởng của bột tỏi bổ sung trong khẩu phần đến năng suất và chất lượng trứng của chim
cút 50
Đặng Hồng Quyên, Phạm Mạnh Cường và Nguyễn Văn Chiến Thắng. Hiệu quả sử
Giấy phép: Bộ Thông tin và Truyền thông dụng chế phẩm Allzyme thảo dược ở Gà Lai F1(MíaxLương Phượng) nuôi tại huyện Việt
Số 257/GP- BTTTT ngày 20/05/2016 Yên, tỉnh Bắc Giang 54
ISSN 1859 - 476X
Xuất bản: Hàng tháng CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC
Nguyễn Thị Mười, Phạm Công Thiếu, Nguyễn Huy Đạt, Trần Quốc Hùng, Lê Thị Thúy
Toà soạn:
Hà, Phạm Thị Thanh Bình, Nguyễn Trung Hiếu, Nguyễn Thị Thanh Vân và Đào Đoan
Địa chỉ: Tầng 4, Tòa nhà 73, Trang. Khả năng sản xuất và chất lượng thịt của con lai giữa gà Lạc Thủy với gà Lương

Hoàng Cầu, Ô Chợ Dừa, Phượng 60
Đống Đa, Hà Nội. Nguyễn Thị Kim Khang, Nguyễn Thảo Nguyên, Ngô Thị Minh Sương, Phạm Huỳnh
Điện thoại: 024.36290621 Thu An và Trần Ánh Ngọc. Ảnh hưởng của phương thức nuôi lên khả năng sinh sản của
gà mái Nòi lai 65
Fax: 024.38691511 Nguyễn Thế Hinh và Bùi Hữu Đoàn. Đánh giá hiệu quả mô hình chăn nuôi lợn thịt trên
E - mail: tapchichannuoi@hoichannuoi.vn chuồng nuôi tiết kiệm nước trong nông hộ 70
Website: www.hoichannuoi.vn Lê Thanh Phương, Phạm Ngọc Du và Nguyễn Thị Hồng Nhân. Sức sinh sản của gà
trống Nòi màu lông khác nhau nuôi nền theo gia đình và nuôi lồng phối nhân tạo 75
Tài khoản:
Nguyễn Thi Hương, Vũ Thị Thanh Nhàn và Phạm Văn Anh. Khả năng sinh trưởng, năng
Tên tài khoản: Hội Chăn nuôi Việt Nam suất và phẩm chất thịt xẻ của lợn mẹo nuôi tại Sơn La 80
Số tài khoản: 1300 311 0000 40, tại Ngân hàng Trần Ngọc Tiến, Nguyễn Thị Thanh Hòa, Hoàng Thanh Thương và Bùi Ngọc Cường.
Nông nghiệp và Phát triển Nông thôn, Chi nhánh Khả năng sản xuất của gà Lạc Thủy nuôi sinh sản quy mô nông hộ tại tỉnh Hòa Bình 85
Thăng Long - Số 4, Phạm Ngọc Thạch, Hà Nội. Lê Thị Thanh. Khảo sát mô hình nuôi thỏ nhà tại tỉnh Đồng Tháp 90
In 1.000 bản, khổ 19x27 tại Công ty CP KH&CN THÔNG TIN KHOA HỌC VÀ CÔNG NGHỆ
Hoàng Quốc Việt. In xong và nộp lưu chiểu: Ban Biên tập. Lợi ích của tiêm phòng cúm cho lợn 96
tháng 4/2021. Phòng Thí nghiệm trọng điểm Công nghệ tế bào động vật - Viện Chăn nuôi. Nhân
bản thành công lợn Ỉ từ tế bào soma mô tai 98
DI TRUYỀN - GIỐNG VẬT NUÔI

ĐẶC ĐIỂM NGOẠI HÌNH CỦA HAI GIỐNG LỢN HUNG VÀ MẸO
Nguyễn Văn Trung1*, Nguyễn Trọng Ngữ2 và Phạm Văn Giới1
Ngày nhận bài báo: 30/01/2021 - Ngày nhận bài phản biện: 01/03/2021
Ngày bài báo được chấp nhận đăng: 09/03/2021
TÓM TẮT
Thí nghiệm được tiến hành 573 cá thể lợn Hung tại huyện Hoàng Su Phì, tỉnh Hà Giang và
318 cá thể lợn Mẹo tại huyện Kỳ Sơn, tỉnh Nghệ An để đánh giá đặc điểm ngoại hình. Sử dụng
phương pháp quan sát và đo lường thông dụng để xác định các chỉ tiêu đặc điểm ngoại hình. Sử
dụng phương pháp phân tích phương sai ANOVA 1 nhân tố trong Minitab16 để phân tích và xử
lý số liệu. Kết quả cho thấy: các chỉ số ngoại hình đối với lợn Hung và lợn Mẹo tương ứng như
sau: đốm trắng ở trán chiếm 24,43 và 60,06%, ở chân chiếm 37,87 và 91,19%, ở bụng, ngực, lưng,
sườn và đuôi chiếm 15,18; 1,40; 2,62; 1,57; 22,86% và 67,30; 8,18; 15,72; 18,24; 59,43%. Hình thái lông
thẳng chiếm đa số (96,03 và 90,07%), mật độ lông trung bình chiếm 70,76 và 72,34%, da thô 77,62 và
41,13%, mặt thẳng 98,92; 88,65%, mõm dài 97,83; 44,68%, tai vểnh chiếm 85,56 và 3,55%, bụng thon
84,12 và 78,72%, lưng thẳng 71,48 và 52,48%, đi bàn 88,09 và 100%, tỷ lệ lợn có 10 vú chiếm 83,80%
và 65,22% của tổng đàn lợn Hung và lợn Mẹo, các kích thước: cao vai, cao lưng, dài đầu, dài tai và
dài đuôi trung bình của lợn Hung đều cao hơn so với của lợn Mẹo.
Từ khóa: Lợn Hung, lợn Mẹo, hình thái, số vú, chiều đo.
ABSTRACT
Evaluation of morphic characteristics and appearance features of Hung and Meo
indigenous pigs
The experiment was conducted with 573 individuals of Hung pigs in Hoang Su Phi district, Ha
Giang province and 318 individuals of Meo pigs in Ky Son district, Nghe An province to evaluate
morphic characteristics and appearance features. Using common observation and measurement
methods to determine mentioned above characteristics and features. Using the method of ANOVA
1 factor in Minitab16 to analyze data. The results showed that: the appearance characteristics for
Hung and Meo pigs being as follows: white spot in the forehead was 24.43 and 60.06%, in the legs
was 37.87 and 91.19%, the abdomen, chest, back, ribs and tails accounted for were 15.18, 1.40, 2.62,
1.57, 22.86% and 67.30, 8.18, 15.72, 18.24, 59.43%. Straight hair forms the majority, reaching 96.03
and 90.07%, medium hair density accounts was 70.76 and 72.34%, rough skin was 77.62 and 41.13%,
face straight was 98.92 and 88.65%, long snout was 97.83 and 44.68%, erectile ears was 85.56 and
3.55%, slim belly was 84.12 and 78.72%, straight back was 71.48 and 52.48%, proportion of toe-
walking was 88.09 and 100%, the proportion of pigs with 10 teats were 83.80 and 65.22% of the total
herd of pigs Hung and Meo pigs, the sizes: average shoulder height, high back, head length, ear
length and tail length of Hung pigs are all larger than those of Meo pigs.
Keywords: Hung pigs, Meo pigs, morphology, number of breasts, dimensionality.

1. ĐẶT VẤN ĐỀ loài Sus domesticus. Giống lợn bản địa của Việt
Nam rất phong phú, được phân bổ rộng khắp
Tất cả các giống lợn bản địa của Việt Nam
các vùng của đất nước. Mỗi giống lợn bản địa
đều thuộc lớp động vật có vú (Maminalia), bộ
mang những đặc trưng riêng của nó, nhưng đều
guốc chẵn (Artiodactyla), họ Sllidae, chủng Sus và
có chung một số đặc điểm đặc trưng: dễ nuôi, lớn
chậm, sinh sản kém, thịt thơm ngon. Hai giống
1
Viện Chăn nuôi lợn Hung và lợn Mẹo cũng là những giống lợn
2
Trường Đại học Cần Thơ
* Tác giả liên hệ: ThS. Nguyễn Văn Trung, Bộ môn Di truyền bản địa nên có những đặc tính chung đó.
- Giống vật nuôi, Viện Chăn nuôi. Điện thoại: 0984900134; Giống lợn Mẹo chủ yếu do dân tộc H’Mông
Email: trungvcn@hotmail.com

KHKT Chăn nuôi số 264 - tháng 4 năm 2021 35

 DI TRUYỀN - GIỐNG VẬT NUÔI

nuôi ở huyện Kỳ Sơn và Quỳ Châu, tỉnh Nghệ Về kích thước một số chiều đo cơ thể cơ
An. Trong lúc đó, giống lợn Hung chủ yếu nuôi bản được đánh giá bằng phương pháp đo lường
ở huyện Bắc Mê, Hoàng Su Phì, Vị Xuyên, tỉnh thông dụng trên từng cá thể theo từng giới tính
Hà Giang. Tuy đã có một số nghiên cứu về và trung bình của mỗi giống.
đặc điểm ngoại hình, song chủ yếu nêu chung 2.3. Xử lý số liệu
chung mà chưa đi sâu vào các đặc trưng riêng
của chúng như màu sắc lông da; hình thái lông, Bộ số liệu được xử lý bằng phương pháp
da, răng nanh, mặt, mõm, tai, bụng, lưng, đuôi; thống kê mô tả và phân tích phương sai
số lượng vú và kích thước một số chiều đo cơ (ANOVA) 1 nhân tố trong Minitab16 tùy thuộc
bản của 2 giống lợn Hung và lợn Mẹo. Vì vậy, để vào tính trạng, tại Bộ môn Di truyền – Giống vật
được góp phần vào công tác bảo tồn bền vững nuôi, Viện Chăn nuôi.
và từng bước phát triển, khai thác chúng một 3. KẾT QUẢ VÀ THẢO LUẬN
cách có hiệu quả nhất, nghiên cứu đánh giá các
đặc điểm ngoại hình là cần thiết. 3.1. Đặc điểm màu sắc lông da của giống lợn
Hung và lợn Mẹo
2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU
Màu sắc lông da là những nét điển hình để
2.1. Đối tượng, địa điểm và thời gian minh chứng cho mỗi giống lợn bản địa. Nhìn
Đàn lợn Hung và lợn Mẹo tại huyện Hoàng chung, đàn lợn khảo sát có màu sắc lông da của
Su Phì, tỉnh Hà Giang và huyện Kỳ Sơn, tỉnh 2 giống lợn bản địa Hung và lợn Mẹo không
Nghệ An được đưa vào đánh giá các đặc điểm thực sự đồng nhất. Nhìn chung, màu sắc lông,
ngoại hình, từ tháng 01/2015 đến tháng 01/2021. da đen và hung là màu chỉ đạo của chúng. Tuy
vậy, chúng vẫn còn nhiều điểm trắng khác nhau.
2.2. Bố trí thí nghiệm
Ở trán, những đốm trắng chiếm 24,43% của tổng
Tổng số 573 cá thể lợn Hung và 318 lợn Mẹo
đàn ở giống lợn Hung và 60,06% ở lợn Mẹo.
được đưa vào đánh giá các đặc điểm ngoại hình
Trong lúc đó, ở chân đốm trắng chiếm 37,87%
đặc trưng như:
của tổng đàn ở lợn Hung và 91,19% ở lợn Mẹo.
Về màu sắc lông da, hình thái lông, da, răng Đốm trắng ở bụng, ngực, lưng, sườn và đuôi của
nanh, mặt, mõm, tai, bụng, lưng, đuôi được lợn Hung chiếm 15,18; 1,40; 2,62; 1,57 và 22,86%
đánh giá bằng phương pháp quan sát và đo của tổng đàn. Tương ứng ở lợn Mẹo là 67,30;
lường thông dụng. 8,18; 15,72; 18,24 và 59,43%. Kết quả nghiên cứu
Các chỉ tiêu theo dõi về hình thái được chia về tỷ lệ lợn có lông trắng này cao hơn so với kết
thành: Hình thái lông: thẳng, xoăn, xù. Mật độ quả nghiên cứu của Hoàng Thanh Hải (2015)
lông: Dày, trung bình và thưa. Hình thái mặt: trên 270 cá thể lợn Hung tại Hà Giang công bố
Mặt thẳng và mặt gãy. Hình thái mõm: Mõm chỉ có 4 cá thể có lông trắng ở 4 chân và trán
dài, mõm trung bình; mõm ngắn. Hình thái tai: chiếm tỷ lệ 1,48%. Phạm Văn Sơn (2015) nghiên
Tai ngang, tai vểnh. Hình thái bụng: Bụng thon, cứu trên 259 cá thể lợn Mẹo tại Nghệ An cho biết
bụng xệ. Hình thái lưng: Lưng thẳng, lưng vồng có 112 cá thể có màu lông đen toàn thân chiếm
và lưng võng. Kiểu đi được chia thành: Đi móng tỷ lệ 43,24%, 147 cá thể có màu lông đen có điểm
và đi bàn. trắng ở trán, 4 chân và bụng chiếm 56,76% đều
Về số lượng vú được đánh giá bằng phương thấp hơn so với kết quả nghiên cứu của chúng
pháp đếm trực tiếp trên từng cá thể lợn cái. tôi trên giống lợn Mẹo.
Bảng 1. Đốm lông trắng trên các bộ phận của cơ thể lợn Hung và lợn Mẹo
Trán Chân Bụng Ngực Lưng Sườn Đuôi
Giống lợn Tỷ lệ Tỷ lệ Tỷ lệ Tỷ lệ
n (%) n (%) n (%) n (%) n Tỷ lệ
(%) n Tỷ lệ
(%) n Tỷ lệ
(%)
Hung (n=573) 140 24,43 217 37,87 87 15,18 8 1,40 15 2,62 9 1,57 131 22,86
Mẹo (n=318) 191 60,06 290 91,19 214 67,30 26 8,18 50 15,72 58 18,24 189 59,43

36 KHKT Chăn nuôi số 264 - tháng 4 năm 2021

DI TRUYỀN - GIỐNG VẬT NUÔI

3.2. Đặc điểm hình thái cơ thể của lợn chiếm đa số, đạt tương ứng 96,03 và 90,07% tổng
Hung và lợn Mẹo đàn. Mật độ lông trung bình ở 2 giống lợn Hung
3.2.1. Hình thái lông của lợn Hung và lợn Mẹo và Mẹo cũng chiếm đa số (70,76 và 72,34%). Ở 2
Hình thái lông của giống lợn Hung và lợn giống lợn này, có một tỷ lệ cá thể có lông bờm,
Mẹo cũng biến động lớn: hình thái lông thẳng tương ứng là 6,14 và 2,13%.
Bảng 2. Hình thái lông của lợn Hung và lợn Mẹo
Hình thái lông Mật độ lông Bờm lông
Giống lợn Thẳng Dày Trung bình Thưa Có bờm
n Tỷ lệ (%) n Tỷ lệ (%) n Tỷ lệ (%) n Tỷ lệ (%) n Tỷ lệ (%)
Hung (n=277) 266 96,03 46 16,61 196 70,76 35 12,64 17 6,14
Mẹo (n=141) 127 90,07 35 24,82 102 72,34 4 2,84 3 2,13

3.2.2. Hình thái da và răng nanh của lợn Hung đa số (77,62%), trong lúc đó ở lợn Mẹo tỷ lệ da
và lợn Mẹo nhăn và thô tương đương nhau (41,13 và 41,13%)
Hình thái da của lợn Hung và lợn Mẹo cũng tổng đàn. Lợn Hung có một số ít có răng nanh
khác nhau: hình thái da thô ở lợn Hung chiếm (0,72%), nhưng lợn Mẹo không có răng nanh.

Bảng 3. Hình thái da và răng nanh của lợn Hung và lợn Mẹo
Trạng thái da
Răng nanh
Giống lợn Nhăn Thô Trơn
n Tỷ lệ (%) n Tỷ lệ (%) n Tỷ lệ (%) n Tỷ lệ (%)
Hung (n=277) 8 2,89 215 77,62 54 19,49 2 0,72
Mẹo (n=141) 58 41,13 58 41,13 25 17,73 0 0

3.2.3. Hình thái về mặt, mõm và tai của lợn 89,30%, kết quả này cao hơn kết quả trên lợn
Hung và lợn Mẹo Mẹo của chúng tôi.
Bảng 4. Hình thái mặt, mõm và tai của lợn 3.2.4. Hình thái bụng, lưng và kiểu đi của lợn
Hung và lợn Mẹo
Mặt thẳng Mõm Dài Tai vểnh
Giống lợn Đánh giá về hình thái bụng, lưng và kiểu
n Tỷ lệ n Tỷ lệ
(%) (%) n Tỷ lệ
(%) đi của lợn Hung và lợn Mẹo cũng có những
Hung (n=277) 274 98,92 271 97,83 237 85,56
điểm khác biệt. Lợn Hung có tỷ lệ bụng thon
Mẹo (n=141) 125 88,65 63 44,68 5 3,55
(84,12%), lưng thẳng (71,48%) và đi móng là chủ
Hình thái mặt, mõm và tai của lợn Hung yếu (88,09%). Trong lúc đó, ở lợn Mẹo tỷ lệ này
và lợn Mẹo cũng khác nhau: ở lợn Hung, hình tương ứng là 78,72; 52,48 và 100%.
thái mặt thẳng (98,92%), mõm dài (97,83%) và tai
vểnh (85,56%) chiếm đa số. Trong lúc đó, ở lợn Hoàng Thanh Hải (2015) nghiên cứu trên
Mẹo tỷ lệ đó là 88,65; 44,68 và 3,55% tổng đàn. 270 cá thể lợn Hung cho biết tỷ lệ lưng thẳng của
Hoàng Thanh Hải (2015) cho biết kết quả nghiên lợn Hung là 50,37%, bụng thon là 100%. Như
cứu trên 270 cá thể lợn Hung tại Hà Giang thì vậy, kết quả nghiên cứu của chúng tôi cao hơn
100% lợn Hung đều có mõm dài, nhọn. Như vậy, ở hình thái lưng, nhưng lại thấp hơn ở hình thái
kết quả nghiên cứu của chúng tôi về các hình bụng. Hoàng Thị Phi Phượng (2020) cho biết đàn
thái này đều thấp hơn. Hoàng Thị Phi Phượng lợn Mẹo hạt nhân ở thế hệ 2 có tỷ lệ lưng thẳng
(2020) khi nghiên cứu trên 215 cá thể lợn Mẹo là 78,14%, tương đương với kết quả nghiên cứu
hạt nhân ở thế hệ xuất phát, thế hệ 1 và 2 cho biết trên lợn Mẹo của chúng tôi.
tỷ lệ mõm dài, thẳng tương ứng là 78,60; 82,79;

KHKT Chăn nuôi số 264 - tháng 4 năm 2021 37

 DI TRUYỀN - GIỐNG VẬT NUÔI

Bảng 5. Hình thái bụng, lưng và kiểu đi 12 vú là 26,63%, trong lúc đó ở lợn Hung chỉ có
của lợn 6,70%. Nhìn chung, cả 2 giống lợn Hung và lợn
Lưng
Mẹo chủ yếu đều là có số vú chẵn. Tỷ lệ lợn có
Bụng thon Đi móng
thẳng số vú lẻ (9, 11, 13 vú) chỉ là 2,24; 0,56 và 0,56% ở
Giống lợn
n Tỷ lệ n Tỷ lệ
(%) (%) n Tỷ lệ
(%)
lợn Hung và 0,54; 2,17; 1,63 và 0,54% số lợn Mẹo
có số vú lẻ 9, 11, 13 và 15 vú. Đặng Hoàng Biên
Hung (n=277) 233 84,12 198 71,48 244 88,09
Mẹo (n=141) 111 78,72 74 52,48 141 100 (2016) thông báo tỷ lệ lợn Hung (Hà Giang) có 10
vú chiếm tỷ lệ 85,92%. Hoàng Thanh Hải (2015)
3.3. Số lượng vú của lợn Hung và lợn Mẹo cho biết tỷ lệ lợn Hung có 10 vú là 93,70%, 12
Giống lợn Hung có số vú biến động từ 8 vú là 6,30%, kết quả này tương đương với quả
đến 14 vú, trong lúc đó ở lợn Mẹo là 8 đến 15 nghiên cứu của chúng tôi. Phạm Văn Sơn (2015)
vú, nhưng tập trung nhiều nhất là 10 vú: giống cho biết lợn Mẹo có 10 vú chiếm 87,25%, 12 vú
lợn Hung có đến 83,80% số cá thể có 10 vú và chiếm 12,75%. Như vậy, kết quả của chúng tôi
lợn Mẹo chỉ có 65,22%. Điều đó nói lên lợn Mẹo thấp hơn ở số lượng lợn Mẹo có 10 vú và cao hơn
có số vú nhiều hơn lợn Hung, thể hiện tỷ lệ có ở lợn Mẹo có 12 vú.
Bảng 6. Số lượng vú của lợn Hung và lợn Mẹo
Số lượng vú của lợn cái
Giống lợn Tham số
8 9 10 11 12 13 14 15
n 8 4 150 1 12 1 3 0
Hung (n=277)
Tỷ lệ (%) 4,47 2,24 83,80 0,56 6,70 0,56 1,68 0
n 2 1 120 4 49 3 4 1
Mẹo (n=184)
Tỷ lệ (%) 1,09 0,54 65,22 2,17 26,63 1,63 2,17 0,54

3.4. Kích thước một số chiều đo của lợn Hung Bảng 7. Kích thước một số chiều đo của lợn (cm)
và lợn Mẹo Lợn Hung Lợn Mẹo
Chỉ Giới
Đánh giá về ngoại hình của lợn, kích thước tiêu tính n Mean±SE n Mean±SE
Cái 118 56,86±0,88a 104 60,40±0,95a
một số chiều đo cơ bản cũng rất quan trọng. Kích Dài Đực 74 59,61±1,47a 10 52,40±3,15b
thân
thước một số chiều đo cơ bản của lợn Hung và TB 192 57,92±0,79 114 59,70±0,93
lợn Mẹo được thể hiện ở Bảng 7 cho thấy hầu hết Cái 118 46,52±0,63a 106 48,16±0,74a
Cao Đực 72 49,51±1,08b 10 40,70±3,97a
vai
các chỉ tiêu dài thân, cao vai, cao lưng, dài đầu, TB 190 47,65±0,58 116 47,52±0,77
rộng đầu, dài tai và dài đuôi của lợn đực đều cao Cái 115 45,26±0,60a 106 46,43±0,69a
Cao Đực 62 49,39±1,04b 10 39,70±3,88a
hơn lợn cái ở giống lợn Hung, nhưng ngược lại ở lưng
TB 177 46,71±0,55 116 45,85±0,73
giống lợn Mẹo là lợn cái lớn hơn lợn đực. Cái 103 28,82±0,43a 88 28,42±0,39a
Dài Đực 60 29,88±0,48a 5 23,40±0,25b
Dài thân trung bình của 2 giống lợn Hung đầu
TB 163 29,21±0,32 93 28,15±0,40
và Mẹo tương ứng là 57,92 và 59,70cm. Trong lúc Cái 98 9,60±0,15a 88 10,48±0,19a
Rộng Đực 57 10,22±0,23b 5 9,00±0,45b
đó, cao vai và cao lưng của giống Hung là 47,65 đầu
TB 155 9,83± 0,13 93 10,40±0,18
và 46,71cm và tương ứng ở lợn Mẹo là 47,52 và Cái 107 10,66±0,17a 88 10,42±0,17a
45,85cm. Dài tai Đực 58 10,76±0,19a 5 9,40±0,68a
TB 165 10,69±0,13 93 10,37±0,17
Kích thước đầu của 2 giống cho thấy dài Cái 107 28,01±0,45a 88 26,40±0,49a
Dài Đực 58 29,47±0,52b 5 23,60±1,57a
đầu và rộng đầu của lợn Hung là 29,21 và đuôi
TB 165 28,52±0,35 93 26,25±0,47
9,83cm, tương ứng của lợn Mẹo là 28,15 và Trong cùng cột Mean±SE, cùng chỉ tiêu của 2
10,40cm. giới tính có chữ cái khác nhau thì sai khác có ý nghĩa
thống kê (P<0,05).

38 KHKT Chăn nuôi số 264 - tháng 4 năm 2021

DI TRUYỀN - GIỐNG VẬT NUÔI

Dài tai của lợn Hung (10,69cm) lớn hơn so
với lợn Mẹo (10,37cm). Tương tự, độ dài của
đuôi lợn Hung là 28,52cm cũng dài hơn so với
của lợn Mẹo (26,25cm).
Kết quả nghiên cứu về các chỉ tiêu chiều đo
ngoại hình của của lợn Hung và lợn Mẹo nhìn
chung đều cao hơn lợn bản địa Naga, mặt khác
các chỉ tiêu của lợn đực đều thấp hơn lợn cái trên
lợn Naga của Ấn Độ (Borkotoky và ctv, 2014),
phù hợp với với kết quả nghiên cứu trên lợn
Hung của chúng tôi. Nhưng kết quả nghiên cứu
trên lợn Mẹo phù hợp với công trình nghiên cứu
của lợn nhập nội ở Brazil, Uruguay và Colombia
(McManus và ctv, 2010), phù hợp với lợn đen
Mianmar (Govindasamy và ctv, 2019) đó là các
chỉ tiêu của lợn đực luôn cao hơn lợn cái.
Tóm lại, hầu hết các chỉ tiêu kích thước cơ
bản như dài thân, cao vai, cao lưng, dài đầu, dài
tai và dài đuôi trung bình của lợn Hung đều to
lớn hơn so với của lợn Mẹo, ngoại trừ chỉ tiêu
rộng đầu.
4. KẾT LUẬN
Đặc điểm ngoại hình của 2 giống lợn bản
địa Hung và Mẹo của Việt Nam có những đặc
trưng riêng biệt từ đốm trắng, hình thái một số
bộ phận cơ thể cũng như kích thước một số chiều
đo chính. Những đặc điểm cơ bản này đóng góp
cho các nhà chọn tạo giống có căn cứ trong chọn
lọc, nhân thuần để bảo tồn bền vững và khai
thác phát triển hiệu quả, đặc biệt rất thích hợp
cho phương thức chăn nuôi an toàn sinh học
theo hướng hữu cơ.
TÀI LIỆU THAM KHẢO
1. Đặng Hoàng Biên (2016). Nghiên cứu đánh giá tiềm năng
di truyền của các giống lợn nội. Báo cáo tổng kết nhiệm
vụ quỹ gen. Bộ Khoa học và Công nghệ.
2. Borkotoky D.P. Perumal P. and Singh R.K. (2014).
Morphometric attributes of Naga local pigs. Vet. Res. Int.,
2(1): 08-11.
3. Hoàng Thanh Hải (2015). Khai thác và phát triển nguồn
gen lợn Hung tỉnh Hà Giang. Báo cáo tổng kết đề tài cấp
Bộ.
4. McManus C., Paiva S.R., Silva A.V.R., Murata L.S.,
Louvandini H., Cubillos G.P.B., Castro G., Martinez
R.A., Dellacasa M.S.L. and Perez J.E. (2010). Phenotypic
characterization ofnaturalized swine breeds in Brazil,
Uruguayand Colombia. Bra. Arc. Bio. Tec., 53: 583-91.
5. Hoàng Thị Phi Phượng (2020). Nghiên cứu nâng cao năng
suất và sử dụng có hiệu quả nguồn gen lợn Cỏ và lợn
Mẹo. Báo cáo tổng kết nhiệm vụ quỹ gen. Bộ Khoa học
và Công nghệ.
6. Ritchil C.H., Hossain M.M. and Bhuiyan A.K.F.H (2014).
Phenotypic and morphological characterization and
reproduction attributes of native pigs in Bangladesh. Ani.
Gen. Res., 54: 1-9. doi:10.1017/S207863361400006X.
7. Phạm Văn Sơn (2015). Xác định một số đặc điểm sinh học,
khả năng sản xuất của lợn Mẹo nuôi tại huyện Kỳ Sơn,
tỉnh Nghệ An. Luận án Thạc sỹ khoa học nông nghiệp.

NĂNG SUẤT SINH SẢN CỦA LỢN NÁI RỪNG

NUÔI BÁN THÂM CANH
Nguyễn Hoàng Thịnh1, Nguyễn Thị Phương Giang1 và Phạm Hồng Hiển2*
Ngày nhận bài báo: 30/01/2021 - Ngày nhận bài phản biện: 22/02/2021
Ngày bài báo được chấp nhận đăng: 09/03/2021
TÓM TẮT
Lợn Rừng ở Việt Nam có phân bố rộng khắp trên cả nước, đặc biệt là dọc dãy núi Trường Sơn
và các vùng núi phía Bắc. Lợn Rừng được người dân chăn nuôi từ lâu nhưng chủ yếu là chăn nuôi
nông hộ theo phương thức chăn thả. Nghiên cứu này được thực hiện nhằm theo dõi khả năng sinh

1
Học viện Nông nghiệp Việt Nam
2
Viện Khoa học Nông nghiệp Việt Nam
* Tác giả liên hệ: Phạm Hồng Hiển; Viện Khoa học Nông nghiệp Việt Nam, ĐT 0934563434; email: hienphamhong@gmail.com

KHKT Chăn nuôi số 264 - tháng 4 năm 2021 39

11/29/21, 10:39 PM ..:: THE JAPS ::..

The Journal of Animal and Plant Sciences

Welcome to The Journal of Animal and Plant Sciences is a fully open

access journal

Home
About the Journal
Instructions to Authors
Accepted Papers Volume 31, No. (6), 2021, December
Latest Issue
(Impact Factor 0.490; JCR 2020)
Journal Archives
Submit a Manuscript
Supplementary Series
CONTENTS
Supplementary Archive
Abstracting / Indexing Agencies Download
Title (Research Paper) Abstract
PDF
Publication Ethics
Editorial Board
Advisory Board
Managing Board GENETIC POLYMORPHISMS AND EXPRESSION PATTERN OF IGF-I GENE IN COMMERCIAL

Contact Us BROILER STRAINS

1 Abstract
M. Fouda , A. Ateya, I. EL Araby, and A. Elzeer

ISSN (Print): Abstract | Full Text | PDF

1018-7081
ISSN (Electronic):
COMPUTATIONAL ANALYSIS OF PHYLOGENETIC RELATIONSHIP OF TAGAP - T CELL
2309-8694
ACTIVATION RHO GTPASE ACTIVATING PROTEIN IN SELECTED MAMMALIAN SPECIES
2 Abstract
S. H. Abbas, A. Mumtaz, M. J. ul Hasanain, M. E. Babar and M. T. Pervez

Abstract | Full Text | PDF

ASSOCIATION OF POLYMORPHISMS IN PROLACTIN RECEPTOR AND MELATONIN RECEPTOR 1C

GENES ON EGG PRODUCTION AND EGG QUALITY TRAITS OF JAPANESE QUAILS (COTURNIX
COTURNIX JAPONICA)
3 Abstract
N. T. H. Nhan, L. T. T. Lan, L. T. Hung, R. L. Soubra, T. T. Gia, L. H. Anh, N. H. Xuan and N. T. Ngu

Abstract | Full Text | PDF

ASSESSMENT OF DELETERIOUS EFFECTS OF BISPHENOL A ON STEROIDOGENESIS, SPERM

COUNT, AND SPERMATOGENESIS IN A MAMMALIAN MODEL
4 Abstract
F. Nawaz, Asmatullah and C. Ara

Abstract | Full Text | PDF

LYSINE SUPPLEMENTATION IMPROVES NUTRIENTS DIGESTION, GROWTH PERFORMANCE AND

LIVER FUNCTION OF FEMALE BLUE FOXES (Alopex lagopus) IN GROWING PHASE
5 Abstract
Q. Jiang, F. Yang, X. Gao and X. Wu

Abstract | Full Text | PDF

EVALUATION OF PREDICTIVE ABILITY OF TWO ARTIFICIAL NEURAL NETWORK ALGORITHMS

AND MULTIPLE REGRESSION MODEL FOR MEAT QUALITY TRAITS AFFECTED BY PRE-
SLAUGHTER FACTORS
6 Abstract
G. Ser, C. T. Bati, E. Arık and S. Karaca

Abstract | Full Text | PDF

7 Abstract

https://www.thejaps.org.pk/Volume/2021/31-06/index.php 1/5
 Journal
Lan et al.,of Animal & Plant Sciences, 31(6): 2021, Page: 1559-1567 The J. Anim. Plant Sci., 31 (6) 2021
ISSN (print): 1018-7081; ISSN (online): 2309-8694
https://doi.org/10.36899/JAPS.2021.6.0359
20SSOCIATION OF POLYMORPHISMS IN PROLACTIN RECEPTOR AND
MELATONIN RECEPTOR 1C GENES ON EGG PRODUCTION AND EGG QUALITY
TRAITS OF JAPANESE QUAILS (COTURNIX COTURNIX JAPONICA)
L. T. T. Lan1,#, N. T. H. Nhan2,#, L. T. Hung1, R. L. Soubra1, T. T. Gia2, L. H. Anh2, N. H. Xuan3 and N. T. Ngu2,*

1
School of Agriculture and Aquaculture, Tra Vinh University, Tra Vinh City, Vietnam
2
College of Agriculture, Can Tho University, Can Tho City, Vietnam
3
College of Food Technology and Biotechnology, Can Tho University of Technology, Can Tho City, Vietnam
*
Corresponding Author: ntngu@ctu.edu.vn
#
These authors contributed equally to this work

ABSTRACT
In the present study, the association between a 24-bp Insertion-Deletion (Indel) in the prolactin receptor gene (PRL), and
the polymorphic site NC_006091.5: c.25.144.C>A(T) in the melatonin receptor gene (MTNR-1C) was investigated in
Japanese laying quails. In total, 396 female and 132 male quails were selected for the experiment. The number of eggs
was recorded daily in individual quails for egg production and other reproductive traits. Every four weeks, one egg per
quail was randomly selected for external and internal assessment. PCR-RFLP and PCR-SSCP were applied for
genotyping the Indel, and the single nucleotide polymorphism in PRL and MTNR-1C genes, respectively. The data was
continuously collected until 48 weeks of laying. For the effects of PRL Indel, it was found that DD genotyped quails
provided a slightly higher egg yield in the first 24 laying weeks (155.1 eggs/quail); however, when the quails reached 36
and 48 weeks of laying, the difference in egg production was clear (P<0.05) in quails with II genotype (213.0 and 281.9
eggs/quail, respectively). In the MTNR-1C gene, six genotypes were detected at the polymorphic site, of which AA and
AT genotyped quails were better for egg yield in comparison with those baring other genotypes. For egg quality, only
albumen weight and albumen ratio differed from quails with II genotype to those of other quails in the 1-24 laying
weeks. In the later period (25-48 weeks), yolk index was the highest in quails baring DD genotype. For the MTNR-1C
polymorphism, the differences (P<0.05) were found in traits related to albumen and yolk; however, no genotype really
stands out in terms of egg quality. In conclusion, the two polymorphisms studied may be utilized in breeding programs to
enhance egg yield and egg quality traits in Japanese quails of which the PRL (II) and MTNR-1C (AA) alleles are
suggested.
Key words: Association, egg traits, Japanese quails, MTNR-1C, PRL
Published first online March 31, 2021 Published online Nov. 20, 2021.

INTRODUCTION increase of prolactin secretion leads to the regression of

Meat and eggs originating from poultry
production have traditionally been the main food supply
for human consumption, thus it is a necessary large
industry all over the world. In addition to industrial
production for chickens, Japanese quail (Coturnix
coturnix japonica) has gained much preference in recent
years. In fact, large-scale production of Japanese quails
for commercial purposes has been widely established in
several regions (Narinc et al. 2013). In quails, the
selection of individuals based on genotypic information
related to reproductive traits is preferred (Deeb and
Lamont 2002). The research on candidate genes and their
impact on economic value traits have laid the foundation
for the use of molecular markers in breeding (Kulibaba
and Podstreshnyi 2012).
Prolactin is a peptide hormone secreted by the
anterior pituitary gland and it has a variety of roles for
biological functions in all vertebrates. In birds, the
ovarian functions and is of crucial importance to egg
production and brooding behavior (Sharp et al. 1984,
Shimada et al. 1991). In Japanese quails, the molecular
characterization of the PRL gene polymorphism is rare
and the majority of the information recorded is restricted
to indigenous or commercial chickens (Lotfi et al. 2013).
In the 5'-flanking region of chicken PRL gene there was
an abundance of single-nucleotide polymorphisms (SNP)
(Liang et al. 2006), and the 24-bp Indel was considerably
correlated with broodiness and egg yield (Cui et al. 2006,
Jiang et al. 2005), which indicates its usefulness as a
molecular marker for egg production.
Melatonin (N-acetyl-5-methoxytryptamine)
secreted from the pineal gland is an important hormone
that is involved in many functions in mammals, including
feeding patterns and changing patterns of reproduction
(Adachi et al. 2002, He et al. 2016). Also, melatonin
helps activate many receptor mechanisms in the ovary
and various cells, including theca and granulosa cells

1559
Lan et al.,
(Ayre et al. 1992, Soares et al. 2003). Some studies have
shown that the presence of melatonin in follicular fluid
and its levels are positively correlated with the quality
and maturity of oocytes (Nakamura et al. 2003, Shi et al.
2009, Tian et al. 2014). Recently, one of the ovarian
melatonin receptors, melanin receptor 1C (MTNR-1C)
has been defined in chickens, and its expression has
shown a direct contribution to the reproductive process of
hens and is therefore marked as a candidate gene for
chicken reproduction (Li et al. 2013). A similar mutation
was also detected in Noi chickens, a native chicken breed
in Vietnam (Vu and Ngu 2016).
The current study was conducted to identify the
polymorphisms of PRL and MTNR-1C genes and further
investigate their association with egg production and egg
quality traits in Japanese quails.
MATERIALS AND METHODS
Experimental quails: The quails studied were selected
from a breeding farm in Tien Giang province. In total,
396 laying quails and 132 male quails were selected. The
birds were fed a grower diet (ME: 2,950 kcal/kg; CP:
24%) from 0 to 6 weeks, and a laying diet (ME: 2,850
kcal/kg; CP: 21%) for the whole experiment. Clean water
was provided at all times. During the laying period, the
female quails were kept in individual compartments for
egg collection and the male was alternatively introduced
every 4 hours per day with the ratio of 1 male to 3
females. All quails were vaccinated against common
diseases before the experimental period of 48 laying
weeks. In detail, Newcastle virus vaccine was
administered on day 1st and day 21st via eye drop and
repeated every 3 months orally, and the vaccine against
coccidiosis was applied on day 5th and day 30th through
drinking water. In addition, vaccines for chronic
respiratory disease (CRD) and salmonella were given on
day 12th via drinking water and H5N1 vaccine was used
on day 15th by intramuscular injection.
Egg production and egg quality measurements: Eggs
were collected daily at 4 P.M. and numbered to monitor
individual yield. The eggs were then marked and
gathered in a storage room for 4 days before an
incubation period of 17 days in an incubator. The
following parameters were recorded as phenotypic data
of reproductive capacity: total egg yield (per bird basis),
total egg hatched, number of fertilized eggs and hatched
chicks, laying rate and hatching rate.
For evaluation of the egg quality traits, one
egg/quail was collected every four weeks with a total of
12 eggs/quail used for quality assessment for the whole
experimental period. Eggs were weighed using an
electronic scale. After breaking the outer shells, eggshells
were washed and dried for 24 hours before weighing to
obtain the ratio between eggshells and weight. For
1560
The J. Anim. Plant Sci., 31 (6) 2021
internal egg properties, album and yolk were evaluated
using a tripod micrometer and a digital caliper. The yolk
weight was recorded and the proportion was expressed in
accordance with egg weight. Albumen weight was
determined by the difference of the yolk and the shell
weight from the whole egg weight. The yolk index was
estimated from the ratio of yolk height to yolk width and
the albumen index was calculated as the ratio of thick
albumen to its thick diameter. In addition, the Haugh unit
(HU) was determined from the formula of HU = 100 x
log (AH + 7.57 – 1.7 x EW0.37), in which AH stands for
albumen height (mm) and EW represents egg weight (g)
(Nasr et al. 2016, Sari et al. 2012).
DNA extraction and genotyping: Genomic DNA
isolated from quails’ feathers (Bello et al. 2001) was
subjected to amplification in a thermal cycler. In the
prolactin gene (Genbank number AB011438.2), the
primer pair was designed for amplifying the fragment in
chickens (Cui et al. 2006). The primer sequences were
5’-TTT AAT ATT GGT GGG TGA AGA GAC A-3’
(forward) and ATG CCA CTG ATC CTC GAA AAC TC
(reverse). The polymerase chain reaction (PCR) was
performed with an annealing temperature of 54 oC and the
subsequence genotyping by PCR-RFLP (Restriction
Fragment Length Polymorphism) of all birds was
completed by following the protocol described by Cui et
al. (2006).
For the MTNR-1C gene, forward (5’-
TGCCAGATAAGTGGGTTCCT-3’) and reverse (5’-
AGCGTCCACGTCAGACAGAT-3’) primers were
designed by the primer3 tool (Untergrasser et al. 2012) to
amplify a fragment of 164 base pairs (Genbank number
NC_006091.5). Polymerase chain reactions were carried
out with the following conditions: 95°C for 5 min,
followed by 35 cycles at 94°C for 30 s, 55°C for 45 s,
72°C for 50 s, and ended with an extended cycle at 72°C
for 5 min. Each PCR contained 10 µL, including 50 ng of
genomic DNA, 0.25 M of each primer, 0.25 M of each
dNTP, 1x PCR buffer, and 1U/µL Taq DNA polymerase.
The polymorphic site was identified by sequencing with
Sanger’s method. For genotyping, the PCR-SSCP
(Single-Strand Conformation Polymorphism) technique
was applied. In brief, the mixture of 8 µl of PCR product
and 10 µl loading buffer was heated to 95°C and
maintained for 10 minutes to separate the DNA strands.
The suspension was quickly transferred to ice and kept at
-20°C for 10 minutes. Before electrophoresis, the gel was
cooled at 7°C for 30 minutes. The DNA mixture was
loaded on gel and run at 10°C for 6 hours at 30 W. After
that, the gel was stained with 250 ml of TAE 1X solution
containing 25 µl of ethidium bromide (25 mg) for 30
minutes and visualized under UV light of the gel imaging
system (Gel Logic 212 - Kodak).
Statistical analysis: The association between genotype
and egg yield and egg quality traits was analyzed based
Lan et al., The J. Anim. Plant Sci., 31 (6) 2021

on the General Linear Model of Minitab software version
16.2.1 (Minitab 2010), Yij = µ + Gi + ξij (where Yij:
traits observed; μ: general mean, Gi: influence of
genotype; ξij: random error). Data is presented as Least
square mean ± Standard error.
RESULTS
Total egg yield was associated with the insertion
or deletion of nucleotides in the prolactin gene depending
on laying stages (Table 1). Considering only in 12 laying
weeks, all reproductive parameters remained similar
(P>0.05); however, a tendency of difference occurred at
six months of egg yield with a slightly higher rate
(P=0.061) in quails with DD genotypes. In the next
period, when the quails reached nine months of laying,
egg yield was the highest in birds carrying the II
genotype (213 eggs/bird; P<0.05). Due to similar
fertilized and hatching rates, the number of fertilized eggs
and hatched chicks was also higher in type II quails. The
difference was even more apparent when eggs were
collected up to 48 weeks of laying with the highest egg
production in birds baring II genotype, while those with
DD genotype were the lowest (P<0.01). However, it is
worth considering that quails with DD genotype
presented only at 3.9% in the population, whereas quails
carrying II genotype occupied 45.1% in the population
studied (396 individuals).

Table 1. Association between PRL polymorphism with egg production in different laying periods.

Genotypes
Parameters P
II (178) ID (n=203) DD (n=15)
1-12 laying weeks
Total egg yield 71.3±0.6 70.6±0.5 73.2±2.1 0.364
Laying rate (%) 84.8±0.7 84.0±0.6 87.2±2.5 0.364
Total egg hatched 67.3±0.6 66.9±0.5 70.0±2.1 0.333
Fertilized eggs 57.7±0.7 56.7±0.6 66.3±2.3 0.121
Fertilized rate (%) 85.7±0.6 84.7±0.6 87.2±2.2 0.312
Hatched chick number 53.2±0.7 52.1±0.6 56.9±2.4 0.125
Hatching rate (%) 92.0±0.4 91.7±0.4 92.8±1.5 0.731
1-24 laying weeks
Total egg yield 148.4±1.0 146.6±0.9 155.1±3.8 0.061
Laying rate (%) 88.3±0.6 87.2±0.6 92.3±2.3 0.061
Total egg hatched 140.6±1.0 139.4±0.9 147.8±3.8 0.087
Fertilized eggs 122.5ab±1.3 119.0b±1.2 133.7a±5.1 0.007
Fertilized rate (%) 87.1a±0.7 85.3b±0.6 90.6a±2.6 0.039
Hatched chick number 111.0ab±1.7 106.7b±1.6 123.0a±6.4 0.016
Hatching rate (%) 89.9±0.6 88.9±0.6 91.8±2.3 0.253
1-36 laying weeks
Total egg yield 213.0a±2.4 204.7b±2.2 205.2ab±9.0 0.034
Laying rate (%) 84.5a±0.9 81.2b±0.9 81.4ab±3.6 0.034
Total egg hatched 199.9a±2.3 192.4b±2.2 193.3a±8.8 0.047
Fertilized eggs 172.4a±1.9 165.0b±1.8 171.2ab±7.3 0.019
Fertilized rate (%) 86.6±0.5 86.2±0.5 88.6±2.0 0.447
Hatched chick number 150.3±1.8 145.1±1.6 151.5±6.7 0.056
Hatching rate (%) 87.4±0.5 88.1±0.5 90.2±2.0 0.298
1-48 laying weeks
Total egg yield 281.9a±2.8 267.3b±3.9 244.8b±15.0 0.007
Laying rate (%) 83.9a±1.4 79.6b±1.2 72.9b±4.5 0.007
Total egg hatched 272.9a±4.2 258.3b±3.9 235.8b±15.0 0.007
Fertilized eggs 234.9a±3.3 221.0b±3.2 207.6ab±11.9 0.003
Fertilized rate (%) 86.7±0.5 86.1±0.5 88.5±1.8 0.373
Hatched chick number 203.5a±2.8 193.1b±2.6 187.0ab±9.9 0.014
Hatching rate (%) 86.9±0.5 87.8±0.5 90.1±1.9 0.174
a,b,c Values within a row with different superscripts are significantly different (P<0.05)

At the polymorphic site of the MTRN-1C gene, when the yield was counted in 12 weeks or until 24
the effects of the genotype were found in egg production weeks of laying (P<0.01), but in the later stage, the

1561
Lan et al., The J. Anim. Plant Sci., 31 (6) 2021

difference was non-significant (Table 2). Superior egg
yield was found in quails of AA genotype while those of
in TT genotyped quails were inferior (153.4 vs. 144.6
eggs/24 laying weeks, respectively). A similar trend was
also found in several fertilized eggs and hatched chicks.
In Table 3, egg quality is presented for different
laying periods (1-24 weeks and 25-48 weeks). Among the
external and internal egg traits, albumen weight and
albumen ratio were found to differ (P<0.01) in the first 6
months of laying, with the highest values being in quails
of II genotype (6.6 g and 54.3%, respectively). In the
later stage (25-48 weeks), most of the parameters were
similar, with the exception of yolk index, in which the
highest was presented in DD genotype quails (P<0.05).
In the first 6 months of laying, many egg quality
characteristics were associated with the MTRN-1C
polymorphism, especially egg weight and other traits
related to yolk and albumen (Table 4). The genotype CC
showed lower egg weight than both CT and TT
genotypes, which was also observed for the yolk index.
Another internal trait, HU was the highest in birds with
TT genotype. However, in the later stage, only yolk ratio
was affected by genotype (P<0.05).

Table 2. Association between MTNR-1C polymorphism with egg production for extended laying periods.

Genotypes
Parameters P
AA (n=40) AC (n=64) AT (n=101) CC (n=25) CT (n=80) TT (n=64)
1-12 laying weeks
Total egg yield 72.4ab±0.6 72.7a±0.7 67.6c±1.4 71.4abc±1.0 71.6abc±0.7 70.1bc±0.6 0.002
Laying rate (%) 86.2 ±0.8
ab
86.5 ±0.8
a
80.4 ±1.7
c
85.0abc±1.1 85.2abc±0.9 83.4bc±0.7 0.002
Total eggs hatched 68.6 ±0.6
ab
68.8 ±0.7
a
63.8 ±1.4
c
67.6abc±0.9 67.7abc±0.7 66.3bc±0.6 0.002
Fertilized eggs 58.8±0.8 57.6±0.9 55.1±1.8 57.7±1.2 57.3±0.9 57.1±0.7 0.439
Fertilized rate (%) 85.8±0.8 83.6±0.9 86.3±1.8 85.3±1.2 84.6±1.0 86.0±0.7 0.342
Hatched chick number 54.6±0.9 52.7±1.0 51.0±2.0 53.1±1.4 52.5±1.0 52.7±0.8 0.477
Hatching rate (%) 92.6±0.7 91.0±0.7 92.4±1.5 91.9±1.0 91.5±0.7 92.0±0.6 0.661
1-24 laying weeks
Total egg yield 153.4a±1.3 148.9ab±1.5 153.9a±2.8 149.7ab±2.1 149.3ab±1.5 144.6b±1.2 0.000
Laying rate (%) 91.3a±0.8 88.7ab±0.9 91.6a±1.7 89.1ab±1.3 88.9ab±0.9 86.1b±0.7 0.000
Total eggs hatched 144.9 ±1.3 140.6 ±1.5 145.4 ±2.7 141.4 ±2.1 140.9ab±1.5
a ab a ab
136.3b±1.2 0.000
Fertilized eggs 126.1a±1.9 118.4ab±2.1 127.1ab±3.9 119.6ab±2.9 121.8ab±2.1 118.6b±1.7 0.019
Fertilized rate (%) 87.0±1.0 84.0±1.1 87.4±2.0 84.5±1.5 86.2±1.1 86.9±0.8 0.211
Hatched chick number 114.8±2.4 105.7±2.7 117.6±5.1 106.0±3.8 109.6±2.7 107.4±2.1 0.052
Hatching rate (%) 90.5±0.9 87.9±1.0 92.1±1.9 87.7±1.4 89.3±1.0 90.0±0.8 0.196
1-36 laying weeks
Total egg yield 210.6±3.6 205.0±3.8 208.4±7.0 214.9±5.5 206.5±4.0 206.6±3.2 0.686
Laying rate (%) 83.6±1.4 81.3±1.5 82.7±2.8 85.3±2.2 82.0±1.6 82.0±1.3 0.686
Total eggs hatched 199.0±3.6 193.5±3.9 196.9±7.1 203.5±5.5 194.9±4.0 195.4±3.2 0.705
Fertilized eggs 172.8±3.0 164.8±3.2 173.3±5.9 172.7±4.6 167.5±3.4 168.1±2.7 0.445
Fertilized rate (%) 87.3±0.8 85.7±0.8 88.2±1.5 85.2±1.2 86.4±0.9 86.1±0.7 0.456
Hatched chick number 153.5±2.7 146.2±2.9 152.7±5.3 150.8±4.1 147.7±3.0 147.3±2.4 0.405
Hatching rate (%) 89.1±0.7 89.0±0.8 88.5±1.5 87.3±1.1 88.3±0.8 87.8±0.7 0.065
1-48 laying weeks
Total egg yield 266.0±6.4 264.9±6.8 246.1±14.8 268.3±9.4 265.2±7.1 270.3±5.7 0.783
Laying rate (%) 79.2±1.9 78.9±2.0 73.3±4.4 79.9±2.8 78.9±2.1 80.5±1.7 0.783
Total eggs hatched 250.6±6.3 249.6±6.8 230.7±14.7 253.0±9.4 249.6±7.1 254.6±5.7 0.784
Fertilized eggs 261.8±5.1 213.2±5.4 204.3±11.8 214.9±7.5 213.4±5.6 218.3±4.5 0.892
Fertilized rate (%) 87.3±0.7 86.1±0.8 85.3±1.7 85.6±1.1 86.3±0.8 86.0±0.7 0.555
Hatched chick number 191.6±4.1 188.0±4.4 183.6±9.5 187.3±6.0 186.3±4.6 190.2±3.7 0.936
Hatching rate (%) 89.0±0.8 88.7±0.8 90.0±1.7 87.5±1.1 87.8±0.8 87.5±0.7 0.494
a,b,c
Values within a row with different superscripts are significantly different (P<0.05)

1562
Lan et al., The J. Anim. Plant Sci., 31 (6) 2021

Table 3. Association between PRL polymorphism and egg quality traits.

Genotype
Parameters P
II ID DD
1-24 laying weeks
Total eggs checked 1.068 1.218 108
Shape index 76.3±0.3 75.9±0.2 76.3±1.3 0.682
Egg weight (g) 12.2±0.1 12.0±0.1 12.2±0.3 0.240
Egg shell weight (g) 1.6±0.01 1.6±0.01 1.5±0.01 0.291
Albumen weight (g) 6.6a±0.1 6.3b±0.1 5.1c±0.4 0.000
Albumen height (mm) 4.1±0.03 4.1±0.02 4.1±0.1 0.554
Albumen width (mm) 41.2±0.8 44.6±0.7 45.9±3.3 0.842
Yolk weight (g) 3.9±0.02 3.8±0.02 3.8±0.1 0.156
Yolk height (mm) 11.0±0.1 10.9±0.03 11.1±0.2 0.081
Yolk width (mm) 23.4±0.2 23.4±0.1 23.6±0.7 0.953
Egg shell ratio (%) 12.9±0.1 12.9±0.1 12.3±0.4 0.347
Albumen ratio (%) 54.3a±0.7 52.1b±0.6 41.9c±3.0 0.000
Albumen index 9.5±0.1 9.5±0.1 9.1±0.5 0.780
Yolk ratio (%) 31.6±0.1 31.4±0.1 31.5±0.6 0.595
Yolk index 48.0±0.6 47.3±0.2 47.2±2.6 0.687
Haugh unit 87.0±0.2 86.9±0.1 86.9±0.7 0.849
25-48 laying weeks
Total eggs checked 1068 1218 108
Shape index 76.3±0.3 75.9±0.3 75.2±1.2 0.548
Egg weight (g) 11.8±0.1 11.8±0.1 11.7±0.3 0.831
Egg shell weight (g) 1.6±0.01 1.6±0.01 1.4±0.1 0.097
Albumen weight (g) 6.6±0.1 6.6±0.1 6.5±0.2 0.929
Albumen height (mm) 4.4±0.03 4.4±0.03 4.3±0.1 0.268
Albumen width (mm) 42.9±0.4 42.3±0.4 42.2±1.8 0.585
Yolk weight (g) 3.7±0.03 3.7±0.03 3.8±0.1 0.364
Yolk height (mm) 10.8±0.1 10.9±0.1 11.2±0.5 0.494
Yolk width (mm) 26.5±1.3 23.2±1.1 22.9±5.4 0.148
Egg shell ratio (%) 13.2±0.1 13.3±0.1 13.3±0.5 0.115
Albumen ratio (%) 55.3±0.2 55.6±0.2 54.9±1.0 0.677
Albumen index 10.4±0.2 10.7±0.1 10.4±0.6 0.287
Yolk ratio (%) 31.4±0.2 31.1±0.2 32.8±0.8 0.084
Yolk index 45.8b±0.4 46.7b±0.3 49.1a±1.2 0.033
Haugh unit 88.6±0.2 89.0±0.2 88.2±0.8 0.264
a,b,c Values within a row with different superscripts are significantly different (P<0.05)

Table 4. Association between MTNR-1C polymorphism with egg quality traits.

Genotypes
Parameters P
AA AC AT CC CT TT
1-24 laying weeks
Total eggs checked 486 120 384 216 612 426
Shape index (%) 76.7±0.5 75.9±0.6 75.7±1.1 76.4±0.8 75.9±0.6 75.6±0.5 0.727
Egg weight (g) 12.2ab±0.1 12.0ab±0.1 12.2ab±0.2 11.7b±0.1 12.3a±0.1 12.2a±0.1 0.025
Egg shell weight (g) 1.6±0.02 1.5±0.02 1.6±0.03 1.5±0.02 1.6±0.02 1.6±0.02 0.485
Albumen weight (g) 6.3±0.1 6.1±0.1 6.8±0.3 6.1±0.2 6.5±0.2 6.5±0.1 0.066
Albumen height (mm) 4.0b±0.04 4.2ab±0.04 4.1ab±0.01 4.1ab±0.1 4.1ab±0.04 4.2a±0.03 0.005
Albumen width (mm) 44.6±1.1 42.9±1.2 45.3±2.2 42.6±1.2 45.2±1.3 45.5±0.9 0.388
Yolk weight (g) 3.9±0.04 3.7±0.04 3.8±0.1 3.8±0.1 3.8±0.1 3.8±0.03 0.085
Yolk height (mm) 11.0abc±0.1 11.1a±0.1 11.1abc±0.1 10.7c±0.1 10.8bc±0.1 11.0ab±0.1 0.002
Yolk width (mm) 23.8a±0.3 23.6ab±0.3 23.6ab±0.5 24.0a±0.3 22.5b±0.3 23.2ab±0.2 0.003
Egg shell ratio (%) 12.8±0.1 12.9±0.1 12.8±0.3 13.1±0.2 12.7±0.2 13.0±0.1 0.525

1563
Lan et al., The J. Anim. Plant Sci., 31 (6) 2021

Albumen ratio (%) 52.1±1.1 51.6±1.1 56.3±2.1 51.9±1.4 53.3±1.2 52.8±0.9 0.429
Albumen index (%) 9.1ab±0.2 9.8a±0.2 9.1ab±0.3 9.6ab±0.2 9.1b±0.2 9.6ab±0.1 0.013
Yolk ratio (%) 31.9ab±0.2 31.1c±0.2 30.8bc±0.4 32.3a±0.3 30.7c±0.2 31.4bc±0.2 0.000
Yolk index 46.3ab±0.9 48.6ab±0.9 47.2 ±1.7
ab
44.8b±1.1 49.7a±1.0 47.9ab±0.7 0.015
Haugh unit 86.3b±0.2 87.3a±0.2 86.9ab±0.4 86.9ab±0.3 86.5ab±0.3 87.3a±0.2 0.004
25-48 laying weeks
Total eggs checked 486 120 384 216 612 426
Shape index (%) 11.8±0.1 11.8±0.1 11.8±0.2 11.5±0.1 11.9±0.1 11.8±0.1 0.254
Egg weight (g) 11.8±0.1 11.9±0.1 11.9±0.2 11.5±0.1 12.0±0.1 11.9±0.1 0.198
Egg shell weight (g) 1.5±0.02 1.6±0.02 1.6±0.04 1.5±0.03 1.6±0.02 1.6±0.02 0.351
Albumen weight (g) 6.5ab±0.1 6.6ab±0.1 6.6ab±0.1 6.3b±0.1 6.7a±0.1 6.6ab±0.1 0.044
Albumen height (mm) 4.4±0.1 4.4±0.1 4.5±0.1 4.4±0.1 4.3±0.1 4.4±0.04 0.145
Albumen width (mm) 42.4±0.6 42.6±0.6 44.0±1.2 41.8±0.8 43.3±0.7 42.5±0.5 0.654
Yolk weight (g) 3.7±0.04 3.7±0.04 3.7±0.09 3.7±0.06 3.7±0.07 3.7±0.04 0.697
Yolk height (mm) 10.7±0.2 11.2±0.2 10.8±0.3 10.7±0.2 10.8±0.2 10.7±0.1 0.249
Yolk width (mm) 28.9±1.8 23.5±1.9 23.7±3.6 23.2±2.4 23.6±2.1 23.4±1.5 0.205
Egg shell ratio (%) 13.1±0.2 13.4±0.4 13.0±0.3 13.3±0.2 13.2±0.2 13.2±0.1 0.797
Albumen ratio (%) 55.3±0.3 55.8±0.3 55.9±0.6 54.8±0.4 56.3±0.4 55.4±0.3 0.161
Albumen index (%) 10.6±0.2 10.6±0.2 10.4±0.4 10.7±0.3 10.2±0.3 10.5±0.2 0.687
Yolk ratio (%) 31.6ab±0.3 30.8ab±0.3 31.1ab±0.5 31.9a±0.3 30.5b±0.3 31.4ab±0.2 0.015
Yolk index 45.1±0.7 47.5±0.8 45.9±1.4 46.2±1.0 46.6±0.8 46.1±0.6 0.345
Haugh unit 89.1±0.3 89.0±0.3 89.6±0.6 89.1±0.4 88.0±0.3 88.7±0.2 0.081
a,b,c Values within a row with different superscripts are significantly different (P<0.05)

DISCUSSION Bagheri Sarvestani et al. (2013) that revealed genotype II

In the present report, a 24-bp Indel and a point
mutation NC_006091.5: c.25.144.C>A(T) was detected
in PRL and MTNR-1C genes of Japanese quails,
respectively. The polymorphisms showed certain effects
on egg production and internal egg quality traits, which
may indicate that they can be of interest in the selection
of reproductive traits in breeding programs.
In the PRL gene, the presence of the 24-bp Indel
with three genotypes, including II (154 bp), ID (154 and
130 bp) and DD (130 bp), was found. The results also
support the statement that in non-commercial breeds of
chickens, the “I” allele frequency varies from low to
medium (Begli et al. 2010, Cui et al. 2006, Rashidi et al.
2012), while in the commercial layer, this allele is
commonly found. Besides, these results correlate
favorably with the reports on chickens (Bagheri
Sarvestani et al. 2013), fowls (Begli et al. 2010), and give
further support to the conclusion found for quails (Lotfi
et al. 2013, Yousefi et al. 2012). It has been demonstrated
that II genotype has a positive effect on egg production
efficiency compared with effects from ID and DD
genotypes (Lotfi et al. 2013). In the present study,
Japanese quails possessing II genotype had higher egg
production, which is also in agreement with the report of
Begli et al. (2010) in Fars native chickens. Supportably,
the increase of allele I in the population has been reported
to eliminate the incubation behavior in local Papua hens
(Lumatauw and Mu’in 2016). However, the current
results were in contrast with the previous report by
and ID had higher hatching rates, whereas genotype DD
gave a lower rate.
There has been evidence showing the linkage
between the PRL polymorphic site with egg production.
Jiang et al. (2005) informed that chickens with
homozygote insertion (II genotype) could reduce
prolactin expression leading to no broodiness in chickens.
Also, the report from Shiue et al. (2006) revealed that
mRNA expression of the prolactin gene was significantly
higher in low egg-producing chickens, which indicates
that egg production was related to prolactin mRNA
expression. Then, a rise of prolactin level in plasma may
induce incubation behavior and then terminate laying
(Sockman et al. 2000) and thus decrease egg production
(Reddy et al. 2002). The elevated levels of prolactin
decrease the egg clutch lengths by increasing the inter-
sequence pauses between the sequences of egg lay,
particularly in native birds (Reddy et al. 2002, Reddy et
al. 2006). Prolactin also plays a significant role in
decreasing the number of follicles in the ovary, thus
affecting egg production. In that respect, broodiness was
adversely correlated with egg production and finally
stimulated the reduction of egg production in domestic
fowl (March et al. 1994).
It was also noted that, in the first months of egg-
laying, the productivity of DD genotyped quails tended to
be higher, then decreased rapidly during the 7-9 month
period. In reality, if quails up to 24 weeks of laying are
used for egg production, then it is reasonable to
incorporate the selection of this genotype into breeding,
yet with longer laying periods, productivity will decrease

1564
Lan et al.,
rapidly. However, in this study, there were only 15
individuals with genotypes DD out of a total of 396
individuals, so it is not possible to have a precise
conclusion about the benefits and disadvantages of this
genotype. Meanwhile, II genotype resulted in relatively
stable egg production and a slow reduction in laying rate.
Therefore, when considering the effectiveness of quails
up to 48 weeks of laying, this would be the best choice in
terms of productivity and flock development.
In the present study, a novel polymorphic site
was detected in MTNR-1C gene and it was found to
associate with egg yield and some egg quality traits.
According to Sundaresan et al. (2009), the MTNR-1C
gene is highly expressed in the follicular granulocytes;
thus, it is thought to play an important role in egg
formation, thereby affecting poultry egg production. The
study by Li et al. (2015) showed that the expression of
the MTNR-1C gene was related to chicken egg
production, and the authors demonstrated that chickens
with a high expression of MTNR-1C had the lowest
number of eggs laid and vice versa. This was in line with
the report of Abd El Naby and Basha (2016) that the
MTNR-1C expression increased, which accompanied a
delay in sexual maturity of Japanese quails. In an
association study, it was found that the MTNR-1C
polymorphic gene is linked with the age at which the first
egg is laid and the number of eggs laid at 300 days of age
in Erlang mountain chickens (Li et al. 2013). Recently,
an association between MTNR-1C polymorphism with
total egg yield at 34 weeks of age, and age at first egg,
was reported and the expression of this gene was up-
regulated in an early-age maturation group of Shaoxing
duck (Feng et al. 2018). Although the exact role of
melatonin receptors in different species during the
reproductive process is not well understood, MTNR-1C is
hypothesized to activate avian sexual mature by down-
regulating its expression level (Feng et al. 2018).
Egg weight is an important indicator of egg
quality and total egg production. If the total number of
eggs is the same, but the egg weight varies, the entire egg
production quality will be different. In quail breeding,
high-quality eggs are favored, especially those close to
the average value, because these eggs give better
hatching probability than oversized or undersized eggs
(Asuquo and Okon 1993). In addition, egg weight
corresponds to the weight of albumen, egg yolk and
eggshell. In Table 4, the genotypes at MTNR-1C
polymorphism produced eggs with weights in the range
of 11.7 to 12.2 g, in which quails of CC genotype had the
lowest value. This result additionally implies that MTNR-
1C polymorphism has certain effects on the egg weight of
Japanese quails. The effect is supposed to relate to gene
expression since MTNR-1C is negatively associated with
egg weight, individuals with low MTNR-1C expression
produce higher egg weight than those with high MTNR-
1C expression (Abd El Naby and Basha 2016). Although
1565
The J. Anim. Plant Sci., 31 (6) 2021
there are differences between quails that carry different
genotypes, no genotype really stands out in egg quality.
Quails carrying AA genotype gave an average egg mass
compared with those with other genotypes, and there is
no difference in other indicators related to albumen and
yolk. However, this is a homogeneous genotype for high
yield, so it should be noted for breeding purposes.
Conclusion: Altogether, it can be concluded that the two
polymorphisms studied may be used in breeding
programs to improve egg production, and to some extent,
egg quality traits in Japanese quails, of which the II
genotype in PRL gene and the homozygous AA genotype
in MTNR-1C genes are appropriate for selection.
Acknowledgments: This research was funded by the
Vietnam National Foundation for Science and
Technology Development (NAFOSTED) under grant
number 106-NN.05-2013.12.
REFERENCES
Abd El Naby, W.S.H. and H.A. Basha (2016). Expression
of melatonin receptor subtype genes and its
impact on reproductive traits in Japanese Quail
in different lighting systems. Avian Biol. Res.,
9(4), 250-256.
Adachi, A., A.K. Natesan, M.G. Whitfield‐Rucker, S.E.
Weigum and V.M. Cassone (2002). Functional
melatonin receptors and metabolic coupling in
cultured chick astrocytes. Glia, 39, 268-278.
Asuquo, B. and B. Okon (1993). Effects of age in lay and
egg size on fertility and hatchability of chicken
eggs. East Afr. Agric. For. J., 59(1), 79-83.
Ayre, E., H. Yuan and S. Pang (1992). The identification
of 125I-labelled iodomelatonin-binding sites in
the testes and ovaries of the chicken (Gallus
domesticus). J. Endocrinol., 133(1), 5-11.
Bagheri Sarvestani, A., A. Niazi, M. Zamiri and M.
Dadpasand Taromsari (2013). Polymorphisms of
prolactin gene in a native chicken population
and its association with egg production. Iranian
J. Vet. Res., 14(2), 113-119.
Begli, H.E., S. Zerehdaran, S. Hassani, M.A. Abbasi, and
A.K. Ahmadi (2010). Polymorphism in prolactin
and PEPCK-C genes and its association with
economic traits in native fowl of Yazd province.
Iranian J. Biotechnol., 8(3), 172-177.
Bello, N., O. Francino and A. Sánchez (2001). Isolation
of genomic DNA from feathers. J. Vet. Diagn.
Invest., 13, 162-164.
Cui, J.-X., H.-L. Du, Y. Liang, X.-M. Deng, N. Li, and
X.-Q. Zhang (2006). Association of
polymorphisms in the promoter region of
chicken prolactin with egg production. Poult.
Sci., 85, 26-31.
Lan et al.,
Deeb, N. and S. Lamont (2002). Genetic architecture of
growth and body composition in unique chicken
populations. J. Hered., 93, 107-118.
Feng, P., W. Zhao, Q. Xie, T. Zeng, L. Lu and L. Yang
(2018). Polymorphisms of melatonin receptor
genes and their associations with egg production
traits in Shaoxing duck. Asian-Australas. J.
Anim. Sci., 31(10), 1535-1541.
He, C., J. Wang, Z. Zhang, M. Yang, Y. Li, X. Tian, T.
Ma, J. Tao, K. Zhu and Y. Song (2016).
Mitochondria synthesize melatonin to ameliorate
its function and improve mice oocyte’s quality
under in vitro conditions. Int. J. Mol. Sci., 17(6),
939.
Jiang, R., G. Xu, X. Zhang and N. Yang (2005).
Association of polymorphisms for prolactin and
prolactin receptor genes with broody traits in
chickens. Poult. Sci., 84, 839-845.
Kulibaba, R. and A. Podstreshnyi (2012). Prolactin and
growth hormone gene polymorphisms in
chicken lines of Ukrainian selection. Cytol.
Genet., 46(6), 390-395.
Li, D., N. Wu, J. Tu, Y. Hu, M. Yang, H. Yin, B. Chen,
H. Xu, Y. Yao and Q. Zhu (2015). Expression
patterns of melatonin receptors in chicken
ovarian follicles affected by monochromatic
light. Genet. Mol. Res., 14(3), 10072-10080.
Li, D., L. Zhang, D. Smith, H. Xu, Y. Liu, X. Zhao, Y.
Wang and Q. Zhu (2013). Genetic effects of
melatonin receptor genes on chicken
reproductive traits. Czech J. Anim. Sci., 58, 58-
64.
Liang, Y., J. Cui, G. Yang, F.C. Leung and X. Zhang
(2006). Polymorphisms of 5′ flanking region of
chicken prolactin gene. Domest. Anim.
Endocrin., 30(1), 1-16.
Lotfi, E., S. Zerehdaran, M. Ahani, and E. Dehnavi
(2013). Genetic polymorphism in Prolactin gene
and its association with reproductive traits in
Japanese quail (Coturnix coturnix japonica).
Poult. Sci. J., 1, 29-35.
Lumatauw, S. and M.A. Mu’in (2016). A 24-bp Indel
(Insertion-Deletion) polymorphism in promoter
prolactin gene of Papua local chickens. Anim.
Prod., 18(1), 1-7.
March, J., P. Sharp, P. Wilson and H.J.R. Sang (1994).
Effect of active immunization against
recombinant-derived chicken prolactin fusion
protein on the onset of broodiness and
photoinduced egg laying in bantam hens. J.
Reprod. Fertil. 101(1), 227-233.
Minitab, 2010. Minitab reference manual, Release 16.2.1
for Windows (Minitab Inc, USA).
Nakamura, Y., H. Tamura, H. Takayama, and H. Kato
(2003). Increased endogenous level of melatonin
in preovulatory human follicles does not directly
1566
The J. Anim. Plant Sci., 31 (6) 2021
influence progesterone production. Fertil. Steril.,
80(4), 1012-1016.
Narinc, D., T. Aksoy, E. Karaman, A. Aygun, M.Z. Firat,
and M.K. Uslu (2013). Japanese quail meat
quality: characteristics, heritabilities, and genetic
correlations with some slaughter traits. Poult.
Sci., 92(7), 1735-1744.
Nasr, M.A., M.S. El-Tarabany and M. J. Toscano (2016).
Effects of divergent selection for growth on egg
quality traits in Japanese quail. Anim. Prod. Sci.,
56(11), 1797-1802.
Rashidi, H., G. Rahimi-Mianji, A. Farhadi and M.
Gholizadeh (2012). Association of prolactin and
prolactin receptor gene polymorphisms with
economic traits in breeder hens of indigenous
chickens of Mazandaran province. Iranian J.
Biotechnol., 10(2), 129-135.
Reddy, I. J., C.G. David, P. V. Sarma and K. Singh
(2002). The possible role of prolactin in laying
performance and steroid hormone secretion in
domestic hen (Gallus domesticus). Gen. Comp.
Endocrinol., 127(3), 249-255.
Reddy, I.J., C.G. David and S.S. Raju (2006). Chemical
control of prolactin secretion and it’s effects on
pause days, egg production and steroid hormone
concentration in Girirani birds. Int. J. Poult. Sci.,
5(7), 685-692.
Sari, M., S. Isik, K. Onk, M. Tilki, and T. Kırmizibayrak
(2012). Effects of layer age and different
plumage colors on external and internal egg
quality characteristics in Japanese quails
(Coturnix coturnix japonica). Arch. Geflügelkd.,
76(4), S. 254-258.
Sharp, P.J., M.C. Macnamee, R.T. Talbot, R.J. Sterling
and T.R. Hall (1984). Aspects of the
neuroendocrine control of ovulation and
broodiness in the domestic hen. J. Exp. Zool.,
232(3), 475-483.
Shi, J.M., X.Z. Tian, G.B. Zhou, L. Wang, C. Gao, S.E.
Zhu, S.M. Zeng, J.H. Tian and G.S. Liu (2009).
Melatonin exists in porcine follicular fluid and
improves in vitro maturation and
parthenogenetic development of porcine
oocytes. J. Pineal. Res., 47(4), 318-323.
Shimada, K., H. Ishida, K. Sato, H. Seo, and N. Matsui
(1991). Expression of prolactin gene in
incubating hens. J. Reprod. Fertil., 91, 147-154.
Shiue, Y.L., L.R. Chen, C.F. Chen, Y.L. Chen, J.P. Ju,
C.H. Chao and Y.P. Lee (2006). Identification of
transcripts related to high egg production in the
chicken hypothalamus and pituitary gland.
Theriogenology, 66(5), 1274-1283.
Soares, J.M., M.I. Masana, Ç. Erşahin and M.L.
Dubocovich (2003). Functional melatonin
receptors in rat ovaries at various stages of the
Lan et al.,
estrous cycle. J. Pharmacol. Exp. Ther., 306(2),
694-702.
Sockman, K. W., H. Schwabl and P. J. Sharp (2000). The
role of prolactin in the regulation of clutch size
and onset of incubation behavior in the
American kestrel. Horm. Behav., 38(3), 168-
176.
Sundaresan, N., M.M. Leo, J. Subramani, D. Anish, M.
Sudhagar, K. Ahmed, M. Saxena, J. Tyagi, K.
Sastry and V. Saxena (2009). Expression
analysis of melatonin receptor subtypes in the
ovary of domestic chicken. Vet. Res. Commun.,
33(1), 49-56.
Tian, X., F. Wang, C. He, L. Zhang, D. Tan, R.J. Reiter,
J. Xu, P. Ji, and G. Liu (2014). Beneficial effects
of melatonin on bovine oocytes maturation: a
1567
The J. Anim. Plant Sci., 31 (6) 2021
mechanistic approach. J. Pineal. Res., 57(3),
239-247.
Untergrasser, A., I. Cutcutache, T. Koressaar, J. Ye, B.
Faircloth, M. Remm and S. Rozen (2012).
Primer3–new capabilities and interfaces.
Nucleic. Acids. Res., 40(15), e115.
Vu, C.T. and N.T. Ngu (2016). Single nucleotide
polymorphisms in candidate genes associated
with egg production traits in native Noi chicken
of Vietnam. Int. J. Pl. An. and Env. Sci., 6, 162-
169.
Yousefi, S., Z. Raoufi, Z. Rasouli and S. Zerehdaran
(2012). Investigation of prolactin gene
polymorphism in Japanese quail. Anim. Sci.
Biotechnol., 45(1), 289-292.
KHKT Chăn nuôi Số 263 - tháng 2 năm 2021

Tổng biên tập: DI TRUYỀN - GIỐNG VẬT NUÔI

TS. ĐOÀN XUÂN TRÚC Nguyễn Thị Ngọc Hân và Nguyễn Ngọc Tấn. Ảnh hưởng của việc bổ sung VEGF đến
sự thành thục nhân c a tế bào trứng heo

ủ
Phó Tổng biên tập: Nguyễn Thanh Ngân, Nguyễn Thị Ngọc Hân, Nguyễn Thị Thạo v Nguyễn Ngọc
PGS.TS. NGUYỄN ĐĂNG VANG

à
Tấn. Cải thi n tỷ l thành thục nhân tế bào trứng heo thu từ nang noãn nhỏ
PGS.TS. NGUYỄN VĂN ĐỨC

ệ
ệ
Nguyễn Ho ng Thịnh, Nguyễn Phuong Giang v Bùi Hữu Đo n. Năng suất sinh

à
à
à
sản c a gà Ri Lạc Sơn nuôi bán chăn thả
Thư ký tòa soạn:

ủ
Trần Ngọc Tiến, Nguyễn Quý Khiêm, Phạm Thùy Linh, Phạm Thị Huệ v Nguyễn
PGS.TS. NGUYỄN VĂN ĐỨC

à
Thị Minh Hường. Khả năng sản xuất c a gà Lai thương phẩm AC12

ủ
Ủy viên Ban biên tập:
TS. NGUYỄN QUỐC ĐẠT DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI
PGS.TS. HOÀNG KIM GIAO
Ho ng Thị Hồng Nhung, Từ Trung Kiên v Trần Thị Bích Ngọc. Xác định mức bón
GS.TS. NGUYỄN DUY HOAN à
à
GS.TS. DƯƠNG NGUYÊN KHANG đạm thích hợp cho cây Moringa Oleifera trồng làm thức ăn chăn nuôi
PGS.TS. NGUYỄN THỊ KIM KHANG Nguyễn Bình Trường. nh hư ng mức b sung thức ăn hỗn hợp đến tiêu thụ và tiêu

Ả
ở
ổ
PGS.TS. ĐỖ VÕ ANH KHOA hóa dưỡng chất c a bò Red Angus x Lai Zebu giai đoạn 13 đến 15 tháng tu i tại tỉnh
ủ
ổ
PGS.TS. ĐỖ ĐỨC LỰC An Giang
PGS.TS. LÊ ĐÌNH PHÙNG
Ho ng Tuấn Th nh, Nguy n Th Hi p, Nguy n Th Lan Anh v Nguy n Th Thủy
à
à
ễ
ị
ệ
ễ
ị
à
ễ
ị
Tiên. nh hư ng c a phương thức nuôi đến khả năng sinh trư ng và sinh sản c a vịt
Xuất bản và Phát hành:
Ả
ở
ủ
ở
ủ
ThS. NGUYỄN ĐÌNH MẠNH Hòa Lan
Đặng Hồng Quyên, Nguyễn Thị Xuân Hồng, Nguyễn Thị Hạnh v Nguyễn Bỉnh Thảo.

U
à
nh hư ng c a b sung chế phẩm Daone AD3E Plus đến năng suất và chất lượng trứng
Ả
ở
ủ
ổ
c a gà sinh sản
ủ
CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC
Lê Thanh Phương, Phạm Ngọc Du v Nguyễn Thiết. Phẩm chất tinh dịch và tỷ l trứng
Giấy phép: Bộ Thông tin và Truyền thông
à
ệ
có phôi, tỷ l ấp n c a hai dòng gà trống nòi
ệ
ở
ủ
Số 257/GP- BTTTT ngày 20/05/2016 Nguyễn Văn Chánh, Đỗ Văn Long v Nguyễn Thanh Hải. Hi u quả sử dụng phụ phẩm
à
ệ
ISSN 1859 - 476X thay thế hoàn toàn cỏ trong chăn nuôi Bê lai chuyên thịt cao sản giai đoạn vỗ béo từ 9
Xuất bản: Hàng tháng đến 12 tháng tu i
ổ
Toà soạn: Văn Ngọc Phong, Nguyễn Hữu Văn, Lê Đình Phùng, Dương Thanh Hải, Nguyễn Thị
Địa chỉ: Tầng 4, Tòa nhà 73, Mùi v Trần Ngọc Long. nh hư ng c a tỷ l trống mái đến năng suất sinh sản c a chim
à
Ả
ở
ủ
ệ
ủ
cút giống nuôi tại Thừa Thiên Huế

Hoàng Cầu, Ô Chợ Dừa,
Đống Đa, Hà Nội. Nguyễn Thiết, Nguyễn Văn Hớn, Nguyễn Trọng Ngữ v Sumpun Thammacharoen.
à
Điện thoại: 024.36290621 Khả năng thích nghi c a dê thịt lai khi uống nước nhiễm mặn lên khối lượng, tăng khối
ủ
lượng và một số chỉ tiêu sinh hoá máu
Fax: 024.38691511
Hồ Thị Việt Thu, Nguyễn Tâm Đồng, Vũ Ngọc Minh Thư v Huỳnh Ngọc Trang. Sự lưu
E - mail: tapchichannuoi@hoichannuoi.vn
à
hành c a virus gây b nh marek trên gà bản địa tỉnh Đồng Tháp
Website: www.hoichannuoi.vn
ủ
ệ
ở
Hồ Thị Kim Hoa, Lê Hữu Ngọc, Dương Chánh Tây, Nguyễn Thị Huệ, Vũ Thuận Th nh
Tài khoản:
à
v Huỳnh Trung Tín. Ủ sinh học chất thải chăn nuôi gia cầm
Tên tài khoản: Hội Chăn nuôi Việt Nam
à
Nguyễn Thị Bích Ng , Đỗ Thị Vân Giang, Trương Thị Tính v Đinh Ngọc Bách. Đặc
à
à
Số tài khoản: 1300 311 0000 40, tại Ngân hàng điểm lâm sàng, b nh tích lợn nhiễm giun tròn Trichocephalus suis tại tỉnh Thái Nguyên
Nông nghiệp và Phát triển Nông thôn, Chi nhánh
ệ
ở
Thăng Long - Số 4, Phạm Ngọc Thạch, Hà Nội.
THÔNG TIN KHOA HỌC VÀ CÔNG NGHỆ
In 1.000 bản, khổ 19x27 tại Công ty CP KH&CN
Hoàng Quốc Việt. In xong và nộp lưu chiểu: TS. Phạm Thị Thanh Thảo. Chu trình chăn nuôi lợn công nghi p Vi t Nam
ệ
ở
ệ
tháng 2/2021. TS. Tăng Xuân Lưu v TS. Ngô Đình Tân, PGS.TS. Nguyễn Văn Đức. B nh viêm da
à
ệ
n i cục do Virus - Lympy Skin Disease
ổ
CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC

5. Lý Thị Thu Lan, Nguyễn Thị Hồng Nhân và Nguyễn
Trọng Ngữ (2017). Ảnh hưởng của đa h nh gen Growth
ì Vet. Adv., 3(7): 424-30.
Hormone đến khả năng đẻ trứng của chim c t Nhật Bản ú
(Coturnix coturnix japonica). Tạp chí KHKT Chăn nuôi,
220: 7-12.
6. Rizk R.E., H.S. Zeweil, M.A. El-Zayat and Salma A. H.
Abou Hafsa (2006). Effect of flock age and dietary fat on
production and reproduction performance in Japanese quail.
World Poultry Science Association (WPSA) XII European
Poultry Conference, 10-14 September, Verona, Italy.
7. Seker I., F. Ekmen, M. Bayraktar and S. Kul (2004). The
effects of parental age and mating ratio on egg weight,
hatchability and chick weight in Japanese quail. J. Ani.
8. Umar Ali, Sarzamin Khan, Rafiullah, Naila Chand, Zahid
Ali Shah, Amanullah Akhtar and Abdul Jabbar Tanweer
(2013). Effect of male to female ratio and vitamin-E
selenium on fertility, hatchability and hatched chick
weight of quail breeders. Sarhad J. Agr., 29(3): 441-47.
9. Zofia Tarasewicz, Danuta Szczerbińska, Marek Ligocki,
Monika Wiercińska, Danuta Majewska and Krystyna
Romaniszyn (2006). The effect of differentiated dietary
protein level on the performance of breeder quails. Ani.
Sci. Papers Rep., 24(3): 207-16.

KH NĂNG THÍCH NGHI C A DÊ THỊT LAI KHI UỐNG NƯỚC

Ả Ủ

NHIỄM MẶN LÊN KHỐI LƯỢNG, TĂNG KHỐI LƯỢNG VÀ

MỘT SỐ CHỈ TIÊU SINH HOÁ MÁU
Nguyễn Thiết1 *, Nguyễn Văn Hớn1, Nguyễn Trọng Ngữ1 v Sumpun Thammacharoen1 à

Ngày nhận bài báo: 02/01/2021 - Ngày nhận bài phản biện: 19/01/2021
Ngày bài báo đư c chấp nhận đăng: 05/02/2021
ợ

TÓM TẮT
Nghiên cứu này nhằm xác định ảnh hưởng của phương pháp thích nghi nư c uống bị nhiễm ớ

m n lên khối lư ng (KL), tăng khối lư ng (TKL) và m t số chỉ tiêu sinh hoá máu của dê thịt lai.
ặ ợ ợ ộ

Thí nghiệm đư c bố trí hoàn toàn ng u nhiên v i hai nghiệm thức (NT): NT1 là nh m nuôi không
ợ ẫ ớ ó

thích nghi và NT2 là nh m nuôi thích nghi, 5 lần l p lại. Kết quả nghiên cứu cho thấy lư ng thức ăn
ó ặ ợ

tiêu thụ của hai NT không c s khác biệt c ý nghĩa thống kê (P>0,05). V vậy, khả năng TKL của
ó ự ó ì

dê không bị ảnh hưởng. Lư ng nư c uống ở nh m thích nghi nhi u hơn nh m không thích nghi.
ợ ớ ó ề ó

Tuy nhiên, ở ngày 7 lư ng nư c uống tương t giữa hai NT (P>0,05). Nồng đ Na+ và Cl- trong
ợ ớ ự ộ

máu giai đoạn 1-6 ngày ở NT thích nghi cao hơn so v i NT không thích nghi, ngư c lại giai đoạn
ớ ợ

7-21 ngày th nồng đ Na+, K+ và Cl- tương đương nhau. Th tích nư c ti u, GFR, hàm lư ng Cl-
ì ộ ể ớ ể ợ

của nh m thích nghi cao hơn nh m không thích nghi; hàm lư ng Na+ và Cl- tương đương nhau.
ó ó ợ

Kết quả thí nghiệm cho thấy dê đư c nuôi thích nghi v i nư c m n c khả năng uống nư c nhiễm
ợ ớ ớ ặ ó ớ

m n nhi u hơn thông qua tăng t lệ lọc ở cầu thận và tăng bài thải các chất điện giải qua nư c ti u.
ặ ề ỷ ớ ể

Từ khóa: Dê thịt, sự th ch nghi, chất điện giải, tăng khối lượng, nước muối.
í

ABSTRACT
Adaptation of growing crossbred goats to saline water on weight gain and some
biochemical indicators in blood
The study aimed to determine adaptation of growing crossbred goats to saline water on
weight gain and some biochemical indicators in blood. The experiment was arranged completely
randomized, including two treatments: non-adapted group and adapted group with 5 replicates.
The results from study showed that feed intake did not affected by saline in drinking water (P>0.05).
Therefore, weight gain was similar to between groups. The amount of water intake in the adaptive
group was greater than those from the non-adaptive group. Interestingly, on day 7, the amount of
water intake was similar between two treatments (P>0.05). The concentration of Na+, Cl- in plasma
from day 1 to day 6 in the adapted group was higher than that of the non-adapted group, whereas
from day 7 to 21 the concentration of Na+, K+ and Cl- in plasma did not differ between groups. The

1
Trường Đại học Cần Thơ
*
Tác giả liên hệ: TS. Nguyễn Thiết, Khoa Phát tri n Nông thôn, Trường Đại học Cần Thơ. Điện thoại: 0932147900; Email:
ể

nthiet@ctu.edu.vn

KHKT Chăn nuôi số 263 - tháng 2 năm 2021 63

 CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC
urine volume, GFR, and Cl- content from adapted group were higher than that from non-adapted
group, whereas the Na+ and Cl- contents were similar. The experimental results showed that the
goats adapted with saline water were able to drink more saline water by increasing the glomerular
filtration rate and increasing the urinary excretion of electrolytes
Keywords: Adatation, growing goat, electrolytes, saline water, weight gain.
1. ĐẶT VẤN ĐỀ
Việt Nam có trên 3.000km bờ biển, tập
trung hàng triệu người sinh sống và khai thác
các nguồn lợi từ biển. Xâm nhập mặn diễn ra
tại hầu hết các địa phương ven biển, gây ảnh
hưởng lớn đến hoạt động sản xuất và sinh hoạt
của người dân, đặc biệt tại những cửa sông đổ
ra biển. Hai đồng bằng rộng lớn của Việt Nam
là Đồng bằng sông Hồng (ĐBSH) và ĐBS Cửu
Long (CL) là những nơi chịu ảnh hưởng lớn
nhất của hiện tượng này. Nhiều giải pháp đã
được đưa ra, phần nào hạn chế được tình trạng
xâm nhập mặn nhưng trong bối cảnh biến đổi
khí hậu diễn ra ngày càng phức tạp thì trong
thời gian tới, hiện tượng xâm nhập mặn vẫn
là mối đe dọa lớn đến đời sống các khu vực
này, đặc biệt là khu vực ĐBSCL. Viện Khoa
học Thủy lợi miền Nam cho biết, mùa khô
năm 2018-2019 ở khu vực ĐBSCL có mặn xâm
nhập sớm, sâu và nồng độ mặn cao hơn so với
những năm gần đây, nhưng vẫn thấp hơn so
với năm hạn mặn lịch sử trên ĐBSCL (2015-
2016). Việc sử dụng nước là một trong những
yếu tố quan trọng ảnh hưởng xâm nhập mặn.
Tại ĐBSCL nước sử dụng đa dạng cho các
ngành sản xuất nhưng nước sử dụng nhiều
nhất vẫn là cho nông nghiệp nước ta trong đó
có ngành chăn nuôi. Hiện tượng xâm nhập
mặn khiến tài nguyên nước ngọt khan hiếm,
không đủ cung cấp cho con người và vật nuôi,
quá trình chăn nuôi sẽ gặp nhiều khó khăn.
Theo khuyến cáo một số loại vật nuôi không
nên sử dụng nước nhiễm mặn, không đạt tiêu
chuẩn có thể gây ngộ độc và dẫn đến những
biến chứng nghiêm trọng bệnh về thận, ảnh
hưởng đến sức khoẻ vật nuôi (Nguyễn Phan
Hồng Phương, 2016). Vì vậy, cần phải có một
số giải pháp trong chăn nuôi để thích ứng với
việc biến đổi khí hậu ở vùng ĐBSCL.
Dê là loại gia súc nhỏ, nhu cầu thức ăn
ít nên không đòi hỏi diện tích chuồng trại và
64
đồng cỏ lớn so với trâu, bò. Thêm vào đó khả
năng chống chịu với điều kiện nắng nóng của
dê tốt hơn so với trâu, bò (Silanikove, 2000;
Silanikove, 2000a). Do đó, dê có thể được xem
là vật nuôi thích hợp trong điều kiện biến đổi
khí hậu hiện nay tại Việt Nam. Bên cạnh đó
các nghiên cứu trước đây đã chỉ rằng dê có
khả năng sử dụng nước uống có độ mặn khác
nhau như chịu được nước uống có nồng độ
NaCl lên tới 12,5‰ (Bell, 1959). Tuy nhiên,
theo Runa và ctv (2019) khi dê thay đổi nước
uống từ nước ngọt sang nước mặn từ từ thì
không ảnh hưởng đến khả năng tăng khối
lượng (TKL) hay lượng ăn vào của dê. Tương
tự, nghiên cứu của Zoidis và Hadjigeorgiou
(2018) cho rằng việc chuyển đổi từ nước ngọt
sang nước mặn từng phần thì không ảnh
hưởng đến TKL, sức khỏe của dê trong thời
gian 14 ngày thí nghiệm. Kết quả nghiên cứu
của Trần Minh Đức và ctv (2020) cho rằng khi
dê uống nước nhiễm mặn với nồng độ TDS
là 15‰ trong 15 ngày đã làm giảm TKL của
dê. Do đó, nghiên cứu này tiếp nối từ kết quả
nghiên cứu của nhóm nghiên cứu với mong
muốn đánh giá khả năng thích nghi của dê
thịt khi uống nước nhiễm mặn lên KL, TKL và
một số chỉ tiêu sinh hoá máu.
2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU
2.1. Đối tượng, thời gian và địa điểm
Đề tài được thực hiện trên 10 con dê lai từ
tháng 9/2020 đến tháng 12/2020, tại Khu thực
nghiệm chăn nuôi thuộc Khoa Phát triển nông
thôn, Trường Đại học Cần Thơ.
Chuồng nuôi dê được xây dựng thoáng
mát sạch sẽ, không bị mưa tạt gió lùa. Mỗi ô
chuồng có khoảng cách trung bình là 0,5m, với
kích thước mỗi ô chuồng là: 1,2m (dài) x 0,7m
(rộng) x 1,7m (cao). Chiều cao từ sàn chuồng
đến mặt đất là 0,7m. Mỗi ô chuồng điều có
máng ăn, máng uống riêng.
KHKT Chăn nuôi số 263 - tháng 2 năm 2021
CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC

Tất cả dê được cho ăn khẩu phần trộn Phương pháp phân tích mẫu nước ở Bảng
hoàn chỉnh (TMR) giống nhau bao gồm 70% 3, trong đó K+ hoà tan, Na+ hoà tan, Ca2+ hoà
bắp ủ chua và 30% thức ăn hỗn hợp. Trong đó, tan, Mg2+ hoà tan đo mẫu trên máy hấp thu
thức ăn hỗn hợp gồm có cám gạo, bột bắp, khô nguyên tử; EC đo bằng máy đo EC; Cl- chuẩn
đậu nành, bột đá mịn và rỉ mật đường (Bảng 1). độ bằng AgNO3 0.02N và TDS chuyển đổi từ
Bảng 1. Nguyên liệu thức ăn thí nghiệm EC bằng công thức: TDS (g/l) = EC (mS/cm) x
0,454.
Thành phần nguyên liệu Tỷ lệ (% DM)
Thân lá bắp ủ chua 70,0 2.2. Phương pháp nghiên cứu
Cám gạo tươi 8,0 2.2.1. Bố trí thí nghiệm
Bột bắp 11,3
Khô đậu nành 7,8
Thí nghiệm (TN) được bố trí hoàn toàn
Bột đá mịn 0,9 ngẫu nhiên gồm hai nghiệm thức (NT) là
Rỉ mật đường 2,0 nhóm dê nuôi không thích nghi (NT1) và
Tổng 100 nhóm nuôi thích nghi (NT2), với 5 lần lặp lại.
Mẫu thức ăn dùng trong thí nghiệm được Tổng số dê là 10 con. Thí nghiệm được thực
sấy để xác định vật chất khô sau đó được đem hiện trong 21 ngày, trong đó giai đoạn trước
đi phân tích thành phần hóa học. TN là từ ngày 1 đến ngày 6 và giai đoạn sau
TN là từ ngày 7 đến ngày 21. Tất cả dê được
Bảng 2. Thành phần hóa học trong thức ăn
ăn và uống hai lần/ngày vào lúc 7 giờ sáng và
Thành phần hóa học Tỷ lệ (%) 14 giờ chiều. Dê được cho ăn khẩu phần TMR,
DM 29,5 bao gồm 70% bắp ủ chua và 30% thức ăn hỗn
CP 16,2
hợp. Thí nghiệm sử dụng nước ngọt (0‰),
EE 2,01
ADF 28,5
nước mặn có nồng độ 5, 10, 15‰ và được
Ash 9,7 uống nước tự do.
DM = Vật chất khô; CP = Protein thô; EE = Béo thô; Tất cả dê TN sẽ được nhốt ở mỗi ô
NDF = Xơ trung tính; Ash = Khoáng tổng số chuồng. Ở nhóm nuôi không thích nghi thì dê
Nước uống dùng cho dê thí nghiệm gồm được uống nước ngọt (0‰) trong 6 ngày liên
tục (từ ngày 1 đến ngày 6 của TN), ngày 7 đến
có nước ngọt (nước sinh hoạt) và nước mặn có
ngày 21 dê được uống nước mặn có nồng độ
nồng độ 5, 10, 15‰ được pha từ nước biển cô
là 15‰. Đối với nhóm nuôi thích nghi thì dê
đặc (nước ót) với nước ngọt theo công thức sau:
từng bước được làm quen với nước mặn bằng
C1xV1=C2xV2 và được đo kiểm tra bằng thiết
cách cho uống nước có nồng độ từ 0, 5, 10‰.
bị khúc xạ kế đo độ mặn ATAGO Master-S/
Mỗi nồng độ sẽ thay đổi sau 48 giờ (hai ngày
MillM Salinity 0~100‰ với độ chính xác ±2‰.
liên tục), tương đương từ ngày 01 đến ngày
Mẫu nước sau khi được đo bằng máy được 06 của TN. Từ ngày 7 đến ngày 21 dê duy trì
đem đi phân tích tại Bộ môn Khoa học Đất, uống nước mặn có nồng độ là 15‰.
khoa Nông Nghiệp, Trường Đại học Cần Thơ. 2.2.3. Các chỉ tiêu theo dõi và thu thập số liệu
Bảng 3. Phân tích mẫu nước cho dê thí nghiệm Tất cả số liệu thức ăn, nước uống sẽ được
Chỉ tiêu 0‰ 15‰ 98‰ ghi nhận hàng ngày trong suốt quá trình TN.
EC (mS/cm) 0,28 33 214 Dê được cân ở thời điểm đầu TN và sau mỗi
TDS (g/l) 0,127 15 97
CL- (g/l) 0,028 8,77 63,34 tuần, vào buổi sáng trước khi cho ăn.
K+ (mg/l) 4,35 156 1.110 Mẫu máu (2ml) của mỗi dê được lấy hai
Na+ (mg/l) 16,6 4.412 31.972
Ca2+ (mg/l) 15,5 92,3 575 giờ sau khi cho ăn, tất cả các mẫu máu được
Mg2+ (mg/l) 9,91 606 4.109 giữ trong đá và đem đi phân tích. Mẫu máu
Ghi chú: TDS là Total Dissolved Solids (Tổng chất rắn sẽ được lấy ở tĩnh mạch cổ của dê, sau đó
hòa tan); EC là Electrical Conductivity (Độ dẫn diện) được cho vào ống Heparin lithium, trữ trong

KHKT Chăn nuôi số 263 - tháng 2 năm 2021 65

 CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC
thùng có chứa đá lạnh và đem đến trung tâm
xét nghiệm để phân tích hàm lượng Na+, K+,
Ca2+, Cl- và creatinin. Mẫu máu được thu thập
ở ngày thứ 4, 6, 8, 14 và ngày thứ 21 của TN.
Nước tiểu được thu thập ở ngày thứ 21
và trong 24 giờ. Tất cả mẫu nước tiểu sẽ được
trữ trong bình đựng sạch và khô. Sau đó trữ
trong thùng có chứa đá giữ lạnh và đem đến
trung tâm xét nghiệm phân tích để phân tích
creatinin niệu và niệu đồ.
2.2.4. Xử lý số liệu
Số liệu TN được xử lý sơ bộ bằng phần
mềm Microsoft Excel. So sánh giữa hai NT
bằng phương pháp Unpaired samples T-Test
và so sánh trên cùng một NT bằng Paired
samples T-Test. Sự khác biệt có nghĩa khi
P<0,05.
3. KẾT QUẢ VÀ THẢO LUẬN
3.1. Ảnh hưởng của phương pháp thích nghi
nước uống nhiễm mặn đến lượng thức ăn và
nước uống tiêu thụ
Nhìn chung, lượng thức ăn tiêu thụ ở giai
đoạn thích nghi và sau thích nghi giữa hai
nhóm không có sự khác biệt có ý nghĩa thống
kê (P>0,05; Bảng 4). Tuy nhiên, lượng thức ăn
tiêu thụ của nhóm không thích nghi giảm dần
thì ở nhóm thích nghi lại tăng dần theo thời
gian TN. Lượng thức ăn tiêu thụ của dê TN
trung bình 27,12-29,23 g/kg KL/ngày. Những
nghiên cứu trước đây cho thấy rằng lượng
thức ăn tiêu thụ của dê không bị ảnh hưởng
bởi nước uống nhiễm mặn. Tsukahara và ctv
(2016) báo cáo rằng khi cung cấp nước nhiễm
mặn chứa 6900mg TDS/l không ảnh hưởng
đến lượng thức ăn tiêu thụ ở dê Boer (6,1
tháng tuổi và 21,3kg) và dê Tây Ban Nha (6,6
tháng tuổi và 19,7kg). Ngược lại, nhiều nghiên
cứu trước đây đã chỉ ra rằng lượng thức ăn
tiêu thụ giảm khi nồng độ nước uống nhiễm
mặn cao. Theo Zoidis and Hadjigeorgiou
(2018) cho thấy rằng khi tăng nồng độ nước
uống từ 10 đến 20‰ thì làm giảm lượng thức
ăn tiêu thụ ở dê. Điều này lý giải rằng nồng độ
nước uống nhiễm mặn khác nhau sẽ đáp ứng
lên lượng tiêu thụ thức ăn của dê khác nhau.
66
Bảng 4. Lượng TA tiêu thụ (g VCK/kg KL/ngày)
Giai đoạn NT1 NT2 P
Ngày 1 đến 6 27,41±1,58 27,70±0,85 0,874
Ngày 7 28,69±1,41 28,23±0,73 0,781
Ngày 8 đến 14 28,06±1,55 28,33±0,49 0,874
Ngày 15 đến 21 27,12±2,05 29,23±0,63 0,355
Nhóm không thích nghi: dê được chuyển đột
ngột từ nước ngọt (0‰) sang nước mặn (15‰)
Nhóm thích nghi: dê được chuyển dần từ
nước ngọt sang nước mặn (0, 5, 10, 15‰)
Ngày 1-6: Giai đoạn thích nghi. Tất cả dê ở
nhóm không thích nghi sẽ được uống nước ngọt;
dê ở nhóm thích nghi sẽ chuyển dần từ nước ngọt
sang nước mặn ở mỗi nồng độ là 2 ngày.
Từ ngày 7 đến 21: Giai đoạn sau thích nghi. Dê
ở cả hai nhóm đều uống nước mặn với nồng độ 15%.
Kết quả trình bày tại Bảng 5 cho thấy
lượng nước uống cả ngày của dê ở giai đoạn
thích nghi (từ ngày 1 đến 6) và giai đoạn sau
thích nghi (từ ngày 8 đến ngày 21) khác biệt có
ý nghĩa thống kê giữa hai nhóm TN (P<0,05),
dê ở nhóm không thích nghi (uống nước ngọt)
uống nước ít hơn so với nhóm thích nghi
(chuyển dần từ nước ngọt sang nước mặn). Ta
có thể lý giải rằng khi uống nước mặn sẽ làm
con vật khát và uống nhiều nước hơn so với
con vật uống nước ngọt. Thêm vào đó, khi dê
được thích nghi với nước mặn nên khả năng
tiêu thụ nước mặn cao hơn so với dê không
được thích nghi. Điều này cho thấy dê đã
phần nào thích nghi được với nước uống bị
nhiễm mặn. Điều thú vị là ở ngày 7 dê của
nhóm không thích nghi chuyển đột ngột từ
nước ngọt sang nước mặn (15‰) thì lượng
nước uống tiêu thụ tăng lên (tăng gấp 4 lần)
và không khác biệt về lượng nước tiêu thụ so
với nhóm thích nghi. Kết quả ở Bảng 3.2 cho
thấy rằng dê TN không được thích nghi từ từ
với nước uống nhiễm mặn thì chúng sẽ điều
chỉnh khả năng chịu đựng bằng cách giảm
lượng nước uống. Ngược lại, dê ở nhóm thích
nghi duy trì lượng nước uống cao là do chúng
đã làm quen và chấp nhận nước nhiễm mặn,
cũng như điều tiết cơ chế thích nghi bằng cách
tăng sự bài thải nước và các ion trong nước
mặn qua nước tiểu.
KHKT Chăn nuôi số 263 - tháng 2 năm 2021
CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC

Bảng 5. Lượng nước uống của dê (kg/con/ngày) TDS/l. Ngược lại với kết quả của TN hiện tại
Thời gian Ngày NT1 NT2 P
về lượng nước uống nhiễm mặn của dê, một
1-6 0,38±0,09 1,50±0,28 0,005 nghiên cứu khác cho thấy sự ảnh hưởng của
7 1,58±0,29 1,87±0,30 0,510 nước mặn (0; 5,5 và 11g TDS/l) đối với việc
Cả ngày
(24h) 8-14 0,73±0,09 1,88±0,29 0,005 giảm lượng nước tiêu thụ được báo cáo bởi
15-21 1,02±0,23 1,68±0,15 0,044 Mdletshe và ctv (2017).
1-6 0,22±0,07 0,73±0,13 0,009 3.2. Ảnh hưởng của phương pháp thích nghi
Buổi sáng 7 0,71±0,22 0,84±0,08 0,587 nước uống nhiễm mặn đến khối lượng và
(7-14h) 8-14 0,28±0,04 0,86±0,12 0,002 tăng khối lượng của dê
15-21 0,49±0,14 0,86±0,10 0,064
Khối lượng và TKL của dê thí nghiệm
1-6 0,28±0,06 0,82±0,18 0,023
Buổi chiều không có sự khác biệt có ý nghĩa thống kê giữa
7 0,47±0,19 1,03±0,28 0,135
và đêm
8-14 0,45±0,07 1,01±0,18 0,020
hai nhóm (Bảng 6; P>0,05) trong 3 tuần TN. Khi
(14-7h)
15-21 0,53±0,09 0,81±0,09 0,064
so sánh khối lượng của dê TN trên cùng một
nhóm thì dê ở nhóm nuôi không thích nghi có
Nhóm không thích nghi: dê được chuyển đột
KL đầu và cuối TN tương đương nhau (P=0,32).
ngột từ nước ngọt (0‰) sang nước mặn (15‰)
Ngược lại, dê của nhóm nuôi thích nghi có KL
Nhóm thích nghi: dê được chuyển dần từ cuối TN có khuynh hướng cao hơn so với KL
nước ngọt sang nước mặn (0, 5, 10, 15‰) đầu TN (P=0,07) và kết quả là TKL ở tuần 3
Ngày 1-6: Giai đoạn thích nghi. Tất cả dê ở cao hơn so với tuần đầu TN (P=0,022). Vì vậy,
nhóm không thích nghi sẽ được uống nước ngọt; ở nhóm nuôi thích nghi khi mà chuyển đổi từ
dê ở nhóm thích nghi sẽ chuyển dần từ nước ngọt nước ngọt sang nước mặn từ từ có thể thấy rằng
sang nước mặn ở mỗi nồng độ là 2 ngày. là sẽ có lợi cho gia súc, có lợi đến sức khỏe vật
Từ ngày 7 đến 21: Giai đoạn sau thích nghi. nuôi giúp cho gia súc TKL tốt hơn, do đó KL của
Dê ở cả hai nhóm đều uống nước mặn với nồng gia súc cao hơn. Theo El Gawad (1997) báo cáo
độ 15%. rằng KL dê cũng không bị ảnh hưởng bởi nước
uống mặn có chứa 1,05 hoặc 8,25g TDS/l trong 6
Ngoài ra, lượng nước uống của gia súc
tuần. Nghiên cứu của Zoidis và Hadjigeorgiou
cũng phụ thuộc vào yếu tố môi trường, con vật
(2018) cũng đã chỉ ra rằng dê uống nước mặn
thường uống nhiều hơn ở các thời điểm nắng
với nồng độ lên tới 20‰ cũng không thay đổi
nóng trong ngày (13-15h). Do đó, TN này tiếp
KL dê. Theo nghiên cứu của Trần Minh Đức và
tục phân tích kết quả nước uống của dê ở buổi
ctv (2020) nếu dê uống nước nhiễm mặn với
sáng, buổi chiều và đêm ở hai nghiệm thức.
nồng độ 15‰ không ảnh hưởng đến KL, nhưng
Kết quả cho thấy rằng lượng nước uống buổi
đã làm giảm TKL của dê.
sáng, buổi chiều và đêm ở dê của nhóm nuôi
thích nghi cao hơn so với nhóm nuôi không Bảng 6. Khối lượng và tăng khối lượng của dê
thích nghi ở các giai đoạn của thí nghiệm ngoại Chỉ tiêu NT1 NT2 P
trừ ngày 7. Tương tự những nghiên cứu trước Ngày 1 24,44±0,73 24,20±0,30 0,769
đây cho thấy lượng nước tiêu thụ cũng tăng KL (kg/ Ngày 7 24,52±0,81 24,12±0,32 0,659
lên đáng kể khi sử dụng nước nhiễm mặn. con) Ngày 14 25,60±1,06 25,56±0,39 0,973
Mohammed (2008) báo cáo rằng có sự gia tăng Ngày 21 25,88±1,15 25,92±0,75 0,977
đáng kể lượng nước uống vào ở nhóm uống 1-7 11,43±19,38 11,43±21,38 0,451
nước mặn 15‰ so với nhóm nước ngọt trong T K L 7-14 77,14±19,48 102,86±16,54 0,344
sáu tuần trên dê Nubian. Hơn nữa, El Gawad (g/con/ 14-21 40,00±44,81 51,43±55,25 0,876
ngày)
(1997) báo cáo rằng lượng nước uống vào 1-21 68,57±25,09 81,90±24,94 0,716
cũng tăng lên ở những dê được cung cấp nước 7-21 61,90±25,85 78,73±28,98 0,676
mặn chứa 8,25g TDS/l trong sáu tuần so với Nhóm không thích nghi: dê được chuyển đột
những dê được cung cấp nước có chứa 1,05g ngột từ nước ngọt (0‰) sang nước mặn (15‰)

KHKT Chăn nuôi số 263 - tháng 2 năm 2021 67

 CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC
Nhóm thích nghi: dê được chuyển dần từ
nước ngọt sang nước mặn (0, 5, 10, 15‰)
Ngày 1-6: Giai đoạn thích nghi. Tất cả dê ở
nhóm không thích nghi sẽ được uống nước ngọt;
dê ở nhóm thích nghi sẽ chuyển dần từ nước ngọt
sang nước mặn ở mỗi nồng độ là 2 ngày.
Từ ngày 7 đến 21: Giai đoạn sau thích nghi.
Dê ở cả hai nhóm đều uống nước mặn với nồng
độ 15%.
3.3. Ảnh hưởng của phương pháp thích nghi
nước uống nhiễm mặn đến nồng độ chất
điện giải trong máu
Nồng độ các chất điện giải trong máu
(Na+, K+, Cl-) không có sự khác biệt có ý nghĩa
thống kê (Bảng 7; P>0,05). Điều này có thể là
do sau một ngày đêm dê TN đã loại thải các
ion Na+, K+, Cl- ra khỏi cơ thể qua thận để đạt
giá trị bình thường và vì vậy lượng các chất
điện giải này tăng lên trong nước tiểu. Kết
quả này tương tự với báo cáo của Zoidis và
Hadjigeorgiou (2018) khi nồng độ K+ và Na+
không ảnh hưởng khi dê uống nước mặn
với nồng độ 5-10‰, ngược lại dê uống nước
nhiễm mặn với nồng độ 20‰ thì hàm lượng
Na+ trong máu tăng nhưng hàm lượng K+
không thay đổi.
Bảng 7. Nồng độ chất điện giải trong máu
trước ăn
Chỉ tiêu NT1 NT2 P cao hơn (0,05<P<0,10). Có thể do nhóm thích
Creatinin (µmol/l) 73,40±4,70 66,60±1,94 0,218
Na+ (mmol/l) 143,16±0,62 144,38±0,28 0,111
K+ (mmol/l) 5,11±0,21 5,20±0,33 0,819
Cl- (mmol/l) 102,26±1,20 102,64±0,46 0,776
Nhóm không thích nghi: dê được chuyển đột
ngột từ nước ngọt (0‰) sang nước mặn (15‰)
Nhóm thích nghi: dê được chuyển dần từ
nước ngọt sang nước mặn (0, 5, 10, 15‰)
Ngày 1-6: Giai đoạn thích nghi. Tất cả dê ở
nhóm không thích nghi sẽ được uống nước ngọt;
dê ở nhóm thích nghi sẽ chuyển dần từ nước ngọt
sang nước mặn ở mỗi nồng độ là 2 ngày.
Từ ngày 7 đến 21: Giai đoạn sau thích nghi.
Dê ở cả hai nhóm đều uống nước mặn với nồng
độ 15%.
68
Ở giai đoạn thích nghi tại thời điểm 2 giờ
sau khi cho ăn, nồng độ Na+ và Cl- trong máu
có sự khác biệt có ý nghĩa thống kê (P<0,05;
Bảng 8). Dê ở nhóm thích nghi có nồng độ Na+
và Cl- trong máu cao hơn so với dê ở nhóm
không thích nghi. Điều này là do dê ở nhóm
thích nghi được uống nước mặn với nồng
độ tăng dần từ 0 đến 10‰, trong khi đó dê ở
nhóm không thích nghi chỉ uống nước ngọt.
Thêm vào đó, kết quả phân tích nồng độ một
số ion trong nước mặn 15‰ cho thấy nồng độ
Na+ và Cl- cao gấp khoảng 266 lần và 313 lần
so với nước ngọt. Tương tự, nồng độ Na+ và
Cl- trong nước mặn (5‰ và 10‰) cũng sẽ cao
hơn gấp nhiều lần so với nước ngọt. Ngoài ra,
thời điểm lấy máu là 2 giờ sau khi cho dê ăn
nên theo tập tính dễ cũng sẽ uống nước nhiều
vào thời gian này. Dẫn đến khi dê uống nước
mặn nhiều sẽ có sự gia tăng nồng độ Na+ và
Cl- trong máu. Ngược lại nồng độ K+ không có
sự khác biệt giữa hai nhóm TN.
Ngược lại, nồng độ các chất điện giải
trong máu ở giai đoạn sau thích nghi giữa
hai nhóm không có sự khác biệt có ý nghĩa
thống kê (P>0,05; Bảng 8). Do ở giai đoạn này
giữa hai nhóm đều được uống nước mặn có
nồng độ giống nhau nên nồng độ chất điện
giải trong máu tương tự nhau. Nhưng điều
thú vị là ngày 14 và 21 nồng độ Cl- trong
máu ở nhóm thích nghi có khuynh hướng
nghi có lượng nước uống nhiều hơn nhóm
không thích nghi dẫn đến nồng độ Cl- lưu giữ
trong cơ thể nhiều hơn. Nhìn chung, nồng
độ Na+ trong máu vẫn nằm trong giá trị bình
thường lần lượt là 135-156 mmol/l (Jackson
và Cockcroft, 2002) và 142-155 mmol/l (Zoidis
and Hadjigeorgiou, 2018). Tương tự nồng
độ K+ trong máu cũng nằm trong giá trị bình
thường lần lượt là 3,4-6,1 mmol/l (Jackson and
Cockcroft, 2002) và 3,5-6,7mmol/l (Zoidis và
Hadjigeorgiou, 2018).
Nhóm không thích nghi: dê được chuyển đột
ngột từ nước ngọt (0‰) sang nước mặn (15‰)
Nhóm thích nghi: dê được chuyển dần từ
nước ngọt sang nước mặn (0, 5, 10, 15‰)
KHKT Chăn nuôi số 263 - tháng 2 năm 2021
CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC

Bảng 8. Nồng độ chất điện giải trong máu thời bài thải nhiều nước tiểu hơn do tỷ lệ lọc ở cầu
điểm 2 giờ sau khi cho ăn thận cao hơn, kết quả này tương tự với TN
Chỉ tiêu Ngày NT1 NT2 P hiện tại. Theo Zoidis và Hadjigeorgiou (2018),
4 144,36±0,18 145,94±0,32 0,003 nồng độ Na+ trong nước tiểu dê khi sử dụng
6 144,36±0,18 145,90±0,37 0,006 nước nhiễm mặn có nồng độ 10-20‰ là 251-
N a +
(mmol/l) 8 145,02±0,65 146,20±0,96 0,341 377 mmol/l, cao hơn so với nghiên cứu hiện
14 144,98±0,58 144,90±0,23 0,901 tại. Tuy nhiên, nồng độ K+ là 133-329 mmol/l
21 147,10±0,48 146,82±0,27 0,624 tương tự so với TN này.
4 4,70±0,23 4,50±0,17 0,513
6 4,70±0,23 4,73±0,17 0,920
Bảng 9. Nồng độ chất điện giải trong nước tiểu
K +
8 4,77±0,15 4,60±0,24 0,577
(mmol/l) Chỉ tiêu NT1 NT2 P
14 4,81±0,17 4,74±0,22 0,790 V nước tiểu (kg/con) 0,95±0,15 1,69±0,12 0,005
21 4,69±0,10 4,62±0,22 0,793 GFR (mmol) 20,92±3,86 41,04±7,78 0,049
4 101,76±0,34 103,58±0,40 0,008 Creatinin (µmol/l) 1.706±294 1.580±240 0,749
6 101,76±0,34 104,02±0,65 0,015 Na+ (mmol/l) 165,30±24,77 201,20±9,17 0,211
C l -
8 103,86±0,46 105,56±1,07 0,182
(mmol/l) K+ (mmol/l) 167,63±18,32 131,67±4,36 0,093
14 103,72±0,49 105,26±0,64 0,094 Cl- (mmol/l) 321,14±15,24 279,68±8,88 0,047
21 103,66±0,71 105,40±0,62 0,103 Nhóm không thích nghi: dê được chuyển đột
Theo Jackson and Cockcroft (2002) giá trị ngột từ nước ngọt (0‰) sang nước mặn (15‰)
bình thường nồng độ creatinin huyết tương
Nhóm thích nghi: dê được chuyển dần từ
từ 54-123 µmol/l; nồng độ Na+ trong máu từ
nước ngọt sang nước mặn (0, 5, 10, 15‰)
135-156 mmol/l; nồng độ K+ trong máu là 3,4-
6,1 mmol/l; nồng độ Ca2+ trong máu là 2,3-2,9 GFR = Glomerular Filtration Rate (tỷ lệ lọc
mmol/l. của cầu thận)
Theo Zoidis and Hadjigeorgiou (2018) Bảng 10. Lượng Na+, K+, Cl- bài thải qua nước tiểu
giá trị bình thường nồng độ Na+ trong máu Chỉ tiêu NT1 NT2 P
từ 142-155 mmol/l; nồng độ K+ trong máu là Na+ (mmol/l) 170,18±44,49 338,22±21,67 0,009
3,5-6,7mmol/l nồng độ creatinin huyết tương K+ (mmol/l) 148,64±14,59 220,57±8,15 0,003
từ 88-159 µmol/l. Cl- (mmol/l) 299,83±40,79 468,71±18,09 0,005
3.4. Ảnh hưởng của phương pháp thích nghi Nhóm không thích nghi: dê được chuyển đột
nước uống nhiễm mặn đến tỷ lệ lọc của cầu ngột từ nước ngọt (0‰) sang nước mặn (15‰)
thận và nồng độ chất điện giải trong nước tiểu Nhóm thích nghi: dê được chuyển dần từ
Qua bảng 9 cho thấy lượng nước tiểu ở nước ngọt sang nước mặn (0, 5, 10, 15‰)
nhóm không thích nghi thấp hơn so với nhóm
4. KẾT LUẬN
thích nghi (P<0,05). Điều này là do lượng nước
uống của nhóm thích nghi cao hơn so với Kết quả TN cho thấy dê được nuôi thích
lượng nước uống của nhóm không thích nghi, nghi với nước mặn có khả năng uống nước
kết quả là tỷ lệ lọc ở cầu thận cao hơn nên sự nhiễm mặn nhiều hơn thông qua tăng tỷ lệ lọc
bài thải nước và các chất điện giải cao hơn ở cầu thận và tăng bài thải các chất điện giải
(Bảng 5, 9 và 10). Tuy nhiên, nồng độ các chất qua nước tiểu.
điện giải và creatinin trong nước tiểu tương tự Lượng thức ăn tiêu thụ, KL và TKL của hai
nhau giữa hai nhóm TN. Theo nghiên cứu của NT không bị ảnh hưởng. Lượng nước uống
Abdalla và ctv (2010) nhóm dê không được ở nhóm thích nghi nhiều hơn nhóm không
uống nước trong ba ngày liên tục dẫn đến thể thích nghi. Tuy nhiên, có sự khác biệt ở ngày
tích nước tiểu và tỷ lệ lọc ở cầu thận giảm. 7 là lượng nước uống của nhóm thích nghi và
Trong khi đó nhóm dê được uống nước tự do nhóm không thích nghi tương tự nhau.

KHKT Chăn nuôi số 263 - tháng 2 năm 2021 69

 CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC

Các chỉ tiêu sinh hóa máu vẫn nằm trong
giá trị bình thường và cho thấy khả năng thích
nghi của dê Boer lai với nước mặn mà không
ảnh hưởng đến chức năng thận. Thể tích nước
tiểu, GFR, hàm lượng Cl- trong nước tiểu của
nhóm thích nghi cao hơn nhóm không thích
nghi, ngược lại hàm lượng Na+ và Cl- tương
đương nhau.
Do TN được thực hiện trong thời gian
ngắn nên chưa thấy được những tác động
của nước uống nhiễm mặn lên năng suất và
sức khỏe của dê lai nuôi thịt. Do đó, nên tiến
hành TN ở các khoảng thời gian thích nghi
khác nhau và thời gian TN dài hơn để đưa ra
khuyến cáo cho người chăn nuôi về khoảng
thời gian cũng như phương pháp thích nghi
với nước mặn mà không ảnh hưởng đến năng
suất và sức khỏe của dê thịt.
LỜI CÁM ƠN
Nghiên cứu này được tài trợ từ nguồn kinh
phí của Bộ Giáo dục và Đào tạo, Mã số B2020-
TCT-08.
TÀI LIỆU THAM KHẢO
1. Bell F.R. (1959). Preference thresholds for taste
discrimination in goats. J. Agr. Sci., 52: 125-28.
2. Trần Minh Đức (2020). Ảnh hưởng của nồng độ nước
muối cao trong nước uống lên khả năng tăng trọng và
chức năng thận của dê thịt. Luận văn tốt nghiệp Đại học
ngành Thú y. Trường Đại học Cần Thơ.
3. El Gawad E. (1997). Physiological responses of Barki and
Damascus goats and their crossbreed to drinking saline
water. Alexandria J. Agr. Res., 42: 23-36.
4. Jackson P.G.G. and Cockcroft P.D. (2002). Clinical
examination of farm animals. Blackwell Sci., Oxford, UK,
Pp: 303-05.
5. Mdletshe Z.M., Chimonyo M., Marufu M.C. and Nsahlai
I.V. (2017). Effects of saline water consumption on
physiological responses in Nguni goats. Small Rum. Res.,
153: 209-11.
6. Mohammed S.A.A. (2008). Effects of salinity of drinking
water, state of hydration, dietary protein level and
unilateral nephrectomy on blood constituents and renal
function in Nubian goats. PhD thesis, Uni. of Khartoum.
Khartoum.
7. Runa R.A., Brinkmann L., Gerken M. and Riek A. (2019).
Adaptation capacity of Boer goats to saline drinking
water. An Int. J. Ani. Biosci., 13: 2268-76.
8. Silanikove N. (2000). Effects of heat stress on the welfare
of extensively managed domestic ruminants. Liv. Pro.
Sci., 67: 1-18.
9. Silanikove N. (2000a). The physiological basis of
adaptation in goats to harsh environments. Small Rum.
Res., 35: 181-93.
10. Tsukahara Y., Puchala R., Sahlu T. and Goetsch A.L.
(2016). Effects of level of brackish water on feed intake,
digestion, heat energy, and blood constituents of growing
Boer and Spanish goat wethers. J. Ani. Sci., 94: 3864-74.
11. Zoidis E. and Hadjigeorgiou I. (2018). Effects of drinking
saline water on food and water intake, blood and urine
electrolytes and biochemical and haematological
parameters in goats: a preliminary study. Ani. Pro. Sci.,
58: 1822-28.

SỰ LƯU HÀNH CỦA VIRUS GÂY BỆNH MAREK TRÊN GÀ

BẢN ĐỊA Ở TỈNH ĐỒNG THÁP
Hồ Thị Việt Thu1*, Nguyễn Tâm Đồng2, Vũ Ngọc Minh Thư1 và Huỳnh Ngọc Trang1
Ngày nhận bài báo: 30/10/2020 - Ngày nhận bài phản biện: 27/11/2020
Ngày bài báo được chấp nhận đăng: 03/12/2020
TÓM TẮT
Bệnh Marek là bệnh truyền nhiễm gây tổn thất lớn trong chăn nuôi gà. Bệnh gây ra bởi Gallid
herpesvirus. Trong tự nhiên, bệnh chủ yếu được truyền lây qua đường hô hấp, gà cảm nhiễm có thể
mắc bệnh do hít phải virus gây bệnh trong tế bào nang lông hoặc mãnh biểu mô da của gà nhiễm
virus. Với mục đích khảo sát sự lưu hành của virus gây bệnh (MDV-Marek’s disease virus) trên
giống gà thả vườn, nghiên cứu này được thực hiện qua việc phát hiện gen Meq của MDV từ 132
mẫu nang lông của 132 đàn gà thu thập từ 105 hộ chăn nuôi tại 5 huyện Hồng Ngự, Cao Lãnh, Lấp

1
Trường Đại học Cần Thơ
2
Chi cục Chăn nuôi, Thú y và Thủy sản Đồng Tháp
* Tác giả liên hệ: Tác giả liên hệ: Hồ Thị Việt Thu – Khoa Nông nghiệp Trường Đại học Cần Thơ; Điện thoại: 0918313954;
Email: htvthu@ctu.edu.vn.

70 KHKT Chăn nuôi số 263 - tháng 2 năm 2021

KHKT Chăn nuôi Số 271 - tháng 11 năm 2021

Tổng biên tập: DI TRUYỀN - GIỐNG VẬT NUÔI

TS. ĐOÀN XUÂN TRÚC Phạm Ngọc Trung, Nguyễn Hữu Tỉnh và Ngô Xuân Đông. Chọn lọc hai dòng lợn nái
Yorkshire và Landrace dựa trên kiểu Gen ESR, FSHB kết hợp chỉ số nái sinh sản tại
Phó Tổng biên tập: Công ty chăn nuôi Nhật Minh 2
PGS.TS. NGUYỄN ĐĂNG VANG Nguyễn Văn Trung, Nguyễn Trọng Ngữ và Phạm Văn Giới. Mối liên kết giữa đa
hình gen OVGP1 và LIF với năng suất sinh sản của lợn Hung và lợn Mẹo 6
PGS.TS. NGUYỄN VĂN ĐỨC
Nguyễn Ngọc Tấn, Phan H u Hương Trinh, Lê Thị Thanh, Trầm Minh Th nh

ữ
à
v Lê T n Lợi. Bi u hiện gen VEGF-R1 trên mẫu mô buồng trứng v phức h p
Thư ký tòa soạn:

à
ấ
ể
à
ợ
Cumulus-t b o trứng heo ở c c giai đo n ph t tri n kh c nhau 11
PGS.TS. NGUYỄN VĂN ĐỨC

ế
à
á
ạ
á
ể
á
Nguyễn Khánh Vân, Phạm Th Kim Yến, Vũ Th Thu Hương và Phạm Doãn Lân.

ị
ị
Ảnh hư ng của tế bào Cumulus đến hi u quả thụ tinh và tạo phôi bò in vitro 17

ở
ệ
Ủy viên Ban biên tập: Tr n Đức Hoàn, Nguyễn Đình Nguyên và Nguyễn Việt Đức. Khả năng sản xuất của

ầ
TS. NGUYỄN QUỐC ĐẠT lợn đực giống Yorkshire nuôi tại Công ty Cổ phần giống chăn nuôi Bắc Giang 23
PGS.TS. HOÀNG KIM GIAO Phạm Văn Quyến, Nguyễn Th Thủy, Hoàng Th Ngân, Nguyễn Văn Tiến, Giang Vi

ị
ị
GS.TS. NGUYỄN DUY HOAN Sal, Bùi Ngọc Hùng, Nguyễn Thanh Tùng, Nguyễn Th Ngọc Anh, Hồ Ngọc Trâm

ị
GS.TS. DƯƠNG NGUYÊN KHANG và Phương Khánh Hồng. Hi n trạng chăn nuôi bò thịt và cơ cấu giống bò thịt tại tỉnh

ệ
Tây Ninh 30
PGS.TS. NGUYỄN THỊ KIM KHANG
PGS.TS. ĐỖ VÕ ANH KHOA
PGS.TS. ĐỖ ĐỨC LỰC DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI
Tr n Th Bích Ngọc, Nguyễn Đình Tường, Dương Th Oanh, Ninh Th Huyền và
GS.TS. LÊ ĐÌNH PHÙNG
ầ
ị
ị
ị
Tr n Hiệp. Ảnh hư ng của tỷ l Lysine tiêu hóa/năng lượng trong khẩu phần ăn của
ầ
ở
ệ
lợn nái ngoại nuôi con đến năng suất sinh sản trong điều ki n chu ng h 39
Xuất bản và Phát hành:

ệ
ồ
ở
Nguyễn Bình Trường và Trương Thanh Trung. Ảnh hư ng các m c bổ sung th c
ThS. NGUYỄN ĐÌNH MẠNH

ở
ứ
ứ
ăn hỗn hợp đến tiêu thụ và tiêu hóa dưỡng chất th c ăn bò lai Wagyu giai đoạn 9-12

ứ
tháng tuổi tại An Giang 44

U Nguyễn Thiết, Trương Văn Khang và Nguyễn Trọng Ngữ. Ảnh hư ng của bổ sung

ở
bột hoa chuối lên lượng ăn vào và tỷ l tiêu hóa dưỡng chất của dê thịt lai 51
ệ
CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC
Nguy n Thị Th y. Ảnh hư ng c a cách cho ăn đến năng suất và hi u quả kinh tế
ễ
ủ
ở
ủ
ệ
trong chăn nuôi gà Nòi chu ng h 56
Giấy phép: Bộ Thông tin và Truyền thông
ồ
ở
Nguy n Hồng Nhung. Hi u quả chăn nuôi vịt thịt nông hộ tại thị xã Long Mỹ, tỉnh
ễ
ệ
Số 257/GP- BTTTT ngày 20/05/2016 Hậu Giang 61
ISSN 1859 - 476X Tr n Ngọc Tiến, Phạm Th Xuân, Khuất Th Tuyên, Nguyễn Th Minh Hường và
ầ
ị
ị
ị
Nguyễn Th Luyến. Khả năng sản xuất của vịt lai thương phẩm (VSDxSTAR53) nuôi
Xuất bản: Hàng tháng
ị
an toàn sinh học tại Thái Bình 66
Toà soạn: Tăng Th Chính, Phùng Đức Hiếu, Nguyễn Th Thanh Lan, Đinh Th Ngọc Thúy
ị
ị
ị
Địa chỉ: Tầng 4, Tòa nhà 73, và Nguyễn Th Diệu Thúy. Sử dụng chế phẩm vi sinh ưa nhi t Sagi bio xử lý chất
ị
ệ
thải rắn chăn nuôi bò sữa thành phân bón hữu cơ tại Sơn La. 71

Hoàng Cầu, Ô Chợ Dừa,
Đống Đa, Hà Nội. Đặng Hồng Quyên, Nguyễn Văn Lưu, Đỗ Th Thu Hường, Nguyễn Th Hạnh và
ị
ị
Nguyễn Công Thành. Năng suất và chất lượng thịt ếch Thái Lan nuôi tại trường Đại
Điện thoại: 024.36290621 học Nông lâm Bắc Giang 76
Fax: 024.38691511 Nguyễn Vĩ Nhân và Nguy n Thị Ngọc Linh. Hoạt tính kháng khuẩn của cao chiết từ
ễ
E - mail: tapchichannuoi@hoichannuoi.vn lá mật gấu trên vi khuẩn Bacillus cereus và Escherichia coli 81
Website: www.hoichannuoi.vn Quan Kim Vy và Tr n Th Thảo. B nh Carré trên chó tại thành phố Vĩnh Long 85
ầ
ị
ệ
Tài khoản:
THÔNG TIN KHOA HỌC VÀ CÔNG NGHỆ
Tên tài khoản: Hội Chăn nuôi Việt Nam
PGS.TS. Nguyễn Văn Đức. Xu hướng chăn nuôi bò sữa, thị trường sữa và các sản
Số tài khoản: 1300 311 0000 40, tại Ngân hàng phẩm sữa 90
Nông nghiệp và Phát triển Nông thôn, Chi nhánh GS.TS. Nguyễn Xuân Trạch. Đạo đ c trong công bố khoa học 92
Thăng Long - Số 4, Phạm Ngọc Thạch, Hà Nội.
ứ
PGS.TS. Nguyễn Văn Đức. Giải pháp thay thế kháng sinh được xác định 96
In 1.000 bản, khổ 19x27 tại Công ty CP KH&CN PGS.TS. Nguyễn Văn Đức. Nước là một trong những yếu tố quan trọng trong ngành
Hoàng Quốc Việt. In xong và nộp lưu chiểu: chăn nuôi lợn 97
tháng 11/2021. PGS.TS. Nguyễn Văn Đức. Protein côn trùng - nhu cầu lớn trong h thống th c ăn
ệ
ứ
và thực phẩm đặc sản của những thế kỷ tới 99
 DI TRUYỀN - GIỐNG VẬT NUÔI

có các chỉ tiêu sinh sản cao hơn 8,5-12,0% ở
tổ hợp nái YL và 9,9-12,2% ở tổ hợp nái LY so
với đàn nái bố mẹ ở THXP; đặc biệt SCCS đạt
31,2-31,4 con/nái/năm, cao hơn 10,5-11,2% so
với đàn giống bố mẹ hiện có tại Công ty Nhật
Minh trước khi tiến hành nghiên cứu chọn lọc.
TÀI LIỆU THAM KHẢO
1. Falconer D.S. and T.F.C. Mackay (1996). Introduction
to quantitative genetics. Fourth edition. Pearson
Education Limited, Edinburgh Gate, Harlow, Essex
CM20 2JE, England.
2. Groeneveld E. (2006). PEST User’s Manual. Institute of
Animal Science, FAL, Germany.
3. Humpolicek P., T. Urban, V. Matousek and Z. Tvrdon
(2007). Effect of estrogen receptor, follicle stimulating
hormone and myogenin genes on the performance of
Large White sows. Czech J. Anim. Sci., 52(10): 334-40
4. Humpolicek P., T. Zdenek and U. Tomas (2009).
4(1): 104-13.
7. Nguyễn Hữu Tỉnh (2016). Xây dựng chỉ số chọn lọc
dựa trên giá trị giống của các tính trạng sản xuất ở đàn
lợn Yorkshire và Landrace có nguồn gốc từ Đan Mạch.
Tạp chí KHKT Chăn nuôi, 212: 7-13.
8. Nguyễn Hữu Tỉnh, Nguyễn Văn Hợp, Trần Văn Hào
và Phạm Ngọc Trung (2019). Ảnh hưởng đa hình gen
FSHB đến một số tính trạng sinh sản ở lợn Landrace và
Yorkshire. Tạp chí KHKT Chăn nuôi, 248(9/2019): 2-6.
9. Nguyen Huu Tinh and Pham Ngoc Trung (2018). Ef-
fects of direct additive and dominance on litter traits in
crossbred sows between Danish Yorkshire and Land-
race pigs in Vietnam. Vietnam J. Anim. Sci., 235: 8-13.
10. Nguyễn Hữu Tỉnh, Nguyễn Văn Hợp, Trần Văn Hào,
Phạm Ngọc Trung và Trần Vũ (2019). Mức độ ổn định
năng suất sinh sản, sinh trưởng ở đàn lợn Yorkshire và
Landrace nhập khẩu từ Đan Mạch qua ba thế hệ chọn
lọc. Tạp chí KHKT Chăn nuôi, 246: 2-7.
11. Wang W., W. Xue, X. Zhou, L. Zhang, J. Wu, L. Qu, B.
Jin, X. Zhang, F. Ma and X. Xu (2013). E ects of can-
ff

Interaction of ESR1 gene with the FSHB and MYOG
genes: effect on the reproduction and growth in pigs.
Ani. Sci. Papers & Reports, 27(2): 105-13.
5. Matousek V., N. Kernerova, O. Kolarikova, H. Krizo-
va, T. Urban and I. Vrtrova (2003). E ect of RYR1 and
ff
ESR genotypes on the fertility of sows of Large White
breed in elite herds. Czech J. Anim. Sci., 48 pp: 129-33.
6. Nakarin P. and M. Supamit (2012). Novel BsuRI-
c.930A>G-FSH Associated with Litter Size Traits on
Large White x Landrace Crossbred Sows. J. Agr. Sci.,
didate genes’ polymorphisms on meat quality traits in
pigs. Acta Agriculturae Scandinavica, Section A-Ani-
mal Science Publication details, including instructions
for authors and subscription information:http://www.
tandfonline.com/loi/saga20.
12. Zhao Y.F., Li N., L. Xiao, G.S. Cao, Y.Z. Chen, S. Zhang,
Y.F. Chen, C.X. Wu, J.S. Zhang, S.Q. Sun and X.Q. Xu
(1999). Inserting mutation of retroposon into of porcine
FSH-β gene and its association with litter size in pigs.
Sci. Chi. Ser., 29: 81-86.

MỐI LIÊN KẾT GIỮA ĐA HÌNH GEN OVGP1 VÀ LIF VỚI

NĂNG SUẤT SINH SẢN CỦA LỢN HUNG VÀ LỢN MẸO
Nguyễn Văn Trung2*, Nguyễn Trọng Ngữ2 và Phạm Văn Giới1
Ngày nhận bài báo: 05/08/2021 - Ngày nhận bài phản biện: 18/09/2021
Ngày bài báo được chấp nhận đăng: 01/10/2021
TÓM TẮT
Mục tiêu của nghiên cứu này nhằm đánh giá mối liên kết giữa đa hình gen OVGP1 và LIF với
một số tính trạng sinh lý sinh dục lợn cái hậu bị và năng suất sinh sản lợn nái giống Hung và Mẹo.
Các chỉ tiêu về sinh lý sinh dục lợn cái hậu bị và năng suất sinh sản lợn nái của 3 lứa đẻ đầu được
thu thập theo từng cá thể trên 78 lợn cái Hung, 76 lợn cái Mẹo. Các mẫu da tai được thu thập, tách
chiết ADN, thực hiện phản ứng chuỗi trùng hợp và xác định kiểu gen bằng phương pháp đa hình
chiều dài đoạn cắt giới hạn. Kết quả cho thấy kiểu gen BB của gen OVGP1 có ảnh hưởng tốt đến
năng suất sinh sản của 3 lứa đẻ đầu trên cả lợn Hung và lợn Mẹo: tổng số con sơ sinh là 21,00 và
22,80 con, tổng số con sơ sinh sống là 20,33 và 22,20 con và tổng số con cai sữa là 19,00 và 19,80 con.
Ngoài ra, đa hình gen LIF cũng có ảnh hưởng đến khoảng cách lứa đẻ trên lợn Hung, theo đó lợn
mang kiểu gen TT có khoảng cách lứa đẻ của 3 lứa đầu ngắn nhất (203,92 ngày) (P<0,05). Trong
2
Viện Chăn nuôi
2
Trường Đại học Cần Thơ
* Tác giả liên hệ: ThS. Nguyễn Văn Trung, Bộ môn Di truyền-Giống vật nuôi, Viện Chăn nuôi. Điện thoại: 0984900134; Email:
trungvcn@hotmail.com

6 KHKT Chăn nuôi số 271 - tháng 11 năm 2021

DI TRUYỀN - GIỐNG VẬT NUÔI

chọn lọc để cải thiện các tính trạng sinh sản ở lợn Hung và lợn Mẹo, alen B (gen OVGP1) và alen T
(gen LIF) cần được duy trì và phát triển trong quần thể.
Từ khóa: Đa hình gen, năng suất sinh sản, lợn Hung, lợn Mẹo.
ABSTRACT
The association between polymorphisms of OVGP1 and LIF genes with reproductive
performance traits in Hung and Meo indigenous pigs
The objective of this study was to evaluate the association between polymorphisms of OVGP1
and LIF genes with some sexually physiological and reproductive performance traits in the three
first parities were collected individually from 78 Hung females and 76 Meo females. Ear samples
were collected and had DNA extracted, polymerase chain reaction performed and genotypes
determined by the restriction fragment length polymorphism technique. The results showed that
the BB genotype of the OVGP1 gene had good effects on the reproductive performance of the
three first parities, including the corresponding parameters in Hung and Meo pigs: total number of
newborns (21.00 and 22.80 heads), total piglets born alive (20.33 and 22.20 heads) and total weaned
(19.00 and 19.80 heads). In addition, the polymorphisms of the LIF gene also affected the farrowing
interval in Hung pigs, whereby pigs carrying genotype TT had the shortest farrowing interval
(203.92 days) in the first three parities (P<0.05). In selection to improve reproductive traits in Hung
and Meo pigs, the B allele (OVGP1 gene) and the T allele (LIF gene) should be maintained and
developed in the populations.
Keywords: Genetic polymorphisms, reproductive performance, Hung pig, Meo pig.

1. ĐẶT VẤN ĐỀ sự kiểm soát của estrogen trong thời kỳ động

Lợn Hung và lợn Mẹo là hai giống lợn
bản địa thuộc nguồn gen quý hiếm vật nuôi
của Việt Nam, chúng có nhiều đặc điểm quý
và đã được khai thác phát triển rất tốt tại địa
phương nơi xuất xứ. Ngày nay, với xu thế về
sản xuất các sản phẩm hữu cơ, an toàn sinh
học trong chăn nuôi, việc sử dụng các nguồn
gen của hai giống lợn này vô cùng quan trọng
để xây dựng đàn giống phục vụ mục tiêu trên.
Việc áp dụng khoa học công nghệ, đặc biệt
là việc xác định chính xác những gen hoặc
những chỉ thị phân tử có mối liên kết với các
tính trạng sinh sản của lợn nái là cần thiết
nhằm tăng độ chính xác của chọn lọc và đẩy
mạnh năng suất sinh sản của hai giống lợn
này, qua đó góp phần tăng hiệu quả khai thác
và sử dụng chúng.
Gen OVGP1 và gen LIF đã và đang được
các nhà khoa học nghiên cứu như là gen ứng
viên để nâng cao năng suất sinh sản trên lợn.
Gen OVGP1 là một loại gen có khối lượng
phân tử lớn và hiện diện trong ống dẫn trứng
(Agarwal và ctv, 2002). Gen OVGP1 được
tổng hợp từ tế bào biểu mô nằm trong ống
dẫn trứng và được tiết vào ống dẫn trứng với
dục và giai đoạn nang trứng ở hầu hết các
loài động vật lớp thú (Bhatt và ctv, 2004). Trên
lợn, gen OVGP1 nằm trên nhiễm sắc thể số 4
(Merchan và ctv, 2006) và các nghiên cứu in
vitro cho thấy gen OVGP1 tham gia quá trình
thụ tinh và phát triển sớm của phôi. Gen LIF
là yếu tố ức chế bệnh bạch cầu, là một thành
viên của họ cytokine interleukin-6, một trong
những cytokine đa chức năng quan trọng
được tiết ra từ nội mạc tử cung và phôi nang.
Gen LIF của lợn nằm trên nhiễm sắc thể số l4
và có vai trò trong việc chuẩn bị cho quá trình
làm tổ của phôi ở tử cung (Ropka-Malik và
ctv, 2012). Một số nghiên cứu về ảnh hưởng
của gen OVGP1 và LIF đến các chỉ tiêu về
năng suất sinh sản đã được công bố trên thế
giới (Niu và ctv, 2006; Lin và ctv, 2009; Spötter
và ctv, 2009). Tại Việt Nam, thời gian qua đã
có một số tác giả nghiên cứu đa hình gen liên
quan đến một số tính trạng năng suất trên lợn
(Tạ Thị Loan và ctv, 2011; Đỗ Võ Anh Khoa
và Nguyễn Thị Diệu Thúy, 2012; Đỗ Võ Anh
Khoa, 2012; Đặng Hoàng Biên, 2016). Tuy
nhiên, hầu như chưa có công bố nào về ảnh
hưởng của đa hình gen OVGP1 và LIF đến
khả năng sinh sản của giống lợn Hung và lợn

KHKT Chăn nuôi số 271 - tháng 11 năm 2021 7

 DI TRUYỀN - GIỐNG VẬT NUÔI

Mẹo. Vì vậy, nghiên cứu này được tiến hành 2.4. Xử lý số liệu
với mục tiêu xác định các đa hình và phân tích Số liệu được xử lý bằng phần mềm Excel
sự liên kết giữa chúng với các tính trạng sinh và SAS9.1 với mô hình tuyến tính tổng quát
sản trên lợn Hung và lợn Mẹo, nhằm tạo cơ sở (GLM). Các tham số thống kê gồm: số mẫu
cho việc chọn lọc lợn giống mang kiểu gen có (n); các giá trị trung bình (Mean); sai số chuẩn
tiềm năng sinh sản cao. (SE); so sánh sự sai khác bằng phương pháp
2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU Duncan, xác suất (P<0,05), tại Bộ môn Di
truyền - Giống vật nuôi, Viện Chăn nuôi.
2.1. Đối tượng, địa điểm và thời gian
3. KẾT QUẢ VÀ THẢO LUẬN
Thí nghiệm được tiến hành trên 78 lợn
cái Hung, 76 lợn cái Mẹo để đánh giá mối 3.1. Mối liên kết giữa đa hình gen OVGP1
liên kết giữa đa hình gen với các chỉ tiêu sinh với các chỉ tiêu sinh lý sinh dục của lợn cái
lý sinh dục và năng suất sinh sản của 3 lứa và năng suất sinh sản lợn nái của lợn Hung
đẻ đầu. Đàn lợn Hung được nuôi tại huyện và lợn Mẹo
Hoàng Su Phì (Hà Giang) và lợn Mẹo được Kết quả Bảng 1 cho thấy đa hình gen
nuôi tại huyện Kỳ Sơn (Nghệ An). Các số liệu OVGP1 không ảnh hưởng đến tuổi phối giống
được thu thập tại cơ sở có điều kiện chăn nuôi chửa lần đầu (TPGCLĐ) và tuổi đẻ lứa đầu
tương đồng trong thời gian 7 năm (2015-2021). (TĐLĐ) đối với 2 giống lợn Hung và Mẹo
(P>0,05). Đối với lợn Hung, những cá thể
2.2. Các chỉ tiêu theo dõi
mang kiểu gen BB có TPGCLĐ và KLĐLĐ
Đối với lợn hậu bị, các đặc điểm sinh lý cao nhất (P<0,05), nhưng trên giống lợn Mẹo,
sinh dục và khối lượng của lợn cái hậu bị được xu hướng này thể hiện ngược lại. Ngoài ra,
theo dõi gồm tuổi động dục lần đầu (TĐDLĐ), không tìm thấy sự khác biệt giữa chỉ tiêu khảo
khối lượng động dục lần đầu (KLĐDLĐ), tuổi sát đối với lợn mang kiểu gen AA và AB trên
phối giống chửa lần đầu (TPGCLĐ), khối cả 2 giống lợn này
lượng phối giống chửa lần đầu (KLPGCLĐ), Bảng 1. Mối liên kết giữa đa hình gen OVGP1
tuổi đẻ lứa đầu (TĐLĐ), khối lượng đẻ lứa với các chỉ tiêu sinh lý sinh dục của lợn cái
đầu (KLĐLĐ). hậu bị
Đối với lợn nái sinh sản, những chỉ tiêu
Lợn Hung Lợn Mẹo
về năng suất sinh sản được ghi nhận như tổng Tính trạng Kiểu
gen n Mean±SE n Mean±SE
số con sơ sinh (TSCSS), tổng số con sơ sinh AA 35 295,29±13,92 48 291,23±6,55
sống (TSCSSS), tổng số con cai sữa (TSCCS) TPGCLĐ AB 40 296,63±8,29 23 295,52±10,81
(ngày)
và khoảng cách lứa đẻ (KCLĐ) của 3 lứa đẻ BB 3 253,67±6,96 5 276,60±10,06
đầu tiên. AA 35 17,88a±0,61 48 24,02±0,72
KLPGCLĐ AB 40 20,27ab±0,70 23 24,57±0,95
2.3. Phương pháp xác định kiểu gen (kg)
BB 3 23,67b±2,40 5 21,80±2,35
Mẫu tai được thu thập, tách chiết ADN,
AA 35 409,31±13,91 48 405,21±6,57
thực hiện phản ứng chuỗi trùng hợp PCR và TĐLĐ
(ngày) AB 40 410,50±8,28 23 409,61±10,78
xác định kiểu gen bằng kỹ thuật đa hình chiều BB 3 368,00±7,00 5 390,20±10,22
dài các đoạn giới hạn (RFLP) tại Phòng thí AA 35 26,43a±0,77 48 35,40±0,91
nghiệm trọng điểm Công nghệ tế bào động KLĐLĐ AB 40 29,15ab±0,77 23 36,04±1,04
(kg)
vật - Viện Chăn nuôi. Các cặp mồi, điều kiện BB 3 33,00b±2,08 5 34,00±2,93
thực hiện phản ứng PCR và enzyme cắt giới
Chú thích: TPGCLĐ: Tuổi phối giống chửa lần đầu;
hạn (EcoRIvà BstUI) sử dụng được tham khảo KLPGCLĐ: Khối lượng PGC lần đầu; TĐLĐ: Tuổi đẻ
từ Niu và ctv (2006) và Ding và ctv (2020) lứa đầu; KLĐLĐ: Khối lượng đẻ lứa đầu. Trong cùng
tương ứng đối với gen OVGP1 (intron 9) và tính trạng, cùng giống, các giá trị Mean có chữ cái khác
LIF (exon 3). nhau thì sự sai khác có ý nghĩa thống kê (P<0,05).

8 KHKT Chăn nuôi số 271 - tháng 11 năm 2021

DI TRUYỀN - GIỐNG VẬT NUÔI

Đối với các chỉ tiêu tổng (T): TSCSS, có SCSS và SCSSS tương ứng là 10,14 con và
TSCSSS và TSCCS của 3 lứa đẻ đầu ở lợn Hung 8,98 con; trong khi đó lợn mang kiểu gen AA
(Bảng 2) chỉ ra rằng nhóm lợn mang kiểu gen là 11,00 con và 10,77 con, tương ứng và lợn
BB thể hiện đẻ nhiều con hơn so với các nhóm mang kiểu gen AB là 11,45 con và 11,02 con.
lợn mang những kiểu gen còn lại (P<0,05). Cụ Tương tự, Spötter và ctv (2005) cũng cho biết
thể, TSCSS của 3 lứa đẻ đầu ở nhóm mang tính trạng SCSSS cũng khác nhau ở lợn mang
kiểu gen BB cao nhất (21,00 con), tiếp theo là các kiểu gen khác nhau, theo đó lợn mang kiểu
nhóm mang kiểu gen AB (18,63 con) và thấp gen AA có SCSSS cao nhất ở các lứa đẻ. Đột
nhất là nhóm mang kiểu gen AA (16,80 con). biến nucleotide có thể làm thay đổi chức năng
Bảng 2. Mối liên kết giữa đa hình gen OVGP1 của gen, bằng cách thay đổi vùng mã hóa của
với năng suất sinh sản lợn nái của 3 lứa đẻ đầu protein, dịch mã hoặc sự ổn định của mRNA
hoặc kiểm soát quá trình phiên mã của gen.
Tính Kiểu Lợn Hung Lợn Mẹo
trạng gen Trong thí nghiệm này, đa hình được tìm thấy
n Mean±SE n Mean±SE
AA 35 16,80b±0,54 48 18,17a±0,59
trên intron 9 của gen OVGP1. Mặc dù đa hình
TSCSS AB 40 18,63ab±0,70 23 18,57a±0,80
trên intron không trực tiếp làm thay đổi axit
(con) amin, chúng có thể đóng một vai trò trong việc
BB 3 21,00a±0,58 5 22,80b±0,86
AA 35 15,77b±0,57 48 17,58a±0,59 điều chỉnh sự biểu hiện gen, do đó đa hình đơn
TSCSSS AB 40 18,00ab±0,72 23 17,70a±0,73 cấu thành có thể liên quan trực tiếp đến sự biến
(con)
BB 3 20,33a±0,88 5 22,20b±0,97 đổi chức năng của gen (Zhang và ctv, 2005).
AA 35 15,06b±0,50 48 16,52a±0,54 3.2. Mối liên kết giữa đa hình gen LIF với các
TSCCS AB 40 17,05ab±0,61 23 17,00ab±0,61
(con) chỉ tiêu sinh lý sinh dục của lợn cái và năng
BB 3 19,00a±0,58 5 19,80b±1,39 suất sinh sản lợn nái của lợn Hung và lợn Mẹo
AA 35 203,91±2,81 48 206,34±2,02
KCLĐ Kết quả Bảng 3 cho thấy, đa hình gen LIF
(ngày) AB 40 207,80±2,80 23 217,98±5,39
BB 3 208,00±6,25 5 212,20±4,29
không có ảnh hưởng đến các chỉ tiêu sinh lý
sinh dục và khối lượng cơ thể của lợn cái hậu
Chú thích: TSCSS, TSCSSS và TSCCS là tổng của 3 bị Hung và Mẹo (P>0,05).
lứa đẻ đầu; KCLĐ là trung bình khoảng cách giữa 3 lứa
đẻ đầu. Bảng 3. Mối liên kết giữa đa hình gen LIF với
các chỉ tiêu sinh lý sinh dục của lợn cái hậu bị
Tương tự, nhóm lợn mang kiểu gen BB
có TSCCS của 3 lứa đẻ đầu đạt cao nhất (19,00 Tính Kiểu Lợn Hung Lợn Mẹo
con) sau đó đến nhóm mang kiểu gen AB trạng gen n Mean±SE n Mean±SE
(17,05 con) và thấp nhất là kiểu gen AA (15,06 CC 2 375,00±24,00 2 319,50±42,50
TPGCLĐ
con) (P<0,05). Kết quả tương tự cũng được tìm (ngày) CT 14 294,71±11,09 5 310,00±20,81
thấy trên lợn Mẹo, theo đó TSCSS, TSCSSS và TT 59 293,63±9,39 69 289,42±5,53
TSCCS cao nhất ở lợn nái mang kiểu gen BB, CC 2 17,00±0,00 2 28,50±0,50
KLPGCLĐ CT 14 19,14±0,82 5 24,40±3,01
tuy nhiên ảnh hưởng của alen B đến các tính (kg)
trạng này không rõ như trên giống lợn Hung, TT 59 19,23±0,59 69 23,88±0,57
lợn với kiểu gen dị hợp tử và kiểu gen đồng CC 2 489,00±24,00 2 433,50±42,50
TĐLĐ CT 14 408,79±11,08 5 424,00±20,97
hợp tử AA có năng suất sinh sản hầu như (ngày)
tương đương nhau. Ngoài ra, không tìm thấy TT 59 407,54±9,38 69 403,41±5,54
sự ảnh hưởng của đa hình này trên KCLĐ của CC 2 24,00±1,00 2 37,00±0,00
KLĐLĐ CT 14 27,86±1,35 5 35,80±3,73
2 giống lợn (P>0,05). Kết quả này có phần khác (kg)
biệt so với công bố của Niu và ctv (2006) khi TT 59 28,02±0,64 69 35,43±0,70
phân tích đa hình gen OVGP1 ở lợn Qingping, Năng suất sinh sản của lợn nái Hung cao
theo đó lợn mang kiểu gen BB có số con sơ sinh nhất ở nhóm mang kiểu gen TT (ngoại trừ
và số con sơ sinh sống thấp hơn lợn mang kiểu KCLĐ), tiếp theo là nhóm mang kiểu gen CT
gen AA và AB. Cụ thể lợn mang kiểu gen BB và thấp nhất ở nhóm mang kiểu gen CC (Bảng

KHKT Chăn nuôi số 271 - tháng 11 năm 2021 9

 DI TRUYỀN - GIỐNG VẬT NUÔI

4). Cả hai nhóm lợn nái mang kiểu gen CT và Large White, cá thể mang kiểu gen CT có
TT có KCLĐ đều ngắn hơn nhóm mang kiểu năng suất thấp hơn hai dạng đồng hợp tử.
gen CC (248,25 ngày) (P<0,05). Đối với giống Nhưng hiện tượng này trái ngược khi ở con
lợn Mẹo, đa hình này hầu như không ảnh lai (LRxLW), nhóm mang kiểu gen dị hợp tử
hưởng đến tất cả các chỉ tiêu khảo sát. Lin và lại cao hơn hai bên đồng hợp tử (Norseeda và
ctv (2009) cho biết sự liên kết có ý nghĩa giữa ctv, 2021). Nghiên cứu của Ding và ctv (2020)
đa hình gen LIF đến số con sơ sinh và số con cũng tìm thấy tác động tích cực của gen LIF
sơ sinh sống trên giống lợn LW. Bên cạnh đó, đến năng suất sinh sản ở lợn: kiểu gen CC
Spötter và ctv (2009) chỉ ra rằng gen LIF có mang lại sự khác biệt đáng kể so với kiểu gen
dấu hiệu tác động cộng gộp đối với tính trạng CT hoặc TT đối với chỉ tiêu SCSS và số SCSSS
SCSSS. Napierała và ctv (2014) nghiên cứu trên ở lợn Wei và Large White. Xu hướng khác biệt
lợn con lai giữa lợn trắng Ba Lan và Landrace về ảnh hưởng của từng kiểu gen trên gen LIF
Ba Lan cho biết lợn mang đa hình kiểu gen cũng được thể hiện qua nhận định của Ding và
LIF khác nhau có SCSSS và SCCS khác nhau ở ctv (2020), theo đó ở giống lợn Anqing nhóm
các lứa đẻ, tuy nhiên chỉ thấy khác nhau có ý mang kiểu gen TT có SCSS, SCSSS cao nhất,
nghĩa thống kê (P<0,05) ở lứa đẻ 1. Tính trạng sau đó đến nhóm mang kiểu gen CT và thấp
SCSSS của lợn mang kiểu gen TT đạt cao nhất nhất nhóm CC. Thế nhưng, xu hướng này lại
(9,40 con); sau đó đến nhóm mang kiểu gen thay đổi ở các giống khác như ở giống lợn Wei
TC (9,39 con/ổ) và thấp nhất ở nhóm mang và Wanna, thứ tự ngược lại ở lợn LW. Trong
kiểu gen CC (8,02 con). Cũng tương tự ở tính các nghiên cứu về sự liên kết của toàn bộ bộ
trạng SCCS, nhóm mang kiểu gen TT đạt cao gen, nhiều locus tính trạng số lượng có ảnh
nhất (9,59 con); sau đó đến nhóm mang kiểu hưởng đến số con và khối lượng sơ sinh đã
gen TC (9,30 con) và thấp nhất ở nhóm mang được tìm thấy trên nhiễm sắc thể 14, gần với
kiểu gen CC (8,48 con). Kết quả này cũng phù locus gen LIF (Onteru và ctv, 2011; Schneider
hợp với kết quả nghiên cứu của chúng tôi. và ctv, 2012). Điều này cũng cho phép suy luận
Mucha và ctv (2013) cũng tìm thấy ảnh hưởng về mối liên kết của gen LIF với những gen có
tích cực của alen T đối với tính trạng SCSSS. liên quan, khác nhau về nền tảng di truyền và
Bảng 4. Mối liên kết giữa đa hình gen LIF với đây có thể là lý do giải thích cho sự liên kết
năng suất sinh sản lợn nái của 3 lứa đẻ đầu không thống nhất giữa kiểu gen với năng suất
sinh sản trên các giống lợn khác nhau.
Tính Kiểu Lợn Hung Lợn Mẹo
trạng gen n Mean±SE n Mean±SE Trong nghiên cứu này, kết quả chỉ ra rằng
CC 2 14,00±3,00 2 19,00±1,00 những cá thể mang alen B của gen OVGP1 và
TSCSS CT 14 17,43±1,58 5 20,40±1,36 alen T của gen LIF nên được duy trì và phát triển
(con)
TT 59 17,98±0,44 69 18,45±0,50 trong quần thể để khai thác tiềm năng di truyền
CC 2 13,00±3,00 2 19,00±1,00 về đặc điểm sinh sản của 2 giống lợn nghiên cứu.
TSCSSS CT 14 17,00±1,57 5 20,00±1,30
(con) 4. KẾT LUẬN
TT 59 17,08±0,48 69 17,74±0,49
CC 2 12,50±3,50 2 18,50±0,50 Đa hình các gen OVGP1 và LIF có mối liên
TSCCS CT 14 16,21±1,33 5 17,80±0,86 kết đến năng suất sinh sản của lợn Hung và
(con)
TT 59 16,22±0,41 69 16,77±0,44 lợn Mẹo, trong đó lợn mang kiểu gen BB của
CC 2 248,25a±4,25 2 199,75±17,25 gen OVGP1 có tổng số con sơ sinh, tổng số con
KCLĐ
(ngày) CT 14 208,64b±4,29 5 215,60±11,95 sơ sinh sống, tổng số con cai sữa của 3 lứa đẻ
TT 59 203,92b±2,07 69 210,17±2,19 đầu cao hơn nhóm mang kiểu gen AB và AA.
Tuy nhiên, trên các giống lợn thương mại, Đa hình của gen LIF cũng có ảnh hưởng đến
kết quả cho thấy kiểu gen CC của gen LIF, khoảng cách lứa đẻ trên lợn Hung, theo đó lợn
SCSS, SCSSS và SCCS cao hơn các lợn mang mang kiểu gen TT có khoảng cách lứa đẻ ngắn
kiểu gen CT và TT. Ở hai giống Landrace và nhất. Do đó, đối với 2 giống lợn này, alen B

10 KHKT Chăn nuôi số 271 - tháng 11 năm 2021

DI TRUYỀN - GIỐNG VẬT NUÔI
(gen OVGP1) và alen T (gen LIF) cần được duy
trì và phát triển để nâng cao khả năng sinh sản
trên 2 giống này.
TÀI LIỆU THAM KHẢO
1. Agarwal A., Yeung W.S. and Lee K.F. (2002). Cloning
and characterization of the human oviduct-specific
glycoprotein (HuOGP) gene promoter. Mol. Hum. Rep.,
8: 167-75.
2. Bhatt P., Kadam K., Saxena A. and Natraj U. (2004).
Fertilization, embryonic development and oviductal
environment: role of estrogen induced oviductal
glycoprotein. Indian. J. Exp Biol., 42: 1043-55.
3. Đặng Hoàng Biên (2016). Khả năng sản xuất và đa hình
gen PRKAG3 của lợn Lũng Pù và lợn Bản. Luận án Tiến
sỹ Nông Nghiệp. Viện Chăn nuôi. Bộ NN&PTNT.
4. Ding Y., Ding C., Wu X., Wu C., Qian L., Li D., Zhang
W., Wang Y., Yang M., Wang L., Ding J., Zhang X., Gao
Y. and Yin Z. (2020). Porcine LIF gene polymorphisms
and their association with litter size traits in four pig
breeds. Can. J. Anim. Sci., 100: 85-92.
5. Đỗ Võ Anh Khoa (2012). Ảnh hưởng của gen MYOG và
LIF lên một số tính trạng kinh tế ở lợn. Tạp chí KHPT,
10(4): 620-26.
6. Đỗ Võ Anh Khoa và Nguyễn Thị Diệu Thúy (2012).
Tương quan giữa đa hình di truyền gen Myogenin
và gen mã hóa yếu tố ức chế ung thư máu (Leukemia
inhibitory factor) với các đặc tính sinh lý-hóa máu lợn.
Tạp chí Khoa học ĐHQGHN, Khoa học Tự nhiên và
Công nghệ, 28: 77-86.
7. Tạ Thị Loan, Nguyễn Thị Diệu Thúy, Nguyễn Giang
Sơn và Đỗ Võ Anh Khoa (2011). Đa dạng di truyền
nguồn gen giống lợn ngoại nuôi tại Việt Nam. Tuyển
tập BC tại Hội nghị khoa học toàn quốc về sinh thái và
tài nguyên sinh vật lần thứ 4. Trang 697-03.
8. Lin H.C., G.F. Liu, A.G. Wang, L.J. Kong, X.F. Wang and
J.L. Fu (2009). Effect of polymorphism in the leukemia
inhibitory factor gene on litter size in Large White pigs.
36(7): 1833-38. doi: 10.1007/s11033-008-9387-0.
9. Merchan M., Rendon M. and Folch J.M. (2006).
Assignment of the oviductal glycoprotein 1 gene
(OVGP1) to porcine chromosome 4q22àq23 by
radiation hybrid panel mapping. Cytogenet. Genome
Res., 114(1): 93C.
BIỂU HIỆN GEN VEGF-R1 TRÊN MẪU MÔ BUỒNG TRỨNG
VÀ PHỨC HỢP CUMULUS-TẾ BÀO TRỨNG HEO
Ở CÁC GIAI ĐOẠN PHÁT TRIỂN KHÁC NHAU
Nguyễn Ngọc Tấn2 *, Phan Hữu Hương Trinh1, Lê Thị Thanh1, Trầm Minh Thành1 và Lê Tấn Lợi1
3
Ngày nhận bài báo: 10/07/2021 - Ngày nhận bài phản biện: 10/08/2021
Ngày bài báo được chấp nhận đăng: 20/08/2021
1
Trường Đại học Nông Lâm Tp. Hồ Chí Minh
* Tác giả liên hệ: TS. Nguyễn Ngọc Tấn, Giảng viên chính Khoa Khoa học Sinh học-Trường Đại học Nông Lâm Tp. Hồ Chí Minh;
Điện thoại: 0948 993 338; Email: nntan@hcmuaf.edu.vn
KHKT Chăn nuôi số 271 - tháng 11 năm 2021
10. Mucha A., Ropka-Molik K., Piórkowska K., Tyra M.
and Oczkowicz M. (2013). Effect of EGF, AREG and LIF
genes polymorphisms on reproductive traits in pigs.
Anim. Rep. Sci., 137: 88-92.
11. Napierała D., Kawęcka M., Jacyno E., Matysiak B. and
Wierzchowska A. (2014). Short communication: Effect
of polymorphism in the LIF gene on reproductive
performanceof hybrid Polish LW and Polish Landrace
sows. S. Afr. J. Anim. Sci., 44(1): 49-53.
12. Niu B.Y., Y.Z. Xiong, F.E. Li, S.W. Jiang, C.Y. Deng,
S.H. Ding, W.H. Guo, M.G. Lei; R. Zheng, B. Zuo, D.Q.
Xu and J.L. Li (2006). Oviduct-specific Glycoprotein 1
locus is associated with litter size and weight of ovaries
in pigs. Asian-Aust. J. Anim. Sci., 19(5): 632-37.
13. Norseeda W., Liu G., Teltathum T., Sringarm K.,
Naraballobh W., Khamlor T. and Mekchay S. (2021).
Effect of leukemia inhibitory factor polymorphism on
litter size traits in Thai commercial pig breeds. Vet.
Integr. Sci., 19(2): 185-96.
14. Onteru S.K., Fan B., Nikkilä M.T., Garrick D.J.,
Stalder K.J. and Rothschild M.F. (2011). Whole-
genome association analyses for lifetime reproductive
traits in the pig. J. Anim. Sci., 89(4): 988-95.
15. Ropka-Molik K., Oczkowicz M., Mucha A.,
Piórkowska K. and Piestrzyńskakajtoch A. (2012).
Variability of mRNA abundance of leukemia inhibitory
factorgene (LIF) in porcine ovary, oviduct and uterus
tissues. Mol. Biol. Rep., 39(8): 7965-72.
16. Schneider J.F., Rempel L.A., Snelling W.M., Wiedmann
R.T., Nonneman D.J. and Rohrer G.A. (2012). Genome-
wide association study of swine farrowing traits. Part
II: Bayesian analysis of marker data. J. Anim. Sci.,
90(10): 3360-67.
17. Spötter A., Drögemüller C., Hamann H. and Distl O.
(2005). Evidence of a new leukemia inhibitory factor-
associated genetic marker for litter size in a synthetic
pig line. J. Anim. Sci., 83: 2264-70.
18. Spötter A., Muller S., Hamann H. and Distl O. (2009).
Effect of polymorphisms in the genes for LIF and RBP4
on litter size in two German pig lines. Rep. Dom. Anim.,
44: 100-105.
19. Zhang Z.B., Lei M.G., Deng C.Y., Xiong Y.Z.H.,
Zuo B. and Li G.E. (2005). Lipoprotein lipase
geneandproductivetraitsin pig resource family. Asian-
Austra. J. Anim. Sci., 18: 458-62.
11
 10.1071/ANv62n14toc

ANIMAL PRODUCTION SCIENCE

CONTENTS Volume 62, Issue 14, 2022, 1303–1438

Sustainable Animal Agriculture for Developing Countries 2019

Foreword
Foreword: Sustainable Animal Agriculture for Developing Countries 2019
Juan Boo Liang i
Review
Feed additives as a strategic approach to reduce enteric methane production in cattle: modes of action,
effectiveness and safety
M. Honan, X. Feng, J. M. Tricarico and E. Kebreab 1303–1317
Perspective
The future of smallholder farming in developing countries in the face of climate change: a perspective with
a focus on Pakistan
P. C. Wynn, H. M. Warriach, H. Iqbal and D. M. McGill 1318–1329
Research Papers
Meta-analysis of the effect of probiotic-yeast (Saccharomyces cerevisiae) intervention on feed intake,
feed efficiency and egg-production indices in laying hens
I. P. Ogbuewu and C. A. Mbajiorgu 1330–1343
Ruminal microbiota is associated with feed-efficiency phenotype of fattening bulls fed high-concentrate diets
S. Costa-Roura, D. Villalba, M. Blanco, I. Casasús, J. Balcells and A. R. Seradj 1344–1352
Analysis of bacterial community in rumen fluid of cattle supplemented with different protein and energy sources
Nguyen Trong Ngu, Luu Huynh Anh, Nguyen Thi Hong Nhan, Nguyen Van Hon, Nguyen Thiet, Juan Boo Liang,
Lam Thai Hung, Nguyen Hong Xuan, Wei Li Chen and Ly Thi Thu Lan 1353–1361
Differences in bacterial diversity across indigenous and introduced ruminants in the Qinghai Tibetan plateau
Xiaodan Huang, Stuart Edward Denman, Jiandui Mi, Jagadish Padmanabha, Lizhuang Hao, Ruijun Long and
Christopher S. McSweeney 1362–1370
Bypass fat enhances liveweight gain and meat quality but not profitability of smallholder cattle fattening systems
based on oil palm frond
O. Pimpa, B. Binsulong, U. Pastsart, B. Pimpa and J. B. Liang 1371–1378
Comparison of microbial diversity in rumen and small intestine of Xinong Saanen dairy goats using
16S rRNA gene high-throughput sequencing
Cong Li, Yanan Geng, Ping Wang, Huaiping Shi and Jun Luo 1379–1390
Milk fatty acid composition, rumen microbial population and animal performance in response to diets
rich in linoleic acid supplemented with Piper betle leaves in Saanen goats
R. A. P. Purba, C. Yuangklang, S. Paengkoum and P. Paengkoum 1391–1401
Enhancing bypass starch in cassava chip to sustain growth in goat
S. Renuh, S. C. L. Candyrine, P. Paengkoum, Y. M. Goh, A. Q. Sazili and J. B. Liang 1402–1413
Biological additives improved qualities, in vitro gas production kinetics, digestibility, and rumen fermentation
characteristics of different varieties of rice straw silage
M. A. Ahmed, M. Y. Rafii, M. Z. Nur Ain Izzati, A. K. Khalilah, E. A. Awad, U. Kaka, S. C. Chukwu, J. B. Liang
and A. Q. Sazili 1414–1429
Effect of dietary protein level on egg production and egg-quality characteristics of Japanese quail
(Coturnix coturnix japonica) in the tropical environment
O. M. A. Jesuyon, A. A. Aganga, M. Orunmuyi and G. T. Falade 1430–1438
CSIRO PUBLISHING SPECIAL ISSUE
Animal Production Science
https://doi.org/10.1071/AN20206

Analysis of bacterial community in rumen fluid of cattle

supplemented with different protein and energy sources

Nguyen Trong Ngu A, Luu Huynh Anh A, Nguyen Thi Hong Nhan A, Nguyen Van Hon A,
Nguyen Thiet B, Juan Boo Liang C, Lam Thai Hung D, Nguyen Hong Xuan E, Wei Li Chen C
and Ly Thi Thu Lan D,F
A
College of Agriculture, Can Tho University, 3/2 Street, Can Tho City, 94000, Vietnam.
B
College of Rural Development, Can Tho University, 3/2 Street, Can Tho City, 94000, Vietnam.
C
Institute of Tropical Agriculture and Food Security, University Putra Malaysia, UPM Serdang,
Selangor, 43400, Malaysia.
D
School of Agriculture and Aquaculture, Tra Vinh University, 126 Nguyen Thien Thanh,
Tra Vinh City, 87000, Vietnam.
E
College of Food Technology and Biotechnology, Can Tho University of Technology,
256 Nguyen Van Cu, Can Tho City, 94000, Vietnam.
F
Corresponding author. Email: thulan@tvu.edu.vn

Abstract
Context. Source and composition of feed influence rumen microbial community, which determines efficiency of feed
digestion and thus productivity in ruminants. Therefore, changes in the structure, function and diversity of the rumen
microbial populations in response to changes in diet provide an understanding in the rumen fermentation process.
Aims. The present study, consisting of two experiments, was conducted to determine the effects of supplementing
different protein and energy sources on the rumen bacterial community in cattle.
Methods. The dietary treatments of the first experiment, which evaluated the effect of protein sources, were as follows:
(i) Hymenachne acutigluma grass, rice straw and rice bran (1.5 kg/head.day; C1), (ii) C1 plus 120 g urea/head.day (C1 + U),
(iii) C1 plus 720 g soybean/head.day (C1 + SM), and (iv) C1 plus 720 g of blood and feather meal (in 1:1 ratio)/head.day
(C1 + BFM). The treatments in the second experiment were (i) Hymenachne acutigluma grass, rice straw and concentrate
(1.5 kg/head.day; C2), (ii) C2 plus 250 g fish oil/head.day (C2 + FO) and (iii) C2 + 250 g soybean oil/head.day (C2 + SO). At
the end of the 90-day feeding trial, rumen fluids were extracted for microbial DNA isolation to identify the microbe species
by the polymerase chain reaction–denaturing gradient gel electrophoresis method and sequencing of the 16S rRNA region.
Key results. The sequences of some DNA bands were closely related to the bacteria strains of the Prevotella, Cytophaga,
Capnocytophaga, Cyanobacterium, Catonella, Faecalibacterium, Lachnospiraceae, Ruminococcaceae, Propionivibrio,
Galbibacter, Moorellaglycerin, Escherichia coli and Klebsiella alba groups, with similarity levels ranging from 73% to
96%. In addition, the Prevotella species was found in both the protein and the energy supplement trials, and irrespective of
diet supplements, the Firmicutes and Bacteroidetes were the prominent groups in the rumen.
Conclusions. Firmicutes and Bacteroidetes are the two dominant groups of rumen microflora, and Bacteroidia and
Clostridia classes together with the Prevotella genus are predominant in the rumen irrespective of protein and energy
sources.
Implications. Our findings provided evidence on the effect of diet on the interaction of rumen microbial community and
have important implications in establishing optimal diets for cattle.

Keywords: cattle, energy, protein, rumen microbial community, supplementation.

Received 30 March 2020, accepted 15 February 2021, published online 11 May 2021

Introduction animal. Typical rumen bacteria require nitrogen, energy

Fermentation of feed by microorganisms in the rumen is vital source, minerals, vitamins and other growth factors for their
to provide nutrients to the host animals, and any interference multiplication and growth, with nitrogen and energy being the
on the microorganism system can enhance or adversely affect two key factors needed for their growth (Van et al. 1995). In
the nutrient supply process, and thus productivity of the host most developing countries, including Vietnam, the forages

Journal compilation
CSIRO 2021 www.publish.csiro.au/journals/an

B Animal Production Science
available for cattle are generally low in protein; therefore,
common practice is to provide nitrogenous supplements such
as urea, soybean meal, and fish and feather meal to support the
growth of the bacteria in the rumen. Although they are
produced for human consumption, soybean oil and fish oil
are useful sources of fat to formulate high energy diets for
ruminants (Dei 2011). The efficient use of the nutrients in
ruminants is primarily determined by the rumen fermentation
process, which is highly influenced by the rumen microbial
communities (Ellison et al. 2014; Wetzels et al. 2015), and
their diversity and activity, which ultimately determine the
effectiveness of feed used by the host animals (Guan et al.
2008). According to de Menezes et al. (2011) and Zhang et al.
(2014), diet is one of the main factors affecting rumen bacterial
population, especially the substrates for microbial fermentation,
which mostly depends on the chemical composition of the feed.
Moreover, the rumen bacterial population responds quickly to
dietary manipulations (Li et al. 2009), which can lead to changes
in microbial communities; thus, a greater understanding of the
interaction between the diet and ruminal microbes would be
beneficial in improving ruminant productivity (Huws et al. 2010).
Huws et al. (2010) investigated the effects of grass and red
clover silage diet with supplementation of fish oil on the
microbial communities, and reported significant changes in the
diversity of the bacterial community responding to different diets.
Similarly, Lillis et al. (2011) reported that supplementation of
soya oil in forage diet resulted in significant changes in the
diversity of the ruminal bacterial population, without
influencing the methane-producing bacteria. Wang et al.
(2009) reported that dietary protein had a great impact on the
structure of the microbial community in goats. It was indicated by
Cui et al. (2019) in lambs that low-energy diet increased the
relative abundance of phyla of Fibrobacteres and the relative
abundance of Butyrivibrio and Prevotellaceae. The authors also
reported that a reduction in dietary protein or energy levels led to a
negative effect on daily weight gain of lambs. According to
Xiaokang et al. (2020), low-energy diets inhibited lamb
growth by increasing rumen microbial diversity but reducing
the abundance of Proteobacteria phylum and
Succinivibrionaceae uncultured genus, which is associated
with altered fermentation phenotypes in ruminants. On the
basis of the above literature, it is hypothesised that diets with
different energy and protein sources and levels affect the rumen
bacterial community and thus microbiota fermentation
differently, which subsequently affects growth rate. Although
the effect of protein or energy supplementation on ruminal
bacterial community has been extensively studied in ruminant
animals, concurrent comparative studies on the effect of different
nitrogen and energy sources on the shift in rumen microbes are
limited. Therefore, the primary objective of the present study was
to examine changes in the diversity of ruminal bacterial groups in
Brahman crossbred cattle fed grass and rice-straw based diets
supplemented with different protein and energy sources.
Materials and methods
Animal management and diet
The study was conducted according to the Research Protocol
for Animal Studies approved by the Can Tho University and
N. T. Ngu et al.
the An Giang Sub-department of Veterinary Medicine. The
study consisted of two experiments, in which 28 Brahman
crossbred cattle (on average, 11 months old and having a
bodyweight of 178
12.5 kg) were concurrently allocated in
two completely randomised block designs. All animals were
vaccinated against foot and mouth disease and dewormed
2 weeks before the start of the experiment. During the
90 days of the study, they were housed in individual pens
and had free access to clean drinking water and home-made
mineral blocks containing sodium (12 g), magnesium (3 g),
calcium (8 g), phosphorus (10 g), iron (8 g ), copper (25 g),
selenium (0.7 g) and iodine (7 g) and glucose as carrier per 100 g.
In Experiment 1, the dietary treatments (n = 4 per
treatment), formulated to meet the nutrient requirements of
beef cattle (NRC 1996), were (i) basal diet (C1) comprising
Hymenachne acutigluma grass, rice straw and rice bran, (ii) C1
plus urea (C1 + U), (iii) C1 plus soybean meal (C1 + SM), and
(iv) C1 plus a mixture of an equal proportion of blood and
feather meal (C1 + BFM). The ingredients and chemical
compositions for the above diets are shown in Table 1. The
grass (~1% bodyweight, DM basis) was divided into two equal
portions and offered to the cattle at 0800 hours and 1400 hours.
Similarly, the rice bran (~1.5 kg/head.day) or a mixture of rice
bran plus different protein sources were also offered in two
equal portions, just before the grass, while rice straw was given
ad libitum in the evening. To ensure that animals consumed the
daily rations offered to them, daily intake of individual animal
(especially that of rice straw as cattle normally consumed
all the other feed ingredients offered to them) was recorded
and used to determine the amount to be offered in the
following day. The diets were nearly isocaloric (ranging
from 9.1 to 10 MJ/kg DM), but CP contents of diets
supplemented with various protein sources had a higher CP
(15.5–21.2%) than did the control (10.4%).
The dietary treatments (n = 4 per treatment) in Experiment
2 were (i) basal diet (C2) comprising Hymenachne acutigluma
grass, rice straw and concentrate (CP = 16%, neutral detergent
fibre = 26.9%, acid detergent fibre = 10.6%, metabolisable
energy = 10.6 MJ/kg), (ii) C2 plus fish oil (C2 + FO), and (iii)
C2 plus soybean oil (C2 + SO; Table 1). Similar to Experiment
1, the grass, concentrate (~1.5 kg/head.day) and concentrate
mixed with fish oil or soybean oil) were offered in two equal
portions at 0800 hours and 1400 hours, while the rice straw
was offered in one bulk in the evening. As in Experiment 1,
daily feed intake was recorded and used to determine the
amount to be offered in the following day.
Rumen sample collection and DNA extraction
In the last 2 days of the feeding period, the rumen fluids were
collected using a stomach tube before morning feeding. The
tube head was inserted quickly into the central rumen to
minimise saliva contamination. Ruminal fluid samples were
stored in sterile falcol tubes and were immediately placed in a
cold box and taken to the laboratory, and stored at –80C for
further use. Two samples from the 2 days of collection from
each cattle were pooled for DNA extraction. In total, 28 DNA
samples were extracted. Microbe genomic DNA extraction
was undertaken following the cetyltrimethyl ammonium
Bacteria community in rumen of cattle Animal Production Science C

Table 1. Nutrient and chemical composition of the experimental diets

C1, Hymenachne acutiglum grass, rice straw and rice bran (1.5 kg/head.day); U, urea (120 g/head.day); SM, soybean meal (720 g/head.day); BFM,
50% blood meal and 50% feather meal mixture (720 g/head.day); C2, Hymenachne acutiglum grass, rice straw and concentrate (1.5 kg/head.day); FO, fish
oil (250 g/head.day); SO, soybean oil (250 g/head.day)

Diet composition Experiment 1 Experiment 2

C1 C1 + U C1 + SM C1 + BFM C2 C2 + FO C2 + SO
Ingredient (% of DM)
Hymenachne acutiglum grass 46.2 47.2 43.2 44.3 32.5 31.3 32.6
Rice straw 23.7 20.4 18.0 14.8 18.8 15.6 12.6
Rice bran 30.1 30.1 26.2 27.7
Urea – 2.4 – –
Soybean meal – – 12.6 –
Blood meal – – – 6.6
Feather meal – – – 6.6
Concentrate 48.7 47.0 48.9
Soybean oil – 6.00
Fish oil 6.00
Chemical composition of diets (%)
DM 57.1 56.6 58.7 58.6 65.3 66.7 65.7
CP 10.4 17.0 15.5 21.2 12.0 11.5 11.8
Neutral detergent fibre (NDF) 58.9 57.0 54.1 50.6 48.0 44.5 43.5
Acid detergent fibre (ADF) 28.3 28.4 26.4 24.0 23.6 21.7 21.0
Metabolisable energy (ME, MJ/kg DM) 9.3 9.1 10.0 9.8 9.1 10.9 10.4

bromide-based protocol described by Minas et al. (2011). In
brief, cell lysis was achieved by bead beating in the presence of
cetyltrimethyl ammonium bromide lysis buffer. The phase was
separated by centrifugation with the presence of phenol:
chloroform:isoamyl alcohol (25:24:1, pH = 6.7; Sigma-
Aldrich). Nucleic acid was further precipitated by adding
isopropanol containing 50 mL of 7.5 M ammonium acetate
(Fisher) and the DNA pellet was washed by ethanol, air-dried
and re-suspended in 200 mL of 75 mM Tris-EDTA buffer.
Polymerase chain reaction (PCR) amplification
The V3 bacterial region (233 bp) was amplified using 341F
primer with GC-Clamp: 50 -CGCCCGCCGCGCGCGGCGG
GCGGGGCGGGGGCACGGGGGGCCTACGGGAGGCAG
CAG-30 and 534R: 50 -ATTACCGCGGCTGCTGG-30
(Muyzer and Smalla 1998). PCR was performed in 20 mL
volumes, which contained 25 ng DNA, 0.25 M per primer,
0.25 M per dNTP, 1· PCR buffer, and 1 U/mL of Taq DNA
polymerase. DNA samples were amplified with a denaturation
period of 94C for 5 min, 20 cycles of touch down (94C for
30 s, 65C to 55C, 1C reduction per 2 cycles, 72C for
1 min), followed by 10 cycles of 94C for 30 s, 56C for 30 s,
72C for 1 min and the last cycle was 72C for 10 min. Of the
V3 bacterial region, 5 mL of the amplified products were tested
on 1.5% agarose gel.
PCR–denaturing gradient gel electrophoresis
(PCR–DGGE) banding profiles
The DGGE was implemented on the D-Code Universal Mutation
Detection System (Bio-Rad) with a gel size of 16 cm · 10 cm · 1
mm. The remaining 15 mL of the sample was tested on 8%
polyacrylamide gel (acrylamide:bis-acrylamide, 37.5:1) in
1·TAE buffer (20 mM Tris; pH 7.4, 10 mM sodium acetate,
0.5 M EDTA), with a denaturation ratio of 40–60%. The
electrophoresis process was performed at 60C, 75 V, 400 mA
for 16 h, after which the DGGE gel was dyed in 0.5 mg/mL
ethidium bromide for 30 min and photographed under ultraviolet
light by Gel Logic 212 transilluminator (Carestream Health Inc.,
Rochester, NY, USA). BioNumerics version 7.5 software
(Applied Maths, Sint-Martens-Latem, Belgium) was used to
analyse the similarity of bands by using the Dice similarity
coefficient at 0.5% optimisation and 1% tolerance.
The dominant bands were cut with sterile knives under UV
light and incubated at 4C for 12 h in 50 mL of 1 · Tris-EDTA
buffer (10 mM TRIS–HCl, 1 mM EDTA, pH 8.0). After that, 2
mL was aspirated to perform a PCR by using primer 341F,
534R without GC clamp (341F: 50 -CCTACGGGAGGCA
GCAG-30 ; 534R: 50 -ATTACCGCGGCTGCTGG-30 ) to
amplify DNA fragments (193 bp) before sequencing by the
dideoxynucleotide method (Sanger et al. 1977). The closest
related bacterial sequences were determined by BLAST from
NCBI (http://www.ncbi.nlm.nih.gov) and the PCR–DGGE
profile was analysed as described by Hernandez-Sanabria
et al. (2010).
Statistical analyses
The nucleotide sequences were compared with the GenBank at
http://www.ncbi.nlm.gov/BLAST, from which the genetic
diversity of rumen microflora was assessed. Data were
analysed using the chi-square method in Minitab version
16.0 (Minitab 2010).
Results
Effects of protein and energy supplements on rumen
microbial community
On the basis of the position of the bands on the gel samples,
62 bands were identified in total (Fig. 1). To describe the
taxonomical classification of the bands, all of them were
D Animal Production Science N. T. Ngu et al.

C2

C2+FO
89
C2+SO

88 C1+U
C1+SM
99
83 C1

C1+BFM

Fig. 1. PCR–DGGE banding profiles of the rumen bacterial 16S rRNA gene (V3 region). C1, Hymenachne acutiglum grass, rice straw and
rice bran (1.5 kg/head.day); U, urea (120 g/head.day); SM, soybean meal (720 g/head.day); BFM, 50% blood meal and 50% feather meal
mixture (720 g/head.day); C2, Hymenachne acutiglum grass, rice straw and concentrate (1.5 kg/head.day); FO, fish oil (250 g/head.day); SO,
soybean oil (250 g/head.day).

Table 2. Composition of bacterial species in different diets

+, present; –, not present; C1, Hymenachne acutiglum grass, rice straw and rice bran (1.5 kg/head.day); U, urea (120 g/head.day); SM, soybean meal (720 g/head.
day); BFM, 50% blood meal and 50% feather meal mixture (720 g/head.day); C2, Hymenachne acutiglum grass, rice straw and concentrate (1.5 kg/head.day);
FO, fish oil (250 g/head.day); SO, soybean oil (250 g/head.day)

Classification Protein supplement Energy supplement

Phylum Class Nearest genus (GenBank accession No) C1 C1 + U C1 + SM C1 + BFM C2 C2 + FO C2 + SO
Bacteroidetes Bacteroidia Prevotella (LT007897.1; LT007537.1; + + + + – + +
KY468482.1)
Bacteroidetes Cytophagia Cytophaga (KJ785895.1) – – – – + – –
Bacteroidetes Flavobacteria Capnocytophaga (LT678706.1) – – – + – – –
Bacteroidetes Flavobacteria Galbibacter (AB681503.1; NR_114009.1; – – – – + + +
NR_041450.1)
Cyanobacteria Cyanobacteria Cyanobacterium (GQ848172.1) + + + + – – –
Firmicutes Clostridia Catonella (KR493919) + – – – – – –
Firmicutes Clostridia Faecalibacterium (KF452298.1) – – – – + – –
Firmicutes Clostridia Lachnospiraceae (KP101965.1; EF709062.1) + – + + – – –
Firmicutes Clostridia Moorella glycerini (NR_029198.1) – – – – + + +
Firmicutes Clostridia Ruminococcaceae (KF502567.1) + + – – – – –
Proteobacteria Gamma-proteobacteria Escherichia coli (KY765033.1) – – – – + + +
Proteobacteria Gamma-proteobacteria Klebsiella alba (KX583581.1) – – – – + + +
Proteobacteria Betaproteobacteria Propionivibrio (LT698564.1) – + – + – – –

filtered, amplified and sequenced. From the sequence of
35 PCR–DGGE bands, 13 bacterial genera were identified
(Table 2). Of the 13 genera, Prevotella, Cyanobacterium,
Lachnospiraceae, Ruminococcaceae and Propionivibrio
were commonly found in animals fed diets with protein
supplements, while Prevotella, Galbibacter, Moorella
glycerin, Escherichia coli and Klebsiella alba were found in
cattle supplemented with different energy sources.
Identification of bacteria present: class classification
Different protein sources in the diet did not affect Bacteroidia
and Cyanobacteria classes (Table 3), while diets supplemented
with various energy sources influenced most of the bacterial
classes with the exception of Flavobacteria. Two groups,
namely Cyanobacteria and Betaproteobacteria, were present
in cattle receiving all protein-supplemented diets, but not in
those receiving the energy-supplemented diets, while bacteria
from the Flavobacteria were found to exist only in 28.6–42.9%
of the cattle in the energy-supplemented groups.
The results also showed that Clostridia is the dominant
class in the rumen of cattle in the C1 diet group, and
outperformed the other diets when supplemented with
SM. However, Bacteroidia was predominant in cattle
receiving the diet with urea supplementation.
For energy-supplemented diets (Table 3), Gamma-
proteobacteria was the most abundant bacterial class in the cattle
receiving fish oil diet, whereas Flavobacteria was dominant in
the soybean oil-supplemented diet group. In addition, it was
shown that supplementation of energy significantly increased
(P < 0.05) Bacteroidia by 20.0% and 14.3% respectively, for
the FO- and SO-supplemented groups, compared with the
basal diet (C2), while supplementation with different
sources of protein did not influence this bacterial group.
Identification of bacteria present in phylum classification
The results in Table 4 imply that irrespective of the diet,
Bacteroidetes, Firmicutes and Proteobacteria were the most
common groups in the rumen. The presence of Firmicutes
Bacteria community in rumen of cattle Animal Production Science E

Table 3. Percentage of ruminal bacterial classes in cattle supplemented with different protein and energy sources
C1, Hymenachne acutiglum grass, rice straw and rice bran (1.5 kg/head.day); U, urea (120 g/head.day); SM, soybean meal (720 g/head.day); BFM, 50% blood
meal and 50% feather meal mixture (720 g/head.day); C2, Hymenachne acutiglum grass, rice straw and concentrate (1.5 kg/head.day); FO, fish oil (250 g/head.
day); SO, soybean oil (250 g/head.day)

Source of Diet Percentage of ruminal bacteria

supplement Bacteroidia Flavobacteria Clostridia Cyanobacteria Betaproteobacteria Cytophagia Gamma-proteobacteria
Protein C1 28.6 0.0 42.9 14.3 14.3 – –
C1 + U 42.9 0.0 14.3 14.3 28.6 – –
C1 + SM 28.6 0.0 42.9 14.3 14.3 – –
C1 + BFM 28.6 14.3 28.6 14.3 14.3 – –
P-value 0.019 0.001 0.001 1.000 0.036 – –
Energy C2 0.0 28.6 28.6 – – 14.3 28.6
C2 + FO 20.0 30.0 10.0 – – 0.0 40.0
C2 + SO 14.3 42.9 28.6 – – 0.0 14.3
P-value 0.001 0.160 0.006 – – 0.001 0.002

Table 4. Ruminal phylum (%) of bacteria in cattle supplemented with different protein and energy sources
ND, not detected; C1, Hymenachne acutiglum grass, rice straw and rice bran (1.5 kg/head.day); U, urea (120 g/head.day); SM, soybean meal (720 g/head.day);
BFM, 50% blood meal and 50% feather meal mixture (720 g/head.day); C2, Hymenachne acutiglum grass, rice straw and concentrate (1.5 kg/head.day); FO, fish
oil (250 g/head.day); SO: soybean oil (250 g/head.day)

Source of supplement Diet Phylum

Bacteroidetes Cyanobacteria Firmicutes Proteobacteria Unclassified bacteria
Protein C1 28.6 14.3 42.9 14.3 0.0
C1 + U 37.5 12.5 12.5 37.5 12.5
C1 + SM 25.0 12.5 37.5 25.0 12.5
C1 + BFM 33.3 11.1 22.2 33.3 11.1
P-value 0.411 0.940 0.001 0.010 0.007
Energy C2 27.3 0.0 18.2 18.2 36.4
C2 + FO 41.7 0.0 8.3 33.3 16.7
C2 + SO 44.4 0.0 22.2 11.1 22.2
P-value 0.106 Not determined 0.043 0.002 0.016

was as high as 42.9% and 37.5%, in the C1 and C1 + SM diet
groups respectively. However, this group of bacteria reduced
significantly (P < 0.05) in cattle receiving diets supplemented
with urea (C1 + U), blood meal (C1 + BM) and feather meal
(C1 + FM). In contrast, the Proteobacteria group in cattle
receiving diets supplemented with urea, SM, and BFM
increased compared with that in the control C1 diet group
(no protein supplementation; P < 0.05).
The populations of Bacteroidetes bacteria in the FO and SO
diet groups were not different from those in the C2 diet group
(P > 0.05). Cyanobacteria were not present in animals
receiving diets with the addition of either fish oil or
soybean oil. For Firmicutes bacteria, the number in the
soybean oil-supplemented diet group was higher (P < 0.05)
than that in the fish oil and C2 diet groups, while the
Proteobacteria population was higher (P < 0.05) in the fish
oil diet group than in the other diet treatment groups.
Microbial diversity with dietary supplements
Figure 2 presents the common abundance of Bacteroidia and
Clostridia groups of bacteria in the rumen. Clostridia was
found in all experimental diet groups, with the highest number
(P < 0.05) occurring in the C1 treatment. Also, Bacteroidia was
present in all seven diet groups, with the exception that no
Bacteroidia was found in the cattle receiving C2 diet. In
contrast, the Cytophagia class was found only in the C2
diet group.
Cyanobacteria was found only in the rumens in the protein-
supplementation experiment. Similarly, Betaproteobacteria
was also found only in the protein-supplementation
experiment. Flavobacteria were found mainly in the energy-
supplemented experimental group, with the highest percentage
in the SO diet group (38.0%), followed by the FO and C2 diet
groups, and the lowest percentage belonging to the BFM in the
protein-supplementation experiment (12.7%; P < 0.05).
Discussion
Results of our study showed that diet has a strong influence on
the variability of the bacterial groups in the rumen of cattle,
and each diet had its dominating well adapted bacterial groups.
Firmicutes (Gram-positive bacteria) and Bacteroidetes (Gram-
negative bacteria) were the two most common phyla in the
rumen, with a higher percentage of Firmicutes phylum
occurring in animals fed the protein-supplemented diets,
F Animal Production Science N. T. Ngu et al.

7.9 100 12.7

20.3
11.8
38.1

20.7
15.8

26.6

17.6 28.5
Bacteroidia Cytophagia Flavobacteria

13.6
22.1 17.7 22.7
28.3 26.2
5.1

11.1
19.9
7.8
24.8
24.8 13.6
39.7
22.8
Cyanobacteria Clostridia Beta-Proteobacteria

17.7 10.2
18.1 C1
29.0
10.2 C1+U

C1+SM
13.6
C1+BFM
18.1
C2

53.3
C2+FO
29.8
Gamma-Proteobacteria Unclassified bacteria C2+SO

Fig. 2. Percentages of bacterial groups present in the rumen of cattle supplemented with different protein and
energy sources.

while the Bacteroidetes phylum was more prevalent in the
energy-supplemented diet groups. The sequencing results of
DNA bands showed a relationship with non-cultured bacteria,
including the bacteria belonging to Prevotella, Cytophaga,
Capnocytophaga, Galbibacter, Cyanobacterium, Catonella,
Faecalibacterium, Lachnospiraceae, Moorella glycerin,
Ruminococcaceae, Escherichia coli, Klebsiella alba and
Propionivibrio groups, with the similarity of 73.0–96.0%.
Among the bacterial groups, Prevotella (Bacteroidetes
phylum) appeared in both protein- and energy-supplemented
diet groups, which is not surprising because Prevotella is a
dominant bacterial population found in the rumen associated
with rumen fermentation (Hernandez-Sanabria et al. 2010;
Huws et al. 2010). It is directly involved in the breakdown of
proteins into peptides and ammonia-nitrogen used as a source
of nitrogen (Firkins 2010), and also plays a role in breaking
down hemicellulose in the rumen (Solden et al. 2018) and in
the production of volatile fatty acids as energy sources for the
host (Boeckaert et al. 2008). According to Liu et al. (2017),
many species of Prevotella are recognised for their
involvement in the breakdown of hemicellulose, pectin,
starch and protein, and different Prevotella species use
different substrate sources; thus, dietary changes may not
always make a difference for the abundance of Prevotella.
Our results showed the presence of Prevotella species in both
the protein- and energy-diet groups and this is in agreement
with reports of Boeckaert et al. (2008) and Petri et al. (2013) in
that Prevotella is the predominant genus in the rumen.
Among the bacterial groups found in the present study,
Capnocytophaga, Cyanobacterium, Catonella, Lachnospiraceae,
Ruminococcaceae and Propionivibrio were not present in the
energy-supplemented diet groups. It has been previously
reported that Lachnospiraceae and Ruminococcaceae
(belonging to the Firmicutes phylum) use substrates from
plant polysaccharides and, when a high level of energy is
added to the diets, the abundance of these two bacterial groups
decreases dramatically (Parmar et al. 2014). The above
supports the present finding that none of the above two
species was found in the energy-supplemented diet groups.
A similar explanation could be drawn to explain for the other
missing bacterial genera with the inclusion of fish oil, as oil has
been demonstrated to be toxic to certain ruminal bacteria
(Maia et al. 2007).
In general, Firmicutes and Bacteroidetes are two dominant
phylum groups in the rumen (Parmar et al. 2014). However,
the reported ratios between these two groups differ greatly.
Cremonesi et al. (2018), for example, reported that
Bacteroidetes phylum made up 61.2%, with the Firmicutes
population accounting only for the remaining 24.2%.
Similarly, it was reported that feeding dairy cows with
Bacteria community in rumen of cattle
different forage diets resulted in a higher population of
Bacteroidetes (80%) than of Firmicutes (10%; Pitta et al.
2014), but other studies have demonstrated that high-fibre
diets increase Firmicutes and reduce Bacteroidetes
populations (Edwards et al. 2004; Purushe et al. 2010). The
contradicting results between different studies could partly be
due to the sampling protocol, because Bacteroidetes phylum
was reported to predominate across many sampling types,
while Firmicutes phylum was available mostly in solid
samples (Parnell and Reimer 2012; Nathani et al. 2015).
Our results are in agreement with the above reports, as
Firmicutes and Bacteroidetes were abundant in the rumen.
Specifically, our results showed that the Firmicutes group
consisting of Catonella, Lachnospiraceae, and
Ruminococcaceae and Bacteroidetes group consisting of
Prevotella and Capnocytophaga were present in the protein-
supplemented animals (first experiment), while in the energy-
supplemented animals (second experiment), the Firmicutes
consisted only of Faecalibacterium and Moorella glycerin
and most of the Bacteroidetes were Prevotella, Cytophaga
and Galbibacter. These findings may imply that bacteria from
Firmicutes outnumber those from Bacteroidetes in diet groups
with protein supplementation and Bacteroidetes are more
abundant in energy-supplemented diet groups.
According to Cabrita et al. (2011), one requirement in
formulating a daily ration for cattle is how protein is
provided through the various feed ingredients. Protein can
be supplemented in the form of oilseed meals (cottonseed
meal, SM), high-protein seeds (cottonseed, peas, soybeans) or
by-product feeds such as fish meal, feather meal, and biofuel
co-products (Huston et al. 2002). However, protein feed is
almost always more expensive than energy feed; thus, urea, a
non-protein nitrogen source, is commonly used in ruminant
diets as an economical alternative to dietary protein (Kertz
2010). Today, urea has been included in ruminant diets to
provide sufficient nitrogen for microbial protein synthesis and
improve rumen fermentation (Ceconi et al. 2015). According
to Wallace (1994), many species of bacteria are involved in the
breakdown of proteins with three species of the Bacteroidetes
group (Bacteroides ruminicola, B. amylophilus and
B. fibrisolvens) being considered the main proteolytic
organisms. Supporting this assumption, when supplementing
with different protein sources (urea, SM and BFM), results of
our study also showed that Bacteroidetes group was present at
a high rate in all protein supplementations, with 37.5%, 25.0%
and 33.3% respectively for the urea, SM and BFM
(Table 4). Besides, according to Jin et al. (2017), when
urea was added to the diet of Holstein dairy cows, the
presence of Proteobacteria group was found to range from
22.4% to 31.9%, which was higher than for Firmicutes group
(11.1–20.2%). Similarly, our results also indicated that
Proteobacteria group (37.5%) was present at a higher
percentage than was Firmicutes group, with only 12.5% in
the diet, with urea inclusion. However, a high proportion
(37.5%) of Bacteroidetes group was found in the present
work, while only 0.2–0.8% Bacteroidetes were reported in
the study of Jin et al. (2017).
Oil is added to cattle diets with the aim to increasing the
energy density of the ration. However, dietary oil supplements
Animal Production Science G
can also be used to manipulate the microbial community and
fermentation processes in the rumen. A study using mice as
an animal model showed that supplementation with
polyunsaturated fatty acids increased the Bacteroidetes:
Firmicutes ratio (Liu et al. 2017). In Experiment 2 of our
study, oil supplement increased the abundance of phylum
Bacteroidetes, and with a reduction in the abundance of
phylum Firmicutes, resulted in a Bacteroidetes:Firmicutes
ratio of 1.5, 5.0 and 2.0 respectively, in the control, fish
oil-supplemented, and soybean oil-supplemented treatments.
More specifically, the observed increase in the abundance of
phylum Bacteroidetes was due to an increase in the abundance
of genus Prevotella (Table 3). This is in agreement with the
study of Vargas et al. (2017), who also reported that oil
supplement increased the abundance of genus Prevotella.
While both fish oil and soybean oil are effective in
increasing the abundance of Prevotella community, fish oil
supplement resulted in an additional benefit of reducing the
abundance of bacteria belonging to Clostridia group, whereas
soybean oil supplement increased the abundance of Clostridia
group (Fig. 2). Fish oils are rich in omega 3 fatty acids, as
opposed to soybean oils that are rich in omega 6 fatty acids,
and omega 6 fatty acids have been shown to enrich pro-
inflammatory microbes, including Clostridia, in mice; this
can be reversed through supplementation of omega 3 rich
oil (Ghosh et al. 2013). Thus, it is evident from the results of
the present study that oils from different sources have different
impacts on rumen microbial diversity. These results are
interesting because they also highlighted the importance of
choosing the type of oil when formulating the feed ration, not
just to meet the nutritional requirement, but also to take into
accounts the impact on the livestock health, as well as
producing meat and milk containing the desired beneficial
fatty acids.
Conclusions
In conclusion, rumen microflora in cattle are affected by the
sources of protein and energy, with Firmicutes and
Bacteroidetes being the two dominant groups. Bacteroidia
and Clostridia classes, together with the Prevotella genus,
are dominant in the rumen irrespective of protein and energy
sources. Another possible effect is that bacteria from
Firmicutes outnumber those from Bacteroidetes in animals
fed diets with protein supplementation, while the reverse is
true in energy-supplemented diet groups.
Conflicts of interest
The authors declare no conflicts of interest.
Acknowledgements
This research was funded by the Vietnam National Foundation for Science
and Technology Development (NAFOSTED) under grant number 106-
NN.05-2013.04.
References
Boeckaert C, Vlaeminck B, Fievez V, Maignien L, Dijkstra J, Boon N
(2008) Accumulation of trans C18:1 fatty acids in the rumen after
dietary algal supplementation is associated with changes in the
H Animal Production Science
Butyrivibrio community. Applied and Environmental Microbiology
74, 6923–6930. doi:10.1128/AEM.01473-08
Cabrita ARJ, Dewhurst RJ, Melo DSP, Moorby JM, Fonseca AJM (2011)
Effects of dietary protein concentration and balance of absorbable
amino acids on productive responses of dairy cows fed corn silage-
based diets. Journal of Dairy Science 94, 4647–4656. doi:10.3168/
jds.2010-4097
Ceconi I, Ruiz-Moreno MJ, DiLorenzo N, DiCostanzo A, Crawford GI
(2015) Effect of urea inclusion in diets containing corn dried distillers
grains on feedlot cattle performance, carcass characteristics, ruminal
fermentation, total tract digestibility, and purine derivatives-
to-creatinine index. Journal of Animal Science 93, 357–369.
doi:10.2527/jas.2014-8214
Cremonesi P, Conte G, Severgnini M, Turri F, Monni A, Capra E, Rapetti
L, Colombini S, Chessa S, Battelli G (2018) Evaluation of the effects
of different diets on microbiome diversity and fatty acid composition
of rumen liquor in dairy goat. Animal 12, 1856–1866. doi:10.1017/
S1751731117003433
Cui K, Qi M, Wang S, Diao Q, Zhang N (2019) Dietary energy and protein
levels influenced the growth performance, ruminal morphology and
fermentation and microbial diversity of lambs. Scientific Reports 9,
16612. doi:10.1038/s41598-019-53279-y
de Menezes AB, Lewis E, O’Donovan M, O’Neill BF, Clipson N, Doyle EM
(2011) Microbiome analysis of dairy cows fed pasture or total mixed
ration diets. FEMS Microbiology Ecology 78, 256–265. doi:10.1111/
j.1574-6941.2011.01151.x
Dei HK (2011) Soybean as a feed ingredient for livestock and poultry. In
Recent trends for enhancing the diversity and quality of soybean
products. (Ed. D Krezhova) pp. 215–226. (InTech Open Access
Publisher: Rijeka)
Edwards JE, McEwan NR, Travis AJ, Wallace RJ (2004) 16S rDNA
library-based analysis of ruminal bacterial diversity. Antonie van
Leeuwenhoek 86, 263–281. doi:10.1023/B:ANTO.0000047942.
69033.24
Ellison MJ, Conant GC, Cockrum RR, Austin KJ, Truong H, Becchi M,
Lamberson WR, Cammack KM (2014) Diet alters both the structure
and taxonomy of the ovine gut microbial ecosystem. DNA Research
21, 115–125. doi:10.1093/dnares/dst044
Firkins JL (2010) Reconsidering rumen microbial consortia to enhance
feed efficiency and reduce environmental impact of ruminant livestock
production systems. Revista Brasileira de Zootecnia 39, 445–457.
doi:10.1590/S1516-35982010001300049
Ghosh S, DeCoffe D, Brown K, Rajendiran E, Estaki M, Dai C, Yip A, Gibson
DL (2013) Fish oil attenuates omega-6 polyunsaturated fatty acid-
induced dysbiosis and infectious colitis but impairs LPS
dephosphorylation activity causing sepsis. PLoS One 8, e55468.
doi:10.1371/journal.pone.0055468
Guan LL, Nkrumah JD, Basarab JA, Moore SS (2008) Linkage of
microbial ecology to phenotype: correlation of rumen microbial
ecology to cattle’s feed efficiency. FEMS Microbiology Letters 288,
85–91. doi:10.1111/j.1574-6968.2008.01343.x
Hernandez-Sanabria E, Goonewardene LA, Li M, Mujibi DF, Stothard P,
Moore SS, Leon-Quintero MC (2010) Correlation of particular bacterial
PCR-denaturing gradient gel electrophoresis patterns with bovine
ruminal fermentation parameters and feed efficiency traits. Applied
and Environmental Microbiology 76, 6338–6350. doi:10.1128/
AEM.01052-10
Huston JE, Rouquette Jr FM, Ellis WC, Lippke H, Forbes TDA (2002)
‘Supplementation of grazing beef cattle.’ Technical Monograph-12.
(Texas Agricultural Experiment Station, TAMU: College Station)
Huws SA, Lee MRF, Muetzel SM, Scott MB, Wallace RJ, Scollan ND
(2010) Forage type and fish oil cause shifts in rumen bacterial
diversity. FEMS Microbiology Ecology 73, 396–702. doi:10.1111/
j.1574-6941.2010.00892.x
N. T. Ngu et al.
Jin D, Zhao S, Zheng N, Bu D, Beckers Y, Denman SE, McSweeney CS,
Wang J (2017) Differences in ureolytic bacterial composition between
the rumen digesta and rumen wall based on ureC gene classification.
Frontiers in Microbiology 8, 385. doi:10.3389/fmicb.2017.00385
Kertz AF (2010) Urea feeding to dairy cattle: a historical perspective and
review. The Professional Animal Scientist 26, 257–272. doi:10.15232/
S1080-7446(15)30593-3
Li XZ, Yan CG, Choi SH, Long RJ, Jin GL, Song MK (2009) Effects of
addition level and chemical type of propionate precursors in
dicarboxylic acid pathway on fermentation characteristics and
methane production by rumen microbes in vitro. Asian–
Australasian Journal of Animal Sciences 22, 82–89. doi:10.5713/
ajas.2009.80413
Lillis L, Boots B, Kenny DA, Petrie K, Boland TM, Clipson N, Doyle EM
(2011) The effect of dietary concentrate and soya oil inclusion on
microbial diversity in the rumen of cattle. Journal of Applied
Microbiology 111, 1426–1435. doi:10.1111/j.1365-2672.2011.
05154.x
Liu K, Xu Q, Wang L, Wang J, Guo W, Zhou M (2017) The impact of diet on
the composition and relative abundance of rumen microbes in goat.
Asian–Australasian Journal of Animal Sciences 30, 531–537.
doi:10.5713/ajas.16.0353
Maia MRG, Chaudhary LC, Figueres L, Wallace RJ (2007) Metabolism of
polyunsaturated fatty acids and their toxicity to the microflora of the
rumen. Antonie van Leeuwenhoek 91, 303–314. doi:10.1007/
s10482-006-9118-2
Minas K, McEwan NR, Newbold CJ, Scott KP (2011) Optimization of a
high-throughput CTAB-based protocol for the extraction of qPCR-
grade DNA from rumen fluid, plant and bacterial pure cultures. FEMS
Microbiology Letters 325, 162–169. doi:10.1111/j.1574-6968.2011.
02424.x
Minitab (2010) Minitab Software Release 16.1.1.0. Minitab Inc., 3081
Enterprise Drive. State College PA, USA
Muyzer G, Smalla K (1998) Application of denaturing gradient gel
electrophoresis (DGGE) and temperature gradient gel electrophoresis
(TGGE) in microbial ecology. Antonie van Leeuwenhoek 73, 127–141.
doi:10.1023/A:1000669317571
Nathani NM, Patel AK, Mootapally CS, Reddy B, Shah SV, Lunagaria
PM, Kothari RK, Joshi CG (2015) Effect of roughage on rumen
microbiota composition in the efficient feed converter and sturdy
Indian Jaffrabadi buffalo (Bubalus bubalis). BMC Genomics 16,
1116. doi:10.1186/s12864-015-2340-4
NRC (1996) ‘Nutrient requirements of beef cattle.’ 7th rev. edn. (National
Academies Press: Washington, DC, USA)
Parmar NR, Solanki J V, Patel AB, Shah TM, Patel AK, Parnerkar S, Ji
NK, Joshi CG (2014) Metagenome of Mehsani buffalo rumen
microbiota: an assessment of variation in feed-dependent
phylogenetic and functional classification. Journal of Molecular
Microbiology and Biotechnology 24, 249–261. doi:10.1159/
000365054
Parnell AJ, Reimer AR (2012) Prebiotic fiber modulation of the gut
microbiota improves risk factors for obesity and the metabolic
syndrome. Gut Microbes 3, 29–34. doi:10.4161/gmic.19246
Petri RM, Schwaiger T, Penner GB, Beauchemin KA, Forster RJ, McKinnon
JJ, McAllister TA (2013) Changes in the rumen epimural bacterial
diversity of beef cattle as affected by diet and induced ruminal
acidosis. Applied and Environmental Microbiology 79, 3744–3755.
doi:10.1128/AEM.03983-12
Pitta DW, Kumar S, Vecchiarelli B, Shirley DJ, Bittinger K, Baker LD,
Ferguson JD, Thomsen N (2014) Temporal dynamics in the ruminal
microbiome of dairy cows during the transition period. Journal of
Animal Science 92, 4014–4022. doi:10.2527/jas.2014-7621
Purushe J, Fouts DE, Morrison M, White BA, Mackie RI, Coutinho PM,
Henrissat B, Nelson KE (2010) Comparative genome analysis of
Bacteria community in rumen of cattle
Prevotella ruminicola and Prevotella bryantii: insights into their
environmental niche. Microbial Ecology 60, 721–729. doi:10.1007/
s00248-010-9692-8
Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain
terminating inhibitors. Proceedings of the National Academy of
Sciences USA 74, 5463–5467. doi:10.1073/pnas.74.12.5463
Solden LM, Naas AE, Roux S, Daly RA, Collins WB, Nicora CD, Purvine
SO, Hoyt DW, Schückel J, Jørgensen B (2018) Interspecies cross-
feeding orchestrates carbon degradation in the rumen ecosystem.
Nature Microbiology 3, 1274–1284. doi:10.1038/s41564-018-0225-4
Van OM, Dulphy JP, Baumont R (1995) The effect of protein degradation
products in grass silages on feed intake and intake behaviour in sheep.
British Journal of Nutrition 73, 51–64. doi:10.1079/BJN19950008
Vargas JE, Andrés S, Snelling TJ, López-Ferreras L, Yáñez-Ruíz DR,
García-Estrada C, López S (2017) Effect of sunflower and marine oils
on ruminal microbiota, in vitro fermentation and digesta fatty acid
profile. Frontiers in Microbiology 8, 1124. doi:10.3389/fmicb.
2017.01124
Wallace RJ (1994) Amino acid and protein synthesis, turnover, and
breakdown by ruminal microorganisms. In ‘Principles of Protein
www.publish.csiro.au/journals/an
Animal Production Science I
Nutrition of Ruminants’. (Ed. JM Asplund) pp. 71–111. (CRC Press:
Boca Raton, FL, USA)
Wang HR, Wang MZ, Yu LH (2009) Effects of dietary protein sources on the
rumen microorganisms and fermentation of goats. Journal of Animal and
Veterinary Advances 7, 1392–1401.
Wetzels SU, Mann E, Metzler-Zebeli BU, Wagner M, Klevenhusen F,
Zebeli Q, Schmitz-Esser S (2015) Pyrosequencing reveals shifts in the
bacterial epimural community relative to dietary concentrate amount
in goats. Journal of Dairy Science 98, 5572–5587. doi:10.3168/
jds.2014-9166
Xiaokang LV, Cui K, Qi M, Wang S, Diao Q, Zhang N (2020) Ruminal
microbiota and fermentation in response to dietary protein and energy
levels in weaned lambs. Animals 10, 109. doi:10.3390/ani10010109
Zhang C, Yuan Q, Lu Y (2014) Inhibitory effects of ammonia on
methanogen mcrA transcripts in anaerobic digester sludge. FEMS
Microbiology Ecology 87, 368–377. doi:10.1111/1574-6941.12229
Handling editor: Karen Harper
 Join U
Advances in Animal and CiteScore
SCOPUS
2020

Veterinary Sciences
Search
0.7
Submit or Track your Manuscript LOG-IN

Home Authors Reviewers Editorial Workflow About Us eAlerts Contact Us

Current Issue

About the Journal

Case Report Submit to
Advances In Animal And
Management of Spinal Osteochondroma in Young Golden Retriever Dog Veterinary Sciences
Editorial Board
Neeranoot Detcharoenyos, Nakrob Pattanapon, Soontaree Petchdee
Current Issue Adv. Anim. Vet. Sci., Vol. 10, Iss. 7, pp. 1513-1517 Review for
Advances In Animal And
Archive Abstract | Full Text | PDF | ePUB | FLIP | DOI | Figures |
Veterinary Sciences

Processing Charges Research Article

Author Guidelines Microencapsulated Symbiotic and Phytosteroids to Enhance Reproductive pattern in

Male Albino Rats
Abstracting & Indexing Emtenan M. Hanafi, Fouad M. Tawfeek, Walid S. El Nattat, Moetazza M. Alshafei, Seham S.
Kassem, Kawkab A. Ahmed, Enas N. Danial, Hagar Elbakry, Hoda S. El-Sayed
Editorial Workflow
Adv. Anim. Vet. Sci., Vol. 10, Iss. 7, pp. 1423-1433

Publishing Ethics Abstract | Full Text | PDF | ePUB | FLIP | DOI | Figures |

Policies Efficiency of Feeding Sesban Hay as a Replacement for Clover Hay on Growth
Performance and Semen Quality of Sheep
Statements Abd El-Moniem Ali S. Mahgoub, Ahmed Mohamed Abd El-Hafeez, Mahmoud Yassin Mohamed, Al-
Moataz Bellah Mahfouz Shaarawy, Mohamed Ibrahim Nassar
Contact Information Adv. Anim. Vet. Sci., Vol. 10, Iss. 7, pp. 1434-1443

Subscription Abstract | Full Text | PDF | ePUB | FLIP | DOI |

Join Us Comparative Effects of Phyllanthus niruri and Plantago major in Carbon

Tetrachloride Intoxicated Rats
Submit Online at Asmaa Khamis, Osama Abdalla, Mohamed Hashem, Noha Abdelnaeim
Adv. Anim. Vet. Sci., Vol. 10, Iss. 7, pp. 1444-1450

Abstract | Full Text | PDF | ePUB | FLIP | DOI | Figures |

The Impact of Dietary Fermented Seaweed (Turbinaria murayana) with Fruit

Indigenous Micro Organism’s (IMO’s) as a Starter on Broiler Performance, Carcass
Special Issues Yield and Giblet Percentage
Sepri Reski, Maria Endo Mahata, Ridho Kurniawan Rusli
Open Special Issues
Adv. Anim. Vet. Sci., Vol. 10, Iss. 7, pp. 1451-1457

Call for Special Issues Abstract | Full Text | PDF | ePUB | FLIP | DOI |

Special Issue Guidelines Antischistosomal Activity of Trigonella foenum (Fenugreek) Crude Seeds Water
Extract on Infected Mice
Published Special Issues Gamalat Y. Osman, Elham M. Hassan, Tarek A. Salem, Azza H. Mohamed

Adv. Anim. Vet. Sci., Vol. 10, Iss. 7, pp. 1458-1465

Membership/Association
Abstract | Full Text | PDF | ePUB | FLIP | DOI | Figures |

Evaluation of Hemato-Biochemical Parameters, Histopathological Altration and

Antioxidant Trace Elements in Demodicosis Infected Dogs
Noha M El-Motaily, Ossama M Abdou, Heba S Farag, Kawkab A Ahmed, Mahmoud Saber
 Adv. Anim. Vet. Sci., Vol. 10, Iss. 7, pp. 1466-1472

Abstract | Full Text | PDF | ePUB | FLIP | DOI | Figures |

Using of Autoregressive Integrated Moving Average (ARIMA) Model for Forecasting

Milk Production of Dairy Cattle Farms in Dakahlia Governarate of Egypt
Asmaa A. Badr, Eman A. Abo Elfadl, Mohammed M. Fouda, Sayed M. Elsayed
Adv. Anim. Vet. Sci., Vol. 10, Iss. 7, pp. 1473-1480

Abstract | Full Text | PDF | ePUB | FLIP | DOI | Figures |

Phylogenetic and Histopathological Characterization of Newcastle Disease Virus

(VII.1.1) Recently Isolated from Naturally Infected Quails in Egypt
Mohamed Lebdah, Sahar Abd El Rahman, Ahmed Attia, Reham Karam, Naglaa Fathy Saeed
Awad, Mohamed Ibrahim El Bagoury
Adv. Anim. Vet. Sci., Vol. 10, Iss. 7, pp. 1481-1491

Abstract | Full Text | PDF | ePUB | FLIP | DOI | Figures |

Hepato Renal Protective Effect of Origanum Majorana against Adverse Effect of

Ivermectin in Rabbits
Ahmed Mohamed Elmahdy, Naglaa Mohammed Alkalamawy

Adv. Anim. Vet. Sci., Vol. 10, Iss. 7, pp. 1492-1503

Abstract | Full Text | PDF | ePUB | FLIP | DOI | Figures |

Metabolomics of Periparturient Holstein-Friesian Cows Associated with Feeding a

Negative Dietary Cation-Anion Difference (DCAD)
Asaad A. Fares, Mohamed M. Ghanem, Yasein M. Abd El-Raof, Hossam M. El-Attar, Ameer A.
Megahed, Heba M. El-Khaiat

Adv. Anim. Vet. Sci., Vol. 10, Iss. 7, pp. 1504-1512

Abstract | Full Text | PDF | ePUB | FLIP | DOI | Figures |

Application of Phages to Control Escherichia coli Infections in Native Noi Chickens

Luu Huynh Anh, Huynh Tan Loc, Nguyen Hong Xuan, Le Minh Thanh, Trinh Thi Hong Mo, Ly Thi
Thu Lan, Nguyen Trong Ngu

Adv. Anim. Vet. Sci., Vol. 10, Iss. 7, pp. 1518-1524

Abstract | Full Text | PDF | ePUB | FLIP | DOI | Figures |

Fecal, Milk, Uterine, Airborne Dust, and Water Microbiota in Dairy Farms in Southern
Vietnam: A Pilot Study
Tu Thi Minh Tran, Diep Hoang Tran, Thuong Thi Nguyen, Tomas J. Acosta, Takeshi Tsuruta, Naoki
Nishino, Hai Thanh Duong
Adv. Anim. Vet. Sci., Vol. 10, Iss. 7, pp. 1525-1531

Abstract | Full Text | PDF | ePUB | FLIP | DOI | Figures | Supplementary Material |

Gender Differences in Traditional Pig Farmers’ Socio-Demographics, Awareness, and

Attitudes Toward Reproductive Biotechnology in Zambia
Rubaijaniza Abigaba, Pharaoh C. Sianangama, Progress H. Nyanga, Edwell S. Mwaanga, Wilson
N.M. Mwenya
Adv. Anim. Vet. Sci., Vol. 10, Iss. 7, pp. 1532-1541

Abstract | Full Text | PDF | ePUB | FLIP | DOI | Figures |

Advances in Animal and Featuring Subscribe Today

Veterinary Sciences
June
Vol. 10, Iss. 6, Pages 1189-1422
Gender Differences in Traditional Pig Farmers’ Socio-Demographics,
Awareness, and Attitudes Toward Reproductive Biotechnology in Zambia
Receive free updates on new
Rubaijaniza Abigaba, Pharaoh C. Sianangama, Progress H. Nyanga, Edwell S.
articles, opportunities and
Mwaanga, Wilson N.M. Mwenya benefits
Adv. Anim. Vet. Sci., Vol. 10, Iss. 7, pp. 1532-1541 First Name
Fecal, Milk, Uterine, Airborne Dust, and Water Microbiota in Dairy Farms in First Name
Southern Vietnam: A Pilot Study
Last Name
Tu Thi Minh Tran, Diep Hoang Tran, Thuong Thi Nguyen, Tomas J. Acosta,
Takeshi Tsuruta, Naoki Nishino, Hai Thanh Duong Last Name
Adv. Anim. Vet. Sci., Vol. 10, Iss. 7, pp. 1525-1531
 Advances in Animal and Veterinary Sciences

Research Article

Application of Phages to Control Escherichia coli Infections in Native

Noi Chickens
Luu Huynh Anh1, Huynh Tan Loc2, Nguyen Hong Xuan3, Le Minh Thanh1, Trinh Thi Hong
Mo4, Ly Thi Thu Lan5, Nguyen Trong Ngu1*
1
Department of Animal Sciences, College of Agriculture, Can Tho University, Can Tho City, Vietnam; 2Department
of Veterinary Medicine, College of Agriculture, Can Tho University, Can Tho City, Vietnam; 3Department of Food
Technology, Faculty of Chemical Engineering, Bio and Food Technolgy, Can Tho University of Technology, Can
Tho City, Vietnam; 4Applied Biology Faculty, Tay Do University, Can Tho City, Vietnam; 5School of Agriculture and
Aquaculture, Tra Vinh University, Tra Vinh City, Vietnam.

Abstract | This study assessed the efficacy of two phages, MHH6 and PR2, against Escherichia coli serotype O6
infected in chickens. A total of 420 broilers were randomly assigned to seven treatment groups. The negative control
(NC) birds received no E. coli or phages, whereas the positive control (PC) birds were infected with E. coli only.
The NC+MHH6 and NC+PR2 treatments received 109 pfu/ml of phages MHH6 or PR2, respectively; whereas the
PC+MHH6, PC+PR2, and PC+MHH6PR2 groups were infected with 107.1 cfu/ml of E. coli strain O6 and treated
with 109 pfu/ml of phages of MHH6, PR2, or both. E. coli infection was inoculated in two-day-old chicks, and phages
were administered 24 hours later. The mortality rate of chickens in the PC+MHH6PR2 group was significantly lower
(16.7%) than in the PC group (58.3%). The frequency of lesions and E. coli densities in the heart, liver, and spleen of
chickens treated with MHH6 and PR2 phages were greatly decreased in infected chickens. After 98 days, the body
weight of birds from the E. coli-infected groups treated with MHH6 and PR2 phages was lower than individuals in
non-E. coli-infected groups (1,313-1,324 g/bird) but higher and significantly different from those in the PC group
(1,172 g/bird). The majority of commercially important traits in chickens improved after phage treatment, proving that
these phages are capable of controlling O6 E. coli infected in Noi chickens.

Keywords | Bacteriophage, Carcass characteristic, Chicken, E. coli, Growth performance

Received | March 03, 2022; Accepted | June 06, 2022; Published | June 20, 2022
*Correspondence | Nguyen Trong Ngu, Department of Animal Sciences, College of Agriculture, Can Tho University, Can Tho City, Vietnam; Email: ntngu@
ctu.edu.vn
Citation | Anh LH, Loc HT, Xuan NH, Thanh LM, Mo TTH, Lan LTT, Ngu NT (2022). Application of phages to control Escherichia coli infections in native
Noi chickens. Adv. Anim. Vet. Sci. 10(7):1518-1524.
DOI | https://dx.doi.org/10.17582/journal.aavs/2022/10.7.1518.1524
ISSN (Online) | 2307-8316

Copyright: 2022 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.
org/licenses/by/4.0/).

INTRODUCTION from poultry intestines and other mucosal surfaces, and

it is classed as a harmful bacterium for chicken, capable

I ncreased consumption of livestock products such as meat, of producing colibacillosis, a gastrointestinal disease.
milk, and eggs necessitates an increase in production by Antibiotics are frequently used to treat infections caused
animal producers to keep up with the demand. As a result, by bacteria; however, their efficacy is being questioned
large-scale livestock production systems are continually due to a rising number of antibiotic-resistant bacteria.
developing, with high stocking densities facilitating According to Nhung et al. (2017), the E. coli APEC strains
disease transmission and economic losses (Nhung et were resistant to ampicillin, amoxicillin, and tetracycline
al., 2017). Escherichia coli (E. coli) is regularly isolated at levels greater than 70% and ciprofloxacin, neomycin,
July 2022 | Volume 10 | Issue 7 | Page 1518
 Advances in Animal and Veterinary Sciences
and chloramphenicol at rates between 50% and 70%. dated on December 22, 2018.
Alternative strategies are required in this situation, one of
which is using bacteriophages (phages) to fight bacterial Bacteria and phages
infections (Rios et al., 2016). In the present study, the E. coli strain of serotype O6
was purchased from ATCC (American Type Culture
Numerous advantages make phage therapy an appealing Collection) (ATCC® 25922TM), and two phages, MHH6
option to antibiotics (Golkar et al., 2014). According to and PR2, were taken from our previous work (Ngu et al.,
Domingo et al. (2016), phages are selective for certain 2020).
bacteria, and phage therapy is deemed safe and effective
compared to antibiotics. This mechanism of action does Chickens and experimental procedure
not affect the proliferation of gut flora (Wernicki et The study was conducted on the experimental farm of
al., 2017; Cieplak et al., 2018). Additionally, because Can Tho University located at Campus IV, Phung Hiep
phages are abundant in nature, they can be isolated and district, Hau Giang province. Noi chickens were purchased
selected quickly in opposition to antibiotic synthesis, from Soc Trang breeding company and kept in-house with
which requires millions of dollars and years of research four cages per treatment. Each cage was outfitted with
to generate an effective antibiotic (Golkar et al., 2014). two drinking troughs and two feeding troughs. Water for
Phage supplementation has been proven to increase feed drinking was constantly accessible. Commercial feeds were
efficiency, body weight gain, pathogen reduction, and egg fed ad libitum for two feeding periods from 1 to 28 days (16%
production in broiler chickens and laying hens (Noor et crude protein, 4% crude fiber, metabolizable energy 2,800
al., 2020). Phage as a feed additive may be an effective way Kcal/kg) and 29 to 98 days (14% crude protein, 5% crude
to regulate the gut microbiota of chickens by lowering fiber, metabolizable energy 2,800 Kcal/kg). Following the
particular pathogenic microbial populations and increasing breeding company’s directions, the vaccination schedule
beneficial bacteria, resulting in enhanced gut health for chickens was thoroughly implemented during the
(Clavijo and Florez, 2018). rearing process.

Upadhaya et al. (2021) have established the efficacy of phage
therapy at a range of doses, such as 108 pfu/ml and 106 pfu/
ml. Their presence aided in decreasing harmful germs in
poultry and animals before slaughter. Additionally, phage
has been used to extend the life of food packaging materials
and as a disinfectant on production lines (Lone et al.,
2016). Oral administration of a bacteriophage mixture to
rats significantly diminished E. coli O157:H7 colonization
in the gastrointestinal tract (Dissanayake et al., 2019). The
phage treatment also significantly reduced the number of
E. coli O157:H7 bacteria on the meat surface (El-Shibiny
et al., 2017). However, little study has been undertaken
on the efficacy of phage therapy against E. coli infection
in indigenous chickens. In a recent study, we isolated two
phages, namely MHH6 and PR2, which were shown by
the transmission electron microscopy to belong to the
Myoviridae family based on their shape and the presence
of the tail diameter (Ngu et al., 2020). These phages could
survive at low pH levels and lyse E. coli strains of O1,
O78, and O6. Therefore, the current study was undertaken
to investigate the effects of MHH6 and PR2 phages on
controlling E. coli in native Noi chickens, as measured by
their growth performance, carcass characteristics, and the
bacteria population in the internal organs.
MATERIALS AND METHODS
Ethical statement
All chickens were handled and cared for in line with
Vietnam’s Animal Husbandry Law, No. 32/2018/QH14
July 2022 | Volume 10 | Issue 7 | Page 1519
The 98-day experiment included a total of 420 one-day-old
Noi broiler chickens. The chicks were randomly assigned to
one of seven experimental groups, each with four replicates
and 15 broilers per replicate. The treatment groups were:
Negative Control (NC) - treatment without E. coli challenge;
NC+Bacteriophage 1 (NC+MHH6); NC+Bacteriophage
2 (NC+PR2); Positive Control (PC) - treatment with
E. coli challenge; PC+Bacteriophage 1 (PC+MHH6);
PC+Bacteriophage 2 (PC+PR2); PC+Bacteriophage 1 and
Bacteriophage 2 (PC+MHH6PR2). Chicks were selected
for oral infection with 1 ml of E. coli on day two at a dose
of 107.1 cfu/ml (based on lethal dose, LD50 results), and
phages were administered orally at 109 pfu/ml starting 24
h after infection, followed for three consecutive days and
repeated weekly until day 63.
Sampling and measurements
The chicken mortality rate was monitored during the
trial. At 7, 21, 35, and 49 days after infection, one chick
from each cage was randomly selected and euthanized by
exsanguination to determine the density of E. coli (Gomes
et al., 2014) and record the weights of internal organs such
as heart, liver, and spleen (Lan et al., 2017).
Chicken body weight (BW) was determined weekly, and
feed intake (FI) was recorded daily for each cage. These
data were then utilized to compute body weight gain
(BWG) and feed conversion ratio (FCR). At the end of the
experiment, 56 chickens (8 per treatment, equal sex) were
slaughtered to determine carcass characteristics and organ

weights. Breast, thigh, drumstick muscle, and wings were
collected according to Faria et al. (2010). In addition, the
liver, spleen, heart, and gizzard were removed and weighed,
and data were expressed as percentages of body weight.
Advances in Animal and Veterinary Sciences
(Figure 2C). Moreover, the E. coli density in organs of
chickens under MHH6 and PR2 treatments was relatively
low (0.00-0.69 log10 cfu/ml) compared to the PC group
with a higher E. coli population (1.37-2.36 log10 cfu/ml).

Statistical analysis
The data were analyzed using the General Linear Model
procedure of the Minitab version 16 software (State
College, PA, USA) (Minitab, 2010). Tukey’s comparison
test with P ≤ 0.05 was performed to detect the mean
difference between treatments.

RESULTS AND DISCUSSION

The mortality rate of chickens

Figure 1 shows the total mortality rate of the experimental
chickens. In treatments without E. coli infection (NC) or
only with phage treatment (NC+MHH6 and NC+PR2),
no dead chickens were found. The highest mortality rate
was found in chickens infected solely with E. coli (PC), at
58.3%, followed by PC+PR2 (25.0%) and PC+MHH6
(22.2%) treatments.

Figure 1: The efficacy of a bacteriophage on mortality

rate of chicken E. coli challenged. NC: negative control,
without E. coli, without phage; PC: positive control, E. coli
challenged, without phages; NC+MHH6 and NC+PR2:
negative control plus MHH6 or PR2 phage, respectively;
PC+MHH6, PC+PR2: positive control plus MHH6 or
PR2 phage, respectively; PC+MHH6PR2: positive control Figure 2: Number of E. coli bacteria in heart, liver, and
plus both MHH6 and PR2 phages. spleen organs over 49 days of infection. (a) Heart; (b)
Liver; (c) spleen; PC: positive control, E. coli challenged,
The presence of E. coli in the internal organs without phages; PC+MHH6, PC+PR2: positive control
of Noi chickens plus MHH6 or PR2 phage, respectively; PC+MHH6PR2:
During 49 days of infection, the lytic ability of phages and positive control plus both MHH6 and PR2 phages.
E. coli invasion were assessed by counting E. coli density
in the heart, liver, and spleen of chickens (Figure 2A-C). Growth performance of chickens
During the experiment, E. coli were not found in birds’ The results in Table 1 indicate that BWG was higher in
hearts, liver, and spleen under NC, NC+MHH6, and chickens treated with phages in the first 35 days (258 g/
NC+PR2 treatments. The number of E. coli declined after bird) and the whole period (1-98 days) (1,143 g/bird)
the 7th day of phage application, and it was eliminated after compared with those in the PC treatment. There was no
49 days in the therapy with both phages included (Figure significant difference in bird growth between the E. coli-free
2B). Moreover, E. coli in the spleen was deficient and could treatments (NC and NC+MHH6; NC+PR2); however,
not be detected in the PC+MHH6PR2 treatment at 35 differences were found when treatments with E. coli
days or the PR2 phage treatment at 49 days post-infection inoculation were accounted. The overall benefit of improved
July 2022 | Volume 10 | Issue 7 | Page 1520

BWG was also demonstrated in the treatment with both
phages included (1,237 g/bird). In addition, higher feed
consumption in the non-treated chickens, combined
with lower BWG, were responsible for a higher FCR
(4.09) in the PC treatment than in the others (3.32-3.71).
Carcass traits of chickens
The phage therapy had a considerable impact on the carcass
Advances in Animal and Veterinary Sciences
and organ weight of infected chickens (Table 2). Chickens
in the only-phage-treated group, as well as those in a co-
inoculation group with E. coli and bacteriophages, had a
higher carcass weight and carcass percentage than chickens
in the only E. coli-infected group (P<0.05). Additionally,
Table 2 demonstrates that the rate of organ weight treated
with PC was generally more remarkable than that treated
with bacteriophage, particularly the spleen (P<0.01).

Table 1: Effect of bacteriophage on on body weight gain (BWG, g), feed intake (FI, g) and feed converstion ratio (FCR,
feed/gain).
Parameters Treatments SEM P
NC NC+ NC+ PC+ PC+ PC+ PC
MHH6 PR2 MHH6 PR2 MHH6PR2
Feed intake (g)
1-35 d 834abc 816abcd 781cd 798bcd 768d 851ab 871a 14.0 0.000
36-70 d 1,795 bc
1,804 b
1,776 bc
1,738 bc
1,679 c
1,970 a
2,003a 26.4 0.000
71-98 d 1,682ab 1,707ab 1,700ab 1,692ab 1,601b 1,773a 1,805a 29.8 0.003
1-98 d 4,312 b
4,328 b
4,259 b
4,228 b
4,049 c
4,595 a
4,680 a
38.6 0.000
Body weight gain (g)
1-35 d 333a 328a 322a 300c 270bc 302b 258d 8.96 0.000
36-70 d 694 698 689 645 687 663 536 40.2 0.105
71-98 d 396 438 439 353 387 396 478 27.2 0.068
1-98 d 1,285a 1,296a 1,284a 1,194c 1,218bc 1,237b 1,143d 7.24 0.000
FCR (feed/ gain)
1-35 d 2.50bc 2.49bc 2.43c 2.66bc 2.84b 2.82b 3.37a 0.08 0.000
36-70 d 2.71b 2.59b 2.58b 2.70b 2.45b 2.97b 3.76a 0.15 0.000
71-98 d 4.27 4.02 3.89 4.92 4.17 4.52 3.80 0.31 0.212
1-98 d 3.35d 3.34d 3.32d 3.54c 3.32d 3.71b 4.09a 0.04 0.000
NC: negative control, without E. coli, without bacteriophage; PC: positive control, E. coli challenged, without bacteriophages;
NC+MHH6 and NC+PR2: negative control plus MHH6 or PR2 bacteriophage, respectively; PC+MHH6, PC+PR2: positive control
plus MHH6 or PR2 bacteriophage, respectively; PC+MHH6PR2: positive control plus both MHH6 and PR2 bacteriophages. a,b,c,d
Within a row, values with different superscripts differ statistically at P<0.05.

Table 2: The effect of bacteriophage supplementation on carcass characterictis and organ weight in broilers.
Parameters Treatments SEM P
NC NC+ NC+ PC+ PC+ PC+ PC
MHH6 PR2 MHH6 PR2 MHH6PR2
Body weight (BW), g 1,314a 1,324a 1,313a 1,222c 1,247bc 1,266b 1,172d 7.29 0.000
Carcass weight (CW), g 896 b
944 a
934 ab
845 c
818 c
900 ab
654 d
9.72 0.000
Carcass, % BW 68.2ab 71.3a 71.1a 69.1ab 65.6b 71.1a 55.8c 0.96 0.000
Breast, % CW 15.7 ab
16.3 ab
17.2 a
15.9 ab
14.9 b
15.8 ab
15.1 b
0.38 0.009
Thigh + drumstick, % CW 24.5 a
24.7 a
24.5 a
23.4 ab
20.8 c
21.6 bc
20.2 c
0.53 0.000
Wing, % CW 14.0 b
14.9 ab
15.6 a
15.4 ab
15.5 a
15.1 ab
15.3 ab
0.31 0.031
Organ weight, % BW
Liver 2.08b 2.18ab 2.13ab 2.37a 1.90b 1.95b 2.12ab 0.06 0.001
Spleen 0.19 b
0.19 b
0.23 ab
0.19 b
0.19 b
0.21 ab
0.27 a
0.01 0.006
Gizzard 3.13 a
2.39 cd
2.67 bcd
2.76 abc
2.23 d
2.98 ab
2.77 abc
0.010 0.000
Heart 0.55a 0.42b 0.53ab 0.51ab 0.42b 0.52ab 0.52ab 0.03 0.005
NC: negative control, without E. coli, without bacteriophage; PC: positive control, E. coli challenged, without bacteriophages;
NC+MHH6 and NC+PR2: negative control plus MHH6 or PR2 bacteriophage, respectively; PC+MHH6, PC+PR2: positive control
plus MHH6 or PR2 bacteriophage, respectively; PC+MHH6PR2: positive control plus both MHH6 and PR2 bacteriophages. a,b,c,d
Within a row, values with different superscripts differ statistically at P<0.05.
July 2022 | Volume 10 | Issue 7 | Page 1521

According to Loc-Carrillo and Abedon (2011), a phage
is an antibacterial, bactericidal agent that can increase in
number during treatment and tends to disrupt the normal
flora only to a minimum extent. The ability of phages to host
diverse bacterial species reflects their specialization, and the
host spectrum of a bacteriophage is defined as the number
of bacteria employed by the phage. Therefore, when using
phages with a broad host spectrum, it is possible to support
the treatment of many strains of bacteria simultaneously.
In the in vitro study (Ngu et al., 2020), MHH6 and PR2
phages demonstrated the wide host range and the ability to
lyse O1, O78, and O6 E. coli strains; however, more testing
in vivo was required. The data in this study showed that
most commercially important traits in chickens improved
after phage treatment (Tables 1 and 2). These phages
could control O6 E. coli infected in native Noi chickens.
At the same time, the mortality rate of the combined
treatment of E. coli infected-birds and phage treated-birds
was significantly reduced (Figure 1). These findings were
consistent with some previous studies, where controlled E.
coli bacteria in the intestinal tract of chickens significantly
improved carcass quality (Isroli et al., 2018). Lau et al.
(2010) also demonstrated that when phages were used,
the mortality rate of chicken was dramatically decreased
(P<0.05). At the end of the experiment, the total mortality
rate of birds inoculated with 108 cfu of E. coli was 83.3%.
When using a phage concentration of 1.5 x 109 pfu/ml, an
average decrease of 25% in chicken mortality was noted
(Oliveira et al., 2010). Additionally, Naghizadeh et al.
(2019) reported that E. coli caused about 46.6% mortality
in 15 days old chicks without phage treatment. Only
13.3% of birds died after being injected with 108 cfu E. coli
and 1010 pfu of the comparable therapy phage. It can be
inferred from these findings that phage therapy effectively
inhibits the growth of E. coli and can be utilized to treat E.
coli infection in broilers.
Regarding the frequency of lesions and E. coli densities in
internal organs of chickens using phages to treat E. coli,
Lau et al. (2010) reported that E. coli colonization was
reduced in the liver, heart, and spleen and cleared from the
blood samples during the experimental period. Utilizing
a phage concentration of 1.5 x 109 pfu/ml resulted in a
41.7% reduction in infection incidence compared with the
untreated group (Oliveira et al., 2010). Additionally, Lim
et al. (2011) showed that after three weeks of follow-up,
the rate of bacterial re-isolation in the liver and spleen of
hens with just bacterial infections was 40-60%, compared
to only 20-40% in the bacteriophage-treated group. It can
be explained that phages can move through the mucosal
surface and even the blood-brain barrier and effectively
protect the host (Huh et al., 2019). These findings were
consistent with the current study, according to which
phage treatment could prevent and reduce the severity of
infected chickens.
July 2022 | Volume 10 | Issue 7 | Page 1522
Advances in Animal and Veterinary Sciences
Colibacillosis is often lethal in chickens, particularly
broilers and turkeys. E. coli enters the bloodstream from
the site of infection, where it spreads to multiple internal
organs, causing sepsis and bird death (Antao et al., 2008).
Naghizadeh et al. (2019) also discovered a high presence of
E. coli in the hearts, livers, and spleens of birds only infected
with E. coli (3/8 birds) 10 days post-challenge. However,
when using phage for treating, E. coli was reduced in the
heart, liver, and spleen after ten days of the challenge. It can
be stated that phage administration effectively inhibited
E. coli growth in the internal organs of chickens in the
present study. According to Bicalho et al. (2010), phages
1230-10 had the highest antibacterial activity and entirely
stopped the growth of 71.7% of all isolates. Additionally,
the combined action of phage preparations led to a broad
spectrum of activity, completely inhibiting 80% of E. coli
strains and significantly suppressing the growth of 90% of
E. coli isolates. According to Dąbrowska (2019), phages are
frequently found in the liver and spleen. The most effective
phages are commonly found in these internal organs, even
at concentrations more significant than those seen in the
blood. Following systemic delivery, the phage can reach the
spleen and liver in minutes and get relatively high titers
in 1 to 3 hours (Tiwari et al., 2011). Typically, the spleen
is the organ where live phages may be identified for the
greatest period, even days after phage treatment (Trigo et
al., 2013).
In contrast with the present study (Table 2), Kim et al.
(2013) demonstrated that FI and FCR were not affected
by phage treatment (0.05%, 0.1%, and 0.2%; 109 pfu/g) to
broiler diets. The inclusion of phages at 0.05 and 0.1% in the
feed did not affect the FI and FCR of broilers (Upadhaya
et al., 2021). However, these authors showed a significant
increase in BWG with an increase in bacteriophage
supplement levels during the starter and slaughter phases.
In contrast, Huff et al. (2004) suggested that BWG was
not affected by the addition of either DAF6 and SPR02
phages via intramuscular injection (3.7 × 109 and 9.3 ×
109 pfu/ml, respectively) in broiler chickens without E.
coli infection. Moreover, Lau et al. (2010) discovered that
chickens infected with E. coli but not treated with phage
had the smallest weights at 14 and 21 days of age. The
chicken weight was not significantly different between the
E. coli-infected but bacteriophage-treated and the negative
control groups.
In the context of the genomes, one may worry about the
safety of using phages in chickens or other animal species.
This issue is not covered in the present study; however,
according to Summers (2001), the majority of phages
identified to date are lytic and only a small proportion are
capable of integrating their DNA into host chromosomes.
Moreover, sequencing can support to eliminate the usage
of phages whose genomes encode known harmful products,

such as toxins, transposases, or repressor proteins (Krylov
et al., 2014). Previously, Krylov et al. (1993) also pointed
out that large-scale manufacturing of phages results in a
small proportion of mutated phages. The mutation process
typically makes the phage inactive but not stronger, and
the most commonly reported mutation renders phages
incapable of infecting bacteria. Approximately 10% of
phage particles undergo such mutations during large-scale
production, but this process often does not compromise
phage safety.
CONCLUSIONS AND
RECOMMENDATIONS
The application of phage therapy in native Noi broilers
considerably reduced mortality, as well as the severity
of gross lesions in chicken infected with E. coli strain
of serotype O6, and contributed to improving growth
performance and carcass characteristics of infected birds.
This study confirmed the beneficial effects of bacteriophages
in controlling E. coli infection in native broilers, which have
a slower growth rate but superior meat quality.
ACKNOWLEDGMENTS
This study is funded in part by the Can Tho University
Improvement Project VN14-P6, supported by a Japanese
ODA loan.
NOVELTY STATEMENT
The isolated MHH6 and PR2 phages displayed a broad
host range and the ability to lyse O1, O78, and O6 E. coli
strains yet further in vivo testing still was required. The
study revealed that phage treatment in native Noi broilers
dramatically reduced mortality and the severity of gross
lesions in chickens infected with the serotype O6 E. coli
strain, and led to enhanced growth performance in infect-
ed birds.
AUTHOR’S CONTRIBUTION
LHA and NTN contributed to the study’s design. The data
collection and analysis were carried out by LHA, TTHM,
LMT and LTTL. The first draft was prepared by LHA,
HTL, and NHX, and the manuscript was corrected by
NTN. The final manuscript has been read and approved
by all authors.
Conflict of interest
The authors have declared no conflict of interest.
July 2022 | Volume 10 | Issue 7 | Page 1523
Advances in Animal and Veterinary Sciences
REFERENCES
Antao EM, Glodde S, LiG, Sharifi R, Homeier T, Laturnus
C, Diehl I, Bethe A, Philipp HC, Preisinger R, Wieler
LH, Ewers C (2008). The chicken as a natural model for
extraintestinal infections caused by avian pathogenic
Escherichia coli (APEC). Microb. Pathog., 45(5-6): 361-369.
https://doi.org/10.1016/j.micpath.2008.08.005
Bicalho RC, Santos TMA, Gilbert RO, Caixeta LS, Teixeira
LM, Bicalho MLS, Machado VS (2010). Susceptibility
of Escherichia coli isolated from uteri of postpartum dairy
cows to antibiotic and environmental bacteriophages. Part
I: Isolation and lytic activity estimation of bacteriophages. J.
Dairy Sci., 93(1): 93-104. https://doi.org/10.3168/jds.2009-
2298
Cieplak T, Soffer N, Sulakvelidze A, Nielsen DS (2018). A
bacteriophage cocktail targeting Escherichia coli reduces E.
coli in simulated gut conditions, while preserving a non-
targeted representative commensal normal microbiota. Gut.
Microb., 9(5): 391-399. https://doi.org/10.1080/19490976
https://doi.org/10.3382/ps/pex359.2018.1447291
Clavijo V, Florez MJV (2018). The gastrointestinal microbiome
and its association with the control of pathogens in broiler
chicken production: A review. Poult. Sci., 97(3): 1006-1021.
https://doi.org/10.3382/ps/pex359
Dąbrowska K (2019). Phage therapy: What factors shape phage
pharmacokinetics and bioavailability? Systematic and
critical review. Med. Res. Rev., 39(5): 2000-2025. https://
doi.org/10.1002/med.21572
Dissanayake U, Ukhanova M, Moye ZD, Sulakvelidze A, Mai
V (2019). Bacteriophages reduce pathogenic Escherichia
coli counts in mice without distorting gut microbiota.
Front. Microbiol., 10: 1984. https://doi.org/10.3389/
fmicb.2019.01984
Domingo-Calap P, Georgel P, Bahram S (2016). Back to the
future: bacteriophages as promising therapeutic tools. HLA,
87(3): 133-140. https://doi.org/10.1111/tan.12742
El-Shibiny A, El-Sahhar S, Adel M (2017). Phage applications
for improving food safety and infection control in Egypt. J.
Appl. Microbiol., 123(2): 556-567. https://doi.org/10.1111/
jam.13500
Faria PB, Bressan MC, de Souza XR, Rossato LV, Botega LMG,
da Gama LT (2010). Carcass and parts yield of broilers reared
under a semi-extensive system. Braz. J. Poult. Sci., 12(3): 153-
159. https://doi.org/10.1590/S1516-635X2010000300003
Golkar Z, Bagasra O, Pace DG (2014). Bacteriophage therapy:
a potential solution for the antibiotic resistance crisis. J.
Infect. Dev. Ctries. 8(2):129-136. https://doi.org/10.3855/
jidc.3573
Gomes A, Quinteiro-Filho W, Ribeiro A, Ferraz-de-Paula V,
Pinheiro M, Baskeville E, Akamine A, Astolfi-Ferreira C,
Ferreira A, Palermo-Neto J (2014). Overcrowding stress
decreases macrophage activity and increases Salmonella
Enteritidis invasion in broiler chickens. Avian Pathol., 43(1):
82-90. https://doi.org/10.1080/03079457.2013.874006
Huff WE, Huff GR, Rath NC, Balog JM, Donoghue AM
(2004). Therapeutic efficacy of bacteriophage and Baytril
(enrofloxacin) individually and in combination to treat
colibacillosis in broilers. J. Poult. Sci., 83: 1944-1947. https://
doi.org/10.1093/ps/83.12.1944
Huh H, Wong S, Jean JS, Slavcev R (2019). Bacteriophage
interactions with mammalian tissue: Therapeutic
applications. Adv. Drug Deliv. Rev., 145: 4-17. https://doi.

org/10.1016/j.addr.2019.01.003
Isroli I, Yudiarti T, Widiastuti E, Wahyuni HI, Sartono TA,
Sugiharto S (2018). Effect of bacillus probiotics on internal
organs and carcass characteristics of broiler chicks infected
with avian pathogenic Escherichia coli. Livest. Res. Rural
Dev., 30(11). http://www.lrrd.org/lrrd30/11/sgh_u30183.
html
Kim KH, Lee GY, Jang JC, Kim JE, Kim YY (2013). Evaluation
of anti-SE bacteriophage as feed additives to prevent
Salmonella enteritidis (SE) in broiler. Asian Austral. J. Anim.,
26(3): 386–393. https://doi.org/10.5713/ajas.2012.12138
Krylov V, Pleteneva E, Shaburova O, Bourkaltseva M, Krylov S,
Chesnokova E, Polygach O (2014). Common pre-conditions
for safe phage therapy of Pseudomonas aeruginosa infections.
Adv. Microbiol., 4: 766-773. https://doi.org/10.4236/
aim.2014.412084
Krylov VN, Tolmachova TO, Akhverdian VZ (1993).
DNA homology in species of bacteriophages active on
Pseudomonas aeruginosa. Arch. Virol., 131: 141-151. https://
doi.org/10.1007/BF01379086
Lan RX, Lee SI, Kim IH (2017). Effects of Enterococcus faecium
SLB 120 on growth performance, blood parameters, relative
organ weight, breast muscle meat quality, excreta microbiota
shedding, and noxious gas emission in broilers. J. Poult. Sci.,
96: 3246-3253. https://doi.org/10.3382/ps/pex101
Lau GL, Sieo CC, Tan WS, Hair-Bejo M, Jalila A, Ho YW
(2010). Efficacy of a bacteriophage isolated from chickens
as a therapeutic agent for colibacillosis in broiler chickens. J.
Poult. Sci., 89(12): 2589-2596. https://doi.org/10.3382/
ps.2010-00904
Lim TH, Lee DH, Lee YN, Park JK, Youn HN, Kim MS, Lee
HJ, Yang SY, Cho YW, Lee JB, Park SY, Choi IS, Song
CS (2011). Efficacy of bacteriophage therapy on horizontal
transmission of Salmonella Gallinarum on commercial
layer chickens. Avian Dis., 55(3): 435-438. https://doi.
org/10.1637/9599-111210-Reg.1
Loc-Carrillo C and Abedon, ST (2011). Pros and cons of
phage therapy. Bacteriophage, 1(2): 111-114. https://doi.
org/10.4161/bact.1.2.14590
Lone A, Anany H, Hakeem M, Aguis L, Avdjian AC, Bouget
M (2016). Development of prototypes of bioactive
packaging materials based on immobilized bacteriophages
for control of growth of bacterial pathogens in foods. Int.
J. Food Microbiol., 217: 49-58. https://doi.org/10.1016/j.
ijfoodmicro.2015.10.011
Minitab (2010). Minitab reference manual, Release 16.2.1 for
Windows. Minitab Inc, USA.
Naghizadeh M, Torshizi MAK, Rahimi S, Dalgaard TS (2019).
Synergistic effect of phage therapy using a cocktail rather
July 2022 | Volume 10 | Issue 7 | Page 1524
Advances in Animal and Veterinary Sciences
than a single phage in the control of severe colibacillosis in
quails. J. Poult. Sci., 98(2): 653-663. https://doi.org/10.3382/
ps/pey414
Ngu NT, Loc HT, Nhan NTH, Huan PKN, Anh LH, Xuan NH
(2020). Isolation and characterization of bacteriophages
against Escherichia coli isolates from chicken farms. Adv.
Anim. Vet. Sci., 8(2): 161-166. https://doi.org/10.17582/
journal.aavs/2020/8.2.161.166
Nhung NT, Chansiripornchai N, Carrique-Mas JJ (2017).
Antimicrobial resistance in bacterial poultry pathogens:
A review. Front. Vet. Sci., 4: 126. https://doi.org/10.3389/
fvets.2017.00126
Noor M, Runa NY, Husna A (2020). Evaluation of the effect
of dietary supplementation of bacteriophage on production
performance and excreta microflora of commercial broiler
and layer chickens in Bangladesh. J. Proteom. Bioinform.,
9(2): 27-31.
Oliveira A, Sereno R, Azeredo J (2010). In vivo efficiency
evaluation of a phage cocktail in controlling severe
colibacillosis in confined conditions and experimental
poultry houses. Vet. Microbiol., 146(3-4): 303-308. https://
doi.org/10.1016/j.vetmic.2010.05.015
Rios AC, Moutinho CG, Pinto FC, Del Fiol FS, Jozala A,
Chaud MV, Vila MMDC, Teixeria JA, Balcão VM (2016).
Alternatives to overcoming bacterial resistances: State of the
art. Microbiol. Res., 191: 51-80. https://doi.org/10.1016/j.
micres.2016.04.008
Summers WC (2001). Bacteriophage therapy. Annu. Rev.
Microbiol. 55: 437-451. https://doi.org/10.1146/annurev.
micro.55.1.437
Tiwari BR, Kim S, Rahman M, Kim J (2011). Antibacterial
efficacy of lytic Pseudomonas bacteriophage in normal and
neutropenic mice models. J. Microbiol., 49(6): 994-999.
https://doi.org/10.1007/s12275-011-1512-4
Trigo G, Martins TG, Fraga AG, Longatto-Filho A, Castro
AG, Azeredo J, Pedrosa J (2013). Phage therapy is effective
against infection by Mycobacterium ulcerans in a murine
footpad model. PLoS Negl. Trop. Dis., 7(4): e2183. https://
doi.org/10.1371/journal.pntd.0002183
Upadhaya SD, Ahn JM, Cho JH, Kim JY, Kang DK, Kim
SW, Kim HB, Kim IH (2021). Bacteriophage cocktail
supplementation improves growth performance, gut
microbiome and production traits in broiler chickens. J.
Anim. Sci. Biotechnol., 12(1): 1-12. https://doi.org/10.1186/
s40104-021-00570-6
Wernicki A, Nowaczek A, Urban-Chmiel R (2017).
Bacteriophage therapy to combat bacterial infections in
poultry. Virol. J., 14(1): 1-13. https://doi.org/10.1186/
s12985-017-0849-7
Back to LRRD Home page

Livestock Research for Rural Development, Volume 34, Number 8, August 2022 ISSN 0121-3784

Contents
Papers:
65. Reproductive and milk yield performance of indigenous and crossbred dairy cattle breeds in
Ghana as influenced by non-genetic factors; J K Hagan, B A Hagan and S A Ofori

66. Production of honey, pot-pollen and propolis from Indonesian stingless bee Tetragonula
laeviceps and the physicochemical properties of honey: A review; Agussalim and Ali Agus

67. Effects of dry season supplementation of Calliandra calothyrsus leaf-meal mixed with
maize-bran on dairy cattle milk production in the West Usambara Highlands, Tanzania;
David D Maleko, George M Msalya and Kelvin M Mtei

68. Impacts of grazing, restoration by planting on the pastoral potential, floristic richness and
diversity of a the southwestern steppe of Naâma (Algeria), in the context of climate change;
Boukerker Hassen, Hecini Lynda, Salemkour Nora, Boumedjane Mouna Rachida, Kherifi
Wahida, Doghbage Abdelghafour, Belhouadjeb Fathi Abdellatif, Bekiri Fadia, Boultif
Meriem and Diab Nacima

69. Effect of cricket meal substituted soybean meal in the diet of white-eared Junglefowl (Gallus
gallus) on feed intake and weight gain; Nguyen Thiet, Nguyen Trong Ngu and Le Thanh
Phuong

70. Feeding coconut meal improves milk production and the quality of Etawah Grade goats; A R
S Asih, K G Wiryawan and L Doloksaribu

71. Using waste mineral water from RO column to culture Chlorella vulgaris algae biomass;
Trinh Thi Lan, Nguyen Thi Thuy Hang, Nguyen Tran Thien Khanh, Nguyen Thi Bich Hanh,
Nguyen Hieu Nhan, Nguyen Thi Bao Thoa, Nguyen Ngoc Phuong Trang and Nguyen Huu
Yen Nhi

72. Impact of graded levels of cassava peels meal as a replacement for maize on growth
performance and nutrient digestibility in weaner rabbits; Udeh F U, Ezenwosu C and
Onyimonyi A E

73. Performance of nile tilapia (Oreochromis niloticus) with giant freshwater prawns
(Macrobrachium rosenbergii) fed diets with duckweed (Lemna minor) and fish waste meal as
replacement for conventional protein sources; Arnold Ebuka Irabor, Lydia Mosunmola
Adeleke, Hardin Jn Pierre and Francis Oster Nwachi

74. Effect of ammonification with different levels of urea on conservation and chemical
components of the fresh tuber of sweet potato (Ipomoea batata L.); M H Ruiloba and C Solís
(in spanish)
 Livestock Research for Rural Development 34 (8) 2022 LRRD Search LRRD Misssion Guide for preparation of papers LRRD Newsletter Citation of this paper

Effect of cricket meal substituted soybean meal in the diet of white-eared Junglefowl (Gallus
gallus) on feed intake and weight gain
Nguyen Thiet, Nguyen Trong Ngu1 and Le Thanh Phuong2
College of Rural Development, Can Tho University, Can Tho City, Vietnam
nthiet@ctu.edu.vn
1 College of Agriculture, Can Tho University, Can Tho City, Vietnam
2 Vietswan Poultry Production Joint Stock Company, Binh Duong Province, Vietnam

Abstract
This experiment aimed to evaluate the effect of cricket meal substituted soybean meal in the diet of white-eared Junglefowl (Gallus gallus) on feed
intake and weight gain. The experiment was arranged in a completely randomized design with 3 treatments and 4 replicates (4 white-eared Junglefowl
per replication). The treatments consisted of control: diet without cricket meal (control); treatment 1: a diet containing 3% cricket meal (3CM) to
substitute 12.05% of soybean meal; treatment 2: a diet containing 6% cricket meal (6CM) to substitute 26.93% of soybean meal. The results from the
experiment showed that birds consumed up to 6% cricket meal in the diets without the negative impacts on dry matter intake (DMI), body weight,
weight gain, and feed conversion rate (FCR) as compared to the control (p>0.05). However, birds supplemented with 3% cricket meal improved weight
gain and decreased FCR compared to control (p <0.05). Additionally, Junglefowl fed with 3% cricket meal were the best choices for economic return. It
can be concluded that cricket meal was considered as a protein resource that can partly replace soybean meal in the diet of white-eared Junglefowl.

Key words: broiler, cricket meal, Junglefowl, production

Introduction
Recently, researchers reported that insects have been recommended as alternative protein sources in animal feed with high crude protein (CP) levels and
good quality amino acid profiles (Wang et al 2005; Sanchez-Muros et al 2014). Previous studies suggested that insect meal such as black soldier fly
larvae, house fly maggots, mealworm, grasshoppers, crickets, and silkworm meals can be partly replaced fish meal (FM) or soybean meal (SBM). Insect
meal has comparable CP and fat contents to FM and SBM (Makkar et al 2014) and does not adverse effects on poultry production (Wang et al 2005;
Permatahati et al 2019; Moula and Detilleux, 2019). In Vietnam, white-eared Junglefowl have been popular recently, particularly in remote areas, due to
good quality meat and low feed cost compared to commercial broilers. In addition, the farmers traditionally fed their Junglefowl with cereal grains,
grasshopper, earthworms, and particularly cricket. Because cricket are easy to produce, have a rapid growth rate, a short reproductive cycle, and a high
feed conversion rate. However, little information is available regarding the usage of cricket meal in the diets of Junglefowl.

Thus, the present experiment aimed to determine the effect of cricket meal substituted soybean meal in the diet of white-eared Junglefowl on feed intake
and weight gain. A shift from conventional protein sources such as FM and SBM towards cricket meal might result in more efficient use of natural
resources and lower emissions of greenhouse gases. In addition, the results from this study would contribute to sustainable livestock development and
environmental protection.

Materials and methods

Preparation of cricket meal

Crickets obtained from cricket farm at College of Rural Development, Can Tho University in Phung Hiep district of Hau Giang province, Vietnam.
After collecting from the farm, the crickets were stored in a freezer for a day. Then they were thawed, clean with fresh water, and dried in an oven at
60oC for two days. The dried crickets were ground using a blender to obtain the cricket meal and then included in the experimental diets.

Birds and housing

The experiment was conducted at the Experimental farm of the College of Rural Development, Can Tho University in Phung Hiep district of Hau Giang
province. The chickens were cared for and handled following the Animal Husbandry Law of Vietnam (32/2018/QH14). All birds were vaccinated before
starting the experiment and housed in confinement houses with a density of 02 birds/m2.

Experimental design and data collection

The experiment was arranged in a completely randomized design with 3 treatments, 4 replicates (4 white-eared junglefowl per replication). The
experiment used 48 white-eared junglefowl of mixed sex for 6 weeks (from 5th to 11th week of age, photo 1), consisting of one week for the adaptation
period and five weeks for data collection. The treatments consisted of the control group: diet without cricket meal (control); treatment 1: a diet
containing 3% cricket meal (3CM) to substitute 12.05% of soybean meal and treatment 2: a diet containing 6% cricket meal (6CM) to substitute 26.93%
of soybean meal. The chemical compositions of cricket meal are shown in Table 1 and the ingredients and chemical compositions of experimental
rations are presented in Table 2. The birds were fed twice daily at 08:00 and 14:00 h and had free access to water. At the beginning and end of the trial,
all birds from each replication were weighed before feeding in the morning.

Feed offered and refusals were recorded daily in the morning starting from day 1st to 35th of the experiment. Feed and refusal samples were collected
once a week and were divided into two parts: one half was immediately dried in the oven at 105°C until its weight remained constant to determine the
dry matter, and the remaining samples were kept frozen at -20°C until chemical analysis. All feed samples were thawed and mixed thoroughly at the end
of the experiment, and subsamples were dried at 65°C for approximately 12 hours for CP and CF analysis according to AOAC (1990).
 Photo 1. White-eared junglefowl at 11 weeks of age

Table 1. Chemical composition of cricket meal (On DM basis except for DM

which is on air-dry basis)
DM CP CF EE Ash
Cricket meal 94.90 50.91 5.84 10.88 3.39

Table 2. Ingredients and chemical composition of experimental rations

Ingredients Control 3CM 6CM
Soybean meal 29.00 25.50 21.19
Cricket meal 0.00 3.00 6.00
Corn meal 52.78 54.41 56.54
Rice bran 16.30 15.20 13.70
CaCO3 1.50 1.50 1.50
Salt 0.23 0.23 0.23
L-Lysine 0.10 0.08 0.08
DL-Methionine 0.09 0.08 0.05
Total 100 100 100
Price (VND/kg) 7.205 6.898 6.588
Chemical composition (%)
DM 89.04 89.05 89.04
CP 19.02 19.05 19.02
CF 4.05 3.92 3.77
Ca* 0.83 0.83 0.83
P* 0.51 0.50 0.48
Lysine* 1.16 1.16 1.18
Methionine* 0.42 0.44 0.43
ME (Kcal/kg)* 3095 3092 3091
*: calculated composition

Statistical analysis
The data are presented as the mean ± SEM. All data were analyzed with one-way ANOVA. The significance of pairwise comparisons was determined by
Tukey posttest. Significance was declared at p<0.05.

Results and discussion

The DMI in this experiment did not differ among treatments (Table 3, p>0.05). Feed intake is one of the indicators to evaluate the palatability of feed
ingredients. This study indicated that cricket meal was proper to be consumed by Junglefowl because the DMI from cricket meal groups was similar to
the control group. These findings were consistent with prior research in which insects had no measurable impact on feed intake (Onsongo et al 2018;
Moula and Detilleux, 2019). Wang et al. (2005) found that Arbor Acres broiler consumed field cricket meals up to 15% without affecting DMI. In
addition, Permatahati et al. (2019) reported that DMI from female Japanese quail was not affected by female field cricket supplementation by up to 8%.
But, Nginya et al. (2019) found that feed intake from indigenous chickens decreased with the diet containing high levels (above 5%) of grasshopper
meal. Lower DMI may be caused by a high fat content or chitin level in insect meal, followed by a decrease in nutrient digestibility (Nginya et al 2019;
Moula and Detilleux, 2019). The different responses to insect supplementation on DMI between the present experiment and previous studies may differ
in the levels of insect meal in diet, type of insects and poultry species.

The result the current study showed that the inclusion of 3% cricket meal in the diet of Junglefowl has improved weight gain, and lower in FCR
compared to control (Table 3, p<0.05). Higher weight gain and lower FCR may be due to the improvement of CP digestibility at a low level of insect
meal in the diet of poultry, as reported by Nginya et al. (2019). However, Junglefowl fed with 6% cricket meal was similar weight gain and FCR
compared to control (Table 3, p>0.05). In addition, the results showed that weight gain was a negative relationship (Figure 1; R2 = 1), and FCR was a
positive relationship (Figure 2; R2 = 1) when RM supplementation increased. Moula and Detilleux (2019) suggested that increasing rates of insect
inclusion are associated with a decrease in weight gain of birds, particularly for rates of 10% and more, and the same tendency in the present work
(Figure 1; R2 = 1). This is due to the imbalance of nutrient composition or high level of chitin is less digestible. Another factor is the influence of insect
meal on the villi's morphology. According to certain research, high levels of black soldier fly larvae or mealworm decreased the height of intestinal villi
(Biasato et al 2018a; Moniello et al 2019) or the total luminal villus absorptive area (Biasato et al 2018b). Some research found that feeding field cricket
meal to birds did not influence on weight gain or FCR in Arbor Acres broilers (Wang et al 2005) or female Japanese quail (Permatahati et al 2019).

The current study showed that the cost of 1 kg weight gain of Junglefowl from 3CM and 6CM groups was cheaper than that compared to control group
from 24.2% (6CM) to 31.34% (3CM) (Table 3). The findings of this study's cost of production are consistent with those of Adeniji (2007) and Bombata
& Balogun (1997). Similarly, Hatab et al (2018) discovered that replacing meat and bone meal with 5% or 10% insect meal in Japanese quail diets
increased the economic benefit from 9% to 39% compared to the control group.
 Table 3. Effect of cricket meal supplementation in the diet of white-eared Junglefowl on feed intake,
weight gain, and FCR
Items Control 3CM 6CM SE p
DMI (g/head/day) 28.4 28.8 28.0 0.70 0.73
Initial BW (g/head) 146 137 141 4.79 0.50
Final BW (g/head) 292 342 316 21.3 0.30
Weight gain (g/head/day) 4.18b 5.85a 4.99ab 0.24 0.01
FCR 7.05a 5.05b 5.80ab 0.42 0.02
Cost (VND/kg gain) 50,802 34,834 38,244 4,114 0.052
Compared to control (%) 0 31.43 24.72
a,b: Mean values with different superscripts within the same row are different at p<0.05 Control: diet
without cricket meal; 3CM: diet containing 3% cricket meal; 6CM: diet containing 6% cricket meal

Figure 1. Curvilinear trend in weight gain (g/head/day) as cricket meal substituted Figure 2. Curvilinear trend in feed conversion rate as cricket meal substituted
soybean meal in the diet of white-eared Junglefowl soybean meal in the diet of white-eared Junglefowl

Conclusions
Cricket meal can replace up to 26.93% of SBM or 6% cricket meal in diets without affecting DMI, body weight, weight gain and FCR of
Junglefowl. However, Junglefowl fed a diet with 3% cricket meal was the best choice in terms of economic return.

Acknowledgments
The author would like to thank the manager of the Experimental farm at College of Rural Development, Can Tho university for supplying all the
experiment materials and sincere gratitude thanks to Mr. Khang and Ms. Tram for taking care of the experiment.

References
Adeniji A A 2007 Effect of replacing groundnut cake with maggot meal in the diet of broilers. International Journal of Poultry Science, 6(11):822- 825. https://doi:
10.3923/ijps.2007.822.825

AOAC 1990 Association of Official Analytical Chemistry. Official Method of Analysis, 15th Edn. Washington, DC USA.

Biasato I, Gasco L, De Marco M, Renna M, Rotolo L, Dabbou S, Capucchio M T, Biasibetti E, Tarantola M and Sterpone L 2018a Yellow mealworm larvae (Tenebrio molitor)
inclusion in diets for male broiler chickens: Effects on growth performance, gut morphology, and histological findings. Poultry Science, 97:540–548.
https://doi.org/10.3382/ps/pex308.

Biasato I, Ferrocino I, Biasibetti E, Grego E, Dabbou S, Sereno A, Gai F, Gasco L and Schiavone A 2018b Modulation of intestinal microbiota, morphology and mucin
composition by dietary insect meal inclusion in free-range chickens. BMV Veterinary Research, 14: 383–398. https://doi.org/10.1186/s12917-018-1690-y.

Bombata F H A and Balogun O 1997 The effect of partial or total replacement of fish meal with maggot meal in the diet of tilapia (Oreochromis niloticus) fry. Journal of Prospects
in Science, 1:178–181.

Hatab M H, Ibrahim N S, Sayed W A and Sabic E M 2020 Potential value of using insect meal as an alternative protein source for Japanese quail diet. Brazilian Journal of Poultry
Science, 22(1): 1-10. https://doi.org/10.1590/1806-9061-2017-0700

Makkar H P S, Tran G, Heuzé V and Ankers P 2014 State of the art on use of insects as animal feed. Animal Feed Science Technology, 197:1–33.
https://doi.org/10.1016/j.anifeedsci.2014.07.008.

Moniello G, Ariano A, Panettieri V, Tulli F, Olivotto I, Messina M, Randazzo B, Severino L Piccolo G and Musco N 2019 Intestinal morphometry, enzymatic and microbial
activity in laying hens fed different levels of a Hermetia illucens larvae meal and toxic elements content of the insect meal and diets. Animals, 9:86–99. https://doi:
10.3390/ani9030086.

Moula N and Detilleux J 2019 A Meta-Analysis of the Effects of Insects in Feed on Poultry Growth Performances. Animals (Basel), 9(5):201. https://doi:10.3390/ani9050201

Nginya E S, Ondiek J O, King’ori A M and Nduko J M 2019 Evaluation of grasshoppers as a protein source for improved indigenous chicken growers. Livestock Research for
Rural Development, 31(1).

Onsongo V O, Osuga I M, Gachuiri C K, Wachira A M, Miano D M, Tanga C M, Ekesi S, Nakimbugwe D and Fiaboe K K M 2018 Insects for income generation through
animal feed: Effect of dietary replacement of soybean and fish meal with black soldier fly meal on broiler growth and economic performance. Journal of Economic Entomology,
111:1966–1973. https://doi.org/10.1093/jee/toy118.

Permatahati D, Mutia R and Astuti D A 2019 Effect of cricket meal (Gryllus bimaculatus) on production and physical quality of Japanese quail egg. Tropical Animal Science
Journal, 42:53–58. https://doi.org/10.5398/tasj.2019.42.1.53.

Sanchez-Muros M J, Barroso F G and Manzano-Agugliaro F 2014 Insect meal as renewable source of food for animal feeding: A review. Journal of Cleaner Production, 65:16–27.
https://doi.org/10.1016/j.jclepro.2013.11.068.

Wang D, Zhai S W, Zhang C X, Bai Y Y, An S H and Xu Y N 2005 Evaluation on nutritional value of field crickets as a poultry feedstuff. Asian-Australasian of Journal Animal
Sciences, 18:667–670. https://doi.org/10.5713/ajas.2005.667.
Veterinary World, EISSN: 2231-0916 RESEARCH ARTICLE
Available at www.veterinaryworld.org/Vol.15/April-2022/3.pdf Open Access

Effects of high salinity in drinking water on behaviors, growth, and renal

electrolyte excretion in crossbred Boer goats under tropical conditions
Nguyen Thiet1 , Nguyen Van Hon2 , Nguyen Trong Ngu2 and Sumpun Thammacharoen3

1. Department of Agricultural Technology, College of Rural Development, Can Tho University, 3/2 Street, Can Tho City
94000, Vietnam; 2. Department of Veterinary Medicine, College of Agriculture, Can Tho University, 3/2 Street, Can
Tho City 94000, Vietnam; 3. Department of Physiology, Faculty of Veterinary Science, Chulalongkorn University, Henri
Dunang Street, Bangkok 10330, Thailand.
Corresponding author: Sumpun Thammacharoen, e-mail: sprueksagorn@hotmail.com
Co-authors: NT: nthiet@ctu.edu.vn, NVH: nvhon@ctu.edu.vn, NTN: ntngu@ctu.edu.vn
Received: 28-11-2021, Accepted: 23-02-2022, Published online: 06-04-2022

doi: www.doi.org/10.14202/vetworld.2022.834-840 How to cite this article: Thiet N, Van Hon N, Ngu NT,
Thammacharoen S (2022) Effects of high salinity in drinking water on behaviors, growth, and renal electrolyte
excretion in crossbred Boer goats under tropical conditions, Veterinary World, 15(4): 834-840.

Abstract
Background and Aim: The high salinity of drinking water has been a significant problem of the Mekong Rivers Delta.
Animals drinking high salinity water altered feed and water intake (WI), urinary electrolytes excretion, and productivity.
This study aimed to evaluate the effects of high salinity in drinking water on drinking and eating behaviors and kidney
function in crossbred goats.
Materials and Methods: The experiment was completely randomized with two treatments: freshwater (0%, seawater
[SW0]) and water high in salinity (1.5%, SW1.5) from diluted SW, with five replicates (five animals per treatment). This
experiment lasted 3 weeks: the 1st week for the pre-treatment period and the 2nd-3rd weeks for the post-treatment. Dry matter
intake (DMI) and WI were recorded every day, while urine volume (UV) was determined from day 8 to day 21. Blood and
urinary samples were collected on days 6, 14, and 21 of the study for electrolytes and creatinine analysis.
Results: The results demonstrated that both DMI and WI were affected by SW1.5 (p<0.05). Goats drinking from SW1.5
had lower DMI during D19–21, and the ratio of DMI/WI was significantly different during D16–21 (p<0.05). Interestingly,
the UV from SW1.5 was higher than that from SW0 during D13–21 (p<0.05). Although the body weights (BW) of both
groups were similar (p>0.05), the weight gain observed in the SW1.5 group tended to decrease (p=0.056) at the 2nd week.
The concentration of electrolytes in blood did not differ between the groups (p>0.05). In contrast, the concentration and
excretion of Na+ and Cl- in urine increased in SW1.5 goats at D14 (p<0.05), while creatinine levels in the blood remained
normal (p>0.05).
Conclusion: The study concluded that crossbred male goats can tolerate 1.5% saline water from diluted SW for 2 weeks.
The high salinity in water influences drinking and eating behavior in growing goats. However, the adaptive mechanism by
increasing urine output and reducing the reabsorption of Na+ and Cl- in the kidney is the key function and works faster than
behavioral responses. The kidney apparently drives drinking behavior during high salinity water consumption.
Keywords: electrolytes, drinking behavior, goat, kidney, saline water.
Introduction saline in drinking water than sheep [1]. Goats could
Vietnam is classified as a water-deficit country in accept 1.5% NaCl in drinking water [2]. Saanen cross-
bred goats and growing local goats in Vietnam rejected
which the mean surface water and groundwater is 4400
saline water at 1.5-2.0% [3]. Boer goats rejected saline
m3/person/year (compared to 7400 m3/person/year in water at 1.25-1.5% NaCl and were more sensitive to
the world on average). According to calculations, if the the ingestion of salt from drinking water after pro-
sea level rises 1 m, 39% of the Mekong River Delta longed exposure to saline water [4]. However, the
(MRD) area becomes at risk of salinity intrusion. In previous study reported that goats can tolerate saline
2016, in the coastal provinces in the MRD, the salin- water up to 2% for at least 2 weeks [5].
ity levels in some locations ranged from 0.6 to 1.5%. In this context, the animals’ ability to tolerate
Interestingly, Boer crossbred goats are the predomi- various degrees of salt loads in drinking water may
nant breed and are well developed in this area. The pre- be related to kidney function [6]. Due to the kidney’s
vious study found that goats are more tolerant to high important role in regulating body fluids and com-
positions, some studies have suggested that sheep
Copyright: Thiet, et al. Open Access. This article is distributed under
the terms of the Creative Commons Attribution 4.0 International
drinking water containing 1.3% NaCl appear to
License (http://creativecommons.org/licenses/by/4.0/), which develop an adaptation for salt tolerance without any
permits unrestricted use, distribution, and reproduction in any negative effects [7]. This ability came from a renal
medium, provided you give appropriate credit to the original
author(s) and the source, provide a link to the Creative Commons adjustment that increased filtration and eliminated
license, and indicate if changes were made. The Creative Commons salt [6]. Similarly, Abou Hussien et al. [8] found that
Public Domain Dedication waiver (http://creativecommons.org/
publicdomain/zero/1.0/) applies to the data made available in this
sheep and goats drinking saline water controlled their
article, unless otherwise stated. salt load by excreting more urine and increasing the
Veterinary World, EISSN: 2231-0916 834

 Available at www.veterinaryworld.org/Vol.15/April-2022/3.pdf

filtration rate, while camels drank less saline water to (Master S28M, Atago, Japan). We bought the con-
decrease salt stress. Although goats may be tolerant centrated SW from an aquaculture farm and deliv-
to saline water up to 1.5% due to renal adjustment, ered it to the experimental site. The water samples
difference in breeds, or climate conditions as reported from the SW0 and SW1.5 groups were analyzed for
by previous studies, there is little information about chemical composition, as shown in Table-1. This
the chronological responses of Boer crossbred goats experiment lasted for 3 weeks, with 7 days for the
to diluted seawater (SW) under tropical conditions. pre-treatment period (from the 1st to 7th day) and
Therefore, this study aimed to investigate the 14 days (from the 8th to 21st day) for the treatment
effects of high salinity in drinking water on chrono- period. All goats were offered the same rations
logical behaviors and renal electrolyte excretion containing 70% corn silage and 30% concentrate
responses in growing crossbred goats under tropical (consisting of 8% rice bran, 11.3% corn meal, 7.8%
conditions. For this purpose, we hypothesized that soybean meal, 0.9% limestone, and 2% molasses)
Boer crossbred goats may adapt to high salinity in formulated as total mixed rations (TMR) according
drinking water with either chronological behaviors or to the recommendation of NRC [11]. The ingredi-
changes in renal electrolyte excretion. ents and chemical compositions of the rations are
presented in Table-2. The goats received TMR ad
Materials and Methods libitum twice daily at 07.00 and 14.00 h and had
Ethical approval free access to water.
The study was approved by the Scientific Meteorological data
Committee, Can Tho University (#3559), Vietnam. The temperature and humidity were recorded at
Study period and location 07.00 h, 09.00, 11.00, 13.00, 15.00, 17.00, and 19.00 h.
The study was carried out from September 2020 The temperature and humidity index was calculated
to March 2021 at the Experimental Farm, College as recommended by Thammacharoen et al. [12]. The
of Rural Development, Cantho University, Vietnam. environmental conditions from the current study are
The samples were analyzed at Department of Animal presented in Table-3.
Science, College of Agriculture, Cantho University,
Vietnam. Table-1: The compositions of freshwater and high salinity
water.
Experimental design and animal care
The experiment was conducted on 10 male Items Freshwater High saline
(SW0) water (SW1.5)
crossbred Boer goats (Boer×Bach Thao goats,
7-8 months old) with an average body weight (BW) EC (mS/cm) 0.28 33.00
TDS (g/L) 0.127 15.00
of 22.70±0.30 kg. In this study, we used the male
Cl‑ (g/L) 0.028 8.77
Boer crossbred goats because the farmers prefer the K+ (mg/L) 4.35 156.00
male goats for meat purposes due to better daily Na+ (mg/L) 16.60 4412.00
weight gain than female Boer crossbred goats. Each Ca2+ (mg/L) 15.50 92.30
animal was in a healthy state and was not suffer- Mg2+ (mg/L) 9.91 606.00
ing from dangerous infectious diseases. All animals EC=Electrical Conductivity; TDS=Total Dissolved Solids;
Cl‑=Chloride; Na+=Sodium; K+=Potassium; Ca2+=Calcium
were kept in individual metabolic cages in 1.2×0.7 m
and Mg2+=Magnesium, SW=Seawater
shaped pens with plastic floors, feeders, and drink-
ing troughs for the adaptation period (10 days). Table-2: Ingredients and chemical composition of the
During this period, all goats ate the same experi- TMR.
mental diets and drank freshwater. Afterward, the
Ingredients % DM
experiment was completely randomized with two
groups: a control group of goats drinking freshwa- Corn silage 70.00
Rice bran 8.00
ter (SW0) and a treatment group of goats drinking Corn meal 11.30
saline water with a concentration of 1.5% (SW1.5). Soybean meal 7.80
The present study has only five replicates, and this Limestone 0.90
is a limitation. However, we think that this sample Molasses 2.00
size has enough power and proved consistent with Chemical composition
Dry matter 29.50
our previous studies [9,10]. Crude protein 16.20
The study used concentrated SW (9%) mixed Ether extract 2.01
with freshwater to achieve water with a salt concen- Acid detergent fiber 28.50
tration of 1.5% (SW1.5), according to the formula Neutral detergent fiber 39.50
Ash 9.70
C1V1=C2V2 (where C1 is the concentration of the Na 0.06
starting solution; V1 is the volume of the starting K 1.71
solution; C2 is the concentration of the final solu- Cl 1.06
tion; and V2 is the volume of the final solution), and Na+=Sodium; K+=Potassium; Cl‑=Chloride. TMR=Total
the salinity was then checked by a refractometer mixed rations

Veterinary World, EISSN: 2231-0916 835

 Available at www.veterinaryworld.org/Vol.15/April-2022/3.pdf
Data collection and measurement
Feed offered and feed refusals (9%) were
recorded daily in the morning starting from day 1 to
the end of the experiment. Daily dry matter intake
(DMI) was calculated by the following formula:
Daily feed intake=feed offered-feed refusals (dry
matter basis)
Feed and refusal samples were collected daily
from day 1 to day 21 and were divided into two parts:
one half was immediately dried in the oven at 105°C
until its weight remained constant to determine the dry
matter (DM), and the remaining samples were kept fro-
zen at −20°C until chemical analysis. At the end of the
experiment, all feed samples were thawed and mixed
thoroughly, and subsamples were dried at 65°C over-
night (approximately 12 h) for nitrogen and ash anal-
ysis according to Association of Official Analytical
Chemists [13], neutral detergent fiber (NDF), and acid
detergent fiber using the procedure developed by Van
Soest et al. [14]. Sodium (Na+), potassium (K+), cal-
cium (Ca2+), and magnesium (Mg2+) were measured
by atomic absorption spectrophotometry (Thermo iCE
3000 series, Thermo Fisher Scientific, China), chlo-
ride (Cl-) was determined by colorimetric titration,
sulfate (SO42-) was measured by spectrophotometry
(Ultraviolet-visible 1800 Shimadzu, Japan), electrical
conductivity (EC) was determined using an EC meter
(Schott instruments D-55122, Mainz, Germany), and
total dissolved solids (TDS) was measured with a
refractometer (Master S28M, Atago, Japan). Water
intake (WI) was measured daily from the beginning
to the end of the experiment by subtracting the weight
of water offered from the weight of water refused. All
of the goats were weighed before the morning feeding
on days 0, 7, 14, and 21 of the experiment, and weight
gain was calculated using the following formula:
 g  Final BW − Initial BW
Body weight gain  =
 day  days of experiment
On days 6, 14, and 21, blood samples (4 mL)
from the jugular vein were collected at 07.00 before
the morning feeding and were then placed in a lithium
heparin tube, kept on crushed ice, and centrifuged at
900 x g for 10 min. The plasma samples were stored
at −20°C until analysis. In addition, total urine was
Table-3: Environmental conditions from the current
experiment.
Time Ambient Humidity THI
temperature (°C) (%)
07.00 27.88±0.11 81.50±1.13 69.42±0.09
09.00 28.00±0.37 79.25±0.22 69.52±0.03
11.00 29.75±0.56 74.00±1.75 70.95±0.96
13.00 30.31±0.59 71.63±3.01 71.25±0.48
15.00 29.50±0.26 75.25±3.31 70.74±0.21
17.00 28.75±0.43 75.75±2.05 70.71±0.35
19.00 28.25±0.43 78.63±0.96 69.30±0.35
THI=Temperature and humidity index
Veterinary World, EISSN: 2231-0916
recorded from day 6 to day 21. The urine samples
(50 ml each) from pre-treatment (day 6), day 14, and
day 21 were collected, filtered through two layers of
cheesecloth, and later analyzed. Plasma creatinine
was determined with an automatic clinical chemis-
try analyzer (XL200, Erba Mannheim, Germany).
Plasma and urine electrolytes were measured with an
automatic analyzer (ST200 PRO, Sensa Core, India).
This study also calculated urinary electrolyte excre-
tion (Uex) with the following formula:
Urinary electrolytes excretion (Uex)=Ue × UV
While Ue: urinary electrolytes, UV: Urine volume.
Statistical analysis
The data for DMI per BW, WI per BW, and urine
per BW were analyzed with repeated two-way anal-
ysis of variance. The significance of the main effects
was determined by the Bonferroni posttest. Moreover,
the data for BW, weight gain, and plasma and urinary
electrolytes were compared using an unpaired t-test.
Significance was declared at p<0.05, and a tendency
was declared at 0.05<p<0.10.
Results
During the pre-treatment period, no differences
were detected in the levels of average daily DMI
and WI per BW (Figures-1-3). During the 2 weeks
of the experimental period, high salinity in drink-
ing water influenced eating and drinking behaviors
(Figures-1-3) and urine volume (UV) (Figure-4). The
average daily DMI per BW from SW1.5 was lower
than that from SW0, especially on D19–21 (Figure-1,
p=0.01). Likewise, an effect of high salinity in drink-
ing water was observed on the average WI per BW
(Figure-2, p=0.047). The ratio of DMI and WI revealed
the chronological phenomenon of the effect of high
salinity water under our conditions. The ratio of DMI
and WI during D16–21 from SW1.5 was significantly
lower than that from SW0 (Figure-3, p<0.05). In this
study, UV was determined from D8–21 of the exper-
iment. High salinity in drinking water significantly
increased daily UV (Figure-4, p=0.001). Significantly
Figure-1: Effects of high salinity in drinking water on dry
matter intake (g/kg body weight). D1-7: Pre-treatment
from day 1 to day 7; D8-21: Treatment period from day 8 to
day 21. *The effect of salinity in drinking water (p<0.05).
836
 Available at www.veterinaryworld.org/Vol.15/April-2022/3.pdf
higher UV in SW1.5 cells was detected from D13–18
(p<0.05).
On the other hand, no effect of saline water on
the bodyweight of goats was observed. Similarly,
weight gain in the 1st week after animals drank
saline water did not differ between the groups
Figure-2: Effects of high salinity in drinking water on daily
water intake (g/kg body weight). D1-7: Pre-treatment from
day 1 to day 7; D8-21: Treatment period from day 8 to day
21. *The effect of salinity in drinking water (p<0.05).
Figure-3: Effects of high salinity in drinking water on ratio
of DMI per WI. D1-7: Pre-treatment from day 1 to day 7;
D8-21: Treatment period from day 8 to day 21. *The effect
of salinity in drinking water (p<0.05).
Figure-4: Effects of high salinity in drinking water on daily
urine volume (g/kg body weight/day). D8-21: Treatment
period from day 8 to day 21. *The effect of salinity in
drinking water (p<0.05).
Veterinary World, EISSN: 2231-0916
(p=1.00, Table-4). However, weight gain in animals
drinking saline water tended to decrease compared to
those drinking freshwater in the 2nd week of post-treat-
ment (p=0.056, Table-4). Furthermore, plasma elec-
trolytes and creatinine contents were similar between
the groups from the pre-treatment (day 6) and treat-
ment periods (day 14 and day 21) (p>0.05, Table-5).
The concentration of urinary electrolytes was similar
between the groups during the pre-treatment period,
whereas the Na+ and Cl- contents from SW1.5 were
higher than those from SW0 during the treatment
period (p<0.05, Table-6). Levels of urinary excre-
tion (Uex) were similar between the groups during
the pre-treatment period (day 1 and day 6). During
the treatment period, the excretion of Na+ and Cl- was
significantly different between the groups. The Uex
of Na+ and Cl- from SW1.5 was higher than SW0
(p<0.05, Table-7). Finally, the Uex of K+ was different
on day 14 but not on other days of study.
Discussion
The present study demonstrated that high salin-
ity in water affects the drinking and eating behav-
iors of goats under tropical conditions. In addition,
goats drinking water with high salinity exhibited a
bigger UV. Furthermore, high salinity in water influ-
enced urine output earlier than it influenced eating
and drinking behaviors. These effects were related
to an increase in the excretion capacity of both Na+
and Cl-.
High salinity in drinking water did not affect
DMI and WI during the 1st week of the treatment
period, D8–15 (Figure-4). Similar results have
been reported by previous studies. For example,
Tsukahara et al. [15] found that brackish water con-
taining 6900 mg TDS/L did not affect DMI in grow-
ing Boer and Spanish goats. Similarly, DMI was not
significantly different among treatments when sheep
drank water with saline levels ranging from 640 to
8326 mg TDS/L [16]. Moreover, some studies have
reported that feed intake is negatively affected by
increasing levels in saline water, and this result was
similar to the previous studies in goats [5,17] and
sheep [18]. On this note, the different responses
observed in the animals may be due to different
salt levels in water or the difference between spe-
cies. The reduction in feed intake in animals that
consumed water high in salinity was affected by a
decrease in nutrient digestibility (DM and NDF) as
observed in this study (data not shown) or ruminal
function and passage rate [19].
In the 1st week of treatment, daily WI was not
affected by high salinity in the water, whereas daily
WI tended to increase in the 2nd week of the study.
Thus, this indicated that saline water affected water
consumption in Boer male crossbred goats in this
study. In this regard, many studies found that WI
increased as the salinity level increased. According to
Mohammed [20], goats that drank water with 1.5%
837
 Available at www.veterinaryworld.org/Vol.15/April-2022/3.pdf

Table-4: Effects of high salinity in drinking water on body weight and weight gain.

Items Period Treatment p‑value

SW0 SW1.5
Body weight Initial 22.54±0.26 22.86±0.57 0.62
(kg/head) Wk1 23.36±0.44 23.68±0.65 0.69
Wk2 24.16±0.37 24.08±0.74 0.93
Average 23.76±0.40 23.88±0.69 0.88
Weight gain Wk1 117.14±41.50 117.14±19.38 1.00
(g/head/day) Wk2 114.29±15.65 57.14±20.20 0.0656
Average 115.71±15.71 87.14±14.71 0.22
Treatment=SW0=Freshwater containing 0.127‰ TDS; SW1.5=High salinity water containing 15‰ TDS, SW=Seawater,
TDS=Total Dissolved Solids

Table-5: Effects of high salinity in drinking water on [18] reported a higher WI in sheep offered saline water
plasma electrolytes and creatinine.
with 11 g and 15 g of NaCl.
Items Day Treatment p‑value On the other hand, some studies found that WI
SW0 SW1.5
was greater at low levels of salinity; however, when the
saline level increased up to 2%, the water consumption
Na+
D6 142.80±0.76 143.20±0.41 0.66
(mmol/L)
decreased [21]. These results indicate that at low lev-
D14 142.63±0.67 142.83±0.31 0.79 els of saline, animals consume more water; conversely,
D21 142.53±0.33 143.15±0.70 0.45 when given high salinity water, animals decrease WI
K+ D6 5.38±0.63 5.34±0.27 0.96 to avoid salt stress from the saline water [22]. From
(mmol/L)
a behavioral point of view, the majority of drinking
D14 5.15±0.33 5.65±0.20 0.24
D21 5.01±0.35 5.35±0.14 0.41 bouts are associated with eating, and the amount of
Cl‑ D6 99.43±0.88 100.60±0.79 0.36 WI is positively correlated with the quantity of food
(mmol/L) ingested [23]. However, the data from the present
D14 101.33±0.62 101.53±0.43 0.80 study revealed that animals drinking water with high
D21 99.73±0.55 100.25±0.34 0.45
Creatinine D6 70.50±4.6 73.50±6.7 0.72
salinity tended to have increased WI but maintained
(µmol/L) or decreased DMI as a result of a lower ratio of DMI
D14 79.25±2.8 82.50±4.1 0.54 per WI (Figure-4). Thus, this suggested the effect of
D21 77.50±2.8 83.00±6.5 0.47 salinity on drinking behavior. Interestingly, this behav-
Treatment: SW0=Freshwater containing 0.127‰ TDS; ioral change occurred later than the adaptation of the
SW1.5=High salinity water containing 15‰ TDS. kidneys handling electrolyte load due to the intake of
D6=Pre‑treatment period on day 6 of experiment;
D14=Treatment period on day 14 of experiment;
water high in salinity (see below).
D21=Treatment period on day 21 of experiment. Furthermore, the results of this study show that
Na+=Sodium; K+=Potassium; Cl‑=Chloride, SW=Seawater, saline water did not affect BW throughout the exper-
TDS=Total Dissolved Solids iment or weight gain during the 1st week post-treat-
ment. However, weight gain observed in the goats
Table-6: Effects of high salinity in drinking water on drinking highly saline water tended to decrease com-
urinary electrolyte concentrations.
pared to those drinking freshwater in the 2nd week
Items Day Treatment p‑value post-treatment (p=0.056, Table-4). The lower weight
SW0 SW1.5 gain in the high salinity group may be due to the
Na (mmol/L)
+
D6 21.18±1.0 23.10±0.89 0.21
lower DMI. Similar results were reported by Mdletshe
D14 22.40±0.86 134.30±3.5 0.001 et al. [17] who found that the weight gain in goats
D21 24.58±1.1 108.60±12 0.001 significantly decreased as the salinity levels increased
K+ (mmol/L) D6 137.60±13 134.50±11 0.86 due to the decrease in feed intake. However, a previ-
D14 142.40±12 135.40±14 0.72 ous study observed that there was no effect on BW
D21 159.90±14 145.80±16 0.52
Cl‑ (mmol/L) D6 181.60±21 194.90±25 0.70
in sheep drinking water with 1% NaCl; conversely, a
D14 189.80±16 286.30±29 0.03 decrease in the BW of some animals receiving 1.5%
D21 192.10±22 247.50±10 0.06 NaCl in water was detected, and 2% NaCl resulted in
Treatment: SW0=Freshwater containing 0.127‰ decreased BW for all of the sheep [18].
TDS; SW1.5=high salinity water containing 15‰ TDS. On another note, plasma electrolytes were simi-
D6=Pre‑treatment period on day 6 of experiment; lar between the groups throughout the experiment and
D14=Treatment period on day 14 of experiment;
D21=Treatment period on day 21 of experiment.
were within the normal ranges for healthy goats, as
Na+=Sodium; K+=Potassium; Cl‑=Chloride, SW=Seawater, mentioned by Zoidis and Hadjigeorgiou [5] and Runa
TDS=Total Dissolved Solids et al. [4]. Similarly, Nguyen et al. [9,10] found that
dairy goats fed high levels of Na+ and K+ in their diet
NaCl demonstrated an increased WI compared with exhibited unchanged plasma concentrations of Na+ and
those drinking freshwater. Similarly, Yousfi and Salem K+. In this sense, the present study demonstrates that
Veterinary World, EISSN: 2231-0916 838
 Available at www.veterinaryworld.org/Vol.15/April-2022/3.pdf
Table-7: Effects of high salinity in drinking water on
urinary electrolyte excretion.
Items Day Treatment p‑value
SW0 SW1.5
Uex Na+ (mmol/ D6 27.32±3.6 23.69±3.8 0.51
head/day)
D14 24.33±4.7 248.90±15 0.001
D21 27.70±7.1 152.70±38 0.02
Uex K+ (mmol/ D6 172.80±13 137.10±21 0.21
head/day)
D14 152.60±26 249.70±25 0.03
D21 168.20±22 194.10±22 0.44
Uex Cl‑ (mmol/ D6 225.60±14 190.30±21 0.21
head/day)
D14 200.50±29 526.60±45 0.001
D21 197.30±17 335.90±46 0.03
Treatment: SW0=Freshwater containing 0.127‰
TDS; SW1.5=High salinity water containing 15‰
TDS. D6=Pre‑treatment period at day 6 of experiment;
D14=Treatment period at day 14 of experiment;
D21=Treatment period at day 21 of experiment.
Na+=Sodium; K+=Potassium; Cl‑=Chloride, Uex=Urinary
electrolyte excretion, SW=Seawater, TDS=Total Dissolved
Solids
saline water has very high Na+ and Cl- concentrations
compared with freshwater (Table-1). However, goats
from the SW1.5 group were still in the reference range
and maintained constant plasma Na+ and Cl- concentra-
tions. The animals’ ability to tolerate various degrees
of salt loads in drinking water may be related to kid-
ney function [6]. Potter [7] suggested that sheep drink-
ing water containing 1.3% NaCl appear to develop
an adaptation for salt tolerance without any negative
effects. This ability of sheep came from a renal adjust-
ment that increased filtration and eliminated salt [6].
In the present experiment, UV and the excretion
of Na+ and Cl- measured in the SW1.5 group were
greater than those in the SW0 group on day 14. It is
noteworthy that these effects were more pronounced
than those of drinking and eating behaviors. Thus,
the results suggested that goats drinking saline water
controlled the salt load by either excreting more UV
and increasing the filtration rate or excreting more
Na+ and Cl- contents through urine (Tables-6 and 7).
In addition, the chronological phenomenon also sug-
gested the coupling of kidney function and behav-
iors. Furthermore, in this study, plasma and urinary
K+ concentrations were not significantly affected by
high salinity in drinking water. However, an increase
in K+ excretion through urine was detected on day
14 but not on day 6 or day 21. This difference was
mainly affected by the difference in UV on that day.
Moreover, the study found that plasma K+ content was
not affected by increasing NaCl levels in drinking
water, while urinary K+ concentration increased with
high NaCl in drinking water [5]. However, increases
in plasma K+ concentration were found in goats [24]
and sheep [6] when given saline water.
On another note, creatinine is a byproduct of mus-
cle metabolism and is excreted by glomerular filtration.
Veterinary World, EISSN: 2231-0916
Thus, creatinine can be used as an indicator of renal
function. In this study, the creatinine concentration in
plasma remained unchanged between the groups and
was at the reference level [23], indicating no adverse
effects on kidney function due to goats consuming
highly saline water. This result is similar to that reported
by Runa et al. [24] when goats drank water with high
salinity without an effect on plasma creatinine, whereas
Zoidis and Hadjigeorgiou [5] reported that plasma cre-
atinine levels increased with the high salinity in the
water.
Conclusion
Although this study has specific limitations,
such as the limited number of animals , the results
demonstrate that salinity influences drinking and
eating behavior in goats under tropical countries.
Furthermore, the kidneys’ responses to saline water
were faster than behavioral responses such as drink-
ing and eating behaviors. This adaptive mechanism in
growing crossbred goats drinking saline water is acti-
vated by regulating water and salt balance by reducing
the reabsorption of Na+ and Cl- in the renal tubules and
increasing excretion through urine. In addition, goats
that drank highly saline water tended to experience
decreased weight gain; however, they consumed more
water than the control group. Therefore, this study
concluded that crossbred male goats can tolerate 1.5%
saline water from diluted SW for 2 weeks. However,
more detailed experiments are required to determine
the goats’ ability to respond to different levels of salin-
ity in drinking water for a longer period.
Authors’ Contributions
NT, NVH, NTN, and ST: Contributed to the
conception and designed the study. NT, NVH, and
NTN: Contributed reagents/materials/analysis tools.
NT: Performed the animal experiments. NT and ST:
Analyzed the data and performed the statistics. NT
and ST: Wrote and revised the manuscript. All authors
contributed to the final version of the manuscript and
read and approved the final manuscript.
Acknowledgments
This study was funded by the Ministry of
Education and Training, Vietnam under grant number
B2020-TCT-08.
Competing Interests
The authors declare that they have no competing
interests.
Publisher’s Note
Veterinary World remains neutral with regard
to jurisdictional claims in published institutional
affiliation.
References
1. McGregor, B.A. (2004) Water Quality and Provision for
Goats. In: A Report for the Rural Industries Research and
839
 Available at www.veterinaryworld.org/Vol.15/April-2022/3.pdf
Development Corporation. RIRDC Publication No. 04/036.
2. Nassar, A.M. and Mousa, S.N. (1981) Observations on
Behavioral Response of Sheep to Water Salinity. Ain Shams
University, Cairo, Egypt.
3. Nguyen, N.T. (2021) Evaluation of salt tolerance threshold
of Bach Thao goats when drinking diluted seawater. Anim.
Sci. J., (submitted).
4. Runa, R.A., Brinkmann, L., Gerken, M. and Riek, A. (2019)
Capacity of Boer goats to saline drinking water. Animal,
13(10): 2268-2276.
5. Zoidis, E. and Hadjigeorgiou, I. (2018) Effects of drink-
ing saline water on food and water intake, blood and urine
electrolytes and biochemical and haematological parame-
ters in goats: A preliminary study. Anim. Prod. Sci., 58(10):
1822-1828.
6. Potter, B.J. (1963) The effect of saline water on kidney
tubular function and electrolyte excretion in sheep. Aust. J.
Agric. Res., 14(4): 518-528.
7. Potter, B.J. (1968) The influence of previous salt ingestion
on the renal function of sheep subjected to intravenous
hypertonic saline. J. Physiol., 194(2): 435-455.
8. Abou Hussien, E.R.M., Gihad, E.A., El-Dedawy, T.M. and
Abdel Gawad, M.H. (1994) Reaction of camels, sheep and
goats with salt water. and Metabolism of water and miner-
als. Egypt. J. Anim. Prod., 31(Suppl): 387-401.
9. Nguyen, T., Chaiyabutr, N., Chanpongsang, S. and
Thammacharoen, S. (2018) Dietary cation and anion dif-
ference: Effects on milk production and body fluid distri-
bution in lactating dairy goats under tropical conditions.
Anim. Sci. J., 89(1): 105-113.
10. Nguyen, T., Chanpongsang, S., Chaiyabutr, N. and
Thammacharoen S. (2019) The effect of dietary ions difference
on drinking and eating patterns in dairy goats under high ambi-
ent temperature. Asian Aust. J. Anim. Sci., 32(4): 599-606.
11. National Research Council (NRC). (1981) Nutrient
Requirements of Goats: Angora, Dairy, and Meat Goats in
Temperate and Tropical Countries. Nutrient Requirements
of Goats.
12. Thammacharoen, S., Chanpongsang, S., Chaiyabutr, N.,
Teedee, S., Pornprapai, A., Insam-ang, A., Srisa-ard, C. and
Channacoop, N. (2020) An analysis of herd-based lacta-
tion curve reveals the seasonal effect from dairy cows fed
under high ambient temperature. Thai J. Vet. Med., 50(2):
169-178.
13. Association of Official Analytical Chemists. (1990)
********
Veterinary World, EISSN: 2231-0916
Official Method of Analysis. 15th ed. Association of Official
Agricultural Chemists, Inc., Virginia.
14. Van Soest, P.J., Robertson, J.B. and Lewis, B.A. (1991)
Methods for dietary fiber neutral detergent fiber and non-
starch polysaccharides in relation to animal nutrition. J.
Dairy. Sci., 74(10): 3583-3597.
15. Tsukahara, Y., Puchala, R., Sahlu, T. and Goetch, A.L.
(2016) Effects of level of brackish water on feed intake,
digestion, heat energy, and blood constituents of grow-
ing Boer and Spanish goat wethers. J. Anim. Sci., 94(9):
3864-3874.
16. Moura, J.H.A., de Araujo, G.G.L., Saraiv, E.P., de
Albuquerque Ich, R.R., Turco, S.H.N., Costa, S.A.P. and
Santo, N.M. (2016) Ingestive behavior of crossbred Santa
Inês sheep fed water with different salinity levels. Semin.
Ciênc. Agrárias, 37(2): 1057-1068.
17. Mdletshe, Z.M., Chimonyo, M., Marufu, M.C. and
Nsahlai, I.V. (2017) Effects of saline water consumption on
physiological responses in Nguni goats. Small. Rumin. Res.,
153: 209-211.
18. Yousfi, I. and Ben Salem, H. (2017) Effect of Increasing
Levels of Sodium Chloride in Drinking Water on Intake,
Digestion and Blood Metabolites in Barbarine Sheep.
Vol. 90. Annales de LINRAT. p202-214.
19. Peirce, A.W. (1957) Studies on salt tolerance of sheep. I.
The tolerance of sheep for sodium chloride in the drinking
water. Aust. J. Agric. Res., 8(6): 711-722.
20. Mohammed, S.A.A. (2008) Effects of Salinity of Drinking
Water, State of Hydration, Dietary Protein Level and
Unilateral Nephrectomy on Blood Constituents and Laconic
Laconic Function in Nubian Goats. University of Khartoum,
Khartoum, Sudan.
21. Eltayeb, E.E. (2006) Effect of Salinity of Drinking Water
and Dehydration on Thermo Regulation, Blood and Urine
Composition in Nubian Goats. University of Khartoum,
Khartoum, Sudan.
22. Simon, S.A., de Araujo, I.E., Gutierrez, R. and
Nicolelis, M.A. (2006) The neural mechanisms of gusta-
tion: A distributed processing code. Nat. Rev. Neurosci.,
7(11): 890-901.
23. Rossi, R. and Scharrer, E. (1992) Circadian patterns of drinking
and eating in pygmy goats. Physiol. Behav., 51(5): 895-897.
24. Runa, R.A., Gerken, M., Riek, A. and Brinkmann, L. (2020)
Boer goats physiology adaptation to saline drinking water.
Res. Vet. Sci., 129: 120-128.
840
Veterinary World, EISSN: 2231-0916 RESEARCH ARTICLE
Available at www.veterinaryworld.org/Vol.15/September-2022/23.pdf Open Access

Effects of probiotic (Lactobacillus plantarum and Bacillus subtilis)

supplementation on mortality, growth performance, and carcass
characteristics of native Vietnamese broilers challenged with
Salmonella Typhimurium
Tran Van Be Nam1 , Luu Huynh Anh2 , Huynh Tan Loc3 , Chau Thi Huyen Trang3 , Nguyen Thiet4 ,
Ly Thi Thu Lan5 , Tran Hoang Diep6 , Nguyen Hong Xuan7 , and Nguyen Trong Ngu2

1. Department of Molecular Biotechnology, Biotechnology Research, and Development Institute, Can Tho University, Can
Tho City, Vietnam; 2. Department of Animal Sciences, College of Agriculture, Can Tho University, Can Tho City, Vietnam;
3. Department of Veterinary Medicine, College of Agriculture, Can Tho University, Can Tho City, Vietnam; 4. Department
of Agricultural Technology, College of Rural Development, Can Tho University, Can Tho City, Vietnam; 5. Animal
Husbandry and Veterinary Medicine Department, School of Agriculture and Aquaculture, Tra Vinh University, Tra Vinh
City, Vietnam; 6. Department of Animal Science and Veterinary, Faculty of Agriculture and Food Technology, Tien Giang
University, My Tho City, Vietnam; 7. Food Technology Department, Faculty of Biological, Chemical, and Food Technology,
Can Tho University of Technology, Can Tho City, Vietnam.
Corresponding Author: Nguyen Trong Ngu, e-mail: ntngu@ctu.edu.vn
Co-authors: TVBN: tvbnam@ctu.edu.vn, LHA: luuhuynhanh@ctu.edu.vn, HTL: tanloc@ctu.edu.vn,
CTHT: cthtrang@ctu.edu.vn, NT: nthiet@ctu.edu.vn, LTTL: thulan@tvu.edu.vn, THD: tranhoangdiep@tgu.edu.vn,
NHX: nhxuan@ctuet.edu.vn
Received: 05-05-2022, Accepted: 08-08-2022, Published online: 26-09-2022

doi: www.doi.org/10.14202/vetworld.2022.2302-2308 How to cite this article: Nam TVB, Anh LH, Loc HT,
Trang CTH, Thiet N, Lan LTT, Diep TH, Xuan NH, and Ngu NT (2022) Effects of probiotic (Lactobacillus plantarum and
Bacillus subtilis) supplementation on mortality, growth performance, and carcass characteristics of native Vietnamese
broilers challenged with Salmonella Typhimurium, Veterinary World, 15(9): 2302–2308.

Abstract
Background and Aim: Probiotic species have been proven to be beneficial on broiler performance; however, most studies have
focused on industrial chickens with fast growth, whereas little information concerning the use of these species on native chickens
is available. This study aimed to investigate the effects of probiotics Lactobacillus plantarum (LP) and Bacillus subtilis (BS) on
the mortality, growth rate, and carcass characteristics in native Noi chickens challenged with Salmonella Typhimurium.
Materials and Methods: We divided 420 1-day-old Noi chicks into seven different treatment groups (n = 60): negative
control (no S. Typhimurium, no probiotics or antibiotics); positive control (PC, S. Typhimurium infection, no probiotics
or antibiotics); and S. Typhimurium infection and supplementation with LP, BS, LP + BS, enrofloxacin, and commercial
probiotics, respectively. Treatment was for 96 days, and the chicks were orally challenged with S. Typhimurium at 22 days old.
Results: No deaths occurred during the 4 weeks post-infection in the negative control, LP, or LP+BS groups. The PC group
had the highest mortality rate (20%). Re-isolation of S. Typhimurium from the liver, spleen, and heart showed reduced
bacterial counts at 1 week post-infection in the LP, BS, and LP + BS groups. The lowest body weight gain was observed
in the PC group (949 g/bird), and chicks in the LP group gained 1148 g/bird. An improved feed conversion ratio was noted
in the groups receiving probiotic supplementation (3.42–3.50 kg feed/kg gain). There was little evidence that probiotics
affected carcass percentage and related parameters, such as breast, thigh and drumstick, and wings.
Conclusion: Lactobacillus plantarum or BS dietary supplementation to native Noi broilers resulted in a lower mortality rate
and improved body weight gain but did not affect carcass characteristics.
Keywords: Bacillus subtilis, growth, Lactobacillus plantarum, mortality, Noi chicken.
Introduction predominant serotypes of Salmonella can cause seri-
The global poultry industry plays an important ous clinical diseases, including gastroenteritis, enteric
role in providing protein-rich meals, such as eggs and fever (typhoid fever), and bacteremia, in animals and
humans [2, 3]. Over the past decades, antimicrobials
meat, to consumers. However, its expansion has led
have been extensively used in intensive poultry pro-
to increased bacterial infections, which impact public
duction to prevent and treat diseases as well as pro-
health as well as cause substantial economic losses [1],
mote growth and productivity. Van Boeckel et al. [4]
of which salmonellosis is a problematic issue. Some
reported an expected increase of 67% in the use of anti-
Copyright: Nam, et al. Open Access. This article is distributed under microbials in livestock and poultry farming, primarily
the terms of the Creative Commons Attribution 4.0 International
License (http://creativecommons.org/licenses/by/4.0/), which
due to the expanding worldwide demand for animal
permits unrestricted use, distribution, and reproduction in any protein [5]. In Vietnam, antimicrobials were found in
medium, provided you give appropriate credit to the original
author(s) and the source, provide a link to the Creative Commons
5.4% of all chicken feed formulations, and a total of
license, and indicate if changes were made. The Creative Commons ten feed items for hens included one or more antimi-
Public Domain Dedication waiver (http://creativecommons.org/
publicdomain/zero/1.0/) applies to the data made available in this
crobials that might be used in the feed formulation [6].
article, unless otherwise stated. The inappropriate use of antibiotics leads to negative
Veterinary World, EISSN: 2231-0916 2302

 Available at www.veterinaryworld.org/Vol.15/September-2022/23.pdf
issues, including microbiota disruption, antibiotic
residues, and the development of antibiotic-resistant
bacteria, which may infect poultry products and seri-
ously threaten human health [7, 8].
Recently, the use of nonantibiotic additives in
poultry feed has been expanded in an effort to enhance
development and feed utilization because antibiotic
use in animal feed was prohibited. Feed additives,
including acidifiers, antioxidants, probiotics, and pre-
biotics, have been effectively utilized in poultry pro-
duction due to a strong drive to find alternatives to
antibiotics [2]. Thus, probiotics have become promi-
nent supplements and food additives and are generally
used to promote healthy digestion since they have been
demonstrated to improve growth performance [9] and
prevent and manage enteric infections in poultry [10].
Bacteria from the genus Bacillus are widely
used in animal production to improve weight gain
and feed efficiency and can be easily administered
to animals as an oral dose. The Bacillus genus com-
prises gram-positive facultative anaerobes. Their
ability to form endospores enables them to survive
longer at elevated temperatures or pressures than non-
spore-forming bacteria. Probiotic bacteria, such as
Bacillus subtilis (BS), improve animal performance
and health conditions by rebalancing the intestinal
microbiota [11]. Bacillus strains isolated and charac-
terized from poultry feces have been reported to reduce
Salmonella Typhimurium from the crop and ceca of
broiler chickens in experimental infections [12]. The
Bacillus genus is common in birds and can improve
health by reducing harmful microorganisms [13]. In
addition, Lactobacillus is an excellent probiotic for
domestic animals because it inhibits the growth of
pathogenic bacteria while promoting the development
of nonpathogenic microorganisms via the production of
various metabolites, thereby improving the gut micro-
biota [14]. Wu et al. [15] concluded that Lactobacillus
plantarum (LP) promoted broiler intestinal and body
health condition by improving intestinal mucosal bar-
rier function, antioxidative ability, and immunity while
decreasing cell apoptosis with strain-specificity.
Most of the above-mentioned studies mainly
focused on fast-growing broiler chickens, and infor-
mation on the use of probiotics in native broilers with
a long-life span remains limited. Therefore, we aimed
to investigate the preventive efficacy of BS and LP
against S. Typhimurium in Noi broilers, an indigenous
Vietnamese chicken breed, with regard to mortality,
S. Typhimurium reduction, growth performance, and
carcass characteristics. Treatments with single or
combined strains of probiotics were also evaluated to
determine their efficiency for long-term use in native
broilers in comparison with antibiotic use.
Materials and Methods
Ethical approval
The chickens were cared for and handled accord-
ing to the Animal Husbandry Law (32/2018/QH14) of
Veterinary World, EISSN: 2231-0916
Vietnam, and the experimental protocol was approved
by the Council of College of Agriculture, Can Tho
University (A10-01-2021/KNN).
Study period and location
The study was conducted from March to July
2021 on the Can Tho University’s experimental farm
in Phung Hiep District, Hau Giang province.
Salmonella, antibiotics, and probiotics
We obtained the virulent strain Salmonella enter-
ica subspp. enterica serovar Typhimurium from the
American Type Culture Collection (ATCC 14028;
Manassas, Virginia, USA) for the experimental infec-
tion of Noi chickens. The antibiotic (enrofloxacin) and
commercial probiotics (BS, 109–1010 Colony-forming
unit (CFU)/g; Lactobacillus spp., 106–109 CFU/g; and
Saccharomyces cerevisiae, 106–109 CFU/g) were sup-
plied by a local veterinary medicine company. Two
probiotic strains, LP and BS, were isolated from fer-
mented food and intestines of chicken raised at differ-
ent poultry farms in the Mekong Delta of Vietnam and
screened for probiotic characteristics [16].
Birds and housing
All birds were vaccinated as instructed by the
chicken breeding company. During the finishing
stage, they were placed in confinement houses at a
density of 10 birds/m2. A commercial broiler diet was
provided ad libitum. The starter diet contained 16%
crude protein and metabolizable energy of 2800 Kcal/
kg, while the grower and finisher diet contained 14%
crude protein and metabolizable energy of 2800 Kcal/
kg. Drinking water was freely available.
Experimental design
We used 420 1-day-old Noi broiler chicks of
mixed sex to determine the preventive effect of pro-
biotics against S. Typhimurium challenge. The chicks
were randomly selected from a breeder flock and
divided into seven different treatment groups (n = 60
birds each, four replicates per treatment): negative
control (NC, no S. Typhimurium, no probiotic or
antibiotic supplementation); positive control (PC;
S. Typhimurium infection, no probiotic or antibiotic
supplementation); and S. Typhimurium infection and
supplementation with LP, BS, LP + BS, enrofloxacin
(Enro, Can Tho, Vietnam), and commercial probiotics
(CProbi, Can Tho, Vietnam), respectively. The chick-
ens were orally challenged with 5 × 107 CFU/mL of
S. Typhimurium [17] at 22 days old (average body
weight, 176 g). The supplementation with corre-
sponding probiotics (10 g/kg feed, 107–108 CFU/g)
or antibiotics (10 mg/kg feed) started 2 days before
infection and occurred twice a week until the end of
the experiment.
Data collection and measurements
We recorded the feed intake and body weight of
each group weekly. Then, after adjusting for any dead
birds, we calculated the feed conversion ratio (FCR)
as feed intake (g)/weight increase (g). Mortality was
2303
 Available at www.veterinaryworld.org/Vol.15/September-2022/23.pdf

monitored daily during the 4 weeks post-infection. 21 W1 W2 W3 W4

We randomly selected four birds per treatment group 18 3.33
(sex balanced when applicable) for S. Typhimurium
re-isolation on days 7, 14, 21, and 28 post-infection 15 3.33

and at the end of the experiment using the procedures 12

of Gomes et al. [18]. At the end of the experiment, 9
6.67
when chickens were 98 days old, we euthanized 56
6
broilers (8 per treatment, sex balanced) to assess 3.33 3.33 3.33
carcass features and organ measurements. The broil- 3 6.67

ers were individually weighed before euthanization 0

through cervical dislocation and exsanguination. The NC LP BS LP+BS CProbi Enro PC

breast, thigh and drumstick muscle, and wings were Figure-1: Mortality rate of chickens during 4-week
collected according to Goliomytis et al. [19]. We also post-infection with Salmonella Typhimurium.
W=Week, NC=Negative control, LP=Lactobacillus
removed and weighed the liver, spleen, heart, and giz- plantarum, BS=Bacillus subtilis, Enro=Enrofloxacin,
zard, and the weights of the organs were calculated as CProbi=Commercial probiotics, PC=Positive control.
a proportion of the body weight.
Statistical analysis
The data were analyzed using the General Linear
Model in Minitab 16.2.1 software (State College,
Pennsylvania, USA). Tukey comparison test was used
to determine the mean differences between treatments.
p ≤ 0.05 was considered statistically significant.
Results
Probiotic administration decreased the mortal-
ity rate of chickens challenged with S. Typhimurium
(Figure-1). There were no deaths in the NC, LP, or
a
LP + BS groups. The highest mortality rate (20%)
was observed in the PC group, in which the major-
ity of birds died within the first and second weeks
post-infection. In addition, the results revealed that
the efficacy of BS (3.33%) was similar to antibiotics
and commercial probiotics provided in the diet.
Re-isolation of S. Typhimurium in several inter-
nal organs indicated a general tendency that, regard-
less of the number of days post-infection, the PC group
had the highest bacteria count, followed by the Enro
and CProbi groups (Figure-2). S. Typhimurium was
found in all organs 7 days after infection, although b
there was a drop in density in birds treated with either
probiotics or antibiotics. However, 1 week later, no
S. Typhimurium was detected in the LP, BS, and
LP + BS groups. Except for the PC group, all groups
were free of S. Typhimurium in all examined organs at
day 28 post-infection. In addition, in the PC group, the
amount of Salmonella re-isolated from the heart was
slightly higher than that re-isolated from the liver and
spleen during the 4 weeks post-infection.
Table-1 shows the feed intake, body weight gain,
and FCR of the different treatment groups. The addi- c
tion of probiotics resulted in a significantly increased Figure-2: Bacterial counts in organs of chickens at
different days’ post infection: (a) Liver, (b) spleen,
feed intake LP, 4,066 g/bird) between 22 and 98 days (c) heart. NC=Negative control, LP=Lactobacillus
of age (p < 0.05), but the inclusion of enrofloxacin plantarum, BS=Bacillus subtilis, Enro=Enrofloxacin,
had no effect when compared with the positive con- CProbi=Commercial probiotics, PC=Positive control.
trol (3,774 g/bird). Improved body weight gains were
also observed in treatments with LP and BS probiotic The carcass characteristics and percentages of
supplementation (1,098–1,155 g/bird), resulting in a internal organs are presented in Table-2. Remarkably,
reduced FCR. the LP+BS group showed a significant improvement
Veterinary World, EISSN: 2231-0916 2304
 Available at www.veterinaryworld.org/Vol.15/September-2022/23.pdf

Table-1: Effects of probiotic supplementation on growth performance of Noi broilers.

Parameters Treatments SEM p‑value

NC LP BS LP+BS CProbi Enro PC
Feed intake, g
22–42 days 834 886 845 840 802 852 803 21.4 0.122
43–70 days 1,633a 1,522ab 1,403b 1,541ab 1,519ab 1,481ab 1,517ab 36.2 0.009
71–98 days 1,719a 1,658ab 1,613abc 1,598abcd 1,554bcd 1,435d 1,455cd 36.7 0.000
22–98 days 4,186a 4,066ab 3,861ab 3,979ab 3,874ab 3,768b 3,774b 74.7 0.003
Body weight gain, g
22–42 days 293ab 284b 286b 322a 280b 285b 280b 6.62 0.001
43–70 days 485a 430bc 395cd 456ab 425bc 388cd 351d 11.5 0.000
71–98 days 420a 435a 417a 376ab 368ab 333b 318b 17.9 0.000
22–98 days 1,198a 1,148abc 1,098bc 1,155ab 1,072cd 1,005de 949e 18.0 0.000
FCR, kg feed/kg gain
22–42 days 2.85ab 3.12a 2.97ab 2.61b 2.87ab 3.00ab 2.87ab 0.09 0.013
43–70 days 3.37b 3.55b 3.58b 3.38b 3.58b 3.84ab 4.33a 0.13 0.000
71–98 days 4.11 3.83 3.90 4.27 4.29 4.37 4.60 0.18 0.075
22–98 days 3.44b 3.50b 3.48b 3.42b 3.58ab 3.73ab 3.93a 0.08 0.002
NC=Negative control, LP=Lactobacillus plantarum, BS=Bacillus subtilis, Enro=Enrofloxacin, CProbi=Commercial
probiotics, PC=Positive control, FCR=Feed conversion ratio, SEM=Standard error of the mean. a,b,c,d,e Within a row, values
with different superscripts differ statistically at p < 0.05

Table-2: Effect of probiotic on carcass characteristics and internal organs of chickens.

Parameters Treatments SEM p‑value

NC LP BS LP+BS CProbi Enro PC
BW, g 1,368 a
1,336 ab
1,296 bc
1,325 ab
1,242 c
1,182 d
1,121e 12.9 0.000
CW, g 971a 957a 923b 960a 888c 822d 777e 6.72 0.000
Carcass, % BW 71.0ab 71.6ab 71.3ab 72.4a 71.5ab 69.5b 69.4b 0.50 0.001
Breast, % CW 18.1ab 17.6b 17.3b 19.6a 18.3ab 18.4ab 18.3ab 0.44 0.023
Thigh + drumstick, % CW 22.6 21.6 22.5 23.2 23.2 22.6 23.1 0.63 0.607
Wing, % CW 13.5 14.0 13.0 13.8 14.6 13.5 14.2 0.42 0.215
Organ weight, % BW
Liver 1.74c 2.33ab 1.92bc 2.11abc 2.02abc 2.13abc 2.40a 0.10 0.001
Spleen 0.18b 0.22ab 0.22ab 0.26ab 0.17b 0.16b 0.29a 0.02 0.002
Gizzard 2.01ab 1.84b 1.71b 1.82b 1.83b 2.02ab 2.48a 0.11 0.001
Heart 0.35 0.38 0.39 0.40 0.44 0.38 0.42 0.02 0.148
NC=Negative control, LP=Lactobacillus plantarum, BS=Bacillus subtilis, Enro=Enrofloxacin, CProbi=Commercial
probiotics, PC=Positive control, SEM=Standard error of the mean, BW=Body weight, CW=Carcass weight. a,b,c,d,e Within a
row, values with different superscripts differ statistically at p < 0.05

in carcass weights (960 g/bird) compared with that of
the PC group (777 g/bird) (p < 0.05). There was also an
increase in the ratio of liver and spleen to body weight
in chickens receiving probiotic treatments. Moreover,
even higher ratios were observed in the PC treatment,
where chickens suffered from the S. Typhimurium
infection but were not treated.
Discussion
Alternatives to antibiotic use in the poultry indus-
try are necessary to mitigate the spread of antimicro-
bial resistance. Since probiotics are beneficial bacteria
with antibacterial and growth-promoting properties,
we sought to identify and evaluate the effects of indig-
enous Lactobacillus and Bacillus species on native Noi
broilers. In general, the inclusion of isolated LP and
BS positively impacted most examined indicators. Our
findings revealed that the PC group (S. Typhimurium-
challenged, without probiotics or antibiotics) showed
the highest mortality rate, which is consistent with ear-
lier findings. El-Shall et al. [20] reported that broiler
Veterinary World, EISSN: 2231-0916
chickens challenged with Salmonella had the highest
mortality rate (25%), and it was highest in the first- and
second-weeks post-infection. The severity of clinical
signs was worse in the birds that were Salmonella-
challenged but received no probiotics than in those
that received probiotics. Abd El-Ghany et al. [21]
also reported the highest morbidity and mortality rates
in the Salmonella-challenged group in their study.
Moreover, in our study, enrofloxacin treatment did
not result in improved prevention of S. Typhimurium
infection, most likely because the bacteria were resis-
tant to this antibiotic since enrofloxacin is one of the
main treatments for S. Typhimurium administered to
live chickens [22].
Sharma et al. [23] found S. Typhimurium in the
spleen and liver at 16 weeks post-infection. In our
study, S. Typhimurium was found in these organs, as
well as the heart, at 11 weeks post-infection, but it was
eliminated in the groups receiving probiotic treatments.
A similar report by Dina and Hams [24] also confirmed
a decline in the total bacterial count of S. Enteritidis
2305
 Available at www.veterinaryworld.org/Vol.15/September-2022/23.pdf
isolated from challenged birds treated with probi-
otics. This could be because the production of lactic
acid by the probiotic might have been unfavorable
for Salmonella growth. A significant reduction in the
incidence of S. Typhimurium has been observed 24 h
after lactic acid bacteria administration, suggesting the
potential of probiotics to control the gut microbiota and
environmental factors, thereby limiting Salmonella
colonization of birds [25]. Probiotics maintain the
correct balance of beneficial microbial populations in
the intestine of birds, and this is essential for efficient
feed conversion, growth, productivity, and stimulation
of immune mechanisms to combat pathogens [26]. In
addition, probiotic activity in the gastrointestinal tract
improves nutrient absorption, theoretically resulting
in more energy being available for net energy produc-
tion [27]. In our study, probiotic-supplemented treat-
ments, either as a single or combination dose of LP
and BS, resulted in improved feed intake, body weight
gain, and FCR. Notably, the advantageous effects were
even more pronounced when compared with antibiotic
supplementation. We found that enrofloxacin supple-
mentation was not very effective, as evidenced by the
fact that the chickens in this group experienced lower
weight gains and higher FCR that were almost identical
to the results of those in the PC group. Supplementing
broilers’ diet with a single probiotic or a mixture of
probiotics significantly improves growth performance
and decreases FCR under normal, stress, disease, and
other conditions [14]. According to Abudabos et al. [2],
BS affects growth parameters in broilers exposed to S.
Typhimurium at the starter phase, where, in terms of
growth performance and feed consumption, probiotic
supplementation was as equally beneficial as antibiotic
supplementation. In addition, some probiotic strains
increased immunoglobulin A, G, and M levels in broil-
ers, contributing to enhanced growth performance and
disease resistance [27]. Collectively, this improved per-
formance of chickens fed probiotics may be attributed
to increased feed digestibility, maintaining a favorable
gut microbiota, and promoting intestinal integrity.
However, the impact of probiotic supplementation on
broiler performance by differences in probiotic dose,
bacteria species, feed type, and microbiomes requires
further investigation.
We found little evidence that probiotics sig-
nificantly affect carcass percentage and related
parameters, such as breast, thigh and drumstick,
and wings. There were no variations in carcass
percentage between the control and probiotic-supple-
mented groups. In line with our findings, Qorbanpour
et al. [28] observed that dietary treatments with
multistrain probiotics (L. acidophilus, L. casei,
Enterococcus faecium, and Bifidobacterium ther-
mophilum) did not affect the weights of the carcass,
breast, and thigh of chickens. However, Mehr et al.
[29] reported that higher levels of probiotic sup-
plementation resulted in heavier body and carcass
weights and a higher percentage of breast weight.
Veterinary World, EISSN: 2231-0916
In our study, most internal organ weight percent-
ages were slightly higher in the PC group, except for the
heart, where the weight proportion did not differ among
the treatment groups. We also observed that the groups
treated with probiotics showed an increasing trend in the
percentage weight of the liver and spleen compared with
the negative control. These outputs correlated fairly well
with reports that the supplementation of broilers’ diets
with BS significantly increased the relative weight of
the spleen but not the liver [30, 31]. In other studies, the
impact of probiotics on internal organ weight is unclear
since no variations in the percentage weights of the liver,
spleen, gizzard, and heart were observed between broil-
ers fed control or a probiotic-supplemented diet [32, 33].
Overall, the above findings indicate that the effect of
probiotics on the weight of visceral organs in chickens
is unclear. To this end, future studies should focus on
the type and quantity of microbial strains employed as
probiotics and the metabolic activity of probiotics.
Conclusion
Our study clarified that dietary supplementation
with two strains of probiotics is likely to contribute
to poultry health and increase growth performance in
chickens. Lactobacillus plantarum or BS supplementa-
tion reduced the mortality rate and positively affected
body weight gain and FCR, as well as decreased the
count of S. Typhimurium in the liver, spleen, and heart
of Noi broilers. On the other hand, there was minimal
evidence that probiotics affected carcass percentage or
related parameters. In addition, compared with anti-
biotic administration, the benefits of probiotics were
significantly more apparent. Although the combination
of the two probiotics did not exhibit a greater favorable
influence on most of the parameters examined, they
are a viable alternative to antibiotics in poultry produc-
tion, particularly in native Noi broilers.
Authors’ Contributions
TVBN, LHA, and NTN: Designed the exper-
imental procedures. TVBN, LHA, HTL, NT, LTTL,
and THD: Performed the experiments. TVBN, CTHT,
NHX, and NTN: Interpreted the data and prepared the
manuscript. All authors have read and approved the
final manuscript.
Acknowledgments
The study was funded in part by the Can Tho
University Improvement Project VN14-P6, sup-
ported by a Japanese ODA loan (Grant No. 04/
HĐ.VN14P6-NCKH.2018).
Competing Interests
The authors declare that they have no competing
interests.
Publisher’s Note
Veterinary World remains neutral with regard to
jurisdictional claims in published institutional affiliation.
2306
 Available at www.veterinaryworld.org/Vol.15/September-2022/23.pdf
References
1. Dipeolu, M., Eruvbetine, D., Oguntona, E., Bankole, O. and
Sowunmi, K. (2005) Comparison of effects of antibiotics
and enzyme inclusion in diets of laying birds. Arch. Zootec.,
54(205): 3–11.
2. Abudabos, A.M., Alyemni, A.H., Dafalla, Y.M. and
Khan, R.U. (2017) Effect of organic acid blend and Bacillus
subtilis alone or in combination on growth traits, blood
biochemical and antioxidant status in broilers exposed
to Salmonella Typhimurium challenge during the starter
phase. J. Appl. Anim. Res., 45(1): 538–542.
3. Arafat, N., Abd El Rahman, S., Naguib, D., El-Shafei, R.A.,
Abdo, W. and Eladl, A.H. (2020) Co-infection of Salmonella
Enteritidis with H9N2 avian influenza virus in chickens.
Avian Pathol., 49(5): 496–506.
4. Van Boeckel, T.P., Brower, C., Gilbert, M., Grenfell, B.T.,
Levin, S.A., Robinson, T.P., Teillant, A. and
Laxminarayan, R. (2015) Global trends in antimicrobial use
in food animals. Proc. Natl. Acad. Sci., 112(18): 5649–5654.
5. Van Boeckel, T.P., Glennon, E.E., Chen, D., Gilbert, M.,
Robinson, T.P., Grenfell, B.T., Levin, S.A., Bonhoeffer, S.
and Laxminarayan, R. (2017) Reducing antimicrobial use in
food animals. Science, 357(6358): 1350–1352.
6. Cuong, N.V., Nhung, N.T., Nghia, N.H., Hoa, N.T.M.,
Trung, N.V., Thwaites, G. and Carrique-Mas, J. (2016)
Antimicrobial consumption in medicated feeds in
Vietnamese pig and poultry production. Ecohealth, 13(3):
490–498.
7. Boerlin, P. and Reid-Smith, R.J. (2008) Antimicrobial resis-
tance: Its emergence and transmission. Anim. Health Res.
Rev., 9(2): 115–126.
8. Stanton, T.B. (2013) A call for antibiotic alternatives
research. Trends Microbiol., 21(3): 111–113.
9. Hernandez-Patlan, D., Solis-Cruz, B., Pontin, K.P.,
Hernandez-Velasco, X., Merino-Guzman, R., Adhikari, B.,
López-Arellano, R., Kwon, Y.M., Hargis, B.M. and
Arreguin-Nava, M.A. (2019) Impact of a Bacillus direct-
fed microbial on growth performance, intestinal barrier
integrity, necrotic enteritis lesions, and ileal microbiota in
broiler chickens using a laboratory challenge model. Front.
Vet. Sci., 6: 108.
10. Ateya, A.I., Arafat, N., Saleh, R.M., Ghanem, H.M.,
Naguib, D., Radwan, H.A. and Elseady, Y. (2019) Intestinal
gene expressions in broiler chickens infected with
Escherichia coli and dietary supplemented with probiotic,
acidifier and synbiotic. Vet. Res. Commun., 43(2): 131–142.
11. Nguyen, A., Nguyen, D., Tran, M., Nguyen, L., Nguyen, A.
and Phan, T.N. (2015) Isolation and characterization of
Bacillus subtilis CH 16 strain from chicken gastrointestinal
tracts for use as a feed supplement to promote weight gain
in broilers. Lett. Appl. Microbiol., 60(6): 580–588.
12. Menconi, A., Morgan, M.J., Pumford, N.R., Hargis, B.M.
and Tellez, G. (2013) Physiological properties and
Salmonella growth inhibition of probiotic Bacillus strains
isolated from environmental and poultry sources. Int. J.
Bacteriol., 2013 : 1-8.
13. Abd El-Hack, M.E., El-Saadony, M.T., Shafi, M.E.,
Qattan, S.Y., Batiha, G.E., Khafaga, A.F., Abdel-Moneim,
A.M.E. and Alagawany, M. (2020) Probiotics in poultry
feed: A comprehensive review. J. Anim. Physiol. Anim.
Nutr., 104(6): 1835–1850.
14. Attia, Y.A., Al-Harthi, M.A., El-Shafey, A.S., Rehab, Y.A.
and Kim, W.K. (2017) Enhancing tolerance of broiler
chickens to heat stress by supplementation with Vitamin E,
Vitamin C and/or probiotics. Ann. Anim. Sci., 17(4): 1155.
15. Wu, Y., Wang, B., Zeng, Z., Liu, R., Tang, L., Gong, L. and
Li, W. (2019) Effects of probiotics Lactobacillus plantarum
16 and Paenibacillus polymyxa 10 on intestinal barrier func-
tion, antioxidative capacity, apoptosis, immune response,
and biochemical parameters in broilers. Poult. Sci., 98(10):
5028–5039.
Veterinary World, EISSN: 2231-0916
16. Phuc, N.B. (2017) Isolation and selection of probiotic bac-
teria applied in poultry production. Biotechnology Research
and Development Institute, Can Tho University, Vietnam.
17. Knap, I., Kehlet, A., Bennedsen, M., Mathis, G., Hofacre, C.,
Lumpkins, B., Jensen, M., Raun, M. and Lay, A. (2011)
Bacillus subtilis (DSM17299) significantly reduces
Salmonella in broilers. Poult. Sci., 90(8): 1690–1694.
18. Gomes, A., Quinteiro-Filho, W., Ribeiro, A., Ferraz-de-
Paula, V., Pinheiro, M., Baskeville, E., Akamine, A.,
Astolfi-Ferreira, C., Ferreira, A. and Palermo-Neto, J.
(2014). Overcrowding stress decreases macrophage activ-
ity and increases Salmonella Enteritidis invasion in broiler
chickens. Avian Pathol., 43(1), 82–90.
19. Goliomytis, M., Panopoulou, E. and Rogdakis, E. (2003)
Growth curves for body weight and major component parts,
feed consumption, and mortality of male broiler chickens
raised to maturity. Poult. Sci., 82(7): 1061–1068.
20. El-Shall, N.A., Awad, A.M., El-Hack, M.E.A., Naiel, M.A.,
Othman, S.I., Allam, A.A. and Sedeik, M.E. (2020) The
simultaneous administration of a probiotic or prebiotic with
live Salmonella vaccine improves growth performance and
reduces fecal shedding of the bacterium in Salmonella-
challenged broilers. Animals (Basel), 10(1): 70.
21. Abd El-Ghany, W.A., El-Shafii, S.S., Hatem, M. and
Dawood, R.E. (2012) A trial to prevent Salmonella enterit-
idis infection in broiler chickens using autogenous bacterin
compared with probiotic preparation. J. Agric. Sci., 4(5):
91–108.
22. Cuong, N.V., Phu, D.H., Van, N.T.B., Truong, B.D.,
Kiet, B.T., Hien, B.V., Thu, H.T.V., Choisy, M.,
Padungtod, P. and Thwaites, G. (2019) High-resolution
monitoring of antimicrobial consumption in Vietnamese
small-scale chicken farms highlights discrepancies between
study metrics. Front. Vet. Sci., 6 : 174.
23. Sharma, P., Pande, V.V., Moyle, T.S., McWhorter, A.R. and
Chousalkar, K.K. (2017) Correlating bacterial shedding
with fecal corticosterone levels and serological responses
from layer hens experimentally infected with Salmonella
Typhimurium. Vet. Res., 48(1): 5.
24. Dina, M. and Hams, A. (2016) Effect of probiotic on
Salmonella Enteritidis infection on broiler chickens.
Egypt . J. Chem. Environ. Health, 2(2): 298–314.
25. Higgins, J.P., Higgins, S.E., Vicente, J.L., Wolfenden, A.D.,
Tellez, G. and Hargis, B.M. (2007) Temporal effects of lac-
tic acid bacteria probiotic culture on Salmonella in neonatal
broilers. Poult. Sci., 86(8): 1662–1666.
26. Dhama, K., Verma, V., Sawant, P., Tiwari, R., Vaid, R. and
Chauhan, R. (2011) Applications of probiotics in poultry:
Enhancing immunity and beneficial effects on produc-
tion performances and health-A review. Vet. Immunol.
Immunopathol., 13(1): 1–19.
27. Abdel-Moneim, A.M.E., Elbaz, A.M., Khidr, R.E.S.
and Badri, F.B. (2020) Effect of in ovo inoculation of
Bifidobacterium spp. on growth performance, thyroid activ-
ity, ileum histomorphometry, and microbial enumeration of
broilers. Probiotics Antimicrob. Proteins, 12(3): 873–882.
28. Qorbanpour, M., Fahim, T., Javandel, F., Nosrati, M., Paz, E.,
Seidavi, A., Ragni, M., Laudadio, V. and Tufarelli, V. (2018)
Effect of dietary ginger (Zingiber officinale Roscoe) and
multi-strain probiotic on growth and carcass traits, blood
biochemistry, immune responses and intestinal microflora
in broiler chickens. Animals (Basel), 8(7): 117.
29. Mehr, M.A., Shargh, M.S., Dastar, B., Hassani, S. and
Akbari, M. (2007) Effect of different levels of protein and
protexin on broiler performance. Int. J. Poult. Sci., 6(8):
573–577.
30. Zhang, Z.F., Cho, J.H. and Kim, I.H. (2013) Effects of
Bacillus subtilis UBT-MO2 on growth performance, relative
immune organ weight, gas concentration in excreta, and
intestinal microbial shedding in broiler chickens. Livest.
Sci., 155(2–3): 343–347.
31. Stefaniak, T., Madej, J.P., Graczyk, S., Siwek, M.,
2307
 Available at www.veterinaryworld.org/Vol.15/September-2022/23.pdf
Łukaszewicz, E., Kowalczyk, A., Sieńczyk, M.,
Maiorano, G. and Bednarczyk, M. (2020) Impact of pre-
biotics and synbiotics administered in ovo on the immune
response against experimental antigens in chicken broilers.
Animals (Basel), 10(4): 643.
32. Stęczny, K. and Kokoszyński, D. (2020) Effect of probiotic
preparations (EM) and sex on morphometric characteristics
********
Veterinary World, EISSN: 2231-0916
of the digestive system and leg bones, and caecal microflora
in broiler chickens. J. Appl. Anim. Res., 48(1): 45–50.
33. Malik, H.E., Hafzalla, R.H., Ali O.H.A., Elhassan M.M.O.,
Dousa, B., Ali, A.M. and Elamin, K.M. (2018) Effect of
probiotics and acidifiers on carcass yield, internal organs,
cuts and meat to bone ratio of broiler chicken. J. Agric. Vet.
Sci., 9(12): 18–23.
2308
Journal of Animal Husbandry Sciences and Technics (JAHST)
Editor in-Chief
Assoc. Prof. Dr. NGUYEN VAN DUC
Vice-Editors in-Chief
Assoc. Prof. Dr. NGUYEN DANG VANG
Dr. NGUYEN XUAN DUONG
Secretary:
Assoc. Prof. Dr. NGUYEN VAN DUC
Editorial members:
Dr. NGUYEN QUOC DAT
Assoc. Prof. Dr. HOANG KIM GIAO
Prof. Dr. NGUYEN DUY HOAN
Prof. Dr. DUONG NGUYEN KHANG
Assoc. Prof. Dr. NGUYEN THI KIM KHANG
Assoc. Prof. Dr. DO VO ANH KHOA
Assoc. Prof. Dr. DO DUC LUC
Prof. Dr. LE DINH PHUNG
Publishing Manager:
MSc. NGUYEN DINH MANH
U ammonia and hydrogen sulphide from poultry, goat and cattle manures and
Permission: Ministry of Information and
Communications of the Socialist
Republic of Vietnam 119/GP-
BTTTT date 26/1/2010
ISSN: 1859 - 476X
Publish: monthly
Office: Floor 4, 73 Hoang Cau, O Cho Dua,
Dong Da, Ha Noi
Telephone: 024.36290621
Fax: 024.38691511
E - mail: tapchichannuoi@hoichannuoi.vn
Website: www.hoichannuoi.vn
Account Name: Hoi Chan nuoi Viet Nam
Account Number: 1300 311 0000 40
Bene bank: Join Stock Commercial Bank
for Foreign Trade of Vietnam
(VietcomBank) - So Giao dich
branch
For VND 0011004132953
For USD 0011372112418
Swift code: 2296620 BFTVVNVX-011
Print 1000 copies, Size 19x27cm at Hoang Quoc
Viet Technology and Science Joint stock company.
Complete and legal copyrighting in August 2022.
No. 279 (Aug, 2022)
ANIMAL GENETICS AND BREEDING
Tran Trung Tu, Le Thanh Phuong, Nguyen Thiet and Nguyen Trong Ngu.
Molecular markers and their application for livestock production in Vietnam 2
Nguyen Duy Hoan, Tran Thi Hoan and Phan Thi Hong Phuc. Comparison of
performance and meat quality between two Sasso lines Low weight (SA51)
and height weight (SA31) reased by free range system 9
Phan Thi Tuoi, Nguyen Thai Anh, Ha Xuan Bo, Tran Xuan Manh, Nguyen
Van Phu, Nguyen Van Hung, Nguyen Hoang Thinh and Do Duc Luc.
Polymorphisms of candidate genes related to growth rate and meat quality
in Vietnamese native fatty pig breed “I” 16
Bui Huy Doanh, Nguyen Thi Huyen, Hoang Thi Hieu, Nguyen Van Trung,
Do Duc Luc and Nguyen Hoang Thinh. The morphological characteristics and
reproductive performance of Lang Dong Khe pig in Cao Bang province 22
Thi Kim Thao Nguyen and Ngoc Tan Nguyen. Expression of growth
differentiation Factor 9 gene in porcino ovarian tissue and cumulus oocyte
complexes at different stages maturation in vitro 27
Nguyen Ba Trung. Molecular analysis using mitochondrial DNA to infer the
formation process of Kazakhstan Kushum horse populations 33
ANIMAL FEEDS AND NUTRITION
Duong Nguyen Khang, Dang Hoang Dao, Tu Phuong Binh, Huynh Vu Duy
Khang, Nguyen Ba Khanh Tuong, Trinh Kim Phuong and Croize Paul-
Antoine. Influence of applying the Bacillus amyloliquefaciens, Pediococcus
pentosaceus and Pediococcus acidilatici bacterial strains in controlling
improving animal growth performance
Nguyen Thi Kim Khang, Doan Phuong Lam, Nguyen Van Truyen and Le
38
Thanh Phuong. Effect of different levels of premix supplementation on
reproductive yield and egg quality of Noi crossbred laying hens 44
Nguyen Thi Kim Khang, Le Hoa Hiep, Nguyen Van Truyen and Le Thanh
Phuong. The effect of protease enzyme supplementation at different levels
on carcass performance, meat quality and laying performance of Noi female
chickens 50
Nguyen Huynh Khang and Nguyen Ba Trung. Effect of supplementation
levels of Polyscias Filicifolia on growth performance and quality of Noi
chicken’s meat 57
Truong Thanh Trung, Tran Long Hai and Pham Thi Cam Nhung. Effects of
vitamin C supplementation in the drinking water on hematological indicators
of growing and reproductive doe rabbits 62
ANIMAL PRODUCTION
Nguyen Tuyet Giang, Do Vo Anh Khoa, Le Thi Thuy Hang and Nguyen
Thi Hanh Chi. Effects of spice herbs on the growth performance of Noi
chickens 70
Melanie Blanchard, Han Anh Tuan, Duc Do Van, Le Tien Dung and Le Thi
Thanh Huyen. Characterisation of large ruminant systems and their multiple
contribution in a highland commune, DienBien province 75
Nguyen Khanh Van, Vu Thi Thu Huong, Quan Xuan Huu, Phan Trung Hieu
and Pham Doan Lan. The effect of the estrous induction methods on the
estrous synchronization in goats 81
Vu Thi Anh Huyen, Do Thi Van Giang, Nguyen Van Binh and Nguyen
Thi Bich Nga. Clinical features and lesions in buffaloes infected with
Trypanosoma evansi 87
SCIENTIFIC NEWS
Overview the situation and orientation for development of livestock
production in Vietnam 2015-2021 93
Prof. Dr. Duong Nguyen Khang. Application on Black Soldier Fly (Hermetia
illucens) rearing technology as a tool to improve environment safety,
sustainability and rural development in South of Vietnam: Emphasis on
aquaculture production 96
 ANIMAL GENETICSANIMAL GENETICS AND BREEDING
AND BREEDING

MOLECULAR MARKERS AND THEIR APPLICATION FOR

LIVESTOCK PRODUCTION IN VIETNAM
Tran Trung Tu1, Le Thanh Phuong2, Nguyen Thiet1 and Nguyen Trong Ngu1*
Submitted: 12 May 2022 - Revised: 22 June 2022
Accepted: 24 June 2022
ABSTRACT
The advancement of molecular markers has opened new opportunities for livestock genetics
and breeding. These markers significantly impacted the study of animal and poultry genomes
to improve their traits of interest. The present paper provides a brief overview of some common
molecular markers (microsatellites, RFLP, SNP, In/Del) employed in biodiversity determination and
candidate gene identification and their uses for animal production and product quality in Vietnam.
Keywords: In/Del, microsatellites, molecular markers, RFLP, SNP.
TÓM TẮT
Ứng dụng của chỉ thị phân tử trên vật nuôi tại Việt Nam
Sự phát triển của các chỉ thị phân tử đã mở ra những cơ hội mới trong di truyền và chọn giống
vật nuôi. Những chỉ thị này đã có ảnh hưởng đáng kể trong công tác nghiên cứu bộ gen gia súc,
gia cầm nhằm cải thiện các tính trạng được quan tâm. Bài báo hiện tại giới thiệu tóm tắt một số chỉ
thị phân tử thông dụng (microsatellites, RFLP, SNP, In/Del) trong xác định đa dạng di truyền, xác
định những gen ứng viên và ứng dụng của chúng đối với năng suất và chất lượng sản phẩm vật
nuôi tại Việt Nam.
Từ khóa: Dấu phân tử, In/Del, microatellites, RFLP, SNP.

1. INTRODUCTION controlled by a single gene can be determined

Genotype-based breeding narrows the
generation gap by pre-selecting traits when
animals are young since genes allow trait
testing regardless of sex or age, increasing
accuracy when selecting difficult traits, and
reducing test populations or offspring via
immediate genotype selection. To achieve
targeted genetic improvement in livestock, the
genes controlling desirable and undesirable
traits must be characterized, which is not yet
complete. Marker-assisted selection (MAS) in
breeding helps to achieve this goal, especially
in cases where pedigree data are unavailable
and the targeted traits have low heritability
(Dentine, 1999).
Identifying genes that control specific
traits can be approached in several ways. Traits
1
Can Tho University, Vietnam
2
Emivest Feedmill Vietnam Co. Ltd
* Corresponding Author: Assoc. Prof. Nguyen Trong Ngu,
College of Agriculture, Can Tho University;
Tel: (84) 989828295; Email: ntngu@ctu.edu.vn
by observing variations through studying
physiology and the biochemical pathways
involved. For traits that are controlled by
multiple genes, genetic mapping can be used.
Maps with genes controlling specific traits
are generated using markers of associated
chromosomal regions. Identifying genes
that regulate traits by genetic mapping has
been done to locate the quantitative trait loci
on chromosomes and identify genes in that
region. Although not expected to significantly
improve traits with high heritability, MAS is
believed to be valuable in improving traits
with low heritability such as carcass and
reproduction traits.
2. SOME COMMON MOLECULAR MARKERS
2.1. Microsatellites
Microsatellites are tandemly repeated
tracts of DNA composed of 1-6 base pair
(bp) long units. Microsatellites loci are also
known as simple sequence repeats (SSR),

2 JAHST No. 279 (Aug, 2022)

ANIMAL GENETICS AND BREEDING
short tandem repeats (STR), simple sequence
tandem repeats (SSTR), and variable number
tandem repeats (VNTR), simple sequence
length polymorphisms (SSLP). They are
ubiquitous in prokaryotes and eukaryotes,
present even in the smallest bacterial genomes
(Field and Wills, 1996). Microsatellites can be
found anywhere in the genome, both in coding
and non-coding regions. Because of their high
mutability, microsatellites are thought to play
a significant role in genome evolution by
creating and maintaining quantitative genetic
variation. In promoter regions, the length of
SSRs may influence transcriptional activity
(Kashi et al., 1997). Hancock (1995) indicated
that SSRs in exons are less abundant than in
non-coding regions and that different taxa
exhibit different preferences for SSR types
(Tautz and Schlötterer, 1994).
The SSR approach offers multiple
advantages, including several alleles in a locus,
even distribution throughout the genome,
co-dominant direction, high polymorphism
and specificity, experiment reproducibility,
minimal DNA usage, low cost, and ease of
implementation. However, microsatellites
also have the following disadvantages:
high initial development expenses, lengthy
development times, and high development
costs. Mutations in the primer annealing sites
may cause misclassification of heterozygotes
as homozygotes when null alleles are present.
Microsatellite markers aid in the identification
of neutral biodiversity but provide no
information regarding the functional
characteristics of biodiversity (Teneva, 2009).
Currently, SSR is the indicator of choice for
forensic record studies, population genetics,
and wildlife studies.
2.2. Restriction fragment length
polymorphism
The RFLP marker, developed by Botstein
et al. (1980), uses bacterial restriction enzymes
to cut DNA molecules at specific recognition
sequences, typically 4-6bp long. Many
restriction enzymes have unique recognition
JAHST No. 279 (Aug, 2022)
sites. Variations in restriction enzyme
recognition sites were discovered by cleaving
genomic DNA with a restriction enzyme and
electrophoresizing the fragments. Numerous
segments were created to test simultaneously
because of the genome’s recognition sites.
The RFLP marker has a high degree
of polymorphism, is co-dominant, can
distinguish heterozygous and homozygous
individuals, and is highly repeatable. This
technique is commonly used for the detection
and identification of gene polymorphisms
and for recombinant DNA technology in
livestock (Beuzen et al., 2000). The PCR-RFLP
technique is performed by restricting the
PCR product of specific loci with one or more
restriction enzymes and separating the cut
DNA fragments on agarose or polyacrylamide
gels. Primer pairs are designed based on the
sequence information of the DNA or cDNA on
the Genbank. These are co-dominant markers
and are specific loci used to distinguish
homozygotes from heterozygotes (Konieczny
and Ausubel, 1993). PCR-RFLP is commonly
used in diagnostic testing to determine the
genotype in a known genetic mutation.
2.3. Single nucleotide polymorphisms
A single nucleotide polymorphism (SNP)
is a variation in the DNA sequence that occurs
at a single nucleotide in the genome (Scherf
and Pilling, 2015). SNP expression sites in the
genome are places where DNA sequences
are distinguished by a single base when
two or more individuals are compared. This
difference in nucleotides can lead to changes
in particular traits or phenotypes. SNPs are
by far the most common form of sequence
change in the genome.
Several reasons are responsible for the
growing emphasis on employing SNPs as
genetic analysis markers. First, they are more
prevalent than other forms of polymorphisms
and provide more possible markers near or
at any area of interest. For example, human
genomic DNA contains an SNP greater than
1,000bp (Landegren et al., 1998). Secondly,
3

some SNPs are positioned in the coding area
and influence the protein’s function directly.
These SNPs are directly responsible for some
interindividual variances in economically
significant features. In addition, SNPs
are more stable than microsatellites and
more dependable for genetic study than
microsatellites (Lipshutz et al., 1999).
Among the molecular markers, SNPs
are promising for association studies. These
markers are abundant and exhibit a low
mutation rate, which facilitates genotyping
(Chen and Sullivan, 2003). Many studies
have been performed on the association
between SNPs in candidate genes and
metabolic pathways in several species. For
example, Wong et al. (2004) identified 2.8
million SNPs in the chicken genome. This
abundance of available SNPs may aid in the
future mapping of causative polymorphisms
underlying complex traits in chickens. In
addition, stability and abundance made SNP
popular and interesting. SNP is a co-dominant
indicator; therefore, it may assess individual
genotypes in a population.
2.4. Insertion/Deletion
The Insert/Delete polymorphism,
abbreviated In/Del, is a type of genetic
variation in which a nucleotide can be inserted
or deleted in the nucleotide sequence of a gene.
Although not as common as SNPs, In/Dels are
common in the genome. In/Del includes a total
of 3 million of the 15 million known genetic
variations (1,000 Genomes Project Consortium,
2010). An In/Del in the coding region of the
gene that is not a multiple of 3 nucleotides
leads to a frameshift mutation. Shifting
reading frames and transcriptional sequences
of genes can code for a different amino acid or
lead to premature codon inactivation, altering
protein structure and function. An In/Del
can change the DNA sequence and shift the
framework, thereby altering the sequence of
amino acids produced, resulting in abnormal
protein production even if no protein is
produced.
4 JAHST No. 279 (Aug, 2022)
ANIMAL GENETICS AND BREEDING
The In/Del mutation is a source of genetic
variation, often segregated into short and long
In/Del due to different approaches to longer
variants. One short In/Del (less than 50bp) for
8 human SNPs (Wilson et al., 2001), represents
a ratio of variation. In/Del is believed to
contribute more to sequence diversity than
SNPs, regarding the number of distinct bases.
In addition, it has been suggested that a short
In/Del could be instrumental in maintaining
an optimal intron size.
3. APPLICATION OF GENETIC MARKERS FOR
LIVESTOCK IN VIETNAM
3.1. Biodiversity and conservation of animal
genetic resources
In cattle, Pham Doan Lan et al. (2008)
assessed the genetic diversity and genetic
structure of the cattle population in Ha Giang
province. A total of 23 microsatellites were used
to the genotype of 530 cattle individuals. The
results showed that 205 alleles were observed
in the total population. The allelic diversity
(average number of alleles per locus) was
8.9±2.05. The average observed and expected
heterozygosity for the population was 0.67
and 0.73, respectively. The polymorphic
information content (PIC) value of each locus
ranged from 0.50 to 0.84. The average genetic
variation between district cattle populations
was very low with an FST value of 0.013.
In chickens, Le Thi Thuy et al. (2009)
used 20 pairs of microsatellite primers to
study the genetic diversity of 5 local chicken
breeds in Vietnam (Ac, Choi, H’Mong, Ho,
and Tre chicken). The results showed that
the populations of these breeds were highly
diverse and the degree of genetic dispersion
among chicken populations was very large.
These five chicken breeds were divided
into 3 groups including (1) Tre chicken, (2)
Ac chicken, and (3) others, in which the
genetic distance of Choi and Ho chicken
was closest. In addition, Ngo Thi Kim Cuc
and Nguyen Van Ba (2019) assessed genetic
diversity and genetic differentiation between
Lac Son chicken and other native chicken
ANIMAL GENETICS AND BREEDING
breeds using 20 microsatellite markers. The
results indicated that microsatellite markers
studied were polymorphic with an average
of 6.73 alleles/locus. The genetic diversity
of Lac Son chicken was on the average level
with the expected heterozygosity of 0.60 and
the number of alleles/locus was 6.05. The
inbreeding coefficient of Lac Son chicken
was very low. The lowest genetic distance
was found between Lac Son chicken and
Dong Tao chicken but the highest genetic
distance was found between Lac Son chicken
and Tai Do chicken. Sub-structuring of the
Vietnamese chicken breeds was related to
their geographical distribution distance. Ri,
Dong Tao, and Mia chicken in the Red River
Delta were in the same group, while Lac
Son chicken in the northern central region
was separated and different from the Tai Do
chicken (Red Jungle Fowl) breed.
3.2. Identification of candidate genes
associated with economic traits
In pigs, several genes are associated with
weight gains such as HAL, GH, and LEP.
Nguyen Ngoc Tuan and Tran Thi Dan (2005)
reported that pigs carrying the HAL gene
with genotype “nn” had a low growth rate
but higher back fat thickness than “NN” or
“Nn” pigs. For imported pig breeds, carcass
ratio, carcass length, back-fat thickness, lean
percentage, and fat percentage did not differ
between genotypes “NN” and “Nn” but the
tenderloin area group of pigs “Nn” was larger
than pigs “NN” with significance (P<0.05). The
group of pigs with the gene “nn” adversely
affected reproductive parameters, while the
group of pigs “NN” had the highest number
of newborns per litter.
Nguyen Huu Tinh et al. (2020a) selected
the terminal sire pig line TS3 (Duroc)
performing with high production based
on testing the genotype of H-FABP, MC4R,
and PIT-1, and the evaluation of breeding
values estimated by the BLUP procedure and
genotype. In the 3rd generation, TS3 pigs were
improved remarkably for tested performance
JAHST No. 279 (Aug, 2022)
traits as compared to the original generation,
such as 932g for ADG, 10.8mm for BF, 63.8mm
for loin depth, 144.9 days for age to 100kg,
2.45 for FCR, 62.1% for lean meat and 3.22%
for intramuscular fat. Commercial crossbred
pigs used TS3 as terminal sires with 921 g
for ADG, 2.39 for FCR, and 61.4% for lean
meat. In addition, Nguyen Huu Tinh et al.
(2020b) selected 2 pig lines SS1 (Landrace)
and SS2 (Yorkshire), and parental crossbred
sows (SS12 and SS21) performing with high
reproduction based on identifying FSHB and
PRLR genotypes and evaluation of breeding
values were estimated by BLUP procedure.
Other markers associated with traits of interest
in pigs are shown in Table 1.
In chickens, Tran Xuan Hoan et al. (2000,
2001) analyzed GH gene polymorphisms in
local chicken breeds and concluded that there
was no association between genotypes and
egg production at 36 weeks of age and body
weight at 20 and 36 weeks old. Studying the
influence of PIT1 gene polymorphism on
performance traits of the Tau Vang chicken
breed, Le Thi Thu Ha et al. (2015) identified 3
genotypes AA, AB, and BB in the flock of Tau
Vang. The authors found only the effect of this
polymorphism on the egg weight of chickens,
in which hens carrying genotype AA gave
the highest egg weight. Recently, Tran Thi
Binh Nguyen et al. (2020) investigated SNP of
candidate genes in Lien Minh chickens with
the allele frequencies obtained were 0.97 and
0.03 for alleles A and G (GHi3), respectively;
in IGFBP2, 0.47 for the A allele and 0.53 for G;
in PIT1, 100% for allele B. These polymorphic
loci (GHi3, PIT1, and IGFBP2) followed the
Hardy-Weinberg equilibrium in the Lien
Minh chicken population. These were the
initial results, which could be used to analyze
the association of molecular markers and
grow traits in Lien Minh chickens. Other
studies related to growth traits in broilers,
egg producing traits in laying hens, and egg
quality characteristics in quails are presented
in Table 2.
5
 ANIMAL GENETICS AND BREEDING

Table 1. The association of some gene polymorphisms with economic traits in pigs
Genes Polymorphisms Traits Population Source
G714A Weight gain, tenderness of tenderloin
Nguyen Trong Ngu et al.
FTH1 Weight gain, color and pH of DP
T698C, G714A (2010)
tenderloin
Nguyen Trong
TNNI1 T5174C Driploss 45 min post-slaughter MC Ngu&Nguyen Thi Hong
Nhan (2012)
pH 45 min post-slaughter, the Nguyen Trong Ngu et al.
TNNC C716G MC
toughness of the meat (2013)
Nguyen Thi Kim Khang
pH 45 min post-slaughter, tenderloin
MYF5 A1205C MC and Nguyen Trong Ngu
weight
(2013)
The number of white blood cells, Do Vo Anh Khoa and
RYR1 C1843T red blood cells; crude protein YL Huynh Thi Phuong Loan
(tenderloin) (2013)
Back-fat thickness (neck); crude
Do Vo Anh Khoa et al.
H-FABP C1489T protein; water holding capacity YL
(2011)
(tenderloin)
Not associated with carcass Stress-resistant P
RYR1 C1843T performance traits, quality and (carries CC and Ha Xuan Bo et al. (2013)
chemical composition in meat CT genotypes)
Stress resistant P
RYR1 C1843T Improve reproductive performance CCxCC; P CCx D Do Duc Luc et al. (2013)
CC)

TNNI, TNNC: Troponin 1, C; MYF5: Myogenic Factor 5; RyR1: Ryanodine Receptor 1; H-FABP: Heart-type Fatty Acid
Binding Protein; FTH1: Ferritin Heavy-Chain; MC, DL, DY, LY, PL, PY (MC: MongCai, D: Duroc; Y: Yorkshire; L:
Landrace; P: Pietrain).

Table 2. Association of some SNP markers with important traits in poultry

Genes Polymorphism Traits Breed Source
I31391359D Egg yield, egg weight (5 months of laying)
NPY
C31394761T Hatching rate (5 months of laying) Noi Nguyen Trong Ngu et al.
C1715301T Egg yield (5 months of laying) chicken (2014)
VIPR-1
C1704887T Egg yield (5 months of laying)
Body length, breast angle and length, thigh Tau
C1549T Do Vo Anh Khoa et al.
Insulin length&ratio, abdominal fat ratio Vang
(2014)
C3737T Breast deep; carcass, thigh ratio; abdominal fat weight chicken
A3971G Carcass ratio, breast ratio, thigh ratio Tau
Do Vo Anh Khoa (2014)
C3199T weight gain, FCR, thigh ratio Vang
GH
Tau Do Vo Anh Khoa et al.
C3094 FCR
Vang (2014)
Tau
A662G pH 24, 48 hours post-slaughter (chicken breast meat) Do Vo Anh Khoa (2014)
Vang
FADS1 C391A The fatty acid composition in egg yolk
Japanese Nguyen Thi Kim Khang
The fatty acid composition in egg yolk (omega-6 and
FADS2 C953T quail (2006)
omega-3 PUFA)
Indel 358
Japanese Nguyen Trong Ngu et al.
Prolactin promoter (24 Number of chicks hatched (5 months of laying)
quail (2021)
nucleotides)

Notes: NPY (Neuropeptide Y); VIPR-1 (Vasoactive Intestinal Peptide Receptor 1); IGFBP2 (Insulin-like Growth Factor
Binding Protein 2); GH (Growth Hormone); FADS (Fatty Acid Desaturase).

6 JAHST No. 279 (Aug, 2022)

ANIMAL GENETICS AND BREEDING
4. CONCLUSIONS
Practically, molecular markers are
applicable to a variety of fields and animal
species. Within the scope of this paper, only
two topics are addressed: genetic diversity and
candidate genes in the primary target species
of pigs, chickens, and quails. In addition
to the aforementioned topics, molecular
markers have been researched in dairy cows
to enhance milk yield and quality. In addition,
recent research on potential genes associated
with disease resistance has been discussed.
When it comes to livestock production in
Vietnam, the use of molecular markers in
breeding is important, particularly for local
breeds, in order to increase productivity while
maintaining the product quality that satisfies
consumer demand.
REFERENCES
1. Beuzen N.D., Stear M.J. and Chang K.C. (2000).
Molecular markers and their use in animal breeding.
Vet. J., 160(1): 42-52.
2. Botstein D., White R.L., Skolnick M. and Davis R.W.
(1980). Construction of a genetic linkage map in man
using restriction fragment length polymorphisms. Am.
J. Hum. Genet., 32: 314-31.
3. Brookes A.J. (1999). The essence of SNPs. Genetics,
234(2): 177-86.
4. Chen X. and Sullivan P.F. (2003). Single nucleotide
polymorphism genotyping: biochemistry, protocol, cost
and throughput. Pharmacogenomics J., 3(2): 77-96.
5. Dentine M.R. (1999). Marker-assisted selection. In The
genetics of cattle (Fries R. and Ruvinsky A., eds). CABI
Publishing, New York, 497-10.
6. Do Vo Anh Khoa and Huynh Thi Phuong Loan (2013).
Skeletal ryanodine receptor gene associated with
chemical compositions of meat and physiochemical
parameters of blood. Biotechnol. in Anim. Husb., 29(3):
431-40.
7. Do Duc Luc, Ha Xuan Bo, Nguyen Chi Thanh, Nguyen
Xuan Trach and Vu Dinh Ton (2013). Reproductive
performance of othe nucleus herd of stress negative
Piétrain and Duroc swine raised at the animal farm of
Hanoi Uni of Agriculture. J. Sci. Dev., 11(1): 30-35.
8. Do Vo Anh Khoa (2012). Effects of C1032T single
nucletotide popymorphim of the IGFBP2 gene on meat
yield traits in Tau Vang chicken. Can Tho Uni. J. Sci.,
24b: 1-7.
9. Do Vo Anh Khoa (2014). Genetic polymorphism of the
C3199T GH gene associated with performance traits of
Tau Vang chicken meat. J. Anim. Sci. Technol., 51: 70-78.
10. Do Vo Anh Khoa, Nguyen Huy Tuong and Nguyen Thi
Dieu Thuy (2011). Effect of H-FABP genotype on blood
JAHST No. 279 (Aug, 2022)
physiological and biochemical traits, performance and
quality of pork. J. Sci. Dev., 4: 673-82.
11. Do Vo Anh Khoa, Nguyen Thị Kim Khang,
Nguyen Minh Thong and Le Thi Men (2014). The
polymorphism of the T3737C insulin gene associated
with some carcass traits of the Tau Vang chicken.
JAHST, 4: 12-19.
12. Field D. and Wills C. (1996). Long polymorphic
microsatellites in simple organisms. Pro. R. Soc. Lond,
263: 209-15.
13. Hancock J.M. (1995). The contribution of slippage-like
processes to genome evolution. J. Mol. Evol., 41: 1038-
47.
14. Ha Xuan Bo, Do Duc Luc and Dang Vu Binh (2013).
Effect of Halothane Genotype, Gender on Carcass
Characteristics and Meat Quality of Stress Negative
Piétrain Pigs. J. Sci. Dev., 11(8): 1126-33.
15. Kashi Y., King D. and Soller M. (1997). Simple
sequence repeats as a source of quantitative genetic
variation. Trends Genet., 13: 74-78.
16. Konieczny A. and Ausubel F.M. (1993). Procedure for
mapping Arabidopsis mutations using co-dominant
ecotype specific PCR-based markers. Plant. J., 4: 403-
410.
17. Landegren U., Nilsson M. and Kwok P.Y. (1998).
Reading bits of genetic information: methods for single
nucleotide polymorphism analysis. Genome Res., 8(8):
769-76.
18. Lipshutz R.J., Fodor S.P., Gingeras T.R. and Lockhart
D.J. (1999). High density synthetic oligonucleotide
arrays. Nature Genet., 21(1): 20-24.
19. Le Thi Thuy, Nguyen Trong Binh and Nguyen Van Ba
(2009). Genetic polymorphism analysis of five Vietnam
native Ac, Choi, Ho, H’mong and Tre chicken breed
using microsatellite. Vietnam J. Biotech., 7(4): 443-53.
20. Le Thi Thu Ha, Nguyen Thi Le Hang, Le Thi Thanh
Tam, Nguyen Thi Dieu Thuy and Nguyen Thi
Thu (2015). Effect of PIT1 gene polymorphism on
performance traits of Tau Vang chicken. JVN Agr. Sci.
Tech., 2(56): 114-20.
21. Nguyen Huu Tinh, Nguyen Van Hop, Tran Van
Hao, Pham Ngoc Trung and Nguyen Thi Lan Anh
(2020a). Production of sire line TS3 selected by EBV and
H-FABP, MC4R and PIT-1 genotypes. JAHST, 259: 2-7.
22. Nguyen Huu Tinh, Nguyen Van Hop, Pham Ngoc
Trung, Tran Van Hao and Nguyen Thi Lan Anh
(2020b). Reproduction of SS1 and SS2 dam lines and
parental crossbred sows selected by estimated breeding
values and FSHB, PRLR genotype. JAHST, 259: 7-13.
23. Nguyen Ngoc Tuan and Tran Thi Dan (2005). Effect of
Halothan gene, Estrogen receptor gene on reproductive
performance and meat quality. J. Agr. Sci. Tech., 2&3:
216-31.
24. Nguyen Thi Kim Khang (2006). Genetic factors
affecting the omega-3 and omega-6 fatty acid variation
in egg yolk. PhD thesis, Uni. of Bonn, Germany.
25. Nguyen Thi Kim Khang and Nguyen Trong Ngu
(2013). Effects of Myogenic Factor 5 (MYF5) gene on
carcass and meat quality of Mong Cai pigs. The Thai J.
Vet. Med., 43(2): 213-18.
7

26. Nguyen Trong Ngu and Nguyen Thi Hong Nhan
(2012). Analysis of troponin I gene polymorphisms and
meat quality in Mongcai pigs. S. Afr. J. Anim. Sci., 42(3):
288-95.
27. Nguyen Trong Ngu, Jennen D., Schellander K. and
Wimmers K. (2010). Gene expression and association
analysis of ferritin heavy-chain with growth and meat
quality in pigs. J. Sci. Dev., 8(2): 145-50.
28. Nguyen Trong Ngu, Nguyen Hong Xuan and Vu Chi
Cuong (2013). Analysis on the relationship between an
intronic polymorphism in Troponin C gene (TNNC1)
with pork quality traits. Int. J. Anim. Vet. Adv., 5(4):
156-59.
29. Nguyen Trong Ngu, Trang Thanh Gia, Chau Thanh
Vu, Luu Huynh Anh, Nguyen Thi Hong Nhan and
Nguyen Hong Xuan. (2014). Effect of Neuropeptide Y
gene on reproductive performance of Noi chicken. Sci.
Tech. J. Agr. Rur. Dev., 12: 128-33.
30. Nguyen Trong Ngu, Ly Thi Thu Lan, Nguyen Thi
Hong Nhan, Lam Thai Hung, Rachel L.S., Trang Thanh
Gia, Luu Huynh Anh and Nguyen Hong Xuan (2021).
Association of polymorphisms in prolactin receptor
and melatonin receptor 1c genes on egg production and
egg quality traits of Japanese quails (Coturnix coturnix
japonica). J. Anim. Pla. Sci., 31: 1559-67.
31. Ngo Thi Kim Cuc and Nguyen Van Ba (2019).
Assessment of genetic diversity of Lac Son chicken
using microsatellite markers. Vietnam J. Agr. Sci., 17(2):
117-25.
32. Pham Doan Lan, Nguyen Trong Binh, Vu Chi Cuong
and Jean-Charles M. (2008). Using microsatellite
technique to assess the genetic diversity and genetic
structure of cattle population in Ha Giang province.
VNU J. Sci., 24: 310-17.
8 JAHST No. 279 (Aug, 2022)
ANIMAL GENETICS AND BREEDING
33. Scherf B.D. and Pilling D. (2015). The Second Report
on the State of the World’s Animal Genetic Resources
for Food and Agriculture.
34. Tautz D. and Schlo¨tterer C. (1994). Simple sequences.
Curr. Opin. Genet. Dev., 4: 832-37.
35. Teneva, A. (2009). Molecular markers in animal genome
analysis. Biotech. Anim. Hus., 25(5-6): 1267-84.
36. Tran Thi Binh Nguyen, Nguyen Thi Thanh Tra, Pham
Thu Giang, Le Cong Toan, Nguyen Huu Duc, Nguyen
Thi Dieu Thuy, Nguyen Manh Linh, Hoang Thi Yen,
Vu Cong Quy, Vu Duc Quy and Nguyen Thanh Huyen
(2020). Genetic polymorphism in GH, IGFBP and PIT
genes of indigenous Lien Minh chickens. JAHST, 255:
8-13.
37. Tran Xuan Hoan, Nguyen Dang Vang and Pham Doan
Lan (2000). Analysis of the GH gene in Ri chickens by
PCR-RFLP. JAHST, 7(34): 22-23.
38. Tran Xuan Hoan, Nguyen Dang Vang and Trinh Xuan
Cu (2001). DNA polymorphisms of the intron I GH
gene in Mia chicken. JAHST, 3(37): 13-14.
39. Wilson T., Wu X.Y., Juengel J.L., Ross I.K.,
Lumsden J.M., Lord E.A., Dodds K.G., Walling G.A.,
McEwan J.C., O’Connell A.R., McNatty K.P. and
Montgomery G.W. (2001). Highly prolific Booroola
sheep have a mutation in the intracellular kinase
domain of bone morphogentic protein IB receptor
(ALK-6) that is expressed in both oocytes and granulosa
cells. Biol. Rep., 64(4): 1225-35.
40. Wong G.K., Liu B., Wang J., Zhang Y., Yang X. and
Zhang Z. (2004). A gentic variation map for chicken
with 2.8 million single nucleotide polymorphisms.
Nature, 432: 717-22.
 Occurrence of Marek's Disease in Backyard Chicken
Flocks in Vietnam

Authors: Viet Thu, Ho Thi, Trang, Huynh Ngoc, Phuoc Chien, Nguyen
Tran, Ngu, Nguyen Trong, and Hien, Nguyen Duc
Source: Avian Diseases, 66(2) : 1-7
Published By: American Association of Avian Pathologists
URL: https://doi.org/10.1637/aviandiseases-D-22-00009

BioOne Complete (complete.BioOne.org) is a full-text database of 200 subscribed and open-access titles
in the biological, ecological, and environmental sciences published by nonprofit societies, associations,
museums, institutions, and presses.

Your use of this PDF, the BioOne Complete website, and all posted and associated content indicates your
acceptance of BioOne’s Terms of Use, available at www.bioone.org/terms-of-use.

Usage of BioOne Complete content is strictly limited to personal, educational, and non - commercial use.
Commercial inquiries or rights and permissions requests should be directed to the individual publisher as
copyright holder.

BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit
publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to
critical research.

Downloaded From: https://bioone.org/journals/Avian-Diseases on 27 Jul 2022

Terms of Use: https://bioone.org/terms-of-use Access provided by Hokkaido University
 AVIAN DISEASES 66:000–000, 2022

Case Report—

Occurrence of Marek’s Disease in Backyard Chicken Flocks in Vietnam

Ho Thi Viet Thu,AC Huynh Ngoc Trang,A Nguyen Tran Phuoc Chien,A Nguyen Trong Ngu,A and Nguyen Duc HienABC
A
Can Tho University, Campus II, Area II, 3/2 Street, Xuan-Khanh Ward, Ninh-Kieu District, Can Tho City, Vietnam
B
Department of Animal Health, Can Tho City, Vietnam
Received 20 January 2022; Accepted 8 April 2022; Published ahead of print 7 July 2022

SUMMARY. Marek’s disease (MD) is a common lymphomatous and neuropathic disease of birds, especially chickens, and has
caused significant losses to chicken production as a result of high mortality and morbidity. This study aims to determine the status
of MD in backyard flocks in the Mekong Delta of Vietnam and to analyze clinical cases occurring during a year. The study was
carried out from August 2018 to July 2019, during which time 16 suspected cases of chicken flocks with MD were observed, 40
chickens were subjected to anatomopathological examination, and PCR was performed for diagnosis of MD and determination of
Marek’s disease virus (MDV) serotypes. The results showed that all of the examined flocks were confirmed as experiencing MD.
Nearly all cases were in an acute form with typical lesions of visceral lymphomas. Besides the presence of Marek’s disease virus
serotype 1 (MDV-1) from 100.0% of tested chicken flocks (16/16), nononcogenic turkey herpesvirus serotype 3 (MDV-3) was also
found from 8 of 16 (50.0%) of examined chicken flocks. Morbidity and mortality at sampling time varied from 1% to 42.11% and
0.6% to 10%, respectively. Chicken flocks with MD vaccination had lower morbidity and mortality. These first findings confirm
endemic MD in backyard chicken populations in Vietnam and confirm it continues to be a threat to chickens in backyard flocks
and poultry production in general.
RESUMEN. Presentación de la enfermedad de Marek en parvadas de pollos de traspatio en Vietnam.
La enfermedad de Marek (MD) es una enfermedad linfoproliferativa y neuropática común de las aves, especialmente de los pollos y
ha causado pérdidas significativas en la producción de pollos como resultado de la alta mortalidad y morbilidad. Este estudio tiene
como objetivo determinar el estado de la enfermedad de Marek en parvadas de traspatio en el delta del Mekong en Vietnam y analizar
los casos clı́nicos que ocurren durante un año. El estudio se llevó a cabo de agosto de 2018 a julio de 2019, tiempo durante el cual se
observaron 16 casos sospechosos de parvadas de pollos con enfermedad de Marek, 40 pollos fueron sometidos a examen
anatomopatológico y se les realizó PCR para el diagnóstico de enfermedad de Marek y determinación del serotipo del virus. Los
resultados confirmaron que todas las parvadas examinadas presentaban enfermedad de Marek y casi todos los casos presentaban una
forma aguda con lesiones tı́picas de linfomas viscerales, especialmente en el hı́gado. Además de la presencia del serotipo 1 del virus de
la enfermedad de Marek (MDV-1) en el 100% de las parvadas de pollos analizadas (16/16), también se encontró el serotipo 3 del
herpesvirus del pavo no oncogénico (MDV-3) en 8 de 16 (50.0 %) de las parvadas de pollo examinadas. La morbilidad y la
mortalidad en el momento del muestreo variaron del 1% al 42.11% y del 0.6% al 10%, respectivamente. Las parvadas de pollos con
vacunación contra la enfermedad de Marek tuvieron menor morbilidad y mortalidad. Estos primeros hallazgos confirman la presencia
endémica del virus de la enfermedad de Marek en las poblaciones de pollos de traspatio en Vietnam y confirman que continúa siendo
una amenaza para los pollos en parvadas de traspatio y para la producción avı́cola en general.
Key words: chicken, Marek’s disease, Vietnam, serotype
Abbreviations: HVT ¼ herpesvirus of turkey; MD ¼ Marek’s disease; MDV ¼ Marek’s disease virus; MDV-1 ¼ Marek’s disease
virus type 1; MDV-2 ¼ Marek’s disease virus type 2; MDV-3 ¼ Marek’s disease virus type 3; PM ¼ postmortem

Marek’s disease (MD) is a common lymphomatous and
neuropathic disease of chickens caused by an alphaherpesvirus
called the Marek’s disease virus (MDV). The disease was first
reported by Jozséf Marek (1). Before the use of vaccines, loss of the
MDV-infected flocks was estimated to range from 25% to 30%,
and occasionally as high as 60% (2). After the first vaccine was
introduced, vaccination has been the best choice for the prevention
and control of this disease (3). MD morbidity and mortality are
reduced, but vaccines now seem to be less effective due to
continuing evolution of virulence and the emergence of more
virulent pathotypes (4). In Vietnam, the majority of farm
operations have used vaccines for prevention, but MD outbreaks
have still occurred and caused a great impact on chicken production
due to high morbidity and mortality (5), and many backyard
chicken flocks have been reported carrying oncogenic Marek’s
C
Corresponding authors. E-mail: htvthu@ctu.edu.vn; ndhien@ctu.edu.vn
disease virus serotype 1 (MDV-1) (6). Although MD is a major
concern of industrial chicken production, many backyard chicken
raisers and extension workers are unaware of MD, and there are rare
reports on this disease, in particular, no literature in English about
MD in our country. Therefore, this study aims to investigate the
status of MD in chicken backyard flocks in the Mekong Delta,
Vietnam and to determine the types of MDVs circulating in
diseased chicken flocks.
MATERIALS AND METHODS
Study time and site. The study was conducted over a year, during
the period from August 2018 to July 2019, by examination of 16
chicken flocks that were suspected of being ill with MD by clinical signs
and macrolesions from five provinces (Tra Vinh, Hau Giang, Vinh
Long, Long An, and Can Tho) in the Mekong Delta. This study used
many examination methods to diagnose MD from the chicken flocks,

1
Downloaded From: https://bioone.org/journals/Avian-Diseases on 27 Jul 2022
Terms of Use: https://bioone.org/terms-of-use Access provided by Hokkaido University
 2 H. T. V. Thu et al.

Fig. 1. Liver with multisized (arrow) tumorous nodules (A) or enlargement whitish appearance with many times bigger than normal occupied
whole abdominal cavity (B), lung (C), and spleen (D) with multisized (circle) tumorous nodules; kidney (E) and heart (F) with lymphocyte tumors
(circle) which made the architecture deformed; multiple lymphomas in proventriculus (G), intestine (H), and hemorrhage at the tumors of
proventriculus and intestines (arrow).

including postmortem, histopathology examination, and conventional
PCR for viral DNA confirmation.
Postmortem. All diseased chickens and chicken carcasses from 16
MD suspicious flocks at visitations were subjected to postmortem (PM)
examination. The chicken’s carcasses were carefully observed, and gross
lesions were identified and recorded. Visceral organs with lymphomas of
40 chickens of these flocks were collected for further testing. The
samples collected included one or more varieties of tumorous tissues
(heart, liver, spleen, kidney, proventriculus, and intestine). Each sample
was divided into two parts; one was placed on ice, and the other was put
into a 10% formalin solution bottle and transported to the laboratory of
the Veterinary Medicine Department, College of Agriculture, Can Tho
University, for preparation of histopathological sections and PCR tests.
Information on 16 diseased chicken flocks was also surveyed in detail
using a questionnaire for collecting epidemiological data such as flock
population, chicken age, number of birds infected and died, vaccination
status (with or without MD vaccination, and type of MD vaccine), and
bird breeds. The number of birds infected and deceased was calculated
based on necropsy and carefully interviewing chicken owners to
minimize bias.
Histopathological examination. Samples of different organs of MD
suspected chickens were kept in 10% formalin until fixation,
dehydrated in ethanol (70%–100%), cleared in xylene, and embedded
in paraffin. The 5 lm thickness of the paraffin section was prepared and
labeled appropriately and thereafter deparaffinized and stained with
hematoxylin and eosin dyes. Finally, histopathological sections were
examined under a light microscope at 1003, 2003, and 4003 high-
powered fields.
Detection of MDVs with PCR. The tumors from the visceral organs
of each suspicious MD chicken were pooled into one for preparing a

Downloaded From: https://bioone.org/journals/Avian-Diseases on 27 Jul 2022

Terms of Use: https://bioone.org/terms-of-use Access provided by Hokkaido University
 Marek’s disease in backyard chicken flocks in Vietnam
Fig. 1. Continued.
homogenate. DNA was extracted from homogenates of the tissue
samples mixed using DNA TopPUREt Tissue viral extraction (ABT
Biomedical Solution Company, Vietnam). In total, 40 processed
samples were subjected to PCR, using serotype 1, 2, and 3 specific
primers. Commercial vaccines (CVI-998, SB-1, and HVT) were used as
positive for the MDV serotypes and synthetic DNA fragments,
sequences of primer pairs for detecting three serotypes (1, 2, and 3)
of MDVs, and PCR procedures performed following the research of
López-Osorio et al. (7). Conventional PCR was used to detect specific
MDV genes. Sets of specific oligonucleotide primers (Gallid herpesvirus
2 Meq, Gallid herpesvirus 3 gD, and Meleagrid herpesvirus 1 sORF 1
genes) were used to detect each of the MDV serotypes (Marek’s disease
virus type 1 [MDV-1], Marek’s disease virus type 2 [MDV-2], and
herpesvirus of turkey [HVT]) and their locations as in Supplemental
Table S1. Samples were considered positive for MDV-1, MDV-2, and
HVT by amplification of products of 1148, 1040, and 350 base pairs,
respectively.
RESULTS
Postmortem examination. In this present study, PM examination
of suspicious chickens revealed visceral lymphomas in one or more
of a variety of chicken internal organs. The most frequently reported
was from the liver with multisized tumorous nodules or enlargement
Downloaded From: https://bioone.org/journals/Avian-Diseases on 27 Jul 2022
Terms of Use: https://bioone.org/terms-of-use Access provided by Hokkaido University
3
with a grayish-whitish appearance and many times bigger than
normal (Fig. 1A–E), and hemorrhages occasionally were seen at the
tumorous proventriculus (Fig. 1G) and intestine (Fig. 1H). There
were only a few chickens that were collected from the flocks at the
ending outbreak periods that had grayish mild enlargement of the
sciatic nerve.
The histopathological examination. The histopathological chang-
es observed from tissue sections of internal organs (liver, lung,
kidney, heart, gizzard, and intestine) obtained from infected
chickens included infiltration and aggregation of lymphocytes at
different levels from mild to severe. They were gathered in a mass
(circle) or dispersed (arrow) among parenchyma or tissue of internal
organ cells (Fig. 2). Under the microscope, sections of internal
organs at 2003 magnification presented extensive infiltration round
neoplastic cells (Fig. 2A, B); at higher magnification (4003), there
was a proliferation of pleomorphic tumor cells (Fig. 2C, D) which
replaced and compressed the parenchyma or tissue cells leading to
distortion of tissue architecture.
Detection of MDVs by the polymerase chain reaction. In the
current study, 40 pooled internal organ samples of 40 chickens
suspected of having MD from 16 chicken flocks were subjected to
screening of MDV-1, MDV-2, and HVT by conventional PCR.
The results revealed that the MDV-1 oncogenic strain (Fig. 3A) and
 4 H. T. V. Thu et al.

Fig. 2. Microscopic lesions of internal organs; intensive infiltration of lymphocytic cells which focused (circle) or dispersed (arrow) among
hepatic parenchyma (A), and submucosa of the gizzard (B) at 2003 magnification; at higher magnification (4003), heart section (C) showing
infiltration of pleomorphic lymphocytes in the myocardium, and lung section (D) showing the proliferation of pleomorphic lymphocytes in the
alveoli (arrow) and around bronchiole (circle).

the HVT nononcogenic strain (Fig. 3B) were amplified from these MDV-1 from samples of internal organs having tumors. There were
pooled samples. 32/40 (80%) chickens that were positive with MDV-1. In addition,
The results of the PCR assays in Table 1 confirmed that all 16 HVT was also detected from 8 of 16 examined flocks; MDV-2 was
suspected flocks (100%) were involved with MD by detecting not detected.

Fig. 3. (A) Agar gel electrophoresis of PCR products of MDV-1; M: Marker 100 bp, well 1, 2, 3, and 4: positive samples, (): negative control,
(þ): positive control. (B) Agar gel electrophoresis of PCR products of Marek’s disease virus type 3 (MDV-3); M: Marker 100 bp, well 1, 2, 3, 4, 5, 6:
positive samples, (): negative control, (þ): positive control.

Downloaded From: https://bioone.org/journals/Avian-Diseases on 27 Jul 2022

Terms of Use: https://bioone.org/terms-of-use Access provided by Hokkaido University
 Marek’s disease in backyard chicken flocks in Vietnam 5
Table 1. Results confirming MD diagnosis by PCR and distribution of MD outbreaks by place.

No. No. No. No. No.

MDV-1–infected MDV-2–infected MDV-2–infected MDV-3–infected infected
Place birds (%) flocks (%) birds (%) flocks (%) birds (%)
Tra Vinh 10/11 (90.9) 0/4 (0) 0/11 (0) 2/4 (50) 4/11 (36.4)
Hau Giang 3/3 (100) 0/3 (0) 0/4 (0) 2/3 (75) 2/3 (75)
Vinh Long 6/6 (100) 0/2 (0) 0/4 (0) 0/2 (0) 0/6 (0)
LongAn 7/12 (58.3) 0/3 (0) 0/13 (0) 3/3 (100) 7/12 (58.3)
Can Tho 6/8 (80) 0/4 (0) 0/8 (0) 1/4 (25) 2/8 (25)
Total 32/40 (80) 0/16 (0) 0/40 (0) 8/16 (50) 15/40 (37.5)

Vaccination status and other epidemiological data collected from
16 flocks in this study are shown in Table 2. The data from Table 2
show that the age of affected birds ranged from 29 to 210 days, and
morbidity and mortality rates varied from 1% to 42.1% and 0.6%
to 20%, respectively. However, cumulative morbidity and mortality
would be higher due to these data being collected only one time at
sampling. Such studies of surveillance need to be conducted on a
regular and continuous basis to assess a more precise measure of the
economic losses from actual MD.
DISCUSSION
PM and histopathological examination. The results of PM
examination (Fig. 1) of diseased chickens showed that chickens had
lymphomatous tumors in visceral organs from every flock, and a few
chickens had lesions of neuritis at the end of the outbreak. In
addition, the best method for confirming the clinical cases of MD is
histopathological observation (8), which was also realized in this
study, and the specific microlesions of MD also were found in
tumorous visceral organs (Fig. 2) of diseased chickens by infiltration
and aggregation of lymphocytes. These results suggest that all of
these examined flocks were affected by ‘‘visceral lymphomatosis’’ or
acute form.
Detecting MDVs with the polymerase chain reaction. Although
specific macro and microlesions are quite enough to confirm MD
clinical cases (8). In some circumstances, MD can be misjudged with
reticuloendotheliosis and lymphoid leucosis, or other cancer
diseases. PCR is a quickly performed and accurate assay that can
demonstrate the presence of virus in the tumor that is sufficient to
make a positive diagnosis. In addition, PCR tests enable
differentiation of oncogenic (MDV-1) and nononcogenic strains
(MDV-2 and HVT) (9,10,11,12). MDV-1 is capable only of
inducing tumors. So the presence of MDV-1 from chickens bearing
tumors can lead to the conclusion that it is indeed MD in the
chickens. As the data in Table 1 show, MDV-1 positive chickens
were found in all 16 flocks (100.0%). All of the chickens from the
flocks in Hau Giang and Vinh Long were positive, but some in Long
An, Tra Vinh, and Can Tho were negative. This might suggest that
there were other cancer diseases such as conditions caused by
retroviruses, reticuloendotheliosis virus, and avian leucosis virus that
concurrently affected these flocks (3,13); other studies should be
conducted to clarify this situation. The presence of HVT may be a
natural infection, such as a latent infection from the vaccine virus
(14,15,16,17).
In the Mekong Delta, chicken production is mainly based on
middle- and small-scale operations with indigenous chicken breeds
for broilers and exotic breeds for layers. MD in chickens might be
due to lack of vaccination because the necessity is not commonly
realized by small chicken flock holders, but MD outbreaks have not
been rare in vaccinated flocks. The data in Table 2 show that 6 of 16
MD-positive flocks were vaccinated earlier. Vaccinations of birds

Table 2. Epidemiological measures of disease occurrence in MD-affected flocks.

Type of Chicken Population No. affected No. died Deaths/diseased

Flock no. Place chickens age (days) Vaccination status (birds) (%)A (%)A (%)
1 Tra Vinh Noi-Binhdinh 65 Cell-free HVT 1000 100 (10) 20 (2.0) 20
2 Tra Vinh Noi-Binhdinh 72 Cell-free HVT 2000 70 (3.5) 40 (2.0) 57.1
3 Tra vinh Noi-Binhdinh 75 None 2000 200 (10) 150 (7.5) 75
4 Tra vinh Noi 170 None 700 200 (28.6) 50 (7.14) 25
5 Hau giang Noi 45 None 300 49 (16.3) 10 (3.3) 20.4
6 Hau giang Noi 35 None 46 4 (8.7) 2 (4.4) 50
7 Hau giang Noi 105 None 500 100 (20) 50 (10) 50
8 Vinh Long Noi 200 None 1000 60 (6) 10 (1) 16.7
9 Vinh Long Noi 120 None 10 1 (10) 1 (10) 100
10 Long An Noi 65 None 1000 100 (10) 100 (10) 100
11 Long An IsaBrown 180 HVTþCVI-998/Rispens 50,000 1000 (2) 500 (1) 50
12 Long An IsaBrown 210 HVTþCVI-998/Rispens 49,600 500 (1) 300 (0.6) 60
13 Can Tho Noi-Binhdinh 90 Cell free HVT 2000 20 (1) 20 (1) 100
14 Can Tho Noi-Binhdinh 29 HVTþCVI-998/Rispens 3000 50 (1.7) 30 (1) 60
15 Can Tho Noi 40 None 38 16 (42.1) 3 (7.9) 18.8
16 Can Tho Noi 40 None 30 4 (13.3) 3 (10) 75
Total 113,224 2474 (2.19) 1289 (1.14) 52.1
A
The number of affected and dead chickens was achieved by interviewing the chicken raisers, observations, and necropsy of chickens during the
site visit.

Downloaded From: https://bioone.org/journals/Avian-Diseases on 27 Jul 2022

Terms of Use: https://bioone.org/terms-of-use Access provided by Hokkaido University
 6 H. T. V. Thu et al.
were mostly done by administering the vaccine to day-old birds
immediately after hatching with cell-free HVT or HVT combined
with MDV-1 (CVI-998/Rispens) vaccines and no booster was given.
However, the reason why the chickens were not protected against
MD although they were vaccinated was not investigated in this
study. Similar findings were reported by many researchers, who
reported that vaccination with either the MDV-1 or HVT vaccine
did not totally protect the chicken flocks against MD
(11,18,19,20,21). Failure of vaccination can come from mistakes
in the preparation, storage handling, and administration of the
vaccine. Besides, mistakes in poultry management can be made, such
as heavy and very early exposure to infection, chicken houses not
being well disinfected, or birds being reared for many cycles in the
same place without cleaning or disinfecting, etc. It was also reported
that vaccinated chickens may shed virulent virus into the
environment because of its immunosuppressive abilities, and
MDV-1 has evolved to become more competent in immune system
depression or evasion (22,23,24,25), and the evolution of MDV
virulence remains the major challenge for the control of the disease
(18,26).
Higher morbidity and mortality were found in unvaccinated
flocks (Nos. 10, 15, and 16). Shortly after the isolation of MDV in
the late 1960s vaccines were developed in many countries, and the
HVT vaccine was widely used in industrial poultry production (27).
The vaccination reduced the incidence of MD by 99% and was the
first successful vaccine against naturally occurring virus-induced
cancer (28), but in the late 1970s, HVT showed a limited effect on
viral infection and transmission (29). Currently, only the attenuated
MDV strain CVI-998-Rispens is effective in protecting against the
very virulent MDV.
In this study, the high mortality of MD chickens might be due to
the more virulent emerging MDVs (29); experimented infection of
MDV 6.13 strain in multiage chickens showed that mortality ranged
from 6.67% to 40%; the highest rate was in chickens that were
inoculated at 1 day old (5). In addition, MD chickens were found
with lesions of coccidiosis, colibacillosis, and roundworms. Infection
with pathogenic (MDV-1), nonpathogenic (MDV-2, HVT), or
vaccine strains not only results in activation of specific immunity but
may also cause immunosuppressive effects (30).
In this study, the morbidity and mortality of chickens in flocks
vaccinated with the bivalent vaccine (flocks No. 11, 12, and 14)
were lower than the others. This suggests there were very virulent
(vvMDV) and very virulent plus (vvþMDV) strains in the poultry
farm environment. Our data also provided evidence that MD has
caused large losses for chicken production in the Mekong Delta, and
vaccination alone cannot totally protect chickens from MDV. Most
of the chickens were raised in backyards or on a medium scale, and
chicken raisers had limited knowledge about disease prevention and
control, especially biosecurity. These matters lead to heavy
environmental pollution and bird immune suppression, which favor
the development of exposure to infectious pathogens. We also
witnessed MD happening in flocks with the subclinical infectious
bursal disease in the past, and all birds in flocks gradually died due to
MDV and other pathogens (unpublished data).
In this study, we also found that losses from MD of cross-breed
(from indigenous chicken lines, Noi-Binh Dinh) flocks were less
than those of pure Noi chicken flocks. The considerable variability
in the susceptibility to MD of different genetic strains of chickens
affecting losses has also been reported by many other researchers
(31,32,33). Nowadays, the increasing virulence of MDV may pose a
Downloaded From: https://bioone.org/journals/Avian-Diseases on 27 Jul 2022
Terms of Use: https://bioone.org/terms-of-use Access provided by Hokkaido University
threat to the standard MD prevention strategy, progressively
reducing the success of vaccine protection. The genetic resistance
to MD should be again considered, especially on small and medium
scales of chicken production in the Mekong Delta. As well,
revaccination should be realized; some studies reported that
revaccination (prime-boost), particularly with the cell-associated
MDV vaccine (CVI-998/Rispens) improved protection against the
disease and increased the magnitude of anti-MDV T cell responses
as demonstrated by enhancement of anti-MDV-neutralizing
antibodies and proliferation of CD4þ, CD8þ, and CD3þ T cells
(24,34,30).
CONCLUSION
These data are the first findings to confirm MD in the Mekong
Delta and show that it continues to be a threat to chicken
production in general. Thus, it is essential to develop sustainable
vaccine strategies and strict biosecurity practices. This has been
achieved by adopting all-in–all-out methods of production, high
standards of husbandry, good sanitation and biosecurity, especially
the prevention of early MDV exposure.
Supplemental data associated with this article can be found at
https://docs.google.com/document/d/1-2w0vwx3XSaOTdMhb
TryoumPu2nREfC0/edit.
REFERENCES
1. Marek J. Multiple Nervenentzündung (Polyneuritis) bei Hühnern
[Multiple inflammation of the nerves (polyneuritis) in chickens]. Dtsch
Tierärztl Wschr. 15:417–421; 1907. [in German].
2. Schat KA, Nair V. Marek’s disease. In: Saif YM, Fadly YM, Glisson
JR, McDougald LR, Nolan LK, Nolan LK, Swayne DE. Diseases of poultry.
12th ed. Ames (IA): Blackwell Publishing. p. 452–514; 2013.
3. Davidson I, Borenstein V. Multiple infection of chickens and turkeys
with avian oncogenic viruses: prevalence and molecular analysis. Acta Virol.
43:36–142; 1999.
4. Biggs PM, Nair V. The long view: 40 years of Marek’s disease
research and Avian Pathology. Avian Pathol. 41:3–9; 2012.
5. Quyet HV, Tam PT, Hoat PC, Tuyen NQ. [Determination of
pathological characteristics of a Marek’s disease virus strain in chickens]. J
Agric Rural Dev Viet Nam 283:28–36; 2016. (in Vietnamese).
6. Thu HTV, Dong NT, Thu VNM, Trang HN. [Circulating of
Marek’s disease virus in indigenous chickens in Dong Thap province]. J
Anim Sci Tech Viet Nam 263:70–76; 2021. (in Vietnamese).
7. López-Osorio S, Villar D, Piedrahita D, Ramı́rez-Nieto G, Nair V,
Baigent S, Chaparro Gutiérrez J. Molecular detection of Marek’s disease
virus in feather and blood samples from young laying hens in Colombia.
Acta Virol. 63:380–391; 2017.
8. [OIE] World Organisation for Animal Health. Marek’s disease. In:
Terrestrial manual. Paris (France): OIE [accessed 7 Jan 2022]. https://www.
oie.int/fileadmin/Home/fr/Health_standards/tahm/3.03.13_MAREK_DIS.
pdf; 2018.
9. Becker Y, Asher Y, Tabor E, Davidson I, Malkinson M, Weisman Y.
Polymerase chain reaction for differentiation between pathogenic and non-
pathogenic serotype 1 Marek’s disease viruses (MDV) and vaccine viruses of
MDV-serotypes 2 and 3. J Virol Methods 40:307–322; 1992.
10. Bumstead N, Sillibourne J, Rennie M, Ross N, Davison F.
Quantification of Marek’s disease virus in chicken lymphocytes using the
polymerase chain reaction with fluorescence detection. J Virol Methods
65:75–81; 1997.
11. Handberg KJ, Nielsen OL, Jorgenesen PH. The use of serotype 1
and serotype 3 specific polymerase chain reaction for the detection of Marek
s disease virus in chickens. Avian Pathol. 30:243–249; 2001.
12. Zhu GS, Ojima T, Hironaka T, Ihara T, Mizukoshi N, Kato A,
Ueda S, Hirai K. Differentiation of oncogenic and non-oncogenic strains of
 Marek’s disease in backyard chicken flocks in Vietnam
Marek’s disease virus type 1 by using polymerase chain reaction DNA
amplification. Avian Dis. 36:637–645; 1992.
13. Chacón RD, Astolfi-Ferreira CS, Guimarães MB, Torres LN, De la
Torre DI, Sá LRM, Diantino Ferreira AJ. Detection and molecular
characterization of a natural coinfection of Marek’s disease virus and
reticuloendotheliosis virus in Brazilian backyard chicken flock. Vet Sci. 6:2–
14; 2019.
14. Rémy M, Pape GL, Gourichon D, Gardin Y, Denesvre C. Chickens
can durably clear herpesvirus vaccine infection in feathers while still carrying
vaccine-induced antibodies. Vet Res. 51:24; 2020.
15. Fakhrul Islam AF, Walkden-Brown SW, Groves PJ, Underwood
GJ. Kinetics of Marek’s disease virus (MDV) infection in broiler chickens 1:
effect of varying vaccination to challenge interval on vaccinal protection and
load of MDV and herpesvirus of turkey in the spleen and feather dander
over time. Avian Pathol. 37:225–235; 2008.
16. Islam A, Walkden-Brown SW. Quantitative profiling of the
shedding rate of the three Marek’s disease virus (MDV) serotypes reveals
that challenge with virulent MDV markedly increases shedding of vaccinal
viruses. J Gen Virol. 88:2121–2128; 2007.
17. Nguyen TV, Ahaduzzaman M, Campbell DLM, Groves PJ,
Walkden Brown SW, Gerber PF. Spatial and temporal variation of Marek’s
disease virus and infectious laryngotracheitis virus genome in dust samples
following live vaccination of layer flocks. Vet Microbiol. 216:108393; 2019.
18. Jayalakshmi K, Selvaraju G. Epidemiology of Marek’s disease in
commercial layer flocks. J Cell Tissue Res. 16:5811–5815; 2016.
19. Bell AS, Kennedy DA, Jones MJ, Cairns CL, Pandey U, Dunn PA,
Szpara ML, Read AF. Molecular epidemiology of Marek’s disease virus in
central Pennsylvania. USA Virus Evol. 5:1–13; 2019.
20. Kamaldeep, Sharma PC, Jindal N, Narang G. Occurrence of
Marek’s disease in vaccinated poultry flocks of Haryana (India). Int J Poult
Sci. 6:372–377; 2007.
21. Othman I, Aklilu E. Marek’s disease herpesvirus serotype 1 in
broiler breeder and layer chickens in Malaysia. Vet World 12:472–476;
2019.
22. Burnside J, Morgan R. Emerging roles of chicken and viral
microRNAs in avian disease. BMC Proc. 5:2–5; 2011.
23. Davison F, Nair V. Use of Marek’s disease vaccines: could they be
driving the virus to increasing virulence? Expert Rev Vaccines 4:77–88; 2005.
24. Gimeno IM. Marek’s disease vaccines: a solution for today but a
worry for tomorrow? Vaccine. 26:31–41; 2008.
Downloaded From: https://bioone.org/journals/Avian-Diseases on 27 Jul 2022
Terms of Use: https://bioone.org/terms-of-use Access provided by Hokkaido University
7
25. Torres ACD, Marin SY, Costa CS, Martin NRS. An overview on
Marek’s disease virus: evolution and evidence for increased virulence in
Brazil. Braz J Poult Sci. 21:1–10; 2019.
26. Nair V. Spotlight on avian pathology: Marek’s disease. Avian
Pathol. 47:440–442; 2018.
27. Schat KA. History of the first-generation Marek’s disease vaccines:
the science and little-known facts. Avian Dis. 60:715–724; 2016.
28. Boodhoo N, Gurung A, Sharif S, Behboudi S. Marek’s disease in
chickens: a review with focus on immunology. Vet Res. 47:1–19; 2016.
29. Dunn JR, Auten K, Heidari M, Buscaglia C. Correlation between
Marek’s disease virus pathotype and replication. Avian Dis. 58:287–292;
2014.
30. Bacon LD, Hunt HD, Cheng HH. Genetic resistance to Marek’s
disease. Curr Top Microbiol Immunol. 255:121–141; 2001.
31. Emara MG, Abdellatif MA, Pollock DL, Sadjadi M, Cloud SS,
Pope CR, Rosenberger JK, Kim H. Genetic Variation in susceptibility to
Marek’s disease in a commercial broiler population. Avian Dis. 45:400–409;
2001.
32. Sharma JM, Stone HA. Genetic resistance to Marek’s disease.
Delineation of the response of genetically resistant chickens to Marek’s
disease virus infection. Avian Dis.16:894–906; 1972.
33. Wu C, Gan J, Jin Q, Chen C, Liang P, Wu Y, Liu X, Ma L,
Davison F. Revaccination with Marek’s disease vaccines induce productive
infection and superior immunity. Clin Vaccine Immumol.16:184–193; 2009.
34. Islam AFMF, Wong CW, Walkden-Brown SW, Colditz IG, Arzey
KE, Groves PJ. Immunosuppressive effects of Marek’s disease virus (MDV)
and herpesvirus of turkeys (HVT) in broiler chickens and the protective
effect of HVT vaccination against MDV challenge. Avian Pathol. 31:449–
461; 2010.
ACKNOWLEDGMENTS
This study is funded in part by the Can Tho University
Improvement Project VN14-P6 supported by a Japanese ODA loan,
Program A-10. The authors declare that there are no conflicts of
interest. Ho Thi Viet Thu and Nguyen Duc Hien designed and
wrote the manuscript. Nguyen Trong Ngu, Huynh Ngoc Trang and
Nguyen Tran Phuoc Chien collected samples and analyzed and
interpreted data. All authors approved the final manuscript.
 Livestock Research for Rural
Development

The peer-reviewed international journal for research

into sustainable developing world agriculture

Published by Fundación CIPAV, Cali, Colombia

Volume 34, On-line Edition

Issue 1 (January)

Issue 2 (February)

Issue 3 (March)

Issue 4 (April)

Issue 5 (May)

Issue 6 (June)

Issue 7 (July)

Issue 8 (August)

Issue 9 (September)

Issue 10 (October)

Issue 11 (November)

ISSN 0121-3784
Back to LRRD Home page

Livestock Research for Rural Development, Volume 34, Number 11,

November 2022 ISSN 0121-3784

Contents
Papers:
97. Evaluation of the effects of Spinosum Seaweed on the growth performance of
broiler chickens: A case study in Zanzibar; F A Kessi and L C Mwaipopo

98. Productive performance of dairy Mambí de Cuba cows in a silvopastoral

system; Onel López-Vigoa, Roberto García-López, Luis Lamela-López, Luis M
Fraga-Benítez, Arelis Hernández-Rodríguez, Yenny García-Orta, Tania
Sánchez-Santana and Jesús M Iglesias-Gómez

99. Modeling of greenhouse gas emissions caused by the application of bovine

excreta to the soil; W F Ordoñez, S L Posada-Ochoa, D M Bolívar and R
Rosero-Noguera (In spanish)

100. Productive behavior of bovine males in silvopastoral system with Tithonia

diversifolia; J Iraola, Yenny García, L M fraga, D Gutiérrez, Delia M Cino, M
Barros-Rodríguez, J L Hernández and D Albelo (In spanish)

101. The Siboney de Cuba cattle: a review of studies conducted on the breed; Anel
Ledesma-Rodríguez, Filippo Cendron, Dervel Felipe Díaz-Herrera, Yuset
Fonseca-Rodríguez, Odalys Uffo Reinosa and Mauro Penasa

102. Effect of replacement of fishmeal-based diet by full-fat or defatted black soldier

fly larvae (Hermetia illucens) meal in diets on performance of Asian seabass
(Lates calcarifer) juvenile in fresh and brackish water; Pham Thi Phuong Lan,
Le Duc Ngoan and Nguyen Duy Quynh Tram

103. Growth and initial development of native trees in a silvopastoral arrangement in

La Guajira, Colombia; Darwin Fabian Lombo Ortiz, Jaime Andrés Arias Rojas,
Milton Rivera Rojas, Adelina Rosa Caballero Lopez, Clara Viviana Rúa
Bustamante and Cristian Camilo Hernandez Martinez (In spanish)

104. Plant species used by Melipona eburnea bees in seasonally-flooded

agroforestry systems in the Peruvian Amazon; Cesar Delgado, Paul V A Fine
and Gladis Atías

105. Silage made from leaves and petioles of Taro (Colocasia esculenta) supported
better growth and feed conversion in crossbred cattle than silage made from
maize stover; Tran Hoan Qui, Nguyen Trong Ngu, Nguyen Thi Hong Nhan and
Nguyen Thiet

106. Optimization of induced breeding of Clarias gariepinus using different sources

of water; Ataguba Gabriel Arome, Okomoda Victor Tosin and Ukpong Prince
 Livestock Research for Rural Development 34 (11) LRRD LRRD Guide for preparation of LRRD Citation of this
2022 Search Misssion papers Newsletter paper

Silage made from leaves and petioles of Taro (Colocasia esculenta) supported better
growth and feed conversion in crossbred cattle than silage made from maize stover
Tran Hoan Qui, Nguyen Trong Ngu1, Nguyen Thi Hong Nhan1 and Nguyen Thiet2
Sub-Department of Animal Husbandry, Animal Health and Fisheries of Dong Thap province, Cao Lanh City, Dong Thap Province,
Vietnam
nthiet@ctu.edu.vn
1 College of Agriculture, Can Tho University, Can Tho City, Vietnam
2 College of Rural Development, Can Tho University, Can Tho City, Vietnam

Abstract
The aim of this study was to evaluate the effects of replacing maize stover silage by Taro petiole and leaf (TPL) silage on the growth
of crossbred cattle. The experiment was designed as a completely randomized block with 12 crossbred cattle (182±15 kg) with 4
treatments including 100% of maize stover silage (MS) and maize stover replaced by Taro leaf and petiole silage (TPL) at 25, 50, and
75%. The inclusion of 75% TPL silage in the diet resulted in higher feed intake and improved live weight gain and feed conversion.

Keywords: baby corn, cattle, maize stover, oxalate, taro petiole and leaf

Introduction
Taro or cocoyam (Colocasia esculenta) is a potential tropical food crop because of its high yield of roots (or stems) and foliage. Taro
is used as animal feed in all tropical countries including Vietnam. It is a plant that usually grows or naturally develops near the house,
forests, ponds, streams, and canals (Buntha et al 2008). Taro leaves contain β-carotene, iron, and folic acid, which help fight against
anemia and are an important source of proteins and vitamins (Sukamoto 2003). The restrictions in taro leaves are anti-nutrient factors
such as cyanogenic glycosides, trypsin inhibitors, mimosine, goitrogens, oxalic acid, tannins, and saponins (Ogle 2006). Fresh taro
leaves are rich in calcium oxalate (443-589 mg/100 g fresh weight) (Oscarsson and Savage 2007). Calcium oxalate causes itching on
the skin and mouth. The content of calcium oxalate can be reduced by boiling or fermentation. During incubation, the oxalic acid
decrease has been reported to range from 79 to 86% (Chittavong et al 2008). An appropriate ensiling method has been published
recently by Hung et al (2020).

Taro leaf can replace up to 70-75% fishmeal protein with higher feed intake and N retention than 100% protein from fishmeal or
fermented taro leaves (Buntha et al 2008). In Laos, taro leaves are commonly used as pig feed, and farmers harvest taro leaves in the
wild or from their gardens and cook with maize, rice bran, cassava roots, and vegetables before feeding the pigs. Phengsavanh et al
(2010) reported that the inclusion of 46% of taro leaves in the diets of native pigs in upland areas was the highest level of inclusion
recorded for any plant material. Previous studies have shown that it is possible to feed pigs with taro leaf silage without adversely
affecting their performance and health, and it can be used as a substitute for protein-rich animal feed fish meal (Buntha et al 2008) and
soybean meal (Hang and Preston 2009). However, information on using taro petiole and leaf silage in cattle is still limited.

Materials and methods

Twelve male crossbred cattle (Brahman x crossbred Sindhi) with an average body weight of 182±15 kg at 12-14 months of age were
allotted to a completely randomized block design, consisting of four treatments and three replicates. TPL silage substituted maize
stover based on the formulation of 79.5% fresh TPL, 20% rice bran, and 0.5% salt during 30 days (Hung et al, 2020). All cattle were
additionally fed 1 kg rice bran/head/day and the study lasted for 90 days. The treatments were:

TPL0): 100% maize stover (Ms), baby corn harvest (Control)

TPL25): 25% TPL silage + 75% Ms (based on DM)

(TPL50): 50% TPL silage + 50% Ms (based on DM)

TPL75): 75% TPL silage + 25% Ms (based on DM)

The ingredients and chemical composition of the experimental diets are presented in Table 1. Cattle were fed twice daily at 07:00 and
15:00 and had free access to water. All animals were kept in individual pens with cement floors. Cattle were vaccinated against
Pasteurellosis, foot and mouth disease, and de-wormed before starting the experiment.
 Table 1. Nutritional value of ingredients and the experimental diets
DM, DM basis ME, Mcal/kg
Items
% CP, % CF, % of DM
Maize stover 22.8 10.7 29.1 2.27
Rice bran 91.2 16.5 13.8 2.76
Taro petiole and leaf
14.8 13.5 20.0 2.50
silage
TPL0 33.8 10.2 28.9 2.28
TPL25 32.3 11.1 26.7 2.34
TPL50 30.9 12.0 24.5 2.39
TPL75 29.9 12.9 22.2 2.45
DM: Dry matter; CP: Crude protein; CF: Crude fibre; ME: Metabolizable
Energy

Feed and feed refusal were recorded daily. At the end of the study, all samples were analyzed for dry matter (DM), ash, and crude
protein (CP) according to AOAC (2005). All animals were weighed at the beginning of the experiment and once a month throughout
the experiment period. Measurements were DM intake, CP intake, body weight (BW) gain, and feed conversion ratio (FCR).

Statistical analysis
The data were subjected to analysis of variance using the General Linear Model procedure of Minitab software version 16.2.1. Tukey's
pairwise comparisons (p<0.05) were applied to determine the differences between dietary treatments.

Results and discussion

Table 2. Effect of different levels of TPL silage on intake, body weight gain and feed conversion
ratio
Treatment
SEM p
Control TPL25 TPL50 TPL75
Initial body weight (kg/head) 181 181.3 182 182 5.10 1.000
Final body weight (kg/head) 237 242.3 245 245.2 4.85 0.630
DM intake (kg DM/100 kg BW) 2.46c 2.79bc 3.16ab 3.51a 0.12 0.003
CP intake (kg CP/100 kg BW) 0.30c 0.35bc 0.41ab 0.47a 0.01 0.001
Daily weight gain (kg/head) 0.62b 0.68a 0.70a 0.70a 0.01 0.001
Feed conversion ratio 8.20b 8.64ab 9.55ab 10.7a 0.45 0.030
abc Means in the same row without sharing a letter are different at p<0.05.

TPL included up to 75% of the control diet resulted in better feed intake and live weight gain (Table 2; Figure 1).

Feed intake, live weight gain fed conversion were all improved as when there were fed silage with increasing proportions of Taro leaf
and petiole silage.

The cattle ate increasing amounts of silage (Figure 1) when it was made by replacing baby corn (maize) silage with silage made from
Taro leaf and petiole (Figure 1). Improvements were also recorded in live weight gain and feed conversion (Figures 2 and 3) when taro
replaced maize as the source of silage.

Improvements were also recorded.

Figure 1. Effect of Taro silage on DM intake Figure 2. Effect of Taro silage on live weigh gaing
 Figure 3. Effect of Taro silage on feed conversion

Conclusions
Silage of Taro leaves and petioles can replace up to 75% of maize stover (at baby corn harvest) for growing cattle with an
increase in feed intake and improvement is body weight gain and feed conversion.

References
AOAC 2005 Official Methods of Analysis of AOAC International. 18th ed. Association of Official Analytical Chemists, Ed. Arlington.

Buntha P, Borin K, Preston T R and Ogle B 2008 Effect of Taro (Colocasia esculenta) leaf silage as replacement for fish meal on feed intake and growth
performance of crossbred pigs. Livestock Research for Rural Development, 20. http://www.lrrd.org/lrrd20/supplement/bunt3.htm

Chittavong C, Preston T R and Ogle B 2008 Ensiling leaves of Taro (Colocasia esculenta (L.) Shott) with sugar cane molasses. Livestock Research For Rural
Development 20. http://www.lrrd.org/lrrd20/supplement/mala1.htm

Hang D T and Preston T R 2009 Taro (Colocacia esculenta) leaves as a protein source for growing pigs in Central Viet Nam. Livestock Research for Rural
Development 21(10). http://www.lrrd.org/lrrd21/10/hang21164.htm

Hung L T, Lan L T T, Thu N T A, Thiet N, Mo T T H, Nhan N T H and Ngu N T 2020 Effects of wilting and rice bran supplementation on the quality of taro
(Colocasia esculenta) leaf and petiole silage. Livestock Research for Rural Development 32(5). http://www.lrrd.org/lrrd32/5/ntngu32082.html

Ogle B 2006 “Forage for pigs: nutritional, physiological and practical implication”. Workshop-seminar “Forages for Pigs and Rabbits” MEKARN-CelAgrid,
Phnom Penh, Cambodia, 22-24. http://www.mekarn.org/proprf/ogle.htm

Oscarsson K V and Savage G P 2007 Composition and availability of soluble and insoluble oxalates in raw and cooked taro (Colocasia esculenta var. Schott)
leaves. Food Chemistry 101(2), 559-662. https://doi.org/10.1016/j.foodchem.2006.02.014

Phengsavanh P, Ogle B, Stur W, Frankow-Lindberg B E and Lindberg J E 2010 Feeding and performance of pigs in small-holder production systems in
Northern Lao PDR. Tropical AnimalHealth and Production, 42, 1627–1633. https://doi.org/10.1007/s11250-010-9612-4

Sukamoto L A 2003 Development of early maturing and leaf blight resistant cocoyam (Colocasia esculenta (L.) Schott) with improved taste. In Proceedings of
final research coordinated meeting organized by the joint FAO/IAEA division of nuclear technique in food agriculture held in Pretoria, South Africa (pp. 19-23).

Received 10 September 2022; Accepted 6 October 2022; Published 1 November 2022

3/28/22, 3:42 PM Current Issue

Join Us
Journal of Animal Health and CiteScore
SCOPUS
2020

Production
Search
0.4
Submit or Track your Manuscript LOG-IN

Home Authors Reviewers Editorial Workflow About Us eAlerts Contact Us

Current Issue

About the Journal

Research Article Submit to
Journal Of Animal Health
Molecular Detection and Characterization of Pasteurella multocida Isolated from And Production
Editorial Board
Rabbits
Current Issue Eman H. Mahrous, Mohamed. W. Abd Al -Azeem, Faisal A. Wasel, Waleed Younis
Review for
J. Anim. Health Prod. Vol. 10, Iss. 1, pp. 1-9 Journal Of Animal Health
Archive And Production
Abstract | Full Text | PDF | ePUB | FLIP | DOI | Figures |
Processing Charges
Prevalence and Association of Hard Ticks (Ixodidae) with Various Breeds of Sheep
Author Guidelines and Goats
Sadaf Shahid, Abdul Razzaq, Gul-Makai, Asim Shamim, Hafiz Muhammad Rizwan, Rana Hamid
Ali Nisar, Qaiser Akram, Mohsin Nawaz
Abstracting & Indexing
J. Anim. Health Prod. Vol. 10, Iss. 1, pp. 10-15
Editorial Workflow
Abstract | Full Text | PDF | ePUB | FLIP | DOI |
Publishing Ethics
Performance, Physiological Parameters and Egg Quality Traits of Laying Hens as
Affected by Dietary Supplementation of Date Palm Pollen
Policies
Amira Mahmoud Refaie, Marwa Hosni Abd El-Maged, Hassan Abd El-Kriam Hassan Abd El-Halim,
Hanan Abd El-Rahman Hassan Alghonimy, Sayed Ahmed Mohamed Shaban
Statements
J. Anim. Health Prod. Vol. 10, Iss. 1, pp. 21-28
Contact Information
Abstract | Full Text | PDF | ePUB | FLIP | DOI |
Subscription
Prevalence of Avian Influenza H5, H7 and H9 Viruses in Commercial Broilers at
Karachi, Pakistan
Join Us
Amjad Ali Channa, Mansoor Tariq, Zaheer Ahmed Nizamani, Nazeer Hussain Kalhoro

Submit Online at J. Anim. Health Prod. Vol. 10, Iss. 1, pp. 29-34

Abstract | Full Text | PDF | ePUB | FLIP | DOI | Figures |

An Abattoir-Based Study on the Prevalence of Hydatidosis Infestation and Fertility of

Hydatid Cysts in Slaughtered Herbivores (Food Animals) in Dhamar Province-Yemen.
Mohammed Naji Ahmed Odhah, Dhary Alewy Almashhadany, Abdullah Garallah Otaifah, Bashiru
Garba, Najeeb Mohammed Salah, Faez Firdaus Abdullah Jesse, Mohd Azam Khan G.K
Special Issues
J. Anim. Health Prod. Vol. 10, Iss. 1, pp. 35-42
Open Special Issues
Abstract | Full Text | PDF | ePUB | FLIP | DOI | Figures |
Call for Special Issues Physicochemical Properties of Duck Egg White Treated with Different Ultrasound
Time
Special Issue Guidelines
Ho Shi Hui, Eng-Keng Seow, Nurul Huda

Published Special Issues J. Anim. Health Prod. Vol. 10, Iss. 1, pp. 43-50

Abstract | Full Text | PDF | ePUB | FLIP | DOI | Figures |

Membership/Association

researcherslinks.com/journal-details/Journal-of-Animal-Health-and-Production/34/current-issue 1/3
3/28/22, 3:42 PM Current Issue

Retrospective Study of Clinical Manifestations and Multiple Treatment Outcomes in

57 Cats Diagnosed with Feline Chronic Gingivostomatitis
Mohammad Hussain Haidary, Rozanaliza Radzi, Muhammad Waseem Aslam, Seng Fong Lau,
Farina Mustaffa Kamal, Ahmad Rasul Radzali

J. Anim. Health Prod., Vol. 10, Iss. 2, pp. 51-59

Abstract | Full Text | PDF | ePUB | FLIP | DOI | Figures |

Effect of Extra Arginine Supplementation on Growth Performance, Carcass

Characteristics and Immune Response in Broilers
Muhammad Khubaib Hameed, Muhammad Aziz ur Rahman, Muhammad Ashraf, Safdar Hassan,
Muhammad Riaz, Muhammad Qamar Bilal, Fawwad Ahmad, Muhammad Sharif

J. Anim. Health Prod. Vol. 10, Iss. 1, pp. 60-67

Abstract | Full Text | PDF | ePUB | FLIP | DOI |

Effect of Gum Arabic on Overall Growth Performance, Visceral and Lymphoid Organs
Along with Intestinal Histomorphology and Selected Pathogenic Bacteria of Broiler
Chickens
Sajjad Khan, Naila Chand, Abdul Hafeez, Nazir Ahmad

J. Anim. Health Prod., Vol. 10, Iss. 1, pp. 73-80

Abstract | Full Text | PDF | ePUB | FLIP | DOI |

Climate Change Mitigation by Dietary Phytogenic Addition in Layer Hens: Some Re-
productive Traits and Endocrine Hormones Responses
El-Kholy KH, Tag El-Din H, Tawfeek FA, Sara HM Hassab
J. Anim. Health Prod., Vol. 10, Iss. 1, pp. 81-87

Abstract | Full Text | PDF | ePUB | FLIP | DOI | Figures |

Fecal Calprotectin Concentrations and Other Indicators in Dogs with Idiopathic

Inflammatory Bowel Disease
Heba El-Zahar, Zeinab Abd El-Rahman, Abbas El-Naggar
J. Anim. Health Prod., Vol. 10, Iss. 1, pp. 88-96

Abstract | Full Text | PDF | ePUB | FLIP | DOI | Figures |

Impact of Mastitis Incidence during Early Postpartum on Reproductive Efficiency,

Antioxidant Status, Hormonal Profile, and Trace Elements in Lactating Egyptian
Buffaloes
Mohamed Abd El-Fattah Abo-Farw, Maged Ahmed Aboul-Omran, Abdel-Khalek El-Sayed Abdel-
Khalek
J. Anim. Health Prod., Vol. 10, Iss. 1, pp. 97-106

Abstract | Full Text | PDF | ePUB | FLIP | DOI | Figures |

Effects of Genotype and Age on Growth Performance and Carcass Traits of Chickens
in Southern Ethiopia
Shewangizaw Wolde, Tadele Mirkena, Aberra Melesse, Tadelle Dessie, Solomon Abegaz
J. Anim. Health Prod., Vol. 10, Iss. 1, pp. 107-115

Abstract | Full Text | PDF | ePUB | FLIP | DOI | Figures |

The Association between Apolipoprotein B2 (Apob2) Gene with Body Weight and
Carcass Traits of Noi Native Chickens
Ly Thi Thu Lan, Nguyen Thi Anh Thu, Lam Thai Hung, Nguyen Thi Hong Nhan, Le Thanh Phuong,
Nguyen Trong Ngu

J. Anim. Health Prod., Vol. 10, Iss.1, pp. 116-120

Abstract | Full Text | PDF | ePUB | FLIP | DOI | Figures |

Short Communication

Allelic Diversity of the Endangered Taro White Cattle Population from Bali using BoLA
Microsatellite Loci

researcherslinks.com/journal-details/Journal-of-Animal-Health-and-Production/34/current-issue 2/3
 Journal of Animal Health and Production

Research Article

The Association between Apolipoprotein B2 (Apob2) Gene with Body

Weight and Carcass Traits of Noi Native Chickens
Ly Thi Thu Lan1, Nguyen Thi Anh Thu1, Lam Thai Hung2, Nguyen Thi Hong Nhan3, Le
Thanh Phuong4, Nguyen Trong Ngu3*
Tra Vinh University, Vietnam; 2Science and Technology Department of Tra Vinh Province, Vietnam; 3Can Tho
1

University, Vietnam, 4Emivest Feedmill Vietnam, Vietnam.

Abstract | The present study was carried out to determine how ApoB2 gene polymorphisms are related to growth-re-
lated traits and carcass characteristics of Noi chickens. A total of 183 birds were examined in the study. Body weight
was recorded individually at days 1, 35, 63, and 91, and carcass parameters were determined at 91 days for all chickens.
For determining single nucleotide polymorphisms, the PCR-RFLP method was used with the help of AcyI restriction
enzyme. A polymorphic site was found in the population, with the frequencies of 11, 12, and 22 genotypes being 0.18,
0.67, and 0.15, respectively. At the end of the experiment, better body weight (965-976 g/bird) and daily weight gain
(10.5-10.6 g/bird/day) were found in chickens with 11 and 12 genotypes. Carcass parameters were superior in chickens
carrying these genotypes (P<0.05) except for thigh and drumstick weight. In breeding selection for improving growth
and carcass traits in Noi native chickens, allele 1 was more advantageous.

Keywords | ApoB2, Carcass, Chicken, Growth, Linkage

Received | August 13, 2021; Accepted | September 21, 2021; Published | March 10, 2022
*Correspondence | Nguyen Trong Ngu, Can Tho University, Vietnam; Email: ntngu@ctu.edu.vn
Citation | Lan LTT, Thu NTA, Hung LT, Nhan NTH, Phuong LT, Ngu NT (2022). The association between apolipoprotein b2 (apob2) gene with body weight
and carcass traits of noi native chickens J. Anim. Health Prod. 10(1): 116-120.
DOI | http://dx.doi.org/10.17582/journal.jahp/2022/10.1.116.120
ISSN | 2308-2801

Copyright: 2022 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.
org/licenses/by/4.0/).

INTRODUCTION It serves as the ligand and the primary structural protein

for the triglyceride-rich low-density lipoprotein receptor,

T he advances in molecular techniques, including quan- which is involved in the transport and metabolism of lipids
titative trait locus (QTL) analysis and candidate gene and energy (Glickman et al., 1986; Schumaker et al., 1994).
approach, have improved our ability to uncover genetic It is synthesized in the liver and is required to transport
markers for economically significant animal traits (Zahra lipids and cholesterol, and is an ApoB receptor activator
et al., 2011). Understanding functional genes aids in the that promotes cell aggregation and low-density lipoprotein
selection of animals with desirable breeding characteristics internal activity (Kirchgessner et al., 1987). Additionally,
and enhances growth rates, body weight, and carcass char- the blood ApoB concentration is tightly linked with the
acteristics (Manjula et al., 2018). It is of particular interest body weight characteristic, abdominal fat, and weight gain
when applied to indigenous breeds, as they are becoming in animals (Sato, 2016; Zhang et al., 2006). A polymorphic
an increasingly favored food source due to their distinctive site in exon 26 of the Apolipoprotein B2 (ApoB2) gene
meat quality. (Zhang et al., 2006), a mutation producing truncations in
the ApoB gene family, has been proved to associate with
Apolipoprotein B (ApoB) is one of the most hydropho- body growth and fatness trait on Iranian commercial broil-
bic apolipoproteins with a molecular weight of 210 kDa. er lines (Seyedabadi et al., 2010) and body weight of Thai

March 2022 | Volume 10 | Issue 1 | Page 116


native chicken (Supakorn, 2016). Information related to
this ApoB2 gene polymorphism in the indigenous chicken
breed is still limited; therefore, the objective of this study
was to identify this locus and assess its linkage with growth
and carcass traits of Noi chicken, a local breed popular in
the Mekong Delta of Vietnam.
MATERIALS AND METHODS
Journal of Animal Health and Production
Bodyweight and carcass characteristics
At 1, 35, 63, and 91 days of age, chickens were weighed
individually at 6 a.m. before feeding to determine body
weight and calculate daily weight gain. At the end of the
experiment, all broilers were slaughtered by exsanguina-
tion for carcass evaluation, of which the breast, thigh and
drumstick muscle were collected as described by Goliomy-
tis et al. (2003).

Bird care and feeding Genotyping of chickens

Chickens from different brooding stocks of a breeding Chicken feather quills were collected for DNA isola-
farm were cared for and handled in accordance with the tion using the phenol/chloroform procedure of Bello et
Animal Husbandry Law of Vietnam (32/2018/QH14). A al. (2001). The ApoB2 polymorphism was genotyped by
total of 183 Noi chickens were raised at the experimental the Polymerase Chain Reaction - Restriction Fragment
farm of Tra Vinh University with the rations according to Length Polymorphism (PCR-RFLP) method with the
the diet formula shown in Table 1. The feeding diet com- AcyI restriction enzyme. The forward and reverse primer
prised yellow maize, soybean meal, rice bran, lysine and sequences were 5’-CATATTTCTAATGGCATCCAG-3’
methionine, dicalcium phosphate, shell, salt, vitamin and and 5’-TTCCCAGCGTTATTTCCG-3’, respectively
mineral premix. From 1-28 days of age, the chicks were (Zhang et al., 2006). Briefly, each PCR reaction was per-
brooded on rice husks with a density of 50 chickens/m2, formed using a volume of 10 µL with 50 ng of genom-
and then they were raised on the floor with 12 chickens/ ic DNA, 0.25 μM each primer, 0.25 μM each dNTP, 1X
m2. The birds were fed ad libitum, and freshwater was given PCR buffer, and 1 U Taq DNA polymerase. The thermal
all time. All birds were numbered individually for pheno- conditions were as follows: 94°C for 10 min; 35 cycles of
typic identification. 94°C for 40 s, 57°C within 40 s, and 72°C within 45 s; and
72°C within 10 min for the final extension. PCR products
Table 1: Experimental diets of Noi chickens were further digested at 37°C overnight with AcyI restric-
Items Experimental period tion enzyme, and the genotypes were determined under
UV light after electrophoresis on 2.0% agarose gel at 80 V,
1-28 day 29-56 day 57-91 day
400 mA within 30 min.
Ingredients
Yellow maize (%) 56.3 56.1 53.6 Statistical analysis
Soybean meal (%) 29.3 23.4 17.0 The genotypic and allelic frequencies were analyzed us-
Rice bran (%) 9.53 15.7 25.4 ing Microsoft Excel, and the method of Rodriguez et al.
Lysine (%) 0.62 0.54 0.45 (2009) was applied to estimate the Hardy-Weinberg equi-
Methionin + cysteine 0.19 0.18 0.17 librium. The association between genotypes and chicken
(%) growth and carcass traits was investigated using the Gen-
Dicalcium phosphate 1.60 1.60 1.00
eral Linear Model procedure of the Minitab version 16.2
(%) software, with the effects of sex and genotypes included
in the model. Tukey’s pairwise comparisons (P<0.05) were
Shell (kg) 1.80 1.80 1.76
applied to determine the differences between genotypes.
Premix* (%) 0.25 0.25 0.25
Salt (%) 0.40 0.40 0.40 RESULTS AND DISCUSSION
Nutritional values
Dry matter (%) 86.9 86.9 86.9 Genotype and allele frequency
Crude protein (%) 19.0 17.0 15.0 The ApoB2_AcyI polymorphism in the ApoB2 gene was
ME (kcal/kg) 2,900 2,900 2,900 investigated. The PCR products had a length of 779 bp
Lysin (%) 1.12 1.03 0.90 (Figure 1), and the PCR-RFLP results indicated two al-
Methionin + cysteine 0.79 0.72 0.64 lele forms that corresponded to three genotypes: 11 (779
(%) bp), 12 (779 bp, 658 bp, 121 bp), and 22 (658 bp, 121 bp)
Threonine (%) 0.86 0.81 0.78
(Figure 2; the 121 bp band was not visible on the gel). The
genotypic and allelic frequencies of the ApoB2_AcyI poly-
Calcium (%) 1.18 1.18 1.03
morphism in Noi broilers are shown in Table 2. At this lo-
Phosphorus (%) 0.84 0.89 0.80 cus, allele 1 was slightly more common than allele 2, while
*: premix includes vitamin and micro-minerals the frequency of the heterozygous genotype 12 appearing
March 2022 | Volume 10 | Issue 1 | Page 117
 Journal of Animal Health and Production
Table 2: Genotype and allele frequency of the polymorphism in Noi chicken
Locus Observed genotype1 Total Allelic frequency χ2 (HW) p (HW)
ApoB2_AcyI 11 12 22 1 2
33 122 28 183 0.52 0.48 20.5 <0.001
(0.18) (0.67) (0.15)
1
Data presented as an individual number followed the frequency in parenthesis; HW: Hardy-Weinberg

Table 3: Association of the ApoB2_AcyI polymorphism with growth traits

Traits Genotypes P
11 12 22
Body weight (g/bird)
Day 1 32.1 ± 0.52 31.5 ± 0.27 32.3 ± 0.56 0.346
Day 35 184 ± 4.21 180 ± 2.19 170 ± 4.50 0.059
Day 63 538 ± 14.9 a
540 ± 7.76 a
480 ± 16.0 b
0.004
Day 91 965 ± 22.2 ab
976 ± 11.5 a
910 ± 23.8 b
0.044
Daily weight gain (g/bird/day)
1-35 day 4.50 ± 0.13 4.40 ± 0.07 4.10 ± 0.13 0.052
36-63 day 13.1 ± 0.50 ab
13.3 ± 0.26 a
11.5 ± 0.53 b
0.009
64-91 day 15.8 ± 0.56 16.2 ± 0.29 15.9 ± 0.59 0.825
Overall (1-91 day) 10.5 ± 0.25 ab
10.6 ± 0.13 a
9.9 ± 0.27
b
0.041
: means with different letters in the same row are significantly different (P<0.05)
a, b

Table 4: Association of the ApoB2_AcyI polymorphism with carcass characteristics

Traits Genotypes P
11 12 22
Carcass weight (CW), g 641 ± 17.2ab 666 ± 8.91a 614 ± 18.4b 0.032
Breast weight, g 86.3 ± 1.66 a
85.2 ± 0.86 a
77.2 ± 1.77 b
0.000
Thigh + drumstick, g 147 ± 2.39 148 ± 1.24 143 ± 2.56 0.225
Carcass, % BW 66.3 ± 0.41 b
68.0 ± 0.21 a
67.3 ± 0.44 ab
0.001
Breast, % CW 13.5 ± 0.22 a
13.0 ± 0.11 ab
12.7 ± 0.23 b
0.029
Thigh + drumstick, % CW 23.0 ± 0.34 ab
22.5 ± 0.18 b
23.7 ± 0.36 a
0.018
: means with different letters in the same row are significantly different (P<0.05)
a, b

Figure 1: PCR product of the ApoB2 gene

in a population was higher than that of the two homozy-
gous genotypes, and the genotype frequency of this poly-
morphism varied from the Hardy-Weinberg equilibrium
(P<0.001). The findings were comparable with those of Su
Figure 2: PCR-RFLP patterns of different genotypes
pakorn (2016), who observed that the genotype frequency
of the heterozygous 12 in the ApoB2 gene was higher than
those of the two homozygous types 11 and 22. Cruz et al.

March 2022 | Volume 10 | Issue 1 | Page 118


(2015) also observed that the ApoB2 gene polymorphism
has a greater incidence of heterozygotes than homozy-
gotes. Similar results were additionally reported in com-
mercial broilers, native and crossbred chickens of Thailand
(Buasook et al., 2014; Seyedabadi et al., 2010; Zhang et
al., 2006). However, Shahabi et al. (2012) discovered that
genotype 22 appeared more significant than the other two
genotypes when investigating the Khazak chicken breed.
Furthermore, when Hardy-Weinberg equilibrium was
postulated in the current study, a substantial difference in
genotype and allele frequencies was discovered. Random
selection in a population was a dominant heritable aspect
of Hardy-Weinberg equilibrium. The Noi chicken popu-
lation came from the same animal breeding farm, which
may explain why gene polymorphism did not follow this
principle.
Association of the ApoB2_AcyI polymorphism
with growth traits
Table 3 shows the influence of ApoB2 genetic polymor-
phism on the body weight gain of the birds at different
days of age. In general, the growth rate of Noi broilers with
the 12 and 11 genotypes was higher than that of carrying
the 22 genotype. Innerarity et al. (1996) and Van Hemert
(2007) reported that the ApoB gene was required for en-
ergy transfer and metabolism and involved lipid transport,
digestion, and meal absorption. It may directly or indirect-
ly affect fat storage and development, leading to a change
in body weight. Hendricks et al. (2009) discovered that
four-week-old chickens had a particular level of plasma
adiponectin, and age-related changes or rapid growth may
cause a decrease in the amount of circulating adiponec-
tin. ApoB has also been reported to associate with body
weight, abdominal fat, and other growth-related character-
istics (Decai et al., 2017). The present study indicated a sig-
nificant influence of the ApoB2_AcyI locus on growth-re-
lated traits of Noi chickens, in which chickens with 11 and
12 genotypes were superior.
Similarly, Seyedabadi et al. (2010) also found that chick-
ens with the CC and CD genotypes (equivalent to the 11
and 12 genotypes) gained more rapidly. In addition, Zhang
et al. (2006) showed the influence of the ApoB2 gene on
body weight in commercial broiler lines at weeks 1 and
3 with greater body weight in chickens of TT (11) and
TG (12) genotypes. Our results were also in line with the
conclusion of Supakorn (2016) that the ApoB2_AcyI poly-
morphic site was closely associated with body weight at 12
weeks in an indigenous Thai chicken breed, of which allele
1 was of interest for breeding selection. Research by Su-
pakorn (2016) showed that Luenghangkhao chickens car-
rying the 11 genotype had a higher body weight; whereas
those of the Pradhuhangdum, Chee, and the Red Jungle
Fowls breeds with 11 and 22 genotypes grew faster.
March 2022 | Volume 10 | Issue 1 | Page 119
Journal of Animal Health and Production
Association of the ApoB2_AcyI polymorphism
with carcass characteristics
The ApoB2 gene polymorphism influenced most car-
cass parameters examined, except for thigh and drum-
stick weight (Table 4). The advantage of allele 1 was also
demonstrated. Previously, Seyedabadi et al. (2010) found a
linkage between ApoB2 genotype and carcass indicators,
comprising carcass weight, breast, and drumstick weight
percentages, with higher values in birds carrying 11 and
12 genotypes. Our study revealed that allele 1 contribut-
ed to higher carcass parameters than allele 2, which was
consistent with the findings of Supakorn (2016) and con-
firmed the report of Seyedabadi et al. (2010) that allele 1
was linked to the QTL of higher growth and body compo-
sition traits. It was stated by Cruz et al. (2015) that ApoB2
gene polymorphism affected feed intake and breast weight.
Fat storage in chickens is related to body weight, which
was utilized as a selection criterion. The ApoB2 gene may
modify thigh and breast fat metabolism, feed consumption,
and breast protein storage in broiler chickens; thus, it may
be the QTL that dictates chicken growth and body com-
position.
CONCLUSIONS
A mutation at the ApoB2_AcyI locus was detected with
two alleles, and three genotypes available in the chicken
population studied. Allele 1 of this polymorphism was
more favorable in breeding selection for improving growth
and carcass traits in Noi native chickens.
ACKNOWLEDGMENTS
This research is funded by the scientific research grant of Tra
Vinh University under grant number 202/HĐ.HĐKH-
ĐHTV, dated 16/09/2019.
CONFLICT OF INTEREST
We certify that there is not any conflict of interest with
any financial, personal, or other organization related to the
material mentioned in the manuscript.
novelty statement
Allele 1 of the ApoB2_AcyI polymorphism was more ad-
vantageous in breeding selection for enhancing growth and
carcass quality in Noi native chickens.
authors contribution
LTTL, LTH and NTN contributed to the design of the
study. NTAT, NTHN and LTP conducted the data collec-

tion and analysis. LTTL, LTH and NTN prepared the first
draft and revised the manuscript. All authors have read and
approved the final manuscript.
REFERENCES
Bello N, Francino O, Sanchez A (2001). Isolation of genomic
DNA from feathers. J. Vet. Diagn. Invest. 13(2): 162-164.
https://doi.org/10.1177/104063870101300212
Buasook T, Duangjinda M, Phasuk Y, Kunhareang S (2014).
Patterns of cGH, IGF-1, ApoB2, ApoVLDL-II and FASN
and body weight and cholesterol level in plasma of Thai
native chicken crossbreds. Khon Kaen Agr. J. 42(3): 357-368.
https://doi.org/10.3923/ajpsaj.2016.141.146
Cruz VARD, Schenkel FS, Savegnago RP, Grupioni N V,
Stafuzza N B, Sargolzaei M, Ibelli AMG, de Oliveira
Peixoto J, Ledur MC, Munari DP (2015). Association of
Apolipoprotein B and Adiponectin Receptor 1 genes with
carcass, bone integrity and performance traits in a paternal
broiler line. PLoS One. 10(8): e0136824. https://doi.
org/10.1371/journal.pone.0136824
Decai X, Zhiyong Z, Bin Z, Zhongcheng H, Quanshu W, Jing L
(2017). Correlation analysis of relative expression of Apob,
Adfp, and Fatp1 with lipid metabolism in Daweishan mini
chickens. Braz. J. Poult. Sci. 19: 151-158. http://dx.doi.
org/10.1590/1806-9061-2016-0357
Glickman RM, Rogers M, Glickman JN (1986). Apolipoprotein
B synthesis by human liver and intestine in vitro. Proc.
Natl. Acad. Sci. USA. 83(14): 5296-5300. https://doi.
org/10.1073/pnas.83.14.5296
Goliomytis M, Panopoulou E, Rogdakis E (2003). Growth
curves for body weight and major component parts, feed
consumption, and mortality of male broiler chickens raised to
maturity. Poult. Sci. 82: 1061-1068. https://doi.org/10.1093/
ps/82.7.1061
Hendricks GL, Hadley JA, Krzysik-Walker SM, Prabhu KS,
Vasilatos-Younken R, Ramachandran R (2009). Unique
profile of chicken adiponectin, a predominantly heavy
molecular weight multimer and relationship to visceral
adiposity. Endocrinology 150(7): 3092-3100. https://doi.
org/10.1210/en.2008-1558
Innerarity TL, Boren J, Yamanaka S, Olofsson SO (1996).
Biosynthesis of apolipoprotein B48-containing lipoproteins.
Regulation by novel post-transcriptional mechanisms. J.
Biol. Chem. 271(5): 2353-2356. https://doi.org/10.1074/
jbc.271.5.2353
Kirchgessner TG, Heinzmann C, Svenson KL, Gordon DA,
March 2022 | Volume 10 | Issue 1 | Page 120
Journal of Animal Health and Production
Nicosia M, Lebherz HG, Lusis AJ, Williams DL (1987).
Regulation of chicken apolipoprotein B, cloning, tissue
distribution, and estrogen induction of mRNA. Gene 59(2-
3): 241-251. https://doi.org/10.1016/0378-1119(87)90332-
5
Manjula P, Park H B, Seo D, Choi N, Jin S, Ahn SJ, Heo K
N, Kang BS, Lee JH (2018). Estimation of heritability and
genetic correlation of body weight gain and growth curve
parameters in Korean native chicken. Asian-australas.
J. Anim. Sci. 31(1): 26-31. https://doi.org/10.5713/
ajas.17.0179
Rodriguez S, Gaunt TR, Day INM (2009). Hardy-Weinberg
equilibrium testing of biological ascertainment for Mendelian
randomization studies. Am. J. Epidemiol. 169(4): 505-514.
https://doi.org/10.1093/aje/kwn359
Sato K (2016). Molecular nutrition: Interaction of nutrients, gene
regulations and performances. Anim. Sci. J. 87(7): 857-862.
https://doi.org/10.1111/asj.12414
Schumaker VN, Phillips ML, Chatterton JE (1994).
Apolipoprotein B and low-density lipoprotein structure:
implications for biosynthesis of triglyceride triglyceride-rich
lipoproteins. Adv. Protein Chem. 45: 205-248. https://doi.
org/10.1016/s0065-3233(08)60641-5
Seyedabadi HR, Amirinia C, Amirmozafari N, Torshizi
RV, Chamani M, Aliabad AJ (2010). Association of
apolipoprotein B gene with body growth and fatness traits in
Iranian commercial broiler lines. Livest. Sci. 132(1-3): 177-
181. https://doi.org/10.1016/j.livsci.2010.05.012
Shahabi A, Seyedabadi HR, Roudbari Z (2012). Detection of
polymorphism in exon 26 of apoB gene in Khazak breed
chickens. Life Sci. J. 9(4): 330-333.
Supakorn C (2016) Genetic polymorphisms of ApoB2, TGFβ4,
LITAF, TRAIL and IAP1 genes and their association with
growth trait in Thai native chicken. Asian J. Poult. Sci. 10(3):
141-146. https://doi.org/10.3923/ajpsaj.2016.141.146
Van Hemert S (2007). Gene expression profiling of chicken
intestinal host responses. Animal Sciences Group of
Wageningen UR, Division of Infectious Diseases, 25-38.
Zahra R, Masoud A, Hamid RS, Cyrus A (2011). Identification
of a single nucleotide polymorphism of the pituitary-specific
transcriptional factor 1 (Pit 1) gene and its association
with body composition trait in Iranian commercial broiler
line. Afr. J. Biotechnol. 60: 12979-12983. https://doi.
org/10.5897/AJB11.1149
Zhang S, Li H, Shi H (2006). Single marker and haplotype
analysis of the chicken Apolipoprotein B gene T123G and
D9500D9 - polymorphism reveals association with body
growth and obesity. Poult Sci. 85(2): 178-184. https://doi.
org/10.1093/ps/85.2.178
5/2/22, 6:07 AM Livestock Research for Rural Developement - Volume 34

Livestock Research for Rural

Development

The peer-reviewed international journal for research

into sustainable developing world agriculture

Published by Fundación CIPAV, Cali, Colombia

Volume 34, On-line Edition

Issue 1 (January)

Issue 2 (February)

Issue 3 (March)

Issue 4 (April)

Issue 5 (May)

ISSN 0121-3784

www.lrrd.org/lrrd34/lrrd34.htm 1/1
5/2/22, 6:08 AM Livestock Research for Rural Development, Volume 34, Number 5, May 2022

Back to LRRD Home page

Livestock Research for Rural Development, Volume 34, Number 5, May 2022 ISSN 0121-3784

Contents
Papers:
35. Developing a feeding system for rabbits using tropical feed resources with a low carbon
footprint; T R Preston

36. Effect of fresh foliage leaves on biomass growth of crickets fed rice bran as the basal diet;
Bui Phan Thu Hang, Nguyen Van Cop, Dao Thi My Tien and Vo Lam

37. The effects of high saline water on physiological responses, nutrient digestibility and milk
yield in lactating crossbred goats; Nguyen Thiet, Nguyen Trong Ngu, Nguyen Thi Hong
Nhan and Sumpun Thammacharoen

38. Phytosociological studies. Methods for its determination and importance in grassland
ecosystems; Lázaro Castro Hernández and Jatnel Alonso Lazo (in spanish)

39. Effect of replacing Para grass (Brachiaria mutica) with Paspalum grass (Paspalum atratum)
on dry mater degradability and methane production; Nguyen Van Thu and Le Van Phong

40. Effect of season on reproductive capacity of Pelibuey rams under sub-humid tropical
conditions; J R Aké-Villanueva, N Y Aké-Villanueva, J R Aké-López, J G Magaña-
Monforte, J A Peralta-Torres and J C Segura-Correa

41. Effects of processing protocols on the potential of hatchery waste as a protein source for
livestock production; Asiedu P, Odoi F N A, Prah A A, Wallace P Y, E K Adu, Bumbie G Z
and Osei D Y

42. The production of honey and pot-pollen from stingless bee Tetragonula clypearis and their
contribution to increase the farmers income in West Lombok Indonesia; Bambang Supeno,
Erwan and Agussalim

43. In vitro methane production and ruminal fermentation parameters of tropical grasses and
grass-legume associations commonly used for cattle feeding in the tropics; Xiomara Gaviria
Uribe, Diana M Bolívar Vergara, Ngonidzashe Chirinda, Isabel Cristina Molina-Botero,
Johanna Mazabel, Rolando Barahona Rosales and Jacobo Arango

44. Effect of nitrogen fertilizer on biomass yield and composition of Paspalum atratum; Nguyen
Van Thu and Le Van Phong

Administrative
www.lrrd.org/lrrd34/5/cont3405.html 1/2
 Guide for
Livestock Research for Rural LRRD LRRD LRRD Citation of
preparation of
Development 34 (5) 2022 Search Misssion Newsletter this paper
papers

The effects of high saline water on physiological responses,

nutrient digestibility and milk yield in lactating crossbred
goats
Nguyen Thiet1, Nguyen Trong Ngu2, Nguyen Thi Hong Nhan2 and Sumpun
Thammacharoen3
1 College of Rural Development, Can Tho University, Can Tho City, Vietnam
nthiet@ctu.edu.vn
2 College of Agriculture, Can Tho University, Can Tho City, Vietnam
3 Faculty of Veterinary Science, Chulalongkorn University, HenriDunang street, Bangkok
10330, Thailand

Abstract
This experiment aimed to evaluate the effects of high saline water on physiological responses,
nutrient digestibility and milk yield in lactating crossbred goats. Ten crossbred dairy goats
were selected and divided into two groups, five animals each. Animals received either control
(fresh water, DSW0.0) or high saline water (1.5% diluted seawater, DSW1.5). The results
showed that rectal temperature (RT) and respiration rate (RR) from DSW1.5 were higher than
those from DSW0.0 at 13:00 and 15:00 h. Dry matter intake, milk yield and body weight did
not differ between groups. Dairy goats in DSW1.5 were lower water intake and urine volume,
whereas plasma ADH concentration increased. Therefore, water balance was lower from
DSW1.5 over 24 h. The results from present study indicated that dairy goats drank with 1.5%
saline water which decreased thermoregulation’s capacity via higher RT and RR.

Key words: dairy goat, diluted seawater, production, thermoregulation, water balance

Introduction
Goat production in the Mekong delta is an important source of income for costal provinces
and protein for human diets in Vietnam. However, the sector is faced with environmental
challenges due to climate change while the demand for animal products is growing. One of
the main challenges is the lack available freshwater during the dry season, lower water quality
due to saline intrusion. Therefore, animals exposed to saline water or heat stress can get ill or
even die. Runa et al. (2019) found that Boer goats rejected saline water at 1.25 to 1.5% NaCl
and were more sensitive to the ingestion of salt from drinking water after prolonged exposure
to saline water. Nguyen et al. (2022a) reported that growing Boer crossbred goats drank with
1.5% saline water increased water intake (WI) and decreased dry matter intake (DMI),
nutrient digestibility and followed by decreasing weight gain. In addition, Bach Thao goats
can be tolerant with saline water up to 1.0% without effects on thermoregulation via
unchanging rectal temperature and respiration rate compared to fresh water group (Nguyen et
al., 2022b), whereas Nassar and Mousa (1981) found that goats could accept 1.5% NaCl in
drinking water. The animal’s ability to tolerate various degrees of salt loads in drinking water
may be related to kidney function (Potter, 1963). Similarly, Abou Hussien et al. (1994) found
that sheep and goats drinking saline water controlled their salt load by excreting more urine
and increasing the filtration rate, while camels drank less saline water to decrease salt stress.
Although goat may tolerant to saline water up to 1.5 % due to renal adjustment, physiological
condition, breeds or climate conditions as reported by previous studies, but there is little
information about the effects of high saline water on physiological responses, nutrient
digestibility and milk yield in lactating crossbred goats. Therefore, the objectives of the
present study were to evaluate the effects of high saline water on physiological responses,
nutrient digestibility and milk yield in lactating crossbred goats.

Materials and methods

Experimental design and animal care

The experiment was conducted on 10 crossbred dairy goats (Saanen x Bach Thao goats), at
120 days in milking. Each animal was in a healthy state and was not suffering from dangerous
infectious diseases. All animals were kept in individual metabolic cages in 1.2 x 0.7 m shaped
pens with plastic floors, hanging together with feeders and drinking troughs for adaptation
period (10 days). This period all goats ate the same experimental diets and drank fresh water.
After that, the experiment was arranged completely randomized with two groups, a control
group of goats drinking fresh water (DSW0.0) and a treatment group of goats drinking saline
water with a concentration of 1.5% (DSW1.5), with 5 replicates. The study used concentrated
seawater (9%) mixed with fresh water to achieve water with a salt concentration of 1.5%
(DSW1.5), according to the formula C1V1 = C2V 2 (where C1 is the concentration of the
starting solution; V1 is the volume of the starting solution; C2 is the concentration of the final
solution an V2 is the volume of the final solution), and the salinity was then checked by a
refractometer (Master S28M, Atago, Japan). For the concentrated seawater, we bought from
the aquaculture farm and then delivery to experimental site. The chemical composition from
water samples were presented in the companion paper (Nguyen et al., 2022a). This
experiment lasted for 3 weeks, with 7 days for the pretreatment period (from the 1st – 7th day)
and 14 days (from the 8th - 21st day) for the treatment period. All goats were offered the same
ration, with 0.5 kg concentrate and 0.5 kg total mix ration (commercial TMR) for the morning
feeding and natural grass ad libitum for afternoon feeding. This ration was formulated
according to the farm’s protocol. The chemical compositions of the ration are presented in
Table 1. The animal received the same ration, twice daily at 08:00 and 14:00 h and had free
access to water.

Table 1. Chemical composition of experimental diets (DM basis)

Items Concentrate TMR Natural grass
DM 87.13 54.30 20.52
CP 18.85 13.87 7.61
ADF 20.02 30.54 44.32
NDF 38.91 47.67 62.50
Ash 7.97 10.57 9.67

The ambient temperature and humidity were recorded at 07:00 hour, 09:00, 11:00, 13:00,
15:00, 17:00 and 19:00 h. The temperature and humidity index (THI) was calculated as
recommendation from Thammacharoen et al. (2020). The environmental conditions from the
current study were presented in Table 2.

Table 2. Environmental conditions from the present experiment

Time Ambient Humidity
THI
(h) temperature (0C) (%)
07:00 28.00±0.58 78.33±3.18 79.55±0.50
09:00 29.67±0.33 70.00±2.89 80.99±0.26
11:00 30.67±0.67 64.33±2.96 81.62±0.96
13:00 32.00±0.58 59.67±2.73 82.74±0.39
15:00 31.67±0.33 61.33±1.33 82.58±0.61
17:00 30.00±0.58 68.67±4.70 81.26±0.33
19:00 28.00±1.00 71.33±4.10 78.62±1.12
Data collection and measurement
Feed offered and grass refusals (10%) were recorded daily in the morning starting from day
1st to 21 st from the experiment. Feed and refusal samples were collected daily from day 1st to
21st and were divided into two parts: one half was immediately dried in the oven at 105 °C
until its weight remained constant to determine dry matter, and the remaining samples were
kept frozen at -20 °C until chemical analysis. At the end of the experiment, all feed samples
were thawed and mixed thoroughly, and subsamples were dried at 65 °C approximately 12
hours for nitrogen and ash analysis according to AOAC (1990), neutral detergent fiber (NDF)
and acid detergent fiber (ADF) using the procedure developed by Van Soest et al. (1991).

Water intake (WI) was measured daily from the beginning to the end of the experiment. The
measurement of water intake was performed by subtracting the weight of water offered from
the weight of water refused. Goats were milked by hand milking twice daily at 06:00 and
14:00 h, recorded daily throughout the experiment. All of the goats were weighed before the
morning feeding at the beginning and the end of experiment.

Rectal temperature (RT) and respiration rate (RR) were determined one per week and
measurements were collected at two-hour intervals during the day time (from 09:00 h to
19:00 h). RT was determined by a digital clinical thermometer(digital clinical thermometer
C202, Terumo, Tokyo, Japan). RR was measured by counting the movement of the flank
within one minute.

On day 21st, blood samples from the jugular vein were collected at 07:00 h before the
morning feeding and were then placed in a lithium heparin tube, kept on crushed ice and
centrifuged at 3,000 rpm for 10 minutes. The plasma samples were stored at -20 °C until
analysis. Total urine and feces were recorded from day 15th to 21st (Week – 3). The water
balance from third week of this experiment was calculated using the difference between water
input (ingested water, feed water) and water output (milk, urinary excretion, feces) throughout
the experiment, without taking account of the water in metabolism. Plasma ADH was
determined using an enzyme-linked immunosorbent assay kit specific for goat hormone
(MBS262591, MyBioSource, San Diego, CA, USA).

Statistical analysis
All data from present experiment were analysed using an unpaired T-test. Significance was
declared at p < 0.05.

Results and discussion

The lactating dairy goats in this study stayed at high ambient temperature from 30 to 32 0C
from 11:00 h to 17:00 h with THI from 81.26 to 82.74, whereas animals stayed at low
ambient temperature and THI during early morning and evening (Table 2). This experimental
condition indicated that animals were exposed to modest heat stress conditions from 11:00 to
17:00 h and there was an absence of heat stress conditions during early morning and evening
(Silanikove and Koluman 2015). Heat stress in dairy animals changes physiological responses
such as increasing RR and RT as reported in previous studies (Chaiyabutr et al. 2000;
Hamzaoui et al. 2013). The current study showed that dairy goats in both groups increased RT
and RR in relation to increments in ambient temperature and THI throughout the day (Table
3). However, the animal’s responses were not similar between groups. Animals in the high
saline water group demonstrated a higher RT than those in the control group at 13:00 h and
15:00 h. Similarly, animals from high saline water group increased RR throughout the day,
even when there was an absence of heat stress. Previous studies suggested that higher water
balance would not only provide a reservoir of soluble metabolites for milk synthesis but
would be useful in slowing down the elevation in body temperature during high ambient
temperature in dairy cows (Chaiyabutr et al. 2000) and in dairy goats (Nguyen et al. 2018).
This would be confirmed by the current experiment when lower water balance from DSW1.5
increased RT and RR than those from DSW0.0. Moreover, higher RT from high saline intake
may be due to greater heat production use for mineral urinary excretion as suggested by Arieli
et al. (1989). Previous study suggested that RT was increased by saline water (Eltayeb, 2006).
In contrast, some studies found that saline water from 0.55% to 1.1% did not effect on RT of
goats (Mdletshe et al., 2017) or RR from Boer goats (Runa et al., 2019). The present results
suggest that dairy goats drank with high saline water under tropical conditions may be more
sensitive than those consumed fresh water due to higher RT and RR.

Table 3. Effects of diluted seawater on rectal temperature ( 0C) and

respiration rate (breath/min.) in lactating crossbred goats
Time Treatment
p
(h) DSW0.0 DSW1.5
Rectal temperature (0C)
07:00 38.76±0.15 38.97±0.09 0.26
09:00 38.78±0.13 39.04±0.12 0.19
11:00 39.00±0.11 39.09±0.15 0.64
13:00 38.67±0.08 38.94±0.09 0.05
15:00 38.82±0.06 39.07±0.07 0.03
17:00 38.95±0.05 39.00±0.07 0.59
19:00 39.05±0.08 39.05±0.03 1.00
Respiration rate (breath/min.)
07:00 47.40±4.60 70.60±7.65 0,03
09:00 64.60±5.53 91.80±6.35 0.01
11:00 68.40±6.92 99.60±6.40 0.01
13:00 65.60±4.95 84.10±5.50 0.04
15:00 61.90±2.51 81.20±3.46 0.01
17:00 70.70±2.44 90.60±2.86 0.001
19:00 70.70±2.27 89.10±3.26 0.01
DSW0.0: dairy goats drank with fresh water; DSW1.5: dairy goats
drank with diluted seawater at level 1.5%.

There were not effects of high saline water on DMI, milk yield and body weight from this
study (Table 4; p>0.05). Previous studies found that DMI from saline water did not differ in
growing goats Tsukahara et al. (2016), sheep (Moura et al., 2016). Similarly, Paiva et al.
(2017) found that dairy goats drank with 0.83% TDS, nutrient intake and milk yield was the
same with control group. But some studies have reported that DMI is negatively affected by
increasing levels in saline water (Mdletshe et al., 2017; Nguyen et al., 2022a). The decrease in
DMI that animals drank with high saline water was decreased by nutrient digestibility
(Mdletshe et al., 2017; Nguyen et al., 2022a). However, the present study showed that DMI
and nutrient digestibility did not differ between groups (Table 4 and 5; p>0.05). The different
responses from the present and previous studies may be different in physiological condition or
breeds.

Daily WI from high saline water was lower than from fresh water (Table 4; p<0.01). Eltayeb
(2006) found that water intake was greater at low levels of salinity, but when the saline level
increased up to 2%, the water consumption decreased. These results indicate that at low levels
of saline, animals consume more water, but when given high salinity water, animals decrease
water intake to avoid salt stress from saline water (Simon, 2006). But some studies found that
WI increased as the salinity levels increased (Mohammed, 2008; Nguyen et al., 2022a) and
also increased electrolytes excretion via renal route (Nguyen et al., 2022a). This study dairy
goats have decreased WI from high saline groups, followed by lower urine volume compared
to control group.
 Table 4. Effects of diluted seawater on dry matter intake, water intake, urine volume,
milk yield (kg/head/day) and body weight (kg/head) in lactating crossbred goats
Treatment
Items p
DSW0.0 DSW1.5
Dry matter intake (kg/head/day) 1.47±0.01 1.47±0.01 0.74
Water intake (kg/head/day) 3.70±0.49 1.88±0.25 0.01
Urine volume (kg/head/day) 2.76±0.29 2.03±0.12 0.052
Milk yield (kg/head/day) 0.62±0.10 0.67±0.04 0.63
Body weight (kg/head) 34.20±1.79 33.84±2.06 0.90
DSW0.0: dairy goats drank with fresh water; DSW1.5: dairy goats drank with diluted
seawater at level 1.5%.

Table 5. Effects of diluted seawater on apparent nutrients digestibility

Treatment
Items p
DSW0.0 DSW1.5
Dry matter (%) 77.32±1.99 80.14±1.09 0.25
Crude protein (%) 83.10±1.25 85.85±0.91 0.11
Neutral detergent fiber (%) 70.10±2.33 73.43±1.42 0.26
Organic matter (%) 77.41±1.93 80.36±1.12 0.22
DSW0.0: dairy goats drank with fresh water; DSW1.5: dairy goats drank
with diluted seawater at level 1.5%.

Water balance from DSW1.5 was lower than from DSW0.0, whereas plasma ADH
concentration from SW1.5 was greater than those control group (Table 6, p<0.05). The effects
of water balance from this study may have mediated the effects of high salinity levels on
urinary volume in relation to plasma ADH level. Theoretically, high saline water may relate
to the increase in Na+ or K+ intake followed by increasing plasma concentrations of Na+ and
K+. This causes an increase of osmotic pressure of plasma. These conditions would stimulate
the thirst center in the brain and increased water intake by the animal (Blair-West et al., 1992)
and followed by increasing blood volume, reducing ADH secretion and renal water
reabsorption. Consequently, urinary excretion would increase. However, the present results
indicated that lactating crossbred goats consumed with high saline levels decreased WI and
urine volume compared to fresh water group and followed by water balance from DSW1.5
decreased. As a result, plasma ADH concentration from SW1.5 was greater than other
treatments from present experiment. The result in water balance from DSW1.5 agreed with
Assad and Elsherif (2002) for ewes. In contrast, previous studies showed that saline water
was not effect on water balance in Morada Nova sheep (Araújo et al., 2019), feedlot lambs
(Albuquerque et al., 2020) and dairy goats (Paiva et al. 2017).
Table 6. Effects of diluted seawater on water balance (kg/head/day) and ADH
hormone in lactating crossbred goats
Treatment
Items p
DSW0.0 DSW1.5
Water from container (kg/head/day) 3.42±0.53 1.90±0.38 0.05
Water from feed (kg/head/day) 2.35±0.02 2.34±0.03 0.85
Water from urine (kg/head/day) 2.35±0.30 1.64±0.16 0.07
Water from milk (kg/head/day) 0.53±0.09 0.58±0.04 0.68
Water from feces (kg/head/day) 0.50±0.05 0.40±0.02 0.08
Water balance (kg/head/day) 2.38±0.20 1.62±0.23 0.03
ADH (pg/ml) 9.49±0.55 16.35±2.28 0.02
DSW0.0: dairy goats drank with fresh water; DSW1.5: dairy goats drank with
diluted seawater at level 1.5%.

Conclusion
The results from current study indicated that lactating crossbred goats response to high
saline water by decreasing water intake e to minimize the salt stress.
 DMI, milk yield and body weight was not affected by high saline water from the
current study.

Water balance decreased and plasma ADH concentration increased from high saline
water group.

These leaded to decrease the thermoregulation’ capacity via higher RT and RR from
high saline group.

Acknowledgments
This research is funded by the Ministry of Education and Training, Vietnam under grant number B2020-TCT-08.

References
Abou Hussien E R M, Gihad E A, El-Dedawy T M and Abdel Gawad M H 1994 Reaction of camels, sheep
and goats with salt water. 2. Metabolism of water and minerals. Egyptian Journal Animal Production, 31: 387-
401.

Albuquerque I R R, Araújo G G L, Voltolini T V, Moura J H A, Costa R G, Gois G C, Costa S A P,

Campos F S, Queiroz M A A and Santos N M S S 2020 Saline water intake affects performance, digestibility,
nitrogen and water balance of feedlot lambs. Animal Production Science, 60: 1-7.
https://doi.org/10.1071/AN19224

AOAC 1990 Association of Official Analytical Chemistry. Official Method of Analysis, 15th Edn. Washington,
DC., USA.

Araújo G G L, Costa S A P, Moraes S A, Queiroz M A A, Gois G C, Santos N M S S, Albuquerque I R R,

Moura J H A and Campos F S 2019 Supply of water with salinity levels for Morada Nova sheep. Small
Ruminant Research, 171: 73–76. https://doi.org/10.1016/j.smallrumres.2019.01.001

Arieli A, Naim E, Benjamin R W and Pasternak D 1989 The effect of feeding saltbush and sodium chloride
on energy metabolism in sheep. Animal Science 49:451–457. https://doi.org/10.1017/S0003356100032657.

Assad F and El-Sherif M M A 2002. Effect of drinking saline water and feed shortage on adaptive responses of
sheep and camels. Small Ruminant Research, 45: 279–290.

Blair-West J R, Denton D A, McKinley M J and Weisinger R S 1992 Thirst and brain angiotensin in cattle.
American Journal of Physiology, 262(2): R204. https://doi.org/10.1152/ajpregu.1992.262.2.R204

Chaiyabutr N, Preuksagorn S, Komolvanich S and Chanpongsang S 2000 Comparative study on the

regulation of body fluids and mammary circulation at different states of lactation in crossbred Holstein cattle
feeding on different types of roughage. Journal of Animal Physiology and Animal Nutrition, 83: 74–84.
https://doi.org/10.1046/j.1439-0396.2000.00251.x

Eltayeb E E 2006 Effect of salinity of drinking water and dehydration on thermoregulation, blood and urine
composition in nubian goats, Khartoum, Sudan: University of Khartoum.

Hamzaoui S, Salama A A, Albanell E, Such X and Caja G 2013 Physiological responses and lactational
performances of late-lactation dairy goats under heat stress conditions. Journal of Dairy Science, 96: 6355–6365.
https://doi.org/10.3168/jds.2013-6665

Mdletshe Z M, Chimonyo M, Marufu M C and Nsahlai I V 2017 Effects of saline water consumption on
physiological responses in Nguni goats. Small Ruminant Research, 153: 209-211.
https://doi.org/10.1016/j.smallrumres.2017.06.019

Mohammed S A A 2008 Effects of salinity of drinking water, state of hydration, dietary protein level and
unilateral nephrectomy on blood constitucnts and laconic laconic function in Nubian goats. Khartoum, Sudan:
University of Khartoum.

Moura J H A, de Araujo G G L, Saraiv E P, de Albuquerque Ich R R, Turco S H N, Costa S A P and

Santo N M 2016 Ingestive behavior of crossbred Santa Inês sheep fed water with different salinity levels.
Semina: Ciências. Agrárias., 37: 1057-1068.
Nassar A M and Mousa S N 1981 Observations on behavioral response of sheep to water salinity. Faculty of
Agriculture, Ain Shams University, Research Bulletin 1488.

Nguyen T, Nguyen V H, Nguyen T N and Thammacharoen S 2022a Effects of high salinity in drinking water
on behaviors, growth and renal electrolyte excretion in crossbred Boer goats under tropical conditions.
Veterinary World (accepted)

Nguyen T, Chaiyabutr N, Chanpongsang S and Thammacharoen S 2018 Dietary cation and anion
difference: Effects on milk production and body fluid distribution in lactating dairy goats under tropical
conditions. Animal Science Journal, 89(1): 105-113. https://doi.org/10.1111/asj.12897

Nguyen T, Truong V K, Nguyen V H, Nguyen T N and Thammacharoen S 2022b The effect of diluted
seawater on salt tolerance threshold and physiological responses in Bach Thao goats under tropical conditions.
Animal Bioscience (submitted)

Paiva G N, De Araújo G G L, Henriques L T, Medeiros A N, Filho E M B, Costa R G, De Albuquerque Í

R R, Gois G C, Campos F S and Freire R M B 2017 Water with different salinity levels for lactating goats.
Semina: C iências Agrárias, L ondrina, 38: 2065–2074

Potter B J 1963 The effect of saline water on kidney tubular function and electrolyte excretion in sheep.
Australian Journal of Agricultural Research , 14: 518-528. https://doi.org/10.1071/AR9630518

Runa R A, Brinkmann L, Gerken M and Riek A 2019 Adaptation apacity of Boer goats to saline drinking
water. Animal, 13: 2268-2276. https://doi.org/10.1017/S1751731119000764

Silanikove N and Koluman N 2015 Impact of climate change on the dairy industry in temperate zones:
Predications on the overall negative impact and on the positive role of dairy goats in adaptation to earth
warming. Small Ruminant Research, 123: 27–34. https://doi.org/10.1016/j.smallrumres.2014.11.005

Simon S A, de Araujo I E, Gutierrez R and Nicolelis MA 2006 The neural mechanisms of gustation: a
distributed processing code. Nature Reviews Neuroscience, 7(11): 890-901. https://doi.org/10.1038/nrn2006.

Thammacharoen S, Chanpongsang S, Chaiyabutr N, Teedee S, Pornprapai A, Insam-ang A, Srisa-ard C

and Channacoop N 2020 An analysis of herd-based lactation curve reveals the seasonal effect from dairy cows
fed under high ambient temperature. Thai Journal Veterinary Medicine, 50(2): 169-178.

Tsukahara Y, Puchala R, Sahlu T and Goetch A L 2016 Effects of level of brackish water on feed intake,
digestion, heat energy, and blood constituents of growing Boer and Spanish goat wethers. Journal Animal
Sciene, 94(9): 3864-3874. https://doi.org/10.2527/jas.2016-0553.

Van Soest P J, Robertson J B, Lewis B A 1991 Methods for dietary fiber neutral detergent fiber and non-starch
polysaccharides in relation to animal nutrition. Journal of Dairy Science, 74: 3583–3597. https://doi:
10.3168/jds.S0022-0302(91)78551-2.

Received 13 March 2022; Accepted 19 March 2022; Published 1 May 2022

 Brazilian Journal of Poultry Science
Revista Brasileira de Ciência Avícola
The Efficiency of Bacteriophages Against
ISSN 1516-635X 2022 / v.24 / n.3 / 001-008
Salmonella Typhimurium Infection in Native Noi
http://dx.doi.org/10.1590/1806-9061-2021-1561 Broilers
Original Article

Author(s)
ABSTRACT
Ngu NTI https://orcid.org/0000-0003-2197-451X Though recently considered a therapeutic treatment for commercial
Phuong LNNI,II https://orcid.org/0000-0003-2180-2267 broilers, little is known about the effects of bacteriophages on
Anh LHI https://orcid.org/0000-0002-0820-7044
native, slow-growing birds. This study evaluated their efficacy against
Loc HTI https://orcid.org/0000-0001-9922-4802
Tam NTI https://orcid.org/0000-0003-1809-2276
Salmonella enterica subsp. enterica serovar Typhimurium infected Noi
Huan PKNIII https://orcid.org/0000-0002-8756-2158
chicken, a native Vietnamese broiler breed. In total, 420 birds were used
Diep THIV https://orcid.org/0000-0003-4834-0824 in a completely randomized design consisting of seven treatments and
Kamei KV https://orcid.org/0000-0002-7496-4692 four replicates of 15 birds. The treatments were NC (negative control),
I
College of Agriculture, Can Tho University,
PC (positive control, S. Typhimurium challenged); NC+B1 and NC+B2
Vietnam. (negative control plus B1 or B2 bacteriophage, respectively); PC+B1,
II
Agricultural Service Center, Department of
Agriculture and Rural Development, Can Tho City,
PC+B2 (positive control plus B1 or B2 bacteriophage, respectively) and
Vietnam. PC+B1B2 (positive control plus both B1 and B2 bacteriophages). After
III
College of Natural Sciences, Can Tho University,
Vietnam. four weeks of infection, the mortality rate in the PC group was 51.1%
IV
Faculty of Agriculture and Food Technology, Tien compared with 11.1% in the PC+B1B2 treatment. Bacteriophage
Giang University, My Tho City, Vietnam.
V
Department of Biomolecular Engineering, Kyoto administration had resulted in increased weight gain and decreased
Institute of Technology, Kyoto, Japan. feed conversion ratio, particularly when both phages were included
in the treatment (p<0.001). Moreover, the relative percentage of
carcass weight was lowest in the PC treatment (66.9%) (p<0.001),
whereas the other treatments registered similar carcass weight values.
Regarding the internal organs, liver weight percentage was higher in
the non-treated Salmonella group, and enlarged spleens were also
noted in infected chickens even when treated with bacteriophages.
Mail Address The correlation between phage administration and blood parameters
Corresponding author e-mail address was unclear. Although the use of two bacteriophages for therapy was
Nguyen Trong Ngu determined to be preferable for the majority of the criteria examined,
College of Agriculture, Can Tho University,
Campus 2, 3/2 Street, Can Tho City,
further genetic characterization of the phages will be required before
Vietnam. they can be widely used in chicken farms.
Phone: +84-292-3831166
Email: ntngu@ctu.edu.vn
INTRODUCTION
Salmonella is a significant poultry pathogen that is of concern for
public health and can potentially cause losses in poultry production
Keywords (Berchieri Jr et al., 2001). In Vietnam, salmonellosis is one of the most
Growth, indigenous chickens, mortality, frequent bacterial infections in poultry farms, with 8.81 percent of
phage therapy, Salmonella. chickens in the Mekong Delta being infected with the disease in 2010
(Khai et al., 2010). So far, antibiotics have been used extensively to
treat and prevent bacterial infections, resulting in antibiotic-resistant
microorganisms. It is estimated that roughly 148 mg of antimicrobial are
required to raise one kilogram of live chicken worldwide; however, in
the Mekong Delta region of Vietnam, a higher level of antimicrobials in
chicken production (260 mg/kg of chicken, excluding medicated feed)
has been documented (Van Boeckel et al., 2015; Nguyen et al., 2015;
Carrique‐Mas et al., 2015). Salmonellosis control at the farm level can
be accomplished through a multi-factorial approach, and when broilers
Submitted: 27/October/2021 get Salmonella, several simultaneous or sequential procedures may
Approved: 03/February/2022 be applied (Clavijo et al., 2019), of which bacteriophage therapy has
1
eRBCA-2021-1561
Ngu NT, Phuong LNN, Anh LH, Loc HT,
Tam NT, Huan PKN, Diep TH, Kamei K
been described as a promising biological control for
salmonellosis in poultry (Thanki et al., 2021).
Bacteriophages, or phages, are predators of
bacteria that are naturally present in the environment.
According to some estimates, they are abundant
in the environment, with an estimated 10:1 ratio
compared to their bacterial counterparts (O’Flaherty
et al., 2009). Bacteriophages are defined as bacterial
viruses that can infect and subsequently kill their host
bacteria via bacteriolysis. Due to their availability, non-
toxicity, and specificity to the bacterial hosts, lytic
phages have been utilized as efficient tools for various
purposes such as improving food safety or preventing
and treating bacterial pathogens (Brovko et al., 2012;
Sulakvelidze, 2013). In addition, bacteriophages are
extremely specific by infecting only a single species of
bacteria, and phage therapy is regarded as safer and
more effective than antibiotics (Upadhaya et al., 2021).
Previously, several reports have mentioned the positive
effects of bacteriophage in reducing pathogens and
improving the production performance of broiler
chickens (Atterbury et al., 2007; Lim et al., 2012; Wang
et al., 2013). According to a recent study (Nabil et al.,
2018), bacteriophage treatment can rapidly reduce S.
Typhimurium and S. Enteritidis in broiler chickens and
could be used instead of antibiotics. The investigation
of Clavijo et al. (2019) also demonstrated that phage
treatment on commercial broiler farms had no adverse
effects on production parameters and significantly
reduced Salmonella infection in the chickens.
The majority of the research appears to have been
concentrating on commercial broilers, with little
information on the use of bacteriophage for indigenous
breeds with slower growth and superior meat quality,
which is an important component in the economies
of rural and underdeveloped countries (Padhi, 2016).
Therefore, the present study was undertaken in Noi
chickens, one of the native breeds mainly reared in the
Southern regions of Vietnam, aiming to evaluate the
effects of bacteriophage on treating S. Typhimurium
infection and further identify its effectiveness in the
growth and carcass characteristics of the birds.
MATERIALS AND METHODS
Bacteria strains and bacteriophage prepa-
ration
In this study, the virulent strain S. Typhimurium
ATCC®14028™ (American Type Culture Collection)
was used for the in vivo infection in Noi chickens.
Moreover, two bacteriophages, namely B1 and B2,
2
The Efficiency of Bacteriophages Against Salmonella
Typhimurium Infection in Native Noi Broilers
were isolated and screened from chicken intestines
and environmental sources at various poultry farms
in the Mekong Delta of Vietnam (Souvannaty et al.,
2019). Briefly, for phage isolation and pure culture
isolation, the double agar-plaque assay (Kropinski et
al., 2009) and the method of Poxleitner et al. (2017)
were applied. The phages were then tested for host
spectrum, pH tolerance (Verma et al., 2009), and lysis
capacity in vitro (Kropinski et al., 2009; Verma et al.,
2009). Based on the criteria for host spectrum, pH
tolerance, and ability to lyse S. Typhimurium, the B1 and
B2 bacteriophages were selected for the experimental
infection of chickens.
Phage proliferation: from the isolates available in
the laboratory, the phages were proliferated in the
ratio of phage: Salmonella: TSB being 1: 2: 30 with a
Salmonella (Salmonella Typhimurium - ATCC®14028™)
population of 108 CFU/ml. The phages were incubated
at 37°C for 24 hours. After that, chloroform solution
was added to the proliferated phage biomass at the
rate of 1 chloroform: 10 phages. The solution was
then vortexed, incubated for 2 hours followed by
centrifuging at 6,000 rpm at 4oC for 15 minutes for
phage collection (Silva et al., 2014). The concentration
of phages was determined as described Poxleitner et
al. (2017) and Gonzalez-Menendez et al. (2018).
Chickens care and experimental design
The study was carried out on the experimental farm
of Can Tho University located at Campus IV, Phung Hiep
district, Hau Giang province. The care and handling
of chickens were performed following guidelines
of Animal Husbandry Law (32/2018/QH14), and the
experimental procedure was approved by the Council
for Science and Education, College of Agriculture (A10-
02-2019/KNN), Can Tho University. The indigenous
Noi chickens were obtained from a breeding company
based in Soc Trang near Hau Giang province. During
the rearing period, chickens were vaccinated against
Marek disease (one-day-old), Newcastle disease and
infectious bronchitis (days 4, 14, and 60th), Gumboro
(days 7 and 12th), Fowl Pox (day 10th), and H5N1 avian
influenza (day 45th). All birds were kept in confinement
houses at the density of 10 birds/m2 in the finishing
stage. Drinking water was available, and chickens
were fed ad libitum of commercial broiler diets: starter
from 1 to 28 days (16% crude protein, 4% crude fiber,
metabolizable energy 2,800 kcal/kg) and grower and
finisher from 29 to 98 days (14% crude protein, 5%
crude fiber, metabolizable energy 2,800 kcal/kg).
In total, 420 birds were arranged in a completely
randomized design with 7 treatments and 4 replicates
eRBCA-2021-1561
Ngu NT, Phuong LNN, Anh LH, Loc HT,
Tam NT, Huan PKN, Diep TH, Kamei K
of 15 birds. The treatments were NC (negative control,
without S. Typhimurium, without bacteriophage); PC
(positive control, S. Typhimurium challenged, without
bacteriophages); NC+B1 and NC+B2 (negative control
plus B1 or B2 bacteriophage, respectively); PC+B1,
PC+B2 (positive control plus B1 or B2 bacteriophage,
respectively) and PC+B1B2 (positive control plus both
B1 and B2 bacteriophages). The chicks were challenged
with 1 ml of S. Typhimurium on the 2nd day at the dose
of 108.5 cfu/ml via oral administration. In treatments
with bacteriophage therapy, the phages were orally
inoculated at the dose of 1010 pfu/ml starting at 24
hours after infection, followed for three consecutive
days, and repeated weekly until day 63rd.
Data collection and measurements
The experiment lasted for 100 days till the Noi
chickens reached their mature weight. Feed intake and
body weight were recorded weekly for each replicate,
and feed conversion ratio (FCR) was calculated as g
feed intake/g weight gain after correcting mortality.
The mortality was recorded in the first four weeks after
infection. During the experimental period, four birds
per treatment (sex-balanced when applicable) were
randomly selected for re-isolation of S. Typhimurium
on days 7, 21, and 35 (Gomes et al., 2014), and organ
relative weight calculation on days 7, 35, and 63.
At the end of the experiment, 56 chickens (8 birds/
treatment, sex-balanced) with weights around the
means were selected for slaughtering to evaluate
carcass characteristics and organ measurements. The
broilers were individually weighed and then killed via
cervical dislocation and exsanguination. The breast,
thigh and drumstick muscle and wings were collected
as described by Goliomytis et al. (2003). In addition,
the liver, spleen, heart, and gizzard were then removed
and weighed, and the organ weights were expressed
as a percentage of the body weight.
Statistical analysis
The data were subjected to analysis of variance
using the General Linear Model procedure of the
Table 1 – Mortality rate (%) of chickens after four weeks of infection.
Week
NC PC
1 0 28.9
2 0 13.5
3 0 4.40
4 0 4.40
1-4 0 51.1
*
NC: negative control, without S. Typhimurium, without bacteriophage; PC: positive control, S. Typhimurium challenged, without bacteriophages; NC+B1 and NC+B2: negative control
plus B1 or B2 bacteriophage, respectively; PC+B1, PC+B2: positive control plus B1 or B2 bacteriophage, respectively; PC+B1B2: positive control plus both B1 and B2 bacteriophages.
The Efficiency of Bacteriophages Against Salmonella
Typhimurium Infection in Native Noi Broilers
Minitab version 16.2.1 software (State College, PA,
USA) (Minitab, 2010). The difference of means among
treatments was measured through Tukey’s comparison
test with p≤0.05.
RESULTS AND DISCUSSION
Mortality of chickens during four weeks
after infection
The effect of treatment on mortality is shown in
Table 1. In the negative control and treatments without
S. Typhimurium challenged, no death were recorded.
In contrast, the mortality was the highest in the
positive control during four weeks post-infection, with
an accumulative value of 51.1%. The bacteriophage
administered treatments either in a single phage or
cocktail phage demonstrated a reduction in mortality
down to 11.1% over four weeks. It was also noted that
a majority of birds’ death happened during the first
week of inoculation. There is little evidence available
on the effects of S. Typhimurium on the death rate of
native chickens. However, in broiler chickens, Nabil et
al. (2018) reported on two-day old chicks infected with
S. Typhimurium (105 cfu/ml) that mortality appeared
after three days of infection with an overall rate of
20%, which is lower than the dead rate of Noi chickens
in the current study, most likely due to the different
breeds and higher dose of bacteria used in our study
(108.5 cfu/ml). When bacteriophages were added, the
effectiveness of reducing diarrhea after two days of
infection was demonstrated, and no dead chickens
were recorded in these treatments (Nabil et al., 2018).
In the present study, the death were also investigated
for lesions, and the nine internal organs (liver, spleen,
and heart) were used for bacteria re-isolation, and
their sequence was confirmed as Salmonella enterica
subsp. enterica serovar Typhimurium str. 14028S in
BLAST, NCBI (https://blast.ncbi.nlm.nih.gov) (data not
shown).
In the current study, there were no death in the
treatments inoculated only bacteriophages after four
Treatments*
NC+B1 NC+B2 PC+B1 PC+B2 PC+B1B2
0 0 11.1 13.3 8.90
0 0 2.20 6.70 2.20
0 0 4.50 2.20 0.00
0 0 0.00 0.00 0.00
0 0 17.8 22.2 11.1
3
eRBCA-2021-1561
Ngu NT, Phuong LNN, Anh LH, Loc HT,
Tam NT, Huan PKN, Diep TH, Kamei K
weeks of infection, showing that the existing phage
application was practically safe for chickens or did
not cause any other health problems. Similar findings
were also reported elsewhere by Wójcik et al. (2020).
Moreover, in our study, the therapeutic effectiveness
has been shown with reduced mortality in treatments
with bacteriophage usage. The clinical manifestations
of salmonellosis were comparably mild, and the
combination of the two phages received a better
response from chicken. It was reported by Fischer et
al. (2013) that combinations of multiple phages might
be more effective at phage bio-control because they
provide a wider range of hosts and, as a result, help to
keep resistances under control. In terms of reducing
the Campylobacter jejuni population, the phage
cocktails performed slightly better than the single
phage following phage delivery. On the other hand,
the cocktail slowed and delayed the formation of
phage resistance (Fischer et al., 2013), and the use of
a phage cocktail for the treatment of S. Typhimurium
in chickens might bring desirable results.
The high mortality rate in the first week after
infection could be attributed to the high concentration
of bacteria in internal organs, as well as the fact that
the birds were still young, with an immature immune
system (Akhtar et al., 2013). Previously, Berchieri Jr et
al. (1991) also mentioned that when newly hatched
chicks were infected with S. Typhimurium, giving phage
lytic solutions soon after infection was shown to reduce
mortality. Still, the efficacy was reduced when offering
phages a few hours later or in lower numbers. This
is important because controlling Salmonella from its
origin has been difficult since S. Typhimurium infection
in young chicks generally causes no symptoms, and
as a result, environmental contamination occurs,
which contributes to the organism’s proliferation
among the flock (Hooton et al., 2011). In addition,
Huff et al. (2006) concluded that to treat a systemic
bacterial infection successfully, a sufficient number of
bacteriophages need to be present when the infection
begins. Taken together, a two-phage cocktail in this
study could reduce the S. Typhimurium invasion in the
internal organs, as well as the mortality of chickens.
Re-isolation of S. Typhimurium in the
internal organs
Among the organs used to re-isolate S. Typhimurium,
a slightly lower concentration of bacteria was found
in the heart over 7, 21, and 35 days post-infection
(Figure 1). As expected, no bacteria were found in the
negative treatments and those without S. Typhimurium
4
The Efficiency of Bacteriophages Against Salmonella
Typhimurium Infection in Native Noi Broilers
inoculation. The bacterial invasion decreased over time,
indicating that bacteriophages aided in eradicating S.
Typhimurium colonization in the birds’ liver, spleen,
and heart. Moreover, a combination of two phages
consistently outperformed a single phage therapy
regardless of the checking point.
Figure 1 – Number of S. Typhimurium re-isolated from organs at different days post-
-infection.
NC: negative control; PC: positive control: B1: Bacteriophage 1; B2: Bacteriophage 2.
In the absence of Salmonella infection, re-isolated
organs were free of S. Typhimurium, indicating that
the control group from the current study was not
infected either from other chickens or the feed used
in the experiment, which is consistent with the report
of Goliomytis et al. (2003). The presence of infected
bacteria in the organs was expected because when
predominant Salmonella serovars infect chickens,
the germs can be found in the spleen, liver, heart,
gallbladder, intestinal tissues, ceca, and various
portions of the ovary and oviduct (Gast et al., 2007;
Keller et al., 1995). Although the bacterial counts were
reduced in the current investigation, their presence
was still observed after 35 days. The phages applied in
our work were not as effective as reported by Wong
et al. (2013) that within 12 hours, the Salmonella
was wholly eradicated from the chicks with phage
by a single intracloacal inoculation an hour after S.
Typhimurium inoculation. The supplied route could
be one reason, as intracloacal inoculation ensures
caecal wall lining establishment and eliminates
passage through the acidic conditions of the crop
and gizzard (Wong et al., 2013). This intracloacal
application, however, is impractical at the farm level.
Another reason for the effectiveness of bacteriophage
treatment may be the low ratio of bacteriophage to
bacteria. Supporting this conclusion was the significant
reduction in S. Typhimurium concentration achieved
by first administering the phage cocktail before or just
after bacterial infection, then twice daily for four days,
and then weekly (Bardina et al., 2012).
eRBCA-2021-1561
Ngu NT, Phuong LNN, Anh LH, Loc HT, The Efficiency of Bacteriophages Against Salmonella
Tam NT, Huan PKN, Diep TH, Kamei K Typhimurium Infection in Native Noi Broilers

Effects of bacteriophage treatments on Body weight is an important characteristic in broiler

production performance of broilers production since lower body weight correlates to
higher broiler meat production costs. A clear tendency
Body weight, feed intake, and feed conversion ratio
of improving the growth rate of infected chickens
(FCR) of chickens were affected by treatments during
treated with bacteriophages was identified in our
the experimental period (Table 2). Bacteriophage
study. The present findings corroborated the research
administration has contributed to better weight gain
outputs of a previous study (Toro et al., 2005) that S.
and reduced FCR, especially in the treatment with Typhimurium phage treatment resulted in a favorable
both phages included. Chickens in the positive control effect on weight gain. These authors also pointed out
treatment grew slowly (265 g/bird) in the first 35 days, that chicks gained less weight following the challenge
which was significantly different (p<0.001) from the and maintained lower weights throughout the study,
ones in other treatments without S. Typhimurium which parallels our results.
infection and tended to be lower than those with Apart from being used as therapeutic bioagents
bacteriophage inoculation. In the next stages, to eradicate bacteria, bacteriophages have been used
although not significant, a superior growth rate was as feed additives to prevent pathogens, resulting in
also documented in bacteriophage treatments, and productivity advantage. For example, in experiments
this contributed to the difference in overall weight gain using diets containing phages against S. Gallinarum, S.
with a respective increase per bird of 1,117 g, 1,263 g, Typhimurium, and S. Enteritidis, where broiler chickens
and 1,217 g for PC, NC, and PC+B1B2 (p<0.005). As were raised under normal physiological conditions
a consequence of higher intake but low efficiency in (without bacterial challenge), improvements in body
feed conversion, the most considerable FCR increased weight and FCR were observed (Lim et al., 2010; Kim
was noted in the PC treatment. Among the infected et al., 2014; Wójcik et al., 2020). This is due to the fact
chickens, those with phage applied provided lower that the bacteriophage inhibits the growth of bacteria
FCR, ranging from 3.56 (phage cocktail) to 3.86 in the broilers’ gastrointestinal tract (Lim et al., 2010),
(phage B2). According to Khoa et al. (2019), the BW and the increase in body weight may be related to
of a Noi broiler at 84 days of age was 1,196 g for an increase in feed intake (Upadhaya et al., 2021).
females and 1,424 g for males, with an average FCR However, not all cases of phage therapy or phage
of 3.52. Thus, the chickens used in this experiment supplementation in diets resulted in enhanced broiler
developed normally, with an average body weight of production traits. Kim et al. (2013) found that feeding
1.263 g in the NC treatment. S. enteritidis-targeted phages had little influence on

Table 2 – Effects of bacteriophage on body weight gain, feed intake and feed conversion ratio.
Treatments
Parameters* SEM p
NC PC NC+B1 NC+B2 PC+B1 PC+B2 PC+B1B2
1-35 days
BWG 327ab 265c 352ab 356a 305bc 302bc 314abc 10.3 0.000
FI 796 859 857 839 867 860 846 15.4 0.075
FCR 2.45bc 3.25a 2.44bc 2.36c 2.84ab 2.84ab 2.71bc 0.10 0.000
36-70 days
BWG 518 474 552 555 539 505 525 21.2 0.175
FI 1,750c 1,930ab 1,870c 1,870abc 1,899abc 1,982a 1,872abc 32.0 0.003
FCR 3.39 4.10 3.40 3.33 3.53 3.92 3.58 0.18 0.051
71-98 days
BWG 400 376 414 388 364 362 377 15.7 0.257
FI 1,578bc 1,742a 1,577bc 1,502c 1,581bc 1,675ab 1,611b 22.3 0.000
FCR 3.79b 4.63a 3.80b 3.92ab 3.35ab 4.63a 4.27ab 0.15 0.003
1-98 days
BWG 1,263ab 1,117c 1,319a 1,301ab 1,209abc 1,171bc 1,217abc 30.4 0.005
FI 4,124e 4,533a 4,304cd 4,145de 4,348bc 4,518ab 4,330c 36.7 0.000
FCR 3.27c 4.07a 3.26c 3.20c 3.60bc 3.86ab 3.56bc 0.08 0.000
*
BWG: Body weight gain (g); FI: Feed intake (g); FCR: Feed conversion ratio (feed/gain). NC: negative control, without S. Typhimurium, without bacteriophage; PC: positive control,
S. Typhimurium challenged, without bacteriophages; NC+B1 and NC+B2: negative control plus B1 or B2 bacteriophage, respectively; PC+B1, PC+B2: positive control plus B1 or B2
bacteriophage, respectively; PC+B1B2: positive control plus both B1 and B2 bacteriophages.
: Within a row, values with different superscripts differ statistically at p<0.05.
a,b,c,d,e

5
eRBCA-2021-1561
Ngu NT, Phuong LNN, Anh LH, Loc HT, The Efficiency of Bacteriophages Against Salmonella
Tam NT, Huan PKN, Diep TH, Kamei K Typhimurium Infection in Native Noi Broilers

broiler performance and it was additionally suggested
that phages targeting several pathogenic bacteria have
more favorable effects than phages targeting single
pathogenic bacteria in boosting broiler performance
(Kim et al., 2014). In another study, Noor et al. (2020)
concluded that antibiotics and bacteriophages did not
affect body weight gain, feed intake, or FCR during
the 15-32 days of commercial broilers. The phage-host
interaction in production traits of chickens might be
dependent on phage types and genotypes, which can
be found from poultry and environmental isolates.
Carcass characteristics and internal organs
of Noi chickens
Carcass composition and internal organ
measurements of chickens are presented in Table
3. The relative percentage of carcass weight was
lowest at the PC treatment (66.9%) (p<0.001), while
in the other treatments, these values were similar.
The greatest breast muscle and thigh and drumstick
ratios were shown in NC+B1 and NC+B2 treatments
(p<0.001). As a consequence of low carcass content
in the body, the percentage of breast, thigh, and
drumstick in chickens from PC was significantly lower
than those from others. There were also differences
in wing weight ratio among treatments, with the
highest being 11.0% in the PC+B1B2 treatment. The
improved carcass weight percentage may benefit from
the superior live weight as these two criteria are closely
related (Tuoi et al., 2021).
As for leg muscle percentage, the current outputs are
in line with the report of (Kim et al., 2013), according to
which the anti-S. Enteritidis bacteriophage treatments
had higher relative leg muscle weights than the control
treatments. In the NC treatment, values of carcass cuts
agreed with the report by Hung et al. (2020) in Noi
chicken at the slaughter of 84 days. There is a scarcity
of comparable data on the impact of bacteriophages
on other carcass traits; however, positive responses to
bacteriophage treatments have been demonstrated.
Most internal organs were numerically higher in the
PC treatment (p<0.005), mainly the relative weights
of small intestines, liver, and gizzard. For spleen
percentage, the highest values were on PC treatment
for most of the time points (Table 3). In addition,
throughout the experiment, a tendency to decrease
liver weight percentage was shown, which could be
attributed to an increase in final body weight (Figure
2a). In contrast, these figures demonstrated an upward
trend in spleen to body weight ratio, with a notable
figure in the PC treatment and other treatments with
Salmonella infection (Figure 2b).
In the present study, liver weight percentage was
higher in the non-treated Salmonella group, similar
to that shown by Wang et al. (2013). The mechanism
for this is unknown, but it could be hypothesized
that bacteriophages may alter the population of gut
intestinal bacteria, which are required for gut and liver
immune system development (Wang et al., 2013).
Regarding spleen weight ratio, the benefit of treating

Table 3 – Means weights of the carcass, carcass parts, and organs of chickens.
Treatments**
Parameters* SEM p
NC PC NC+B1 NC+B2 PC+B1 PC+B2 PC+B1B2
LW, g 1.280bc 1.148e 1.344a 1.337ab 1.228cd 1.193de 1.240cd 13.5 0.000
Carcass parts relative to LW (%)
KW 95.8 96.4 97.0 96.6 96.2 96.6 96.5 0.30 0.209
DFW 85.6a 82.0b 85.6a 86.1a 85.4a 84.8a 85.0a 0.45 0.000
CW 71.0ab 66.9c 71.4ab 71.5a 70.9ab 70.0b 70.8ab 0.32 0.000
BW 12.5bc 10.9d 14.7a 13.2b 11.5cd 12.0cd 11.7cd 0.26 0.000
TDW 16.2a 13.9b 15.8ab 17.2a 13.9b 15.9ab 15.6ab 0.47 0.000
WW 10.5abc 9.89c 10.7ab 10.8a 9.96bc 10.7ab 11.0a 0.17 0.000
Internal organs relative to LW (%)
SM 7.70ab 9.35a 6.75b 7.52b 8.19ab 7.52b 7.23b 0.38 0.002
Caecum 0.72b 1.02a 0.69 b
0.75 b
0.87ab 1.03a 0.82ab 0.05 0.000
Liver 2.06b 3.02a 2.14 b
2.40 b
2.43b 2.51ab 2.26b 0.12 0.000
Spleen 0.18b 0.32a 0.24 ab
0.30 ab
0.29ab 0.31a 0.32a 0.03 0.000
Gizzard 2.51b 3.95a 2.74 b
2.81 b
2.52b 2.44b 2.90b 0.14 0.000
Heart 0.49abc 0.67ab 0.46 c
0.48 bc
0.54abc 0.58a 0.44c 0.02 0.000
*
LW: live weight; KW: killed weight; DFW: De-feather wight; CW: Carcass weight; BW: Breast muscle weight; TDM: Thigh and drumstick muscle weight; WW: Wing weight; SM: Small
intestine.
**
NC: negative control, without S. Typhimurium, without bacteriophage; PC: positive control, S. Typhimurium challenged, without bacteriophages; NC+B1 and NC+B2: negative control
plus B1 or B2 bacteriophage, respectively; PC+B1, PC+B2: positive control plus B1 or B2 bacteriophage, respectively; PC+B1B2: positive control plus both B1 and B2 bacteriophages.
: Within a row, values with different superscripts differ statistically at p<0.05.
a,b,c

6
eRBCA-2021-1561
Ngu NT, Phuong LNN, Anh LH, Loc HT,
Tam NT, Huan PKN, Diep TH, Kamei K
Figure 2 – Relative weight percentage of chicken liver (a) and spleen (b) during the
experimental period.
chicken with phages was not demonstrated compared
to those from Kim et al. (2013), whose results showed
a drop in spleen weight relative to body weight,
indicating that phage inclusion was better. The current
outputs are consistent with the findings of Upadhaya
et al. (2021), who discovered that the relative weight of
the gizzard increased more substantially in the positive
control group than the control and phage groups,
which could be explained by an increase in feed intake
in the positive control group. On the other hand,
supplementation with anti-S. Enteritidis bacteriophage
did not affect the relative weight of organs after 35
days (Kim et al., 2013). Moreover, in E. coli-infected
birds treated with bacteriophages, the heart, liver, and
spleen sizes were not significantly different from the
control groups (Lau et al., 2010). Nonetheless, on days
2, 3, and 21 post-infection, the livers of untreated
E. coli-challenged birds were enlarged. These birds’
spleens were also enlarged on days 2, 3, and 7 post-
infection but subsequently experienced a gradual
reduction in size (Lau et al., 2010).
CONCLUSION
In this study, bacteriophage treatment resulted
in a decrease in mortality in broilers infected with S.
7
The Efficiency of Bacteriophages Against Salmonella
Typhimurium Infection in Native Noi Broilers
Typhimurium. Additionally, they tended to facilitate
the growth of chickens and the improvement of feed
conversion ratio. When bacteriophages were applied,
the carcass proportion increased, yet no evident
benefits were observed in internal organ weight. The
use of two bacteriophages for therapy was preferable
for most of the criteria investigated; nevertheless, a
comprehensive genetic characterization of the phages
and their host range needs to be undertaken as the
next stage before they can be extensively used in
chicken farms.
ACKNOWLEDGMENTS
This study is funded in part by the Can Tho
University Improvement Project VN14-P6, supported
by a Japanese ODA loan.
CONFLICT OF INTEREST
The authors declare no conflict of interest.
REFERENCES
Akhtar A, Bejo M, Zakaria Z. Pathogenicity of Salmonella Enteritidis phage
types 6A and 7 in experimentally infected chicks. Journal of Animal and
Plant Science 2013;23:1290-1296.
Atterbury RJ, Van Bergen M, Ortiz F, Lovell M, Harris J, De Boer A, et al.
Bacteriophage therapy to reduce Salmonella colonization of broiler
chickens. Applied and Environmental Microbiology 2007;73(14):4543-
4549.
Bardina C, Spricigo DA, Cortés P, Llagostera M. Significance of the
bacteriophage treatment schedule in reducing Salmonella colonization
of poultry. Applied and Environmental Microbiology 2012;78(18):6600-
6607.
Berchieri Jr A, Lovell M, Barrow P. The activity in the chicken alimentary
tract of bacteriophages lytic for Salmonella Typhimurium. Research in
Microbiology 1991;142(5):541-549.
Berchieri Jr A, Murphy C, Marston K, Barrow P. Observations on the
persistence and vertical transmission of Salmonella enterica serovars
Pullorum and Gallinarum in chickens: effect of bacterial and host
genetic background. Avian Pathology 2001;30(3):221-231.
Brovko LY, Anany H, Griffiths MW. Bacteriophages for detection and control
of bacterial pathogens in food and food-processing environment.
Advances in Food and Nutrition Research 2012;67:241-288.
Carrique‐Mas JJ, Trung NV, Hoa NT, Mai HH, Thanh TH, Campbell JI, et
al. Antimicrobial usage in chicken production in the Mekong Delta of
Vietnam. Zoonoses and Public Health 2015;62:70-78.
Clavijo V, Baquero D, Hernandez S, Farfan J, Arias J, Arévalo A, et al. Phage
cocktail SalmoFREE® reduces Salmonella on a commercial broiler farm.
Poultry Science 2019;98(10):5054-5063.
Fischer S, Kittler S, Klein G, Glünder G. Impact of a single phage and a
phage cocktail application in broilers on reduction of Campylobacter
jejuni and development of resistance. PLoS ONE 2013;8(10):e78543.
eRBCA-2021-1561
Ngu NT, Phuong LNN, Anh LH, Loc HT,
Tam NT, Huan PKN, Diep TH, Kamei K
Gast RK, Guraya R, Guard-Bouldin J, Holt PS, Moore RW. Colonization of
specific regions of the reproductive tract and deposition at different
locations inside eggs laid by hens infected with Salmonella Enteritidis
or Salmonella Heidelberg. Avian Diseases 2007;51(1):40-44.
Goliomytis M, Panopoulou E, Rogdakis E. Growth curves for body weight
and major component parts, feed consumption, and mortality of male
broiler chickens raised to maturity. Poultry Science 2003;82(7):1061-
1068.
Gomes A, Quinteiro-Filho W, Ribeiro A, Ferraz-de-Paula V, Pinheiro M,
Baskeville E, et al. Overcrowding stress decreases macrophage activity
and increases Salmonella Enteritidis invasion in broiler chickens. Avian
Pathology 2014;43(1):82-90.
Hooton SP, Atterbury RJ, Connerton IF. Application of a bacteriophage
cocktail to reduce Salmonella Typhimurium U288 contamination on pig
skin. International Journal of Food Microbiology 2011;151(2):157-163.
Huff W, Huff G, Rath N, Donoghue A. Evaluation of the influence of
bacteriophage titer on the treatment of colibacillosis in broiler chickens.
Poultry Science 2006;85(8):1373-1377.
Hung LT, Lan LTT, Thu NTA, Phong NH, Nhan NTH, Ngu NT. Effects of dietary
lysine on apparent amino acid digestibility and carcass characteristics of
Noi broilers. Livestock Research for Rural Development 2020;32, Article
#126.
Keller LH, Benson CE, Krotec K, Eckroade RJ. Salmonella Enteritidis
colonization of the reproductive tract and forming and freshly laid eggs
of chickens. Infection and Immunity 1995;63(7):2443-2449.
Khai LTL, Phan TT, Chuc NT. Determination of transmitted sources of
salmonellosis caused by Salmonella as zoonosis in some provinces in the
Mekong Delta. Can Tho University Journal of Science 2010;(16b):69-
79.
Khoa DAV, Tuoi NTH, Thuy NTD, Okamoto S, Kawabe K, Khang NTK, et al.
Growth performance and morphology of in 28-84 day-old Vietnamese
local Noi chicken. Biotechnology in Animal Husbandry 2019;35(3):301-
310.
Kim J, Kim J, Lee B, Lee G, Lee J, Kim G-B, et al. Effect of dietary
supplementation of bacteriophage on growth performance and cecal
bacterial populations in broiler chickens raised in different housing
systems. Livestock Science 2014;170:137-141.
Kim K, Lee G, Jang J, Kim J, Kim Y. Evaluation of anti-SE bacteriophage as
feed additives to prevent Salmonella Enteritidis (SE) in broiler. Asian-
Australasian Journal of Animal Science 2013;26(3):386-393.
Kropinski AM, Mazzocco A, Waddell TE, Lingohr E, Johnson RP. Enumeration
of bacteriophages by double agar overlay plaque assay. Methods in
Molecular Biology 2009,501:69-76.
Lau G, Sieo C, Tan W, Hair-Bejo M, Jalila A, Ho Y. Efficacy of a bacteriophage
isolated from chickens as a therapeutic agent for colibacillosis in broiler
chickens. Poultry Science 2010;89(12):2589-2596.
Lim T-H, Kim M-S, Lee D-H, Lee Y-N, Park J-K, Youn H-N, et al. Use of
bacteriophage for biological control of Salmonella Enteritidis infection
in chicken. Research in Veterinary Science 2012;93(3):1173-1178.
Lim T-H, Lee H-J, Kim M-S, Kim B-Y, Yang S-Y, Song C-S. Evaluation of
efficacy of bacteriophage CJø07 against Salmonella Enteritidis infection
in the SPF chicks. Korean Journal of Poultry Science 2010;37(3):283-
287.
Minitab. Reference manual. Release 16.2.1 for Windows. Minitab Inc;
2010.
Nabil NM, Tawakol MM, Hassan HM. Assessing the impact of bacteriophages
in the treatment of Salmonella in broiler chickens. Infection Ecology
and Epidemiology 2018;8(1):1539056.
Nguyen VT, Carrique-Mas JJ, Ngo TH, Ho HM, Ha TT, Campbell JI, et al.
Prevalence and risk factors for carriage of antimicrobial-resistant
Escherichia coli on household and small-scale chicken farms in the
Mekong Delta of Vietnam. Journal of Antimicrobial Chemotherapy
2015;70(7):2144-2152.
8
The Efficiency of Bacteriophages Against Salmonella
Typhimurium Infection in Native Noi Broilers
Noor M, Runa N, Husna A. Evaluation of the effect of dietary supplementation
of bacteriophage on production performance and excreta microflora of
commercial broiler and layer chickens in Bangladesh. MOJ Proteomics
& Bioinformatics 2020;9(2):27-31.
Gonzalez-Menendez E, Fernandez L, Gutierrez D, Rodriguez A, Martinez
B, Garcia P. Comparative analysis of different preservation techniques
for the storage of Staphylococcus phages aimed for the industrial
development of phage-based antimicrobial products. PLoS One
2018;13(10): e0205728.
O’Flaherty S, Ross RP, Coffey A. Bacteriophage and their lysins for elimination
of infectious bacteria. FEMS Microbiology Reviews 2009;33(4):801-
819.
Padhi MK. Importance of indigenous breeds of chicken for rural economy
and their improvements for higher production performance. Scientifica
2016;2604685.
Poxleitner M, Pope W, Jacobs-Sera D, Silvanathan V, Hatfull G. Phage
discovery guide. Ashurn: Howard Hughes Medical Institute; 2017.
Silva YJ, Costa L, Pereira C, Mateus C, Cunha A, Calado R, et al. Phage
therapy as an approach to prevent Vibrio anguillarum infections in fish
larvae production. PloS One 2014;9(12):e114197.
Souvannaty V, Loc HT, Anh LH, Ngu NT. Isolation and application of
bacteriophages to reduce Salmonella colonization on chicken intestinal
diseases (in Vietnamese). Journal of Animal Husbandry Sciences and
Technics 2019;241:86-92.
Sulakvelidze A. Using lytic bacteriophages to eliminate or significantly
reduce contamination of food by foodborne bacterial pathogens.
Journal of the Science of Food and Agriculture 2013;93(13):3137-
3146.
Thanki AM, Hooton S, Gigante AM, Atterbury RJ, Clokie MR. Potential roles
for bacteriophages in reducing Salmonella from poultry and swine.
In: Lamas A, Regal P, Franco CM, editor. Salmonella spp. London:
IntechOpen; 2021.
Toro H, Price S, McKee S, Hoerr F, Krehling J, Perdue M, et al. Use of
bacteriophages in combination with competitive exclusion to reduce
Salmonella from infected chickens. Avian Diseases 2005;49(1):118-
124.
Tuoi NTH, Giang NT, Thuy NTD, Loan HTP, Shimogiri T, Khoa DVA. Carcass
characteristics of Vietnamese indigenous Noi chicken at 91 days. Asian
Journal of Poultry Science 2021;15:53-59.
Upadhaya SD, Ahn JM, Cho JH, Kim JY, Kang DK, Kim SW, et al.
Bacteriophage cocktail supplementation improves growth performance,
gut microbiome and production traits in broiler chickens. Journal of
Animal Science and Biotechnology 2021;12(1):1-12.
Van Boeckel TP, Brower C, Gilbert M, Grenfell BT, Levin SA, Robinson TP, et
al. Global trends in antimicrobial use in food animals. Proceedings of
the National Academy of Sciences 2015;112(18):5649-5654.
Verma V, Harjai K, Chhibber S. Characterization of a T7-like lytic
bacteriophage of Klebsiella pneumoniae B5055: a potential therapeutic
agent. Current Microbiology 2009;59(3):274-281.
Wang J, Yan L, Lee J, Kim IH. Evaluation of bacteriophage supplementation
on growth performance, blood characteristics, relative organ weight,
breast muscle characteristics and excreta microbial shedding in broilers.
Asian-Australasian Journal of Animal Science 2013;26(4):573-578.
Wójcik EA, Stańczyk M, Wojtasik A, Kowalska JD, Nowakowska M, Łukasiak
M, et al. Comprehensive evaluation of the safety and efficacy of
BAFASAL® bacteriophage preparation for the reduction of Salmonella
in the food chain. Viruses 2020;12(7):742.
Wong CL, Sieo CC, Tan WS, Abdullah N, Hair-Bejo M, Abu J, et al.
Evaluation of a lytic bacteriophage, Φ st1, for biocontrol of Salmonella
enterica serovar Typhimurium in chickens. International Journal of Food
Microbiology 2013;172:92-101.
eRBCA-2021-1561
 Livestock Research for Rural
Development

The peer-reviewed international journal for research

into sustainable developing world agriculture

Published by Fundación CIPAV, Cali, Colombia

Volume 34, On-line Edition

Issue 1 (January)

Issue 2 (February)

Issue 3 (March)

Issue 4 (April)

Issue 5 (May)

Issue 6 (June)

Issue 7 (July)

ISSN 0121-3784
Back to LRRD Home page

Livestock Research for Rural Development, Volume 34, Number 7, July 2022 ISSN 0121-3784

Contents
Papers:
54. Impact of thermal, saline and hydric stress on the germination of two Acacia
species native to the Hoggar (Algerian Sahara); A Oudjiane, F Krouchi, J-P Mevy,
Z Abdellaoui, S Ali Ahmed and A Derridj (in french)

55. Importance of tolerance to climatic stress on weaning weight in Criollo cattle from
Cuba; M Suarez Tronco, M Rodríguez, Y Coss, A Mitat, F Ramos and A
Menéndez-Buxadera (in spanish)

56. Genetic parameters for age at first calving, calving interval and Cumulative
weaning weight at second calving in Simmental and Simbrah cattle in Mexico; M
Montaño-Bermúdez, DY Bejarano-Cabrera, A Ríos-Utrera, G Martínez-
Velázquez, R Calderón-Chagoya, Y Girón-Ruiz and VE Vega-Murillo (in spanish)

57. Effect of different waste substrates on the growth, development and proximate
composition of black soldier fly (Hermetia illucens) larvae; G M Holeh, M A
Opiyo, C L Brown, E Sumbule, J Gatagwu, E O Oje and F Munyi

58. Using banana leaf and pseudo-stem (Musa spp) silage substituted rice bran in the
diet of growing wild crossbred boar; Nguyen Thiet, Phan Van Binh, Nguyen Thi
Hong Nhan and Nguyen Trong Ngu

59. Effect of replacing essential amino acids and soybean seed with meat and bone
meal on feed intake, body weight change and quality of eggs in exotic chickens;
Berhane Mekete Bogale and Tesfaye Engida D

60. Response to long-term feeding of cocoa by-products based diets on the

reproductive performance of large white primiparous breeding sows; P Asiedu, K
O Amoah, S W A Rhule, G Z Bumbie and B A Hagan

61. Investigation into the performance characteristics and genomic variations

associated with the rumpless phenotype of the indigenous Cay Cum chickens
(Gallus gallus L.); Thi Thom Bui, Duc Quan Nguyen, Van Tung Nguyen, Ngoc
Lan Nguyen, Thanh Hien Nguyen and Huy Hoang Nguyen

62. Defoliation frequency and intensity effects on biomass production and the
morphology of Tithonia diversifolia (Hemsl.) A. Gray; Ariana Ziegler, Maria B
Rossner and Enrique A Yáñez

63. The effects of the methods (drying and grinding in the the liquidiser) on the crude
protein solubility of Mimosa pigra and Water spinach; Nguyen Thi Thu Hong and
Nguyen Thi Ngoc Trang

64. In vitro degradability of diets containing varying levels of Gliricidia sepium and
cassava leaf meals; O O Adelusi, O J Idowu, K O Adebayo, M T Balogun and A O
Oni
 Livestock Research for Rural LRRD LRRD Guide for preparation LRRD Citation of this
Development 34 (7) 2022 Search Misssion of papers Newsletter paper

Using banana leaf and pseudo-stem (Musa spp) silage

substituted rice bran in the diet of growing wild crossbred boar
Nguyen Thiet, Phan Van Binh, Nguyen Thi Hong Nhan1 and Nguyen Trong Ngu
College of Rural Development, Can Tho University, Can Tho City, Vietnam
nthiet@ctu.edu.vn
1 College of Agriculture, Can Tho University, Can Tho City, Vietnam

Abstract
This experiment aimed to determine the effect of additive sources on banana leaf and pseudo-stem
(BLS) silage and evaluate the effect of using BLS silage in the diet of growing wild crossbred boar.
First experiment was arranged with a completely randomized design with 04 treatments and 04
replicates. The ratio of materials was calculated as a dry matter ratio and the treatments were control
(BS): 99.5% wilting BLS + 0.5% salt; treatment 1 (BSC): 94.5% wilting BLS + 5% corn meal +
0.5% salt; treatment 2 (BSB): 94.5% wilting BLS + 5% rice bran + 0.5% salt; treatment 3 (BSM):
94.5% wilting BLS + 5% sugar cane molasses + 0.5% salt. The second experiment was arranged into
a completely randomized design, consisting of three treatments and four replicates. The treatments
were control group (BSM0): 70% rice bran + 30% water spinach (based on DM); treatment 1
(BSM10): 10% BSM silage + 60% rice bran + 30% water spinach; treatment 3 (BSM20): 20% BSM
silage + 50% rice bran + 30% water spinach. The results from the first experiment showed that BLS
mixed with 5% sugar cane molasses could improve the silage quality by decreasing pH after 7 days
of ensiling and NH 3-N content within the acceptable range for feed silage quality. In addition, wild
crossbred boar can consume BSM up to 10% without negative impacts on feed intake and weight
gain. But, 20% BSM in the diet decreased weight gain and remained unchanged in feed intake
throughout the study. It was found that 5% sugar cane molasses can effectively ensile with BSL, and
that BSM may substitute 10% rice bran in the diet of growing wild crossbred boars.

Key words: banana leaf and pseudo-stem, goat, silage, weight gain

Introduction
In Vietnam, the banana tree is regarded as one of the most important fruit trees, occupying a high
position in planted area and total annual output. The natural conditions of Vietnam are very suitable
for banana tree development. However, after harvesting fruit, the leaves and pseudo-stems have not
been used in the appropriate ways for animal feed. Banana leaves have relatively high CP with
11.18% (Van 2012), whereas pseudo-stems were low CP with 2.79% (Wang et al 2016). Additionally,
banana pseudo-stems are also limited to use in livestock diets, especially monogastric, due to high
water content and low digestibility. Therefore, it is necessary to develop appropriate methods to
preserve this feed resource to make full use of its potential. The ensiling technique is a suitable
approach for the preservation of animal feed resources, and the method is extensively used
worldwide (McDonald et al 1991). Silage quality depends on several factors, of which moisture
content and feed composition are the most important (McDonald et al 1991). To improve the silage
quality, cereal grains or sugar cane molasses can be added to provide conditions for an efficient
fermentation process and reduce effluent production (Sibanda et al 1997; Jaurena and Pichard, 2001).
Previous studies suggested that banana pseudo-stems could be improved by making silage together
with taro foliage or yeast to improve protein content, feed intake, and live weight gain in growing
pigs (Ty et al 2012; Manivanh and Preston 2015). In Vietnam, wild crossbred boars are popular
recently, particularly in small farmers and remote areas due to good quality meat and low feed cost
compared to commercial pigs. In addition, the farmers traditionally fed their wild crossbred boars
with fresh banana pseudo-stem or green vegetable (sweet potato leaf and water spinach), rice bran, or
cereal grains, and mineral. However, there is little information on the use of BLS silage in the diets of
wild crossbred boar. Thus, the present experiment aimed to determine the effect of additive sources
on BLS silage and evaluate the impacts of using BLS silage in the diet of growing wild crossbred
boar. The results from this study would contribute to the sustainable exploitation of local resources
for livestock development and environmental protection.

Materials and methods

Experiment 1: Effects of additives supplementation on the quality of banana leaf and pseudo-
stems silage

Banana leaf and pseudo-stem preparation for silage:

After harvesting fruit, leaf and stem were chopped into 2 to 4 cm length and then sundried a half day
before processing the silage (Photo 1).

Photo 1. Banana leaf and pseudo-stem preparation for silage

Experimental design and analysis
This experiment was arranged with a completely randomized design with 04 treatments and 04
replicates. The ratio of materials was calculated as a dry matter ratio and the treatments were control
(BS): 99.5% wilting BLS + 0.5% salt; treatment 1 (BSC): 94.5% wilting BLS + 5% corn meal +
0.5% salt; treatment 2 (BSB): 94.5% wilting BLS + 5% rice bran + 0.5% salt; treatment 3 (BSM):
94.5% wilting BLS + 5% molasses + 0.5% salt. The level of salt from these treatments was followed
by Hung L T et al. (2020) for Taro leaf and petiole silage. The mixtures were packed into
polyethylene bags of 10 kg capacity with air removed from the bags. During storage, the bags were
checked regularly and would be re-opened, made compact and re-tied if found to be loose.

The silage samples (500 g each bag) were collected on days 7, 14, 21, and 28 after ensiling. All
samples were divided into two parts; the first part (100 g) was immediately measured for pH by using
pH meter (pH221, Lutron, Taipei, Taiwan), ammonia nitrogen (NH3-N) was determined by Kjeldahl
method (AOAC, 1990); the second part (400 g) was dried in an oven at 65oC until the weight was
stabilized (12 hours) and then analyzed for crude protein (CP), ash, and crude fiber (CF) contents
according to AOAC (1990).

Experiment 2: Effects of BLS silage substituted rice bran in diets on dry matter intake and
weight gain of wild crossbred boar
Experiment 1 showed that BLS mixed with 5% sugar cane molasses (BSM) is a good choice for
making the silage. Therefore, the experiment used this formula (BSM) to substitute the rice bran in
the diets of wild crossbred boar. BLS from this study was ensiled with 5% sugar cane molasses
within 14 days before feeding for the wild crossbred boar

Experimental design and data collection

Twelve male wild crossbred boars with average body weight (BW) of 18.63 ± 0.69 kg were arranged
into a completely randomized design, consisting of three treatments and four replicates. The study
lasted for 70 days, with 10 days for adaptation and 60 days for data collection. The treatments were
control group (BSM0): 70% rice bran + 30% water spinach (based on DM); treatment 1 (BSM10):
10% BSM silage + 60% rice bran + 30% water spinach (based on DM); treatment 3 (BSM20): 20%
BSM silage + 50% rice bran + 30% water spinach (based on DM). The ingredients and chemical
compositions of experimental rations are presented in Table 1. The animals were fed twice daily at
08:00 and 14:00 h and had free access to water. All animals were weighed before morning feeding at
the beginning and the end of the experiment.
Table 1. The ingredients and chemical compositions of experimental rations
Items BSM0 BSM10 BSM20
Ingredients (%)
Water spinach 30 30 30
BLS silage 0 10 20
Rice bran 70 60 50
Chemical composition (%)
DM 66.36 59.76 53.16
CP 15.83 15.62 15.35
CF 10.56 11.30 12.23

Feed offered and refusals (10%) were recorded daily in the morning starting from day 1st to 60th of
the experiment. Feed and refusal samples were collected daily from day 1st to 60 th and were divided
into two parts: one half was immediately dried in the oven at 105°C until its weight remained
constant to determine dry matter, and the remaining samples were kept frozen at -20°C until chemical
analysis. At the end of the experiment, all feed samples were thawed and mixed thoroughly, and
subsamples were dried at 65°C for approximately 12 hours for CP, CF, and ash analysis according to
AOAC (1990).

Statistical analysis
The data are presented as the mean ± SEM. All data were analyzed with one-way ANOVA. The
significance of pairwise comparisons was determined by Tukey posttest. Significance was declared at
p<0.05.

Results and discussion

Effects of additives supplementation on the quality of banana leaf and pseudo-stems silage
The effects of additive sources on the pH, DM, and NH3-N contents of ensiled banana leaf and
pseudo-stem, as well as the changes over the days of ensiling, were found (Table 2, 3, and 5; p<0.05).
However, additive sources did not affect the CP content of ensiled BLS. (Table 4;p>0.05).

Generally, the pH from BSC and BSM groups ranged from 4.45 to 4.84 and was lower than those
from BS (pH from 5.47 on day 7 decreased to 5.28 on day 28) and BSB (pH from 6.5 on day 7
decreased to 5.5 at day 28) groups throughout the days of ensiling. Additionally, pH from BSM
decreased rapidly and lowered to 4.5 during the first week and then remained unchanged until 4
weeks. In contrast, pH from BS or BSM groups slowly decreased during the days of ensiling, and pH
was higher than 5. Higher pH from BS and BSB groups may be due to either greater NH3-N level
(Table 5; p<0.05) or low water-soluble carbohydrates to provide the conditions for the fermentation
process. In comparison, sugar cane molasses and corn meal are readily available feedstuffs in
Vietnam and are high in readily available carbohydrates in the form of sugar or starch, which can
promote the growth of lactic acid bacteria (McDonal et al 1991), resulting in a rapid pH decrease at
day 7 in the BSC and BSM groups. Wang et al (2016) reported that pH on day 20 and 30 from
banana pseudo-stem silage was 5.09 and 4.43, respectively and differed from the present experiment.
Liu et al. (2013) suggested that BLS can be directly ensiled for 60 days. However, pH value indicated
that wilting BLS or addition with 5% rice bran moderately preserved as silage within 4 weeks.

The results from the present study show that wilting BLS before ensiling can be achieved an
adequate DM level (more than 20%) for the fermentable process (McDonal et al 1991). DM content
from additive groups was higher than in control groups (Table 3, p<0.05). The increase in DM
content from BSC, BSB, and BSM groups can be explained by the added DM from corn meal, rice
bran, and sugar cane molasses. An and Lindberg (2004) reported that sweet potato leaves added with
cassava root meal and sugar cane molasses also increased the DM level and similar findings from this
study. In this study, DM content decreased all treatments after ensiling (day 7 to day 28).
Accordingly, McDonal et al (1991) suggested that DM losses during fermentation should not exceed
40 g/kg DM (4%). However, DM losses between days 7 and 28 from this study arranged from
11.99% (BS group) to 22.85% (BSC group) and were much higher than the recommendation from
McDonal et al (1991). DM losses from this study were also greater than the result reported by Wang
et al (2016) in banana pseudo-stem silage. The result from DM content suggested that BS, BSB, and
BSM were the same DM losses, while BSC was high two times compared to other treatments (Table
3, p=0.054).

Table 2. Effects of additive sources on pH in ensiled banana leaf and pseudo-stem

Days of Treatment
SEM p
ensiling BS BSC BSB BSM
7 5.47b 5.34b 6.50a 4.47c 0.18 0.001
14 5.09 b 4.45c 6.22a 4.54 bc 0.15 0.001
21 5.12 4.82 5.05 4.84 0.22 0.705
28 5.28ab 4.74bc 5.77a 4.45c 0.14 0.001
a,b,c: Mean values with different superscripts within the same row are different at P<0.05 BS: 99.5%
wilting BLS + 0.5% salt; BSC: 94.5% wilting BLS + 5% corn meal + 0.5% salt; BSB: 94.5% wilting
BLS + 5% rice bran + 0.5% salt; BSM: 94.5% wilting BLS + 5% molasses + 0.5% salt.
 Table 3. Effects of additive sources on dry matter (%) in ensiled banana leaf and pseudo-stem
Days of Treatment
SEM p
ensiling BS BSC BSB BSM
7 22.17b 25.22a 25.99a 24.79ab 0.66 0.01
14 20.47 b 24.43 a 23.21ab 23.22 ab 0.68 0.01
21 19.17 b 21.30 ab 22.64 a 21.48 a 0.53 0.01
28 19.48 b 19.63 ab 21.63 a 21.68 a 0.55 0.02
DM losses, % (day 7 and 28) 11.99 22.85 16.77 12.42 2.74 0.054
a,b: Mean values with different superscripts within the same row are different at P<0.05 BS: 99.5%
wilting BLS + 0.5% salt; BSC: 94.5% wilting BLS + 5% corn meal + 0.5% salt; BSB: 94.5% wilting
BLS + 5% rice bran + 0.5% salt; BSM: 94.5% wilting BLS + 5% molasses + 0.5% salt.

There were no effects of additive sources in ensiled BLS on CP content, even though corn meal, rice
bran, and molasses were added to BSC, BSB, and BSM groups (Table 4, p>0.05). The CP content
from additives did not differ in CP level from the BSL mixture in this study. The CP content of silage
decreased as the time of ensiling. During the ensiling, the decline in CP content may be due to the
nitrogen loss from protein decomposition by bacteria in the silage (An and Lindberg 2004).
Therefore, NH3-N level from this study increased by the time of ensiling, particularly in BSB and BS
group (Table 5); as a result the pH from BSB and BS also slowly decreased over time (Table 2).
Moreover, NH3-N level from BSB was significantly higher than those of other treatments in this
study and increased from 19.05 to 29.55 g/100g of the total N (Table 5, p=0.001). In addition, after
28 days of ensiling NH3 -N level did not differ in BS, BSC and BSM groups. Similar finding was
reported by Lima et al (2010) that addition of molasses to forage resulted in silage with lower pH and
ammonia content. Álvarez et al (2015) found that combination of molasses and beet pulp to banana
by-products (green banana and bunch) was also lower ammonia compared to without the additives.
Silage is considered excellent when the NH3-N/N content is below 7 g/100 g of the total N and
considered good when the NH3–N/N content is between 7 g and 10 g/100 g of the total N (Lima et al
2010). Therefore, NH3 -N content from BSM group arranged in acceptable level for feed silage
quality (McDonal et al 1991; Lima et al 2010).
Table 4. Effects of additive sources on CP (%) in ensiled banana leaf and pseudo-stem
Days of Treatment
SEM p
ensiling BS BSC BSB BSM
7 7.46 7.71 8.48 7.66 0.33 0.19
14 7.56 7.73 8.18 7.33 0.44 0.58
21 7.27 7.44 7.85 7.19 0.33 0.50
28 7.03 7.30 7.69 7.12 0.25 0.30
BS: 99.5% wilting BLS + 0.5% salt; BSC: 94.5% wilting BLS + 5% corn meal + 0.5% salt; BSB:
94.5% wilting BLS + 5% rice bran + 0.5% salt; BSM: 94.5% wilting BLS + 5% molasses + 0.5% salt

Table 5. Effects of additive sources on NH3-N (%TN) in ensiled banana leaf and pseudo-stem
Days of Treatment
SEM p
ensiling BS BSC BSB BSM
7 9.11c 9.47c 19.05a 16.43b 0.45 0.001
14 14.52 a 11.69 b 16.14a 10.37b 0.42 0.001
21 17.62 b 10.15 d 20.61a 13.65 c 0.67 0.001
28 12.83 b 11.78 b 29.55a 10.95b 0.51 0.001
a,b,c,d: Mean values with different superscripts within the same row are different at P<0.05 BS: 99.5% wilting
BLS + 0.5% salt; BSC: 94.5% wilting BLS + 5% corn meal + 0.5% salt; BSB: 94.5% wilting BLS + 5% rice
bran + 0.5% salt; BSM: 94.5% wilting BLS + 5% molasses + 0.5% salt.

Effects of BLS silage replaced rice bran in diets on dry matter intake and weight gain of wild
crossbred boar
There was no difference in the daily intakes of DM and CP, body weight among treatments (Table 6,
p>0.05), although the crude fiber content increased as the inclusion of BSM increased in the diet
(Table 2). Some studies found that increasing the fiber content in diet decreased the feed intake and
nutrient digestibility (Ngoc et al 2013 and Lindberg 2014). A similar finding was reported by Sivilai
et al (2016) when Moo Lath pigs fed ensiled banana pseudo-stem and ensiled taro foliage with daily
DMI from 23.3 to 26.3 g/kg BW/day. But, Arjin et al (2021) reported that local Thai pigs consumed
fresh or fermented banana pseudo-stem was about 40 g DMI/head/day and higher than the DMI from
the present study. The difference in DMI between this study and previous studies may be due to
differences in breeds, ingredients, and fiber levels in the diet. The higher fiber in the diet may
decrease palatability, thereby reducing daily weight gain and FCR, as reported by Avelar et al (2010)
and Ngoc et al (2013). But the results from current study show that the increasing level of BSM in
diet did not affect body weight and FCR (Table 6, p <0.05), but daily weight gain decreased as the
inclusion of BSM increased. Reduced daily weight gain with BSM20 may be owing to increased
fiber levels in the diet as a result of BSM inclusion (Table 2), which decreased nutrient digestibility.
(Ngoc et al 2013 and Lindberg 2014). The inclusion level of BSM was negatively correlated with
daily weight gain (p=0.03, R2=0.927, Table 6 and Figure 1).
Table 6. Effects of BLS silage replaced rice bran in diets on dry matter intake and weight gain of wild crossbred boar
Treatment
Items SEM p
BSM0 BSM10 BSM20
DMI (kg/head/day) 0.735 0.647 0.695 0.04 0.32
DMI (g/kg BW/day) 26.86 25.12 26.64 1.03 0.46
CPI (g/head/day) 118.58 103.22 108.91 6.2 0.26
CPI (g/kg BW/day) 4.33 4.00 4.19 0.16 0.40
Initial body weight (kg) 19.40 18.17 19.33 0.91 0.58
Final body weight (kg) 27.33 25.83 26.00 0.81 0.40
Daily weight gain (g/head/day) 132.22 a 127.78 ab 111.11 b 4.71 0.03
FCR 5.70 5.08 6.22 0.41 0.20

Figure 1. The relationship between total weight gain (kg/head) and the level of BSM in diet

Conclusions
Banana leaf and pseudo-stem mixture ensiled with 5% sugar cane molasses which decreased
pH to 4.5 within 7 days, and NH3-N content arranged acceptable level for feed silage quality.
BSM can be substituted for rice bran up to 10% in the diet of wild crossbred boar without
affecting daily intakes of DM, CP, and weight gain.
There is a limitation in this experiment that we did not measure the tannin and NaCl levels in
the silage mixture. Therefore, it is nessessary to analyze these parameters for further
experiment and need to pay attention in the salt level in the diets to provide for local pig.
Acknowledgments
The author would like to thank the manager of the Experimental farm at College of Rural
Development, Can Tho university for supplying all the experiment materials and sincere gratitude
thanks to Mr. Khang and Ms. Tram for taking care of the experiment.

References
Alvarez S, Mendez P and Martinez-Fernandez A 2015 Fermentative and nutritive quality of banana by-product silage
for goats. Journal of Applied Animal Research, 43: 396-401.

An L V and Lindberg J E 2004 Ensiling of Sweet Potato Leaves (Ipomoea batatas L. Lam) and the nutritive value of
sweet potato leaf silage for growing pigs. Asian-Australia Journal Animal Science, 17(4): 497-503.
https://doi.org/10.5713/ajas.2004.497.

AOAC 1990 Association of Official Analytical Chemistry. Official Method of Analysis, 15th Edn. Washington, DC USA.

Arjin C, Souphannavong C, Sartsook A, Seel-audom M, Mekchay S and Sringarm K 2020 Efficiency of fresh and
fermented banana stem in low protein diet on nutrient digestibility, productive performance and intestinal morphology of
crossbred pig ((Thai native x Meishan) x Duroc). Veterinary Integrative Sciences, 19(1): 51–64.
https://doi.org/10.12982/VIS.2021.005.

Avelar E, Jha R, Beltranena E, Cervantes M, Morales A, Zijlstra R T 2010 The effect of feeding wheat distillers
dried grain with solubles on growth performance and nutrient digestibility in weaned pigs. Animal Feed Science and
Technology, 160: 73-77. https://doi.org/10.1016/j.anifeedsci.2010.06.009.

Hung L T, Lan L T T, Thu N T A, Thiet N, Mo T T H, Nhan N T H and Ngu N T 2020 Effects of wilting and rice
bran supplementation on the quality of taro (Colocasia esculenta) leaf and petiole silage. Livestock Research for Rural
Development. Volume 32, Article #82. Retrieved June 19, 2022, from http://www.lrrd.org/lrrd32/5/ntngu32082.html

Jaurena G, Pichard G 2001 Contribution of storage and structure polysaccharides to the fermentation process and
nutritive value of lucerne ensiled alone or mixed with cereal grains. Animal Feed Science and Technology, 92:159-173.
https://doi.org/10.1016/S0377-8401(01)00257-7.

Lima R, Lourenço M, Díaz R F, Castro A and Fievez V 2010 Effect of combined ensiling of sorghum and soybean
with or without molasses and lactobacilli on silage quality and in vitro rumen fermentation. Animal Feed Science and
Technology, 155:122–131. https://doi.org/10.1016/j.anifeedsci.2009.10.008.

Lindberg J E 2014 Fiber effects in nutrition and gut health in pigs. Journal of Animal Science and Biotechnology, 5:15.
https://doi: 10.1186/2049-1891-5-15.

Liu J Y, Gao Y E, Huang B Z, Wang A K, Zhang J C and Yuan X P 2013 Research on the nutritional evaluation
storage process of banana stalk-leaves. China symposium on ruminant nutrition and feed resources. Beijing, China.

Manivanh N, Preston T R 2015 Protein-enriched cassava root meal improves the growth performance of Moo Lat pigs
fed ensiled taro (Colocacia esculenta) foliage and banana stem. Livestock Research for Rural Development. Volume 27,
Article #44. Retrieved December 28, 2016, from http://www.lrrd. org/ lrrd27/3/noup27044.html

McDonald P, Henderson N and Heron S 1991 The Biochemistry of Silage. Second edition, p. 340.

Ngoc T T B, Len N T, Lindberg J E 2013 Impact of fiber intake and fiber source on digestibility, gut development,
retention time and growth performance of indigenous and exotic pigs. An international journal of animal bioscience, 7:
736-745. https://doi.org/10.1017/S1751731112002169.

Sibanda S, Jingura R M and Topps J H 1997 The effect of level of inclusion of the legume Desmodium uncinatum and
the use of molasses or ground maize as additives on the chemical composition of grass- and maize-legume silages.
Animal Feed Science and Technology, 68: 295-305. https://doi.org/10.1016/S0377-8401(97)00049-7.

Sivilai B, Preston T R and Kaensombath L 2016 Feed intake, nutrient digestibility and nitrogen retention by Moo Lath
pigs fed ensiled banana pseudo-stem (Musa spp.) and ensiled taro foliage (Colocasia esculenta). Livestock Research for
Rural Development, 28:6

Ty C, Samkol P, Kimseang A Suheang S and Preston T R 2012 Replacing rice bran by mixture taro (Colocasia
esculenta) foliage and banana stem on intake and nutrient digestibility of crossbred pigs. Proceedings of the International
Conference "LivestockBased Farming Systems, Renewable Resources and the Environment", 6-9 June 2012, Dalat,
Vietnam (Editors: Reg Preston and Sisomphone Southavong) http:/www.mekarn.org/
workshops/dalat2012/html/samkol.htm

Van N H 2012 study on the determination of feed intake, digestibility, nitrogen balance and the improvement of
utilization value of banana leaves as feeds for goat. Hue university journal of science, 6: 221 – 228.

Van Soest P J, Robertson J B and Lewis B A 1991 Methods for dietary fiber neutral detergent fiber and non-starch
polysaccharides in relation to animal nutrition. Journal of Dairy Science, 74: 3583–3597. https://doi: 10.3168/jds.S0022-
0302(91)78551-2.

Wang C F, Muhammad A, Liu Z Y, Huang B Z and Cao B 2016 Effects of ensiling time on banana pseudo-stem silage
chemical composition, fermentation and in sacco rumen degradation. Journal of Animal and Plant Sciences, 26: 339-346.

Received 7 April 2022; Accepted 24 May 2022; Published 1 July 2022

KHKT Chăn nuôi Số 275 - tháng 3 năm 2022

Tổng biên tập: DI TRUYỀN - GIỐNG VẬT NUÔI

TS. ĐOÀN XUÂN TRÚC Lê Tấn Lợi, Phạm Thị Như Tuyết, Nguyễn Thị Khánh Ly, Hoàng Tuấn Thành và
Nguyễn Ngọc Tấn. Đa hình gen Prolactin trên vùng Exon 5 ở vịt lai Star53 bằng kỹ
thuật PCR-RFLP 2
Phó Tổng biên tập:
Hoàng Tuấn Thành, Nguyễn Thị Hồng Trinh, Nguyễn Thị Lan Anh, Nguyễn Thị
PGS.TS. NGUYỄN ĐĂNG VANG Thủy Tiên, Phạm Công Hải, Nguyễn Đức Thỏa và Phạm Công Thiếu. Đặc điểm
PGS.TS. NGUYỄN VĂN ĐỨC ngoại hình và khả năng sản xuất của gà Mã Đà nuôi bảo tồn tại Đồng Nai 7
Lê Thanh Hải, Nguyễn Thị Hồng Trinh và Phạm Thị Như Tuyết. Năng suất và chất
Thư ký tòa soạn: lượng trứng của vịt thương phẩm chuyên trứng VST12 nuôi tại trại vịt giống Vigova 13
PGS.TS. NGUYỄN VĂN ĐỨC Dương Thanh Hải, Phan Thị Hằng, Trần Ngọc Long, Nguyễn Đức Thạo, Nguyễn
Hải Quân, Đinh Văn Hà, Đinh Văn Trung, Nguyễn Thị Thuý, Đinh Thị Hường và
Ủy viên Ban biên tập:
Phùng Tô Long. Năng suất sinh sản của gà Chọi lai và Ri lai nuôi tại huyện Sơn Hà,
tỉnh Quảng Ngãi 20
TS. NGUYỄN QUỐC ĐẠT Nguyễn Thị Xuân Hồng, Nguyễn Văn Lưu, Nguyễn Thị Hạnh, Trần Thị Tâm và Tạ
PGS.TS. HOÀNG KIM GIAO Thị Hương Giang. Khả năng sinh trưởng và hiệu quả sử dụng thức ăn của ngan lai
GS.TS. NGUYỄN DUY HOAN thương phẩm RT12 nuôi tại Bắc Giang 24
GS.TS. DƯƠNG NGUYÊN KHANG Phạm Văn Quyến, Nguyễn Văn Tiến, Giang Vi Sal, Bùi Ngọc Hùng, Hoàng Thị
PGS.TS. NGUYỄN THỊ KIM KHANG Ngân, Nguyễn Thị Thủy, Đoàn Đức Vũ, Huỳnh Văn Thảo, Nguyễn Thị Ngọc Hiếu,
PGS.TS. ĐỖ VÕ ANH KHOA Thạch Thị Hòn, Nguyễn Thanh Hoàng và Hoàng Thanh Dũng. Năng suất sinh sản
PGS.TS. ĐỖ ĐỨC LỰC các nhóm bò lai F1 hướng thịt tại tỉnh Trà Vinh 28
GS.TS. LÊ ĐÌNH PHÙNG
DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI
Nguyễn Quốc Trung, Phùng Thị Duyên, Lê Khánh Pháp, Phan Thị Hiền, Bùi
Xuất bản và Phát hành: Quang Tuấn, Nguyễn Xuân Cảnh, Trịnh Thị Thu Thủy và Phạm Kim Đăng. Phương
ThS. NGUYỄN ĐÌNH MẠNH pháp phá vách tế bào nấm men và tách chiết Beta-glucan (β-glucan) từ bã men bia
sử dụng protease bền nhiệt và chịu kiềm 38

U
Nguyễn Thi Hương, Nguyễn Thị Thanh Vân, Phạm Văn Sơn và Đặng Vũ Hòa. Ảnh
hưởng của bổ sung enzyme, probiotic, thảo dược vào khẩu phần đến sinh trưởng và
hiệu quả kinh tế chăn nuôi lợn theo hướng hữu cơ 44

CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC

Nguyễn Thùy Linh, Nguyễn Văn Vui, Hồ Quốc Đạt, Kim Nàng, Nhan Hoài Phong,
Nguyễn Hoàng Quí, Nguyễn Thị Anh Thư, Thái Thị Thanh Trọn, Phạm Ngọc Anh,
Giấy phép: Bộ Thông tin và Truyền thông Đỗ Đức Lực và Thiệu Ngọc Lan Phương. Đánh giá chăn nuôi gà nòi Bến Tre để làm
Số 257/GP- BTTTT ngày 20/05/2016 tiền đề cho chọn giống và xây dựng mô hình nuôi gà thả vườn có kiểm soát 49
ISSN 1859 - 476X Phạm Văn Quyến, Nguyễn Văn Tiến, Giang Vi Sal, Bùi Ngọc Hùng, Hoàng Thị
Ngân, Nguyễn Thị Thủy, Lê Việt Bảo, Lê Minh Trí và Bùi Thanh Điền. Sử dụng liệu
Xuất bản: Hàng tháng pháp kết hợp hormone để xử lý tình trạng chậm động dục ở bò cái sinh sản và bò cái
Toà soạn: tơ hướng thịt tại Tp. Hồ Chí Minh và Đông Nam Bộ 54
Nguyễn Vĩ Nhân. Hoạt tính kháng khuẩn của cao chiết từ lá mật gấu trên vi khuẩn
Địa chỉ: Tầng 4, Tòa nhà 73, P. aeruginosa và S. aureus 61
Hoàng Cầu, Ô Chợ Dừa, Hồ Quảng Đồ, Võ Châu Kỳ, Ngô Thị Minh Sương và Lê Công Triều. Đặc điểm hình
Đống Đa, Hà Nội. thái, thành phần dưỡng chất và tỷ lệ tiêu hóa của cây đậu biển Vigna marina 67
Điện thoại: 024.36290621 Ngô Đình Tân . Ảnh hưởng của quá trình làm lạnh đến đặc điểm ngon miệng và độ
an toàn của thịt bò 71
Fax: 024.38691511 Nguyễn Thị Diệu Hiền, Nguyễn Trọng Ngữ, Trương Văn Khang và Nguyễn Thiết.
E - mail: tapchichannuoi@hoichannuoi.vn Ảnh hưởng của độ mặn trong nước uống lên năng suất sữa và sự bài thải chất điện
Website: www.hoichannuoi.vn giải của dê sữa 85
Tài khoản: THÔNG TIN KHOA HỌC VÀ CÔNG NGHỆ
Tên tài khoản: Hội Chăn nuôi Việt Nam PGS.TS. Nguyễn Văn Đức. Người đầu tiên ở Mỹ sống được nhờ trái tim của chú lợn
Số tài khoản: 1300 311 0000 40, tại Ngân hàng biến đổi gen 91
Nông nghiệp và Phát triển Nông thôn, Chi nhánh TS. Nguyễn Khánh Vân, PGS.TS. Nguyễn Văn Đức. Thông tin về bốn chú lợn Ỉ đực
nhân bản đầu tiên tại Việt Nam có đặc điểm ngoại hình, khả năng sinh trưởng và
Thăng Long - Số 4, Phạm Ngọc Thạch, Hà Nội.
sinh lý phát dục bình thường như giống lợn Ỉ sinh sản hữu tính 92
In 1.000 bản, khổ 19x27 tại Công ty CP KH&CN PGS.TS. Nguyễn Văn Đức. Lợn là động vật thích hợp nhất được khoa học công nghệ
Hoàng Quốc Việt. In xong và nộp lưu chiểu: sử dụng phục vụ cho con người 94
tháng 3/2022. PGS.TS. Nguyễn Văn Đức. Chùm tin về những cảnh báo của FAO trong lĩnh vực
chăn nuôi 96
CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC

Dry versus wet aging of beef: Retail cutting yields and
consumer palatability evaluations of steaks from US
choice and US select short loins. Meat Sci., 79: 631-39.
30. Therkildsen M., Kristensen L., Kyed S. and Oksbjerg
N. (2012). Improving meat quality of organic pork
through post mortem handling of carcasses: An
innovative approach. Meat Sci., 91(2): 108-15.
31. Vieira C. and Fernandez A.M. (2014). Effect of ageing
time on suckling lamb meat quality resulting from
different carcass chilling regimes. Meat Sci., 96(2): 682-
87.
32. Warner R.D., Dunshea F.R., Gutzke D., Lau J. and
Kearney G. (2014). Factors influencing the incidence of
high rigor temperature in beef carcasses in Australia.
Anim. Pro. Sci., 54(4): 363-74.
33. Warner R.D., Jacob R.H., Rosenvold K., Rochfort S.,
Trenerry C., Plozza T. and McDonagh M.B. (2015).
Altered post-mortem metabolism identified in very
fast chilled lamb M. longissimus thoracis et lumborum
using metabolomic analysis. Meat Sci., 108: 155-64.
34. Wiklund E., Kemp R.M., leRoux G.J., Li Y. and Wu
G. (2010). Spray chilling of deer carcasses—Effects
on carcass weight, meat moisture content, purge and
microbiological quality. Meat Sci., 86(4): 926-30.
35. Williscroft C. (2007). A lasting legacy-A 125 year
history of New Zealand farming since the first frozen
meat shipment. Auckland, New Zealand: NZ Rural
Press.
36. Xiong Y. (2017). The storage and preservation of meat:
I-Thermal Technologies. In F. Toldra (Ed.), Lawrie’s
Meat Sci. 8th ed, Pp. 205-30. Sawston, UK: Woodhead
publishing.
37. Yu L.H., Lim D.G., Jeong S.G., In T.S., Kim J.H.,
Ahn C.N. and Park B.Y. (2008). Effects of temperature
conditioning on postmortem changes in physico-
chemical properties in Korean native cattle (Hanwoo).
Meat Sci., 79(1): 64-70.
38. Zhang Y.M., Zhang X.Z., Wang T.T., Hopkins D.L.
and Zhu L.X. (2018). Implications of step-chilling on
meat color investigated using proteome analysis of
the sarcoplasmic protein fraction of beef longissimus
lumborum muscle. J. Integrative Agr., 17(9): 2118-25.

ẢNH HƯỞNG CỦA ĐỘ MẶN TRONG NƯỚC UỐNG LÊN NĂNG

SUẤT SỮA VÀ SỰ BÀI THẢI CHẤT ĐIỆN GIẢI CỦA DÊ SỮA
Nguyễn Thị Diệu Hiền1, Nguyễn Trọng Ngữ1, Trương Văn Khang1 và Nguyễn Thiết1*
Ngày nhận bài báo: 01/11/2021 - Ngày nhận bài phản biện: 01/12/2021
Ngày bài báo được chấp nhận đăng: 06/12/2021
TÓM TẮT
Thí nghiệm (TN) được thực hiện nhằm đánh giá ảnh hưởng của các mức độ mặn trong nước
uống lên năng suất sữa và sự bài thải chất điện giải của dê sữa. Thí nghiệm được bố trí hoàn toàn
ngẫu nhiên với hai nghiệm thức (NT) và 05 lần lập lại, trên 10 dê sữa Saanen lai. Hai NT là NT đối
chứng (ĐC) và NT nước mặn (SW1.5) tương ứng với nồng độ nước biển pha loãng là 1,5%. Kết quả
TN cho thấy nước mặn trong nước uống không ảnh hưởng đến lượng thức ăn, năng suất sữa của
dê. Tuy nhiên, lượng nước uống giảm xuống khi dê sử dụng nước mặn (P<0,05). Nồng độ các chất
điện giải huyết tương không khác biệt giữa hai nhóm, nhưng dê uống nước mặn có nồng độ chất
điện giải trong nước tiểu cao hơn và thể tích nước tiểu thấp hơn, do đó phân số bài tiết và lượng
bài tiết chất điện giải tương tự giữa hai nhóm. Kết quả chỉ ra rằng dê sữa đáp ứng với nước uống
có độ mặn cao bằng cách giảm sự tiêu thụ nước và thể tích nước tiểu.
Từ khóa: Chất điện giải, dê sữa, độ mặn, nước uống, thức ăn.
ABSTRACT
The effects of salinity in drinking water on milk yield and electrolyte excretion
in crossbred dairy goats
This study was aimed to evaluate the effects of salinity in drinking water on dry matter intake,
water consumption, milk yield and electrolyte excretion in crossbred dairy goats. The experiment
was arranged in a completely randomized design with two treatments and 5 replicates, for a total of
10 Saanen crossbred dairy goats. Two treatments were control group (ĐC) and saline water group

1
Trường Đại học Cần Thơ
* Tác giả liên hệ: TS. Nguyễn Thiết, Khoa Phát triển Nông thôn, Trường Đại học Cần Thơ. Điện thoại: 0932147900; Email:
nthiet@ctu.edu.vn

KHKT Chăn nuôi số 275 - tháng 3 năm 2022 85

 CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC

(SW1.5) in corresponse to diluted seawater concentration of 1.5%. The results from present study
show that salinity levels in drinking water did not affect dry matter intake, milk yield. However,
water intake decreased in SW1.5 group (P<0.05). Plasma electrolyte levels did not differ between
groups, but urinary electrolyte concentrations from SW1.5 group were greater and urinary volume
was smaller than control group (P<0.05). Thus, FE and urinary excretion were similar to two groups.
The results in this study indicated that dairy goats responsed to high salinity in drinking water by
decreasing water intake and urinary volume.
Keywords: Dairy goat, dry matter intake, electrolyte, saline water, water intake.

1. ĐẶT VẤN ĐỀ dê. Tuy nhiên, cho đến nay tại Việt Nam nói
chung và khu vực ĐBSCL nói riêng chưa có
Tình trạng xâm nhập mặn ở nước ta hiện
các nghiên cứu cơ bản, có hệ thống nào để
nay đang có xu hướng tăng lên và hậu quả
đánh giá khả năng chịu mặn của dê sữa trong
mà nó gây ra cũng ngày một nghiêm trọng
điều kiện khí hậu nhiệt đới. Vì vậy, nghiên
hơn. Hiện tượng xâm nhập mặn không chỉ
cứu này nhằm đánh giá ảnh hưởng của độ
khiến tài nguyên nước ngọt khan hiếm, mà
mặn cao trong nước uống đến năng suất sữa
nước sinh hoạt cũng bị giảm chất lượng do
và sự bài thải chất điện giải của dê sữa được
nhiễm mặn, nhiễm phèn cao dẫn đến không
thực hiện là cần thiết.
sử dụng được, đời sống của người dân ngày
càng khó khăn. Bên cạnh đó, khi vật nuôi sử 2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU
dụng nguồn nước ô nhiễm, không đạt yêu
2.1. Đối tượng, vật liệu, thời gian và địa điểm
cầu làm phát sinh bệnh tật, giảm năng suất và
chất lượng, ảnh hưởng trực tiếp đến kinh tế Thí nghiệm (TN) được thực hiện trên dê
của người dân trong khu vực. Vì vậy, cần phải cái Saanen lai, khoảng 120 ngày sau khi đẻ và
có một số giải pháp trong chăn nuôi để thích khối lượng trung bình là 34,6±1,25kg, từ tháng
ứng với biến đổi khí hậu ở vùng đồng bằng 5/2021 đến tháng 8/2021, tại Trại dê Hải Triều,
sông Cửu Long (ĐBSCL). Để phát triển ngành xã Trường Long Tây, huyện Châu Thành A,
chăn nuôi vùng ĐBSCL theo hướng bền vững, tỉnh Hậu Giang và Trung tâm xét nghiệm y
cần tổ chức lại cơ cấu giống vật nuôi, lựa chọn khoa Center Lab Việt Nam (Số 50-52, Trần
các giống vật nuôi có sức chống chịu cao, Bạch Đằng, P. An Khánh, Q. Ninh Kiều, thành
trong đó, dê mà đặc biệt là dê sữa là một trong phố Cần Thơ).
những loài gia súc đáng chú ý và phát triển 2.2. Phương pháp
mạnh mẽ ở những năm gần đây do dễ thích Tất cả dê TN được cho ăn khẩu phần
nghi với địa lý, khí hậu khác nhau trong nước. giống nhau, theo quy trình của trang trại. Buổi
Thêm vào đó khả năng chống chịu với điều sáng cho ăn 0,5kg thức ăn hỗn hợp (TAHH) và
kiện nắng nóng của dê tốt hơn so với trâu, bò 0,5kg TMR; buổi chiều dê được cho ăn cỏ tự
(Silanikove, 2000). Các nghiên cứu trước đây nhiên. Thành phần hóa học (TPHH) của thức
đã chỉ ra rằng dê có khả năng sử dụng nước ăn được thể hiện tại bảng 1.
uống có độ mặn khác nhau, cũng như sự đáp
Bảng 1. Thành phần hóa học của thức ăn
ứng với khả năng chịu mặn khác nhau giữa
dê thịt và dê sữa (Mdletshe và ctv, 2017). Dê TPHH TAHH TMR Cỏ tự nhiên
Boer không uống nước mặn 1,25-1,5% NaCl DM 87,13 54,30 20,52
và có độ nhạy cao hơn đối với việc uống nước CP 18,85 13,87 7,61
muối trong thời gian dài (Runa và ctv, 2016). ADF 20,02 30,54 44,32
Có thể nhận thấy rằng dê có thể chấp nhận NDF 38,91 47,67 62,50
nước uống có nồng độ muối 1,5%, tuy nhiên Ash 7,97 10,57 9,67
nếu sử dụng trong thời gian dài sẽ ảnh hưởng Ghi chú: DM = Vật chất khô; CP = Protein thô; ADF =
đến năng suất và những thay đổi sinh lý của Xơ axít; NDF = Xơ trung tính; Ash = Khoáng tổng số

86 KHKT Chăn nuôi số 275 - tháng 3 năm 2022

CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC
Nước uống dùng cho dê TN là nước ngọt
và nước mặn có nồng độ 15‰ được pha từ
nước biển cô đặc với nước ngọt theo công
thức sau: C1xV1=C2xV2 và được đo kiểm tra
bằng thiết bị khúc xạ kế đo độ mặn ATAGO
Master-S/MillM Salinity 0~100‰ với độ chính
xác ±2‰. Nước ngọt cho dê uống trong TN
được lấy từ nguồn nước sinh hoạt là nguồn
nước sạch không màu, không mùi hôi thối và
không gây ảnh hưởng đến sức khỏe của dàn
dê. Kết quả phân tích mẫu nước tương tự như
báo cáo của Nguyễn Thiết và ctv (2021).
Thí nghiệm được bố trí hoàn toàn ngẫu
nhiên gồm hai NT là ĐC (nước ngọt) và nước
có nồng độ muối cao (1,5%: SW1.5) được thực
hiện với 5 lần lập lại. Thí nghiệm gồm 7 ngày
nuôi thích nghi (trước thí nghiệm) và 14 ngày
thu thập số liệu, sử dụng nước biển pha với
nước ngọt để đạt được nồng độ muối 1,5%.
Tất cả dê TN được ăn khẩu phần giống nhau,
được cho ăn 2 lần/ngày vào lúc 7.0am và
16.0pm và được uống nước tự do.
Tất cả số liệu thức ăn, nước uống và thức
ăn thừa sẽ được ghi nhận hàng ngày, mẫu cỏ
và TAHH thừa sẽ được lấy một lần/tuần trong
suốt quá trình TN. Vào cuối TN, các mẫu thức
ăn và thức ăn thừa sẽ được trộn lại và đem
đi phân tích các chỉ tiêu DM, Ash và CP theo
phương pháp của AOAC (1990) và NDF, ADF
theo phương pháp của Van Soet và ctv (1991).
Dê được vắt sữa vào 13:00pm hàng ngày. Khối
lượng dê được cân ở thời điểm bắt đầu và kết
thúc TN, vào buổi sáng trước khi cho ăn.
Mẫu máu (2ml) của mỗi dê được lấy 2
giờ sau khi cho ăn ở ngày thứ 21 của TN, tất
cả các mẫu máu được giữ trong đá và đem đi
phân tích. Mẫu máu sẽ được lấy ở tĩnh mạch
cổ, sau đó được cho vào ống Heparin lithium,
trữ trong thùng có chứa đá lạnh và đem đến
trung tâm xét nghiệm để phân tích hàm lượng
Na+, K+, Cl-.
Nước tiểu được thu thập ở ngày thứ 17 và
trong 24 giờ. Tất cả mẫu nước tiểu sẽ được trữ
trong bình đựng sạch và khô. Sau đó trữ trong
thùng có chứa đá giữ lạnh và đem đến trung
tâm xét nghiệm phân tích để phân tích niệu đồ.
KHKT Chăn nuôi số 275 - tháng 3 năm 2022
2.3. Xử lý số liệu
Số liệu thí nghiệm được xử lý sơ bộ bằng
phần mềm Microsoft Excel. So sánh giữa hai
nghiệm thức bằng phương pháp Unpaired
T-test. Sự khác biệt có nghĩa khi P<0,05.
3. KẾT QUẢ VÀ THẢO LUẬN
3.1. Ảnh hưởng của nồng độ nước muối cao
lên lượng thức ăn của dê
Kết quả bảng 2 cho thấy lượng thức ăn ăn
vào của dê ở trước (từ ngày 1 đến ngày 7) và
sau thí nghiệm (từ ngày 8 đến ngày 21) không
có sự khác biệt có ý nghĩa thống kê giữa hai
NT (P>0,05). Điều này cho thấy lượng thức ăn
của dê không bị ảnh hưởng bởi nồng độ nước
muối cao. Điều này phù hợp với kết luận của
Masters và ctv (2007) chỉ ra rằng lượng ăn vào
của động vật nhai lại không bị ảnh hưởng bởi độ
mặn trong nước uống. Mặt khác, vẫn có nhiều
nhận định cho rằng lượng ăn vào của dê bị ảnh
hưởng bởi nồng độ muối cao. Theo Zoidis và
Hadjigeorgiou (2017), lượng thức ăn trung bình
hàng ngày của dê giảm mạnh (P<0,05) trong giai
đoạn sử dụng nước muối có nồng độ 1,0-2%, dê
tăng lượng thức ăn khi được uống nước ngọt
trở lại. Ngược lại, nhiều nghiên cứu khác chỉ ra
rằng nước uống có độ mặn thấp (0,5%) có thể
kích thích dê ăn nhiều hơn (Runa và ctv, 2019).
Ngoài ra, cũng theo tác giả này thì lượng tăng
thức ăn ở nhóm dê già cao hơn so với nhóm dê
sinh trưởng (dê con). Điều này lý giải rằng nồng
độ nước uống nhiễm mặn khác nhau sẽ đáp ứng
lên lượng tiêu thụ thức ăn của dê khác nhau và
sự đáp ứng với nước nhiễm mặn phụ thuộc vào
lứa tuổi của dê.
Bảng 2. Ảnh hưởng của nồng độ nước muối
cao lên lượng thức ăn
Ngày ĐC SW1.5 P
D1-7 1,27±0,01 1,25±0,02 0,47
D8-14 1,28±0,01 1,27±0,01 0,66
D15-21 1,26±0,01 1,26±0,01 0,85
TB8-21 1,27±0,01 1,27±0,01 0,74
3.2. Ảnh hưởng của nồng độ nước muối cao
lên lượng nước uống của dê
Từ kết quả bảng 3 cho thấy lượng nước
uống của dê ở giai đoạn đầu (1-7 ngày) giữa
87
 CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC
hai NT khác nhau không có ý nghĩa thống kê
(P>0,05). Tuy nhiên, kể từ ngày 8 đến ngày 21,
sự khác biệt này có ý nghĩa thống kê (P<0,05),
dê ở nhóm SW1.5 uống ít hơn so với nhóm dê
ĐC. Điều này có thể được giải thích rằng khi
dê không được thích nghi từ từ với nước uống
có hàm lượng muối cao, chúng sẽ điều chỉnh
sự thích nghi bằng cách giảm sự tiêu thụ nước
uống. Nhiều nghiên cứu đã chỉ ra rằng lượng
nước tiêu thụ đã giảm xuống khi độ mặn tăng
lên do nước muối ít ngon miệng hơn và giảm
stress do muối. Theo Zoidis và Hadjigeorgiou
(2017), lượng nước uống của dê tăng trong
giai đoạn nước có nồng độ 1,0%, nhưng giảm
mạnh khi nước có nồng độ muối là 2%. Tương
tự, dê tăng tiêu thụ nước cho đến khi độ mặn
là 8,15g TDS/l và sau đó ở nồng độ 12,22g
TDS/l thì giảm lượng nước tiêu thụ (Attia-
Ismail và ctv, 2008). Tuy nhiên, nhiều nghiên
cứu cho ra rằng lượng nước uống được tăng
lên khi độ mặn tăng lên và hiệu quả là giúp
thận loại bỏ lượng muối vượt quá khỏi cơ thể
(Kii và Dryden, 2005). Sự giảm lượng nước
uống có hàm lượng muối cao ở dê sữa của thí
hiện tại có thể là một trong những cơ chế thích
nghi của dê nhằm làm giảm sự stress muối.
Bảng 3. Ảnh hưởng của nồng độ nước muối
cao lên lượng nước uống
Ngày ĐC SW1.5 P thấy trong các nghiên cứu sau thời gian dài
D1-7 3,34±0,30 3,51±0,20 0,64
D8-14 3,98±0,48 1,86±0,29 0,01
D15-21 3,42±0,53 1,90±0,30 0,04
TB8-21 3,70±0,49 1,88±0,25 0,01
3.3. Ảnh hưởng của nồng độ nước muối cao
lên năng suất sữa của dê
Kết quả bảng 4 cho thấy năng suất sữa
của dê qua từng giai đoạn TN không có sự
sai khác có ý nghĩa thống kê (P>0,05), điều đó
cho thấy nồng độ muối cao trong nước uống
không ảnh hưởng đến năng suất cho sữa của
dê. Kết quả này phù hợp với nghiên cứu của
Paiva (2017) khi cung cấp nước có nồng độ
8326 mg/l TDS trên 24 dê sữa trong 65 ngày
(12 ngày nuôi thích nghi) cho thấy không ảnh
hưởng đến sản lượng sữa của dê. Điều này
chứng minh rằng khả năng thích nghi của dê
với nước có mức TDS lên đến 8326 mg/l.
88
Bảng 4. Ảnh hưởng của nồng độ nước muối
cao lên năng suất sữa
Ngày ĐC SW1.5 P
D1-7 0,64±0,09 0,69±0,06 0,72
D8-14 0,63±0,10 0,69±0,04 0,58
D15-21 0,61±0,10 0,65±0,05 0,68
TB2-3 0,62±0,10 0,67±0,04 0,63
3.4. Ảnh hưởng của nồng độ nước muối cao
trong nước uống lên nồng độ chất điện giải
huyết tương và nước tiểu của dê
Qua bảng 5 cho thấy nồng độ chất điện
giải (Na+, K+, Cl-) huyết tương của dê trong
quá trình thí nghiệm không có sự khác biệt
có ý nghĩa thống kê giữa hai nghiệm thức
(P>0,05). Nồng độ Na+, K+, Cl- vẫn nằm trong
mức bình thường theo báo cáo của Zoidis
và Hadjigeorgiou (2017). Điều này cho thấy
không có sự ảnh hưởng của nước muối đến
nồng độ các chất điện giải trong máu của dê
thí nghiệm. Laboklin (2017) đã chứng minh
rằng ngoại trừ urê, tất cả các thông số máu
đo được đều nằm ở mức bình thường đối với
dê khỏe mạnh, cho thấy rằng động vật có thể
điều chỉnh cân bằng điện giải mà không bị
suy giảm sức khỏe. Không có thay đổi đáng
kể nào về nồng độ natri huyết thanh được tìm
uống nước mặn có nồng độ 1-1,3% ở hươu (Ru
và ctv, 2005).
Nồng độ các chất điện giải trong nước tiểu
có sự khác nhau có ý nghĩa thống kê (P<0,05),
cụ thể là nồng độ chất điện giải ở dê uống nước
muối cao hơn so với ĐC. Điều này có thể được
giải thích rằng, những con dê đã uống một
lượng nước muối có nồng độ cao mà trong
máu vẫn không bị ảnh hưởng cho thấy lượng
muối đã được loại thải ra ngoài chủ yếu bằng
nước tiểu và một phần qua phân. Có thể thấy
rằng nồng độ Na+ tăng trong nước tiểu mà
không tăng trong huyết tương. Kết quả này
tương tự với báo cáo của Eltayeb (2006). Theo
Zoidis và Hadjigeorgiou (2017), nồng độ K+
trong máu ở dê không bị ảnh hưởng đáng kể
bởi việc tăng nồng độ NaCl trong nước uống.
KHKT Chăn nuôi số 275 - tháng 3 năm 2022
CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC

Bảng 5. Ảnh hưởng của nồng độ muối cao lên hoạt động của tim và dẫn truyền xung động
nồng độ chất điện giải huyết tương và nước thần kinh.
tiểu (mmol/l)
Bảng 6. Ảnh hưởng của nồng độ nước muối
Trong Chỉ tiêu ĐC SW1.5 P cao trong nước uống lên phân số bài tiết chất
Na+ 146,34±0,72 146,82±0,56 0,61 điện giải và lượng bài tiết chất điện giải
Huyết K+ 4,01±0,16 4,32±0,34 0,43 (mmol/ngày)
tương
Cl- 107,92±0,24 108,98±0,70 0,19
Chỉ tiêu ĐC SW1.5 P
Na+ 108,56±9,19 146,74±8,95 0,02
FE Na+ (%) 3,90±0,82 5,86±0,48 0,07
K+ 110,98±2,47 130,28±7,01 0,03
Nước FE K+ (%) 143,6±24,17 179,36±13,44 0,23
tiểu Cl- 153,68±6,08 175,58±5,58 0,03
FE Cl- (%) 7,36±1,19 9,46±0,46 0,16
V (l/ 2,43±0,15 1,92±0,15 0,04
ngày) UE Na+ 261,90±18,66 284,04±33,20 0,58
UE K+ 269,12±12,75 250,17±25,13 0,52
Theo Zoidis and Hadjigeorgiou (2017) nồng độ Na+
UE Cl- 373,07±22,73 337,87±31,13 0,39
trong máu bình thường 142-155 mmol/l; nồng độ K+
bình thường là 3,5-6,7 mmol/l. Theo Tạ Thành Văn và ĐC: TDS 0,127 g/l, Cl- 0,028 g/l, K+ hòa tan 4,35 mg/l,
ctv (2013) nồng độ Cl- bình thường ở người 99-109 Na+ hòa tan 16,60 mg/l. SW1.5: TDS 15,00 g/l, Cl- 8,77
mmol/l g/l, K+ hòa tan 156,00 mg/l, Na+ hòa tan 4412,00 mg/l.
FE: Phân số bài tiết chất điện giải; UE: lượng bài tiết
3.5. Ảnh hưởng của nồng độ nước muối cao chất điện giải
trong nước uống lên phân số bài tiết chất
Sự bài tiết chất điện giải phụ thuộc vào
điện giải và lượng bài tiết chất điện giải
nồng độ chất điện giải và thể tích nước tiểu.
Qua bảng 6 cho thấy phân số bài tiết K+, Mặc dù nhóm dê ở nghiệm thức SW1.5 có
Cl- khác biệt không có ý nghĩa thống kê giữa nồng độ chất điện giải cao hơn so với nhóm
hai nhóm (P>0,05). Theo Hà Hoàng Kiệm dê ĐC, nhưng thể tích nước tiểu lại thấp hơn
(2010), tỷ lệ giữa hệ số thanh thải natri/hệ số (Bảng 5; P<0,05). Kết quả là lượng bài tiết chất
thanh thải creatinine nội sinh phản ánh khả điện giải giữa hai nghiệm thức khác nhau
năng tái hấp thu natri của ống thận và được không có ý nghĩa thống kê (Bảng 6; P>0,05).
gọi là phân số thải natri FENa. Bình thường, Ở động vật, việc kiểm soát cân bằng nước và
FE Na+ <1%, khi FE Na+ >1% phản ánh khả muối thông qua hệ thống renin-angiotensin.
năng tái hấp thu natri của ống thận giảm. Kết Hệ thống này bao gồm các hormone như
quả thí nghiệm cho thấy phân số bài tiết Na+ renin, angiotensin I và II, aldosterone. Thông
của dê ở nhóm SW1.5 có khuynh hướng cao thường, khi động vật tiêu thụ nhiều muối, dẫn
hơn so với nhóm ĐC. Do dê uống nước muối đến tăng áp suất thẩm thấu huyết tương dẫn
đã điều chỉnh cân bằng natri trong cơ thể bằng đến phản hồi ngược về sự tiết aldosterone và
cách giảm khả năng tái hấp thu natri ở ống sau đó làm giảm nồng độ aldosterone trong
thận. Theo Tạ Thành Văn và ctv (2013), một huyết tương, dẫn đến thúc đẩy sự bài tiết
cơ chế quan trọng khác duy trì cân bằng nước natri. Theo Runa và ctv (2019), dê uống nước
bình thường là tác dụng của ADH. ADH là muối và kiểm soát sự thải muối bằng cách bài
hormone của vùng dưới đồi, được dự trữ ở tiết qua nước tiểu trong đó tỷ lệ hai loại ion là
thùy sau tuyến yên. Tác dụng của ADH là tăng Na+ và Cl- được thải nhiều nhất và tăng tỷ lệ
tính thấm của ống góp với nước, làm tăng tái lọc ở cầu thận. Theo Zoidis và Handjigeorgiou
hấp thu nước ở thận và cô đặc nước tiểu. Theo (2017) việc gia tăng lượng nước muối có liên
Runa và ctv (2019), dê phản ứng nhạy hơn với quan đến bài tiết nước tiểu tăng hơn 100% khi
độ mặn của nước uống sau khi tiếp xúc lâu với dê uống nước với nồng độ 2% NaCl.
nước mặn cho thấy cơ chế điều chỉnh linh hoạt
4. KẾT LUẬN
tùy thuộc vào tổng cân bằng natri của con vật.
Natri và clo có chức năng thiết yếu để kiểm Kết quả thí nghiệm chỉ ra rằng dê sử dụng
soát áp suất thẩm thấu, chất lỏng cân bằng, nước nhiễm mặn với nồng độ 1,5% không ảnh

KHKT Chăn nuôi số 275 - tháng 3 năm 2022 89

 CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC
hưởng đến sự tiêu thụ thức ăn và năng suất
sữa. Tuy nhiên, khi dê sử dụng nước uống có
nồng độ muối là 1,5% đã giảm lượng nước
uống nhằm giảm stress muối. Mặc dù dê uống
nước nhiễm mặn có nồng độ chất điện giải
trong nước tiểu tăng, tuy nhiên phân số bài
tiết và sự bài thải chất điện giải qua nước tiểu
không thay đổi.
LỜI CÁM ƠN
Nghiên cứu này được tài trợ từ nguồn kinh
phí của Bộ Giáo dục và Đào tạo, Mã số B2020-
TCT-08.
TÀI LIỆU THAM KHẢO
1. Attia-Ismail S.A., Abdo A.R. and Asker A.R.T. (2008).
Effect of salinity level in drinking water on feed intake,
nutrient utilization, water intake and turnover and
rumen function in sheep and goats. Effect of salinity
level in drinking water on feed intake, nutrient
utilization, water intake and turnover and rumen
function in sheep and goats, 3(1): 77-94.
2. Eltayeb E.E. (2006). Effect of salinity of drinking water
and dehydration on thermo regulation, blood and urine
composition in nubian goats. M. Vet. Sci. Thesis Faculty
of Vet. Med., Uni. Khartoum, Sudan.
3. Jackson P.G.G. and Cockcroft P.D. (2002). Clinical
Examination of Farm Animals. Blackwell Science,
Oxford, UK, Pp. 303-05
4. Hà Hoàng Kiệm (2010). Thận học lâm sàng‖, NXB Y
học. Hà Nội.
5. Kii W.Y. and Dryden G.M. (2005). Effect of drinking
saline water on food and water intake, food digestibility,
and nitrogen and mineral balances of rusa deer stags
(Cervus timorensis russa). Anim. Sci., 81(1): 99-05.
6. Laboklin (2017). Normalvalues dog, cat, horse, cattle.
Retrieved on Sep 04, 2017. http://oldsite.laboklin.de/
pdf/en/products/reference_values.pdf, accessed on
24/09/2020.
7. Nguyễn Ngọc Lanh, Văn Đình Hoa, Phan Thị Thu
Anh và Trần Thị Chính (2012). Sinh Lý Bệnh học. NXB
Y Học, Hà Nội
8. Masters D.G., S.E. Benes and H.C. Norman (2007).
Biosaline agriculture for forage and livestock
production. Agr. Ecosyst. Env., 119: 234-48. doi:10.1016/j.
agee.2006.08.003.
90
9. Mdletshe Z.M., Chimonyo M., Marufu M.C. and
Nsahlai I.V. (2017). Effects of saline water consumption
on physiological responses in Nguni goats. Small Rum.
Res., 153: 209-11.
10. Paiva G.N., de Araújo G.G.L., HEMRIQUES L.,
Medeiros A.N., Beltrão F.E.M., Costa R.G. and Freire
R.M.B. (2017). Water with different salinity levels
for lactating goats. Embrapa Semiárido-Artigo em
periódico indexado (ALICE).
11. Ru Y.J., Glatz P.C. and Bao Y.M. (2005). Effect of salt
level in water on feed intake and growth rate of red and
fallow weaner deer. Asian - Aust. J. Anim. Sci., 18: 32-37.
12. Runa R.A., Brinkmann L., Riek A., Hummel J. and
Gerken M. (2019). Reactions to saline drinking water in
Boer goats in a free-choice system. An Int. J. Ani., 13(1):
98-05.
13. Runa R.A., Brinkmann L., Riek A., Hummel J. and
Gerken M. (2019). Reactions to saline drinking water in
Boer goats in a free-choice system. Anim. Int. J. Anim.
BioSci., 13(1): 98.
14. Silanikove N. (2000). The physiological basis of
adaptation in goats to harsh environments. Sma. Rum.
Res., 35(3): 181-93.
15. Nguyễn Thiết, Nguyễn Văn Hớn, Nguyễn Trọng Ngữ
và Sumpun T. (2021). Khả năng thích nghi của dê thịt
lai khi uống nước nhiễm mặn lên khối lượng, tăng khối
lượng và một số chỉ tiêu sinh hoá máu. Tạp chí KHKT
Chăn nuôi, 263(3): 63-70.
16. Thiet Nguyen, Narongsak C., Somchai C. and
Sumpun T. (2017). Dietary cation and anion difference:
Effects on milk production and body fluid distribution
in lactating dairy goats under tropical conditions.
Anim. Sci. J., 89(1): 105-13.
17. Van Soest P.V., Robertson J.B. and Lewis B. (1991).
Methods for dietary fiber, neutral detergent fiber,
and nonstarch polysaccharides in relation to animal
nutrition. J. Dai. Sci., 74(10): 3583-97.
18. Tạ Thành Văn (2013). Hóa Sinh Lâm Sàng. NXB Y Học,
Hà Nội.
19. Washington I.M. and Van H.G. (2012). Clinical
biochemistry and hematology. In The laboratory rabbit,
guinea pig, hamster, and other rodents, Pp. 57-16.
Academic Press.
20. Zoidis E. and Hadjigeorgiou I. (2017). Effects of
drinking saline water on food and water intake,
blood and urine electrolytes and biochemical and
haematological parameters in goats: a preliminary
study. Anim. Pro. Sci., 58(10): 1822-28.
KHKT Chăn nuôi số 275 - tháng 3 năm 2022
KHKT Chăn nuôi Số 274 - tháng 2 năm 2022

Tổng biên tập: DI TRUYỀN - GIỐNG VẬT NUÔI

TS. ĐOÀN XUÂN TRÚC Nguyễn Thị Lan Anh, Lê Tấn Lợi, Đỗ Thế Anh, Nguy n Thị Khánh Ly, Nguy n Thị

ễ
ễ
Thủy Tiên và Ho ng Tu n Th nh. Đa dạng di truyền Ngan xám dựa vào trình tự

à
ấ
à
Phó Tổng biên tập: Nucleotide trên vùng gen Cytochrome B ty thể 2
PGS.TS. NGUYỄN ĐĂNG VANG Nguyễn Ngọc T n, Trần Thị Vũ, Lê Văn Lộc, Lê Tấn Lợi và Ho ng Tu n

ấ
à
ấ
PGS.TS. NGUYỄN VĂN ĐỨC Th nh. Đa dạng di truyền cừu Phan Rang dựa vào trình tự Nucleotide trên vùng

à
D-Loop ty thể 8
Thư ký tòa soạn: Tr n Ngọc Ti n, Phạm Th Xuân, Phạm Thùy Linh, Nguyễn Th Minh Hường v

ầ
ế
ị
ị
à
PGS.TS. NGUYỄN VĂN ĐỨC Ngô Hạnh. Khả năng sản xuất của vịt bố mẹ (trống VSD v m i Star53) nuôi theo

à
á
hướng an to n sinh học tại Th i B nh 14

à
á
ì
Ủy viên Ban biên tập:
TS. NGUYỄN QUỐC ĐẠT DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI
PGS.TS. HOÀNG KIM GIAO Tr n Th Bích Ngọc, Ninh Th Huyền, Tr n Th Thu Hiền v Phạm Kim Đăng. Ảnh
ầ
ị
ị
ầ
ị
à
GS.TS. NGUYỄN DUY HOAN hưởng Lysine tiêu hóa trong khẩu phần đến năng suất v chất lượng trứng của g Isa

à
à
GS.TS. DƯƠNG NGUYÊN KHANG Brown 19
PGS.TS. NGUYỄN THỊ KIM KHANG Phan Văn Sơn, Nguyễn Văn Nh t, Nguyễn Th Lệ, Lê Th Lệ Thương v Tr n Đức

ấ
ị
ị
à
ầ
PGS.TS. ĐỖ VÕ ANH KHOA Huy. Ảnh hưởng của men vi sinh Biopromax đối với tăng khối lượng của g lai Hồ v

à
à
PGS.TS. ĐỖ ĐỨC LỰC hiệu quả kinh tế 27
GS.TS. LÊ ĐÌNH PHÙNG Từ Trung Kiên, Tr n Th Hoan, Cù Th Thúy Nga, Từ Quang Trung, Tr n Th Anh
ầ
ị
ị
ầ
ế
v Lù Th Hướng. Ảnh hưởng của chế phẩm Biolin đến năng suất v chất lượng thịt
à
ị
à
Xuất bản và Phát hành: g Ri Lai 33
à
ThS. NGUYỄN ĐÌNH MẠNH Tăng Xuân Lưu, Nguyễn Văn Hùng, Ho ng Kinh Giao, Phan Tùng Lâm, Thân

à
Minh Ho ng, Tr n Anh Tuyên, Lê Văn Thực v Ngô Đình Tân. Ảnh hưởng của bổ

U
à
ầ
à
sung tảo xoắn Spirulina plantensis đến tăng khối lượng, năng suất v chất lượng thịt

à
bò lai Wagyu giai đoạn vỗ béo 37

CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC

Nguyễn Anh D ng. Ứng dụng của chế phẩm probiotic trong chăn nuôi 45
ũ
Giấy phép: Bộ Thông tin và Truyền thông Ngô Hồng Phư ng, Nguyễn Quỳnh Thương v Tr n Vân Ty. Hiệu quả kh ng khuẩn
ợ
à
ầ
á
của chitosan t phụ phẩm tôm đối với vi khuẩn gây bệnh viêm vú trên bò sữa 51
Số 257/GP- BTTTT ngày 20/05/2016
ừ
Ngô Th Lệ Quyên, Nguyễn Công Đ nh, Phạm Hải Ninh, Nguyễn Quy t Thắng,
ISSN 1859 - 476X
ị
ị
ế
Nguyễn Qúy Khiêm v Đ Th Liên. Phương thức nuôi thích hợp vịt Minh Hương
à
ỗ
ị
Xuất bản: Hàng tháng thương phẩm 58
Toà soạn: Nguyễn Th Hạnh v Đặng Hồng Quyên. Ảnh hưởng của tuổi cai sữa đến sinh
ị
à
Địa chỉ: Tầng 4, Tòa nhà 73, trưởng của lợn con tại huyện Việt Yên, tỉnh Bắc Giang 63
Hồ Lý Quang Nhựt, Nguyễn Trọng Ngữ v Nguyễn Thi t. Ảnh hưởng của mức độ

Hoàng Cầu, Ô Chợ Dừa,
à
ế
Đống Đa, Hà Nội. mặn trong nước uống lên lượng thức ăn, nước uống, tăng khối lượng v chỉ tiêu sinh
à
lý của dê thịt 69
Điện thoại: 024.36290621
Đặng Hồng Quyên, Nguyễn Văn Lưu, Nguyễn Thu Hằng v Đo n Th Hường. Khả
Fax: 024.38691511
à
à
ị
năng sinh trưởng của ếch Th i Lan nuôi mật độ cao tại Bắc Giang 76
E - mail: tapchichannuoi@hoichannuoi.vn
á
Đặng Ho ng Lâm, Bùi Th Ho ng Y n, Nguyễn Th H Phương v V Xuân Dương.
à
ị
à
ế
ị
à
à
ũ
Website: www.hoichannuoi.vn Ảnh hưởng của hỗn hợp saponin v glyceride butyrin đến khả năng sản xuất v
à
à
Tài khoản: phòng chống cầu trùng trên g thịt lông m u 80
à
à
Tên tài khoản: Hội Chăn nuôi Việt Nam Nguyễn Phi Bằng. S n dây chó, mèo: Hiện trạng c c biện ph p ki m so t v sức
á
á
á
ể
á
à
khỏe cộng đồng 86
Số tài khoản: 1300 311 0000 40, tại Ngân hàng
Nông nghiệp và Phát triển Nông thôn, Chi nhánh
Thăng Long - Số 4, Phạm Ngọc Thạch, Hà Nội. THÔNG TIN KHOA HỌC VÀ CÔNG NGHỆ
In 1.000 bản, khổ 19x27 tại Công ty CP KH&CN TS. Nguyễn Hữu Tỉnh, PGS.TS. Nguyễn Văn Đức. Hệ thống nhân giống lợn ở c c
á
Hoàng Quốc Việt. In xong và nộp lưu chiểu: quốc gia ph t tri n Đan Mạch, Mỹ, Anh, Canada, H Lan, Ph p 94
á
ể
à
á
tháng 2/2022. PGS.TS. Nguyễn Văn Đức. Một số thông tin trong công nghệ chăn nuôi 96
PGS.TS. Nguyễn Văn Đức. Thận lợn biến đổi gen đã được ghép cho con người 99
CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC

4. KẾT LUẬN bệnh đư ng tiêu hóa như hội chứng tiêu chảy.
ờ

Sinh trư ng của lợn con sau cai sữa khi

ở
TÀI LIỆU THAM KHẢO
được cai sữa 18 ngày tuổi tốt hơn so với cai
ở 1. Funderburke D.W. and Seerley R.W. (1990). The effects
sữa 25 ngày tuổi: KL lợn con 45 và 60 ngày of postweaning stressors on pig weight change, blood,
liver and digestive tract characteristics. J. Anim. Sci., 68:
tuổi lần lượt đạt 13,62 và 21,19 kg/con với tuổi 155-62.
CS là 18 ngày, cao hơn lợn con được CS 25 ở

2. Nguyễn Văn Hiền (2002). Cai sữa và nuôi dưỡng lợn con.
ngày tuổi (13,29 và 20,70 kg/con). NXB Nông nghiệp Hà Nội.
3. Lê Hồng Mận (2002). Chăn nuôi lợn nái sinh sản nông
T lệ nuôi sống và độ đ ng đều của đàn ở

hộ, NXB Nông nghiệp – Hà Nội.

ỷ ồ

lợn được cai sữa các th i điểm 18 và 25 ngày

ở ờ

4. Oconnell N.E., Beattie V.E. and Weatherup R.N. (2004).

tuổi không có sự sai khác có nghĩa thống kê,
tuy nhiên TLNS và độ đ ng đều của lợn conồ
được cai sữa 18 ngày tuổi cao hơn so với cai
sữa 25 ngày tuổi. Cai sữa sớm 18 ngày tuổi,
ý
Influence of group size during the post-weaning period
on the performance and behaviour of pigs. Liv. Pro. Sci.,
86: 225-32.
5. Trần Văn Phùng, Từ Quang Hiển, Trần Thanh Vân và
Hà Thị H o (2004). Giáo trình chăn nuôi lợn, NXB Nông
ả

lợn con không ảnh hư ng đến t lệ cảm nhiễm

ở ỷ nghiệp, Hà Nội.

ẢNH HƯỞNG CỦA MỨC ĐỘ MẶN TRONG NƯỚC UỐNG

LÊN LƯỢNG THỨC ĂN, NƯỚC UỐNG, TĂNG KHỐI LƯỢNG
V CHỈ TIÊU SINH LÝ CỦA DÊ THỊT
À

Hồ Lý Quang Nhựt1, Nguyễn Trọng Ngữ1 v Nguyễn Thi t1* à ế

Ngày nhận bài báo: 01/11/2021 - Ngày nhận bài phản biện: 01/12/2021
Ngày bài báo được chấp nhận đăng: 06/12/2021
TÓM TẮT
Thí nghiệm này được thực hiện nhằm đánh giá ảnh hư ng của các mức độ mặn trong nước
ở

uống lên lượng thức ăn, nước uống, khả năng tăng tr ng và chỉ tiêu sinh l của dê thịt. Thí nghiệm
ọ ý

được bố trí hoàn toàn ng u nhiên với bốn nghiệm thức và 04 lần lập lại, tổng cộng là 16 đơn vị thí
ẫ

nghiệm là 16 dê đực Boer lai. Bốn nghiệm thức (NT) trong thí nghiệm bao g m: NT đối chứng (ĐC), ồ

3 nghiệm thức nước mặn là NT5, NT10 và NT15 tương ứng với các n ng độ nước biển pha loãng ồ

là 0,5; 1,0 và 1,5%. Kết quả thí nghiệm cho thấy các mức độ mặn trong nước uống ảnh hư ng đến ở

lượng thức ăn, nước uống của dê. Lượng thức ăn tiêu thụ của dê giảm dần khi lượng nước uống
có n ng độ muối tăng dần. Ngược lại, lượng nước uống tăng t lệ thuận với n ng độ muối trong
ồ ỷ ồ

nước uống (P<0,05). Tr ng lượng, tăng tr ng, tần số hô hấp và nhiệt độ trực tràng của dê không có
ọ ọ

sự khác biệt có nghĩa thống kê giữa các nghiệm thức (P>0,05). Tuy nhiên, th i điểm 15:00 gi
ý ở ờ ờ

dê NT15 giảm tần số hô hấp và tăng nhiệt độ trực tràng so với ĐC. Kết quả của thí nghiêm đã chỉ
ở

ra rằng dê thịt lai Boer có thể s dụng nước muối với n ng độ 0,5-1,0%, ngược lại n ng độ nước
ử ồ ở ồ

muối 1,5% dê giảm lượng tiêu thụ thức ăn.

Từ khóa: Dê th t, đ p ng sinh lý, đ mặn, tăng kh i lư ng, th c ăn.
ị á ứ ộ ố ợ ứ

ABSTRACT
The effects of salinity in drinking water on dry matter intake, water consumption, weight
gain and physiological responses in growing crossbred goats
This study aimed to evaluate the effects of salinity in drinking water on dry matter intake,
water consumption, weight gain and physiological responses in growing crossbred goats. The

1
Trư ng Đại h c Cần Thơ
ờ ọ

* Tác giả liên hệ: TS. Nguyễn Thiết, Khoa Phát triển Nông thôn, Trư ng Đại h c Cần Thơ. Điện thoại: 0932147900; Email:
ờ ọ

nthiet@ctu.edu.vn

KHKT Chăn nuôi số 274 - tháng 2 năm 2022 69

 CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC

experiment was arranged in a completely randomized design with four treatments and four
replicates, for a total of 16 experimental units and 16 Boer crossbred male goats. Four treatments
(NT) in the experiment consisted of control group (ĐC), three treatment groups were NT5, NT10
and NT15 with different levels of diluted seawater of 0.5, 1.0 and 1.5%, respectively. The results
from present study showed that growing goats consumed saline water affected on dry matter intake
(DMI) and water intake (WI). DMI decreased and WI increased as saline levels increased (P<0.05).
Body weight, weight gain, respiration rate and rectal temperature did not affect throughout the
experiment. However, at 15:00h goats from NT15 decreased respiration rate and increased rectal
temperature as compared to with control group (P<0.05). The results in this study indicated that
Boer crossbred male goats could consume saline water with levels from 0.5 to 1.0%, but goats drank
with saline water of 1.5% which decreased DMI.
Keywords: Dry matter intake, growing goats, physiological responses, salinity, weight gain.

1. ĐẶT VẤN ĐỀ
Nông nghiệp Việt Nam phát triển mạnh
mẽ từ nhiều năm qua về chăn nuôi lợn, gia
súc, gia cầm, trồng trọt,… Nhưng vài năm trở
lại đây, việc chăn nuôi dê ngày ngày càng trở
nên phổ biến hơn. Nghề chăn nuôi dê đã có từ
lâu đời nhưng chủ yếu là theo phương thức
quảng canh (Đinh Văn Bình, 2006). Mặt khác,
những thách thức về khí hậu do những thay
đổi toàn cầu, nhiễm mặn nước ngầm làm cho
khan hiếm nước là mối đe dọa ngày càng tăng
đối với vật nuôi, đặc biệt là ở các vùng ven
biển (Hallegatte và ctv, 2013). Trong điều kiện
khô hạn đó, các động vật có vú khác, động
vật nhai lại có khả năng nước uống có nồng
độ muối cao, nổi bật là dê thích nghi tốt với
môi trường khô hạn và khan hiếm nước, thậm
chí có thể sống sót trên nước biển (Dunson,
1974). Tuy nhiên, một số nghiên cứu đã cho
rằng việc hấp thụ nước muối thông qua nước
uống cũng như các cây trồng chịu mặn và có
thể ảnh hưởng xấu đến năng suất, chủ yếu
là lượng thức ăn, lượng nước uống vào giảm
do hoạt động của vi sinh vật dạ cỏ bị ảnh
hưởng (Assad và El-Sherif, 2002). Song song
đó, muối (NaCl) là một yếu tố thiết yếu trong
khẩu phần ăn của động vật (Suttle, 2010).
Nếu các tác động không tốt của việc tiêu thụ
nguồn nước uống có hàm lượng TDS từ trung
bình đến cao của gia súc nhai lại là đủ nghiêm
trọng, thì trong một số trường hợp, các biện
pháp quản lý có thể được thay đổi để giảm
bớt ảnh hưởng, ví dụ rõ ràng nhất là thay
đổi nguồn nước khác hoặc pha loãng nguồn
nước. Bên cạnh đó, động vật nhai lại có cơ chế
điều tiết bẩm sinh cho phép chúng lựa chọn
chế độ ăn uống cân bằng theo nhu cầu dinh
dưỡng của chúng (Fedele và ctv, 2002). Cho
đến nay, đã có nhiều nghiên cứu về dê và có
một số nghiên cứu trước đó cũng đã thực hiện
về ngưỡng cảm nhận nồng độ muối trong nước
uống của dê (Bell, 1959) và cừu (Goatcher và
Church, 1970a). Tuy nhiên, vẫn còn thiếu các
nghiên cứu về khả năng chịu mặn của dê thịt
được thực hiện bằng cách pha loãng từ nước
biển với các nồng độ khác nhau. Vì vậy, nghiên
cứu này được thực hiện nhằm đánh giá ảnh
hưởng của các mức độ mặn trong nước uống
lên lượng thức ăn, nước uống, khả năng tăng
khối lượng (TKL) và chỉ tiêu sinh lý của dê thịt.
2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU
2.1. Đối tượng, thời gian và địa điểm
Đề tài được thực hiện trên dê thịt lai Boer,
khoảng 09 tháng tuổi và khối lượng (KL)
trung bình là 37,73±1,46kg, từ tháng 5/2021
đến tháng 8/2021, tại Trại Chăn nuôi Thực
nghiệm, Khoa Phát triển Nông thôn, trường
Đại học Cần Thơ: Số 554, Quốc lộ 61, ấp Hoà
Đức, xã Hoà An, huyện Phụng Hiệp, tỉnh Hậu
Giang.
Mẫu thức ăn và nước uống được lấy tại
Trại Chăn nuôi Thực nghiệm, Khoa Phát triển
Nông thôn, trường Đại học Cần Thơ.
Xét nghiệm máu tại Trung tâm xét nghiệm
y khoa Center Lab Việt Nam: Số 50-52, Trần
Bạch Đằng, phường An Khánh, quận Ninh
Kiều, thành phố Cần Thơ.

70 KHKT Chăn nuôi số 274 - tháng 2 năm 2022

CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC

Phân tích nước và thức ăn tại Bộ môn Khoa Nước uống dùng cho dê trong thí nghiệm
học Đất và Chăn nuôi, Khoa Nông nghiệp, là gồm có nước ngọt (nước sinh hoạt) và nước
Trường Đại học Cần Thơ: Khu 2, đường 3/2, P. mặn có nồng độ 5‰, 10‰, 15‰ được pha từ
Xuân Khánh, Q. Ninh Kiều, TP. Cần Thơ. nước biển cô đặc (nước ót, 97‰) với nước ngọt
theo công thức C1 x V1 = C2 x V2 và được đo
2.2. Bố trí thí nghiệm và thu thập số liệu
kiểm tra bằng thiết bị khúc xạ kế đo độ mặn
Tất cả dê thí nghiệm (TN) được cho ăn ATAGO Master-S/MillM Salinity 0~100‰ với
khẩu phần trộn hoàn chỉnh (TMR) giống nhau độ chính xác ±2‰.
bao gồm 70% bắp ủ chua và 30% thức ăn hỗn Nước ngọt cho dê uống trong TN được
hợp. Trong đó, thức ăn hỗn hợp bao gồm có lấy từ nguồn nước sinh hoạt là nguồn nước
cám gạo, bột bắp, khô đậu nành, bột đá mịn và sạch không màu, không mùi hôi thối và không
rỉ mật đường. Dê được cho ăn 2 lần/ngày vào gây ảnh hưởng đến sức khỏe của đàn dê.
lúc 7:00 và 14:00 và được uống nước tự do.
Bảng 3. Kết quả phân tích mẫu nước thí nghiệm
Bảng 1. Nguyên liệu thức ăn làm thí nghiệm
Chỉ tiêu Nước ngọt Nước biển
Thành phần nguyên liệu Tỷ lệ, % DM (0,127‰) cô đặc 97‰
Thân lá bắp ủ chua 70,0 EC (mS/cm) 0,28 214
Cám gạo tươi 8,0 TDS chuyển đổi từ EC (g/l) 0,127 97
Bột bắp 11,3 CL- (g/l) 0,028 63,34
Khô đậu nành 7,8 K+ (mg/l) 4,35 1.110
Bột đá mịn 0,9 Na+ (mg/l) 16,6 31.972
Rỉ mật đường 2,0 Ca2+ (mg/l) 15,5 575
Tổng 100 Mg2+ (mg/l) 9,91 4.109
Mẫu thức ăn được xác định vật chất khô, TDS = Total Dissolved Solids (Tổng chất rắn hòa tan);
sau đó được phân tích thành phần hóa học. EC= Electrical Conductivity (Độ dẫn điện)
Bảng 2. Thành phần hóa học trong thức ăn Trong đó K+ hoà tan, Na+ hoà tan, Ca2+ hoà
tan, Mg2+ hoà tan đo mẫu trên máy hấp thu
Thành phần hóa học Tỷ lệ, % DM nguyên tử; EC đo bằng máy đo EC; Cl- chuẩn
DM 29,5 độ bằng AgNO3 0,02N và TDS chuyển đổi từ EC
CP 16,2 bằng công thức: TDS (g/l) = EC (mS/cm) x 0,454.
EE 2,01
ADF 28,5
Thí nghiệm được bố theo trí khối hoàn
NDF 39,5
toàn ngẫu nhiên với 4 nghiệm thức (NT) và
Ash 9,7
4 lần lặp lại, tổng cộng là 16 đơn vị TN là 16
dê đực Boer lai. Các NT với các nồng độ muối
DM = Vật chất khô; CP = Protein thô; EE = Béo thô; khác nhau gồm: đối chứng (ĐC, nước ngọt) và
ADF = Xơ axít; NDF = Xơ trung tính; Ash = Khoáng TN có nồng độ muối 0,5% (NT5, 5‰), nồng
tổng số độ muối 1% (NT10, 10‰), nồng độ muối 1,5%
Ủ chua thân cây bắp là quá trình lên men (NT15, 15‰). Trước TN, nuôi 1 tuần thích
yếm khí, được làm từ thân cây bắp đã thu nghi (tuần 1) và 8 tuần (tuần 2-9) thu thập số
hoạch trái tại các nông hộ lân cận. Sau đó đem liệu. Thí nghiệm sử dụng nước biển cô đặc
thân cây bắp về cắt nhỏ ra bằng máy băm cỏ pha với nước ngọt để đạt được các nồng độ
và trộn với rỉ mật đường (đã được bổ sung muối 0,5; 1 và 1,5%. Thức ăn sử dụng là khẩu
thêm nước) để cho quá trình lên men dễ dàng phần trộn hoàn chỉnh (TMR) bao gồm 70% cỏ
hơn. Giai đoạn cuối cùng là trữ vào thùng tự nhiên (bắp ủ chua) và 30% thức ăn hỗn hợp.
(hoặc túi nilong) sao cho thân lá cây bắp nén Dê được cho ăn hai lần/ngày vào lúc 7:00 và
chặt lại, không còn không khí và các khoảng 16:00 và được uống nước tự do.
hở giữa các thân cây bắp. Sau thời gian 3 tuần Tất cả số liệu thức ăn, nước uống và thức
thì có thể sử dụng cho dê ăn. ăn thừa được ghi nhận hàng ngày, mẫu cỏ và

KHKT Chăn nuôi số 274 - tháng 2 năm 2022 71

 CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC

thức ăn hỗn hợp thừa được lấy một lần/tuần ctv (1994), lượng nước đưa vào có nồng độ
trong quá trình thí nghiệm. Cuối thí nghiệm, muối dưới 1% không ảnh hưởng đến lượng
các mẫu thức ăn và thức ăn thừa được trộn lại ăn vào của dê, nhưng nếu tăng lên đến 1,7%
và phân tích các chỉ tiêu DM, OM và CP theo đã làm giảm lượng ăn vào của dê. Mặt khác,
phương pháp của AOAC (1990) và NDF, ADF lượng thức ăn ăn vào của dê sẽ bị ảnh hưởng
theo phương pháp của Van Soet và ctv (1991). nhiều khi độ mặn trong nước uống tăng lên,
Dê được cân trọng lượng ở thời điểm bắt đầu vì độ mặn trong nước sẽ làm giảm sự thèm ăn
thí nghiệm và cuối thí nghiệm, vào buổi sáng cũng như việc sử dụng thức ăn ở động vật, kết
trước khi cho ăn. quả của Yira và ctv (2018), cho rằng việc tăng
Nhiệt độ trực tràng được đo bằng nhiệt nồng độ muối trong nước uống sẽ làm giảm
kế tự động (digital clinical thermometer C202, lượng thức ăn tiêu thụ và khả năng tiêu hóa
Terumo, Tokyo, Japan). Tần số hô hấp được của dê, việc chuyển hóa năng lượng cũng bị
đo bằng cách đếm sự chuyển động lên xuống ảnh hưởng. Tuy nhiên theo báo cáo của Al-
của sườn bụng tương ứng với một lần thở. Ramamneh và ctv (2012), đã ghi nhận lượng
Nhiệt độ trực tràng và tần số hô hấp sẽ được thức ăn hàng ngày của dê giữa nghiệm thức
đo vào mỗi hai giờ từ 07:00 giờ đến 19:00 giờ đối chứng 76,6 g/kg BW/ngày với NT cho uống
và mỗi tuần của thí nghiệm. nước muối có nồng độ 10 và 15% NaCl, tương
ứng 72,0 và 75,0 g/kg BW/ngày thay đổi không
2.3. Xử lý số liệu
đáng kể (P>0,05). Kết quả cho thấy nếu cung
Sử dụng phần mềm Minitab 16.0 để phân cấp nước có hàm lượng muối 0,5-1,0% dê có thể
tích so sánh các giá trị trung bình theo phép chấp nhận, nhưng tăng hàm lượng muối lên
thử GLM (General Linear Model). Sự khác 1,5% thì dê giảm lượng thức ăn ăn vào.
biệt có ý nghĩa khi P<0,05.
Bảng 4. Ảnh hưởng lên LTATT (g/kg BW/ngày)
3. KẾT QUẢ VÀ THẢO LUẬN
Nghiệm thức
Tuần SE P
3.1. Ảnh hưởng của các mức độ mặn trong ĐC NT5 NT10 NT15
nước uống lên lượng thức ăn ăn vào của dê thịt 1 19,76 19,38 19,67 19,33 0,49 0,907
2 22,10 21,72 20,63 19,76 0,648 0,094
Khả năng tiêu thụ thức ăn của dê khi cung
3 21,47ab 21,98a 20,34ab 18,72b 0,768 0,048
cấp nước muối có rất nhiều yếu tố ảnh hưởng
4 21,90a 20,81ab 18,95ab 18,40b 0,827 0,038
như yếu tố môi trường, giống dê, độ nhạy
5 20,49 19,58 17,66 17,44 0,876 0,081
của từng con, tình trạng dư thừa khoáng chất
6 21,72 21,17 19,37 19,19 0,757 0,084
của động vật, nếu những con bị thiếu muối 7 20,02a 18,9ab 15,43b 17,07ab 0,983 0,035
nó sẽ thể hiện rất rõ khi tiếp xúc với thức ăn 8 17,58 16,82 16,48 14,78 0,751 0,110
cũng như nước uống có hàm lượng muối và 9 17,61a 17,89a 16,62ab 14,29b 0,784 0,027
ngược lại, một trong những yếu tố quan trọng TB2-9 20,36a 19,81a 18,18ab 17,46b 0,610 0,018
khác là việc cung cấp nước mặn cho động
Ghi chú: Các giá trị trung bình trong cùng một hàng có
vật là nước biển pha loãng, thành phần của
chữ cái khác nhau thì khác biệt có ý nghĩa thống kê (P<0,05)
hai loại nước có thể khác nhau về loại muối
có trong mỗi loại nước. Kết quả ở bảng 4 cho 3.2. Ảnh hưởng của các mức độ mặn trong
thấy lượng thức ăn ăn vào của dê trước TN nước uống lên lượng nước uống của dê thịt
(tuần 1) khác biệt không có ý nghĩa thống kê Lượng nước uống hàng ngày của dê được
(P>0,05). Ngược lại ở giai đoạn sau TN, lượng thể hiện qua bảng 5 cho thấy lượng nước của
thức ăn của dê giảm dần khi dê uống nước dê ở tuần 2 đến tuần 9 rất có ý nghĩa thống
muối có nồng độ tăng dần (P<0,05) và dẫn kê (P=0,001), đặc biệt giữa NT10 và NT15 so
đến trung bình của giai đoạn này ở NT15 dê với ĐC và NT5. Nguyên nhân của sự sai khác
tiêu thụ lượng thức ăn thấp nhất so với NT này là do khi tiêu thụ lượng nước muối cao
ĐC (P<0,05). Theo nghiên cứu của Abous và gây ra hai phản ứng cân bằng nội môi chính,

72 KHKT Chăn nuôi số 274 - tháng 2 năm 2022

CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC

đó là tăng lượng nước hấp thụ (Blache và ctv, 3.3. Ảnh hưởng của độ mặn trong nước
2007), nói cách khác đế tránh nồng độ muối uống lên tần số hô hấp và nhiệt độ trực
cao trong dịch ngoại bào hoặc nội bào của tràng của dê
cơ thể, một phản ứng cân bằng nội môi là sự Kết quả bảng 6 đã ghi nhận ảnh hưởng
gia tăng lượng nước đưa vào và tăng bài thải của nồng độ muối trong nước uống lên tần số
muối qua nước tiểu (NRC, 2005). Kết quả của hô hấp trước và sau TN không có sự khác biệt
thí nghiệm hiện tại này phù hợp với nghiên (P>0,05). Điều này có thể do dê là loài động
cứu của Runa và ctv (2019), đã kiểm tra phản vật ưa muối và loài chịu đựng được nồng
ứng sinh lý thích nghi với việc tăng độ mặn độ muối cao hơn so với các loài nhai lại khác
trong nước uống cho 12 con dê Boer giữa các (Suttle, 2010). Kết quả của nghiên cứu hiện
nồng độ muối khác nhau (0,25; 0,5; 0,75; 1; tại tương đồng với nghiên cứu của Cardoso
1,5% NaCl), sau 4 tuần TN, dê dần dần thích và ctv (2021) cho rằng tần số hô hấp trên dê
nghi tốt với các nồng độ muối khác nhau đặc uống nước muối và dê uống nước ngọt khác
biệt là ở 1,5% NaCl và tổng lượng nước tiêu biệt không có ý nghĩa thống kê. Tuy nhiên, kết
thụ tăng lên khi nồng độ muối tăng (P<0,05) quả của TN hiện tại cũng cho thấy ở thời điểm
(75,4 g/kg/ngày). Theo Mohammed (2008) ghi 15:00 giờ của giai đoạn sau TN dê uống nước
nhận rằng dê Nubian uống nước với nồng muối với nồng độ 1,5% có kết quả tần số hô
độ muối 1,5% trong 6 tuần không ảnh hưởng hấp thấp hơn so với dê ở NT uống nước ngọt
đến lượng nước tiêu thụ. Điều này có thể giải và nước muối nồng độ thấp (0,5%). Kết quả
thích sự cảm ứng Na+/K+ ATPase trong thận, này tương tự so với báo cáo của Mdletshe và
gan và hồi tràng ở dê tiếp xúc với nước mặn. ctv (2017), tác giả cho rằng dê uống nước muối
Vì enzyme này đóng vai trò trung tâm trong với nồng độ 0,5-1,1% trong thời gian 4 tuần đã
việc vận chuyển tích cực natri ra khỏi tế bào làm giảm tần số hô hấp.
và các cơ chế không vận chuyển khác và khả Bảng 6. Ảnh hưởng lên tần số hô hấp (lần/phút)
năng chịu đựng nước mặn của dê cao hơn so Chỉ Nghiệm thức
với các loài nhai lại khác (Macfarlane, 1982). Giờ SE P
tiêu ĐC NT5 NT10 NT15
Tuy nhiên, theo nghiên cứu Mdletshe và ctv 07 17,67 18,00 18,00 17,33 1,184 0,974
(2017), cho thấy dê uống nước muối có độ 09 19,00 19,33 22,00 18,67 1,318 0,308
mặn 1,1% đã giảm lượng nước tiêu thụ so với 11 18,67 17,00 21,00 18,00 1,491 0,320
nhóm dê uống nước ngọt. Nguyên nhân có Trước 13 16,67 21,00 20,00 21,33 1,900 0,332
thí
thể là do nước muối ít ngon miệng hơn, stress nghiệm 15 17,00 17,67 18,67 18,33 0,890 0,575
do muối và có thể là một trong những các cơ 17 20,00 17,33 18,33 19,33 1,190 0,443
chế thích nghi của dê. 19 18,00 19,00 20,00 17,67 1,196 0,529
TB7-19 18,14 18,48 19,71 18,67 0,862 0,616
Bảng 5. Ảnh hưởng lên lượng nước uống
07 21,67 19,67 22,46 19,42 1,204 0,255
Nghiệm thức 09 22,50 25,08 24,25 20,54 1,388 0,153
Tuần SE P
ĐC NT5 NT10 NT15 11 22,96 23,13 22,25 21,71 1,152 0,808
1 10,530 11,075 13,793 13,210 1,324 0,278 Sau thí 13 26,29 25,83 27,00 25,50 1,136 0,806
2 9,523ab 7,593b 20,372a 15,848ab 2,794 0,026 nghiệm 15 25,83a 26,63a 24,33ab 23,33b 0,666 0,019
3 13,383 12,070 22,498 21,290 3,107 0,075 17 26,63 25,88 26,92 22,75 1,368 0,175
4 6,945b 8,460ab 21,153a 19,423ab 3,527 0,028 19 20,29 20,79 22,46 21,79 0,684 0,163
5 7,895c 13,478bc 18,173ab 25,143a 2,687 0,005 TB7-19 23,74 23,86 24,24 22,15 0,820 0,330
6 9,243c 10,665bc 21,488ab 29,568a 3,210 0,002 Kết quả nhiệt độ trực tràng của dê của các
7 12,308b 16,260ab 26,375ab 29,048a 3,839 0,027 thời điểm trong ngày ở trước và sau TN cho
8 8,237b 8,580b 19,858a 16,753ab 2,154 0,005 thấy không có sự khác biệt có ý nghĩa thống
9 9,230b 9,758b 15,815b 25,233a 1,746 0,001 kê (P>0,05). Trong đó, nhiệt độ trực tràng (RT)
TB2-9 9,640b 10,575b 20,717a 22,788a 1,042 0,001 của dê ở các NT trong thời gian 7:00-19:00

KHKT Chăn nuôi số 274 - tháng 2 năm 2022 73

 CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC

không có sự chênh lệch đáng kể. Tuy nhiên, lượng dê ở nghiên cứu này tương đồng với
ở 15:00 giờ, nhiệt độ trực tràng của dê NT15 nghiên cứu của Runa và ctv (2019), chỉ ra rằng
cao hơn so với ĐC tương ứng 39,24oC so với những con dê Boer uống nước có nồng độ
38,93oC (P=0,01). Điều này có thể do tần số muối 0,75; 1; 1,25; 1,5% KL không ảnh hưởng
hô hấp của dê ở NT15 nhỏ hơn so với NT ĐC giữa các NT trong 4 tuần TN. Tương tự, At-
(Bảng 6) dẫn đến quá trình thải nhiệt của dê tia-Ismail và ctv (2008) khi so sánh KL dê uống
nhỏ hơn và nhiệt độ cơ thể sẽ cao hơn ở TN mặn có nồng độ cao 12,33g TDS/l là 13,71 kg/
này. Nhiệt độ trực tràng ở TN hiện tại vẫn nằm con so với nhóm uống nước ngọt là 14,00 kg/
trong giới hạn sinh lý của dê, thay đổi trong con, không có sự khác biệt. Tuy nhiên, khi
khoảng 38,8-40oC (Swenson and Reece, 2006). hàm lượng nước muối tăng lên 1,7% lượng
Kết quả này tương tự báo cáo của Cardoso và ăn sẽ giảm ở dê, uống liên tục nước muối có
ctv (2021), ghi nhận nhiệt độ trực tràng không nồng độ 2% trở lên làm giảm cảm giác thèm
có sự khác biệt có ý nghĩa thống kê khi dê ăn, giảm lượng thức ăn, khả năng tiêu hóa và
uống nước mặn 0,1-1,2%. Tương tự, Costa và do đó dẫn đến giảm KL (Abou và ctv, 1994).
ctv (2021) báo cáo rằng cừu uống nước muối Bảng 8. Ảnh hưởng lên KL (kg), TKL (g/con/ngày)
có nồng độ 0,3-0,9% không ảnh hưởng đến
nhiệt độ trực tràng. Nghiệm thức
Chỉ tiêu SE P
ĐC NT5 NT10 NT15
Bảng 7. Ảnh hưởng lên nhiệt độ trực tràng (0C) KL đầu TN 38,00 37,43 37,77 37,73 1,034 0,980
Nghiệm thức KL cuối TN 41,50 40,70 40,60 41,00 0,935 0,903
Tuần Giờ SE P TKL 62,50 58,33 50,60 58,33 4,984 0,429
ĐC NT5 NT10 NT15
07 38,43 38,50 38,27 38,43 0,079 0,244 Kết quả TN cho rằng dê uống nước
09 38,83 39,20 38,80 39,00 0,164 0,334 muối với nồng độ lên tới 1,5% trong 08 tuần
Trước 11 38,77 38,83 38,53 38,63 0,130 0,397 không ảnh hưởng đến TKL của dê (P>0,05).
thí 13 38,80 38,87 38,70 38,87 0,118 0,727 Một số nghiên cứu chỉ ra rằng TKL của gia
nghiệm 15 38,87 38,47 38,80 39,03 0,172 0,181 súc bị ảnh hưởng xấu bởi độ mặn của nước.
17 38,77 39,13 38,27 38,63 0,235 0,127 Theo Mdletshe và ctv (2017), TKL ở dê giảm
19 39,00 38,77 38,40 38,93 0,172 0,114 (P<0,05) với nồng độ muối trong nước uống
07 38,74 38,59 38,70 38,56 0,076 0,356 0,55-1,1% so với nhóm uống nước ngọt. Theo
09 39,21 39,12 39,10 38,88 0,107 0,218
Patterson và ctv (2004), TKL giảm 27% khi
11 38,98 39,15 38,98 39,00 0,074 0,330
Sau thí nồng độ muối của nước tăng từ 0,12 lên 0,48%.
13 38,57 39,04 38,78 38,90 0,202 0,431
nghiệm Tuy nhiên, cũng có những nghiên cứu cho thấy
15 38,93b 39,11ab 38,91b 39,24a 0,062 0,01
TKL không bị ảnh hưởng bởi nước mặn. Ở cừu
17 39,22 39,25 39,01 39,08 0,087 0,226
đực Barbarine, Yousfi và ctv (2017) phát hiện
19 39,11 39,13 38,95 39,00 0,073 0,312
ra rằng nước với 0,7% NaCl không ảnh hưởng
Ghi chú: Trước TN tương ứng với tuần 1 và tất cả dê đến TKL. Các kết quả TN có thể thấy rằng ảnh
đều được uống nước ngọt; sau TN là dê uống nước
hưởng của nước mặn đối với vật nuôi thay
với các nồng độ nước muối tương ứng với các NT thí
đổi theo mức độ mặn, loại khoáng chất và khả
nghiệm và kết quả nhiệt độ trực tràng là trung bình từ
tuần 2 đến tuần 9. năng chống chịu của vật nuôi với mức độ mặn
thấp có thể được khuyến cáo cho vật nuôi, đặc
3.4. Ảnh hưởng của các mức độ mặn trong biệt thí nghiệm hiện tại đã chỉ ra rằng dê sử
nước uống lên trọng lượng và tăng trọng của dụng nước với nồng độ muối 1,5% trong 8 tuần
dê thịt không ảnh hưởng đến KL và TKL của dê.
Kết quả tại bảng 8 cho thấy KL dê ở đầu
4. KẾT LUẬN
và cuối TN không có sự khác biệt có ý nghĩa
thống kê (P>0,05). Cụ thể, KL dê đầu TN là Dê sử dụng nước nhiễm mặn với nồng độ
37,73 kg/con và cuối TN là 40,95 kg/con. Khối 0,5-1% không ảnh hưởng đến sự tiêu thụ thức

74 KHKT Chăn nuôi số 274 - tháng 2 năm 2022

CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC
ăn, nước uống, các chỉ tiêu sinh lý và sự thay
đổi KL. Tuy nhiên, khi dê sử dụng nước uống
có nồng độ muối là 1,5% đã giảm lượng tiêu
thụ thức ăn, tăng lượng nước uống và không
thay đổi KL hay TKL. Bên cạnh đó, ở thời
điểm 15:00 giờ tần số hô hấp giảm và nhiệt độ
trực tràng tăng khi dê sử dụng nước muối có
nồng độ cao (1,5%).
LỜI CÁM ƠN
Nghiên cứu này được tài trợ từ nguồn kinh phí
của Bộ Giáo dục và Đào tạo, Mã số B2020-TCT-08.
TÀI LIỆU THAM KHẢO
1. Abou Hussien E.R.M., Gihad E.A., El-Dedawy T.M.
and Abdel Gawad M.H. (1994). Response of camels,
sheep and goats to saline water. 2. Water and mineral
metabolism. Egypt. J. Anim. Pro., 31: 387-01.
2. Al-Ramamneh D., Riek A. and Gerken M. (2012). Effect
of water restriction on drinking behaviour and water
intake in German black-head mutton sheep and Boer
goats. Anim. Sci., 6(1): 173-78.
3. Assad F. and El-Sherif M.M.A. (2002). Effect of drinking
saline water and feed shortage on adaptive responses of
sheep and camels. Small Rumin. Res. Sci., 45(3): 279-90.
4. Association of Official Analytical Chemists – A.O.A.C.
(1990). Official methods of analysis of the Association of
Official Agricultural Chemists. Was., D.C., USA.
5. Attia-Ismail S.A., Abdo A.R. and Asker A.R.T. (2008).
Effect of salinity level in drinking water on feed intake,
nutrient utilization, water intake and turnover and
rumen function in sheep and goats. Egyt. J. Sci., 1: 1-11.
6. Bell F.R. (1959). Preference thresholds for taste
discrimination in goats. J. Agr. Sci., 52: 125-28.
7. Blache D., Grandison M.J., Masters D.G., Dynes R.A.,
Blackberry M.A. and Martin G.B. (2007). Relationships
between metabolic endocrine systems and voluntary
feed intake in Merino sheep fed a high salt diet. J. Agr.
Sci., 47(5): 544-50.
8. Cardoso E.D.A., Furtado D.A., Ribeiro N.L., Saraiva E.P.,
Nascimento J.W.B., Medeiros A.N. and Pereira P.H.B.
(2021). Intake salinity water by creole goats in a controlled
environment: ingestive behavior and physiological
variables. Trop. Anim. Health Prod., 53(3): 1-7.
9. Costa R.G., Freire R.M.B., Araújo G.G.L., Queiroga
R.D.C.R.D.E., Paiva G.N., Ribeiro N.L. and Lorenzo
J.M. (2021). Effect of Increased Salt Water Intake on the
Production and Composition of Dairy Goat Milk. Anim.
Sci., 11(9): 2642.
10. Đinh Văn Bình (2006). Đánh giá đàn dê đực gồm 3 giống
Boer, Alpine và Saanen nhập về từ Mỹ qua 4 năm nuôi tại
Việt Nam thông qua khả năng sản xuất đời con. Báo cáo
khoa học Viện Chăn nuôi, Hà Nội.
11. Dunson W.A. (1974). Some aspects of salt and water
balance of feral goats from arid islands. Am. J. Phys.,
226(3): 662-69.
KHKT Chăn nuôi số 274 - tháng 2 năm 2022
12. Fedele V., Claps S., Rubino R., Calandrelli M., Pilla
A.M. (2002). Effect of free-choice and traditional feeding
systems on goat feeding behaviour and intake. Liv. Pro.
Sci., 74(1): 19-31.
13. Goatcher, W. D., & Church, D. C. (1970a). Taste responses
in ruminants. I. Reactions of sheep to sugars, saccharin,
ethanol and salts. J. Anim. Sci., 30(5): 777-83.
14. Hallegatte S., Green C., Nicholls R.J. and Corfee-Morlot
J. (2013). Future flood losses in major coastal cities. J.
Nature climate change. Sci., 3(9): 802-06.
15. Macfarlane W.V. (1982). Concepts in animal adaptation.
Proceedings of the 3rd International Conference on Goat
Production and Disease: Dairy Goat Publishing Co., pp:
375-85.
16. Mdletshe Z.M., Chimonyo M., Marufu M.C. and
Nsahlai I.V. (2017). Effects of saline water consumption
on physiological responses in Nguni goats. Small Rumin.
Res., 153: 209-11.
17. Mohammed S.A.A. (2008). Effects of salinity of drinking
water, state of hydration, dietary protein level and
unilateral nephrectomy on blood constituents and renal
function in Nubian goats. PhD thesis, Uni. of Khartoum.
Khartoum.
18. National Research Council – NRC. (2005). Mineral
tolerance of animals. The Second Revised Edition. Was.,
D.C., USA.
19. Patterson H.H., Johnson P.S., Epperson W.B. and Haigh
R.D. (2004). Effect of total dissolved solids and sulfates
in drinking water for growing steers. South Dakota State
University Beef Report. Rep. Anim. Sci., 5: 27-30.
20. Rossi R., Del Prete E., Rokitzky J. and Scharrer E.
(1998). Effects of a high NaCl diet on eating and drinking
patterns in pygmy goats. J. Phys & Behavior. Sci., 63(4):
601-04.
21. Runa R.A., Brinkmann L., Gerken M. and Riek A. (2019).
Adaptation capacity of Boer goats to saline drinking
water. An Int. J. Anim. BioSci., 13: 2268-76.
22. Runa R.A., Brinkmann L., Riek A., Hummel J. and
Gerken M. (2019). Reactions to saline drinking water in
Boer goats in a free-choice system. An Int. J. Anim., 13(1):
98-05.
23. Suttle N.F. (2010). Mineral nutrition of livestock. Cabi.4th
Edition: Pp. 17-26.
24. Swenson M. and Reece W.O. (1996). Dukes Fisiologia
dos Animais Domésticos. Rio de Janeiro, RJ. Editora:
Guanabara Koogan. J. Cap., 29: 451-57.
25. Van Soest P.V., Robertson J.B. and Lewis B. (1991).
Methods for dietary fiber, neutral detergent fiber,
and nonstarch polysaccharides in relation to animal
nutrition. J. Dai. Sci., 74(10): 3583-97.
26. Yirga H., Puchala R., Tsukahara Y., Tesfai K., Sahlu T.,
Mengistu U.L. and Goetsch A.L. (2018). Effects of level
of brackish water and salinity on feed intake, digestion,
heat energy, ruminal fluid characteristics, and blood
constituent levels in growing Boer goat wethers and
mature Boer goat and Katahdin sheep wethers. J. Small
Rum. Res., 164: 70-81.
27. Yousfi I., Ben Salem H., Aouadi D. and Abidi S. (2016).
Effffect of sodiuim chloride, sodium sulfate or sodium
nitrite in drinking water on intake, digestion, growth
rate, carcass traits and meat quality of Barbarine lamb. J.
Small Rum. Res. 143: 43-52.
75
Tạp chí Khoa học Trường Đại học Cần Thơ Tập 58, Số Chuyên đề SDMD (2022): 48-55

DOI:10.22144/ctu.jvn.2022.191
ẢNH HƯỞNG CỦA NƯỚC MUỐI LÊN KHẢ NĂNG TĂNG TRỌNG VÀ NĂNG
SUẤT SỮA CỦA DÊ
Nguyễn Thiết1*, Trương Văn Khang1, Nguyễn Trọng Ngữ2 và Sumpun Thammacharoen3
1
Khoa Phát triển Nông thôn, Trường Đại học Cần Thơ
2
Khoa Nông nghiệp, Trường Đại học Cần Thơ
3
Khoa Thú y, Trường Đại học Chulalongkorn, Thái Lan
*Người chịu trách nhiệm về bài viết: Nguyễn Thiết (email: nthiet@ctu.edu.vn)
ABSTRACT
Thông tin chung:
The objective of the experiment was to evaluate the effect of salinity in drinking water
Ngày nhận bài: 30/08/2022
on the weight gain and milk yield of goats. The experiment was arranged in a
Ngày nhận bài sửa: 18/09/2022
completely randomized design with 04 treatments (NT) and 05 replicates on 20 Boer
Ngày duyệt đăng: 17/10/2022
crossbred goats (experiment 1) and 20 Saanen crossbred goats (experiment 2)
including freshwater (control), three saline water treatments from diluted seawater
Title: concentrations: 0.50%; 1.00%, and 1.50% (NT5, NT10, and NT15 respectively). The
The effect of salinity in results from experiment 1 showed that dry matter intake (DMI) decreased and water
drinking water on weight gain intake (WI) increased with increasing salinity in drinking water. Body weight, weight
and milk production in goats gain, respiratory rate and rectal temperature did not differ among treatments
(P>0.05). However, goats in NT15 at 15:00 decreased respiratory rate and increased
Từ khóa: rectal temperature compared with control group. The results from experiment 2
Dê, đáp ứng sinh lý, năng suất showed that DMI, body weight and milk yield were not different among treatments
sữa, nước biển pha loãng, (P>0.05). WI increased when dairy goats drank saline water with concentrations of
tăng trọng 0.5% and 1%, but at 1.5% concentration WI decreased as compared with NT5 and
NT10 groups (P<0.05). Dairy goats in NT15 increased rectal temperature and
Keywords: respiratory rate at 15:00 - 17:00 compared with other treatments (P<0.05). The
Diluted seawater, goats, milk results from present experiment show that the responsiveness to salinity in drinking
yield, physiological responses, water is different between meat and dairy goats.
weight gain TÓM TẮT
Mục tiêu của thí nghiệm là đánh giá ảnh hưởng của nước muối lên khả năng tăng
trọng và năng suất sữa của dê. Thí nghiệm được bố trí hoàn toàn ngẫu nhiên với 04
nghiệm thức (NT) và 05 lần lập lại trên 20 dê thịt lai Boer (thí nghiệm 1) và 20 dê sữa
lai Saanen (thí nghiệm 2) gồm: NT đối chứng (ĐC, nước ngọt), 3 nghiệm thức nước
mặn là các nồng độ nước biển pha loãng: 0,50; 1,00 và 1,50% (NT5, NT10 và NT15).
Kết quả thí nghiệm 1 cho thấy lượng thức ăn tiêu thụ (DMI) giảm và lượng nước uống
(WI) tăng dần khi tăng dần nồng độ muối trong nước uống. Trọng lượng, tăng trọng,
tần số hô hấp và nhiệt độ trực tràng của dê không có sự khác biệt giữa các nghiệm
thức (P>0,05). Tuy nhiên, ở thời điểm 15:00 giờ, dê ở NT15 giảm tần số hô hấp và
tăng nhiệt độ trực tràng so với NT ĐC. Kết quả thí nghiệm 2 cho thấy DMI, trọng
lượng, năng suất sữa không khác biệt giữa các NT (P>0,05). WI của dê tăng khi uống
nước muối có nồng độ 0,.5% và 1%, nhưng ở nồng độ 1,5% thì WI giảm so với nhóm
NT5 và NT10 (P<0,05). Dê ở NT15 tăng nhiệt độ trực tràng và tần số hô hấp ở thời
điểm 15:00 – 17:00 giờ so với các NT của thí nghiệm (P<0,05). Kết quả thí nghiệm
cho thấy khả năng đáp ứng với nước muối khác nhau giữa dê thịt và dê sữa.

48
Tạp chí Khoa học Trường Đại học Cần Thơ
1. GIỚI THIỆU
Theo những nghiên cứu gần đây, Việt Nam được
xếp vào nhóm các quốc gia thiếu nước với tổng bình
quân đầu người cả nước mặt và nước ngầm trên
phạm vi lãnh thổ là 4.400 m3/người/năm (so với
bình quân thế giới là 7.400 m3/người/, năm). Theo
tính toán, nếu mực nước biển Việt Nam dâng 1 m
thì 39% diện tích Đồng bằng Sông Cửu Long
(ĐBSCL) có nguy cơ bị ngập mặn. Tại một số tỉnh
ĐBSCL trong năm 2016, độ mặn đo được tại một số
địa phương từ 6‰ đến 15‰. Hiện tượng xâm nhập
mặn khiến tài nguyên nước ngọt khan hiếm, không
đủ để cung cấp cho con người và vật nuôi, quá trình
chăn nuôi sẽ gặp nhiều khó khăn. Việc xâm nhập
mặn do biến đổi khí hậu (BĐKH) gây ra không chỉ
làm cho nguồn nước ngọt khan hiếm mà còn có
khuynh hướng làm giảm chất lượng nước do nước
bị nhiễm mặn, nhiễm phèn quá cao. Khi đó gia súc,
gia cầm sử dụng các nguồn nước ô nhiễm, không đạt
tiêu chuẩn này làm phát sinh thêm nhiều bệnh tật,
ảnh hưởng đến sức khỏe vật nuôi. Vì vậy, cần phải
có một số giải pháp trong chăn nuôi để thích ứng với
biến đổi khí hậu ở vùng ĐBSCL. Để phát triển
ngành chăn nuôi vùng ĐBSCL theo hướng bền
vững, cần có những giải pháp để ngành chăn nuôi
thích ứng với tình hình BĐKH hiện nay như: tổ chức
lại cơ cấu giống vật nuôi, thay đổi phương thức chăn
nuôi, chọn tạo các giống cỏ chịu hạn, mặn. Dê có
khối lượng nhỏ, nhu cầu thức ăn ít nên không đòi
hỏi diện tích chuồng trại và đồng cỏ lớn so với trâu
bò. Thêm vào đó khả năng chống chịu với điều kiện
nắng nóng (HTa) của dê tốt hơn so với trâu, bò
(Silanikove, 2000). Vì vậy, dê có thể được xem là
vật nuôi thích hợp trong điều kiện biến đổi khí hậu
hiện nay tại Việt Nam. Các nghiên cứu trước đây đã
chỉ ra rằng dê có khả năng sử dụng nước uống có độ
mặn khác nhau, cũng như sự đáp ứng với khả năng
chịu mặn khác nhau giữa dê thịt và dê sữa (El
Gawad, 1997; Mdletshe et al., 2017). Dê có thể chấp
nhận 1,5% NaCl trong nước uống (Nassar and
Moussa, 1981), trong khi dê Boer không uống nước
mặn từ 1,25 đến 1,5% NaCl và có độ nhạy cao hơn
đối với việc uống nước muối trong thời gian dài
(Runa et. al., 2016). Abou Hussien et al. (1994) nhận
ra rằng cừu và dê uống nước muối đã kiểm soát sự
thải muối bằng cách bài tiết nhiều qua nước tiểu và
tăng tỷ lệ lọc ở cầu thận, trong khi lạc đà uống nước
muối ít để giảm stress muối. Có thể nhận thấy rằng
dê có thể chấp nhận nước uống có nồng độ muối
1,5%, tuy nhiên nếu sử dụng trong thời gian dài sẽ
ảnh hưởng đến năng suất và những thay đổi sinh lý
của dê.
49
Tập 58, Số Chuyên đề SDMD (2022): 48-55
Tại ĐBSCL, các tỉnh có số lượng đàn dê lớn là
các tỉnh ven biển như Bến Tre, Tiền Giang và Trà
Vinh. Hàng năm, các tỉnh này chịu ảnh hưởng nặng
nề của xâm ngập mặn trong những tháng mùa khô
và cũng ảnh hưởng rất lớn đến đàn gia súc đang nuôi
tại đây. Tuy nhiên, cho đến nay tại Việt Nam nói
chung và khu vực ĐBSCL nói riêng chưa có các
nghiên cứu cơ bản, có hệ thống nào để đánh giá khả
năng chịu mặn của dê thịt và dê sữa trong điều kiện
khí hậu nhiệt đới. Xuất phát từ những vấn đề trên,
đề tài “Ảnh hưởng của nước muối lên khả năng tăng
trọng và năng suất sữa của dê” được thực hiện là cần
thiết. Mục tiêu của nghiên cứu là đánh giá ảnh
hưởng của các mức độ mặn trong nước uống lên sự
đáp ứng sinh lý, khả năng tăng trọng và năng suất
sữa dê.
2. VẬT LIỆU VÀ PHƯƠNG PHÁP
NGHIÊN CỨU
2.1. Thời gian và địa điểm nghiên cứu
Thí nghiệm được thực hiện từ tháng 03 năm
2020 đến tháng 6 năm 2021 tại trại Chăn nuôi Thực
nghiệm, Khoa Phát triển Nông thôn, Trường Đại học
Cần Thơ.
2.2. Phương pháp nghiên cứu
2.2.1. Thí nghiệm 1: Ảnh hưởng của các mức độ
mặn trong nước uống lên khả năng tăng
trọng và những thay đổi sinh lý của dê thịt
dưới điều kiện nhiệt đới
Bố trí thí nghiệm
Thí nghiệm được bố trí hoàn toàn ngẫu nhiên với
4 nghiệm thức và 5 lần lập lại, tổng cộng là 20 đơn
vị thí nghiệm là 20 dê đực Boer lai (khoảng 08 tháng
tuổi). Các nghiệm thức tương ứng với các nồng độ
muối khác nhau gồm: nghiệm thức đối chứng (ĐC,
nước ngọt), nghiệm thức có nồng độ muối 0,50%
(NT5, 5‰), nghiệm thức có nồng độ muối 1,00%
(NT10, 10‰), nghiệm thức có nồng độ muối 1,50%
(NT15, 15‰). Thí nghiệm gồm 10 ngày nuôi thích
nghi và 56 ngày thu thập số liệu. Thí nghiệm sử dụng
nước biển pha với nước ngọt để đạt được các nồng
độ muối ở các nghiệm thức có nồng độ muối là
0,50%, 1,00% và 1,50%. Tất cả động vật thí nghiệm
được ăn khẩu phần trộn hoàn chỉnh (TMR) giống
nhau bao gồm 70% bắp ủ chua và 30% thức ăn hỗn
hợp (cám gạo tươi, bột bắp, khô dầu đậu nành, rỉ mật
đường và bột đá mịnh) với CP của TMR là 16,20%.
Dê được cho ăn hai lần/ngày vào lúc 07 giờ sáng và
16 giờ chiều và được uống nước tự do.
Thu thập số liệu và đo lường các chỉ tiêu thí
nghiệm
Tạp chí Khoa học Trường Đại học Cần Thơ
Tất cả số liệu thức ăn, nước uống và thức ăn thừa
sẽ được ghi nhận hàng ngày, mẫu thức ăn và thức ăn
thừa sẽ được lấy một lần/tuần trong suốt quá trình
thí nghiệm. Vào cuối thí nghiệm, các mẫu thức ăn
và thức ăn thừa sẽ được trộn lại và đem đi phân tích
các chỉ tiêu DM, OM và CP theo phương pháp của
AOAC (1990) và NDF, ADF theo phương pháp của
Van Soet et al. (1991). Thành phần hóa học của thức
ăn thí nghiệm được trình bày tương tự như báo cáo
của Thiet et al. (2022a). Dê được cân trọng lượng ở
thời điểm bắt đầu thí nghiệm và mỗi tuần, vào buổi
sáng trước khi cho ăn. Tăng trọng của dê = (trọng
lượng cuối TN – trọng lượng đầu TN) / số ngày TN.
Nhiệt độ và ẩm độ chuồng nuôi được ghi nhận
vào mỗi tuần của thí nghiệm, vào mỗi hai giờ từ 7
sáng đến 19 giờ tối, và bằng thiết bị đo nhiệt độ, ẩm
độ của Đài Loan (Thermohygrometer, Sato,
Taiwan). Sau đó, dựa trên kết quả của nhiệt độ và
ẩm độ sẽ tính được chỉ số nhiệt độ ẩm độ (THI) theo
công thức sau:
THI = (1.8 x Tdb + 32) – ((0.55 – 0.0055) x RH
x (1.8 x Tdb – 26.8))
Trong đó: Tdb là nhiệt độ không khí 0C; RH: là
độ ẩm tuyệt đối không khí (%)
Nhiệt độ trực tràng được đo bằng nhiệt kế tự
động (digital clinical thermometer C202, Terumo,
Tokyo, Japan). Tần số hô hấp được đo bằng cách
đếm sự chuyển động lên xuống của sườn bụng tương
ứng với một lần thở. Nhiệt độ trực tràng và tần số hô
hấp sẽ được đo vào mỗi hai giờ từ 7 sáng đến 19 giờ
tối và mỗi tuần của thí nghiệm.
Nước uống dùng trong thí nghiệm
Nước uống dùng cho dê trong thí nghiệm là gồm
có nước ngọt (nước sinh hoạt) và nước mặn có nồng
độ 0,50%, 1,00%, 1,50% được pha từ nước biển cô
đặc (nước ót với nồng độ muối là 9,8%) với nước
ngọt theo công thức sau: C1 x V1 = C2 x V2 và được
đo kiểm tra bằng khúc xạ kế đo độ mặn ATAGO
Master-S/MillM Salinity 0~100‰ với độ chính xác
±2,00‰. Nước ngọt cho dê uống trong thí nghiệm
được lấy từ nguồn nước sinh hoạt là nguồn nước
sạch không màu, không mùi và không gây ảnh
hưởng đến sức khỏe của dàn dê. Mẫu nước sau khi
được đo bằng máy được đem đi phân tích tại Bộ môn
Khoa học Đất, Khoa Nông nghiệp, Trường Đại học
Cần Thơ. Thành phần hóa học của nước uống dùng
cho dê thí nghiệm được trình bày tương tự như báo
cáo của Thiet et al. (2022a).
Lượng nước uống hàng ngày (g/con/ngày) =
lượng nước cho dê uống – lượng nước thừa. Sau đó
50
Tập 58, Số Chuyên đề SDMD (2022): 48-55
sẽ tính toán lượng nước uống (g/kgBW/ngày) =
Lượng nước uống hàng ngày (g/con/ngày)/trọng
lượng của dê TN.
2.2.2. Thí nghiệm 2: Đánh giá ảnh hưởng của
các mức độ mặn trong nước uống lên
năng suất sữa và những thay đổi sinh lý
của dê sữa
Bố trí thí nghiệm
Thí nghiệm được bố trí khối hoàn toàn ngẫu
nhiên với 4 nghiệm thức và 5 lần lập lại, tổng cộng
là 20 đơn vị thí nghiệm là 20 dê cái Saanen lai. Các
nghiệm thức của thí nghiệm là các nồng độ muối
khác nhau như sau: nghiệm thức đối chứng (NT1,
nước ngọt), nghiệm thức có nồng độ muối 0,50%
(NT2, 5‰), nghiệm thức có nồng độ muối 1,00%
(NT3, 10‰), nghiệm thức có nồng độ muối 1,50%
(NT4, 15‰). Thí nghiệm được thực hiện trong 49
ngày gồm 7 ngày nuôi thích nghi và 42 ngày thu thập
số liệu. Thí nghiệm sử dụng nước biển cô đặc pha
với nước ngọt để đạt được các nồng độ muối ở các
nghiệm thức là 0,50%, 1,00% và 1,50%. Tất cả dê
nuôi thí nghiệm được ăn khẩu phần giống nhau theo
quy trình nuôi của trang trại bao gồm 0,5 kg thức ăn
hỗn hợp, 0,5 kg TMR vào buổi sáng và cho ăn cỏ tự
do vào buổi chiều. Dê được cho ăn 2 lần/ngày vào
lúc 7 giờ sáng và 16 giờ chiều và được uống nước
tự do, dê được vắt sữa vào 13 giờ trước khi cho ăn,
và được cân riêng cho mỗi dê để tính năng suất
sữa/dê/ngày.
Thu thập số liệu và đo lường các chỉ tiêu thí
nghiệm
Tất cả số liệu thức ăn, nước uống và thức ăn thừa
sẽ được ghi nhận hàng ngày, mẫu cỏ và thức ăn hỗn
hợp thừa sẽ được lấy một lần/tuần trong suốt quá
trình thí nghiệm. Dê được cân trọng lượng ở thời
điểm bắt đầu thí nghiệm và mỗi tuần, vào buổi sáng
trước khi cho ăn.
Phân tích thành phần hóa học của thức ăn, thức
ăn thừa; ghi nhận nhiệt độ, ẩm độ chuồng nuôi và
nhiệt độ trực tràng, tần số hô hấp tương tự như Thí
nghiệm 1. Thành phần hóa học của thức ăn thí
nghiệm được trình bày tương tự như báo cáo của
Thiet et al. (2022b).
2.3. Xử lý số liệu
Số liệu thí nghiệm được xử lý sơ bộ trên phần
mềm Excel. Các số liệu được phân tích phương sai
theo mô hình tuyến tính tổng quát (GLM) của
chương trình Minitab 16. So sánh sự khác biệt giữa
các trung bình nghiệm thức bằng phép thử Tukey.
Sự khác biệt có ý nghĩa thống kê khi P<0,05.
Tạp chí Khoa học Trường Đại học Cần Thơ Tập 58, Số Chuyên đề SDMD (2022): 48-55

3. KẾT QUẢ VÀ THẢO LUẬN lượng thức ăn trung bình hàng ngày của dê giảm (P
3.1. Kết quả nhiệt độ, ẩm độ và THI trong thí <0,05) khi tăng độ mặn trong nước từ 0 đến 11 g
nghiệm TDS/L. Tuy nhiên, một số kết quả nghiên cứu trước
đó cho thấy nước mặn không ảnh hưởng lên lượng
Bảng 1. Nhiệt độ, ẩm độ, THI trong quá trình tiêu thụ thức ăn của dê (Tsukahara et al., 2016), cừu
thực hiện thí nghiệm (Yousfi et al., 2017), hay trên hươu (Kii & Dryden,
Nhiệt độ Ẩm độ 2005). Do đó, nếu cung cấp nước có hàm lượng
Giờ THI muối thấp dê có thể chấp nhận, nhưng tăng hàm
(oC) (%)
7:00 26,00±1,00 75,50±1,50 76,09±1,39 lượng muối cao thì lượng thức ăn ăn vào của dê sẽ
9:00 28,00±1,00 71,50±3,50 78,67±1,06 bị ảnh hưởng nhiều, vì độ mặn trong nước sẽ làm
11:00 30,25±0,25 62,50±2,50 80,75±0,74 giảm sự thèm ăn cũng như việc sử dụng thức ăn ở
13:00 31,50±0,50 55,00±1,00 81,30±0,84 động vật. Yira et al. (2018) cho rằng việc tăng nồng
15:00 32,00±1,00 65,50±2,50 83,78±1,88 độ muối trong nước uống sẽ làm giảm lượng thức ăn
17:00 29,25±0,25 70,00±2,00 80,39±0,66 tiêu thụ và khả năng tiêu hóa của dê, việc chuyển
19:00 27,50±0,50 73,50±1,50 78,20±0,96 hóa năng lượng cũng bị ảnh hưởng. Kết quả thí
nghiệm cho thấy nếu cung cấp nước có hàm lượng
THI: Temperature Humidity Index (chỉ số nhiệt độ độ
ẩm) muối 0,50 – 1,00% dê thịt có thể chấp nhận, nhưng
tăng hàm lượng muối lên 1,50%, dê thịt giảm lượng
Kết quả được trình bày Bảng 1 cho thấy nhiệt độ thức ăn ăn vào. Việc thích nghi từng bước với nước
tăng dần từ 7:00 giờ đến 13:00 giờ sau đó giảm dần, mặn ở dê là một phương pháp hiệu quả để tạo môi
còn độ ẩm thì ngược lại do khi nhiệt độ môi trường trường cho vật nuôi tiếp xúc với nước mặn khi nồng
tăng lên thì độ ẩm sẽ giảm xuống. Chỉ số nhiệt độ độ dưới 1,50%. Dê phản ứng nhạy cảm hơn với độ
độ ẩm (THI) ở khoảng 76,09 – 83,78. Khi THI < 82, mặn của nước uống sau khi tiếp xúc lâu với nước
dê và cừu không bị stress nhiệt; từ 82 – 84 dê và cừu mặn cho thấy cơ chế điều chỉnh linh hoạt tùy thuộc
bị stress nhiệt nhẹ; từ 84 – 86 dê và cừu bị stress vào tổng cân bằng natri của động vật.
nhiệt nặng và > 86 dê và cừu bị stress nhiệt nghiêm
trọng (Livestock and Poultry Heat Stress Indices Lượng nước uống của dê thịt tăng dần khi dê
[LPHSI], 1990). Theo báo cáo của West (1994), chỉ uống nước muối có nồng độ tăng dần (Bảng 2;
số THI ở bò với giá trị tương đương 70 hoặc nhỏ P<0,05), đặc biệt giữa NT10 và NT15 so với NT5
hơn bò không bị stress nhiệt, lớn hơn 70 bò bị stress và ĐC. Nguyên nhân của sự sai khác này là do khi
nhiệt và THI trên 80 bò bị stress nhiệt nghiêm trọng. tiêu thụ với lượng muối cao gây ra hai phản ứng cân
Tóm lại, ở động vật nhai lại dê và cừu có khả năng bằng nội môi là sự gia tăng lượng nước đưa vào và
chịu được stress nhiệt tốt hơn so với bò (Silanikove, một phản ứng tương tự trong quá trình bài tiết muối
2000). qua nước tiểu (National Research Council, 2005).
Trong khi đó, ở dê sữa lượng nước uống tăng dần
3.2. Ảnh hưởng của các mức độ mặn trong khi nước muối có nồng độ từ 0 – 1%, và giảm ở nồng
nước uống lên lượng thức ăn và nước độ muối 1,50% (Bảng 2; P<0,01). Theo Mdletshe
uống của dê thịt và dê sữa (2017), dê phản ứng thích nghi với lượng nước mặn
Lượng thức ăn của dê thịt giảm dần khi dê uống (có nồng độ muối cao) bằng cách giảm lượng nước
nước muối có nồng độ tăng dần (P<0,05), đặc biệt mặn đưa vào cơ thể để giảm tác động không tốt của
giữa NT15 (17,50 g VCK/kg BW/ngày) dê tiêu thụ muối đối với tế bào (gây gia tăng áp suất thẩm thấu
lượng thức ăn thấp hơn so với NT ĐC (20,10 g huyết tương do tế bào mất nước đặc biệt là tế bào
VCK/kg BW/ngày). Ngược lại, lượng thức ăn của huyết tương). Tương tự, Eltayeb (2006) cho rằng
dê sữa không có sự khác biệt thống kê giữa các NT lượng nước uống vào đã tăng lên (P<0,05) ở dê
(Bảng 2; P>0,05). Theo báo cáo của Abous Husien Nubian uống nước mặn chứa 0,80 và 1,60% NaCl
et al. (1994), lượng nước uống vào có nồng độ dưới so với nhóm uống nước ngọt, nhưng khi sử dụng
1,00% không ảnh hưởng đến lượng ăn vào của dê, NaCl ở mức 2,00% thì lượng nước uống vào lại
nhưng nếu tăng nồng độ muối lên đến 1,70% sẽ làm giảm (P<0,05) so với nhóm nước ngọt.
giảm lượng ăn vào. Theo Mdletshe et al. (2017),

51
Tạp chí Khoa học Trường Đại học Cần Thơ Tập 58, Số Chuyên đề SDMD (2022): 48-55

Bảng 2. Ảnh hưởng của các mức độ mặn trong nước uống lên lượng thức ăn và nước uống của dê thịt
và dê sữa (g/kg BW/ngày)
Nghiệm thức
Chỉ tiêu SE P
ĐC NT5 NT10 NT15
Lượng TĂ (dê thịt) 20,40a 19,80ab 18,20ab 17,50b 0,61 0,01
Lượng TĂ (dê sữa) 32,54 32,12 33,92 33,61 2,20 0,93
Lượng nước uống (dê thịt) 9,64b 10,60b 20,70a 22,80a 1,04 0,001
Lượng nước uống (dê sữa) 84,68b 91,90ab 138,56a 65,40b 13,26 0,01
ĐC: Nghiệm thức đối chứng; Nghiệm thức NT5: Nồng độ độ muối 0,50%; Nghiệm thức NT10: Nồng độ muối 1,00%;
Nghiệm thức NT15: Nồng độ muối 1,50%
Các giá trị trung bình trong cùng một hàng có chữ cái khác nhau thì khác biệt có ý nghĩa thống kê (P<0,05).

3.3. Ảnh hưởng của các mức độ mặn trong
nước uống lên tần số hô hấp của dê thịt
và dê sữa
Tần số hô hấp của dê thịt khác biệt không có ý
nghĩa giữa các nghiệm thức ở hầu hết các thời điểm
trong ngày (Bảng 3; P>0,.05). Eltayeb (2006) cho dê
uống nước ở nồng độ 0,80% đến 1,60% NaCl trong
16 ngày, cho rằng tần số hô hấp không có sự chênh
lệch lớn giữa nhóm uống nước muối và nhóm đối
chứng. Tần số hô hấp của cả hai nhóm đều cao hơn
khi đo vào buổi chiều. Tương tự, Cardoso et al.
(2021) cho rằng dê uống nước mặn với nồng độ từ
0,10 – 1,20% không ảnh hưởng đến tần số hô hấp
của dê. Ở thời điểm 15:00, tần số hô hấp của dê thịt
giảm dần khi nồng độ mặn trong nước uống tăng dần
(Bảng 3; P<0,01). Kết quả này tương tự so với báo
cáo của Mdletshe et al. (2017), khi cho rằng dê uống
nước muối với nồng độ từ 0,50% đến 1,10% trong
thời gian 4 tuần đã làm giảm tần số hô hấp. Tuy
nhiên, thí nghiệm hiện tại cho thấy dê sữa mẫn cảm
với nước mặn hơn so với dê thịt do tần số hô hấp
tăng khi nồng độ muối trong nước uống tăng, đặc
biệt là ở thời điểm đầu buổi sáng hoặc từ 13:00 đến
17:00 (Bảng 3; P<0,05). Kết quả của thí nghiệm trên
dê sữa khác so với trên dê thịt có thể do nhu cầu về
nước uống của dê sữa cao hơn so với dê thịt, do đó
tác động của nước nhiễm mặn sẽ ảnh hưởng nhiều
hơn nên sẽ tác động đến tần số hô hấp cũng sẽ khác
nhau.

Bảng 3. Ảnh hưởng của các mức độ mặn trong nước uống lên tần số hô hấp của dê thịt và dê sữa
(nhịp/phút)
Nghiệm thức
Chỉ tiêu Giờ SE P
ĐC NT5 NT10 NT15
07:00 21,70 19,70 22,50 19,40 1,20 0,25
09:00 22,50 25,10 24,30 20,50 1,39 0,15
11:00 23,00 23,10 22,30 21,70 1,15 0,80
Dê thịt 13:00 26,30 25,80 27,00 25,50 1,14 0,80
15:00 25,80a 26,60a 24,30ab 23,30b 0,67 0,01
17:00 26,60 25,90 26,90 22,80 1,37 0,17
19:00 20,30 20,80 22,50 21,80 0,68 0,16
07:00 42,20b 40,20b 30,00b 69,10a 5,05 0,001
09:00 37,60 50,40 62,60 55,80 7,42 0,15
11:00 41,60 51,60 51,40 61,40 7,53 0,36
Dê sữa 13:00 41,90 53,60 50,02 62,50 4,97 0,06
15:00 46,10 49,60 53,20 68,70 6,20 0,09
17:00 53,60b 51,00b 68,60ab 74,20b 4,80 0,01
19:00 56,70 53,20 60,40 72,70 6,61 0,22
ĐC: Nghiệm thức đối chứng; Nghiệm thức NT5: Nồng độ độ muối 0,50%; Nghiệm thức NT10: Nồng độ muối 1,00%;
Nghiệm thức NT15: Nồng độ muối 1,50%
Các giá trị trung bình trong cùng một hàng có chữ cái khác nhau thì khác biệt có ý nghĩa thống kê (P<0,05).

52
Tạp chí Khoa học Trường Đại học Cần Thơ Tập 58, Số Chuyên đề SDMD (2022): 48-55

3.4. Ảnh hưởng của các mức độ mặn trong
nước uống lên nhiệt độ trực tràng của dê
thịt và dê sữa
Tương tự tần số hô hấp, nhiệt độ trực tràng
(NĐTT) của dê thịt khi uống nước muối không khác
biệt ở hầu hết các thời điểm trong ngày, trừ thời
điểm 15:00 giờ NĐTT của dê thịt tăng dần khi dê
uống nước muối tăng dần. Kết quả này tương tự đối
với dê sữa ở thời điểm buổi sáng, tuy nhiên từ 15:00
Bảng 4. Ảnh hưởng của các mức độ mặn trong nước uống lên nhiệt độ trực tràng của dê thịt và dê sữa
(oC)
– 17:00 giờ NĐTT của dê sữa giữa các NT khác biệt
có ý nghĩa thống kê (Bảng 4; P<0,05). Kết quả
NĐTT của dê thịt tương đồng với báo cáo của
Cardoso et al. (2021), đã ghi nhận nhiệt độ trực tràng
không có sự khác biệt khi dê uống nước mặn 0,10%
(38,5oC) và 1,20% (38,7oC). Như vậy, dê có thể giữ
cho nhiệt độ cơ thể ổn định bằng cách giảm các hoạt
động, tăng lượng nước uống vào và tăng sự thất
thoát nhiệt do bay hơi thông qua tăng tần số hô hấp.

Nghiệm thức
Tuần Giờ SE P
ĐC NT5 NT10 NT15
07:00 38,70 38,60 38,70 38,60 0,08 0,36
09:00 39,20 39,10 39,10 38,90 0,11 0,22
11:00 39,00 39,20 39,00 39,00 0,07 0,33
Dê thịt 13:00 38,60 39,00 38,80 38,90 0,20 0,43
15:00 38,90b 39,10ab 38,90b 39,20a 0,06 0,01
17:00 39,20 39,30 39,00 39,10 0,09 0,23
19:00 39,10 39,10 39,00 39,00 0,07 0,31
07:00 39,10 38,98 39,08 39,02 0,14 0,93
09:00 39,22 39,22 39,38 38,90 0,17 0,26
11:00 39,22 38,94 39,46 39,10 0,15 0,13
Dê sữa 13:00 39,22 38,56 39,04 39,20 0,23 0,18
15:00 39,28ab 38,60b 38,94ab 39,58a 0,17 0,01
17:00 39,30a 38,76b 38,84b 39,48a 0,11 0,001
19:00 39,24 39,04 39,28 39,44 0,12 0,16
ĐC: Nghiệm thức đối chứng; Nghiệm thức NT5: Nồng độ độ muối 0,50%; Nghiệm thức NT10: Nồng độ muối 1,00%;
Nghiệm thức NT15: Nồng độ muối 1,50%
Các giá trị trung bình trong cùng một hàng có chữ cái khác nhau thì khác biệt có ý nghĩa thống kê (P<0,05).

3.5. Ảnh hưởng của các mức độ mặn trong Kết quả thí nghiệm cho thấy dê uống nước muối
nước uống lên trọng lượng, khả năng với nồng độ lên tới 1,50% trong 8 tuần không ảnh
tăng trọng và năng suất sữa của dê hưởng đến tăng trọng của dê (Bảng 5; P>0,05). Một
số nghiên cứu chỉ ra rằng tăng trọng của gia súc bị
Bảng 5 cho thấy trọng lượng của dê ở đầu và cuối
ảnh hưởng bởi độ mặn của nước uống. Patterson et
thí nghiệm không thấy sự khác biệt (P>0,05). Cụ
al. (2003) đã ghi nhận tăng trọng trung bình hàng
thể, trọng lượng của dê đầu thí nghiệm trung bình là
ngày giảm 27,00% khi nồng độ muối tăng từ 0,12%
37,7 kg/con và cuối thí nghiệm là 40,9 kg/con. Kết
lên 0,48%. Một số báo cáo trước đây cho thấy mức
quả nghiên cứu hiện tại tương tự với nghiên cứu của
tăng trọng trung bình hàng ngày của dê giảm khi
Runa et al. (2018), khi chỉ ra rằng những con dê
nồng độ muối trong nước uống tăng từ 0 lên 1,10%
Boer trưởng thành khi uống nước với nồng độ muối
NaCl (Mdletshe et al., 2017) hoặc dê lai uống nước
từ 0,75 đến 1,50% NaCl, trọng lượng cơ thể không
biển pha loãng với nồng độ 1,50% (Nguyen et al.,
bị ảnh hưởng giữa các nghiệm thức trong 4 tuần thí
2022). Kết quả về tăng trọng của thí nghiệm hiện tại
nghiệm. Zoidis and Hadjigeorgiou (2018) cũng
khác so với các nghiên cứu trước đây có thể do dê
nhận định trọng lượng cơ thể dê khi uống nước muối
thịt ở thí nghiệm này đã trưởng thành và vì vậy ít bị
có nồng độ từ 0,05; 0,50; 1,00 % NaCl không có sự
ảnh hưởng bởi nước uống nhiễm mặn, mặc dù lượng
khác biết (P=0,86), nhưng khi dê tiêu thụ liên tục
thực ăn giảm xuống. Runa et al. (2019) cho rằng dê
nước muối có nồng độ 2,00% trở lên làm giảm cảm
trong giai đoạn còn nhỏ (sinh trưởng) mẫn cảm hơn
giác thèm ăn, giảm lượng thức ăn, khả năng tiêu hóa
với nước muối so với giai đoạn trưởng thành.
dẫn đến trọng lượng cơ thể có xu hướng giảm.

53
Tạp chí Khoa học Trường Đại học Cần Thơ Tập 58, Số Chuyên đề SDMD (2022): 48-55

Bảng 5. Ảnh hưởng của các mức độ mặn trong nước uống lên trọng lượng, khả năng tăng trọng và năng
suất sữa của dê

Nghiệm thức
Chỉ tiêu SE P
ĐC NT5 NT10 NT15
Dê thịt
TL đầu TN (kg/con) 38,00 37,40 37,80 37,70 1,03 0,98
TL cuối TN (kg/con) 41,50 40,70 40,60 41,00 0,94 0,90
Tăng trọng (g/con/ngày) 62,50 58,30 50,60 58,30 4,98 0,43
Dê sữa
TL đầu TN (kg) 33,88 34,72 32,92 34,38 2,15 0,94
TL cuối TN (kg/con) 35,28 36,88 33,92 35,52 2,26 0,83
Năng suất sữa (kg/con/ngày) 0,55 0,60 0,69 0,52 0,08 0,49
Hiệu quả sử dụng TĂ (FE) 2,24 2,14 1,76 2,32 0,26 0,45
ĐC: Nghiệm thức đối chứng; Nghiệm thức NT5: Nồng độ độ muối 0,50%; Nghiệm thức NT10: Nồng độ muối 1,00%;
Nghiệm thức NT15: Nồng độ muối 1,50%

Trọng lượng, năng suất sữa và hiệu quả sử dụng
thức ăn của dê không có sự khác giữa các nghiệm
thức (Bảng 5; P>0,05). Kết quả về năng suất sữa
tương tự với nghiên cứu trước đây trên dê sữa (Paiva
et al., 2017).
4. KẾT LUẬN
Kết quả thí nghiệm trên dê thịt đã chỉ ra rằng dê
lai Boer có thể sử dụng nước muối với nồng độ 0,50
– 1,00%, ngược lại ở nồng độ nước muối 1,50% dê
giảm lượng tiêu thụ thức ăn. Trọng lượng, tăng
trọng, tần số hô hấp và nhiệt độ trực tràng của dê
không bị ảnh hưởng bởi nồng độ muối cao (1,50%)
trong nước uống.
Kết quả thí nghiệm trên dê sữa đã chỉ ra rằng
lượng thức ăn ăn vào, năng suất sữa không bị ảnh
hưởng bởi nước muối có nồng độ từ 0,50 – 1,50%.
Tuy nhiên, lượng nước uống vào tăng ở nồng độ
muối từ 0,5 – 1,0% và giảm ở nồng độ muối 1,5%.
Nhiệt độ trực tràng và tần số hô hấp của dê không
thay đổi ở nồng độ muối từ 0,00 – 1,00%, nhưng
tăng lên khi nước muối có nồng độ 1,50% và điều
này sẽ làm giảm khả năng điều hòa thân nhiệt của
dê sữa.
LỜI CẢM TẠ
Nghiên cứu này được tài trợ từ nguồn kinh phí
của Bộ Giáo dục và Đào tạo, Mã số B2020-TCT-08.

TÀI LIỆU THAM KHẢO

Abou Hussien, E. R. M., Gihad E. A., El-Dedawy, T.
M., & Abdel Gawad, M. H. (1994). Responses of
camels, sheep and goats on saline water. 2.
Water and mineral metabolism. Egyptian Journal
of Animal Production Suppl., 31, 387-401.
AOAC. (1990). Official methods of analysis of the
Association of Official Agricultural Chemists.
Was., D.C., USA.
Cardoso, E. D. A., Furtado, D. A., Ribeiro, N. L.,
Saraiva, E. P., do Nascimento, J. W. B., de
Medeiros, A. N., ... & Pereira, P. H. B. (2021).
Intake salinity water by creole goats in a
controlled environment: ingestive behavior and
physiological variables. Tropical Animal Health
and Production, 53(3), 1-7.
El-Gawad, E. I. (1997). Physiological responses of
Barki and Damascus goats and their crossbred to
drinking saline water. Alexandra Journal
Agricultural Research, 42(1), 23-36.
Eltayeb, E. E. (2006). Effect of salinity of drinking
water and dehydration on thermo regulation,
blood and urine composition in nubian goats. In:
M. Vet. Sc. Thesis Faculty of Veterinary
Medicine, University of Khartoum, Sudan.
Kii, W. Y., & Dryden, G. M. (2005). Effect of
drinking saline water on food and water intake,
food digestibility, and nitrogen and mineral
balances of rusa deer stags (Cervus timorensis
russa). Animal Science, 81(1), 99-105.
LPHSI. (1990). Livestock and Poultry Heat Stress
Indices. Agriculture Engineering Technology
Guide. Clemson University, Clemson, SC. USA.
Mdletshe, Z. M., Chimonyo, M., Marufu, M. C., &
Nsahlai, I. V. (2017). Effects of saline water
consumption on physiological responses in
Nguni goats. Small Ruminant Research, 153,
209-211.
Nassar, A. M., & Moussa, S. N. (1981).
Observations on behavioral responses of sheep

54
Tạp chí Khoa học Trường Đại học Cần Thơ
to water salinity. Faculty of Agriculture, Ain
Shams University, Res. Bull. 1488.
National Research Council. (2005). Mineral
tolerance of animals (2nd ed). Washington, DC.
Paiva, G. N., De Araújo, G. G. L., Henriques, L. T.,
Medeiros, A. N., Filho, E. M. B., Costa, R. G.,
De Albuquerque, Í. R. R., Gois, G. C., Campos,
F. S., & Freire, R. M. B. (2017). Water with
different salinity levels for lactating goats.
Semina: C iências Agrárias, L ondrina, 38,
2065–2074.
Patterson, H. H., Johnson, P. S., Young, D. B., &
Haigh, R. (2003). Effects of water quality on
performance and health of growing steers. Beef,
15, 101-104.
Runa, R. A., Riek, A., Brinkmann, L., & Gerken, M.
(2016). Adaptation of Boer goats to saline
drinking water. September 2016 in Hannover.
Runa, R. A., Brinkmann, L., Riek, A., Hummel, J., &
Gerken, M. (2018). Reactions to saline drinking
water in Boer goats in a free-choice
system. Animal, 13(1), 98-105.
Silanikove, N. (2000). The physiological basis of
adaptation in goats to harsh environments. Small
Ruminant Research, 35(3): 181-193.
Thiet, N., Khang, T. V., Hon, N. V., Ngu, N. T.,
Thammacharoen, S. (2022a). Effects of high
salinity in drinking water on behaviors, growth
and renal electrolyte excretion in crossbred Boer
goats under tropical conditions. Veterinary
World, 15, 834-840.
55
Tập 58, Số Chuyên đề SDMD (2022): 48-55
Thiet, N., Ngu, N. T., Nhan, N. T. H.,
Thammacharoen, S. (2022b) The effects of high
saline water on physiological responses, nutrient
digestibility and milk yield in lactating crossbred
goats. Livestock Research for Rural
Development, 34(37), 01-07.
Tsukahara, Y., Puchala, R., Sahlu, T., & Goetsch, A. L.
(2016). Effects of level of brackish water on feed
intake, digestion, heat energy, and blood constituents
of growing Boer and Spanish goat wethers. Journal
of animal science, 94(9), 3864-3874.
Van Soet, P. V., Robertson, J. B., & Lewis, B. A.
(1991). Methods for dietary fiber, neutral
detergent fiber, and nonstarch polysaccharides in
relation to animal nutrition. Journal of dairy
science, 74(10), 3583-3597.
West, J. W. (1994). Interactions of energy and
bovine somatotropin with heat stress. Journal of
Dairy Science, 77(7), 2091-2102.
Yousfi, I., & Salem, H. B. (2017). Effect of increasing
levels of sodium chloride in drinking water on
intake, digestion and blood metabolites in Barbarine
sheep. In Annales de l’INRAT, 90, 202-214.
Zoidis, E., & Hadjigeorgiou, I. (2018). Effects of
drinking saline water on food and water intake,
blood and urine electrolytes and biochemical and
haematological parameters in goats: a
preliminary study. Animal Production
Science, 58(10), 1822-1828.
Tạp chí Khoa học Trường Đại học Cần Thơ Tập 58, Số Chuyên đề SDMD (2022): 104-114

DOI:10.22144/ctu.jvn.2022.196

CRYOBANK: GIẢI PHÁP KHÔI PHỤC NHANH ĐÀN VẬT NUÔI SAU DỊCH BỆNH

Trần Thị Thanh Khương1*, Lâm Phước Thành2, Nguyễn Thị Kim Khang2, Nguyễn Trọng Ngữ2 và
Dương Nguyễn Duy Tuyền3
1
Viện Công nghệ Sinh học và Thực phẩm, Trường Đại học Cần Thơ
2
Bộ môn Chăn nuôi, Trường Nông nghiệp, Trường Đại học Cần Thơ
3
Đơn vị IVF hỗ trợ sinh sản, Bệnh viện Mỹ Đức
*Người chịu trách nhiệm về bài viết: Trần Thị Thanh Khương (email: tttkhuong@ctu.edu.vn)
ABSTRACT
Thông tin chung:
Ngày nhận bài: 12/09/2022 Cryobank or cryoconservation of animal genetic resources is the collection
Ngày nhận bài sửa: 30/09/2022 and deep-freezing of mamalian cells. One of the important steps in the
Ngày duyệt đăng: 17/10/2022 cryobank process is that the cell is isolated from animals that have been
screened for free of pathogens before kept at -196°C. Cryobank is
Title: considered one of the important solutions in the recovery of livestock herds
Cryobank: rapid re-herding after the epidemic, which is the rapid supply of breedings negative for
solutions for livestock after pathogens. Vietnam's livestock production is currently facing epidemics in
disease livestock and poultry. Consequently, there is an urgent demand for high-
yield, disease-free breedings. Cryobank along with techniques of
Từ khóa: reproductive biotechnology has been used for a very long period and
Cấy truyền phôi, con giống, frequently in industrialized countries to mass create disease-free animal
cryobank, gieo tinh nhân tạo, breeds with valuable genetic resources and speedy responses to the market.
tái đàn This overview will analyze the difficulties faced by Vietnam's livestock
business due to epidemics, introduce methods used globally by cryobank
Keywords: and reproductive biotechnologies to provide disease-free breedings, and
Artificial insemination, provide comprehensive details on cryobanks for animal semen.
breedings, cryobank, embryo
transfer, re-herding TÓM TẮT
Cryobank hay cryoconservation of animal genetic resource là ngân hàng
lưu trữ tế bào động vật trong điều kiện đông lạnh. Một trong những bước
quan trọng trong quy trình của cryobank là nguồn tế bào được thu nhận từ
vật nuôi đã được sàng lọc các mầm bệnh trước lưu trữ ở nhiệt độ -196°C.
Chăn nuôi Việt Nam hiện đang đối mặt với các dịch bệnh trên đàn gia súc
gia cầm nên nhu cầu về con giống sạch bệnh, có năng suất cao trở nên rất
cấp thiết. Cryobank cùng với kỹ thuật công nghệ sinh học sinh sản sản xuất
hàng loạt con giống sạch bệnh, đáp ứng nhanh cho thị trường đã được áp
dụng rộng rãi ở các nước phát triển. Bài viết tập trung phân tích những
thách thức từ dịch bệnh của ngành chăn nuôi, tổng hợp những phương
pháp sản xuất con giống sạch bệnh từ cryobank và công nghệ sinh học sinh
sản trên thế giới và cung cấp những quy trình cơ bản trong đông lạnh tinh
trùng động vật nuôi.

104
Tạp chí Khoa học Trường Đại học Cần Thơ Tập 58, Số Chuyên đề SDMD (2022): 104-114

1. THÁCH THỨC TỪ DỊCH BỆNH CỦA
NGÀNH CHĂN NUÔI
Theo báo cáo của Bộ Nông nghiệp và Phát triển
Nông thôn (NN và PTNN), năm 2021, nhiều dịch
bệnh trên gia súc, gia cầm đã gây thiệt hại hàng tỷ
đồng cho ngành chăn nuôi. Dự báo trong năm 2022,
rủi ro dịch bệnh trên vật nuôi vẫn còn rất lớn. Cụ
thể, từ đầu năm đến tháng 2/2022 nay, cả nước có
tổng số 13,6 ngàn gia cầm bệnh chết và tiêu hủy do
cúm A/H5N1, A/H5N6 và A/H5N8, có hơn 168 ổ
dịch tả heo châu Phi chưa qua 21 ngày, hơn 19,6
ngàn con heo mắc bệnh đã tiêu hủy, viêm da nổi cục
trên trâu bò xảy ra tại 17 xã thuộc 2 tỉnh thành trên
cả nước (Nguyên, 2022). Trải qua năm 2021 đầy
biến động với ngành nông nghiệp nói chung và
ngành y chăn nuôi nói riêng, năm 2022 sẽ là một
năm với nhiều khó khăn hơn nữa: như dịch bệnh trên
người, dịch bệnh trên vật nuôi và đứt gãy các chuỗi
cung ứng toàn cầu, tình hình chăn nuôi trong nước
chưa có những động thái tích cực và những khó
khăn, thách thức vẫn còn rất lớn (Dương, 2022).
Để khắc phục tình trạng trên và nhằm từng bước
giảm thiểu những khó khăn của ngành chăn nuôi,
Thủ tướng Chính phủ đã phê duyệt tại Quyết định
số 1520/2020/QD-TTg, ngày 6 tháng 10 năm 2020
về Chiến lược phát triển chăn nuôi 2021-2030, tầm
nhìn 2045. Trong đó, hướng dẫn cụ thể các giải pháp
một cách đồng bộ giữa các ban ngành với mục tiêu
phát triển ngành chăn nuôi bền vững. Một trong
những đề án được đưa lên đầu tiên ở Quyết định này
là “nghiên cứu những công nghệ sản xuất vật nuôi”.
Ở điều kiện bình thường, giống vật nuôi có năng
suất cao, thích nghi với biến đổi khí hậu rất quan
trọng, và trong điều kiện dịch bệnh phức tạp, cùng
với nhu cầu tái đàn nhanh sau dịch bệnh, thì nhu cầu
con giống vật nuôi sạch bệnh lại càng cấp thiết hơn.
Để tái đàn hiệu quả, Bộ NN và PTNN khuyến cáo
người dân cần thận trọng và tuân thủ những quy định
về phòng chống dịch và chăn nuôi theo hướng an
toàn sinh học. Tuy nhiên, tỉ lệ tái đàn và tăng đàn ở
một số địa phương còn thấp hơn so với dự kiến. Có
nhiều yếu tố ảnh hưởng đến chương trình này là: đứt
quản chuỗi cung ứng, biến động của thị trường khiến
giá thành thức ăn và thuốc thú y tăng cao, các hộ
chăn nuôi nhỏ thiếu vốn tái đàn, cơ sở vật chất
không đảm bảo tiêu chuẩn chăn nuôi an toàn và tình
trạng con giống vật nuôi khan hiếm. Với con giống
vật nuôi, đây là một trong những khó khăn cơ bản
của các hộ và trang trại khi tái đàn. Theo khảo sát,
khoản một nửa số hộ chăn nuôi báo cáo về tình hình
mua con giống với giá cao, chất lượng không ổn
định và điều kiện giống không đảm bảo nguồn gốc,
kiểm định dịch bệnh (Quang, 2020; Chánh & Vũ,
2022).

Bảng 1. Các tác nhân gây bệnh (virus gây dịch tả heo Châu Phi, virus gây lở mồm long móng,…) và khả
năng lây truyền qua đường sinh dục trong giao phối tự nhiên hoặc gieo tinh bằng tinh dịch tươi
Phân lập
Nguy cơ lây
Tác nhân gây bệnh virus trong
nhiễm
tinh dịch
Porcine adenovirus (pADV 1-5, pADV AC, virus gây bệnh đường tiêu
cao thấp
hóa nhẹ ở heo)
African swine fever virus (ASFV, virus gây bệnh dịch tả heo châu Phi) cao cao
Blue eye disease virus (virus gây bệnh mắt xanh) cao cao
Porcine sapelovirus (PSV, sapelovirus ở heo) cao cao
Classical Swine Fever Virus(CSFV, virus gây bệnh sốt heo cổ điển) cao cao
Footandmouth disease virus (FMDV, virus gây lở mồm long móng) cao thấp
Highly Pathogenic Avian Influenza (HPAI, virus cúm) cao thấp
Porcine Circovirus Type 2 (PCV2, circovirus loại II ở heo) cao cao
Procine parvovirus (PPV, virus gây suy sinh sản ở heo) cao cao
Porcine reproductive and respiratory syndrome virus (PRRSV,Virus hội cao cao
chứng hô hấp và sinh sản ở heo)
Retrovirus cao thấp
Swine vesicular disease (SVD, virus bệnh mụn nước ở heo) cao cao
Transmissible gastroenteritis coronavirus (TGEV, virus viêm dạ dày ruột cao
rất thấp
nguyên nhiễm)
(Nguồn: Martins Pereira et al., 2013)
Hiện nay, ở vùng đồng bằng sông Cửu Long một số gia súc như trâu, dê, cừu hầu hết là kết quả
(ĐBSCL), việc sản xuất con giống trên gia cầm và của giao phối tự nhiên. Khi dịch bệnh xảy ra, cả con

105
Tạp chí Khoa học Trường Đại học Cần Thơ
đực giống và con cái giống đều mang mần bệnh, vì
thế trang trại và nông hộ không có khả năng tự cung
cấp con giống (Dhama et al., 2014). Ngay cả trên
chăn nuôi heo, mặc dù heo được áp dụng phương
pháp gieo tinh nhân tạo (GTNT) bằng tinh tươi,
nhưng nguồn tinh tươi được khai thác ngay tại chỗ
và phải sử dụng trong thời gian ngắn (tối đa 7 ngày).
Vì vậy, nếu con đực giống mang mần bệnh như virus
gây dịch tả heo Châu Phi, virus lở mồm long móng
thì tinh tươi được khai thác sau đó đều có khả năng
cao lây truyền mầm bệnh qua đường GTNT (Bảng
1). Đây là một trong những nguyên nhân làm giảm
số lượng con giống và khiến nguồn cung cấp con
giống cho tái đàn khan hiếm.
2. SẢN XUẤT CON GIỐNG SẠCH BỆNH
BẰNG CRYOBANK VÀ CÁC KỸ THUẬT
CÔNG NGHỆ SINH HỌC SINH SẢN
Cryobank hay cryoconservation of animal
genetic resource là ngân hàng lưu trữ tế bào động
vật như tế bào tinh trùng, tế bào trứng, phôi và tế
bào sinh dưỡng trong điều kiện đông lạnh (Food and
Agriculture Organization of the United Nations
[FAO], 2007, Groeneveld et al., 2016)). Một trong
những bước quan trọng trong quy trình của
cryobank là nguồn tế bào được thu nhận từ vật nuôi
đã được chọn lọc, lai tạo in vitro và sàng lọc các
mầm bệnh trước khi áp dụng các công nghệ làm lạnh
và lưu trữ ở nhiệt độ -196°C trong thời gian lên đến
hàng chục năm. Chính vì khả năng lưu trữ lâu dài
như vậy, mà cryobank hay bảo quản lạnh là một
trong những công cụ hữu ích không những trong sản
xuất những con giống sạch bệnh mà còn để cải thiện
chọn lọc, cải biến di truyền và bảo tồn nguồn gen.
Chính vì tầm quan trọng của việc bảo quản lạnh mà
trong kế hoạch toàn cầu của mình, FAO (2007,
2012) đã kiến nghị thực hiện các chương trình bảo
tồn nguồn gene động vật. Vì thế mà trên thế giới đã
Hình 1. Sơ đồ mô tả các thế hệ ứng dụng cryobank và công nghệ sinh học sinh sản trong sản xuất con
giống vật nuôi
Thế hệ thứ 1 (A): Tinh trùng được chọn lọc và
âm tính với tác nhân gây bệnh (Morrell, 2011). Quá
106
Tập 58, Số Chuyên đề SDMD (2022): 104-114
có rất nhiều ngân hàng gene đông lạnh ra đời như ở
nhiều nước Châu Âu, Châu Phi ( Leroy et al., 2019;
Iaffaldano et al., 2021; Tomka et al., 2022), Mỹ
(Blackburn, 2009).
Để sản xuất con giống, cryobank phải kết hợp
với những kỹ thuật công nghệ sinh học trong sinh
sản. Ngành công nghệ sinh học sinh sản được đánh
dấu bằng việc gieo tinh nhân tạo bằng tinh trùng
đông lạnh trong cọng rạ được thực hiện đầu tiên vào
năm 1953. Nhóm nghiên cứu của Sherman et al.
(1953) đã chứng minh rằng tinh trùng đông lạnh
bằng glycerol khi rã đông, có thể thụ tinh với tế bào
trứng và phôi hình thành phát triển bình thường. Đây
là trường hợp mang thai đầu tiên sử dụng tinh đông
lạnh trên người thành công được báo cáo vào năm
1953 (Bunge & Sherman, 1953).
Trên gia súc, những lợi thế khiến cryobank tinh
trùng có vai trò quan trọng như: (1) duy trì đa dạng
di truyền ở động vật nuôi cũng như động vật hoang
dã (Critser & Russell, 2000; Woelders et al., 2012);
(2) tạo thuận lợi lai tạo xa giữa các vùng trong nước
và thế giới trên những giống có đặc tính vượt trội về
mặt di truyền (Barbas & Mascarenhas, 2009); (3)
bảo tồn và khôi phục động vật có nguy cơ tuyệt
chủng (Walters et al., 2009); (4) sử dụng ngân hàng
gene động vật biến đổi gene làm mô hình bệnh ở
người (Agca, 2012). Chính vì vậy, kỹ thuật này đã
được áp dụng lần đầu tiên trên bò (Bratton et al.,
1955), heo (Bwanga et al., 1990), gia cầm (Shaffner
et al., 1941) và các động vật nuôi khác (Walters et
al., 2009), và ngày càng được được phát triển đến
hôm nay.
Về phương pháp tạo ra con giống bằng cryobank
và các kỹ thuật công nghệ sinh học sinh sản được
tóm tắt ở Hình 1.
trình gieo tinh nhân tạo trên con cái động dục tự
nhiên hoặc nhân tạo bằng tinh tươi hoặc tinh cọng
Tạp chí Khoa học Trường Đại học Cần Thơ
rạ (cryobank tinh trùng) là công cụ chính trong các
chương trình cải thiện giống bò sữa/thịt, dê, cừu,
heo, gia cầm,…ở các nước phát triển. Kỹ thuật này
chủ yếu gia tăng tối đa khả năng khai thác tiềm năng
di truyền tốt của con đực giống. Đực giống được
chọn lọc cẩn thận với những ưu thế di truyền và âm
tính với tác nhân gây bệnh. Tinh dịch được thu nhận,
đánh giá, pha loãng và bảo quản dưới dạng tinh tươi
hoặc tinh đông lạnh. Từ 1 lần xuất tinh của đực
giống có thể sử dụng phối giống cho hàng chục con
cái khác nhau. Ngoài ra, tinh đông lạnh sẽ giúp cho
việc phân phối nguồn chất liệu di truyền tốt đến
khắp nơi trên thế giới. Ước tính, hàng năm trên toàn
thế giới khoảng 100 triệu lần GTNT trên bò, 40 triệu
trên heo, 3,3 triệu trên cừu và 500 000 trên dê. Tuy
nhiên hạn chế của kỹ thuật này là chỉ tận dụng được
½ kiểu gene tốt từ con đực (Thibier & Wagner,
2002; Wiebke et al., 2021).
Thế hệ thứ 2 (B): Kỹ thuật này cơ bản dựa trên
kỹ thuật gây siêu bài noãn và động dục đồng loạt, từ
đó gia tăng khả năng khai thác tiềm năng di truyền
tốt của con cái giống. Đồng thời, việc bảo tồn đông
lạnh trứng và phôi cũng giúp cho phân phối chất di
truyền tốt được thuận lợi và rộng khắp hơn, cũng
như giúp bảo tồn những nguồn gene quý. Ước tính,
có khoảng 440.000 phôi trên bò, 17.000 phôi trên
cừu, 2.500 phôi trên ngựa và 12.000 phôi trên được
cấy truyền trên dê hàng năm. Ngoài ra, khoảng 80%
bò đực giống trên khắp thế giới được sinh ra từ cấy
truyền phôi (ET) (Squires et al., 1999, Perry, 2014,
Thibier, M. 2009).
Thế hệ thứ 3 (C): Với phương pháp này, tế bào
noãn được thu nhận trực tiếp từ những con cái giống
đã được tuyển chọn, sau đó những tế bào này sẽ
được nuôi trưởng thành trong phòng thí nghiệm.
Phôi được tạo ra trong phòng thí nghiệm là sự kết
hợp giữa tế bào noãn và tế bào tinh trùng từ nguồn
đông lạnh được đã được tuyển chọn. Phương pháp
này tạo được nhiều phôi hơn ở thế hệ thứ 2, yêu cầu
ít số lượng tinh trùng hơn và đồng thời có thể xác
định được giới tính của phôi trước khi cấy truyền.
Tuy nhiên, trong việc này không thể thực hiện nếu
phôi được tạo ra từ những phương pháp ở thế hệ thứ
2 (Wagtendonk-de Leeuw, 2006; Obuchi et al.,
2019).
Thế hệ thứ 4 (D): Kỹ thuật chọn lọc phôi trong
phòng thí nghiệm trước khi cấy truyền phôi. Các tế
bào phôi sẽ được thu nhận bằng phương pháp sinh
thiết và được chọn lọc với sự hỗ trợ của các gene
marker (marker assisted selection_MAS) (Ponsart et
al., 2014; de Sousa et al., 2017). Một trong những
MAS ứng dụng phổ biến trên bò là microarray chip
107
Tập 58, Số Chuyên đề SDMD (2022): 104-114
the Bovine SNP50. The BovineSNP50 chứa gần
54.000 dấu phân tử đa hình đơn nucleotide (single
nucleotide polymorphism) dọc theo bộ gene của bò
(Matukumalli et al., 2009). Gần đây, nhờ vào sự
phát triển vượt trội của công nghệ giải trình gene thế
hệ mới, và phương pháp nghiên cứu liên kết toàn hệ
gene (Genome Wide Association Study), nhiều
microarray đã được phát triển và sử dụng với mục
đích chọn lọc gene marker: như GeneSeek GGP-
LDv3, GeneSeek GGP-LDv4, GeneSeek GGP-
90KT, GeneSeek GGP-HDv3, GeneSeek Bovine-
GGP-F250, and Illumina HD 778K (Crum et al.,
2019; Smith et al., 2022). Bằng việc chọn lọc con
giống bằng kiểu gene đã mang lại nhiều giá trị như
tăng tính chính xác của chọn lọc thông qua các thông
tin liên quan trực tiếp đến kiểu gene, đồng thời rút
ngắn thời gian chọn giống so với lai tạo thông
thường.
Theo báo cáo của Hiệp hội Công nghệ Phôi
Quốc tế (IETS) về dữ liệu các hoạt động chuyển
phôi (ET) trên toàn cầu vào năm 2020, sản xuất phôi
trên thế giới tăng lên trong hầu hết các vùng và tất
cả các loài, bất chấp đại dịch Covid-19 và ảnh hưởng
tiêu cực đến nền kinh tế toàn cầu (Viana, 2020). Số
liệu thống kê của ngành công nghiệp phôi của bò,
cừu, dê và ngựa trên thế giới vào năm 2020 được mô
tả cụ thể Bảng 2. Lần đầu tiên, hơn 1,5 triệu phôi bò
đã được ghi nhận, tăng 7,0% so với năm 2019
(1.518.150 so với 1.419.336; tương ứng). Trên toàn
thế giới, phôi IVP (phôi bò được sản xuất ở thế hệ
thứ 3, Hình 1C) chiếm 76,2% tổng số phôi gia súc
có thể chuyển giao trong năm 2020. Thị trường sản
xuất và xuất khẩu các phôi ở các loài động vật khác
cũng diễn ra sôi nổi. Số lượng IVD (phôi bò được
sản xuất ở thế hệ thứ 2, Hình 1B) phôi tăng ở ngựa
(+ 13,6%), cừu (+ 33,3%) và dê (+ 51,0%); và phôi
IVP cũng tăng ở ngựa (+ 37,1%) và dê (+ 204,1%)
so với năm 2019. Ở tất cả các loài này (ngựa, cừu và
dê) tổng số phôi được ghi nhận cao nhất vào năm
2020. Đồng thời, theo số liệu của những nước có gửi
báo cáo, thì hơn 31,7% các quốc gia trên thế giới có
sản xuất và trao đổi phôi vật nuôi. Đây là minh
chứng về việc sản xuất con giống bằng công nghệ
cấy truyền phôi đã được ứng dụng mạnh mẽ ngày
một nhiều trên thế giới. Như vậy, cryobank tinh
trùng, phôi không những sản xuất những con giống
sạch bệnh mà còn tạo ra những con giống mang
những đặc điểm di truyền ưu thế, có khả năng vận
chuyển trong nước và xuất khẩu đi các vùng lãnh
thổ, vấn đề mà giao phối tự nhiên không thể làm
được.
Tạp chí Khoa học Trường Đại học Cần Thơ Tập 58, Số Chuyên đề SDMD (2022): 104-114

Bảng 2. Số liệu về thị trường trao đổi phôi giống động vật của bò, ngựa, cừu và dê giữa các vùng lãnh
thổ trên thế giới
Bò Ngựa Cừu Dê
Vùng lãnh thổ
IVD IVP IVD IVP IVD IVP IVD IVP
Châu Phi 2.763 4.977 0 0 0 0 0 0
Châu Á 0 0 0 0 0 0 0 0
Châu Âu 126.491 47.470 2.248 5.359 966 0 346 0
Bắc Mỹ 196.704 578.995 851 1.126 9.204 141 10.757 2,275
Châu Đại Dương 4.211 14.345 0 0 12.427 0 1.890 0
Nam Mỹ 31.559 500.397 22.120 2.156 7.222 0 184 0
Tổng 2020 361.728 1.156.422 15.219 8.641 29.819 141 13.177 2.275
Tổng 2019 387.769 1.031.567 22.198 6.303 22.374 1.137 8.725 748
So với 2020 (%) -6,7 +12,1 +13,6 +37,1 +33,3 -87,6 +51,0 +204,1
IVD: phôi được sản xuất ở thế hệ thứ 2 (Hình 1B), IVP: phôi được sản xuất ở thế hệ thứ 3 (Hình 1C). (Nguồn: Viana,
2019
3. CRYOBANK: NHỮNG QUY TRÌNH (Burrows & Quinn, 1937) và được sử dụng rộng rãi
CƠ BẢN TRONG ĐÔNG LẠNH TINH đến bây giờ (Iaffaldano et al., 2021). Nguyên lý cơ
TRÙNG ĐỘNG VẬT bản của phương pháp này là giữ cố định con trống
và nhẹ nhàng massage phần dưới bụng của con
Cryobank các loại động vật như tế bào tinh
trống. Con trống đáp ứng lại bằng cách cương dương
trùng, tế bào trứng, phôi và tế bào sinh dưỡng trong
và lúc này người thu nhận nhẹ nhàng bóp dương vật
điều kiện đông lạnh. Trong các loại tế bào trên,
và thu nhận tinh dịch vào ống đựng mẫu. Để khai
cryobank trên tinh trùng là loại tế bào được nghiên
thác tối đa và dễ dàng tinh dịch gia cầm, con trống
cứu và ứng dụng đầu tiên và cũng như quan trọng
và con mái cần được nhốt riêng và xen kẽ nhau.
cho các lĩnh vực ứng dụng công nghệ sinh học sinh
Đồng thời con trống không nên được cho ăn ít nhất
sản trong phát triển con giống. Vì thế, bài viết sẽ tập
12 giờ trước khi thu mẫu để hạn chế sự ô nhiễm của
trung mô tả chi tiết quy trình trong cryobank tinh
phân trong tinh dịch.
trùng.
Phương pháp lấy tinh bằng tay: Phương pháp
Đông vật thí nghiệm: Trước khi tiến hành lấy
khai thác tinh dịch heo bằng tay đã được thực hiện
tinh trùng, bước chọn lọc đực giống là một trong
đầu tiên vào năm và ứng dụng rộng rãi ở các cơ sở
những bước chính yếu. Con đực giống phải là những
sản xuất tinh đực heo giống. Chất lượng của khai
con đực mang những ưu thế về kiểu hình và kiểu
thác tinh sẽ phụ thuộc nhiều vào tay nghề (kỹ thuật
gene mang tính trạng về kinh tế như năng suất, tăng
của kỹ thuật viên). Heo đực giống trước khi khai
trọng, chống chịu điều kiện khí hậu, hiệu quả hấp
thác thu nhận tinh dịch cần được huấn luyện đực
thụ thức ăn…đang ở độ tuổi sinh sản và đều qua các
nhảy giá. Tùy theo mỗi giống heo và kỹ thuật viên,
bước kiểm nghiệm âm tính với các tác nhân gây
thời gian thông thường cho heo thành thạo là từ 2- 4
bệnh như Salmonella Gallinarum Pullorum,
tuần. Phương pháp khai thác này không cần nhiều
Salmonella enteritidis, Typhimurim, Mycoplasma
về các thiết bị. Kỹ thuật viên sẽ dùng tay đeo găng
trên gia cầm (Blesbois et al., 2007; Dhama et al.,
tay chuyên dụng để thực hiện, các dụng cụ lấy tinh
2014); African Swine Fever (ASF) và Pathogenic
như cốc thủy tinh, gạc lọc tinh, găng tay và lọ đựng
Porcine Reproductive and Respiratory Syndrome
tinh phải được khử trùng và làm ấm trước khi sử
(HP-PRRS) ở heo (Chanapiwat et al., 2020); virus
dụng, đây là một trong những yêu cầu quan trọng
gây viêm da nổi cục ở trâu bò (Annandale et al.,
đảm báo tính an toàn với tác nhân gây bệnh cho tinh
2018), lở mồm long móng và các bệnh khác ở gia
dịch (Huyen Le Thi & Marshall., 2020).
súc (Givens, 2018).
Âm đạo giả: Về nguyên tắc cấu tạo chung, âm
Phương pháp lấy tinh: Tinh dịch là một trong
đạo giả sẽ gồm các bộ phận: ống nhựa cứng hình trụ,
những nguồn gengene động vật và có thể thu nhận
ống chứa tinh dịch sau khi thu nhận, một ống cao su
bằng các phương pháp sau:
mềm bền nhiệt có vai trò tạo nhiệt độ gần với nhiệt
Massage trên gia cầm: Thu nhận tinh dịch trên độ cơ thể động vật, ngoài ra âm đạo giả còn tạo được
gia cầm là một trong những phương pháp đơn giản áp lực giống với âm đạo thật. Kích thước của âm đạo
và không xâm lấn, được phát triển từ năm 1973 giả (AV) sẽ điều chỉnh phụ thuộc vào kích cỡ của

108
Tạp chí Khoa học Trường Đại học Cần Thơ
mỗi loài động vật thí nghiệm. Trước khi thu nhận
tinh dịch con đực, âm đạo giả cần làm ấm với nhiệt
độ thích hợp và bôi trơn ống hình trụ. Tùy vào mỗi
loại động vật, việc kích thích con đực xuất tinh có
thể sử dụng bằng giá nhảy như trên trâu, bò, ngựa
(Aurich, 2012; Neglia et al., 2020) hoặc dùng con
cái như trên dê, thỏ (Soliman & El-Sabrout, 2020).
Phương pháp sử dụng xung điện: Đối với những
con đực giống hạn chế hợp tác với việc huấn luyện
lấy tinh bằng âm đạo giả, phương pháp sử dụng xung
điện là một giải pháp thích hợp và mang lại hiệu quả
thu nhận tinh dịch cao. Đây là một thiết bị có đầu
dò, đầu dò này sẽ đưa vào trực tràng, sau đó sử dụng
xung điện để kích thích tạo phản ứng xuất tinh ở con
đực và thu nhận tinh dịch bằng dụng cụ thu mẫu.
Mặc dù phương pháp này thu nhận tinh dịch nhanh
chóng và chất lượng tốt, nhưng hạn chế là phương
pháp xâm lấn, gây tổn thương cho động vật, một số
nghiên cứu cho thấy việc gia tăng các hormone như
cortisol ở nhóm xung điện cao hơn so với nhóm sử
dụng âm đạo giả (Yang, 2020).
Các phương pháp đông lạnh tinh trùng động vật
nuôi
Bảo quản lạnh là việc sử dụng nhiệt độ thấp để
bảo quản các tế bào và mô nguyên vẹn về mặt cấu
trúc và chức năng (Pegg, 2002). Tuy nhiên, ở nhiệt
độ thấp sẽ ảnh hưởng đến sức sống của tế bào.
Hình 2. Nguyên lý trong đông lạnh tế bào
(Nguồn: Jones & Shikanov, 2020)
109
Tập 58, Số Chuyên đề SDMD (2022): 104-114
Nguyên nhân của hiện tượng này là do nước trong
tế bào sẽ đóng băng và hình thành những tinh thể
nước. Đây chính là nguyên nhân làm tế bào bị vỡ
trong quá trình đông lạnh. Các tinh thể nước sẽ phá
vỡ cơ học màng tế bàovà các bào quan khác, do đó
tế bào sẽ không còn nguyên vẹn sau khi trở về trạng
thái bình thường, đồng thời nồng độ chất tan nội bào
tăng khi khi nước hình thành tinh thể sẽ gây chết tế
bào. Để giải quyết vấn đề này, trong nguyên lý của
việc đông lạnh phải đảm bào ít nhất hai yếu tố quan
trọng: sử dụng chất bảo quản lạnh (cryoprotectants)
và lựa chọn tốc độ làm lạnh và giải đông thích hợp
(Rusco et al., 2019). Chất bảo quản lạnh là những
chất có khả năng hòa tan trong nước cao ở nhiệt độ
thấp, có thể dễ dàng đi qua màng sinh học và độ độc
hại cho tế bào ở mức tối thiểu. Những chất bảo quản
lạnh được sử dụng phổ biến trong đông lạnh tinh
trùng cũng như các tế bào động vật khác là: glycerol,
DMSO, ethylene glycol và propadiol. Việc quan
trọng kế tiếp trong quá trình làm lạnh là sử dụng quá
trình làm lạnh và giải đông. Sự thành công của quá
trình bảo quản lạnh phụ thuộc vào việc tránh hình
thành tinh thể đá nội bào và cân đối với việc sự di
chuyển của nước qua màng tế bào được mô tả ở hình
2 (Jones & Shikanov, 2020). Vì thế, nguyên lý cơ
bản và quan trọng nhất của việc đông lạnh là bảo vệ
tế bào khỏi sự hình thành của tinh thể nước
(Estudillo et al., 2021).
Tạp chí Khoa học Trường Đại học Cần Thơ
Việc đông lạnh tinh trùng người thực hiện từ
cuối những năm 1940. Bắt đầu bằng việc glycerol
được khám phá rằng có thể bảo vệ tinh trùng khỏi bị
hư hại do đông lạnh đến việc tinh trùng người được
bảo quản trên đá khô ở -79oC được sử dụng (Polge
et al., 1949). Sau đó việc sử dụng nitơ lỏng trong
việc bảo quản lạnh tinh dịch đã phát triển nhanh
chóng ở nhiều quốc gia với việc thành lập các ngân
hàng tinh trùng thương mại (Perloff & Steinberger,
1964). Một loạt các quy trình bảo quản lạnh hiện đã
và đang được sử dụng với các chất bảo quản lạnh và
quy trình đông lạnh khác nhau. Sự sống sót của tế
bào sau khi đông lạnh và rã đông phụ thuộc chủ yếu
vào việc giảm thiểu sự hình thành tinh thể băng nội
bào. Điều này được thực hiện bằng cách sử dụng
chất bảo quản lạnh thích hợp và tốc độ đông lạnh và
rã đông thích hợp để giảm thiểu lượng nước trong
nội bào có thể hình thành tinh thể băng. Tuy nhiên,
bảo quản lạnh có ảnh hưởng xấu đến chức năng tinh
trùng người, đặc biệt là khả năng vận động của tinh
trùng. Trung bình, chỉ có khoảng 50% số tinh trùng
di động có thể tồn tại sau quá trình trữ lạnh và rã
đông (Oberoi et al., 2014).
Có hai kỹ thuật đông lạnh thông thường chính
được sử dụng trong bảo quản đông lạnh tinh trùng:
đông lạnh chậm và phương pháp thủy tinh hóa.
Đông lạnh chậm (slow-freezing)
Kỹ thuật đông lạnh chậm do Behrman và
Sawada (1966) đề xuất bằng cách làm lạnh tinh
trùng với khoảng thời gian từ 2-4 giờ trong hai hoặc
ba bước, được thực hiện bằng thủ công hoặc tự động
hóa bằng cách sử dụng tủ đông đã được bán lập trình
(Behrman & Sawada, 1966).
Phương pháp thủ công được thực hiện bằng cách
đồng thời giảm nhiệt độ của tinh trùng khi vừa bổ
sung chất bảo quản lạnh theo từng bước và sau khi
nhúng mẫu vào nitơ lỏng. Tốc độ làm lạnh ban đầu
tối ưu của mẫu từ nhiệt độ phòng xuống đến 5°C là
0,5 – 1°C/phút. Sau đó, mẫu được hạ nhiệt độ từ 5°C
đến −80°C với tốc độ 1 – 10°C/phút và cuối cùng
được nhúng vào nitơ lỏng ở -196°C (Mahadevan &
Trounson, 2009).
Dù phương pháp đông lạnh bằng thủ công vẫn
được thực hiện thành công, nhưng hạn chế lớn nhất
của phương pháp này là độ ổn định không cao và
thất thoát hơi lạnh rất lớn. Do vậy, hệ thống làm lạnh
tự động được được nghiên cứu và phát triển. Hệ
thống này sử dụng tấm kim loại để giữ các ống trữ
lạnh và được làm lạnh trực tiếp bằng nitơ lỏng. Nitơ
lỏng được đổ vào bể chứa và máy sẽ được lập trình
sử dụng phần mềm ghi dữ liệu để làm lạnh tự động
từ 20°C đến −80°C với tốc độ 1,5°C/phút và sau đó
110
Tập 58, Số Chuyên đề SDMD (2022): 104-114
ở 6°C/phút. Khi hoàn thành quá trình đông lạnh, ống
trữ lạnh chuyên dụng được lấy ra và bảo quản trong
nitơ lỏng ở -196°C. Tổng quá trình này mất khoảng
40 phút (Holt, 2000). Tùy vào mỗi loại tế bào và mỗi
loại mô mà có quy trình làm lạnh khác nhau. Ưu
điểm của phương pháp này là cân bằng việc di
chuyển của nước và hạ nhiệt độ nên độ tỉ lệ sống của
tế bào sau khi giải đông rất cao. Tuy nhiên, hạn chế
của phương pháp này là thời gian kéo dài và yêu cầu
thiết bị làm lạnh chuyên dụng (Santo et al., 2012).
Phương pháp thủy tinh hóa
Đây là phương pháp làm lạnh tinh trùng với thời
gian rất nhanh mà toàn bộ khối vật chất bên trong và
bên ngoài tế bào sẽ chuyển thành dạng khối đặc,
trong suốt như thủy tinh trong quá trình giảm nhiệt
độ. Tinh trùng sẽ được nhúng trực tiếp vào nitơ lỏng
cộng với nồng độ chất bảo quản lạnh được sử dụng
khá cao. Điều này sẽ tránh được sự hình thành tinh
thể đá bên trong cũng như bên ngoài tế bào trong
quá trình làm lạnh.
Phương pháp này được Rall và Fahy (1985) thực
hiện thành công đầu tiên trên phôi bò và sau đó được
thực hiện rộng rãi trên gia súc vào nhiều năm sau đó
(Rall & Fahy, 1985). Kuleshova và Lopate (1999)
đã ứng dụng thành công phương pháp này để trữ
lạnh trứng của người (Kuleshova et al., 1999).
Phương pháp thủy tinh hóa ngoài sử dụng tốc độ làm
lạnh cao mà còn sử dụng nồng độ cao các chất bảo
quản lạnh để tránh tạo tinh thể đá trong quá trình
đông lạnh cũng như rã đông (Loutradi et al., 2008;
Son et al., 2009). Phương pháp này giúp đông lạnh
đơn giản, dễ thực hiện mà lại tiết kiệm được thời
gian, nguyên liệu và trang thiết bị. Hiện nay, đông
lạnh bằng phương pháp thủy tinh hóa là một kỹ thuật
đang được ứng dụng rộng tại trong nghiên cứu và cả
trong ứng dụng điều trị.
Trong suốt quá trình phát triển của kỹ thuật thủy
tinh thể, thay thế cho phương pháp đông lạnh chậm,
môi trường được sử dụng luôn được thay đổi và phát
triển, chủ yếu là việc kết hợp các chất bảo quản lạnh
không thẩm thấu để giảm tổn thương tế bào. Những
năm gần đây, đã có rất nhiều nghiên cứu phương
pháp thủy tinh hóa nhưng không sử dụng chất bảo
quản lạnh cũng mang lại những kết quả khả thi
(Sanchez et al, 2015). Mặc dù kỹ thuật này có những
ưu điểm trong việc điều chỉnh khả năng phục hồi áp
suất thẩm thấu và có những kết quả đáng kể trên tế
bào tinh trùng người (Aizpurua et al., 2017), việc sử
dụng quy trình này ở động vật như gia súc, gia cầm
vẫn chưa có kết quả khả quan. Ở gia súc, những
nghiên cứu cho thấy tỉ lệ tinh trùng sống và di động
rất thấp khi áp dụng phương pháp thủy tinh thể
Tạp chí Khoa học Trường Đại học Cần Thơ
(Yánez-Ortiz et al., 2021). Ở trên heo, quá trình thủy
tinh hóa giảm rõ rệt khả năng vận động, khả năng
tồn tại và tính toàn vẹn acrosome của tinh trùng
(Arraztoa et al., 2017; My và ctv., 2021). Kết quả
giảm chất lượng tinh trùng sau khi giải đông cũng
có kết quả tương tự, hiệu quả thấp hơn so với
phương pháp đông lạnh chậm cũng ở cừu, dê, gia
cầm ( Long et al., 2010); Jiménez-Rabadán et al.,
2015; Agossou & Koluman, 2018).
4. THẢO LUẬN
Vì khả năng lưu trữ lâu dài, cryobank hay bảo
quản lạnh là một trong những công cụ hữu ích không
những sản xuất những con giống sạch bệnh mà còn
để cải thiện chọn lọc, cải biến di truyền và bảo tồn
nguồn gene. Chính vì tầm quan trọng của việc bảo
quản lạnh mà trong kế hoạch toàn cầu của mình,
FAO đã kiến nghị thực hiện các chương trình bảo
tồn nguồn gene động vật vì thế mà trên thế giới đã
có rất nhiều ngân hàng gene đông lạnh ra đời. Tại
Việt Nam, nhận thấy tầm quan trọng của ứng dụng
cryobank và công nghệ sinh học trong chăn nuôi,
vào ngày 12 tháng 01 năm 2006, Thủ Tướng chính
phủ đã phê duyệt “Chương trình trọng điểm phát
triển và ứng dụng công nghệ sinh học trong lĩnh vực
nông nghiệp và phát triển nông thôn đến năm 2020”.
Ở QĐ số 11/2006/QĐ-TTG trong đó ghi rất rõ nội
dung: “Nghiên cứu cải tiến và ứng dụng các công
nghệ tế bào động vật tiên tiến để nâng cao hiệu quả
sinh sản của vật nuôi; phục vụ tốt cho công tác lưu
giữ, bảo quản, bảo tồn các tế bào sinh dục và đánh
giá chất lượng vật nuôi; ứng dụng phương pháp cắt
phôi và cải tiến phương pháp thụ tinh trong ống
nghiệm phục vụ lĩnh vực sinh sản động vật. Ứng
dụng rộng rãi các công nghệ tinh, phôi đông lạnh
trong việc lưu giữ, bảo quản và bảo tồn lâu dài quỹ
gene bản địa, quý hiếm ở vật nuôi”. Quyết định số
1520/2020/QD-TTg, ngày 6 tháng 10 năm 2020 về
Chiến lược phát triển chăn nuôi 2021-2030, tầm
nhìn 2045, trong đó, những đề án được đưa lên hàng
đầu trong Quyết định này là “nghiên cứu những
công nghệ sản xuất vật nuôi”. Tuy nhiên, trên thực
tế, cho đến nay (tháng 09 năm 2022) việc ứng dụng
công nghệ sinh sản trong chăn nuôi ở Việt Nam nói
chung và vùng đồng bằng sông Cửu Long nói riêng
là rất hạn chế. Như theo sơ đồ ở Hình 1, có thể nói,
việc ứng dụng công nghệ sinh học sinh sản ở vùng
ĐBSCL chỉ mới ở thế hệ thứ nhất, trong khi các
nước trên thế giới và trong khu vực đã phát triển đến
111
Tập 58, Số Chuyên đề SDMD (2022): 104-114
các thế hệ ba và bốn. Thế hệ thứ nhất là ứng dụng
gieo tinh nhân tạo, kỹ thuật này đã được đưa vào
Việt Nam và ứng dụng rất thành công từ những năm
1970. Trong đó chỉ tập trung trên 2 đối tượng vật
nuôi là gieo tinh nhân tạo tinh đông lạnh cọng rạ trên
bò và tinh dịch tươi trên heo, còn các gia súc, gia
cầm khác đều là giao phối tự nhiên. Đối với tinh
đông lạnh, hầu hết đều là tinh nhập khẩu từ nước
ngoài, thuận lợi của việc nhập khẩu là tận dụng được
nguồn gene về tính trạng trội trên năng suất của con
đực. Bên cạnh những hiệu quả tích cực mang lại từ
việc sử dụng tinh ngoại nhập, công tác này còn gặp
phải một số hạn chế như: giống ngoại chưa thích
nghi với điều kiện dinh dưỡng, chăm sóc và đặc biệt
là khí hậu nóng ẩm của Việt Nam; giá thành tinh
động vật nhập ngoại khá cao. Vì vậy, kỹ thuật này
chưa được nhân rộng, đặc biệt đến trang trại nhỏ và
nông hộ. Hơn thế nữa, tình hình dịch bệnh đang
ngày rất phức tạp, đồng thời sự yêu cầu của phát
triển kinh tế đất nước mà quy mô chăn nuôi nhỏ lẻ,
nông hộ đang dần thay thế cho những trang trại lớn.
Với quy mô nhỏ, việc gia tăng số lượng đàn bằng
phương pháp giao phối tự nhiên có thể chấp nhận
được. Tuy nhiên, nếu quy mô trang trại lớn hàng
ngàn con vật nuôi thì việc áp dụng cryobank và gieo
tinh nhận tạo và cấy truyền phôi là rất cần thiết để
phát triển ổn định, quy mô, có kiểm soát và đạt hiệu
quả cao. Như vậy, lĩnh vực cryobank và công nghệ
sinh học sinh sản cần phải được quan tâm và đầu tư
hơn nữa về phát triển nguồn nhân lực, về trang thiết
bị máy móc, đặc biệt là ưu tiên phát triển từ các ban
ngành địa phương, các doanh nghiệp để nghiên cứu,
phát triển và áp dụng cryobank trên các loài động
vật khác nhau nhằm sản xuất con giống sạch bệnh
với số lượng lớn, đồng thời lai tạo bảo tồn những
động vật mang tính trạng tốt thích nghi với biến đổi
khí hậu mà nguồn tinh, nguồn phôi nhập khẩu không
thể có được, đồng thời lưu trữ những nguồn gene
quý bản địa của từng địa phương.
5. KẾT LUẬN
Cryobank tinh trùng vật nuôi kết hợp với các kỹ
thuật công nghệ sinh học sinh sản là giải pháp không
những sản xuất nhanh con giống sạch bệnh sau dịch
bệnh, mà còn là cơ sở lai tạo giống động vật nhanh
mang kiểu hình và kiểu gene tốt về năng suất và
thích nghi với điều kiện biến đổi khí hậu tại địa
phương.
Tạp chí Khoa học Trường Đại học Cần Thơ
TÀI LIỆU THAM KHẢO
Agca, Y. (2012). Genome resource banking of
biomedically important laboratory animals.
Theriogenology, 78(8), 1653–1665.
https://doi.org/10.1016/j.theriogenology.2012.0
8.012
Agossou, D. J., & Koluman, N. (2018). The effects
of natural mating and artificial insemination
using cryopreserved buck semen on reproductive
performance in Alpine goats. Archives Animal
Breeding, 61(4), 459–461.
https://doi.org/10.5194/aab-61-459-2018
Aizpurua, J., Medrano, L., Enciso, M., Sarasa, J.,
Romero, A., Fernández, M. A., & Gómez-Torres,
M. J. (2017). New permeable cryoprotectant-free
vitrification method for native human sperm.
Human Reproduction, 32(10), 2007–2015.
https://doi.org/10.1093/humrep/dex281
Annandale, C. H., Smuts, M. P., Ebersohn, K., du
Plessis, L., Venter, E. H., & Stout, T. A. E. (2018).
Effect of semen processing methods on lumpy skin
disease virus status in cryopreserved bull semen.
Animal Reproduction Science, 195, 24–29.
https://doi.org/10.1016/j.anireprosci.2018.04.080
Arraztoa, C. C., Miragaya, M. H., Chaves, M. G.,
Trasorras, V. L., Gambarotta, M. C., & Neild, D.
M. (2017). Porcine sperm vitrification II:
Spheres method. Andrologia, 49(8), e12738.
https://doi.org/10.1111/and.12738
Aurich, J. E. (2012). Artificial Insemination in
Horses—More than a Century of Practice and
Research. Journal of Equine Veterinary Science,
32(8), 458–463.
https://doi.org/10.1016/j.jevs.2012.06.011
Barbas, J. P., & Mascarenhas, R. D. (2009).
Cryopreservation of domestic animal sperm
cells. Cell and Tissue Banking, 10(1), 49–62.
https://doi.org/10.1007/s10561-008-9081-4
Behrman, S. J., & Sawada, Y. (1966). Heterologous
and Homologous Inseminations with Human
Semen Frozen and Stored in a Liquid-Nitrogen
Refrigerator. Fertility and Sterility, 17(4), 457–
466. https://doi.org/10.1016/S0015-
0282(16)36003-4
Blackburn, H. D. (2009). Genebank development for
the conservation of livestock genetic resources in
the United States of America. Livestock Science,
120(3), 196–203.
https://doi.org/10.1016/j.livsci.2008.07.004
Blesbois, E., Seigneurin, F., Grasseau, I., Limouzin,
C., Besnard, J., Gourichon, D., Coquerelle, G.,
Rault, P., & Tixier-Boichard, M. (2007). Semen
Cryopreservation for Ex Situ Management of
Genetic Diversity in Chicken: Creation of the
French Avian Cryobank. Poultry Science, 86(3),
555–564. https://doi.org/10.1093/ps/86.3.555
112
Tập 58, Số Chuyên đề SDMD (2022): 104-114
Bratton, R. W., Foote, R. H., & Cruthers, J. C.
(1955). Preliminary Fertility Results with Frozen
Bovine Spermatozoa. Journal of Dairy Science,
38(1), 40–46. https://doi.org/10.3168/jds.S0022-
0302(55)94935-3
Bunge, R. G., & Sherman, J. K. (1953). Fertilizing
Capacity of Frozen Human Spermatozoa.
Nature, 172(4382), 767–768.
https://doi.org/10.1038/172767b0
Burrows, W. H., & Quinn, J. P. (1937). The
Collection of Spermatozoa from the Domestic
Fowl and Turkey. Poultry Science, 16(1), 19–24.
https://doi.org/10.3382/ps.0160019
Bwanga, C. O., Braganca, M. M., Einarsson, S., &
Rodriguez-Martinez, H. (1990).
Cryopreservation of Boar Semen in Mini- and
Maxi-Straws. Journal of Veterinary Medicine
Series A, 37(1–10), 651–658.
https://doi.org/10.1111/j.1439-
0442.1990.tb00958.x
Chánh, T & Vũ, V. (2022). Khôi phục đàn heo giống hạt
nhân, tạo tiền đề chăn nuôi bền vững.
https://nongnghiep.vn/khoi-phuc-dan-heo-giong-hat-
nhan-tao-tien-de-chan-nuoi-ben-vung-d325059.html
Critser, J. K., & Russell, R. J. (2000). Genome
Resource Banking of Laboratory Animal
Models. ILAR Journal, 41(4), 183–186.
https://doi.org/10.1093/ilar.41.4.183
Crum, T. E., Schnabel, R. D., Decker, J. E.,
Regitano, L. C. A., & Taylor, J. F. (2019).
CRUMBLER: A tool for the prediction of
ancestry in cattle. PLOS ONE, 14(8), e0221471.
https://doi.org/10.1371/journal.pone.0221471
de Sousa, R. V., da Silva Cardoso, C. R., Butzke, G.,
Dode, M. A. N., Rumpf, R., & Franco, M. M. (2017).
Biopsy of bovine embryos produced in vivo and in
vitro does not affect pregnancy rates. Theriogenology,
90, 25–31.
https://doi.org/10.1016/j.theriogenology.2016.11.003
Dhama, K., Singh, R. P., Karthik, K., Chakrabort, S.,
Tiwari, R., Wani, M. Y., & Mohan, J. (2014).
Artificial Insemination in Poultry and Possible
Transmission of Infectious Pathogens: A
Review. Asian Journal of Animal and Veterinary
Advances, 9(4), 211–228.
https://doi.org/10.3923/ajava.2014.211.228
Dương, N.X. (2022). Ngành chăn nuôi 2022: Nhận
diện thách thức, tập trung giải pháp.
http://nhachannuoi.vn/nganh-chan-nuoi-2022-
nhan-dien-thach-thuc-tap-trung-giai-phap/
Estudillo, E., Jiménez, A., Bustamante-Nieves, P. E.,
Palacios-Reyes, C., Velasco, I., & López-
Ornelas, A. (2021). Cryopreservation of Gametes
and Embryos and Their Molecular Changes.
International Journal of Molecular Sciences,
Tạp chí Khoa học Trường Đại học Cần Thơ
22(19), 10864.
https://doi.org/10.3390/ijms221910864
FAO. (2012). Cryoconservation of Animal Genetic
Resources; FAO Animal Production and Health
Guidelines No. 12; FAO: Rome, Italy.
Givens, M. D. (2018). Review: Risks of disease
transmission through semen in cattle. Animal, 12,
s165–s171.
https://doi.org/10.1017/S1751731118000708
Groeneveld, L. F., Gregusson, S., Guldbrandtsen, B.,
Hiemstra, S. J., Hveem, K., Kantanen, J., Lohi,
H., Stroemstedt, L., & Berg, P. (2016).
Domesticated Animal Biobanking: Land of
Opportunity. PLOS Biology, 14(7), e1002523.
https://doi.org/10.1371/journal.pbio.1002523
Holt, W. V. (2000). Fundamental aspects of sperm
cryobiology: The importance of species and
individual differences. Theriogenology, 53(1),
47–58. https://doi.org/10.1016/S0093-
691X(99)00239-3
Iaffaldano, N., Di Iorio, M., Rusco, G., Antenucci,
E., Zaniboni, L., Madeddu, M., Marelli, S.,
Schiavone, A., Soglia, D., Buccioni, A.,
Cassandro, M., Castellini, C., Marzoni, M., &
Cerolini, S. (2021). Italian semen cryobank of
autochthonous chicken and turkey breeds: A tool
for preserving genetic biodiversity. Italian
Journal of Animal Science, 20(1), 2022–2033.
https://doi.org/10.1080/1828051X.2021.1993094
Jiménez-Rabadán, P., García-Álvarez, O., Vidal, A.,
Maroto-Morales, A., Iniesta-Cuerda, M., Ramón,
M., del Olmo, E., Fernández-Santos, R., Garde,
J. J., & Soler, A. J. (2015). Effects of vitrification
on ram spermatozoa using free-egg yolk
extenders. Cryobiology, 71(1), 85–90.
https://doi.org/10.1016/j.cryobiol.2015.05.004
Jones, A. S. K., & Shikanov, A. (2020). Ovarian Tissue
Cryopreservation and Novel Bioengineering
Approaches for Fertility Preservation. Current
Breast Cancer Reports, 12(4), 351–360.
https://doi.org/10.1007/s12609-020-00390-z
Kuleshova, L., Gianaroli, L., Magli, C., Ferraretti,
A., & Trounson, A. (1999). Birth following
vitrification of a small number of human
oocytes: Case Report. Human Reproduction,
14(12), 3077–3079.
https://doi.org/10.1093/humrep/14.12.3077
Leroy, G., Boettcher, P., Besbes, B., Danchin-Burge,
C., Baumung, R., & Hiemstra, S. J. (2019).
Cryoconservation of Animal Genetic Resources
in Europe and Two African Countries: A Gap
Analysis. Diversity, 11(12), 240.
https://doi.org/10.3390/d11120240
Long, J. A., Bongalhardo, D. C., Pelaéz, J., Saxena,
S., Settar, P., O’Sullivan, N. P., & Fulton, J. E.
(2010). Rooster semen cryopreservation: Effect
of pedigree line and male age on postthaw sperm
113
Tập 58, Số Chuyên đề SDMD (2022): 104-114
function. Poultry Science, 89(5), 966–973.
https://doi.org/10.3382/ps.2009-00227
Loutradi, K. E., Kolibianakis, E. M., Venetis, C. A.,
Papanikolaou, E. G., Pados, G., Bontis, I., &
Tarlatzis, B. C. (2008). Cryopreservation of
human embryos by vitrification or slow freezing:
A systematic review and meta-analysis. Fertility
and Sterility, 90(1), 186–193.
https://doi.org/10.1016/j.fertnstert.2007.06.010
Mahadevan, M., & Trounson, A. O. (2009). Effect of
Cooling, Freezing and Thawing Rates and
Storage Conditions on Preservation of Human
Spermatozoa. Andrologia, 16(1), 52–60.
https://doi.org/10.1111/j.1439-
0272.1984.tb00234.x
Martins Pereira, E. C., Silva, A., da Costa, E. P., &
Real Pereir, C. E. (2013). The Potential for
Infectious Disease Contamination During the
Artificial Insemination Procedure in Swine. In A.
Lemma (Ed.), Success in Artificial
Insemination—Quality of Semen and Diagnostics
Employed. InTech. https://doi.org/10.5772/52337
Matukumalli, L. K., Lawley, C. T., Schnabel, R. D.,
Taylor, J. F., Allan, M. F., Heaton, M. P.,
O’Connell, J., Moore, S. S., Smith, T. P. L.,
Sonstegard, T. S., & Van Tassell, C. P. (2009).
Development and Characterization of a High
Density SNP Genotyping Assay for Cattle. PLoS
ONE, 4(4), e5350.
https://doi.org/10.1371/journal.pone.0005350
My, L. H., Phuoc, M. B. T., Tuyen, D. N. D., &
Khuong, T. T. T. (2021) Đông lạnh trinh trùng
lợn bằng phương pháp thủy tinh hóa. Tạp chí
Nông nghiệp và Phát triển nông thôn, 7, 116-121
Neglia, G., de Nicola, D., Esposito, L., Salzano, A.,
D’Occhio, M. J., & Fatone, G. (2020). Reproductive
management in buffalo by artificial insemination.
Theriogenology, 150, 166–172.
https://doi.org/10.1016/j.theriogenology.2020.01.016
Nguyên, B. (2022). Ngành chăn nuôi thiệt hại nặng vì
dịch, bệnh. http://www.baodongnai.com.vn/tieu-
diem/202202/nganh-chan-nuoi-thiet-hai-nang-vi-
dich-benh-3104046/index.htm
Oberoi, B., Kumar, S., & Talwar, P. (2014). Study of
human sperm motility post cryopreservation.
Medical Journal Armed Forces India, 70(4), 349–
353. https://doi.org/10.1016/j.mjafi.2014.09.006
Obuchi, T., Osada, M., Ozawa, T., Nakagawa, H.,
Hayashi, M., Akiyama, K., Sakagami, N., Miura,
R., Geshi, M., & Ushijima, H. (2019).
Comparative evaluation of the cost and
efficiency of four types of sexing methods for the
production of dairy female calves. Journal of
Reproduction and Development, 65(4), 345–352.
https://doi.org/10.1262/jrd.2019-028
Pegg, D. E. (2002). The History and Principles of
Cryopreservation. Seminars in Reproductive
Tạp chí Khoa học Trường Đại học Cần Thơ
Medicine, 20(1), 005–014.
https://doi.org/10.1055/s-2002-23515
Perloff, W. H., & Steinberger, E. (1964). In vivo
survival of spermatozoa in cervical mucus.
American Journal of Obstetrics and Gynecology,
88(4), 439–442. https://doi.org/10.1016/0002-
9378(64)90499-5
Perry, G. (2014). 2013 statistics of embryo collection
and transfer in domestic farm animals.
https://doi.org/10.13140/RG.2.2.22202.59842
Polge, C., Smith, A. U., & Parkes, A. S. (1949). Revival
of Spermatozoa after Vitrification and Dehydration
at Low Temperatures. Nature, 164(4172), 666–666.
https://doi.org/10.1038/164666a0
Ponsart, C., Le Bourhis, D., Knijn, H., Fritz, S.,
Guyader-Joly, C., Otter, T., Lacaze, S.,
Charreaux, F., Schibler, L., Dupassieux, D., &
Mullaart, E. (2014). Reproductive technologies
and genomic selection in dairy cattle.
Reproduction, Fertility and Development, 26(1),
12. https://doi.org/10.1071/RD13328
Quang, T. (2020) "Đặt hàng" doanh nghiệp cung cấp
lợn giống cho người chăn nuôi.
https://danviet.vn/dat-hang-doanh-nghiep-cung-
cap-lon-giong-cho-nguoi-chan-nuoi-1085623.htm
Quyết định số 11/2006/QĐ-TTg, của Thủ tướng
Chính phủ, ngày 12 tháng 01 năm 2006 về việc
phê duyệt “Chương trình trọng điểm phát triển và
ứng dụng công nghệ sinh học trong lĩnh vực nông
nghiệp và phát triển nông thôn đến năm 2020”
Quyết định số 1520/2020/QD-TTg, của Thủ tướng
Chính phủ, ngày 6 tháng 10 năm 2020 về việc
phê duyệt “chiến lược phát triển chăn nuôi 2021-
2030, tầm nhìn 2045”.
Rall, W. F., & Fahy, G. M. (1985). Ice-free
cryopreservation of mouse embryos at −196 °C
by vitrification. Nature, 313(6003), 573–575.
https://doi.org/10.1038/313573a0
Rusco, G., Di Iorio, M., Gibertoni, P. P., Esposito,
S., Penserini, M., Roncarati, A., Cerolini, S., &
Iaffaldano, N. (2019). Optimization of Sperm
Cryopreservation Protocol for Mediterranean
Brown Trout: A Comparative Study of Non-
Permeating Cryoprotectants and Thawing Rates
In Vitro and In Vivo. Animals, 9(6), 304.
https://doi.org/10.3390/ani9060304
Shaffner, C. S., Henderson, E. W., & Card, C. G.
(1941). Viability of Spermatozoa of the Chicken
Under Various Environmental Conditions. Poultry
Science, 20(3), 259–265.
https://doi.org/10.3382/ps.0200259
Smith, J. L., Wilson, M. L., Nilson, S. M., Rowan, T.
N., Schnabel, R. D., Decker, J. E., & Seabury, C.
M. (2022). Genome-wide association and genotype
by environment interactions for growth traits in
114
Tập 58, Số Chuyên đề SDMD (2022): 104-114
U.S. Red Angus cattle. BMC Genomics, 23(1),
517. https://doi.org/10.1186/s12864-022-08667-6
Soliman, F., & El-Sabrout, K. (2020). Artificial
insemination in rabbits: Factors that interfere in
assessing its results. Journal of Animal
Behaviour and Biometeorology, 8(2), 120–130.
https://doi.org/10.31893/jabb.20016
Squires, E. L., McCue, P. M., & Vanderwall, D.
(1999). The current status of equine embryo
transfer. Theriogenology, 51(1), 91–104.
https://doi.org/10.1016/S0093-691X(98)00234-9
Thibier, M., & Wagner, H.-G. (2002). World
statistics for artificial insemination in cattle.
Livestock Production Science, 74(2), 203–212.
https://doi.org/10.1016/S0301-6226(01)00291-3
Tomka, J., Huba, J., & Pavlík, I. (2022). State of
conservation of animal genetic resources in
Slovakia. Genetic Resources, 3(6), 49–63.
https://doi.org/10.46265/genresj.XRHU9134
van Wagtendonk-de Leeuw, A. M. (2006). Ovum Pick
Up and In Vitro Production in the bovine after use in
several generations: A 2005 status. Theriogenology,
65(5), 914–925.
https://doi.org/10.1016/j.theriogenology.2005.09.007
Viana, J. (2019). 2018 Statistics of embryo production
and transfer in domestic farm animals. Embryo
Technology Newsletter, 36(4), 17.
Walters, E. M., Benson, J. D., Woods, E. J., &
Critser, J. K. (2009). The history of sperm
cryopreservation. In A. A. Pacey & M. J.
Tomlinson (Eds.), Sperm Banking (1st ed., pp. 1–
17). Cambridge University Press.
https://doi.org/10.1017/CBO9781139193771.002
Wiebke, M., Hensel, B., Nitsche-Melkus, E., Jung, M.,
& Schulze, M. (2021). Cooled storage of semen
from livestock animals (part I): Boar, bull, and
stallion. Animal Reproduction Science, 106822.
https://doi.org/10.1016/j.anireprosci.2021.106822
Woelders, H., Windig, J., & Hiemstra, S. (2012). How
Developments in Cryobiology, Reproductive
Technologies and Conservation Genomics Could
Shape Gene Banking Strategies for (Farm)
Animals: Technologies of Animal Gene Banking.
Reproduction in Domestic Animals, 47, 264–273.
https://doi.org/10.1111/j.1439-0531.2012.02085.x
Yánez-Ortiz, I., Catalán, J., Rodríguez-Gil, J. E., Miró,
J., & Yeste, M. (2021). Advances in sperm
cryopreservation in farm animals: Cattle, horse, pig
and sheep. Animal Reproduction Science, 106904.
https://doi.org/10.1016/j.anireprosci.2021.106904
Yang, S. (2020). Assisted reproductive technologies in
nonhuman primates. In Reproductive Technologies in
Animals (pp. 181–191). Elsevier.
https://doi.org/10.1016/B978-0-12-817107-3.00012-6
KHKT Chăn nuôi Số 282 - tháng 11 năm 2022

Phó Tổng biên tập Phụ trách: DI TRUYỀN - GIỐNG VẬT NUÔI
PGS.TS. NGUYỄN VĂN ĐỨC Vũ Khắc Tùng, Trần Hiếu Thuận, Nguyễn Trọng Ngữ và Nguyễn Thiết. Đặc điểm
ngoại hình và tập tính lựa chọn thức ăn của gà Rừng Tai Trắng (Gallus gallus gallus)
Phó Tổng biên tập: tại huyện Tịnh Biên - tỉnh An Giang 2
Đặng Hồng Quyên, Đỗ Thị Liên và Nguyễn Văn Duy. Năng suất sinh sản của 2
PGS.TS. NGUYỄN ĐĂNG VANG dòng vịt Biển hướng trứng nuôi tại Trung tâm nghiên cứu Vịt Đại Xuyên 7
TS. NGUYỄN XUÂN DƯƠNG Trần Ngọc Tiến, Tạ Thị Hương Giang, Nguyễn Quý Khiêm, Trần Thị Hà, Đặng Thị
Phương Thảo và Nguyễn Thị Tâm. Chọn tạo 2 dòng ngan từ ngan R41 nhập nội và
Thư ký tòa soạn: ngan Trâu bản địa 12
Tạ Thị Hương Giang, Trần Ngọc Tiến, Nguyễn Quý Khiêm, Vũ Đức Cảnh, Phạm
PGS.TS. NGUYỄN VĂN ĐỨC Thị Xuân, Phạm Thị Kim Thanh, Trần Thị Hà, Đặng Thị Phương Thảo, Phạm Thị
Huệ, Nguyễn Thị Tâm, Nguyễn Thị Minh Hường và Nguyễn Thị Yến. Khả năng sản
Ủy viên Ban biên tập: xuất của ngan bố mẹ (Trống NTP1VS1 và mái NTP2VS2) 18
TS. NGUYỄN QUỐC ĐẠT Phan Thị Tươi, Nguyễn Văn Trung, Trần Xuân Mạnh, Nguyễn Văn Phú, Nguyễn
Văn Hùng, Nguyễn Hoàng Thịnh và Đỗ Đức Lực. Kích thước một số chiều đo của
PGS.TS. HOÀNG KIM GIAO lợn Ỉ nuôi bảo tồn tại Công ty TNHH lợn giống Dabaco Phú Thọ 22
GS.TS. NGUYỄN DUY HOAN Bùi Ngọc Hùng, Hoàng Thị Ngân, Phạm Văn Quyến, Nguyễn Văn Tiến, Giang Vi
GS.TS. DƯƠNG NGUYÊN KHANG Sal, Nguyễn Thị Thủy, Phùng Thế Hải và Đào Văn Lập. Khả năng sinh trưởng bò
PGS.TS. NGUYỄN THỊ KIM KHANG lai giữa đực Charolais, Red Angus với cái Brahman tại Trung tâm Nghiên cứu và phát
PGS.TS. ĐỖ VÕ ANH KHOA triển chăn nuôi gia súc lớn 27
Hoàng Thị Ngân, Phạm Văn Quyến, Lê Thị Ngọc Thùy, Bùi Ngọc Hùng, Nguyễn
PGS.TS. ĐỖ ĐỨC LỰC Thị Thủy, Nguyễn Văn Tiến, Phan Văn Sỹ, Đỗ Thị Thanh Vân và Đỗ Chiến Thắng.
GS.TS. LÊ ĐÌNH PHÙNG Khả năng sinh trưởng của dê F1(Saanen x Bách thảo) tại Trung tâm nghiên cứu và
phát triển chăn nuôi gia súc lớn 34
Nguyễn Đức Lâm, Đào Đức Hảo, Phạm Công Thiếu, Vũ Ngọc Hiệu và Nguyễn
Xuất bản và Phát hành: Văn Lưu. Đặc điểm sinh học và hình thái ong đá (Apis Laboriosa) ở miền núi phía
ThS. NGUYỄN ĐÌNH MẠNH Bắc Việt Nam 39

U
DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI
Nguyễn Công Oánh, Phạm Thị Mai Hiên và Phạm Kim Đăng. Ảnh hưởng của bổ
sung chế phẩm Max2slive vào khẩu phần ăn đến khả năng sinh trưởng và chất lượng
thịt lợn 44
Nguyễn Thị Thương, Phan Thị Ngọc Thểu và Dương Nguyên Khang. Khảo sát tình
trạng cân bằng năng lượng âm trên bò sữa sau khi sinh tại TP. Hồ Chí Minh 50
Giấy phép: Bộ Thông tin và Truyền thông
Số 257/GP- BTTTT ngày 20/05/2016 CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC
ISSN 1859 - 476X Đặng Vũ Hòa, Đặng Thúy Nhung và Nguyễn Xuân Lới. Ảnh hưởng của vị trí trong
chuồng nuôi đến nhiệt độ, độ ẩm và các chỉ tiêu năng suất của gà đẻ trứng thương
Xuất bản: Hàng tháng phẩm 58
Toà soạn: Nguyễn Vĩ Nhân. Xác định hàm lượng Tanin trong cây thức ăn gia súc ở dạng tươi và
Địa chỉ: Tầng 4, Tòa nhà 73, sấy khô 63
Hoàng Cầu, Ô Chợ Dừa, Cù Thị Thiên Thu và Bùi Quang Tuấn. Xác định mức phân Ure phù hợp cho cỏ
Ghi-nê Mombasa và cỏ Mulato II trong điều kiện khô hạn vùng Nam Trung Bộ 67
Đống Đa, Hà Nội.
Sử Thanh Long, Phan Thị Hằng và Trịnh Văn Bình. Bước đầu nghiên cứu một số
Điện thoại: 024.36290621 yếu tố ảnh hưởng đến chức năng hoạt động của buồng trứng trên đàn bò H’mông tại
Fax: 024.38691511 vùng cao nguyên đá Hà Giang 71
E - mail: tapchichannuoi@hoichannuoi.vn Lê Thị Thanh. Dẫn liệu về thành phần thức ăn của một số loài lưỡng cư ở huyện Cao
Lãnh, tỉnh Đồng Tháp 76
Website: www.hoichannuoi.vn
Công Hà My, Vũ Hoài Nam, Nguyễn Lê Tiến Vũ, Phan Ngọc Linh và Bùi Khánh
Tài khoản: Linh. Ảnh hưởng của chiết xuất hạt cau đối với ấu trùng giun móc trong điều kiện
Tên tài khoản: Hội Chăn nuôi Việt Nam phòng thí nghiệm 82
Số tài khoản: 1300 311 0000 40, tại Ngân hàng Nguyễn Khánh Vân, Vũ Thị Thu Hương, Quản Xuân Hữu, Lê Văn Đạt, Phan Trung
Hiếu, Nguyễn Thị Lệ Hương, Lưu Quang Minh và Phạm Doãn Lân. Tạo dê sữa
Nông nghiệp và Phát triển Nông thôn, Chi nhánh Saanen từ phôi in vivo bằng kỹ thuật cấy chuyển phôi 87
Thăng Long - Số 4, Phạm Ngọc Thạch, Hà Nội.
In 1.000 bản, khổ 19x27 tại Công ty CP KH&CN THÔNG TIN KHOA HỌC VÀ CÔNG NGHỆ
Hoàng Quốc Việt. In xong và nộp lưu chiểu: PGS.TS. Lê Văn Năm. Bệnh mới: viêm mũi - khí quản gia cầm (avian rhino
tháng 11/2022. tracheitis-art) và biện pháp phòng trị 92
Ban Biên tập. Thử nghiệm gen tự loại bỏ trên muỗi 99
 DI TRUYỀN
DI TRUYỀN - GIỐNG VẬT NUÔI - GIỐNG VẬT NUÔI

ĐẶC ĐIỂM NGOẠI HÌNH VÀ TẬP TÍNH LỰA CHỌN THỨC ĂN

CỦA GÀ RỪNG TAI TRẮNG (GALLUS GALLUS GALLUS)
TẠI HUYỆN TỊNH BIÊN - TỈNH AN GIANG
Vũ Khắc Tùng1, Trần Hiếu Thuận1, Nguyễn Trọng Ngữ1 và Nguyễn Thiết1*
Ngày nhận bài báo: 25/6/2022 - Ngày nhận bài phản biện: 12/7/2022
Ngày bài báo được chấp nhận đăng: 25/7/2022
TÓM TẮT
Mục tiêu của nghiên cứu là đánh giá đặc điểm ngoại hình và tập tính lựa chọn thức ăn của
gà Rừng Tai Trắng (Gallus gallus gallus) tại huyện Tịnh Biên, tỉnh An Giang. Thí nghiệm theo dõi
trên 8 cá thể trưởng thành (4 gà trống và 4 gà mái). Số liệu được thu thập bằng cách quan sát ghi
chép về các đặc điểm ngoại hình bên ngoài kết hợp với lấy các số liệu cân đo trực tiếp trên đàn gà
thí nghiệm. Đối với đặc tính lựa chọn thức ăn, thí nghiệm sử dụng 7 loại thức ăn và các máng ăn
riêng lẻ trong chuồng nuôi. Kết quả nghiên cứu cho thấy gà Rừng Tai Trắng (RTT) trống trong thí
nghiệm có sự đồng nhất về màu lông (100% màu đỏ, đỏ cam, đen ánh kim, trắng). Trong khi đó, gà
mái có màu lông nâu, đen, xám chiếm 75% và 25% gà có màu lông nâu, đen, xám, vàng cam. Đa số
kích thước các chiều đo cơ thể của gà trống lớn hơn so với gà mái (P<0,05). Qua thí nghiệm tập tính
lựa chọn thức ăn cho thấy có 2 loại thức ăn được gà RTT ưa thích nhất trong tổng số 7 loại thức ăn
được sử dụng trong thí nghiệm là thịt heo và gạo lứt.
Từ khóa: Đặc điểm ngoại hình, gà Rừng Tai Trắng, tập tính ăn.
ABSTRACT
Morphological characteristics and eating behavior of Junglefowls (Gallus gallus gallus)
in Tinh Bien district, An Giang province
The aim of this study was to evaluate the morphological characteristics and eating behavior of
Junglefowls (Gallus gallus gallus) in Tinh Bien district, An Giang province. The experiment observeb
on eight adult Junglefowls (04 roosters and 04 hens). The data collection on morphological
characteristics were recorded by observation or directly measured by ruler from the Junglefowls.
For eating behavior, this experiment used seven types of feed, put into the trough and hang in the
barn. The results from present study show that male Junglefowls were uniformity in feather color
(red, red-orange, iridescent black, white), whereas female Junglefowls were 75% feather color in
brown, black and gray, and remained 25% feather color in brown, black, gray and yellow-orange.
Most of body measurements from rooster were greater than those from hens (P<0.05). Through
eating behavior experiment, there were two types of feed (pork and brown rice) which were
preferred by Junglefowls.
Keywords: Gallus gallus gallus, morphological characteristics, eating behavior.

1. ĐẶT VẤN ĐỀ những năm qua, tốc độ tăng trưởng ngành

chăn nuôi có xu hứng tăng lên rõ rệt. Tăng
Chăn nuôi là ngành cung cấp thực
trưởng bình quân mỗi năm, trong 3 năm qua
phẩm, nguồn protein động vật chủ yếu cho
(2011-2013) là 9,10%. Trong năm 2013, giá trị
cuộc sống hàng ngày của cộng đồng và chăn
sản xuất của ngành chăn nuôi đạt 147.979 tỷ
nuôi cũng là công việc giúp người dân nâng
đồng, chiếm 24,60% tổng giá trị sản xuất của
cao thu nhập, tạo công việc cho người lao
ngành nông nghiệp (Lê Thị Mai Hương và
động, góp phần phát triển kinh tế. Trong
Trần Văn Hùng, 2015). Với sự phát triển của
1
Trường Đại học Cần Thơ ngành chăn nuôi đã tạo ra nhiều loài vật nuôi
* Tác giả liên hệ: TS. Nguyễn Thiết, Khoa Phát triển Nông
thôn, Trường Đại học Cần Thơ. Điện thoại: 0932147900; khác nhau từ các nguồn gen bản địa hoặc các
Email: nthiet@ctu.edu.vn loài hoang dã,…

2 KHKT Chăn nuôi số 282 - tháng 11 năm 2022

DI TRUYỀN - GIỐNG VẬT NUÔI
Trong thời điểm hiện nay, nhu cầu sử
dụng động vật làm thực phẩm có nguồn gốc
hoang dã hay được chăn nuôi gần giống như
tự nhiên ngày càng gia tăng. Tuy nhiên, việc
săn bắt sử dụng động vật hoang dã bị cấm
vì vậy việc nuôi các loài này là phương pháp
khả thi nhất. Đa phần các loài này được người
dân nuôi để tăng thu nhập, tuy nhiên hầu hết
đều mang tính tự phát, nhỏ lẻ, thiếu nhiều
kỹ thuật chăn nuôi nên hiệu quả chăn nuôi
chưa được cao, trong đó có gà Rừng Tai Trắng
(Gallus gallus gallus) (Phạm Nhật và Nguyễn
Xuân Đặng, 2005). Gà Rừng Tai Trắng (RTT)
là một trong ba loài gà rừng được người dân
thuần hóa nuôi nhốt tại huyện Tịnh Biên, tỉnh
An Giang. Tuy nhiên, các nghiên cứu về giống
gà RTT vẫn rất ít, đặc biệt là xác định đặc điểm
ngoại hình còn rất hạn chế. Ngoài ra, do gà
RTT trong tự nhiên được người dân gài bẫy
và bắt về nuôi thuần hóa nên việc xác định tập
tính ăn sẽ giúp cho quá trình nuôi sẽ tốt hơn.
Do đó, nghiên cứu này được thực hiện nhằm
đánh giá đặc điểm ngoại hình và tập tính lựa
chọn loại thức ăn góp phần xây dựng khẩu
phần ăn thích hợp để chăn nuôi chúng có hiệu
quả cao hơn.
2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU
2.1. Đối tượng và địa điểm
Thí nghiệm (TN) được thực hiện trên
tổng số 8 cá thể gà RTT trưởng thành (4 con
trống và 4 con mái) có nguồn gốc tại huyện
Tịnh Biên, tỉnh An Giang được nuôi nhốt tại
hộ dân.
2.2. Bố trí thí nghiệm
Thí nghiệm được thực hiện trên 8 cá thể (4
trống và 4 mái) gà RTT trưởng thành có nguồn
gốc tại huyện Tịnh Biên, tỉnh An Giang. Do
đặc tính nhút nhát và đang trong quá trình
sinh sản của gà RTT nên 8 cá thể được chia
nhỏ vào 4 ô chuồng, mỗi ô nuôi một trống và
một mái để tiện cho việc chăm sóc, quản lý
và thu thập số liệu. Chuồng nuôi có đầy đủ
các điều kiện ánh sáng, nhiệt độ thích hợp;
có nguồn nước sạch được cung cấp thường
xuyên. Gà được cho ăn bằng các loại rau xanh
KHKT Chăn nuôi số 282 - tháng 11 năm 2022
tự nhiên và kết hợp cùng các loại thức ăn tinh,
thức ăn hỗn hợp.
2.2.1. Đánh giá đặc điểm ngoại hình
Đặc điểm ngoại hình của gà RTT trống và
mái được đánh giá bằng phương pháp quan
sát, chụp ảnh, ghi chép mô tả các đặc điểm
hình thái. Các chiều đo cơ thể của gà RTT
được đo ở cùng thời điểm với thời gian mô
tả đặc điểm ngoại hình. Theo Bùi Xuân Mến
(2007) và Bùi Hữu Đoàn và ctv (2011), các chỉ
tiêu ngoại hình thường được sử dụng đánh
giá trong gia cầm gồm:
Dài mỏ: Đo bằng thước kẹp, có điểm đo từ
gốc mỏ đến chót mỏ.
Rộng mỏ: Đo bằng thước kẹp, để thước ở
giữa hai bên thành mỏ phần giữa của chiều
dài mỏ.
Dài đầu: Đo bằng thước kẹp, khoảng đo từ
giữa gốc mỏ đến sau xương chẩm.
Dài cổ: Đo bằng thước kẹp hoặc thước dây,
đo từ đốt sống cổ đầu tiên đến đốt sống cổ
cuối cùng (giáp với đốt sống ngực đầu tiên).
Dài cánh: Đo bằng thước dây, từ nách cánh
đến chóp cánh, khi đo phải kéo cho thẳng cánh.
Dài thân: Đo bằng thước kẹp hoặc thước
dây, điểm đo từ đốt sống ngực đầu tiên đến
đốt sống hông cuối cùng giáp với xương đuôi.
Vòng ngực: Đo bằng thước dây, điểm đo
vòng ngực sau nách cánh.
Sâu ngực: Đo bằng thước kẹp, từ gốc cánh
đến mép trước xương lưỡi hái.
Dài ức: Đo bằng thước kẹp, từ mép trước
của lườn dọc theo đường thẳng tới cuối hốc
ngực phía trước (mỏm trước đến điểm cuối
cùng xương lưỡi hái).
Rộng ngực: Đo bằng thước kẹp, đo từ hai
điểm cong xương sườn rộng nhất sau nách cánh.
Góc ngực: Đo bằng giác kế, hai đầu giác kế
đặt vào ngực ở khoảng cách đầu trước xương
lưỡi hái về phía đầu 1cm và đọc kết quả ghi
trên giác kế.
Dài đùi: Đo bằng thước dây hoặc thước
kẹp, điểm đo kéo thẳng từ đầu xương đùi gắn
3
 DI TRUYỀN - GIỐNG VẬT NUÔI

với khớp hông đến cuối xương chày giáp với trình thử nghiệm. Loại thức ăn ưa thích của gà
xương bàn. RTT là loại thức ăn chúng lựa chọn ăn trước
Dài bàn chân: Đo bằng thước kẹp, đo và ăn với số lượng nhiều nhất.
thẳng từ đầu xương bàn chân đến cuối xưng Để xác định lượng thức ăn thu nhận
bàn chân giáp với xương ngón chân. (LTATN) và lựa chọn thức ăn của gà RTT, TN
Vòng bàn chân: Đo bằng thước dây, quấn đã tiến hành theo dõi trong 10 ngày. Thức ăn
thước dây xung quanh xương bàn chân ở vị trí đã được cung cấp cho gà RTT nuôi TN vào
giữa xương bàn chân. các thời điểm 08:00, 11:00, 15:00 và 18:00 trong
Khối lượng: Sử dụng cân điện tử với giá trị ngày. Các loại thức ăn không trộn với nhau
nhỏ nhất là 0,1g. mà được cho vào các máng thức ăn riêng biệt.
Màu sắc lông: Quan sát và mô tả chi tiết Lượng thức ăn hàng ngày được tính bằng
màu lông của từng bộ phận như đầu, cổ, lông lượng thức ăn cho ăn của ngày hôm trước trừ
thân, lông cánh và lông đuôi. đi lượng thức ăn thừa của sáng ngày hôm sau.
Màu sắc da thân và da chân: Quan sát và mô 2.3. Xử lý số liệu
tả màu sắc. Số liệu được thu thập và xử lý thống kê
Hình dạng và màu sắc mào: Quan sát và mô mô tả trên phần mềm Microsoft Excel 2013.
tả hình dáng, màu sắc. So sánh số đo cơ thể giữa gà trống và gà mái
Hình ảnh: Ảnh chụp các đặc điểm của gà bằng so sánh không cặp đôi (unpair T-test). Sự
trong quá trình lấy chỉ tiêu. khác biệt có ý nghĩa thống kê khi P<0,05.
2.2.2. Đánh giá tập tính lựa chọn thức ăn 3. KẾT QUẢ VÀ THẢO LUẬN
Tập tính lựa chọn thức ăn của gà RTT 3.1. Đặc điểm ngoại hình
trưởng thành được đánh giá dựa trên sự lựa
chọn các loại thức ăn được cung cấp trong 3.1.1. Kiểu hình, màu sắc gà Rừng Tai Trắng
nghiên cứu. Dựa trên cơ sở tập tính và đặc Điểm nổi bật của gà RTT là có tai và yếm
điểm lựa chọn sử dụng thức ăn của gà RTT tại tai trắng. Gà trống có sự đồng nhất về màu
huyện Tịnh Biên, tỉnh An Giang, thí nghiệm lông, nhưng gà mái có 3 màu lông chủ yếu là
cung cấp các loại thức ăn bao gồm: tấm, lúa, nâu, đen, xám trên cơ thể, tuy nhiên cũng có
gạo lứt, thức ăn hỗn hợp (TAHH), thịt lợn, những cá thể gà có thêm lông màu vàng cam
chuối chín và rau muống. Các loại thức ăn (Bảng 1). Ở phần đầu và cổ, gà có lông màu
này được cho ăn hàng ngày với lượng thức đỏ-cam xuất hiện, phần lưng có 3 màu lông
ăn bằng nhau và cho ăn trong các máng ăn gồm đỏ, đỏ-cam và đen, phần bụng lông màu
riêng biệt. Các chỉ tiêu được theo dõi trong thí đen. Cánh gà có lông màu đỏ-cam và màu đen
nghiệm bao gồm các loại thức ăn ưa thích và có ánh kim, đầu phiến lông tròn. Đuôi gà có
lượng thức ăn hằng ngày. lông ống màu đen ánh kim và các lông tơ màu
Mục đích thí nghiệm là xác định được loại trắng ở gốc đuôi, hai lông đuôi giữa dài cong
thức ăn ưa thích của gà RTT thông qua quá xuống hình lưỡi liềm.
Bảng 1. Màu sắc lông của gà Rừng Tai Trắng theo giới tính
Gà mái (n=4) Gà trống (n=4) Chung (n=8)
Màu lông
n (con) Tỷ lệ (%) n (con) Tỷ lệ (%) n (con) Tỷ lệ (%)
Đỏ cam, đỏ, đen ánh kim, trắng 0 0 4 100 4 50
Nâu, đen, xám, vàng cam 1 25,00 0 0 1 12,50
Nâu, đen, xám 3 75,00 0 0 3 35,50
Trong nghiên cứu này, tỷ lệ gà mái có lông đen xuất hiện đều trên các bộ phận gồm đầu,
nâu, đen, xám chiếm 75% và chỉ có màu nâu, cổ, thân, cánh và đuôi, riêng màu xám chỉ xuất

4 KHKT Chăn nuôi số 282 - tháng 11 năm 2022

DI TRUYỀN - GIỐNG VẬT NUÔI

hiện dưới bụng. Trong khi đó, 25% là nâu, đen, nghiên cứu chỉ thực hiện trên một số lượng
xám và vàng cam; màu vàng cam chỉ xuất hiện ít cá thể đại diện (4 trống và 4 mái). Kết quả
ở đầu và cổ còn các màu còn lại giống với 75% trình bày tại bảng 4 cho thấy có sự chênh lệch
gà mái còn lại. So với kết quả của Nguyễn Thị khá rõ về kích thước cơ thể của gà trống và gà
Thu Ngân (2014), gà RTT trong thí nghiệm có mái trưởng thành. Kết quả các chỉ tiêu về một
màu sắc lông giống với gà Rừng Tai Đỏ vùng số chiều đo cơ thể như rộng mỏ, dài đầu, dài
Đông Bắc. Tuy nhiên, gà Rừng Tai Đỏ Đông cổ, dài cánh, dài thân, sâu ngực, dài bàn chân,
Bắc lại có lông cổ ngắn và màu vàng cam. vòng bàn chân và dài đùi tại thời điểm đo là
Đối với màu da, gà RTT có da thân là màu gà RTT trưởng thành có sự khác biệt rõ rệt với
trắng và da chân là màu xanh đen. Tỷ lệ màu mức ý nghĩa thống kê P>0,05.
da chân xanh đen là 100% và da thân trắng là Bảng 4. Chiều đo gà Rừng Tai Trắng trưởng thành
100%. Đối với mào, gà RTT trong nghiên cứu
Chỉ tiêu Trống (n=4) Mái (n=4)
này có 2 loại mào xuất hiện là mào lá và mào (cm) P
Mean±SE Mean±SE
dâu. Đối với mào dâu chỉ xuất hiện ở gà mái
Khối lượng (g) 802,75±74,05 634,33±47,94 0,105
và chiếm 12,50%, còn lại là 87,50% số gà có
Dài mỏ 3,50±0,47 2,55±0,16 0,102
mào dạng lá (Bảng 2). Rộng mỏ 1,15±0,03 1,00±0,04 0,024
Bảng 2. Hình dạng mào của gà Rừng Tai Trắng Dài đầu 3,73±0,09 3,45±0,06 0,037
Dài cổ 12,78±0,40 11,20±0,23 0,014
Mái (n=4) Trống (n=4) TB (n=8)
Chỉ tiêu Dài cánh 18,55±0,21 15,60±0,19 0,000
n Tỷ lệ n Tỷ lệ n Tỷ lệ
(con) (%) (con) (%) (con) (%) Dài thân 15,10±0,21 12,88±0,44 0,004
Mào lá 3 75 4 100 7 87,5 Dài ức 8,48±0,02 8,20±0,66 0,694
Mào dâu 1 25 0 0 1 12,5 Sâu ngực 9,25±0,36 7,88±0,35 0,034
Rộng ngực 5,80±0,18 5,68±0,06 0,541
Màu sắc của mào gà RTT cũng đa dạng, Vòng ngực 24,53±0,56 22,90±0,56 0,085
mào có màu đỏ đậm chiếm 25,00% tổng số gà thí Gốc ngực (o) 78,00±2,00 82,00±2,83 0,292
nghiệm trong đó có 01 con trống và 01 con mái. Dài bàn chân 8,75±0,12 7,05±0,26 0,001
Đối với màu đỏ tía có 1 gà trống. Đối với mào Vòng bàn chân 3,55±0,12 2,90±0,04 0,002
màu đỏ nhạt tỷ lệ xuất hiện cao nhất là 50,00% Dài đùi 16,78±0,44 14,05±0,41 0,004
trong đó có 3 gà mái 1 gà trống (Bảng 3).
Nguồn: Kết quả nuôi thí nghiệm gà Rừng Tai Trắng tại
Bảng 3. Màu sắc mào của gà Rừng Tai Trắng huyện Tịnh Biên tỉnh An Giang năm 2018
Mái (n=4) Trống (n=4) TB (n=8) Khối lượng gà RTT trưởng thành lần lượt
Chỉ tiêu n Tỷ lệ n Tỷ lệ n Tỷ lệ là 802,75 và 634,33g tương ứng với gà trống
(con) (%) (con) (%) (con) (%)
và mái. Kết quả này thấp hơn so với gà Rừng
Đỏ đậm 1 25,00 1 25,00 2 25,00
Tai Đỏ nuôi tại Vườn Quốc gia Cúc Phương
Đỏ tía 0 0 1 25,00 1 12,50
Đỏ nhạt 3 75,00 1 25,00 4 50,00
(Phạm Hải Ninh và ctv, 2017). Tuy có sự khác
nhau, nhưng sự khác biệt đó không có ý nghĩa
Màu sắc của yếm tai là một trong những thống kê với mức P>0,05 (Bảng 4). Kết quả này
đặc điểm nổi bật nhất và dễ dàng nhất để phù hợp với kết quả thí nghiệm của Del Hoyo
nhận biết các loại gà RTT ở Việt Nam trên và ctv (1994) là đối với gà trống là 672-1.500g
cả 2 giới tính trống và mái. Kết quả quan sát và gà mái là 485-1.050g. Theo Dương Thị Anh
trong thí nghiệm cho thấy gà RTT có yếm tai Đào (2016), đối với gà Rừng Tai Đỏ trưởng
màu trắng. thành con trống và con mái có KL lần lượt là
3.1.2. Kích thước một số chiều đo và khối 1.252,00 và 703,30g, cao hơn gà RTT trưởng
lượng gà thành. Khối lượng gà RTT trong nghiên cứu
Do đặc tính hoang dã của gà RTT còn rất này thấp hơn so với công bố trong nghiên cứu
cao, nên quá trình thu thập các chỉ tiêu trong trên gà Rừng Tai Đỏ nuôi tại vườn thú Hà Nội

KHKT Chăn nuôi số 282 - tháng 11 năm 2022 5


(Nguyễn Thị Thu Ngân, 2014) và gà Rừng Tai
Đỏ thương phẩm nuôi tại Vườn Quốc gia Cúc
Phương (Phạm Hải Ninh và ctv, 2018).
3.2. Thức ăn của gà Rừng Tai Trắng
Để mang lại hiệu quả cho chăn nuôi gà
RTT, thức ăn là một yếu tố rất quan trọng vì
nó đóng góp đến 60-70% giá thành sản phẩm.
Vì vậy, việc xác định được khẩu phần ăn hàng
ngày của gà RTT thích hợp có thể chủ động
nguồn thức ăn và sử dụng được hiệu quả
nguồn thức ăn từ đó nâng cao được năng suất
và chất lượng của sản phẩm và hiệu quả chăn
nuôi. Để thiết kế được khẩu phần ăn thích
hợp, việc nghiên cứu tập tính chọn loại thức
ăn là rất quan trọng. Dựa trên tình hình điều
tra thực tế, đề tài đã đề xuất đưa ra 7 loại thức
ăn thông dụng để xác định tập tính ăn của gà
RTT. Qua quá trình TN có thể thấy được các
loại thức ăn ưa thích của gà RTT (Bảng 5).
Bảng 5. Thức ăn ưa thích của gà Rừng Tai Trắng
Loại Lượng ăn tươi Ưa
thức ăn (g/con/ngày) thích
Ghi chú
Tấm 2,11 + trong lúc đó kết quả thí nghiệm này thì 4 loại
Lúa 2,71 + thức ăn đó chỉ ở mức bình thường. Kết quả
Gạo lức 12,29 +++
TAHH 6,98 ++ TA cho gà
Thịt heo 23,24 +++ Chín, cắt nhỏ
Rau muống 4,23 ++ Cắt nhỏ
Chuối chín 1,96 +
Tổng 53,51
Chú thích: +++ ăn nhiều; ++ bình thường; + ăn ít.
Kết quả thí nghiệm cho thấy lượng thức
ăn tiêu thụ (LTATN) của gà RTT trong ngày
là 53,51 g/con, thấp hơn so với kết quả của
Nguyễn Chí Thành và Vũ Tiến Thịnh (2014)
công bố là 140,22 g/con. Tuy nhiên, kết quả về
LTATN có sự chênh lệch có thể xuất phát từ
nguyên nhân khối lượng gà RTT trưởng thà-
nh trong nghiên cứu của Nguyễn Chí Thành
và Vũ Tiến Thịnh (2014) là 1.250g đối với gà
trống và 1.100g đối với gà mái, đều cao hơn so
với 802,75g của gà trống và gà mái là 634,33g
của thí nghiệm này.
Thí nghiệm cũng cho biết loại thức ăn
ưa thích nhất của GR là thịt lợn chặt nhỏ và
6 KHKT Chăn nuôi số 282 - tháng 11 năm 2022
DI TRUYỀN - GIỐNG VẬT NUÔI
gạo lứt với khối lượng thức ăn/con/ngày lần
lược là 23,24 và 12,29g. Đối với TAHH và rau
muống, gà RTT chỉ ưa thích ở mức độ bình
thường, mỗi ngày 2 loại thức ăn này được
tiêu thụ bởi 1 con là 6,98 và 4,23g. Lúa, tấm
và chuối chín là 3 loại thức ăn mà gà RTT ăn
ít nhất với khối lượng lần lược là 2,71; 2,11 và
1,96g. Kết quả này là căn cứ quan trọng trong
việc thiết kế khẩu phần ăn của gà RTT một
cách hợp lý nhất nhằm đạt được kết quả tốt
nhất trong quá trình nuôi gà RTT.
Đối với gà RTT trong thí nghiệm này chỉ
có 2 loại thức ăn ưa thích là thịt lợn và gạo
lứt. Trong lúc đó, theo Nguyễn Chí Thành và
Vũ Tiến Thịnh (2014), gà Rừng trưởng thành
có 6 loại thức ăn ưa thích gồm: rau xanh, gạo,
TAHH, bắp, lúa và quả mềm. Trong 6 loại
thức ăn này, không có thịt và gạo lứt so với
thí nghiệm này của chúng tôi. Kết quả nghiên
cứu của Nguyễn Chí Thành và Vũ Tiến Thịnh
(2014) cho biết rau xanh, TAHH, lúa và quả
mềm là các loại thức ăn ưa thích của gà RTT,
này có thể lý giải bởi nguyên nhân gà RTT
trong nghiên cứu của Nguyễn Chí Thành và
Vũ Tiến Thịnh (2014) đã được cho ăn các loại
thức ăn này từ khi tập ăn.
Tính theo lượng vật chất khô, tỷ lệ thức
ăn gà RTT tiêu thụ cao nhất là gạo lứt, chiếm
36,73%, tiếp đến là thịt heo với 24,77% và
TAHH là 20,87%. Đối với lúa, tấm, chuối chín
và rau muống chiếm tỷ lệ thấp, lần lượt là
8,10; 6,31; 1,98 và 1,23% (Bảng 6).
Bảng 6. Lượng thức ăn/ngày theo vật chất khô
Loại Lượng ăn Tỷ lệ
thức ăn (g/con/ngày) (%)
Tấm 1,90 6,31
Lúa 2,44 8,10
Gạo lức 11,06 36,73
TAHH 6,29 20,87
Thịt heo 7,46 24,77
Rau muống 0,37 1,23
Chuối chín 0,60 1,98
Tổng 30,11 100
DI TRUYỀN - GIỐNG VẬT NUÔI

4. KẾT LUẬN
Kết quả quan sát thực tế về lông của gà
trống có màu sắc nổi bật gồm các màu đỏ, đỏ
cam, đen ánh kim và trắng; trong lúc đó gà
mái có màu xám là màu chủ đạo, ngoài ra còn
có các màu khác như đen, nâu và vàng cam.
Da thân của gà RTT có màu trắng và da chân
thì có màu xanh đen. Đối với mào, có 2 loại là
mào lá và mào dâu, mào dâu chỉ xuất hiện ở
gà mái. Gà RTT trống có các chỉ số chiều đo và
khối lượng cơ thể lớn hơn gà mái. Thí nghiệm
cũng cho thấy có 2 loại thức ăn ưa thích nhất
của gà RTT là thịt heo và gạo lứt. Đối với rau
quả, gà RTT thích ăn rau muống. Vào thời
điểm buổi sáng và buổi chiều là thời gian gà
RTT ăn nhiều nhất trong ngày.
LỜI CẢM ƠN
Nhóm tác giả xin chân thành cảm ơn sự hỗ trợ
về kinh phí thực hiện nghiên cứu này của Sở Khoa
học và Công nghệ, UBND tỉnh An Giang (Quyết
định số 1046/QĐ-UBND).
TÀI LIỆU THAM KHẢO
1. Dương Thị Anh Đào (2016). Khả năng sinh sản của gà
rừng tai đỏ (Gallus gallus spadiceus) nuôi tại vườn quốc
gia Cúc Phương. Tạp chí KH Đại học Quốc gia Hà nội:
Khoa học Tự nhiên và Công nghệ, 32(2): 85-91.
2. Del Hoyo J., Elliott A. and Sargatal J. (1994). Handbook
of the Birds of the World, 2: New World Vultures to
Guineafowl. Lynx Edicions, Barcelona.
3. Bùi Hữu Đoàn, Nguyễn Thị Mai, Nguyễn Thanh
Sơn và Nguyễn Huy Đạt (2011). Các chỉ tiêu dùng
trong nghiên cứu chăn nuôi gia cầm. NXB Nông
nghiệp, Hà Nội.
4. Lê Thị Mai Hương và Trần Văn Hùng (2015). Ngành
chăn nuôi trước thách thức Việt Nam gia nhập cộng
đồng kinh tế ASEAN (AEC). Tạo chí PT và Hội nhập,
23(33): 13-18.
5. Bùi Xuân Mến (2007). Giáo trình thực tập chăn nuôi gia
cầm. NXB Đại Học Cần Thơ.
6. Nguyễn Thị Thu Ngân (2014). Một số đặc điểm sinh
học, sinh trưởng và sinh sản của gà rừng (gallus gallus,
linnaeus) nuôi tại vườn thú Hà Nội. Luận văn Thạc sĩ,
Học Viện Nông nghiệp Việt Nam.
7. Phạm Nhật và Nguyễn Xuân Đặng (2005). Bài giảng
Nhân nuôi động vật hoang dã. Trường Đại học Lâm
Nghiệp.
8. Phạm Hải Ninh, Phạm Công Thiếu, Nguyễn Công
Định, Đặng Vũ Hòa, Nguyễn Quyết Thắng, Nguyễn
Khắc Khánh, Lê Thị Bình, Hoàng Xuân Thủy và
Nguyễn Hữu Cường (2017). Kết quả bước đầu nghiên
cứu đặc điểm ngoại hình và khả năng sản xuất của gà
Tai đỏ trong điều kiện nuôi nhốt. Tạp chí KHCN Chăn
nuôi, 80(10.17): 2-12.
9. Phạm Hải Ninh, Phạm Đức Đồng, Nguyễn Khắc
Khánh và Hoàng Xuân Thủy (2018). Khả năng sinh
trưởng, năng suất và chất lượng thịt Gà Tai Đỏ thương
phẩm. Tạp chí KHKT Chăn nuôi, 233(6.18): 26-33.
10. Nguyễn Chí Thành và Vũ Tiến Thịnh (2014). Đặt điểm
sinh trưởng và sử dụng thức ăn của gà rừng (Gallus
Linnaeus, 1758) trong điều kiện nuôi nhốt. Tạp chí
KHCN Lâm nghiệp, 1: 29-35.

NĂNG SUẤT SINH SẢN CỦA 2 DÒNG VỊT BIỂN HƯỚNG

TRỨNG NUÔI TẠI TRUNG TÂM NGHIÊN CỨU VỊT ĐẠI XUYÊN
Đặng Hồng Quyên1*, Đỗ Thị Liên1,2 và Nguyễn Văn Duy2
Ngày nhận bài báo: 10/6/2022 - Ngày nhận bài phản biện: 30/6/2022
Ngày bài báo được chấp nhận đăng: 11/7/2022
TÓM TẮT
Nghiên cứu được tiến hành trên 2 dòng vịt Biển hướng trứng gồm dòng trống (BT) và dòng
mái (TB) nhằm mục tiêu đánh giá năng suất sinh sản của vịt. Vịt biển hướng trứng được nuôi theo
phương thức nuôi nhốt không cần nước bơi lội áp dụng quy trình chăn nuôi của tại Trung tâm
Nghiên cứu Vịt Đại Xuyên. Kết quả cho thấy: Vịt dòng trống (BT) và dòng mái (TB) thành thục về
tính sớm, có tuổi đẻ quả trứng đầu tiên 19-20 tuần tuổi với khối lượng vào đẻ trung bình 1.633,87-
1.665,54 g/con; tỷ lệ đẻ 77,39-74,88%; năng suất trứng đạt 281,68-272,55 quả/ mái/52 tuần đẻ với tiêu
tốn thức ăn 2,13-2,23kg thức ăn/10 quả trứng và khối lượng trứng đạt 70,88-71,23 g. Tỷ lệ vỏ 10,43-

1
Trường Đại học Nông Lâm Bắc Giang
2
Trung tâm nghiên cứu vịt Đại Xuyên
* Tác giả liên hệ: TS. Đặng Hồng Quyên, Khoa Chăn nuôi - Thú y, Trường Đại học Nông Lâm Bắc Giang: TT Bích Động, Việt
Yên, Bắc Giang. Điện thoại: 0983816582. Email: quyendangbafu@gmail.com

KHKT Chăn nuôi số 282 - tháng 11 năm 2022 7

KHKT Chăn nuôi Số 281 - tháng 10 năm 2022

Phó Tổng biên tập Phụ trách: DI TRUYỀN - GIỐNG VẬT NUÔI
PGS.TS. NGUYỄN VĂN ĐỨC Bùi Phạm Mỹ Lan, Lê Tấn Lợi, Hoàng Tuấn Thành và Nguyễn Ngọc Tấn. Ảnh
hưởng đa hình gen Prolactin trên Exon 5 đến một số chỉ tiêu sinh sản ở nhóm vịt Lai
Phó Tổng biên tập: BT thế hệ I 2
Trần Ngọc Tiến, NguyễnTrọng Thiện, Vũ Quốc Dũng, Lê Ngọc Tân, Đặng Đình Tứ
PGS.TS. NGUYỄN ĐĂNG VANG và Nguyễn Văn Hùng. Khả năng sản xuất của gà chuyên trứng bố mẹ GT nuôi quy
TS. NGUYỄN XUÂN DƯƠNG mô trang trại tại Hà Nam 7
Vũ Khắc Tùng, Trần Hiếu Thuận, Nguyễn Trọng Ngữ, Trương Văn Khang và
Thư ký tòa soạn: Nguyễn Thiết. Khả năng sinh trưởng của gà rừng tai trắng (Gallus gallus gallus) giai
đoạn 0-12 tuần tuổi 11
PGS.TS. NGUYỄN VĂN ĐỨC Phạm Hải Ninh, Phạm Công Thiếu, Nguyễn Quyết Thắng, Phạm Đức Hồng và Lê
Thị Thanh Huyền. Năng suất sinh sản lợn Hương qua 3 thế hệ 15
Ủy viên Ban biên tập: Ngô Đình Tân, Tăng Xuân Lưu và Phan Tùng Lâm. Kết quả bước đầu về khả năng
TS. NGUYỄN QUỐC ĐẠT sản xuất và chất lượng thịt của bò Lai F1(Wagyu x Holstein) tại Ba Vì 24
PGS.TS. HOÀNG KIM GIAO
GS.TS. NGUYỄN DUY HOAN DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI
GS.TS. DƯƠNG NGUYÊN KHANG Nguyễn Mạnh Hà, Nguyễn Thị Thúy Mỵ, Nguyễn Thị Út, Phan Thu Hương, Ngô
PGS.TS. NGUYỄN THỊ KIM KHANG Thanh Xuân và Phạm Bá Uyên. Ảnh hưởng các mức protein trong khẩu phần đến
PGS.TS. ĐỖ VÕ ANH KHOA sinh trưởng vịt bầu Sín Chéng nuôi thịt tại Lào Cai 34
PGS.TS. ĐỖ ĐỨC LỰC Tạ Thị Hương Giang, Trần Ngọc Tiến, Nguyễn Quý Khiêm, Phạm Thùy Linh, Phạm
Thị Kim Thanh, Trần Thị Hà, Đặng Thị Phương Thảo, Đỗ Thị Nhung, Nguyễn Thị
GS.TS. LÊ ĐÌNH PHÙNG
Tâm và Nguyễn Thị Minh Hường. Xác định mức ăn thích hợp cho ngan mái NTP2
nuôi sinh sản giai đoạn hậu bị 37
Xuất bản và Phát hành: Phạm Ngọc Thảo, Nguyễn Quang Thiệu, Lã Văn Kính và Nguyễn Hữu Tỉnh. Ảnh
ThS. NGUYỄN ĐÌNH MẠNH hưởng của các mức năng lượng trao đổi và Lysine tiêu hóa hồi tràng chuẩn trong
khẩu phần đến khả năng nuôi con của lợn Nái cấp giống ông bà 42

U
Đoàn Phương Thúy, Dương Thị Vi, Nguyễn Văn Toản và Đoàn Văn Soạn. Ảnh hưởng
của Safmannan đến sinh trưởng, chuyển hóa thức ăn và chất lượng thịt lợn lai 48
Dương Trần Tuyết Mai, Nguyễn Thị Thu Hà, Trần Thị Thúy Hằng và Lâm Phước
Thành. Ảnh hưởng của dầu cá Ngừ và dầu hạt Lanh lên lượng ăn vào, khả năng tiêu
hóa, năng suất và thành phần sữa dê Saanen lai 53
Giấy phép: Bộ Thông tin và Truyền thông
Số 257/GP- BTTTT ngày 20/05/2016 CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC
ISSN 1859 - 476X Nguyễn Đình Vinh, Nguyễn Thị Dịu và Lương Hoàn Đức. Hiệu quả mô hình nuôi
gà liên Minh thương phẩm tại Hải Phòng và Quảng Ninh 59
Xuất bản: Hàng tháng
Phạm Văn Quyến, Nguyễn Văn Tiến, Trần Quang Hạnh, Nguyễn Đức Điện, Lê
Toà soạn: Năng Thắng, Giang Vi Sal, Hoàng Anh Dương và Hoàng Thị Ngân. Sử dụng liệu
Địa chỉ: Tầng 4, Tòa nhà 73, pháp kết hợp hormone để xử lý tình trạng chậm động dục ở bò cái sinh sản và bò cái
Hoàng Cầu, Ô Chợ Dừa, tơ hướng thịt tại tỉnh Đắk Lắk 64
Đống Đa, Hà Nội. Phạm Văn Quyến, Nguyễn Văn Tiến, Trần Quang Hạnh, Nguyễn Đức Điện, Lê
Năng Thắng, Giang Vi Sal, Hoàng Anh Dương và Hoàng Thị Ngân. Giải pháp can
Điện thoại: 024.36290621 thiệp sản khoa và sử dụng liệu pháp hormone để xử lý tình trạng gieo tinh nhiều lần
Fax: 024.38691511 không đậu thai trên bò cái sinh sản hướng thịt tại tỉnh Đắk Lắk 72
E - mail: tapchichannuoi@hoichannuoi.vn Đặng Hồng Quyên, Nguyễn Thu Hằng và Bùi Tiến Đạt. Hiệu quả bổ sung chế phẩm
Lacto đến khả năng sinh trưởng của ếch Thái Lan (Ranna Tigerina) 78
Website: www.hoichannuoi.vn Nguyễn Văn Lanh, Tất Tân Hy, Đinh Đức Tân, Nguyễn Thanh Hải, Ngô Hồng
Tài khoản: Phượng và Nguyễn Thị Mỹ Nhân. Hiệu quả giảm phát thải khí mêtan In vitro với
Tên tài khoản: Hội Chăn nuôi Việt Nam khẩu phần thức ăn chăn nuôi bò thịt qua các quy trình xử lý nhiệt 84
Ngô Anh Đức, Công Thế Anh và Sử Thanh Long. Một số yếu tố ảnh hưởng đến tỷ
Số tài khoản: 1300 311 0000 40, tại Ngân hàng lệ bò động dục lại sau đẻ và bệnh buồng trứng trên bò cái lai Zebu tại Nghĩa Đàn,
Nông nghiệp và Phát triển Nông thôn, Chi nhánh Nghệ An 90
Thăng Long - Số 4, Phạm Ngọc Thạch, Hà Nội.
In 1.000 bản, khổ 19x27 tại Công ty CP KH&CN THÔNG TIN KHOA HỌC VÀ CÔNG NGHỆ
Hoàng Quốc Việt. In xong và nộp lưu chiểu: Ban Biên tập. Hội nghị Chăn nuôi Á-Úc AAAP19 tổ chức tại Hàn Quốc đã thành công
tháng 10/2022. tốt đẹp 96
Ban Biên tập. Giới thiệu mẫu viết bài tóm tắt và abstract cho Hội nghị AAAP 98
DI TRUYỀN - GIỐNG VẬT NUÔI

85,67%; 96,07 và 86,39%; và 96,31 và 86,61%. TÀI LIỆU THAM KHẢO

Như vậy, gà bố mẹ GT nuôi tại mô hình có tỷ
lệ phôi đạt tương đương gà VCN-G15, nhưng
thấp hơn gà AVG và gà VGA.
4. KẾT LUẬN
Gà bố mẹ GT có năng suất chất lượng cao,
dễ nuôi, tiêu tốn thức ăn thấp và nuôi chúng
mang lại hiệu quả cao. Với kết quả này cho
thấy khả năng sản xuất, phát triển thành giống
vật nuôi phổ biến. Triển khai mô hình chăn
nuôi gà bố mẹ GT tại Hà Nam thu được kết quả
khả quan: TLNS các giai đoạn gà con và dò hậu
bị đều đạt cao (96,33-97,675%); KL lúc 19 tuần
tuổi gà trống đạt 1.890,40g và mái đạt 1.462,40g,
TTTA/con/giai đoạn ở gà trống là 8,25 kg/con
và gà mái là 7,07 kg/con. Các chỉ tiêu này đều
tương đương với các dòng gà trứng khác.
Gà có tuổi đẻ đầu là 135 ngày, NST/mái/68
tuần tuổi đạt 260,00 quả, TTTA/10 trứng
là 1,72kg, TLĐ trung bình đạt 76,25%. Tỷ lệ
trứng chọn ấp đạt 92,42%; tỷ lệ phôi 94,40%;
tỷ lệ nở/tổng trứng ấp đạt 82,15%.
LỜI CẢM ƠN
Nhóm tác giả xin chân thành cảm ơn sự
tài trợ kinh phí từ Dự án SXTN cấp Nhà nước
DAĐL.CN-04/20.
1. Bùi Hữu Đoàn, Nguyễn Thị Mai, Nguyễn Huy
Đạt và Nguyễn Thanh Sơn (2011). Một số chỉ tiêu
nghiên cứu trong chăn nuôi gia cầm, NXB Nông
nghiệp, Hà Nội.
2. Trần Kim Nhàn, Phạm Công Thiếu, Vũ Ngọc Sơn,
Hoàng Văn Tiệu, Diêm Công Tuyên, Nguyễn Thị
Thúy và Nguyễn Thị Hồng (2010). Năng suất và chất
lượng trứng gà lai giữa gà VCN-G15 với gà Ai Cập.
Tạp chí KHCN Chăn nuôi, 26: 26-34
3. Nguyễn Quý Khiêm, Phùng Đức Tiến, Phạm Thùy
Linh, Trần Ngọc Tiến, Nguyễn Thị Kim Oanh,
Nguyễn Thị Tình, Nguyễn Thị Nga, Lê Thị Thu Hiền,
Nguyễn Trọng Thiện và Phùng Văn Cảnh (2016). Báo
cáo Nghiệm thu đề tài cấp Nhà nước Nghiên cứu chọn
tạo bốn dòng gà chuyên trứng cao sản.
4. Phùng Đức Tiến, Nguyễn Quý Khiêm, Nguyễn Thị
Mười và Phạm Thùy Linh (2009). Kết quả nghiên cứu
chọn tạo hai dòng gà hướng trứng HA1, HA2, Phần
Di truyền - Giống vật nuôi, BCKH Viện Chăn nuôi, Hà
Nội, tháng 11/2010: 194-06
5. Trần Ngọc Tiến, Nguyễn Quý Khiêm và Phạm Thùy
Linh (2018). Khả năng sản xuất của gà bố mẹ GT12,
GT34 và gà lai thương phẩm GT 1234. Tạp chí KHKT
Chăn nuôi, 231: 7-13.
6. Trần Ngọc Tiến (2019). Nghiên cứu chọn tạo 4 dòng
gà chuyên trứng cao sản GT1, GT2, GT3 và GT4. Luận
án tiến sĩ Nông nghiệp. Viện Chăn nuôi, Hà Nội.
7. Diêm Công Tuyên, Phạm Công Thiếu, Vũ Ngọc Sơn
và Hoàng Văn Tiệu (2009). Đặc điểm ngoại hình và
khả năng sản xuất của gà mái ¾ Ai Cập. BCKH Viện
Chăn nuôi năm 2009. Phần Di truyền-giống vật nuôi:
262-68.

KHẢ NĂNG SINH TRƯỞNG CỦA GÀ RỪNG TAI TRẮNG

(GALLUS GALLUS GALLUS) GIAI ĐOẠN 0-12 TUẦN TUỔI
Vũ Khắc Tùng1, Trần Hiếu Thuận1, Nguyễn Trọng Ngữ1, Trương Văn Khang1 và Nguyễn Thiết1*
Ngày nhận bài báo: 25/6/2022 - Ngày nhận bài phản biện: 12/7/2022
Ngày bài báo được chấp nhận đăng: 25/7/2022
TÓM TẮT
Mục tiêu của đề tài là đánh giá khả năng sinh trưởng của gà Rừng Tai Trắng (Gallus gallus
gallus) giai đoạn từ 0 tuần tuổi (TT) đến 12TT. Thí nghiệm theo dõi trên 30 cá thể gà Rừng Tai Trắng
giai đoạn 0-12TT trong điều kiện nuôi nhốt. Kết quả nghiên cứu cho thấy gà Rừng Tai Trắng trống
và mái có sự đồng nhất về các chiều đo của cơ thể giai đoạn 0-4TT. Ngược lại, từ 8TT đã có thể phân
biệt gà trống và mái: đa số chiều đo cơ thể của gà trống lớn hơn so với gà mái giai đoạn 8-12TT. Sinh
trưởng tuyệt đối của gà Rừng Tai Trắng thấp, trung bình là 2,71-3,86 g/con/ngày. Giai đoạn 12TT
gà trống có sinh trưởng tuyệt đối cao hơn so với gà mái, trong khi đó sinh trưởng tương đối giữa

1
Trường Đại học Cần Thơ
* Tác giả liên hệ: TS. Nguyễn Thiết, Khoa Phát triển Nông thôn, Trường Đại học Cần Thơ. Điện thoại: 0932147900; Email:
nthiet@ctu.edu.vn

KHKT Chăn nuôi số 281 - tháng 10 năm 2022 11

 DI TRUYỀN - GIỐNG VẬT NUÔI

gà trống và gà mái là tương đương nhau trong giai đoạn 0-12TT. Hệ số chuyển hoá thức ăn của gà
Rừng Tai Trắng 0-5TT là 3,07 kg/kg và giai đoạn 5-12TT là 7,05 kg/kg.
Từ khóa: Gà Rừng Tai Trắng, sinh trưởng, kích thước, khối lượng, hiệu quả sử dụng thức ăn.
ABSTRACT
The production of Junglefowls (Gallus gallus gallus) in Tinh Bien district,
An Giang province
The objective of this study was to determine the growth performance of white ear Junglefowls
(Gallus gallus gallus). The study was carried out with 30 white ear Junglefowls. The results from
study show that male and female Gallus gallus gallus were similar morphological characteristics
from birth to 4 weeks of age, whereas at 8 weeks of age there is a distinguish between male and
female Gallus gallus gallus. Most of the body dimensions from male were greater than female from 8
to 12 weeks of age. The absolute growth rate of Gallus gallus gallus is low, average value is from 2.71
to 3.86 g/head/day. At 12 weeks of age, absolute growth rate from male were higher than that from
female, while relative growth rate between male and female was the same from 0 to 12 weeks of
age. Feed conversion ratio was 3.07 for 0-5 weeks of age and 7.05 for 5-12 weeks of age, respectively.
Keywords: Gallus gallus gallus, growth, body dimensions, body weight, FCR.

1. ĐẶT VẤN ĐỀ ngoại hình và khả năng sinh trưởng của gà

Chăn nuôi các giống gà bản địa hiện nay
đang được các nhà quản lý và người chăn
nuôi quan tâm bởi khả năng thích nghi cao,
phù hợp với tập quán, văn hóa và phương
thức chăn nuôi; hơn nữa, chất lượng thịt tốt,
quí hiếm nên có giá bán cao, ít biến động và
rất phù hợp với thị hiếu của người tiêu dùng
có thu nhập cao. Chăn nuôi gà bản địa còn có
ý nghĩa bảo vệ sự đa dạng sinh học và đa dạng
di truyền, giúp cho ngành chăn nuôi Việt Nam
phát triển bền vững (Nguyễn Hoàng Thịnh và
ctv, 2016). Đặc biệt, số lượng các loài động vật
hoang dã ngoài tự nhiên cũng đang giảm sút
nhanh chóng, việc nhân nuôi thành công các
động vật này cũng giảm bớt nguy cơ săn bắt
gay gắt ngoài tự nhiên.
Giống gà Rừng Tai Trắng (Gallus gallus
gallus-RTT) là giống gà quý hiếm tại vùng
Thất Sơn, tỉnh An Giang. Đặc điểm của giống
gà này tuy có năng suất thấp, nhưng chúng
có nhiều đặc điểm di truyền tốt như có thể
chịu được điều kiện nuôi kham khổ, khả năng
chống chịu bệnh tốt, trứng và thịt có chất
lượng thơm ngon. Giống gà RTT đã được
người dân thuần dưỡng và chăn nuôi, nhưng
hầu hết đều mang tính tự phát, nhỏ lẻ, thiếu
hướng dẫn kỹ thuật nên hiệu quả chăn nuôi
không cao. Chi tiết về sự thay đổi đặc điểm
RTT rất khó quan sát từ môi trường sống tự
nhiên vì loài gà này nhút nhát và cảnh giác,
trở nên rất nhạy cảm khi bị con người tiếp cận,
khó quan sát trong thời gian dài.
Để có cơ sở khuyến cáo và định hướng
phát triển chăn nuôi gà bản địa nói chung và
gà RTT nói riêng, việc đánh giá khả năng sinh
trưởng của giống gà này đối với người dân
vùng Thất Sơn, tỉnh An Giang là rất cần thiết.
Do đó, nghiên cứu này được thực hiện nhằm
đánh giá khả năng sinh trưởng của giống gà
RTT trong điều kiện nuôi nhốt tại huyện Tịnh
Biên, tỉnh An Giang.
2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU
2.1. Đối tượng, địa điểm và thời gian
Gà Rừng Tai Trắng: 30 cá thể (13 trống và
17 mái), được nuôi nhốt tại trại thực nghiệm
Khoa Phát triển Nông thôn, Trường Đại học
Cần Thơ, từ tháng 9 đến tháng 12/2019.
2.2. Phương pháp
Thí nghiệm (TN) được thực hiện trên 30
cá thể (13 trống và 17 mái) gà RTT mới nở. Gà
được đeo số chân và theo dõi định kỳ về các
chỉ tiêu như kích thước một số chiều đo cơ
thể và khối lượng (KL), tăng khối lượng trung
bình ngày (TKL), lượng thức ăn thu nhận
(LTATN) và hiệu quả sử dụng thức ăn (FCR).

12 KHKT Chăn nuôi số 281 - tháng 10 năm 2022

DI TRUYỀN - GIỐNG VẬT NUÔI

2.2.1. Khả năng sinh trưởng cho thấy kích thước cơ thể của gia cầm có thể
* Kích thước một số chiều đo cơ thể: Chiều quy định bởi kiểu gen của từng loài.
dài thân, dài bàn chân, dài đùi bằng thước kẹp Bảng 1. Kích thước các chiều đo theo tuổi (mm)
có độ chính xác 0,01 mm; vòng ngực và vòng
Chỉ Tuổi Trống Mái Chung
chân bằng thước dây có độ chính xác 0,10mm tiêu (tuần) Mean±SE Mean±SE Mean±SE
và theo phương pháp thông dụng.
0 40,92±1,19 40,47±0,76 40,75±0,76
* Sinh trưởng tích lũy Dài 4 74,39±2,31 72,80±2,32 73,84±1,68
Cân khối lượng cơ thể gà theo định kỳ 4 thân 8 95,25±2,12 91,70±2,48 94,01±1,64
tuần/lần (từ sơ sinh đến 12 tuần tuổi). Cân vào 12 112,18a±2,27 99,70b±2,21 107,84±2,07
buổi sáng trước khi cho gà ăn. Dùng cân điện 0 16,17±0,43 15,14±0,60 15,77±0,36
Dài
tử có độ chính xác 0,01g. bàn 4 30,79±1,13 29,35±1,22 30,29±0,85
chân 8 44,48±1,34 42,46±1,02 43,78±0,95
* Xác định tốc độ sinh trưởng
12 55,19a±1,22 51,30b±1,02 53,84±0,94
Sinh trưởng tương đối (R, %): R (%)=[(W1- 0 20,35±0,41 19,66±0,76 20,09±0,38
W0)/(W1+W0)/2)]*100. Dài 4 37,8±1,26 37,00±1,27 37,53±0,92
Sinh trưởng tuyệt đối/tăng khối lượng (A, g/ đùi 8 51,43±1,23 50,04±1,12 50,95±0,89
con/ngày): A=(W1-W0)/t. 12 58,14 a±1,08 54,58b±1,05 56,9±0,86
0 54,47±1,75 54,45±1,99 54,46±1,27
Ghi chú, W1 và W0: KL gà tại thời điểm t1 và t0
Vòng 4 112,47±3,47 109,31±4,03 111,37±2,63
(g/con); t: thời gian giữa hai lần cân (ngày). ngực 8 147,33±3,44 143,63±4,64 146,04±2,72
2.2.2. Tiêu thụ thức ăn 12 185,28a±3,52 170,38b±2,36 180,10±2,84
Các chỉ tiêu lượng thức ăn thu nhận và hệ 0 10,54±0,18 10,30±0,18 10,45±0,13
Vòng
số chuyển hoá thức ăn được theo dõi và xác bàn 4 17,83±0,54 17,31±0,53 17,65±0,39
định theo phương pháp thông dụng. chân 8 22,47a±0,26 21,25b±0,37 22,04±0,24
12 26,00a±0,26 24,38b±0,38 25,43±0,27
2.3. Xử lý số liệu
Số liệu được thu thập và xử lý thống kê Ghi chú: Trong cùng hàng các giá trị Mean mang chữ
cái khác nhau thì sai khác có ý nghĩa thống kê (P<0,05).
mô tả trên phần mềm Microsoft Excel 2013. So
sánh khả năng sinh trưởng giữa gà trống và 3.1.2. Khối lượng gà qua các tuần tuổi
gà mái bằng so sánh không cặp đôi (unpair Qua bảng 2 cho thấy gà RTT mới nở có
T-test). Sự khác biệt có ý nghĩa thống kê khi khối lượng (KL) tương đối nhỏ, trung bình
P<0,05. Kết quả được trình bày dưới dạng lúc 0TT là 17,48 g/con. Khối lượng gà RTT 0TT
Mean±SE. trong nghiên cứu này thấp hơn so với gà Rừng
3. KẾT QUẢ VÀ THẢO LUẬN Tai Đỏ nuôi tại Vườn Quốc gia Cúc Phương
(Phạm Hải Ninh và ctv, 2017) công bố là 21,93g/
3.1. Khả năng sinh trưởng con. Khối lượng của gà tăng nhanh theo các
3.1.1. Kích thước một số chiều đo cơ thể tuần tuổi: đến thời điểm 4TT, KL tăng gấp 6,2
Kết quả các chỉ tiêu về một số chiều đo cơ lần so với 0TT, đạt 108,42 g/con. Ở thời điểm
thể có tỷ lệ thuận so với khối lượng (KL) của 12TT, KL cơ thể gà RTT trung bình là 290,67 g/
gà. Ở 12 tuần tuổi, gà trống có chiều đo cơ thể con, tăng gấp 17 lần so với thời điểm 0TT. Khối
lớn hơn so với gà mái (P<0,05; Bảng 1). Nhìn lượng gà RTT lúc 12TT trong nghiên cứu này
chung, kích thước chiều đo cơ thể (0-12TT) của thấp hơn so với gà Rừng Tai Đỏ nuôi tại Vườn
gà RTT ở thí nghiệm hiện tại lớn hơn kết quả Quốc gia Cúc Phương (Phạm Hải Ninh và ctv,
nghiên nghiên cứu về gà Tre (Nguyễn Thị Thu 2017) công bố là 467,17 và 386,67 g/con đối với
Hiền và ctv, 2014) và thấp hơn kết quả nghiên gà trống và mái. Khối lượng của gà RTT trống
cứu về con lai F1(Trống Rừng x mái Ai Cập) lớn hơn gà mái ở thời điểm 12TT (Bảng 2;
của Nguyễn Thị Hồng Hạnh (2013). Điều đó P<0,05). Khối lượng gà RTT trong nghiên cứu

KHKT Chăn nuôi số 281 - tháng 10 năm 2022 13

 DI TRUYỀN - GIỐNG VẬT NUÔI

này qua các tuần tuổi thấp hơn so với nghiên quy luật chung của gia cầm, giảm dần từ tuần
cứu trên gà Rừng Tai Đỏ nuôi tại vườn thú Hà tuổi thứ nhất cho đến tuần tuổi thứ 12. Ở giai
Nội (Nguyễn Thị Thu Ngân, 2014) và nuôi tại đoạn sơ sinh đến 4TT, sinh trưởng tương đối
Vườn Quốc gia Cúc Phương (Phạm Hải Ninh trung bình của gà trống là 33,07% và gà mái là
và ctv, 2018). Kết quả này cũng tương đương 34,41%. Sau đó, 8-12TT giảm dần ở gà trống
với chỉ tiêu trong nghiên cứu gia cầm của Bùi chỉ đạt 8,02% và gà mái 6,11%. Kết quả trong
Hữu Đoàn và ctv (2011). Theo các tác giả này, nghiên cứu này tương tự so với nghiên cứu
gia cầm non sau 2-3 tháng tuổi, KL tăng hàng của Nguyễn Thị Thu Ngân (2014) trên gà
chục lần so với mới nở. Rừng Tai Đỏ nuôi tại vườn thú Hà Nội cũng
Bảng 2. Khối lượng của gà theo tuổi (g/con) cho biết sinh trưởng tương đối giảm dần qua
các tuần tuổi.
Tuổi Trống Mái Chung
0TT 17,75±0,59 17,05±0,76 17,48±0,46
Bảng 4. Sinh trưởng tương đối (Mean±SE, %)
4TT 111,04±8,47 103,51±8,79 108,42±6,24 Giai đoạn Trống Mái Chung
8TT 232,71±12,20 204,36±12,00 222,85±9,27 Wk0-4 33,07±1,81 34,41±2,55 33,58±1,43
12TT 307,13a±12,27 259,82b±9,87 290,67±9,82 Wk4 -8 18,79±1,22 16,70±1,19 18,13±0,89
3.1.3. Sinh trưởng tuyệt đối Wk8-12 8,02±0,92 6,11±1,20 7,78±0,74
Qua bảng 3 cho thấy sinh trưởng tuyệt 3.2. Tăng khối lượng, lượng thức ăn thu nhận
đối của gà RTT từ sơ sinh đến 4 tuần là như và hệ số chuyển hoá thức ăn
nhau, tốc độ tăng trọng trung bình là 2,89(g/ Tăng khối lượng trên đàn gà RTT ở giai
con/ngày). Giai đoạn 4-8TT sinh trưởng tuyệt đoạn 0-4 tuần tuổi là 3,10 g/con/ ngày và 4-12
đối của gà trống có khuynh hướng cao hơn tuần tuổi là 3,35 g/con/ngày. Tăng khối lượng
so với gà mái (P=0,07), tốc độ tăng khối lượng của gà RTT qua giai đoạn 0-4TT và 4-12TT
trung bình (TKL) là 3,86 g/con/ngày. Trong tăng dần. Kết quả này phù hợp với quy luật
khi đó, giai đoạn 8-12TT, tốc độ sinh trưởng sinh trưởng chung của gia cầm vì KL tăng lên
của gà giảm hơn so với giai đoạn trước đó, thì quá trình trao đổi chất diễn ra mạnh nhu
chỉ đạt 2,71 g/con/ngày. Ở giai đoạn này, gà cầu về các chất dinh dưỡng cũng tăng lên, dẫn
trống sinh trưởng nhanh hơn so với gà mái đến gà phải ăn nhiều để thu nhận thức ăn đáp
(P<0,05). So với kết quả nghiên cứu trên gà ứng nhu cầu về sinh trưởng. Gà có tốc độ sinh
Tre của Nguyễn Thị Thu Hiền và ctv (2014) trưởng càng nhanh, KL lớn thì lượng thức ăn
cho thấy sinh trưởng tuyệt đối của gà tre giai thu nhận cũng như hiệu quả sử dụng thức ăn
đoạn 1-4 tuần là 2,05 g/con/ngày và giảm dần càng lớn.
từ tuần 8 đến tuần 12 là 0,99 g/con/ngày. Như
Bảng 5. TKL, LTATN và TTTA của gà
vậy, sinh trưởng tuyệt đối sẽ khác nhau ở từng
loài gia cầm và do kiểu gen của từng loài qui Chỉ tiêu Mean±SE Min Max
định. Tuy nhiên, sinh trưởng tuyệt đối có thể 8,61±0,76
LTATN0-4 (g/con/ngày) 7,41 10,03
bị ảnh hưởng do nguồn thức ăn, sức khỏe gia
cầm, điều kiện nuôi nhốt. LTATN4-12 (g/con/ngày) 22,35±0,43 18,72 25,95
Bảng 3. Sinh trưởng tuyệt đối (g/con/ngày) TKL0-4 (g/con/ngày) 3,10±0,19 1,48 4,57
Giai đoạn Trống Mái Chung TKL4-12 (g/con/ngày) 3,35±0,16 2,04 4,66
Wk0 - 4 2,83±0,48 2,99±0,52 2,89±0,34 3,07±0,25
FCR0-4 1,70 6,06
Wk4 - 8 4,41±0,31 3,60±0,22 3,86±0,22
Wk8 - 12 3,02a±0,28 1,98b±0,35 2,71±0,24 FCR4-12 7,05±0,41 4,88 12,17
3.1.4. Sinh trưởng tương đối Tiêu tốn thức ăn là chỉ tiêu để đánh giá
Từ kết quả thí nghiệm (Bảng 4) cho thấy hiệu quả kinh tế của từng giống gà. Thông
sinh trưởng tương đối của gà RTT tuân theo qua lượng thức ăn thu nhận hàng ngày có thể

14 KHKT Chăn nuôi số 281 - tháng 10 năm 2022

DI TRUYỀN - GIỐNG VẬT NUÔI
đánh giá tình trạng sức khỏe của gà, chất lượng
thức ăn và trình độ chăm sóc nuôi dưỡng. Khả
năng tiêu thụ thức ăn của gà phụ thuộc vào
các yếu tố giống, tính chất khẩu phần và điều
kiện ngoại cảnh: nhiệt độ chuồng nuôi quá
cao/quá thấp đều làm cho gà ăn ít, chất lượng
thức ăn kém làm giảm khả năng thu nhận
thức ăn, ngược lại với thức ăn mới, thơm ngon
sẽ kích thích tính thèm ăn ở gà) (Nguyễn Thị
Hồng Hạnh, 2013).
Giá trị FCR của đàn gà RTT ở giai đoạn
0-4TT là 3,07 và 4-12TT là 7,05. Như vậy, hiệu
quả sử dụng thức ăn giai đoạn 0-4TT tốt hơn
so với giai đoạn 4-12 tuần tuổi.
4. KẾT LUẬN
Gà Rừng Tai Trắng có khả năng sinh
trưởng tương đương các giống gà bản địa của
Việt Nam: các chiều đo cơ thể của gà trống và
mái giai đoạn 0-4TT là như nhau, nhưng từ
8 tuần tuổi đã phân biệt được gà trống và gà
mái, và các chiều đo cơ thể gà trống lớn hơn so
với gà mái ở 12 tuần tuổi.
Đến 12TT, gà trống có sinh trưởng tuyệt
đối cao hơn so với gà mái, trong khi đó sinh
trưởng tương đối giữa gà trống và gà mái là
như nhau giai đoạn 0-12TT. Hệ số FCR của
gà RTT giai đoạn 0-4TT là 3,07 và giai đoạn
4-12TT là 7,05kg/kg.
LỜI CẢM ƠN
Nhóm tác giả xin chân thành cảm ơn sự hỗ
trợ về kinh phí thực hiện đề tài này của Sở Khoa
học và Công nghệ, UBND tỉnh An Giang (Quyết
định số 1046/QĐ-UBND) và sự hỗ trợ về cơ sở vật
NĂNG SUẤT SINH SẢN LỢN HƯƠNG QUA 3 THẾ HỆ
Phạm Hải Ninh1*, Phạm Công Thiếu1, Nguyễn Quyết Thắng1, Phạm Đức Hồng1
Ngày nhận bài báo: 01/7/2022 - Ngày nhận bài phản biện: 16/7/2022
Ngày bài báo được chấp nhận đăng: 10/8/2022
TÓM TẮT
1
Viện Chăn nuôi
*
Tác giả liên hệ: ThS. Phạm Hải Ninh, Phó trưởng Bộ môn Động vật Quý hiếm và Đa dạng sinh học, Viện Chăn nuôi; Điện
thoại: 0988 397 223; Email: phamhaininh_vcn@yahoo.com
KHKT Chăn nuôi số 281 - tháng 10 năm 2022
chất từ Khoa Phát triển Nông thôn, trường Đại
học Cần Thơ.
TÀI LIỆU THAM KHẢO
1. Bùi Hữu Đoàn, Nguyễn Thị Mai, Nguyễn Thanh Sơn
và Nguyễn Huy Đạt (2011). Các chỉ tiêu dùng trong
nghiên cứu chăn nuôi gia cầm. NXB Nông nghiệp, Hà
Nội.
2. Nguyễn Chí Thành và Vũ Tiến Thịnh (2014). Nghiên
cứu đặc điểm sinh trưởng và sử dụng thức ăn của gà
rừng (Gallus gallus Linnaeus, 1758) trong điều kiện nuôi
nhốt. Tạp chí Khoa học và Công nghệ Lâm nghiệp, 1:
29-35.
3. Nguyễn Hoàng Thịnh, Phạm Kim Đăng, Vũ Thị Thúy
Hằng, Hoàng Anh Tuấn và Bùi Hữu Đoàn (2016). Một
số đặc điểm ngoại hình và khả năng sản xuất của gà
nhiều ngón nuôi tại rừng quốc gia Xuân Sơn, huyện
Tân Sơn, tỉnh Phú Thọ. Tạp chí Khoa học và Phát triển,
14(1): 9-20.
4. Nguyễn Thị Hồng Hạnh (2013). Nghiên cứu đặc điểm
ngoại hình, khả năng sản xuất của con lai F1(Rừng x Ai
Cập) và F1(Rừng x H’Mong) nuôi tại viện chăn nuôi.
Luận văn Thạc sĩ, Trường đại học Nông nghiệp Hà Nội.
5. Nguyễn Thị Thu Hiền và Lê Thị Ngọc (2014). Đặc
điểm sinh trưởng của gà Tre trong điều kiện nuôi thả
vườn tại huyện Bến Cát tỉnh Bình Dương. Tạp chí Đại
học Thủ Dầu Một, 5(18): 40-47.
6. Nguyễn Thị Thu Ngân (2014). Nghiên cứu một số đặc
điểm sinh học, sinh trưởng và sinh sản của gà Rừng
(Gallus gallus, Linnaeus) nuôi tại vườn thú Hà Nội. Luận
văn Thạc sĩ, Học Viện Nông nghiệp Việt Nam.
7. NRC (1994). Hội đồng Nghiên cứu Quốc gia. Nhu cầu
dinh dưỡng của vật nuôi. Nhu cầu dinh dưỡng của gia
cầm, Tái bản sửa đổi lần thứ 9, NXB Học viện Quốc
gia, Washington, DC, Hoa Kỳ.
8. Phạm Nhật và Nguyễn Xuân Đặng (2005). Bài giảng
Nhân nuôi động vật hoang dã. Trường Đại học Lâm
Nghiệp.
9. Phạm Hải Ninh, Phạm Công Thiếu, Nguyễn Công
Định, Đặng Vũ Hòa, Nguyễn Quyết Thắng, Nguyễn
Khắc Khánh, Lê Thị Bình, Hoàng Xuân Thủy và
Nguyễn Hữu Cường (2017). Kết quả bước đầu nghiên
cứu đặc điểm ngoại hình và khả năng sản xuất của gà
Tai đỏ trong điều kiện nuôi nhốt. Tạp chí KHCN Chăn
nuôi, 80(10.17): 2-12.
và Lê Thị Thanh Huyền1
15
KHKT Chăn nuôi Số 278 - tháng 6 năm 2022

Phó Tổng biên tập Phụ trách: DI TRUYỀN - GIỐNG VẬT NUÔI
PGS.TS. NGUYỄN VĂN ĐỨC Hoàng Tuấn Thành, Nguyễn Thị Hồng Trinh, Nguyễn Thị Lan Anh, Nguyễn Thị
Thủy Tiên, Phạm Công Hải, Nguyễn Đức Thỏa, Phạm Hải Ninh và Phạm Công
Phó Tổng biên tập: Thiếu. Đặc điểm ngoại hình và khả năng sản xuất của ngan Xám nuôi bảo tồn tại
PGS.TS. NGUYỄN ĐĂNG VANG tỉnh Đồng Nai 2
TS. NGUYỄN XUÂN DƯƠNG Nguyễn Thị Phương, Nguyễn Văn Duy, Nguyễn Đình Tiến, Nguyễn Đức Điện và
Vũ Đình Tôn. Thực trạng chăn nuôi gà tại vùng Tây Nguyên 7
Thư ký tòa soạn: Hà Xuân Bộ, Lê Việt Phương và Đỗ Đức Lực. Mô tả năng suất trứng cộng dồn của
gà D310 và ISA Brown bằng một số hàm sinh trưởng 15
PGS.TS. NGUYỄN VĂN ĐỨC
Phạm Thị Yến, Nguyễn Đình Vinh và Lương Hoàn Đức. Xác định mức năng lượng
và protein thích hợp trong chăn nuôi gà Liên Minh thương phẩm 20
Ủy viên Ban biên tập: Nguyễn Văn Tiến, Phạm Văn Quyến, Giang Vi Sal, Nguyễn Thanh Tùng, Nguyễn
TS. NGUYỄN QUỐC ĐẠT Quang Phúc và Huỳnh Văn Lâm. Hiện trạng chăn nuôi bò lai hướng thịt tại huyện
PGS.TS. HOÀNG KIM GIAO Bàu Bàng, tỉnh Bình Dương 26
GS.TS. NGUYỄN DUY HOAN
GS.TS. DƯƠNG NGUYÊN KHANG DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI
PGS.TS. NGUYỄN THỊ KIM KHANG Lê Ngọc Mẫn, Trần Văn Bé Năm, Lê Minh Thành, Lưu Huỳnh Anh, Phạm Thị
PGS.TS. ĐỖ VÕ ANH KHOA Ngọc Yến, Trịnh Thị Hồng Mơ, Trần Hoàng Diệp và Nguyễn Trọng Ngữ. Xác định
PGS.TS. ĐỖ ĐỨC LỰC mật số và khả năng chịu muối mật của vi khuẩn Probiotic trong các sản phẩm men
GS.TS. LÊ ĐÌNH PHÙNG vi sinh sử dụng trong chăn nuôi 35
Phạm Thị Thanh Bình, Nguyễn Thị Hải, Nguyễn Thị Mười, Trần Thị Thu Hằng và
Đào Đoan Trang. Xác định mức năng lượng và Protein thích hợp cho gà lai hướng
Xuất bản và Phát hành:
trứng GB giai đoạn 20-72 tuần tuổi 40
ThS. NGUYỄN ĐÌNH MẠNH Bùi Quang Tuấn và Nguyễn Thị Thu Hồng. Ảnh hưởng của bổ sung Bacillus subtitis
lên khả năng sinh trưởng và thân thịt của gà Minh Dư 46

U Trần Hồng Định và Hồ Thúy Hằng. Nhu cầu Lysine của gà thịt tăng trưởng chậm giai
đoạn từ 1 đến 21 ngày tuổi
Nguyễn Thùy Linh và Nguyễn Thị Kim Đông. Ảnh hưởng của sự bổ sung lúa mầm
lên khả năng sinh sản của Thỏ cái Californian
51

58

Giấy phép: Bộ Thông tin và Truyền thông

CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC
Số 257/GP- BTTTT ngày 20/05/2016 Đỗ Văn Thu, Trần Xuân Khôi và Lê Thị Huệ. Sử dụng tinh bò siêu thịt Blanc Blue
ISSN 1859 - 476X Belge phối giống cho đàn cái lai Zebu tại huyện Tuyên Hoá (Quảng Bình), để nâng
Xuất bản: Hàng tháng cao năng suất, chất lượng đàn bò thịt của địa phương 64
Phan Thị Thu Hiền. Ảnh hưởng của phân bón NPK bọc vi sinh thúc đẩy tăng trưởng
Toà soạn:
đến khả năng sinh trưởng và năng suất của giống ngô A380 trong điều kiện nhà
Địa chỉ: Tầng 4, Tòa nhà 73, kính 69
Hoàng Cầu, Ô Chợ Dừa, Phan Thị Thu Hiền. Ảnh hưởng phân bón vô cơ đến khả năng phát triển và tạo sinh
Đống Đa, Hà Nội. khối cây cỏ Voi (Pennisetum purpurem Schum.) phục vụ chăn nuôi gia súc lớn tại
Điện thoại: 024.36290621 tỉnh Vĩnh Phúc 74
Fax: 024.38691511 Ngô Trí Dũng, Lê Thị Thúy Hằng, Lê Thị Thúy Loan, Phạm Đức Thọ và Nguyễn
Tuyết Giang. Ảnh hưởng của phương pháp làm khô đến chất lượng của bột lá Chùm
E - mail: tapchichannuoi@hoichannuoi.vn
ngây (Moringa oleifera L.) 78
Website: www.hoichannuoi.vn Đặng Hồng Quyên, Trần Thị Tâm và Vi Thị Cúc. Tình hình bệnh Parvovirus trên Chó
Tài khoản: tại Phòng khám Thú y Pet Health Thái Nguyên 84
Tên tài khoản: Hội Chăn nuôi Việt Nam Nguyễn Thị Bích Ngà, Đỗ Thị Vân Giang và Vũ Thị Ánh Huyền. Đặc điểm bệnh lý
Số tài khoản: 1300 311 0000 40, tại Ngân hàng và lâm sàng bệnh do giun tròn Oesophagostomum gây ra ở lợn tại tỉnh Bắc Kạn 90
Nông nghiệp và Phát triển Nông thôn, Chi nhánh
Thăng Long - Số 4, Phạm Ngọc Thạch, Hà Nội. THÔNG TIN KHOA HỌC VÀ CÔNG NGHỆ
In 1.000 bản, khổ 19x27 tại Công ty CP KH&CN Ban Biên tập. Phát triển khoa học, công nghệ, thúc đẩy đổi mới sáng tạo 94
Hoàng Quốc Việt. In xong và nộp lưu chiểu: Ban Biên tập. Sự căng thẳng ở gà con có thể liên quan tới Galacto - Oligosaccharides
tháng 6/2022. của đậu nành trong khẩu phần thức ăn gà giai đoạn đầu 102
PGS.TS. Nguyễn Văn Đức. Thịt giả làm chảy máu tiền thật 104
DINH DƯỠNG VÀ THỨC
DINH ĂN CHĂN
DƯỠNG NUÔI ĂN CHĂN NUÔI
VÀ THỨC

XÁC ĐỊNH MẬT SỐ VÀ KHẢ NĂNG CHỊU MUỐI MẬT CỦA

VI KHUẨN PROBIOTIC TRONG CÁC SẢN PHẨM MEN VI SINH
SỬ DỤNG TRONG CHĂN NUÔI
Lê Ngọc Mẫn1, Trần Văn Bé Năm2, Lê Minh Thành2, Lưu Huỳnh Anh2, Phạm Thị Ngọc Yến2,
Trịnh Thị Hồng Mơ3, Trần Hoàng Diệp1 và Nguyễn Trọng Ngữ1*
Ngày nhận bài báo: 21/3/2022 - Ngày nhận bài phản biện: 05/4/2022
Ngày bài báo được chấp nhận đăng: 21/4/2022
TÓM TẮT
Nghiên cứu hiện tại được tiến hành với mục tiêu xác định được mật số và khả năng chịu
muối mật của vi khuẩn Lactobacillus acidophilus và nấm men Saccharomyces cerevisiae hiện hữu trong
các sản phẩm men vi sinh trên thị trường. Từ 20 sản phẩm men vi sinh, ghi nhận được 5 chủng
thuộc chi Lactobacillus, 4 chủng thuộc chi Bacillus, 2 chủng thuộc chi Bifidobacterium và 1 chủng
thuộc chi Saccharomyces, còn lại là loài Aspergillus oryzae. Đánh giá mật số Lactobacillus acidophilus
và Saccharomyces cerevisiae trên 8 sản phẩm thu thập, kết quả cho thấy số lượng của 2 loài này giảm
(11,4-42,6%) so với thông tin ghi trên bao bì. Về khả năng chịu muối mật, 2 loài trên có khả năng
sống và phát triển tốt trong môi trường muối mật 0,3%. Như vậy, sau thời gian 7-9 tháng sản phẩm
men vi sinh được lưu hành trên thị trường, mật số của vi khuẩn Lactobacillus acidophilus và nấm
men Saccharomyces cerevisiae giảm nhưng một trong những đặc điểm probiotic quan trọng là khả
năng chịu muối mật thì vẫn khá ổn định.
Từ khóa: Chế phẩm, muối mật, Lactobacillus acidophilus, Saccharomyces cerevisiae.
ABSTRACT
Determination of density and bile salt tolerance of probiotic bacteria in commercial
products used for animal production
The present study was conducted with the objective of determining the density and tolerance to
bile salts of Lactobacillus acidophilus and Saccharomyces cerevisiae yeast present in probiotic products
on the market. From 20 probiotic products, 5 strains of the genus Lactobacillus, 4 strains of the
genus Bacillus, 2 strains of the genus Bifidobacterium and 1 strain of the genus Saccharomyces were
recorded, and the remaining species was Aspergillus oryzae. The results of assessing the density
of Lactobacillus acidophilus and Saccharomyces cerevisiae on 8 products showed that the number of
these two species decreased (11.4-42.6%) compared to the information stated on the package. In
terms of tolerance to bile salts, these two species were able to live and grow well in 0.3% bile salt
environment. Thus, probiotic products after 7-9 months being circulated on the market, the density
of Lactobacillus acidophilus and Saccharomyces cerevisiae decreased, yet one of the important probiotic
characteristics, the tolerance to bile salts, was relatively stable.
Keywords: Bile salt, Lactobacillus acidophilus, Probiotic, Saccharomyces cerevisiae.

1. ĐẶT VẤN ĐỀ một số nghiên cứu đã ứng dụng thành công

chế phẩm probiotic mang lại hiệu quả tích cực
Hiện tại, việc sử dụng các sản phẩm
probiotic nhằm tăng cường sức khỏe cho bộ đến tốc độ tăng trưởng của gà thịt (Lei và ctv,
máy tiêu hóa của vật nuôi được xem là một 2015; Ahiwe và ctv, 2021), kiểm soát các bệnh
giải pháp hữu hiệu và phổ biến. Trên gia cầm, đường ruột, ngăn ngừa viêm ruột hoại tử
(Jayaraman và ctv, 2013), kiểm soát bệnh cầu
1
Trường Đại học Tiền Giang
2
Trường Đại học Cần Thơ trùng (Dalloul và ctv, 2003). Bên cạnh đó, việc
3
Trường Đại học Tây Đô ứng dụng probiotic trong chăn nuôi heo cũng
*Tác giả liên hệ: PGS.TS. Nguyễn Trọng Ngữ, Khoa Nông
nghiệp, Trường Đại học Cần Thơ. Điện thoại: 0989828295;
đã mang lại nhiều thành công như cải thiện
Email: ntngu@ctu.edu.vn tốc độ sinh trưởng và giảm tiêu tốn thức ăn

KHKT Chăn nuôi số 278 - tháng 6 năm 2022 35

 DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI
ở heo cai sữa (Kantas và ctv, 2015), heo tăng
trưởng (Meng và ctv, 2010) và giảm chi phí
thức ăn (Phan Kim Đăng và ctv, 2016). Ngoài
ra, các sản phẩm probiotic cũng góp phần xử
lý môi trường chăn nuôi giúp vật nuôi tăng
trưởng tốt hơn (Đoàn Thị Vân và ctv, 2021).
Công bố của Gorobets và ctv (2021) cũng cho
thấy chế phẩm probiotic giúp heo tăng trọng
cao hơn nhóm đối chứng trong giai đoạn 48
đến 148 ngày tuổi. Với vai trò quan trọng như
trên, hiện tại trên thị trường Việt Nam các sản
phẩm probiotic khá đa dạng về thành phần
chủng, loài từ nhiều nguồn phân lập khác
nhau. Tuy nhiên, trong quá trình lưu hành, do
ảnh hưởng của nhiều yếu tố, đặc biệt là khâu
bảo quản và thời gian bảo quản, mật số và đặc
điểm probiotic của các nhóm vi sinh vật có mặt
trong sản phẩm có thể bị ảnh hưởng. Nghiên
cứu hiện tại được tiến hành nhằm khảo sát
thành phần vi sinh thường sử dụng, số lượng
và khả năng chịu muối mật của các nhóm vi
khuẩn probiotic phổ biến trong các sản phẩm
men vi sinh sử dụng trong chăn nuôi gia súc,
gia cầm.
2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU
2.1. Thu thập và xử lý mẫu
Tổng cộng 20 sản phẩm (SP) được sử
dụng để ghi nhận tần số của các chủng vi
sinh vật được sử dụng. Các SP được thu thập
tại các cửa hàng và đại lý bán lẻ trên địa bàn
Thành phố Cần Thơ và tỉnh Vĩnh Long. Đa số
các SP có hạn sử dụng là 24 tháng, ngoại trừ
SP1 và SP3 có hạn dùng là 12 tháng và SP4
có hạn dùng là 18 tháng. Thời điểm phân tích
mẫu dao động 7-9 tháng sau khi SP được lưu
hành trên thị trường.
2.2. Phương pháp nghiên cứu
2.2.1. Phân lập, định danh Lactobacillus
acidophilus và nấm men Saccharomyces
cerevisiae
Quy trình phân lập vi khuẩn Lactobacillus
acidophilus (L. acidophilus) và nấm men
Saccharomyces cerevisiae (S. cerevisiae) được
thực hiện theo phương pháp của Weiss và ctv
(2005). Quy trình được lập lại nhiều lần cho
36
đến khi thu được khuẩn lạc rời có hình dạng,
kích thước và màu sắc đồng nhất. Vi khuẩn
và nấm men thuần được giữ giống trong ống
Eppendorf 2ml chứa môi trường NB lỏng, ở
nhiệt độ 8°C. Định danh sơ bộ L. acidophilus
thông qua kiểm tra khả năng di động và
nhuộm Gram (Cao Ngọc Điệp và Nguyễn
Hữu Hiệp, 2008).
2.2.2. Hình thái vi khuẩn L. acidophilus và
nấm men S. cerevisiae
Quan sát kính hiển vi xác định vi khuẩn
gram dương bắt màu tím hay xanh đen của
Crystaviolet và vi khuẩn gram âm bắt màu
hồng của Safra (Weiss và ctv, 2005). Đối với
nấm men, quan sát kính hiển vi xác định S.
cerevisiae có hình dạng tròn đều, nhô, có màu
trắng đục và đồng nhất (Lương Đức Phẩm,
2006).
2.2.3. Mật số vi khuẩn L. acidophilus và nấm
men S. cerevisiae
Sản phẩm probiotic thương mại được
cân đúng như chỉ dẫn trên bao bì sản phẩm
hòa tan với 9ml nước cất vô trùng trong ống
nghiệm, lắc đều cho chế phẩm tan hoàn toàn.
Pha loãng mẫu với 6 nồng độ khác nhau, ủ
mẫu ở 37°C cho khuẩn lạc phát triển. Chọn
các mức pha loãng có số lượng khuẩn lạc rời
nhau rõ để đếm số khuẩn lạc, mỗi khuẩn lạc
phát triển từ một tế bào vi khuẩn, vì vậy từ
đếm khuẩn lạc có thể xác định được mật số vi
khuẩn và nấm men tại mức pha loãng tương
ứng, từ đó xác định được mật số ban đầu
(Hoben và Somasegaran, 1982).
2.2.4. Khả năng chịu muối mật của L. acidop-
hilus và nấm S. cerevisiae
Thí nghiệm được tiến hành theo phương
pháp của Gilliland và ctv (1984) ở nồng độ
muối mật là 0,3%. Các dòng vi khuẩn, nấm
được nuôi tăng sinh trong môi trường lỏng
NB, được lắc trên máy lắc với tốc độ 120 vòng/
phút ở 37°C sau 24 giờ đến 36 giờ. Sau đó
mang dịch tăng sinh đo OD (108 cfu/ml) với
bước sóng 600 nm. Tiếp theo hút 1,5 ml dung
dịch chứa các dòng vi khuẩn, nấm đã đo OD
cho vào Eppendorf 2 ml (mỗi mẫu 4 ống Ep-
pendorf tương ứng với bốn khung giờ 0h, 1h,
KHKT Chăn nuôi số 278 - tháng 6 năm 2022
DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI
2h, 3h) tiến hành ly tâm 2.000 vòng/phút trong
15 phút ở 4°C để thu cặn, hút 1,5 ml nước cất
vô trùng cho vào Eppendorf để rửa tế bào, thu
cặn, nuôi cấy và đếm mật số.
2.3. Phương pháp xử lý số liệu
Số liệu được tổng hợp và xử lý bằng phần
mềm Microsoft Excel 2013 và Minitab 16.0.
3. KẾT QUẢ VÀ THẢO LUẬN
3.1. Các chủng vi sinh vật thường gặp trong
men vi sinh
Kết quả khảo sát 20 sản phẩm men vi sinh
ghi nhận tất cả 13 chủng vi sinh vật bao gồm
5 chủng thuộc chi Lactobacillus, 4 chủng thuộc
chi Bacillus, 2 chủng thuộc chi Bifidobacterium
và 1 chủng thuộc chi Saccharomyces, còn lại là
loài Aspergillus oryzae. Trong đó, vi khuẩn L.
acidophilus và nấm men S. cerevisiae với sự xuất
hiện trong các sản phẩm rất cao, lần lượt là 60,
55% số SP probiotic được khảo sát (Hình 1).
Kết quả phù hợp với nghiên cứu của Nguyễn
Thị Huyền và ctv (2014) khi khảo sát 24 SP
men vi sinh trên thị trường ghi nhận 8 chủng
thuộc chi L. acidophilus chiếm 79,2% trong số
SP probiotic thu được, hai chủng thuộc chi
Streptococcus, một chủng thuộc chi Bacillus là
Bacillus clausii, còn lại là các chủng Bifidobac-
terium spp.
Hình 1. Tần số xuất hiện của một số chủng,
loài vi sinh vật sử dụng làm probiotic
3.2. Hình thái vi khuẩn L. acidophilus và nấm
S. cerevisiae
Kết quả khảo sát đặc điểm hình thái
khuẩn lạc của các vi khuẩn L. acidophilus và
KHKT Chăn nuôi số 278 - tháng 6 năm 2022
nấm men S. cerevisiae trên môi trường PDA
cho thấy hầu hết đều phát triển tốt, khuẩn lạc
được quan sát rõ sau 12-24 giờ khi ủ ở nhiệt
độ 37°C. Trong các SP được khảo sát, có 8 sản
SP vi khuẩn L. acidophilus (SP1, SP2, SP3, SP4,
SP5, SP6, SP7, SP8) cho thấy các khuẩn lạc có
hình dạng là hình cầu, nhô ra khỏi mặt agar
và có màu vàng nhạt. Kết quả phù hợp với ng-
hiên cứu của Tô Minh Châu (2000), cho rằng
các khuẩn lạc đều có hình cầu, nhô cao và có
màu vàng nhạt đồng nhất.
Bên cạnh đó, có 6 SP chứa nấm men S. ce-
revisiae được ký hiệu SP2, SP3, SP4, SP5, SP6,
SP7 cho thấy chỉ đồng nhất một dạng khuẩn
lạc mọc tròn đều, nhô và có màu trắng đục, có
hình oval đặc trưng với tỷ lệ 100%. Kết quả phù
hợp với nghiên cứu của Hartwell (1974) khi
quan sát hình thái nấm S. cerevisiae cũng ghi
nhận đều có hình oval, đây là điểm đặc trưng
để nhận dạng các dòng nấm men. Ngoài ra,
kết quả phù hợp với nghiên cứu của Jermini
và Schmidt-Lorenz (1987) cho rằng khuẩn lạc
của nấm men khi phân lập nấm men tự nhiên
trên môi trường PDA đều có hình tròn láng,
trắng đục, bìa nguyên và mô.
3.3. Khả năng di động, kiểu bắt màu nhuộm
Gram của vi khuẩn L. acidophilus
3.3.1. Khả năng di động
Kết quả cho thấy 100% SP chứa vi khuẩn
L. acidophilus và vi khuẩn này không có khả
năng di động. Kết quả này phù hợp với công
bố của Nguyễn Lân Dũng và ctv (2000), tác giả
cho rằng, vi khuẩn L. acidophilus không có khả
năng di động, nhưng chúng có khả năng bám
dính rất tốt trong thành ruột nhằm cạnh tranh
vi trí với các vi khuẩn bất lợi khác.
3.3.2. Kiểu bắt màu nhuộm Gram
Kết quả nhuộm Gram cho thấy 100% các
mẫu có chứa vi khuẩn bắt màu tím (Gram
dương), hình que ngắn, kết chuỗi hay riêng
lẻ. Kết quả phù hợp với nghiên cứu của Pyar
và Peh (2014), cho rằng khi nhuộm vi khuẩn
L. acidophilus trên môi trường LB là vi khuẩn
Gram dương, hình que ngắn.
37
 DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI

3.4. Khảo sát mật số vi khuẩn Lactobacilus các vi khuẩn probiotic còn sống trong tất cả
acidophilus các chế phẩm nhưng có 5 SP với số lượng vi
Bảng 1. Số lượng vi khuẩn nhãn và thực tế khuẩn thấp hơn nhiều so với công bố trên
(cfu/g) nhãn và ngược lại, có 13 SP chứa nhiều chủng
vi sinh vật hơn so với các chủng được công bố
SP Trên nhãn Thực tế % giảm trên nhãn. Ngoài ra, nghiên cứu của Nimrat
SP1 1×108 1,58×105 35,0
và Vuthiphandchai (2011) xác định trên 12
SP2 2×108 1,15×105 39,0
SP probiotic dùng cho thủy sản tại Thái Lan
SP3 6×1010 1,12×107 34,6
cũng ghi nhận các vi khuẩn chết dần trong
SP4 1×108 3,80×106 17,8
quá trình lưu trữ và bảo quản.
SP5 2×109 1,18×106 34,7
SP6 1×108 1,51×106 22,8 3.5. Khả năng chịu muối mật của L.
SP7 106‑109 2,08×105 11,4-40,9 acidophilus
SP8 5×1010 1,37×106 42,6 Kết quả tại bảng 2 ghi nhận tất cả các SP
Qua bảng 1 cho thấy, tổng số 8 SP được chứa L. acidophilus đều thể hiện khả năng chịu
khảo sát đều ghi nhận các vi khuẩn đều còn muối mật tốt. Trong đó, khả năng chịu muối
sống nhưng mật số của tất cả các SP đều giảm mật tốt nhất trong cùng mốc thời gian cho
so với thông tin ghi trên nhãn (11,4-42,6%). thấy mốc thời gian T0 SP2 có mật số trung bình
Trong đó, SP4 và SP6 có sự thay đổi về mật cao nhất (9,56 log cfu/ml) (P≤0,001). Sau 3 giờ,
số L. acidophilus thấp hơn so với những SP mật số trung bình của vi khuẩn trong SP2 vẫn
còn lại. Kết quả nghiên cứu phù hợp với cao nhất (8,26 log cfu/ml) (P≤0,001). Khi xét về
công bố của Nguyễn Thị Huyền và ctv (2014) tính ổn định thì tại các mốc thời gian T1-T3, SP4
khi khảo sát trên 24 SP men vi sinh trên thị có mật số trung bình tương đối tốt với các giá
trường dùng cho người ở Hà Nội. Theo đó, trị lần lượt là 7,95; 7,65; 7,18 log cfu/ml.
Bảng 2. Mật số vi khuẩn theo thời gian trong điều kiện có muối mật 0,3%
Mật số trung bình vi khuẩn (log cfu/ml)
SP
T0 T1 T2 T3 P
SP1 4,43d±0,03B 4,55e±0,07B 4,74f±0,01A 4,83f±0,02A 0,000
SP2 9,56a±0,06A 6,70b±0,06C 9,75a±0,02A 8,26a±0,02B 0,000
SP3 4,83c±0,06C 5,71 ±0,04
c A
5,78d±0,04A 5,10e±0,02B 0,000
SP4 5,83b±0,02D 7,95 ±0,00
a A
7,65b±0,04B 7,18b±0,00C 0,000
SP5 4,39d±0,06C 4,44 ±0,02
e C
4,91e±0,02B 6,69c±0,03A 0,000
SP6 4,73c±0,04D 5,62 ±0,06
cd B
6,49c±0,02A 5,08e±0,06C 0,000
SP7 4,43d±0,01D 5,53cd±0,04B 4,81ef±0,03A 4,92f±0,03C 0,000
SP8 4,44d±0,01D 5,45d±0,03B 4,83ef±0,03C 6,16d±0,04A 0,000
P 0,000 0,000 0,000 0,000
Ghi chú: Các giá trị trên cùng cột với các chữ cái a, b, c, d hoặc trên cùng hàng với các chữ cái A, B, C, D khác nhau
thì khác biệt có ý nghĩa ở mức P<0,05; T0, T1, T2, T3 tương ứng với 0, 1, 2 và 3 giờ tiếp xúc với muối mật 0,3%.
Kết quả nghiên cứu của Pyar và Peh ảnh hưởng bởi muối mật và pH thấp của dịch
(2014) cho thấy khả năng sống của vi khuẩn dạ dày (Boonkumklao và ctv, 2006; Jensen và
L. acidophilus giảm với sự gia tăng nồng độ ctv, 2012).
muối mật, khả năng dung nạp muối mật của 3.6. Khả năng chịu muối mật của S. cerevisiae
L. acidophilus là 75,5% ở nồng độ muối mật
Kết quả ở bảng 3 cho thấy, nấm men S.
0,3%. Kết quả này cũng phù hợp với kết quả
cerevisiae trong tất cả các SP đều thể hiện khả
của một nghiên cứu khác phản ánh rằng các
năng chịu muối mật tốt. Trong đó, ở mốc thời
chủng vi khuẩn probiotic gần như không bị

38 KHKT Chăn nuôi số 278 - tháng 6 năm 2022

DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI

gian T0, SP2 thể hiện khả năng chịu muối tốt của S. cerevisiae trong điều kiện muối mật 0,3%
nhất với mật số trung bình (6,68 log cfu/ml) là tốt nhất. Kết quả phù hợp với nghiên cứu
(P<0,001). Tại các mốc thời gian T0-T3, SP5 có của Fakruddin và ctv (2017), tác giả đã chứng
mật số trung bình ổn định và có chiều hướng minh S. cerevisiae tồn tại ở điều kiện muối mật
tăng dần. Trong đó, SP4 có mật số trung bình
với nồng độ 0,1-0,4%. Bên cạnh đó, nghiên
tăng dần ở mốc thời điểm từ T0-T2 nhưng
cứu của Kim và ctv (2007) và Trần Quốc Việt
sau đó giảm nhẹ ở thời điểm T3. Từ kết quả
kiểm tra muối mật của 6 mẫu SP được kí hiệu và ctv (2009) cũng cho thấy, các chủng vi sinh
(SP2, SP3, SP4, SP5, SP7) cho thấy tất cả các vật thử nghiệm đều có khả năng tồn tại trong
SP đều thể hiện khả năng chịu muối mật tốt. môi trường chứa muối mật với nồng độ 0,3%
Tuy nhiên, SP5 cho thấy khả năng sinh trưởng trong một thời gian nhất định.
Bảng 3. Mật số trung bình nấm log (cfu/ml) theo thời gian trong điều kiện có muối mật (0,3%)
Mật số vi khuẩn trung bình nấm log (cfu/ml)
SP
T0 T1 T2 T3 P
SP2 5,63c±0,04D 6,70a±0,03A 5,88d±0,02C 6,23c±0,02B 0,000
SP3 4,63d±0,04D 5,58c±0,07B 6,58c±0,05A 5,12d±0,06C 0,000
SP4 4,57de±0,03D 4,68 ±0,03
d C
6,59 ±0,01
c A
4,92d±0,03B 0,000
SP5 6,47b±0,03C 5,80b±0,02D 6,81b±0,04B 8,04b±0,02A 0,000
SP6 4,43e±0,02B 5,55c±0,06A 3,81e±0,03C 3,87e±0,08C 0,000
SP7 6,68a±0,03D 6,81a±0,03C 7,97a±0,02B 9,18a±0,02A 0,000
P 0,000 0,000 0,000 0,000

4. KẾT LUẬN
Trong 20 SP men vi sinh khảo sát có 13
loài vi sinh vật được sử dụng và ghi thông
tin trên nhãn, trong đó chiếm tần số cao nhất
là B. subtilis, L. acidophilus và S. cerevisiae. Sau
7-9 tháng lưu hành, mật số của vi khuẩn L.
acidophilus và nấm men S. cerevisiae trong
các SP bị giảm (11,4-42,6%), tuy nhiên chúng
vẫn có khả năng sinh sống và phát triển tốt
trong môi trường muối mật 0,3%, là một trong
những đặc điểm quan trọng của nhóm vi sinh
vật sử dụng làm probiotic phục vụ trong chăn
nuôi gia súc, gia cầm.
LỜI CẢM ƠN
Đề tài này được tài trợ bởi Dự án Nâng cấp
Trường Đại học Cần Thơ VN14-P6 bằng nguồn
vốn vay ODA từ chính phủ Nhật Bản.
TÀI LIỆU THAM KHẢO
1. Ahiwe E.U., Dos Santos T.T., Graham H. and P.A. Iji
(2021). Can probiotic or prebiotic yeast (S. cerevisiae)
serve as alternatives to in-feed antibiotics for healthy or
disease-challenged broiler chickens? A review. J. App.
Poul. Res., 30(3): 100164.
2. Boonkumklao P., Parichart K. and A. Apinya (2006).
Acid and bile tolerance of Lactobacillus thermotolerans,
a novel species isolated from chicken feces. Agr. Nat.
Resour., 40(5): 13-17.
3. Cao Ngọc Điệp và Nguyễn Hữu Hiệp (2008). Giáo
trình thực tập môn vi sinh vật đại cương. Trường Đại
học Cần Thơ.
4. Tô Minh Châu (2000). Giáo trình thực tập vi sinh vật
học. Trường Đại học Nông Lâm Tp. HCM.
5. Dalloul R., Lillehoj H., Shellem T. and Doerr J. (2003).
Enhanced mucosal immunity against Eimeria acervulina
in broilers fed a Lactobacillus-based probiotic. Poul.
Sci., 82(1): 62-66.
6. Nguyễn Lân Dũng, Nguyễn Đình Quyển và Phạm
Văn Ty (2000). Vi sinh vật. NXB Giáo dục, Tp. HCM.
7. Phạm Kim Đăng, Trần Hiệp và Nguyễn Đình Trình
(2016). Ảnh hưởng của việc bổ sung chế phẩm Bacillus
pro đến một số chỉ tiêu kinh tế-kỹ thuật của lợn sinh
trưởng. Tạp chí KHKT Chăn nuôi, 205: 37-42.
8. Fakruddin M., Hossain M.N. and M.M. Ahmed
(2017). Antimicrobial and antioxidant activities
of Saccharomyces cerevisiae IFST062013, a potential
probiotic. BMC Complement. Med. Ther., 17(1): 64.
9. Gilliland S.E., Staley T.E. and L.J. Bush (1984).
Importance of bile tolerance of Lactobacillus acidophilus
used as a dietary adjunct. Int. J. Dai. Sci., 67(12): 3045-51.
10. Gorobets A.Y., Trubnikov D.V., Trubnikova, E.V.
and A.S. Belous (2021). Safety and properties of
Enzymesporine microencapsulated probiotic product
with enzyme and its effect on the physiology of
intestinal digestion and weight gain of pigs. IOP Conf.
Ser. Earth Env. Sci., 624(1): 012225.
11. Hartwell L.H. (1974). Saccharomyces cerevisiae cell
cycle. Bacteriol. Rev., 38(2): 164.

KHKT Chăn nuôi số 278 - tháng 6 năm 2022 39

 DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI

12. Hoben H. and P. Somasegaran (1982). Comparison
of the Pour, Spread, and Drop plate methods for
enumeration of Rhizobium spp. in inculants made from
presterilized peat. App. Env. Microbiol. 44(5): 1246-47.
13. Nguyễn Thị Huyền, Nguyễn Thị Thu Hường, Trịnh
Thị Thủy Linh, Nhữ Thị Hà, Trịnh Thị Hảo, Nguyễn
Thành Linh và Đặng Xuân Nghiêm (2014). Khảo sát
thành phần vi sinh và các đặc tính probiotic của các
sản phẩm men tiêu hóa trên thị trường. Tạp chí KHPT,
12(1): 65-72.
14. Jayaraman S., Thangavel G., Kurian H., Mani R.,
Mukkalil R. and H. Chirakkal (2013). Bacillus subtilis
PB6 improves intestinal health of broiler chickens
challenged with Clostridium perfringens induced
necrotic enteritis. Poult. Sci., 92(2): 370-374.
15. Jensen H., Grimmer S., Naterstad K. and L.
Axelsson (2012). In vitro testing of commercial and
potential probiotic lactic acid bacteria. Int. J. Food
Microbiol., 153(1): 216-222.
16. Jermini M.F. and W. Schmidt-Lorenz (1987).
Heat resistance of vegetative cells and asci of two
Zygosaccharomyces yeasts in broths at different water
activity values. J. Food Prot., 50(10): 835-84.
17. Kantas D., Papatsiros V., Tassis P., Giavasis I., Bouki
P. and E. Tzika (2015). A feed additive containing
Bacillus toyonensis (Toyocerin®) protects against enteric
pathogens in postweaning piglets. J. App. Microbiol.,
118(3): 727-38.
18. Kim P.I., Jung M.Y., Chang Y.H., Kim S., Kim S.J. and
Y.H. Park (2007). Probiotic properties of Lactobacillus
and Bifidobacterium strains isolated from porcine
gastrointestinal tract. Appl. Microbiol. Biotechnol.,
74(5): 1103-11.
19. Lei X., Piao X., Ru Y., Zhang H., Peron A. and Zhang H.
(2015). Effect of Bacillus amyloliquefaciens-based direct-
fed microbial on performance, nutrient utilization,
intestinal morphology and cecal microflora in broiler
chickens. Asian-Aust. J. Ani. Sci., 28(2): 239-46.
20. Meng Q., Yan L., Ao X., Zhou T., Wang J., Lee J. and Kim
I. (2010). Influence of probiotictv in different energy and
nutrient density diets on growth performance, nutrient
digestibility, meat quality, and blood characteristictv in
growing-finishing pigs. J. Anim. Sci., 88(10): 3320-26.
21. Nimrat S. and V. Vuthiphandchai (2011). In vitro
evaluation of commercial probiotic products used
for marine shrimp cultivation in Thailand. Afr. J.
Biotenchnol., 10(22): 4643-50.
22. Lương Đức Phẩm (2006). Nấm men Công nghiệp. NXB
KHKT, Hà Nội.
23. Pyar H. and K.K. Peh (2014). Characterization and
identification of Lactobacillus acidophilus using biolog
rapid identification system. Int. J. Pha. Pha. Sci., 6(1):
189-93.
24. Đoàn Thị Vân, Nguyễn Công Thùy Trâm và Nguyễn
Thị Thu Bình (2021). Ứng dụng vi khuẩn Bacillus
licheniformis TT01 xử lý phụ phẩm chăn nuôi chim cút.
Tạp chí KHCN-Đại học Đà Nẵng, 19(10): 82-86.
25. Trần Quốc Việt, Bùi Thị Thu Huyền, Dương Văn Hợp
và Vũ Thành Lâm (2009). Phân lập, tuyển chọn và đánh
giá các đặc tính probiotic của một số chủng vi sinh vật
hữu ích để sản xuất các chế phẩm probiotic dùng trong
chăn nuôi. Tạp chí KHCN Chăn nuôi, 16: 35-45.
26. Weiss A., Hans O.L., Walter K., Helmut K.M. and
K. Wolfgang (2005). Molecular methods used for the
identification of potentially probiotic Lactobacillus
reuteri strains. Food Technol. Biotechnol., 43(3): 295-00.

XÁC ĐỊNH MỨC NĂNG LƯỢNG VÀ PROTEIN THÍCH HỢP CHO

GÀ LAI HƯỚNG TRỨNG GB GIAI ĐOẠN 20-72 TUẦN TUỔI
Phạm Thị Thanh Bình1*, Nguyễn Thị Hải1, Nguyễn Thị Mười1, Trần Thị Thu Hằng1 và Đào Đoan Trang1
Ngày nhận bài báo: 10/02/2022- Ngày nhận bài phản biện: 22/02/2022
Ngày bài báo được chấp nhận đăng: 11/3/2022
TÓM TẮT
Nghiên cứu được tiến hành nhằm xác định mức năng lượng trao đổi (ME) và protein thô (CP)
thích hợp trong khẩu phần nuôi gà lai GB hướng trứng giai đoạn 20-72 tuần tuổi tại Trung tâm
Thực nghiệm và Bảo tồn vật nuôi. Thí nghiệm được bố trí theo phương pháp ngẫu nhiên hoàn toàn
2 nhân tố: Nhân tố 1 là 3 mức ME (2.650, 2.750, 2.850 kcal) và nhân tố thứ hai là 3 mức CP (16,5; 17,0
và 17,5%). Thí nghiệm được chia làm 9 lô, mỗi lô lặp lại 3 lần, mỗi lần lặp lại gồm 50 mái. Kết quả
cho thấy: với mức ME 2750kcal/kg TĂ và CP 17%, nuôi gà lai GB giai đoạn 20-72 tuần tuổi đạt hiệu
quả cao nhất: năng suất trứng/mái đạt 268,20 quả, tiêu tốn thức ăn/10 trứng là 1,53kg, chi phí thức
ăn/10 trứng là 14.448 đồng.
Từ khóa: Gà lai GB hướng trứng, năng lượng, protein.
1
Trung tâm Thực nghiệm và Bảo tồn vật nuôi
*Tác giả liên hệ: Ths. Phạm Thị Thanh Bình, Trung tâm Thực nghiệm và Bảo tồn vật nuôi - Thụy Phương, Bắc Từ Liêm, Hà
Nội; Điện thoại: 0982217287; Email: binhpham7287@gmail.com

40 KHKT Chăn nuôi số 278 - tháng 6 năm 2022

 Livestock Research for Rural Development 35 (5) LRRD LRRD Guide for preparation of LRRD Citation of this
2023 Search Misssion papers Newsletter paper

Effect of urea treatment and preservation duration on chemical composition of rice

straw offer for growing Sind crossbred cattle
Nguyen Thiet and Nguyen Trong Ngu1
College of Rural Development, Can Tho University, Can Tho City, Vietnam
ntngu@ctu.edu.vn
1 College of Agriculture, Can Tho University, Can Tho City, Vietnam

Abstract
This study was aimed to determine the effect of varying levels of urea treatment and preservation time on chemical composition of rice
straw offer for growing beef cattle. First experiment was arranged with a completely randomized design with 04 treatments and 04
replicates. The treatments were U2: rice straw + 2% urea; U3) rice straw + 3% urea; U4: rice straw + 4% urea; U5: rice straw + 5% urea.
Second experiment was arranged into a completely randomized design, consisting of three treatments and three replicates (3
animals/replicate). The treatments were control (C) 0.5 kg rice bran/100 kg body weight + natural grass ad libitum; U3: 0.5 kg rice
bran/100 kg body weight + 1,5 kg natural grass/100 kg BW + 3% urea treated rice straw ad libitum; U5: 0.5 kg rice bran/100 kg body
weight + 1,5 kg natural grass/100 kg BW + 5% urea treated rice straw ad libitum. The results from first experiment showed that there was
not influence of urea treatment on DM and ADF contents. But CP level increased as urea added in rice straw increased (p<0.05). After 30
days’ incubation NDF and lignin levels were lower in U3, U4 and U5 as compared to U2 (p<0.05). Cattle supplemented with 3% or 5%
urea treated rice straw did not affect on DMI and FCR, whereas improved final body weight and weight gain. It concluded that using 3%
or 5% urea treated rice straw can replace up to 53.78% natural grass and improve animal performance.

Key words: beef cattle, performance, rice straw, urea

Introduction
According to the Department of Livestock Production beef cattle were from 677.873 heads in 2014 to 849.642 heads in 2019, which
increased 1.25 times during 2014-2019 (GSO 2019). Rice straw is a major forage for ruminant in rice-producing areas. Rice straw can be
treated in order to improve its nutritive value. Those treatments are designed to enhance feed intake and digestibility. Improving
digestibility may be achieved through mechanical, chemical, heat and pressure treatments. Urea treatment is the easiest to apply. It can be
done by smallholder farmers using plastic bags, with a 5% urea w/w solution and can increase digestibility by 18% (Van Soest 2006).
Feeding rice straw to livestock reduces its environmental impact and makes the best use of rice as both an energy source and a protein
provider. In short, rice straw has high indigestible fiber content and low protein and energy levels (Aquino et al 2019; Sarnklong et al
2010). They are common use as basal diet in ruminant. Additionally, intake capacity from animal is limited due to physical characteristics
and low nutrition digestibility (Ravi et al 2019). Therefore, improvement of nutrition digestibility and intake are the main objectives when
using rice straw provide for animal. The objectives of this study were to determine the effect of varying levels of urea treatment and
preservation time on chemical composition of rice straw offer for growing beef cattle.

Materials and methods

Experiment 1: Effect of urea treatment and preservation duration on chemical composition of rice straw

Experimental design
The experiment was arranged with a completely randomized design, 4 treatments and 4 replicates. Samples were collected on days 1, 30,
60 and 90 after adding with urea. The treatments were as follows:

Treatment 1 (U2): rice straw + 2% urea

Treatment 2 (U3): rice straw + 3% urea

Treatment 3 (U4): rice straw + 4% urea

Treatment 4 (U5): rice straw + 5% urea

Urea treatment preparation

Dry rice straw was chopped into 7 to 10 cm long, then it was added with urea solution depending on the treatments. The mixtures were
packed into polyethylene bags with a 50 kg capacity with air removed from inside the bags.

Sampling collection and analysis

The samples (400 g each bag) were collected on days 1, 30, 60, and 90 after adding with urea. All samples were dried in an oven at 65oC
until the weight was stabilized (24 hours), then analyzed for crude protein (CP), ash, and crude fiber (CF) contents according to AOAC
(1990). Neutral detergent fiber (NDF), acid detergent fiber (ADF) and lignin were determined by the procedure of Van Soest et al (1991).

Experiment 2: Effect of urea treated rice straw on weight gain and FCR of Sind crossbred cattle

Experimental design
Twenty-seven growing cattle (Sind crossbred cattle), 11 months of age and 120.28±0.92 kg of body weight, were randomly selected and
assigned to a completely randomized design with 3 treatments and 3 replicates (3 animals/replicate). The cattle were vaccinated against
foot and mouth disease, de-wormed using Ivermectin before running the experiment. They were randomly allocated to treatments: control
(C) 0.5 kg rice bran/100 kg body weight + natural grass ad libitum; U3: 0.5 kg rice bran/100 kg body weight + 1,5 kg natural grass/100 kg
BW + 3% urea treated rice straw ad libitum; U5: 0.5 kg rice bran/100 kg body weight + 1,5 kg natural grass/100 kg BW + 5% urea treated
rice straw ad libitum.

Urea treatment preparation

Dry rice straw was treated with 3% or 5% urea depending on the treatments. The solid urea was diluted in the water and sprayed on to the
dry rice straw slowly, and incubated in plastic bags for 30 days before feeding. The chemical composition of feeds is presented in Table 1.
Cattle were fed twice daily at 07:00 and 15:00 and had free access to water. All animals were kept in individual pens with cement floors.
Animals were weighted at the beginning and the end of experiment, before morning feeding.

Table 1. Chemical composition of feeds in the experiment (DM basis)

Items, Rice Natural 3% urea treated 5% urea treated
% bran grass rice straw (U3) rice straw (U5)
DM 88.13 22.52 47.50 48.01
CP 15.36 7.01 12.01 14.11
ADF 26.28 47.32 38.52 38.24
NDF 45.29 65.50 62.31 62.54

Data collection
Feed and feed refusal were recorded daily. At the end of the study, all samples were analyzed for dry matter (DM), ash, and crude protein
(CP) according to AOAC (1990). All animals were weighed at the beginning of the experiment and once a month throughout the
experiment period. Measurements were DM intake, body weight (BW), BW gain, and feed conversion ratio (FCR).

Photo 1. Rice straw was added with urea, packed into polyethylene bags and offered for growing crossbred Sind cattle
Statistical analysis
The data were subjected to analysis of variance using the General Linear Model procedure of Minitab software version 16.2.1. Tukey's
pairwise comparisons (p<0.05) were applied to determine the differences between dietary treatments.

Results and discussion

Effect of urea treatment and preservation duration on chemical composition of rice straw
During 90 days, there were not influence of urea treatment on DM and ADF contents (Table 2; p>0.05) in this study. Similar findings were
reported by previous studies (Trach and Tuan 2008; Fang et al 2012). But some studies found that urea treated rice straw decreased ADF
content (Wanapat et al 2013). This study showed that urea treatment influenced the CP content of rice straw (Table 2, p<0.05). Adding
from 2 to 5% in rice straw has increased CP level from 8.52% in U2 at day 1 to 13.94% in U5 at day 30. The increased CP level from urea
treated rice straw was also reported by Pradhan et al (1996) and Gunun et al (2013). In contrast, from 30 to 60 days after incubation NDF
and lignin levels decreased as urea levels increased (Table 2; p<0.05). The decrease in NDF content may be due to the reduction in
hemicelluloses which was used by microorganism during fermentation (Wadhwa et al 2010) or the reduction in lignin content from present
experiment. Similar results were reported by Sharma et al (2004) and Wanapat et al (2013). In short, urea treated rice straw can improve
nutritive contents of rice straw by increasing CP content (U5 group) and decreasing NDF and lignin levels (U3, U4 and U5 groups) after
30 days’ incubation. Therefore, we prefer to 3% and 5% urea levels which will be added to dry rice straw and offered for growing cattle in
second experiment.

Table 2. Effect of urea treatment and preservation duration on chemical composition of rice straw
Treatment
Day Parameters SEM p
U2 U3 U4 U5
1 48.9 49.2 48.8 49 0.47 0.82
30 48.0 47.8 47.5 47.2 0.68 0.66
DM (%)
60 47.3 46.9 46.8 46.8 0.67 0.74
90 47.0 46.8 46.6 46.5 0.52 0.66
1 8.51c 10.9b 11.4b 13.44a 0.32 0.001
30 9.00d 10.4c 11.97b 13.94a 0.28 0.001
CP (%)
60 9.01b 10.8b 12.70a 13.64a 0.42 0.001
90 9.06b 10.14b 12.46a 13.52a 0.34 0.001
1 38.58 38.74 38.26 38.53 0.41 0.87
30 39.01 38.53 38.36 38.71 0.44 0.76
ADF (%)
60 39.12 39.3 38.05 38.66 0.49 0.39
90 38.93 38.87 38.78 37.68 0.73 0.59
1 66.23 66.22 65.73 65.61 0.67 0.87
30
NDF (%) 65.10a 63.09ab 62.40b 62.28b 0.49 0.005
60 65.11 62.9 62.86 62.04 0.82 0.06
90 64.14 62.73 61.92 61.86 0.79 0.20
1 19.9 19.1 18.67 19.25 0.38 0.195
30 19.2a 16.5b 16.45b 16.47b 0.48 0.001
Lignin (%)
60 18.3a 16.6b 16.12b 16.36b 0.34 0.01
90 16.9 16.3 15.96 16.38 0.32 0.26
a,b: Means in the same row without sharing a letter are different at p<0.05

Effect of urea treated rice straw on weight gain and FCR of Sind crossbred cattle
The result in current experiment showed that there was not influence urea treatment on DMI at first and third months. But cattle fed with
5% urea treated rice straw (U5 group) increased DMI as compared to other groups at second month from this study (Table 3; p<0.05). In
principle, natural grass is more palatable than urea treated rice straw because it has high contents of indigestible fibers and anti-nutritional
factors (silica and lignin). But this study found that cattle from urea treatment groups can replaced up to 53.78% natural grass (data not
show) without negative effects on DMI. Chenost and Kayouli (1997) suggested that alkali agents can be absorbed into the cell wall and
chemically break down the ester bonds between lignin and hemicellulose/cellulose and follow by making the structural fibers swollen. In
addition, urea treatment also increased nutrients digestibility as suggested by previous studies (Gunun et al 2013; Wanapat et al 2013).
These factors contribute to improve DMI in cattle fed with urea treated rice straw.
 Table 3. Effect of urea treatment on dry matter intake in growing Sind crossbred cattle
Treatment
SEM p
Control U3 U5
Urea treated rice straw, kg/100 kgBW/day
1st month 0.00b 0.773a 0.991a 0.12 0.01
nd
2 month 0.00 b 0.655 a 0.917a 0.10 0.01
3rd month 0.00b 0.754a 0.935a 0.06 0.001
Rice bran, kg/100 kgBW/day
1st month 0.562 0.578 0.526 0.02 0.20
2nd month 0.620 0.644 0.493 0.03 0.06
rd
3 month 0.655 0.522 0.428 0.05 0.09
Natural grass, kg/100 kgBW/day
1st month 2.17a 1.29b 1.27b 0.10 0.01
nd
2 month 2.12a 1.43a 1.43b 0.11 0.02
3rd month 2.07a 1.60ab 1.42b 0.10 0.02
Total DMI, kg/100 kgBW/day
1st month 2.73 2.64 2.79 0.05 0.20
2nd month 2.74b 2.73b 2.84a 0.02 0.02
3rd month 2.73 2.87 2.79 0.07 0.39
abc Means in the same row without sharing a letter are different at p<0.05

Cattle supplemented with urea treated rice straw with 3% (U3) or 5% (U5) were better final body weight, daily weight gain than those in
the control (Table 4; p<0.05) or linear trends in improvement of live weight gain as the levels of treated rice straw increased (Figure 1, R2
= 0.95). The improvement of BW or gain may be higher CP intake from urea treatment from this study or nitrogen from urea treatment
could increase the activity of ruminal microorganism in degrading fibers of cell wall when energy was sufficient (Obara et al 1975) and
nutrients digestibility (Gunun et al 2013; Wanapat et al 2013). Don Viet Nguyen and Lam Hoang Dang (2020) found that 2% urea treated
fresh rice straw can be replaced from 33.33% (1/3) to 66.67% (2/3) green grass without the effects on final BW or gain in Sind crossbred
cattle. But this study showed that 3% or 5% urea treated dry rice straw can replace up to 53.78% natural grass and improve final BW and
gain. Although FCR did not differ among treatments (Table 4; p>0.05), but cattle fed with urea treatment were lower FCR than those as
compared to control from 7.87% (U3) to 13.69% (U5). In addition, there was linear trend in improvement of FCR as the levels of treated
rice straw increased (Figure 2, R2 = 0.99). The FCR from this study was consistent to Don and Dang (2020).
Table 4. Effect of urea treatment on live weight gain and feed conversion ratio in growing
Sind crossbred cattle
Treatment
Items SEM p
Control U3 U5
Initial body weight (kg/head) 119.17 122.11 119.56 1.88 0.54
Final body weight (kg/head) 159.17b 168.89a 169.33a 1.26 0.01
Live weight gain (kg/head/day) 0.444b 0.520a 0.553a 0.01 0.01
Feed conversion ratio (FCR) 9.28 8.55 8.01 0.33 0.15
FCR compared to control (%) 0 7.87 13.69
abc Means in the same row without sharing a letter are different at p<0.05

Figure 1. Effect of urea treatment on live weight Figure 2. Effect of urea treatment feed conversion
gain in growing Sind crossbred cattle ratio in growing Sind crossbred cattle

Conclusions
Adding 3% or 5% urea to rice straw can improve nutritive contents of rice straw by increasing CP content and decreasing NDF and
lignin levels after 30 days’ incubation.

Cattle supplemented with urea treated rice straw with 3% (U3) or 5% (U5) can replace up to 53.78% natural grass without influence
on daily DMI and FCR and improve final body weight, weight gain.

References
AOAC 1990 Association of Official Analytical Chemistry. Official Method of Analysis, 15th Edn. Washington, DC., USA.

Aquino D, Barrio A D, Trach N.X, Hai N T, Khang D N, Toan N T and Hung N V 2019 Rice straw – based fodder for ruminants,In: Gummert M, Hung N,
Chivenge P, Douthwaite B. (eds). Sustainable Rice Straw Management. Springer, Cham., pp. 111 – 119.

Chenost M and Kayouli C 1997 Roughage Utilization in Warm Climates. Food and Agriculture Organization of the United Nations. Rome.

Don N V and Dang H L 2020 Fresh rice straw silage affected by ensiling additives and durations and its utilization in beef cattle diets. Asian Journal Animal Science,
14: 6-24.

Fang J M, Matsuzaki H, Suzuki Y, Cai K, Horiguchi I and Takahashi T 2012 Effects of lactic acid bacteria and urea treatment on fermentation quality,
digestibility and ruminal fermentation of roll bale rice straw silage in wethers. Grassland Science Journal, 58: 73-78.

General statistics office (GSO) 2019 Statistical yearbook of Vietnam, pp: 481-591.

Gunun P, Wanapat M and Anantasook N 2013 Rumen fermentation and performance of lactating dairy cows affected by physical forms and urea treatment of rice
straw. Asian-Australasian Journal of Animal Sciences, 26: 1295-1303.

Obara Y, Shimbayashi K and Yonemura T 1975 Changes of ruminal properties of sheep during feeding urea diet. Japanese Journal Zootechnical Science, 46: 140-
145

Pradhan R, Tobioka H and Tasaki I 1996 Effect of urea and ammonia treatment on voluntary intake, digestibility, energy partition and nitrogen retention of rice
straw supplemented with soybean meal and fish meal in goats. Animal Science and Technology (Jpn) 67(8): 702 – 712.

Ravi D, Rao I V S, Jyothi B, Sharada P, Venkateshwarlu G, Reddy R K, Prasad K V S V and Blummel M 2019 Investigation of fifteen popular and widely
grown Indian rice varieties for variations of straw fodder traits and grain-straw relationship. Field Crop Research, 241: 107566.

Sarnklong C, Cone J W, Pellikaan W and Hendricks W H 2010 Utilization of rice straw and different treatments to improve its feed value for ruminants: a review.
Asian-Australasian Journal of Animal Science, 23 (6): 680-692

Sharma K, Dutta N and Naulia U 2004 An on-farm appraisal of feeding urea-treated straw in buffaloes during late pregnancy and lactation in a mixed farming
system. Livestock Research for Rural Development, 16 (11).From http://www.lrrd.org/lrrd16/11/shar16091.htm

Trach N X and Tuan B Q 2008 Effects of treatment of fresh rice straw on its nutritional characteristics. Journal of Agricultural Science and Technology. Hanoi
Agricultural University, Special Issues, pp: 129-135.

Van Soest P J, Robertson J B, Lewis B A 1991 Methods for dietary fiber neutral detergent fiber and non-starch polysaccharides in relation to animal nutrition.
Journal of Dairy Science, 74: 3583–3597.

Van Soest P J 2006 Rice straw, the role of silica and treatments to improve quality. Animal Feed Science Technology, 130: 137-171.

Wadhwa M, Kaur K and Bakshi M 2010 Effect of naturally fermented rice straw based diet on the performance of buffalo calves. Indian Journal Animal Science,
80: 59-62.

Wanapat M, Kang S, Hankla M and Phesatcha K 2013 Effect of rice straw treatment on feed intake, rumen fermentation and milk production in lactating dairy
cows. African Journal of Agricultural Research, 8 (7): 1677 – 1687.

Received 1 February 2023; Accepted 17 March 2023; Published 1 May 2023

KHKT Chăn nuôi Số 286 - tháng 3 năm 2023

Phó Tổng biên tập Phụ trách: DI TRUYỀN - GIỐNG VẬT NUÔI
PGS.TS. NGUYỄN VĂN ĐỨC Lưu Khải Nhiên và Nguyễn Ngọc Tấn. Ảnh hưởng của việc bổ sung huyết thanh
thai bò trong môi trường nuôi cấy đến sự phân lập và tăng sinh tế bào nguyên sợi từ
Phó Tổng biên tập: mẫu mô buồng trứng heo
PGS.TS. NGUYỄN ĐĂNG VANG Tạ Thị Hương Giang, Phùng Đức Tiến và Nguyễn Quý Khiêm, Trần Ngọc Tiến,
TS. NGUYỄN XUÂN DƯƠNG Phạm Thị Kim Thanh và Nguyễn Thị Tâm. Kết quả chọn tạo ngan dòng mái NTP2
theo hướng năng suất trứng
Thư ký tòa soạn: Trần Trung Tú, Lê Thanh Phương và Nguyễn Trọng Ngữ. Năng suất sinh sản của
gà Ác (Gallus gallus domesticus Brisson) giai đoạn 16-40 tuần tuổi
PGS.TS. NGUYỄN VĂN ĐỨC
Mai Thị Xoan và Hồ Nguyễn Thị Huyền Trân. Khả năng sinh trưởng, năng suất và
chất lượng thịt vịt Grimaud nuôi sàn tại Tp. Buôn Ma Thuột, tỉnh Đắk Lắk
Ủy viên Ban biên tập: Hồ Quốc Đạt và Phạm Đăng Khoa. Năng suất sinh trưởng của tổ hợp lai giữa nái
TS. NGUYỄN QUỐC ĐẠT F1(LY) và F1(YL) phối với đực D, L, Y giai đoạn 70-170 ngày tuổi tại Trung tâm Giống
PGS.TS. HOÀNG KIM GIAO tỉnh Bạc Liêu
GS.TS. NGUYỄN DUY HOAN Đặng Hồng Quyên, Nguyễn Thị Hạnh và Trần Đình Vy. Năng suất sinh sản của
GS.TS. DƯƠNG NGUYÊN KHANG lợn nái Lai F1(Landrace x Yorkshire) phối với đực Duroc tại Công ty TNHH Lợn giống
PGS.TS. NGUYỄN THỊ KIM KHANG hạt nhân Dabaco
PGS.TS. ĐỖ VÕ ANH KHOA
PGS.TS. ĐỖ ĐỨC LỰC
DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI
Đỗ Thị Phương Thảo, Hoàng Thị Phương Thúy, Trần Anh Tuyên, Nguyễn Thị
GS.TS. LÊ ĐÌNH PHÙNG Quyên, Nguyễn Xuân Việt và Nguyễn Tài Năng. Sản xuất chế phẩm thảo dược
dạng bột và hiệu quả dùng bổ sung trong thức ăn chăn nuôi gà thịt
Xuất bản và Phát hành: Phạm Văn Quyến, Nguyễn Thị Thủy, Hoàng Thị Ngân, Nguyễn Văn Tiến, Giang Vi
ThS. NGUYỄN ĐÌNH MẠNH Sal, Bùi Ngọc Hùng, Nguyễn Thanh Tùng, Hoàng Anh Dương, Nguyễn Ngọc Anh
Thư, Hồ Ngọc Trâm, Phương Khánh Hồng và Nguyễn Đức Điện. Khẩu phần nuôi
dưỡng bò lai F1 hướng thịt phù hợp với điều kiện chăn nuôi tại tỉnh Tây Ninh

U Nguyễn Thị Mai, Sunva Xaythanasy, Mai Văn Tùng, Lê Hoàng Vũ và Phạm Thị
Hải. Ảnh hưởng của thức ăn bổ sung dầu vừng đến tăng trưởng, sử dụng thức ăn, tỷ
lệ sống và khả năng kháng bệnh ở cá rô phi vằn Oreochromis Niloticus

CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC

Giấy phép: Bộ Thông tin và Truyền thông Nguyễn Thị Thu Hiền. Tổng quan nghiên cứu Hormone stress không xâm lấn trên
Số 257/GP- BTTTT ngày 20/05/2016 động vật hoang dã
ISSN 1859 - 476X Phạm Văn Quyến, Nguyễn Thị Thủy, Hoàng Thị Ngân, Nguyễn Văn Tiến, Giang Vi
Sal, Bùi Ngọc Hùng, Nguyễn Thanh Tùng, Hoàng Anh Dương, Nguyễn Ngọc Anh
Xuất bản: Hàng tháng Thư, Hồ Ngọc Trâm, Phương Khánh Hồng và Nguyễn Đức Điện. Năng suất sinh
Toà soạn: sản của bò cái lai hướng thịt tại tỉnh Tây Ninh
Địa chỉ: Tầng 4, Tòa nhà 73, Trương Văn Khang, Nguyễn Trung Trực, Nguyễn Trọng Ngữ và Nguyễn Thiết.
Ngưỡng chịu mặn và ảnh hưởng của nước biển pha loãng lên năng suất của dê

Hoàng Cầu, Ô Chợ Dừa,
Bách Thảo
Đống Đa, Hà Nội.
Nguy n Vĩ Nhân. Khả năng sinh trưởng, năng suất và thành phần hóa học của cây
Điện thoại: 024.36290621 mật gấu (Vernonia Amygdalina Del) ở chiều cao cắt khác nhau
ễ
Fax: 024.38691511 Nguyễn Đức Nghĩa, Cù Thị Thúy Nga, Nguyễn Mạnh Tuấn và Nguyễn Thị Minh
E - mail: tapchichannuoi@hoichannuoi.vn Thuận. Ảnh hưởng của chế phẩm vi sinh đến vi khuẩn gây bệnh và hàm lượng dinh
dưỡng của phân dê
Website: www.hoichannuoi.vn Vũ Thị Ánh Huyền, Đỗ Thị Vân Giang, Nguyễn Thị Bích Ngà và Đặng Văn Nghiệp.
Tài khoản: Tình hình bệnh dịch tả lợn châu Phi trên địa bàn tỉnh Bắc Ninh giai đoạn 2019-2021
Tên tài khoản: Hội Chăn nuôi Việt Nam
Số tài khoản: 1300 311 0000 40, tại Ngân hàng THÔNG TIN KHOA HỌC VÀ CÔNG NGHỆ
PGS.TS. Nguyễn Văn Đức. Ứng dụng công nghệ cao trong chăn nuôi và một số điểm
Nông nghiệp và Phát triển Nông thôn, Chi nhánh sáng
Thăng Long - Số 4, Phạm Ngọc Thạch, Hà Nội. Ban Biên tập. Quy chuẩn kỹ thuật quốc gia về nước thải chăn nuôi sử dụng cho cây
In 1.000 bản, khổ 19x27 tại Công ty CP KH&CN trồng
Ban Biên tập. Đồng Nai di dời 3.006 cơ sở chăn nuôi ra khỏi khu vực không được
Hoàng Quốc Việt. In xong và nộp lưu chiểu: phép chăn nuôi
tháng 3/2023. Ban Biên tập. Chùm tin: Dịch bệnh vẫn là nguy cơ lớn trong chăn nuôi
Ban Biên tập. Chín giải pháp đột phá về phát triển nông nghiệp năm 2023
 CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC
Droughtmaster và Red Angus nuôi trong nông hộ tỉnh
Quảng Ngãi. Tạp chí KHNN Việt Nam, 19(1): 42-49.
18. Marie-Madeleine M., Gilles R., Daniel K. and François
M. (1999). Puberty of Charolais heifers in relation to
growth rate. Ann. Zoot., 48: 413-26.
19. Michaela B., Jindrich C., Alena S. and Zdenka V.
(2020). Genetic parameters for age at first calving and
first calving interval for beef cattle. Animals, 10: 2122.
20. Hoàng Thị Ngân, Phạm Văn Quyến, Nguyễn Văn
Tiến, Bùi Ngọc Hùng, Giang Vi Sal, Nguyễn Thị
Thủy và Lê Thị Ngọc Thùy (2021). Khả năng thích nghi
và một số chỉ tiêu sinh sản của bò Red Angus ngoại
nhập 3 lứa đầu nuôi tại Trung tâm Nghiên cứu và Phát
triển Chăn nuôi Gia súc lớn. Tạp chí KHKT Chăn nuôi,
270(10.21): 8-22.
21. Ochio D.M.J., Baruselli P.S. and Campanile G. (2019).
Influence of nutrition, body condition, and metabolic
status on reproduction in female beef cattle: A review.
Theriogenology, 125: 277-84.
22. Oyedipe E.O., Osori D.I.K., Akerejola O. and
Saror D. (1982). Effect of level of nutrition on
onset of puberty and conception rates of zebu
heifers. Theriogenology, 18: 525-39. Cross Ref Google
Scholar PubMed.
23. Phillips C.J.C. (2010). Principle of Cattle Production.
2nd-ed. CABI. Wallingford.
24. Phạm Văn Quyến (2009). Nghiên cứu khả năng sản
xuất của bò Droughtmaster thuần nhập nội và bò lai
giữa bò Droughtmaster với bò lai Sind tại miền Đông
Nam bộ. Luận án Tiến sĩ.
25. Phạm Văn Quyến (2010). Khả năng sản xuất của bò
Droughtmaster thuần nhập nội và bò lai (Droughtmaster
x lai Sind) tại miền Đông Nam bộ. KHCN Chăn nuôi,
9(2010): 26-34.
26. Phạm Văn Quyến, Nguyễn Văn Tiến, Giang Vi Sal,
Bùi Ngọc Hùng, Hoàng Thị Ngân, Nguyễn Thị Thủy,
Đoàn Đức Vũ, Huỳnh Văn Thảo, Nguyễn Thị Ngọc
Hiếu, Thạch Thị Hòn, Nguyễn Thanh Hoàng và
Hoàng Thanh Dũng (2022a). Khả năng sinh sản của các
nhóm bò lai hướng thịt tại tỉnh Trà Vinh. Tạp chí KHKT
Chăn nuôi, 275(3.22): 28-38.
27. Phạm Văn Quyến, Nguyễn Văn Tiến, Giang Vi Sal,
Bùi Ngọc Hùng, Hoàng Thị Ngân, Nguyễn Thị Thủy,
Đoàn Đức Vũ, Lê Việt Bảo, Lê Minh Trí và Bùi Thanh
Điền (2022b). Năng suất sinh sản của bò cái lai hướng
NGƯỠNG CHỊU MẶN VÀ ẢNH HƯỞNG CỦA NƯỚC BIỂN PHA
LOÃNG LÊN NĂNG SUẤT CỦA DÊ BÁCH THẢO
Trương Văn Khang1, Nguyễn Trung Trực2, Nguyễn Trọng Ngữ1 và Nguyễn Thiết1*
Ngày nhận bài báo: 16/12/2022 - Ngày nhận bài phản biện: 30/12/2022
Ngày bài báo được chấp nhận đăng: 30/01/2023
1
Trường Đại học Cần Thơ
2
Trường Cao đẳng Nông nghiệp Nam Bộ
* Tác giả liên hệ: TS. Nguyễn Thiết, Khoa Phát triển Nông thôn, Trường Đại học Cần Thơ. Điện thoại: 093.214.7900; Email:
nthiet@ctu.edu.vn.
74
thịt tại thành phố Hồ Chí Minh và đông Nam bộ. Tạp
chí KHKT Chăn nuôi, 277(5.22): 17-18.
28. Riley D.G., Chase C.C., Coleman S.W., Olson T.A. and
Randel R.D. (2010). Evaluation of tropically adapted
straightbred and crossbred beef cattle: Heifer age and
size at first conception and characteristics of their first
calves. J. Ani. Sci., 88: 3173-82.
29. Roughsedge T., Amer P.R., Thompson R. and Simm G.
(2005). Genetic parameters for maternal breeding goal
in beef production. J. Ani. Sci., 83: 2319-29.
30. Siller A.E. (2017). Initial Asessment of calf performance
and cow reproduction traits in a dominican republic
beef herd. Masters thesis. Texas A & M university.
31. Phạm Văn Thanh (2016). Báo cáo kết quả dự án ứng
dụng thụ tinh nhân tạo giống bò B.B.B với đàn bò cái
nền lai Zebu nhằm nâng cao chất lượng đàn bò thịt trên
địa bàn tỉnh Vĩnh Phúc, 05/TKTNVP, Sở Khoa học và
Công ngệ tỉnh Vĩnh Phúc.
32. Torell (2009). Gestation length of the beef cow vs.
dystocia. Extension Liv. specialist Uni. Nevada.
February, 2009.
33. Nguyễn Quốc Trung (2014). So sánh con lai giữa các
giống bò Brahman, Red Angus, lai Sind trên đàn bò nền
địa phương và xây dựng mô hình chăn nuôi bò thịt chất
lượng cao tại huyện Ba Tri. BCNT đề tài KHCN tỉnh
Bến Tre.
34. Hoàng Văn Trường và Nguyễn Tiến Vởn (2008). Kết
quả nghiên cứu khả năng thích nghi với điều kiện chăn
nuôi nông hộ ở Bình Định của bò thịt Brahman (nhập từ
CuBa). Tạp chí NN&PTNT, 2(2.08): 33-37.
35. Phạm Vũ Tuân (2014). Đánh giá khả năng sinh sản và
thử nghiệm một số biện pháp kỹ thuật nhằm nâng
cao khả năng sinh sản của đàn bò cái Brahman nuôi
tại Trạm Nghiên cứu và Sản xuất Tinh đông lạnh
Moncada. Luận văn Thạc sĩ nông nghiệp. Trường Đại
học Nông nghiệp Hà Nội.
36. Usmanova E.N., Kuzyakina L.I., Pashtestky V.S.,
Ostapchuk P.S. and Kuevda T.A. (2021). Reproductive
function of cows and heifers of the Aberdeen-Angus
breed according to the calving season. IOP Conf. Series:
Earth & Env. Sci., 723: 022006.
37. William O.H. (2022). Calving Difficulty in Beef Cattle:
BIF Fact Sheet. Published by university extension,
university of missouri - Columbia.
KHKT Chăn nuôi số 286 - tháng 3 năm 2023
CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC

TÓM TẮT
Nghiên cứu này được thực hiện nhằm đánh giá ngưỡng chịu mặn và ảnh hưởng của nước biển
pha loãng lên năng suất của dê Bách Thảo. Nghiên cứu gồm hai thí nghiệm, thí nghiệm 1 nhằm xác
định ngưỡng chịu mặn trên 07 dê Bách Thảo và chia làm hai giai đoạn. Giai đoạn 1 tất cả dê được
uống nước ngọt trong 7 ngày và được cung cấp ở hai máng uống giống nhau. Trong giai đoạn 2
máng uống được cung cấp nước ngọt cho máng thứ nhất và nước biển pha loãng cho máng thứ
hai hoặc ngược lại. Mỗi nồng độ thí nghiệm sẽ được đánh giá trong 48 giờ (hai ngày liên tục). Thí
nghiệm 02 được bố trí hoàn toàn ngẫu nhiên với 04 nghiệm thức (NT) và 05 lần lặp lại. Các NT thí
nghiệm là NT đối chứng (NT0.0, nước ngọt), nghiệm thức có nồng độ nước biển pha loãng 0,5%
(NT0.5), nghiệm thức có nồng độ nước biển pha loãng 1,0% (NT1.0), nghiệm thức có nồng độ nước
biển pha loãng 1,5% (NT1.5). Kết quả thí nghiệm 1 cho thấy dê có thể chấp nhận nước biển pha
loãng có nồng độ dưới 1,0%, bắt đầu giảm lượng nước uống ở 1,5% và uống dưới 20% ở nồng độ
2,0%. Kết quả thí nghiệm 2 cho thấy lượng nước uống tăng khi nồng độ nước biển pha loãng tăng
đến 1,0% (P<0,05). Tuy nhiên nồng độ nước biển pha loãng tăng đã làm giảm tăng khối lượng và
tăng hệ số chuyển hóa thức ăn, trong khi đó thức ăn tiêu thụ không có sự khác biệt giữa các nghiệm
thức. Kết quả thí nghiệm cho thấy ngưỡng chịu mặn của dê là dưới 2,0% và dê uống với nồng độ
nước biển pha loãng 1,5% trong 56 ngày thí nghiệm đã làm giảm năng suất của dê.
Từ khóa: Dê Bách Thảo, nước biển, ngưỡng chịu mặn, tăng khối lượng.
ABSTRACT
Evaluation of salt tolerance and effects of diluted seawater in drinking water on
production of Bach Thao goats
This research aimed to evaluate salt tolerance and effects of diluted seawater in drinking wa-
ter on production of Bach Thao goats. The research consisted of two experiments, first experiment
aimed to determine salt tolerance on seven Bach Thao goats and divided into two periods. First
period all goats drank fresh water and provied in two containers and in second period, firts contai-
ner was provided with fresh water and second container was provided with diluted seawater or
vice versa. Each experimental concentration was evalutaed for 48 hours (two concecutive days).
Second experiment was arranged in a completely randomized design with four treatments and five
replicates. The treatments were control (NT0.0, fresh water), 0.5% diluted seawater (NT0.5), 1.0%
diluted seawater (NT1.0), 1.5% diluted seawater (NT1.5). The results from first experiment showed
that goats can accept diluted seawate with a concentration of less than 1.0%, start to decrease water
intake (WI) at 1.5% and drink less than 20% at 2.0% level. The results from second experiment
found that WI increased as the level of diluted seawater increased to 1.0% (P<0.05). However, in-
creasing concentration of diluted seawater decreased in weight gain and increased in feed conver-
sion ratio, while dry matter intake remained unchange among treatments. The results from current
research indicated that the salt tolerance threshold of Bach Thao goats was below 2.0% and goats
drank 1.5% diluted seaater for 56 days which deacreased the productivity.
Keywords: Bach Thao goats, salt tolerance threshold, seawater, weight gain.

1. ĐẶT VẤN ĐỀ hệ thống canh tác và nhất là làm thay đổi cơ

Nghề chăn nuôi dê đã có từ lâu đời, nhưng
chủ yếu là theo phương thức quảng canh, tự
phát và ít được người nông dân biết đến (Đinh
Văn Bình, 2006). Tuy nhiên, với tình trạng
biến đổi khí hậu hiện nay đã tác động mạnh
làm cho thiên tai trên thế giới cũng như ở Việt
Nam ngày càng gia tăng về số lượng, cường độ
và phạm vi ảnh hưởng. Đặc biệt, tác động xâm
nhập mặn đã ảnh hưởng đến cơ cấu mùa vụ,
cấu vật nuôi, từ đó gây ra nhiều bệnh tật làm
giảm năng suất chăn nuôi cũng như làm trì trệ
nền nông nghiệp (Mavi và ctv, 2012). Việc tiêu
thụ nước biển trong tự nhiên cũng được quan
sát thấy đối với các loài nhai lại khác nhau mà
dê là loài có khả năng sử dụng nước uống có
độ mặn khác nhau, cũng như sự đáp ứng với
khả năng chịu mặn khác nhau giữa dê thịt với
dê sữa và giữa dê thịt với trâu, bò thịt (Fedele

KHKT Chăn nuôi số 286 - tháng 3 năm 2023 75

 CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC
và ctv, 2002). Tuy nhiên, việc hấp thụ nước
muối thông qua nước uống cũng như các cây
trồng chịu mặn và có thể ảnh hưởng xấu đến
năng suất, chủ yếu là lượng thức ăn (TA),
lượng nước uống vào giảm do hoạt động của
vi sinh vật dạ cỏ bị ảnh hưởng (Assad và El-
Sherif, 2002). Ngược lại, nước mặn sẽ không
nhất thiết ảnh hưởng đến chế độ ăn hoặc uống
nước ngọt có bổ sung NaCl chủ yếu là do sự
khác biệt về mức độ của các khoáng chất khác
(Rossi và ctv, 1998). Với nghiên cứu của Abou
và ctv (1994), có thể nhận thấy rằng dê có thể
chấp nhận nước uống có nồng độ muối 1,50%,
nhưng với điều kiện khi dê uống nước muối
thì chúng cần phải thích nghi với nước muối
trong một thời gian dài (McGregor, 2004).
Tuy nhiên, theo Runa và ctv (2019) dê Boer có
ngưỡng chịu mặn là 1,25%. Có thể thấy rằng
các nghiên cứu về ảnh hưởng của nước uống
nhiễm mặn lên ngưỡng chịu mặn của dê là
khác nhau do giống, giai đoạn sinh lý và điều
kiện môi trường. Hiên nay tai Việt Nam chưa
có nghiên cứu nào đánh giá về ngưỡng chịu
nước uống nhiệm mặn và ảnh hưởng lên năng
suất của dê Bách Thảo. Vì vậy, nghiên cứu này
được thực hiện là cần thiết, đặc biệt là tại khu
vực đồng bằng sông Cửu Long khi các tỉnh
ven biển thường xuyên bị xâm ngập mặn vào
mùa khô và ở đây cũng có số lượng đàn dê
lớn, rất phát triển trong thời gian gần đây.
2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU
2.1. Thời gian và địa điểm
Đề tài được thực hiện từ tháng 01 đến tháng
8/2022, tại trại Thực nghiệm Chăn nuôi, khoa
Phát triển Nông thôn, trường Đại học Cần Thơ.
2.2. Thí nghiệm
2.2.1. Đánh giá ngưỡng chịu mặn của dê Bách
Thảo khi uống nước biển pha loãng
Nghiên cứu này được thực hiện trên 07
dê Bách Thảo (BT) và được chia thành hai giai
đoạn: Giai đoạn 1 (giai đoạn đối chứng-ĐC)
tất cả dê được uống nước ngọt trong 7 ngày
và mỗi dê sẽ được nhốt ở chuồng cá thể, nước
uống được cung cấp ở hai máng uống giống
nhau, ghi nhận lượng nước uống hàng ngày
76
trên hai máng uống của tất cả dê; giai đoạn 2
(giai đoạn thí nghiệm- TN), máng uống của
mỗi dê sẽ được cung cấp nước ngọt cho máng
thứ nhất và nước biển pha loãng cho máng
thứ hai hoặc ngược lại. Vị trí máng sẽ được
thay đổi lúc 06:00; 13:00 và 18:00 giờ mỗi ngày
để tránh sai sót do thói quen của dê nhận biết
vị trí của máng nước chứa nước ngọt hay
nước mặn. Mỗi nồng độ TN sẽ được đánh giá
trong 48 giờ (hai ngày liên tục). Quy trình này
cho phép xác định được ngưỡng mà dê chấp
nhận hay từ chối một phần hay hoàn toàn
nước uống mặn. Theo các nghiên cứu trước
đây nồng độ cao nhất gần với ngưỡng dê từ
chối nước uống mặn là 2% (Runa và ctv, 2019;
McGregor, 2004). Vì vậy, TN này cung cấp
nước uống cho dê với các nồng độ tăng dần
(0,5; 1,0; 1,5; 2,0%) cho đến khi dê đạt ngưỡng
theo báo cáo của Goatcher và Church (1970)
thì kết thúc TN và xác định được ngưỡng dê
từ chối uống nước mặn. Ngưỡng mà dê từ
chối uống nước mặn khi dê chỉ uống dưới 20%
của tổng lượng nước uống của cả hai máng
uống được cung cấp cho mỗi dê.
Tỷ lệ dê uống nước mặn (%) = lượng nước
mặn dê uống/tổng lượng nước dê uống ở 2
máng) x 100.
Tất cả dê sẽ được cho ăn khẩu phần TMR
gồm 70% bắp ủ chua và 30% TAHH (cám gạo:
8,0%; bột bắp: 11,3%; khô dầu đậu nành: 7,8%;
bột đá mịn: 0,9%; rỉ mật đường: 2,0%). Thành
phần hóa học của TMR là DM là 29,5%; CP là
16,2%; ADF là 28,5% và NDF là 39,5%.
Hình 1. Mô hình chuồng dê thí nghiệm
Giai đoạn 1: máng 1 và 2 nước ngọt; giai
đoạn 2: máng 1 nước ngọt, máng 2 nước mặn
KHKT Chăn nuôi số 286 - tháng 3 năm 2023
CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC

hay ngược lại, và tùy vào nồng độ TN từ thấp nước ngọt và nước biển pha loãng với nồng
tới cao và sẽ được thay đổi vị trí lúc 06:00; độ 0-1,0%. Tuy nhiên, dê bắt đầu tránh uống
13:00 và 18:00 giờ mỗi ngày. nước biển pha loãng với nồng độ 1,5% và gần
2.2.2. Ảnh hưởng của nước biển pha loãng lên như không uống (dưới 20% tổng lượng nước
tiêu thụ thức ăn, nước uống và tăng khối lượng uống ở hai máng uống) nước biển pha loãng
với nồng độ 2,0% (P<0,001). Do đó, có thể
Thí nghiệm được bố trí hoàn toàn ngẫu
khẳng định rằng dê BT ở TN này có ngưỡng
nhiên với bốn NT và 05 lần lập lại, tổng cộng
chịu uống nước mặn là 1,5-2,0%. Kết quả này
là 20 đơn vị TN là 20 dê đực BT (KL 16,6±0,2kg
cao hơn so với kết quả nghiên cứu của Runa
và 07 tháng tuổi). Các NT với các nồng độ muối
và ctv (2019) khi dê Boer có ngưỡng chịu mặn
khác nhau gồm: ĐC (NT0.0, nước ngọt), NT có
là 1,25% và tương đương so với báo cáo của
nồng độ nước biển pha loãng: 0,5% (NT0.5),
McGregor (2004). Theo Chandrashekar và ctv
1,0% (NT1.0), 1,5% (NT1.5). Thí nghiệm gồm
(2010), vị mặn gây ra hai phản ứng ở động vật:
10 ngày nuôi thích nghi và 56 ngày thu thập
(1) kích thích động vật sử dụng với nồng độ
số liệu. Thí nghiệm sử dụng nước biển cô đặc
thấp và (2) động vật từ chối uống với nồng độ
pha với nước ngọt để đạt được các nồng độ
cao mặc dù con vật bị thiếu muối. Tóm lại, khả
nước biển pha loãng ở các NT có nồng độ
năng chịu được nước uống nhiễm mặn ở các
nước biển pha loãng là 0,5; 1,0 và 1,5%. Tất
loài khác nhau, trong đó lạc đà có khả năng
cả động vật TN được ăn khẩu phần trộn hoàn
chịu được lượng nước uống nhiễm mặn cao
chỉnh (TMR) giống như TN1, bao gồm 70%
nhất, kế đến là dê và cừu và sau đó là hươu
cỏ tự nhiên và 30% TAHH với CP của TMR
(Runa và ctv, 2019).
là 16,2%. Dê được cho ăn 2 lần/ngày vào lúc
07AM và 16PM, được uống nước tự do.
Phương pháp thu thập số liệu
Tất cả số liệu TA, nước uống và TA thừa
sẽ được ghi nhận hàng ngày, mẫu TA thừa sẽ
được lấy 1 lần/tuần trong suốt quá trình TN.
Vào cuối TN, các mẫu TA và TA thừa sẽ được
trộn lại và đem đi phân tích các chỉ tiêu DM
và CP theo phương pháp của AOAC (1990) và
NDF, ADF theo phương pháp của Van Soet và
ctv (1991). Dê được cân ở thời điểm bắt đầu và
kết thúc TN, vào buổi sáng trước khi cho ăn. Hình 2. Tỷ lệ nước uống từ 2 máng
2.3. Xử lý số liệu 3.2. Ảnh hưởng của nước biển pha loãng lên
Đối với TN1 so sánh giữa 2NT bằng unpair tiêu thụ thức ăn, nước uống và khối lượng
T-test và với TN2 sử dụng phần mềm Minitab của dê
16.0 để phân tích số liệu bằng mô hình tuyến Ở động vật có thể giảm sự ảnh hưởng
tính tổng quát GLM (General Linear Mode) và của lượng muối cao trong TA bằng cách uống
so sánh giá trị trung bình giữa NT theo phép nhiều nước hơn. Tuy nhiên, khi con vật uống
thử Tukey. Sự khác biệt có ý nghĩa khi P<0,05. nước bị nhiễm mặn với nồng độ cao thì cơ chế
3. KẾT QUẢ VÀ THẢO LUẬN này không hiệu quả và con vật bị thừa muối
và có thể dẫn đến bị ngộ độc muối. Khi con
3.1. Ngưỡng chịu mặn của dê thịt khi uống vật sử dụng lượng muối lớn dẫn đến nồng
nước biển pha loãng độ muối ngoài tế bào cao hơn bên trong tế
Kết quả trình bày tại hình 2 cho thấy dê bào. Điều này dẫn đến sự thay đổi về áp suất
thịt có mức độ uống ưu tiên giống nhau giữa thẩm thấu và là nguyên nhân của sự co tế

KHKT Chăn nuôi số 286 - tháng 3 năm 2023 77

 CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC

bào. Để đạt được trạng thái cân bằng, cơ thể nồng độ nước biển pha loãng trong nước
sẽ cố gắng loại bỏ lượng muối từ dịch ngoại uống. Có thể thấy rằng sử dụng lượng nước
bào qua đường tiểu, dẫn đến cơ thể mất nhiều uống có nồng độ muối 1,3-1,5% có ảnh hưởng
nước, khát, môi và mắt khô. Cơ thể cố gắng bù rất ít lên năng suất ở dê thịt lai Boer trên 12
đắp sự thất thoát nước qua đường tiểu bằng tháng tuổi (Hồ Lý Quang Nhựt và ctv, 2022).
cách tăng nhịp tim, co mạch máu và điều này Tuy nhiên một số nghiên cứu khác cho rằng
dẫn đến giảm lượng máu đến não và các cơ ở dê thịt lai Boer dưới 6 tháng tuổi sử dụng
quan của cơ thể và là nguyên nhân của hôn nước muối với nồng độ 1,5% đã làm giảm
mê và chết ở con vật khi sử dụng nhiều muối TKL của dê trong 3 tuần TN (Nguyen Thiet và
(Giuggio, 2018). ctv, 2022). Một số yếu tố ảnh hưởng đến khả
năng chịu đựng lượng muối trong nước uống
Kết quả của TN cho thấy dê tăng lượng hay khẩu phần như tuổi (Runa và ctv, 2019;
nước uống ở nồng độ muối 0-1,0% và đã giảm Nguyen Thiet và Thammacharoen, 2022), sự
uống nước muối ở nồng độ 1,5% (Bảng 1, thích nghi (Runa và ctv, 2019; Nguyễn Thiết
P<0,05). Thêm vào đó, sử dụng lượng nước và ctv, 2021). Như vậy, TN này cho thấy đối
muối có hàm lượng 1,5% đã làm giảm TKL với dê khoảng 7 tháng tuổi không nên sử
và có khuynh hướng tăng FCR, trong khi đó dụng nước uống nhiễm mặn có nồng độ 1,5%,
lượng tiêu thụ TA không thay đổi ở 8 tuần TN ngược lại đối với dê thịt trên 12 tháng tuổi có
(Bảng 1, P>0,05). Kết quả nghiên cứu cũng cho thể sử dụng nước uống nhiễm mặn có nồng
thấy rằng TKL có tương quan nghịch (Hình 3, độ 1,5% trong 7 tuần mà không ảnh hưởng
R2=0,929) và hệ số chuyển hóa thức ăn (FCR) đến năng suất của dê (Hồ Lý Quang Nhựt và
có tương quan thuận (Hình 4, R2=0,998) với ctv, 2022).
Bảng 1. Ảnh hưởng của nước biển pha loãng lên nước uống, TA, TKL và FCR của dê Bách Thảo
Hạng mục NT0.0 NT0.5 NT1.0 NT1.5 SE P
Nước uống (g/kg BW/ngày) 44,06b 51,03ab 67,44a 53,08ab 4,81 0,02
Tổng TĂ (kg/con) 24,01 23,56 24,18 23,58 0,36 0,54
Tổng KL tăng (kg/con) 3,48a
3,23ab
3,20 ab
3,00b
0,08 0,01
FCR (kg TA/kg TKL) 6,92 7,32 7,59 7,87 0,24 0,06
Ghi chú: Các giá trị trung bình trong cùng một hàng có chữ cái khác nhau thì khác biệt có ý nghĩa thống kê (P<0,05)

Hình 3. Ảnh hưởng nước biển pha loãng lên
TKL
4. KẾT LUẬN
Nghiên cứu đã xác định được ngưỡng
chịu mặn của dê Bách Thảo là dưới 2,0%. Dê
Hình 4. Ảnh hưởng nước biển pha loãng lên
FCR
sử dụng nước biển pha loãng với nồng độ
1,5% đã giảm năng suất, tuy nhiên với nồng
độ 1,0% thì không ảnh hưởng đến TKL và FCR
của dê Bách Thảo.

78 KHKT Chăn nuôi số 286 - tháng 3 năm 2023

CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC
LỜI CẢM ƠN
Nghiên cứu này được tài trợ từ nguồn kinh
phí của Quỹ Nghiên cứu Khoa học Quốc gia
(Nafosted), Mã số 106.05-2020.45.
TÀI LIỆU THAM KHẢO
1. Abou H.E.R.M., Gihad E.A., El-Dedawy T.M. and
Abdel G.M.H. (1994). Response of camels, sheep and
goats to saline water. 2. Water and mineral metabolism.
Egy. J. Ani. Pro., 31: 387-01.
2. Assad F. and El-Sherif M.M.A. (2002). Effect of
drinking saline water and feed shortage on adaptive
responses of sheep and camels. Small Rumin. Res. Sci.,
45(3): 279-90.
3. AOAC (1990). Official methods of analysis of the
Association of Official Agricultural Chemists. Was.,
D.C., USA.
4. Đinh Văn Bình (2006). Đánh giá đàn dê đực gồm 3
giống Boer, Alpine và Saanen nhập về từ Mỹ qua 4 năm
nuôi tại Việt Nam thông qua khả năng sản xuất đời con.
BCKH Viện Chăn nuôi, Hà Nội.
5. Chandrashekar J., Kuhn C., Oka Y., Yarmolinsky D.A.,
Hummler E., Ryba N.J.P. and Zuker C.S. (2010). The
cells and peripheral representation of sodium taste in
mice. Nature, 464: 297-01.
6. Fedele V., Claps S., Rubino R., Calandrelli M. and
Pilla A.M. (2002). Effect of free-choice and traditional
feeding systems on goat feeding behaviour and intake.
Liv. Pro. Sci., 74(1): 19-31.
7. Giuggio V.M. (2018). Potential effects of drinking
saltwater – what if you drink saltwater. Retrieved on 01
March 2018 from, https://science.howstuffworks.com/
science-vsmyth/what-if/what-if-you-drink-saltwater1.
htm
8. Goatcher W.D. and Church D.C. (1970). Taste responses
in ruminants. I. Reactions of sheep to sugars, saccharin,
ethanol and salts. J. Ani. Sci., 30(5): 777-83.
KHẢ NĂNG SINH TRƯỞNG, NĂNG SUẤT VÀ THÀNH PHẦN
HÓA HỌC CỦA CÂY MẬT GẤU (VERNONIA AMYGDALINA DEL)
Ở CHIỀU CAO CẮT KHÁC NHAU
Ngày nhận bài báo: 02/02/2023 - Ngày nhận bài phản biện: 20/02/2023
Ngày bài báo được chấp nhận đăng: 02/03/2023
TÓM TẮT
Đề tài “Khảo sát sinh trưởng, năng suất và thành phần hóa học của cây Mật Gấu (Vernonia
Amygdlalina) với chiều cao cắt khác nhau” được thực hiện tại tỉnh Tiền Giang từ tháng 3/2022 đến
1
Trường Đại học Tiền Giang
*
Tác giả liên hệ: ThS. Nguyễn Vĩ Nhân, Giảng viên, Khoa Nông Nghiệp - Trường Đại học Tiền Giang. Điện thoại: 0901210677;
Email: nguyenvinhan@tgu.edu.vn
KHKT Chăn nuôi số 286 - tháng 3 năm 2023
9. Mavi M.S., Marschner P., Chittleborough D.J., Cox
J.W. and Sanderman J. (2012). Salinity and sodicity
affect soil respiration and dissolved organic matter
dynamics differentially in soils varying in texture. Soil
Biol. Bioch., 45: 8-13.
10. McGregor B.A. (2004). Water quality and provision
for goats. Australian Government. Rural Industries
Research and Development Corporation.
11. Hồ Lý Quang Nhựt, Nguyễn Trọng Ngữ và Nguyễn
Thiết (2022). Ảnh hưởng của mức độ mặn trong nước
uống lên lượng thức ăn, nước uống, tăng khối lượng và
chỉ tiêu sinh lý của dê thịt. Tạp chí KHKT Chăn nuôi,
274(2): 69-75.
12. Rossi R., Del Prete E., Rokitzky J. and Scharrer
E. (1998). Effects of a high NaCl diet on eating and
drinking patterns in pygmy goats. J. Phy. Beh. Sci.,
63(4): 601-04.
13. Runa R.A., Brinkmann L., Gerken M. and Riek A.
(2019). Adaptation capacity of Boer goats to saline
drinking water. An Int. J. Ani. Biosci., 13: 2268-76.
14. Nguyen Thiet and Thammacharoen S. (2022). Water
and feed intakes, weight gain and plasma stress
hormones of growing Boer crossbred and Bach Thao
goats consuming with diluted seawater. Liv. Res. Rur.
Dev., 34(95): 01-05.
15. Nguyen Thiet, Nguyen Van Hon, Nguyen Trong Ngu
and Thammacharoen S. (2022). Effects of high salinity
in drinking water on behaviours, growth and renal
electrolyte excretion in crossbred Boer goats under
tropical conditions. Vet. World, 15(4): 834-40.
16. Nguyễn Thiết, Nguyễn Văn Hớn, Nguyễn Trọng Ngữ
và Sumpun T. (2021). Khả năng thích nghi của dê thịt
lai khi uống nước nhiễm mặn lên khối lượng, tăng khối
lượng và một số chỉ tiêu sinh hoá máu. Tạp chí KHKT
Chăn nuôi, 263(3): 63-70.
17. Van Soest P.V., Robertson J.B. and Lewis B. (1991).
Methods for dietary fiber, neutral detergent fiber,
and nonstarch polysaccharides in relation to animal
nutrition. J. Dai. Sci., 74(10): 3583-97.
Nguyễn Vĩ Nhân12*
79
KHKT Chăn nuôi Số 286 - tháng 3 năm 2023

Phó Tổng biên tập Phụ trách: DI TRUYỀN - GIỐNG VẬT NUÔI
PGS.TS. NGUYỄN VĂN ĐỨC Lưu Khải Nhiên và Nguyễn Ngọc Tấn. Ảnh hưởng của việc bổ sung huyết thanh
thai bò trong môi trường nuôi cấy đến sự phân lập và tăng sinh tế bào nguyên sợi từ
Phó Tổng biên tập: mẫu mô buồng trứng heo
PGS.TS. NGUYỄN ĐĂNG VANG Tạ Thị Hương Giang, Phùng Đức Tiến và Nguyễn Quý Khiêm, Trần Ngọc Tiến,
TS. NGUYỄN XUÂN DƯƠNG Phạm Thị Kim Thanh và Nguyễn Thị Tâm. Kết quả chọn tạo ngan dòng mái NTP2
theo hướng năng suất trứng
Thư ký tòa soạn: Trần Trung Tú, Lê Thanh Phương và Nguyễn Trọng Ngữ. Năng suất sinh sản của
gà Ác (Gallus gallus domesticus Brisson) giai đoạn 16-40 tuần tuổi
PGS.TS. NGUYỄN VĂN ĐỨC
Mai Thị Xoan và Hồ Nguyễn Thị Huyền Trân. Khả năng sinh trưởng, năng suất và
chất lượng thịt vịt Grimaud nuôi sàn tại Tp. Buôn Ma Thuột, tỉnh Đắk Lắk
Ủy viên Ban biên tập: Hồ Quốc Đạt và Phạm Đăng Khoa. Năng suất sinh trưởng của tổ hợp lai giữa nái
TS. NGUYỄN QUỐC ĐẠT F1(LY) và F1(YL) phối với đực D, L, Y giai đoạn 70-170 ngày tuổi tại Trung tâm Giống
PGS.TS. HOÀNG KIM GIAO tỉnh Bạc Liêu
GS.TS. NGUYỄN DUY HOAN Đặng Hồng Quyên, Nguyễn Thị Hạnh và Trần Đình Vy. Năng suất sinh sản của
GS.TS. DƯƠNG NGUYÊN KHANG lợn nái Lai F1(Landrace x Yorkshire) phối với đực Duroc tại Công ty TNHH Lợn giống
PGS.TS. NGUYỄN THỊ KIM KHANG hạt nhân Dabaco
PGS.TS. ĐỖ VÕ ANH KHOA
PGS.TS. ĐỖ ĐỨC LỰC
DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI
Đỗ Thị Phương Thảo, Hoàng Thị Phương Thúy, Trần Anh Tuyên, Nguyễn Thị
GS.TS. LÊ ĐÌNH PHÙNG Quyên, Nguyễn Xuân Việt và Nguyễn Tài Năng. Sản xuất chế phẩm thảo dược
dạng bột và hiệu quả dùng bổ sung trong thức ăn chăn nuôi gà thịt
Xuất bản và Phát hành: Phạm Văn Quyến, Nguyễn Thị Thủy, Hoàng Thị Ngân, Nguyễn Văn Tiến, Giang Vi
ThS. NGUYỄN ĐÌNH MẠNH Sal, Bùi Ngọc Hùng, Nguyễn Thanh Tùng, Hoàng Anh Dương, Nguyễn Ngọc Anh
Thư, Hồ Ngọc Trâm, Phương Khánh Hồng và Nguyễn Đức Điện. Khẩu phần nuôi
dưỡng bò lai F1 hướng thịt phù hợp với điều kiện chăn nuôi tại tỉnh Tây Ninh

U Nguyễn Thị Mai, Sunva Xaythanasy, Mai Văn Tùng, Lê Hoàng Vũ và Phạm Thị
Hải. Ảnh hưởng của thức ăn bổ sung dầu vừng đến tăng trưởng, sử dụng thức ăn, tỷ
lệ sống và khả năng kháng bệnh ở cá rô phi vằn Oreochromis Niloticus

CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC

Giấy phép: Bộ Thông tin và Truyền thông Nguyễn Thị Thu Hiền. Tổng quan nghiên cứu Hormone stress không xâm lấn trên
Số 257/GP- BTTTT ngày 20/05/2016 động vật hoang dã
ISSN 1859 - 476X Phạm Văn Quyến, Nguyễn Thị Thủy, Hoàng Thị Ngân, Nguyễn Văn Tiến, Giang Vi
Sal, Bùi Ngọc Hùng, Nguyễn Thanh Tùng, Hoàng Anh Dương, Nguyễn Ngọc Anh
Xuất bản: Hàng tháng Thư, Hồ Ngọc Trâm, Phương Khánh Hồng và Nguyễn Đức Điện. Năng suất sinh
Toà soạn: sản của bò cái lai hướng thịt tại tỉnh Tây Ninh
Địa chỉ: Tầng 4, Tòa nhà 73, Trương Văn Khang, Nguyễn Trung Trực, Nguyễn Trọng Ngữ và Nguyễn Thiết.
Ngưỡng chịu mặn và ảnh hưởng của nước biển pha loãng lên năng suất của dê

Hoàng Cầu, Ô Chợ Dừa,
Bách Thảo
Đống Đa, Hà Nội.
Nguy n Vĩ Nhân. Khả năng sinh trưởng, năng suất và thành phần hóa học của cây
Điện thoại: 024.36290621 mật gấu (Vernonia Amygdalina Del) ở chiều cao cắt khác nhau
ễ
Fax: 024.38691511 Nguyễn Đức Nghĩa, Cù Thị Thúy Nga, Nguyễn Mạnh Tuấn và Nguyễn Thị Minh
E - mail: tapchichannuoi@hoichannuoi.vn Thuận. Ảnh hưởng của chế phẩm vi sinh đến vi khuẩn gây bệnh và hàm lượng dinh
dưỡng của phân dê
Website: www.hoichannuoi.vn Vũ Thị Ánh Huyền, Đỗ Thị Vân Giang, Nguyễn Thị Bích Ngà và Đặng Văn Nghiệp.
Tài khoản: Tình hình bệnh dịch tả lợn châu Phi trên địa bàn tỉnh Bắc Ninh giai đoạn 2019-2021
Tên tài khoản: Hội Chăn nuôi Việt Nam
Số tài khoản: 1300 311 0000 40, tại Ngân hàng THÔNG TIN KHOA HỌC VÀ CÔNG NGHỆ
PGS.TS. Nguyễn Văn Đức. Ứng dụng công nghệ cao trong chăn nuôi và một số điểm
Nông nghiệp và Phát triển Nông thôn, Chi nhánh sáng
Thăng Long - Số 4, Phạm Ngọc Thạch, Hà Nội. Ban Biên tập. Quy chuẩn kỹ thuật quốc gia về nước thải chăn nuôi sử dụng cho cây
In 1.000 bản, khổ 19x27 tại Công ty CP KH&CN trồng
Ban Biên tập. Đồng Nai di dời 3.006 cơ sở chăn nuôi ra khỏi khu vực không được
Hoàng Quốc Việt. In xong và nộp lưu chiểu: phép chăn nuôi
tháng 3/2023. Ban Biên tập. Chùm tin: Dịch bệnh vẫn là nguy cơ lớn trong chăn nuôi
Ban Biên tập. Chín giải pháp đột phá về phát triển nông nghiệp năm 2023
DI TRUYỀN - GIỐNG VẬT NUÔI

NĂNG SUẤT SINH SẢN CỦA GÀ ÁC (GALLUS GALLUS

DOMESTICUS BRISSON) GIAI ĐOẠN 16-40 TUẦN TUỔI
Trần Trung Tú1,2∗, Lê Thanh Phương1 và Nguyễn Trọng Ngữ2
Ngày nhận bài báo: 16/12/2022 - Ngày nhận bài phản biện: 30/12/2022
Ngày bài báo được chấp nhận đăng: 30/01/2023
TÓM TẮT
Đề tài được thực hiện tại trại gà huyện Phong Điền thành phố Cần Thơ từ tháng 5 đến tháng 12
năm 2022 nhằm đánh giá một số chỉ tiêu sinh sản của gà Ác. Có tất cả 400 cá thể gà mái được nuôi
trên lồng theo phương thức cá thể giai đoạn 16-40 tuần tuổi. Kết quả nghiên cứu cho thấy gà Ác có
tuổi thành thục sinh dục ở 111 ngày tuổi, trung bình tuổi đẻ đầu tiên của quần thể là 119 ngày tuổi
và tỷ lệ đẻ đạt đỉnh cao ở 205 ngày tuổi. Giai đoạn từ 16-40 tuần tuổi, năng suất trứng trung bình là
69,3 quả/mái; tỷ lệ đẻ là 39,6%, tiêu tốn thức ăn/10 quả trứng là 3,0 kg. Trứng gà Ác có khối lượng
trung bình 34,9 g/quả; tỷ lệ lòng đỏ đạt 31,3%; đơn vị Haugh là 81,2. Kết quả ấp nở cho thấy tỷ lệ
trứng có phôi/trứng ấp trung bình là 86,4%; tỷ lệ nở/trứng ấp đạt 75,2%; tỷ lệ nở/trứng có phôi là
87,0% và tỷ lệ gà loại I/gà nở đạt 98,9%.
Từ khóa: Gà Ác, năng suất sinh sản, gà bản địa.
ABSTRACT
The evaluation of some reproductive parameters of Ac chickens at the age of 16-40 weeks
The study was carried out at the chicken farm in Phong Dien district, Can Tho city from
May to December, 2022 to evaluate some reproductive parameters to evaluate some reproductive
parameters of Ac chickens. A total of 400 hens were raised in cages according to the individual
method at the age of 16-40 weeks. The results showed that the at Ac chickens had sexual maturity at
111 days of age, the average age of first laying of the population was 119 days of age and the laying
rate peaked at 205 days old. In the period from 16-40 weeks of age, the average egg yield was 69.3
eggs/hen; laying rate was 39.6%, feed consumption/10 eggs was 3.0kg. The eggs had an average
weight of 34.9 g/egg; yolk ratio reached 31.3%; Haugh unit was 81.2. Incubation results indicated
the average rate of fertile eggs/incubated eggs was 86.4%; hatched/incubated eggs reached 75.2%;
hatched/fertile eggs was 87.0% and the rate of type I chicks/hatched chicks was 98.9%.
Keywords: Ac chicken hen, reproductive productivity, native chicken.

1. ĐẶT VẤN ĐỀ
Theo thống kê của Cục Chăn nuôi, sản
lượng trứng gia cầm của Việt Nam tăng từ
hơn 8,8 tỉ quả (năm 2015) lên hơn 16 tỷ quả
(năm 2020).
Để đáp ứng nhu cầu sử dụng trứng gia
cầm của người tiêu dùng, Việt Nam đã nhập
nội, nghiên cứu nuôi thích nghi và đưa vào
sản xuất nhiều giống gà công nghiệp hướng
trứng có năng suất cao như gà Leghorn, ISA
Brown, Hyline,... Các dòng gà hướng trứng có
đặc điểm sinh trưởng chậm nhưng thời gian
1
Công ty TNHH MTV Giống Gia cầm Vietswan, Việt Nam
2
Trường Đại Học Cần Thơ
∗
Tác giả liên hệ: ThS. Trần Trung Tú, Công ty TNHH MTV
Giống Gia cầm Vietswan. Điện thoại: 037.461.6078; Email:
tttu23@gmail.com
thành thục về tính dục sớm (18-20 tuần tuổi),
không còn bản năng ấp bóng, sản lượng trứng
cao. Tuy nhiên, ở nước ta người tiêu dùng vẫn
thích ăn trứng gà bản địa và sẵn sàng trả giá
cao hơn. Trong các giống gà bản địa, gà Ác
là giống có thân hình nhỏ, bộ lông màu trắng
xước, chân có năm ngón; da, thịt, xương và mỏ
đều có màu đen; trứng có chất lượng tốt. Gà
ác được nuôi phổ biến ở các tỉnh thuộc Đồng
bằng Sông Cửu Long và Miền Đông Nam Bộ,
được dùng để bồi dưỡng sức khoẻ như một vị
thuốc. Tuy nhiên, các nghiên cứu về khả năng
sinh sản của gà Ác giai đoạn 16-40 tuần tuổi
hiện vẫn còn hạn chế. Do đó, đề tài khảo sát
một số chỉ tiêu sinh sản của gà Ác giai đoạn
16-40 tuần tuổi đã được tiến hành.

KHKT Chăn nuôi số 286 - tháng 3 năm 2023 13

 DI TRUYỀN - GIỐNG VẬT NUÔI

2. VẬT LIỆU VÀ PHƯƠNG PHÁP trứng có phôi (soi trứng ở 7 ngày ấp), tỷ lệ nở,
tỷ lệ gà con loại I.
2.1. Đối tượng, thời gian và địa điểm
2.3. Xử lý số liệu
Thí nghiệm (TN) được tiến hành trên 400 gà
Ác mái giai đoạn 16-40 tuần tuổi, từ tháng 5/2022 Số liệu thu thập được xử lý sơ bộ bằng
đến tháng 11/2022, tại trại gà giống ở huyện phần mềm Microsoft Excel 2016. Số liệu thống
Phong Điền, thành phố Cần Thơ. Đề tài sử dụng kê được xử lý bằng chương trình Minitab 16.
30 cá thể gà trống để ghép gia đình nhằm thu 3. KẾT QUẢ VÀ THẢO LUẬN
trứng ấp nhằm đánh giá kết quả ấp nở.
3.1. Tuổi thành thục sinh dục của gà Ác
Thức ăn được sử dụng là loại 8103
Emivest (8-17 tuần tuổi) và 8106 Emivest (18- Kết quả ở bảng 2 cho thấy gà Ác đẻ sớm
40 tuần tuổi). Lượng ăn cho gà trống là 66 g/ với tuổi thành thục sinh dục ở 111 ngày tuổi
con/ngày và gà mái là 55 g/con/ngày. Gà được (15,9 tuần tuổi), tuổi đẻ quả trứng đầu trung
uống nước tự do bằng núm uống tự động. bình của quần thể là 119 ngày tuổi (17 tuần
Chế độ chiếu sáng đảm bảo 16 giờ/ngày. Gà tuổi) và tuổi đẻ đạt đỉnh cao là 205 ngày tuổi
được ngừa, phòng bệnh và trị bệnh theo qui (29,3 tuần tuổi).
trình của Công ty TNHH MTV Giống Gia cầm Bảng 2. Tuổi thành thục sinh dục của gà Ác
Vietswan. Chỉ tiêu Ngày Tuần
Bảng 1. Thành phần thức ăn Emivest sử dụng tuổi tuổi
Tuổi đẻ của quần thể 119 17,0
Thành phần 8103 8106
Tuổi thành thục sinh dục 111 15,9
Độ ẩm (Max), % 13 13
Đạm thô (Min), % 15,5 16 Tuổi đẻ đạt đỉnh cao 205 29,3
Năng lượng (Min), kcal/kg 2.700 2.700 Tuổi thành thục sinh dục của gà Ác trong
Xơ thô (Max), % 5 5 nghiên cứu này sớm hơn so với một số giống
Canxi (Min-Max), % 0,7-1,5 2,5-4,5 gà bản địa khác như gà Móng là 150 ngày
Phospho (Min-Max), % 0,5-1,2 0,5-1,2
(Ngô Thị Kim Cúc và ctv, 2016) và gà Liên
Lysin (Min), % 0,75 0,73
Minh là 197,5 ngày (Bùi Hữu Đoàn và ctv,
Met & Cys (Min), % 0,62 0,63
Threonin (Min), % 0,48 0,53 2016). Nguyễn Hoàng Thịnh và ctv (2021b)
Cát sạn (Max), % 1 1 khi cho rằng tuổi đẻ của gà Ri ở 19 tuần tuổi
Ash (Max), % 9 20 (133 ngày tuổi), đàn gà đạt tỷ lệ đẻ 5% vào 21
Aflatoxin (Max), ppb 50 50 tuần tuổi (147 ngày tuổi) và đỉnh cao ở tuần
2.2. Phương pháp thứ 31 (217 ngày tuổi). Gà H’Mông có tuổi
thành thục sinh dục lúc 135-138 ngày tuổi, đẻ
Gà Ác mái giai đoạn 16-32 tuần tuổi trong
TN này được nuôi theo phương thức cá thể đỉnh cao lúc 213-215 ngày tuổi (Nguyễn Thị
trên lồng. Ở tuần tuổi 33, ghép 30 gia đình để Hải và ctv, 2022), tuổi đẻ quả trứng đầu là 140
thu trứng ấp nhằm khảo sát ấp nở (mỗi gia đình ngày và tuổi đẻ 5% là 150-154 ngày tuổi (Phạm
gồm 1 gà trống, 5 gà mái). Công Thiếu và ctv, 2010). Gà Lạc Thủy đẻ sớm
Các chỉ tiêu về năng suất sinh sản trong TN với tuổi đẻ đạt tỷ lệ 5% ở 137 ngày tuổi và
được tiến hành dựa theo phương pháp nghiên tuổi đẻ đạt đỉnh cao là 196 ngày tuổi (Nguyễn
cứu của Bùi Hữu Đoàn và ctv (2011): trung Hoàng Thịnh và ctv, 2021a). Gà Bang Trới nuôi
bình tuổi đẻ của quần thể, tuổi đẻ thành thục theo phương thức bán chăn thả bằng thức ăn
sinh dục và tuổi đẻ đạt đỉnh cao, năng suất công nghiệp đẻ quả trứng đầu tiên ở 22 tuần
trứng, khối lượng trứng, chỉ số hình dáng của tuổi, đẻ đạt 5% ở 22-23 tuần tuổi và tỷ lệ đẻ
trứng, tỷ lệ lòng trắng, tỷ lệ lòng đỏ, tỷ lệ vỏ, đạt đỉnh cao ở 32-33 tuần tuổi. Như vậy, gà Ác
tiêu tốn thức ăn/10 quả trứng (TTTA), tỷ lệ trong nghiên cứu này có tuổi thành thục sinh

14 KHKT Chăn nuôi số 286 - tháng 3 năm 2023

DI TRUYỀN - GIỐNG VẬT NUÔI

dục sớm hơn so với một số giống gà bản địa tuổi là 34,1% (Nguyễn Hoàng Thịnh và ctv,
nuôi tại Việt Nam. 2021a), gà H’Mông giai đoạn 39-40 tuần tuổi
3.2. Tỷ lệ đẻ, năng suất trứng và tiêu tốn thức là 36,92% (Nguyễn Thị Hải và ctv, 2022), gà
ăn của gà Ác Ri Lạc Sơn ở 40 tuần tuổi là 31,41% (Nguyễn
Hoàng Thịnh và ctv, 2021b).
Bảng 3 cho thấy ở những tuần đầu mới
đẻ thì tỷ lệ đẻ của gà Ác thấp (1,4%) nhưng Bên cạnh đó, TTTA của gà Ác ở tuần thứ
tăng dần ở các tuần tiếp theo và đạt đỉnh cao 16 cao nhất là 33,9kg do ở giai đoạn đầu đàn
(56,4%) lúc 30 tuần tuổi, sau đó giảm dần. gà mới bước vào đẻ. Thời điểm tiêu tốn thức
Trong giai đoạn 16-40 tuần tuổi, gà Ác có tỷ ăn ít nhất (1,0kg) ở tuần 27-32 vì trong giai
lệ đẻ trung bình là 39,6% và năng suất trứng đoạn này gà đang đẻ đỉnh cao. Trung bình tiêu
cộng dồn đạt 69,3 quả. tốn thức ăn/10 quả trứng của gà Ác từ 16-40
tuần tuổi là 3,0kg. Ở gà Lạc Thủy, TTTA trong
Bảng 3. Tỷ lệ đẻ, năng suất trứng, tiêu tốn thức ăn
giai đoạn 19-41 tuần tuổi là 4,49kg (Nguyễn
Năng suất trứng Hoàng Thịnh và ctv, 2021a), gà Ri Lạc Sơn giai
Tuần lệTỷ
đẻ TTTA/10
tuổi Quả/mái/ Cộng trứng (kg) đoạn 20-40 tuần tuổi là 4,0kg (Nguyễn Hoàng
(%) tuần dồn
Thịnh và ctv, 2021b), gà Lạc Thủy giai đoạn
16 1,40 0,1 0,1 33,9
20-40 tuần tuổi là 3,44kg (Trần Thanh Vân và
17 6,10 0,4 0,5 8,1
ctv, 2015). Một số nghiên cứu về TTTA ở các
18 13,4 0,9 1,5 3,7
giống gà ngoại nhập như gà Lương Phượng
19 18,0 1,3 2,7 2,8
20 25,2 1,8 4,5 2,1
trong 48 tuần đẻ là 2,77kg (Nguyễn Huy Đạt
21 28,7 2,0 6,5 1,8 và ctv, 2005), gà SASSO là 3,51kg, gà Kabir là
22 31,0 2,2 8,7 1,8 2,45-3,37kg (Trần Công Xuân, 2004), gà Isa là
23 34,1 2,4 11,1 1,6 2,68kg (Đoàn Xuân Trúc và ctv, 2003). Như
24 37,3 2,6 13,7 1,5 vậy, TTTA của gà Ri Lạc Sơn ít hơn so với một
25 41,9 2,9 16,6 1,3 số giống gà bản địa được công bố nhưng cao
26 47,1 3,3 19,9 1,2 hơn so với các giống gà lai khác.
27 52,1 3,6 23,5 1,0 3.3. Chất lượng trứng của gà Ác
28 54,5 3,8 27,4 1,0
Kết quả phân tích trứng gà Ác được trình
29 56,0 3,9 31,3 1,0
30 56,4 3,9 35,2 1,0
bày ở bảng 4 cho thấy khối lượng trung bình
31 54,5 3,8 39,0 1,0 34,9 g/quả, trong đó tỷ lệ lòng trắng, lòng đỏ và
32 52,0 3,6 42,7 1,0 vỏ lần lượt là 55,0; 31,3 và 14,2%. Kết quả này
33 49,8 3,5 46,2 1,1 cho thấy trứng gà Ác nhỏ hơn so với trứng gà
34 48,5 3,4 49,6 1,1 Lạc Thủy ở 32 tuần tuổi với khối lượng 49,17
35 48,6 3,4 53,0 1,1 g/quả, tỷ lệ lòng trắng, lòng đỏ và vỏ lần lượt
36 48,7 3,4 56,4 1,1 là 58,47; 30,62 và 10,9% (Nguyễn Hoàng Thịnh
37 46,7 3,3 59,6 1,2 và ctv, 2021a). Tương tự, trứng gà Ác cũng có
38 46,8 3,3 62,9 1,2 khối lượng nhỏ hơn so với gà trứng Bang Trới
39 46,1 3,2 66,1 1,2 (48,43 g/quả); tỷ lệ lòng đỏ 32,04%; lòng trắng
40 45,5 3,2 69,3 1,2 56,52%, vỏ 11,44% (Nguyễn Hoàng Thịnh và
TB 39,6 2,8 29,9 3,0 ctv, 2020). Bên cạnh đó, kết quả nghiên cứu
Tỷ lệ đẻ của gà Ác trong nghiên cứu hiện của Nguyễn Bá Mùi và Phạm Kim Đăng (2016)
tại cao so với một số giống gà bản địa khác cho thấy gà Ri có khối lượng trứng 50,27 g/quả
như gà Ri đến 38 tuần tuổi là 39,94% (Nguyễn và tỷ lệ lòng đỏ 32,19%. Theo Nguyễn Hoàng
Bá Mùi và Phạm Kim Đăng, 2016), gà Lạc Thịnh và ctv (2021b), trứng gà Ri Lạc Sơn có
Thủy lúc 40 tuần tuổi là 33,58% (Trần Thanh tỷ lệ vỏ là 11,44%; lòng đỏ là 31,81% và lòng
Vân và ctv, 2015), gà Bang Trới lúc 37-40 tuần trắng là 57,32%.

KHKT Chăn nuôi số 286 - tháng 3 năm 2023 15

 DI TRUYỀN - GIỐNG VẬT NUÔI

Bảng 4. Chất lượng trứng gà Ác 16-40 tuần tuổi Bên cạnh đó, bảng 4 cũng cho thấy chỉ số
Haugh của trứng gà Ác trong nghiên cứu hiện
Chỉ tiêu Mean±SD (n=100)
tại là 81,2. Kết quả này thấp hơn so với chỉ số
Khối lượng trứng (g) 34,9 ± 3,01
Haugh ở trứng Bang Trới là 86,87 (Nguyễn
Chỉ số hình dáng (%) 79,1 ± 3,04 Hoàng Thịnh và ctv, 2020). Theo Nguyễn
Tỷ lệ lòng đỏ (%) 31,3 ± 2,41 Hoàng Thịnh và ctv (2021b), trứng gà Ri Lạc
Tỷ lệ lòng trắng (%) 54,0 ± 2,75 Sơn có đơn vị Haugh là 85,4. Theo Trần Công
Tỷ lệ vỏ (%) 14,2 ± 1,53 Xuân và ctv (2004), đơn vị Haugh của gà
Đơn vị Haugh 81,2 ± 9,37 Lương Phượng là 83,98. Theo nghiên cứu của
Bạch Thị Thanh Dân (1995), chất lượng trứng
Chỉ số hình dáng trứng (rộng/dài) của gà
rất tốt khi chỉ số Haugh là 80-100, tốt là 65-79,
Ác là 79,1%. Nếu xét theo tỷ lệ dài/rộng thì
trung bình 55-64 và xấu là <55. Như vậy, chỉ số
chỉ số hình dáng trứng gà Ác là 1,26. Kết quả
Haugh của trứng gà Ác trong nghiên cứu hiện
này tương đương với trứng gà Lạc Thủy ở 32
tại cho thấy đạt chất lượng rất tốt.
tuần tuổi là 1,28 (Nguyễn Hoàng Thịnh và ctv,
2021a). Tuy nhiên, kết quả này lại thấp hơn 3.4. Kết quả ấp nở của gà Ác
so với chỉ số hình dáng của trứng gà Ri (1,32) Bảng 5 cho thấy kết quả ấp nở của gà Ác
trong nghiên cứu của Nguyễn Bá Mùi và qua 4 đợt. Tỷ lệ trứng có phôi/trứng ấp trung
Phạm Kim Đăng (2016) và trứng gà Bang Trới bình là 86,4%; tỷ lệ nở/trứng ấp đạt 75,2%; tỷ
(1,34) trong nghiên cứu của Nguyễn Hoàng lệ nở/trứng có phôi là 87,0% và tỷ lệ gà đạt loại
Thịnh và ctv (2020). I/gà nở đạt 98,9%.
Bảng 5. Kết quả ấp nở trứng gà Ác qua 4 đợt
Trứng Trứng Tỷ lệ Gà nở Tỷ lệ nở/ Tỷ lệ nở/ Gà con loại I Tỷ lệ gà
Đợt ấp có phôi (%) (con) trứng ấp trứng có phôi (con) loại I/gà nở
(quả) (quả) (%) (%) (%)
1 480 412 85,8 353 73,5 85,7 348 98,6
2 475 410 86,3 355 74,7 86,6 351 98,9
3 473 411 86,9 360 76,1 87,6 356 98,9
4 470 407 86,6 359 76,4 88,2 356 99,2
Tổng 1.898 1.640 86,4 1427 75,2 87,0 1.411 98,9

Kết quả ấp nở/trứng ấp của gà Ác trong 85,39 và 86,96%. Ở gà H’Mông, tỷ lệ trứng có

nghiên cứu hiện tại cho thấy cao hơn so với
nghiên cứu của Ngô Thị Kim Cúc và ctv (2013)
trên gà Mía là 66,7-66,9%; ở gà Ri Vàng Rơm
và Ri lai là 77-77,95% (Nguyễn Huy Tuấn,
2013) và ở gà Hồ là 72,81% (Nguyen Van Duy
và ctv, 2015). Tuy nhiên, kết quả này lại thấp
hơn ở gà Lạc Thủy (91,8%). Nguyễn Hoàng
Thịnh và ctv (2021a) cho biết tỷ lệ nở/trứng ấp
đạt 80,40% và tỷ lệ gà loại I/trứng ấp đạt 71%.
Gà Lạc Thủy khi nuôi tại Viện Chăn nuôi có tỷ
lệ trứng có phôi/trứng ấp, tỷ lệ nở/trứng ấp và
tỷ lệ gà loại I/trứng ấp lần lượt là 93,21; 87,17
và 82,37% (Trần Thanh Vân và ctv, 2015). Theo
Nguyễn Hoàng Thịnh và ctv (2021b), gà Ri
Lạc Sơn có tỷ lệ trứng có phôi, gà nở/trứng có
phôi, gà con loại I/trứng nở lần lượt là 80,70;
phôi/trứng ấp đạt 90,08-94,21%, nhưng tỷ lệ
nở/trứng ấp là 80,25-80,68% (Nguyễn Thị Hải
và ctv, 2022). Kết quả nghiên cứu của Nguyễn
Văn Quyên (2010) cho thấy gà Nòi với tỷ lệ
trứng có phôi/trứng ấp là 96,33% và tỷ lệ nở/
trứng có phôi là 97,67%. Sự khác nhau về các
kết quả ấp nở ở các nghiên cứu trên có thể là
do sự khác nhau về con giống, điều kiện thí
nghiệm, chế độ dinh dưỡng,…
4. KẾT LUẬN
Gà Ác được nuôi theo phương thức cá thể
trên lồng có tuổi thành thục sinh dục ở 111
ngày tuổi, trung bình tuổi đẻ của quần thể là
119 ngày tuổi và tỷ lệ đẻ đạt đỉnh cao ở 205
ngày tuổi.

16 KHKT Chăn nuôi số 286 - tháng 3 năm 2023

DI TRUYỀN - GIỐNG VẬT NUÔI
Giai đoạn 16-40 tuần tuổi, gà Ác có năng
suất trứng là 69,3 quả/mái, tỷ lệ đẻ là 39,6%,
tiêu tốn thức ăn/10 quả trứng là 3,0kg. Trứng
gà Ác có khối lượng 34,9 g/quả, tỷ lệ lòng đỏ
đạt 31,3% và đơn vị Haugh là 81,2. Kết quả
ấp nở cho thấy tỷ lệ trứng có phôi/trứng ấp là
86,4%, tỷ lệ nở/trứng ấp đạt 75,2%, tỷ lệ nở/
trứng có phôi là 87,0% và tỷ lệ gà loại I/gà nở
đạt 98,9%.
LỜI CẢM ƠN
Nghiên cứu được tài trợ một phần từ Đề
tài cấp Tỉnh của Sở Khoa học và Công nghệ tỉnh
Trà Vinh: “Chọn lọc nâng cao năng suất trứng
gà Ác gắn với xây dựng chuỗi giá trị tại tỉnh
Trà Vinh”.
TÀI LIỆU THAM KHẢO
1. Ngô Thị Kim Cúc, Nguyễn Công Định, Trần Trung
Thông, Nguyễn Thị Minh Tâm và Phạm Thị Bích
Hường (2013). Bảo tồn và khai thác nguồn gen gà Mía.
Chuyên khảo Bảo tồn và khai thác nguồn gen vật nuôi
Việt Nam. Nhà XB Khoa học Tự nhiên và Công nghệ:
162-71.
2. Ngô Thị Kim Cúc, Phùng Đức Tiến, Nguyễn Trọng
Tuyển và Lưu Quang Minh (2016). Chọn lọc và nhân
thuần giống gà Móng. Tạp chí KHCN Chăn nuôi, 61:
22-32.
3. Bạch Thị Thanh Dân (1995). Kết quả bước đầu xác
định các yếu tố hình dạng, khối lượng trứng đối với tỷ
lệ ấp nở của trứng ngan. Kết quả nghiên cứu khoa học
các công trình nghiên cứu của nghiên cứu sinh. Viện
Khoa học Kỹ thuật Nông nghiệp Việt Nam.
4. Nguyen Van Duy, Nassim Moula, Do Duc Luc, Pham
Kim Dang, Dao Thi Hiep, Bui Huu Doan, Vu Dinh
Ton and Frederic F. (2015). Ho Chicken in Bac Ninh
Province (Vietnam): From an Indigenous Chicken to
Local Poultry Breed, Int. J. Poul. Sci., 14(9): 521-28.
5. Nguyễn Huy Đạt, Vũ Thị Hương và Hồ Xuân Tùng
(2005). Nghiên cứu chọn lọc nâng cao năng suất gà Ri
Vàng Rơm. Báo cáo Khoa học năm 2005. Viện Chăn nuôi.
6. Bùi Hữu Đoàn, Nguyễn Thị Mai, Nguyễn Thanh Sơn
và Nguyễn Huy Đạt (2011). Các chỉ tiêu dùng trong
nghiên cứu chăn nuôi gia cầm. Nhà XB Nông nghiệp.
7. Bùi Hữu Đoàn, Phạm Kim Đăng, Hoàng Anh Tuấn và
Nguyễn Hoàng Thịnh (2016). Lien Minh chicken breed
and livehood of people on district island Cat Hai of Hai
Phong city, Vietnam: Characterization and prospects. J.
Ani. Hus. Sci. Tech., 209: 26-31.
KHKT Chăn nuôi số 286 - tháng 3 năm 2023
8. Nguyễn Thị Hải, Nguyễn Thị Mười, Trần Quốc
Hùng, Phạm Thị Thanh Bình, Lê Thị Thúy Hà, Trần
Thị Thúy Hằng, Đào Đoan Trang, Ngô Thị Tố Uyên,
Nguyễn Văn Tám và Lã Thị Nguyện (2022). Chọn lọc,
nhân thuần gà H’Mông trong 3 năm 2019-2021. BCKH
Viện Chăn nuôi năm 2020–2022, Phần di truyền - giống
vật nuôi, Trang: 130-38.
9. Nguyễn Bá Mùi và Phạm Kim Đăng (2016). Khả năng sản
xuất của gà Ri và con lai (Ri-Sasso-Lương Phượng) nuôi tại
An Dương, Hải Phòng. Tạp chí KHPT, 3(7): 392-99.
10. Nguyễn Văn Quyên (2010). Nghiên cứu ảnh hưởng
của các mức năng lượng trao đổi và đạm thô trên sự
tăng trưởng phát dục và tỷ lệ đẻ của gà Nòi ở Đồng
bằng sông Cửu Long. Luận án tiến sĩ ngành Chăn nuôi,
Đại học Cần Thơ.
11. Nguyễn Hoàng Thịnh, Bùi Hữu Đoàn và Nguyễn Thị
Châu Giang (2021a). Năng suất sinh sản gà Lạc Thủy
nuôi bán thâm canh. Tạp chí KHKT Chăn nuôi, 262: 14-17.
12. Nguyễn Hoàng Thịnh, Nguyễn Phuong Giang và Bùi
Hữu Đoàn (2021b). Năng suất sinh sản của gà Ri Lạc
Sơn nuôi bán chăn thả. Tạp chí KHKT Chăn nuôi, 263:
12-16.
13. Nguyễn Hoàng Thịnh, Nguyễn Thị Vinh, Nguyễn
Thanh Lâm, Mai Thị Thanh Nga, Bùi Hữu Đoàn
(2020). Đặc điểm ngoại hình và khả năng sinh sản của
gà Bang Trới. Vietnam J. Agri. Sci., 18(10): 812-19.
14. Phạm Công Thiếu, Vũ Ngọc Sơn, Hoàng Văn Tiệu,
Nguyễn Viết Thái và Trần Kim Nhàn (2010). Chọn lọc
nâng cao năng suất chất lượng gà H’Mông. BCKH Viện
Chăn nuôi năm 2010, Phần di truyền - giống vật nuôi:
266-78.
15. Đoàn Xuân Trúc, Hà Đức Tính, Nguyễn Xuân Bỉnh, Bùi
Văn Điệp, Trần Văn Tiến và Nguyễn Xuân Dũng (2003).
Nghiên cứu khả năng sản xuất của gà ông bà và gà bố
mẹ lông màu Isacolor nuôi tại xí nghiệp gà giống Hòa
Bình, BC Chăn nuôi Thú y 2002-2003, Phần Chăn nuôi
Gia cầm: 100-06.
16. Nguyễn Huy Tuấn (2013). Khả năng sản xuất của tổ
hợp lai giữa gà Ri vàng rơm và gà ri lai (7/8 vàng rơm
và 1/8 lương phượng) nuôi tại trại thực nghiệm của
gia cầm Liên Ninh. Luận văn Thạc sỹ, Trường Đại học
Nông nghiệp Hà Nội.
17. Trần Thanh Vân, Đỗ Thị Kim Dung, Vũ Ngọc Sơn
và Nguyễn Thị Thúy Mỵ (2015). Nghiên cứu một số
đặc điểm ngoại hình và khả năng sinh sản của gà địa
phương Lạc Thủy - Hòa Bình, Kỷ yếu HNKH Chăn
nuôi-Thú y toàn quốc, Trường Đại học Cần Thơ: 195-00.
18. Trần Công Xuân, Vũ Xuân Dịu, Phùng Đức Tiến,
Vương Tuấn Ngọc, Nguyễn Quý Khiêm, Đỗ Thị Sợi
và Hoàng Văn Lộc (2004). Nghiên cứu khả năng sản
xuất của tổ hợp lai giữa gà trống X44 (Sasso) với gà mái
Lương Phượng hoa. BCKH Chăn nuôi Thú y - Phần
Chăn nuôi gia cầm: 352-60.
17
KHKT Chăn nuôi Số 288 - tháng 5 năm 2023

Phó Tổng biên tập Phụ trách: DI TRUYỀN - GIỐNG VẬT NUÔI
PGS.TS. NGUYỄN VĂN ĐỨC Hoàng Tuấn Thành, Nguyễn Thị Lan Anh, Nguyễn Duy An, Lê T n Lợi v Nguyễn
Thị Kim Ngân. Đa hình gen Neuropeptides Y (NPY) trên gà Hắc Phong 2

ấ
à
Phó Tổng biên tập: Đỗ Chí Hiếu, Lê T n Lợi, Hoàng Tuấn Thành, Lưu Quang Minh v Nguyễn Ngọc
T n. Đa hình gen Prolactin trên vùng Intron I của vịt Lai BT (Biển x TC) 7

ấ
à
PGS.TS. NGUYỄN ĐĂNG VANG

ấ
TS. NGUYỄN XUÂN DƯƠNG Nguyễn Văn Hợp, Nguyễn Hữu Tỉnh, Ngô Thị Kim Cúc v Đỗ Thế Anh. Ảnh hưởng
di truyền cộng gộp, di truyền trội của đa h nh gen H-FABP đến tỷ lệ mỡ giắt, dày mỡ

à
lưng, dày thăn thịt và tuổi đạt khối lượng 100kg ở giống lợn Duroc 12

ì
Thư ký tòa soạn:
Nguyễn Văn Hợp, Nguyễn Hữu Tỉnh, Ngô Thị Kim Cúc v Đỗ Thế Anh. Tiềm năng
PGS.TS. NGUYỄN VĂN ĐỨC di truyền và khuynh hướng di truyền của tính trạng mỡ giắt, dày mỡ lưng và tuổi đạt

à
khối lượng 100kg ở giống lợn Duroc 21
Ủy viên Ban biên tập: Trương Hữu Dũng, Phùng Đức Ho n v Trần Văn Phùng. Mối liên kết giữa đa h nh
gen ESR (Estrogen receptor) và năng suất sinh sản của lợn nái rừng lai F1(Rừng x

à
à
ì
TS. NGUYỄN QUỐC ĐẠT
PGS.TS. HOÀNG KIM GIAO VCNMS15) trong chăn nuôi nông hộ 29
GS.TS. NGUYỄN DUY HOAN Bùi Thị Thơm, Dương Thị Khuyên v H Thị Thư. Đặc điểm ngoại h nh của lợn đen
bản địa lục khu tại huyện Hà Quảng, tỉnh Cao Bằng 34

à
à
ì
GS.TS. DƯƠNG NGUYÊN KHANG
PGS.TS. NGUYỄN THỊ KIM KHANG DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI
PGS.TS. ĐỖ VÕ ANH KHOA
Trương H Thái, Chu Thị Thanh Hương, Vũ Thị Thu Tr , Nguyễn Thị Phương Giang
PGS.TS. ĐỖ ĐỨC LỰC v Phạm Kim Đăng. Ảnh hưởng của việc bổ sung chế phẩm Creazyme Mix 808 vào
à
à
GS.TS. LÊ ĐÌNH PHÙNG thức ăn đến một số chỉ tiêu sinh trưởng trong chăn nuôi gà Mía hướng thịt 39
à
Nguyễn Thị Ho , Quách Minh Chiến, Nguyễn Th nh Công, Đặng Vũ Ho , Đặng Thuý
Nhung, Đỗ Đức Lực v H Xuân Bộ. Ảnh hưởng của tỷ lệ thức ăn tinh và thô trong khẩu
à
à
à
Xuất bản và Phát hành:
phần đến khả năng sinh trưởng của đà điểu giai đoạn từ 4 đến 12 tháng tuổi 43
à
à
ThS. NGUYỄN ĐÌNH MẠNH
Nguyễn Thùy Linh. Ảnh hưởng mức protein thô trong khẩu phần đến khả năng sinh
trưởng của gà tây Huba giai đoạn 10-20 tuần tuổi 49

U Trương H Thái, Vũ Thị Thu Tr , Chu Thị Thanh Hương, Nguyễn Thị Phương
Giang v Phạm Kim Đăng. Ảnh hưởng của việc bổ sung chế phẩm Tanca 70 vào
à
à
thức ăn đến một số chỉ tiêu sinh trưởng của lợn con sau cai sữa 54
à
Nguyễn Thị Thủy, Đậu Văn Hải, Nguyễn Văn Tiến, Ho ng Thị Ngân, Phạm Văn Quyến,
Lê Phương Thảo, Nguyễn Thị Kim Loan, Nguyễn Văn Chiểu v Nguyễn Duy Phát. Hiệu
à
Giấy phép: Bộ Thông tin và Truyền thông quả của thức ăn ủ chua trên bò lai BBB và dê Bách Thảo tại Tiền Giang 58
à
Số 257/GP- BTTTT ngày 20/05/2016 Ngô Thị Minh Sương, Hồ Quảng Đồ, Nguyễn Hữu Tâm v Phạm Thị Hữu Hạnh.
Khảo sát h nh thái, thành phần dưỡng chất và so sánh khả năng sinh khí trong điều
à
ISSN 1859 - 476X
kiện in vitro của cây rau muống biển với một số cây thức ăn gia súc 64
ì
Xuất bản: Hàng tháng
Toà soạn: CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC
Địa chỉ: Tầng 4, Tòa nhà 73, Thái Quốc Hiếu, Lê Vĩnh Nguyên Hân, Từ Phương Bình, Bùi Thị Tuyết Trinh,

Hoàng Cầu, Ô Chợ Dừa, Trần Ho ng Diệp, Đo n Thị Ngọc Thanh, Lê Thị Hồng Nhớ, Lê Phương Thảo v
Nguyễn Trọng Ngữ. Năng suất trứng của cút Nhật Bản với các nhóm màu lông, kiểu
à
à
à
Đống Đa, Hà Nội.
chuồng nuôi và tần số kiểu gen prolactin indel 70
Điện thoại: 024.36290621
Bùi Thị Thơm, Dương Thị Khuyên v Nguyễn Hưng Quang. Khả năng sinh trưởng, năng
Fax: 024.38691511 suất, chất lượng thịt của lợn Nậm Khiếu nuôi thịt tại huyện Đồng Hỷ, tỉnh Thái Nguyên 76
à
E - mail: tapchichannuoi@hoichannuoi.vn Ho ng Thị Ngân,Phạm Văn Quyến, Nguyễn Văn Tiến, Bùi Ngọc Hùng, Nguyễn
Thị Thủy, Lê Thị Ngọc Thùy và Tr n Thanh T ng. Khả năng sinh trưởng của bê
à
Website: www.hoichannuoi.vn
lai F1(BBB x LBR) v F1(WAGYU x LBR) t sơ sinh đ n 18 th ng tu i tại Trung tâm
ầ
ù
Tài khoản: Nghiên cứu và phát triển chăn nuôi gia súc lớn 80
à
ừ
ế
á
ổ
Tên tài khoản: Hội Chăn nuôi Việt Nam Nguyễn Thiết v Nguyễn Thị Ngọc Linh. Năng suất và thành phần hóa học của
cỏ Paspalum (Paspalum Atratum) và Setaria (Setaria Sphacelata) được trồng trên
à
Số tài khoản: 1300 311 0000 40, tại Ngân hàng
Nông nghiệp và Phát triển Nông thôn, Chi nhánh vùng đất phèn Hòa An, Hậu Giang 89
Thăng Long - Số 4, Phạm Ngọc Thạch, Hà Nội. Nguyễn Thị Thủy, Đậu Văn Hải, Nguyễn Văn Tiến, Ho ng Thị Ngân, Phạm Văn
Quyến, Lê Phương Thảo, Nguyễn Thị Kim Loan, Nguyễn Văn Chiểu v Nguyễn
à
In 1.000 bản, khổ 19x27 tại Công ty CP KH&CN Duy Phát. Ảnh hưởng các mức phân chuồng đến năng suất, chất lượng cỏ Panicum
à
Hoàng Quốc Việt. In xong và nộp lưu chiểu: Maximum CV. Hamil và Panicum Maximum CV. Mombasa) tại Tiền Giang 93
tháng 5/2023. Dương Thị Toan, Nguyễn Văn Lưu, Nguyễn Thị Chinh v Trần Thị Tâm. Một số đặc
điểm dịch tễ và lâm sàng bệnh đầu đen ở gà tại huyện Việt Yên, tỉnh Bắc Giang 100
à
 CHĂNVẬT
CHĂN NUÔI ĐỘNG NUÔI
VÀĐỘNG VẬTĐỀ
CÁC VẤN VÀKHÁC
CÁC VẤN ĐỀ KHÁC

NĂNG SUẤT TRỨNG CỦA CÚT NHẬT BẢN VỚI CÁC NHÓM
MÀU LÔNG, KIỂU CHUỒNG NUÔI VÀ TẦN SỐ KIỂU GEN
PROLACTIN INDEL
Thái Quốc Hiếu1, Lê Vĩnh Nguyên Hân1, Từ Phương Bình1, Bùi Thị Tuyết Trinh1,
Trần Ho ng Diệp2, Đo n Thị Ng c Thanh2, Lê Thị H ng Nh 1, Lê Phương Thảo1 và Nguyễn Tr ng Ngữ3*
à à ọ ồ ớ ọ

Ngày nhận bài báo: 16/02/2023 - Ngày nhận bài phản biện 11/3/2023
Ngày bài báo được chấp nhận đăng 17/3/2023
TÓM TẮT
Nghiên cứu được tiến hành nhằm mục tiêu xác định năng suất trứng và tần số ki u gen ể

prolactin indel (PRL indel) trên cút Nhật Bản thuộc 3 nhóm màu lông: vàng nâu, trắng đốm nâu và
xám đen được nuôi trong điều kiện chuồng hở và chuồng kín. Thí nghiệm được bố trí trên cút đẻ
trong giai đoạn 7-40 tuần tuổi (34 tuần đẻ) với tổng số là 540 con (270 cút được nuôi trong chuồng
hở và 270 cút được nuôi trong chuồng kín), trong đó mỗi nhóm màu lông là 90 mái. Kết quả cho
thấy, về năng suất trứng, cút với màu lông xám đen cho số lượng trứng nhiều nhất (170,9 quả/mái)
(P<0,05), tương ứng với tỷ lệ đẻ trung bình đạt 73,7%. Hai nhóm cút vàng nâu và trắng đốm nâu
có tỷ lệ đẻ thấp hơn với tỷ lệ lần lượt là 69,4% và 65,2%. Bên cạnh đó, cút nuôi trong chuồng kín
cho năng suất trứng cao và tỷ lệ đẻ tốt hơn so với chuồng hở (69,4% so với 65,7%). Khi xét về sự
hiện diện của của các ki u gen PRL indel, không có sự khác biệt về tần số ki u gen của các nhóm
ể ể

cút trong quần th , theo đó tần số ki u gen có tiềm năng liên quan đến khả năng đẻ trứng tốt dao
ể ể

động 44,1-45,6% với trung bình tần số alen I và alen D lần lượt là 77,3% và 22,7%. Tóm lại, cút với
màu lông xám đen có tỷ lệ đẻ tốt nhất và hiệu quả chăn nuôi được cải thiện nếu được nuôi trong
chuồng kín.
Từ khóa: Năng suất trứng, m u lông, chu ng nuôi, đa hình Prolactin indel, cút Nh t Bản.
à ồ ậ

ABSTRACT
Egg production of Japanese quails with different feather colors and housing types, and
genotype frequency of prolactin indel
The present study was conducted with the aim of determining egg yield and genotype
frequency of prolactin indel (PRL indel) on Japanese quails in 3 feather color groups: yellow-brown,
white-spotted white and dark gray reared in conditions of open and closed houses. The experiment
was designed on 540 laying quails from 7-40 weeks of age (34 weeks of laying), of which 270 quails
were raised in open houses and 270 quails were raised in closed ones, with the number of each color
group being 90 heads/group. The results showed that, in terms of egg yield, quails with dark gray
feathers gave the highest number of eggs (170.9 eggs/quail) (P<0.01), corresponding to the average
laying rate of 73.7%. The two groups of yellow-brown and white-spotted quail had lower laying
rates of 69.4% and 65.2%, respectively. In addition, quail raised in closed houses gave higher egg
yield and better laying rate than open cages (69.4% versus 65.7%). When it comes to the presence
of PRL indel genotypes, there is no difference in genotype frequencies among quail groups in the
population, according to which genotype frequencies potentially related to good egg-laying ability
ranged from 44.1-45.6% with the average frequency of allele I and allele D being 77.3% and 22.7%,
respectively. In summary, quail with dark gray feather color has the best laying rate and improved
breeding efficiency if kept in closed houses.
Keywords: Egg production, feather color, housing, Prolactin indel, Japanese quail.
1
Chi cục Chăn nuôi và Thú y Tiền Giang
2
Trư ng Đại học Tiền Giang
ờ

3
Trư ng Đại học Cần Thơ
ờ

* Tác giả liên hệ: PGS.TS. Nguy n Trọng Ngữ, Trư ng Nông nghiệp, Trư ng Đại học Cần Thơ. Điện thoại: 0989828295; Email:
ễ ờ ờ

ntngu@ctu.edu.vn

70 KHKT Chăn nuôi số 288 - tháng 5 năm 2023

CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC
1. ĐẶT VẤN ĐỀ
Trứng cút là loại thực phẩm giá thành
rẻ, chất lượng cao, giàu dinh dưỡng thường
xuyên xuất hiện trên bàn ăn của mọi người
và được mệnh danh là “nhân sâm của động
vật” (Santos và ctv, 2015), góp phần thúc đẩy
sự tăng trưởng và phát triển cơ thể (Liua và
ctv, 2020). Hiện nay, nuôi chim cút đang trở
nên rất phổ biến bởi nhiều ưu điểm: yêu cầu
diện tích đất tối thiểu, lợi nhuận cao với mức
đầu tư thấp, quay đồng vốn nhanh, cút có tuổi
thành thục sớm, đẻ nhiều trứng, thời gian đẻ
kéo dài, rủi ro thấp, nhu cầu thị trường cao.
Trên địa bàn tỉnh Tiền Giang, tổng đàn chim
cút khoảng 1,3 triệu con, đứng hàng thứ nhì
ở các tỉnh, thành phía Nam (sau tỉnh Đồng
Nai); trong đó, chăn nuôi cút đẻ trứng chiếm
khoảng 80%/tổng đàn so với nuôi cút thịt. Về
chuồng trại nuôi cút thì phổ biến nhất vẫn là
loại chuồng hở, tuy nhiên đối với các trang
trại quy mô lớn đã đầu tư hệ thống chuồng
kín (chuồng lạnh, khép kín).
Hiện nay, chim cút đẻ có sự lai tạp nhiều
nên có nhiều nhóm màu lông thường thấy
như màu lông vàng nâu, màu lông trắng đốm
nâu và màu lông xám đen. Nhiều nhóm màu
lông trên chim cút đẻ có thể đã phân chia
thành nhiều nhóm hoặc dòng khác nhau dẫn
tới năng suất sinh sản cũng khác nhau. Do đó,
công tác lai tạo và chọn lọc giống có ý nghĩa
quan trọng nhằm góp phần nâng cao năng
suất, chất lượng giống và thu nhập cho người
chăn nuôi. Bên cạnh việc chọn giống truyền
Vàng nâu Trắng đốm nâu
Hình 1. Cút với các nhóm màu lông khác nhau được sử dụng trong thí nghiệm
KHKT Chăn nuôi số 288 - tháng 5 năm 2023
thống thì việc chọn lọc dựa vào chỉ thị phân
tử cũng là một trong những xu hướng hiện
nay. Trong đó, đối với gia cầm nói chung hay
cút nói riêng thì đa hình PRL indel đã được
nghiên cứu khá nhiều và được cho là có liên
quan đến năng suất trứng (Jiang và ctv, 2005;
Cui và ctv, 2006; Ngu và ctv, 2021). Mục tiêu
của nghiên cứu này là đánh giá khả năng đẻ
trứng của cút với các nhóm màu lông và được
nuôi trong các điều kiện chuồng trại khác
nhau, đồng thời xác định tần số gen và tần số
alen của đa hình PRL indel để từ đó chọn lọc
nhóm cút có năng suất cao đáp ứng được nhu
cầu của người chăn nuôi.
2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU
2.1. Đối tượng, địa điểm và thời gian
Thí nghiệm được tiến hành trên 540 cút
mái giai đoạn 7-40 tuần tuổi. Cút được nuôi
trong điều kiện chuồng hở và chuồng kín
tại một trang trại ở tỉnh Tiền Giang từ tháng
12/2021 đến tháng 9/2022. Cút được phân chia
dựa theo 3 nhóm màu lông: vàng nâu, trắng
đốm nâu và xám đen (Hình 1); theo đó mỗi
nhóm màu lông có 90 mái được sử dụng để
theo dõi năng suất trứng và đánh giá tỷ lệ đẻ.
Đối với chuồng hở, lồng nuôi cút được làm
bằng sắt kích thước 1x0,2x0,5m để nuôi 30-40
con, mái che bằng lá hoặc tôn, xung quanh
trại có phủ bạt để tránh mưa tạt, gió lùa. Đối
với chuồng kín, lồng nuôi cút được làm bằng
sắt, kích thước 1x0,25x0,9m để nuôi 50-60 con,
mái che bằng tôn, có hệ thống làm mát và quạt
thông gió trong trại.
Xám đen
71
 CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC
2.2. Chăm sóc, nuôi dưỡng và thu thập số liệu
2.2.1. Chăm sóc, nuôi dưỡng
Cút được cho ăn thức ăn hỗn hợp cho cút
đẻ với giá trị dinh dưỡng như sau: protein thô
(CP) tối thiểu 21%; độ ẩm tối đa 13%; xơ thô tối
đa 6%; Ca 3,3-4,8%; P tổng số: 0,5-1,2%; Lysine
tổng số tối thiểu 1,1%; Methionine+Cystine
tổng số tối thiểu 0,8%; năng lượng trao đổi tối
thiểu 2.900 Kcal/kg. Thức ăn được đưa vào
máng 01 lần/ngày vào buổi sáng, nước uống tự
do. Tất cả cút được đánh số thứ tự và đeo vào
chân cho từng cá thể. Khẩu phần ăn và chế độ
chăm sóc nuôi dưỡng như nhau cho tất cả các
nhóm. Cút được phòng các bệnh phổ biến và
bổ sung một số chế phẩm để hỗ trợ tiêu hóa,
tăng sức đề kháng trong quá trình nuôi.
2.2.2. Các chỉ tiêu về năng suất trứng
Trứng cút được thu gom hàng ngày vào
buổi sáng và ghi nhận số lượng theo từng
nhóm màu lông và kiểu chuồng nuôi. Theo
dõi khả năng đẻ trứng của cút trong 34 tuần
đẻ, bắt đầu từ tuần thứ 7, khi cút bắt đầu đẻ
trứng. Tỷ lệ đẻ được tính dựa trên số trứng
thu được trong ngày trên tổng số cút có mặt
trong trại. Bên cạnh đó, ghi nhận số lượng cút
loại thảo hoặc chết để tính tỷ lệ hao hụt so với
số lượng ban đầu.
2.2.3. Xác định kiểu gen Prolactin indel
Mỗi cá thể thu thập khoảng 5-7 sợi
lông, cho vào túi nilon, trữ lạnh và mang
về phòng TN để ly trích DNA (Bello và ctv,
2001). Vùng promoter của gen prolactin
(GenBank No. AB452962.1) được sử dụng
để thiết kế cặp mồi với trình tự như sau:
5’-TGGAGGGTGAAGAGACAAGG-3’
(mồi xuôi) và
5’-ACGGCTGGATGAAGAGAACA-3’ (mồi
ngược). Nhiệt độ gắn mồi là 63oC, sản phẩm
của phản ứng chuỗi trùng hợp (PCR) được
điện di trên gel 3%, ở 80 V trong 45 phút. Đoạn
DNA chèn vào hoặc mất đi (indel) có chiều dài
24bp, do đó sản phẩm của PCR có chiều dài
147bp; 147 và 123bp và 123bp tương ứng với
các kiểu gen II, ID và DD.
72
2.3. Xử lý số liệu
Số liệu được xử lý và phân tích thống kê
bằng phần mềm Microsoft Excel 16 và Minitab
16.2.
3. KẾT QUẢ VÀ THẢO LUẬN
3.1. Năng suất trứng và tỷ lệ đẻ
Tổng số trứng tích lũy qua 34 tuần đẻ và
tỷ lệ đẻ của cút được thể hiện qua Hình 2, theo
đó số trứng đạt được cao nhất là 170,9 quả/mái
đối với nhóm cút xám đen nuôi trong chuồng
kín và thấp nhất là 145,6 quả/mái trên nhóm
cút với màu lông vàng nâu trong điều kiện
nuôi chuồng hở. Bên cạnh đó, tỷ lệ đẻ đạt đỉnh
cao nhất khoảng tuần đẻ thứ 16 và duy trì đến
tuần đẻ 22, sau đó giảm dần với tốc độ chậm.
Trong nghiên cứu hiện tại, tỷ lệ hao hụt dao
động trong khoảng 5,5% (trại kín) đến 7,5%
(trại hở), do đó không có sự khác biệt nhiều về
tỷ lệ đẻ tính trên ngày (HD, Hen-day) so với
tỷ lệ đẻ tính trên số đầu con từ lúc bắt đầu thí
nghiệm (HH, Hen-housed).
Trong thực tế, màu lông xám là nhóm
màu lông khá phổ biến đối với cút Nhật Bản
với nhiều biến thể từ xám nhạt đến xám đậm.
Ngoài ra, nhóm cút màu lông trắng đốm nâu
cũng thường được nuôi tại các trang trại và
phổ biến hơn nhóm cút có màu lông vàng nâu.
Khi xét đến khả năng đẻ trứng của cút có màu
lông khác nhau có thể nhận thấy, cút với màu
lông xám đen có tỷ lệ đẻ cao hơn (P<0,01) so
với cút thuộc 2 nhóm màu lông còn lại (Hình
3), trong đó ở tất cả 3 nhóm màu lông, tỷ lệ
đẻ của cút nuôi trong điều kiện chuồng kín
tốt hơn so với nuôi chuồng hở (69,4% so với
65,7%) (P<0,01). Trong các nghiên cứu trước
đây, kết quả cũng chỉ ra rằng nhóm cút mang
kiểu hình hoang dại (lông xám, sậm màu)
thường có năng suất trứng cao hơn (Cahyadi
và ctv, 2019; Lan và ctv, 2021). Bên cạnh đó,
báo cáo của Bagh và ctv (2016) cũng cho
thấy cút có tăng trưởng cao hơn trong giai
đoạn sinh trưởng thường bị ảnh hưởng đến
hiệu suất trong giai đoạn đẻ trứng. Trước đó,
nghiên cứu của Nestor và Bacon (1982) đã
phát hiện ra rằng sản lượng trứng giảm ở cút
KHKT Chăn nuôi số 288 - tháng 5 năm 2023
CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC
có kích thước lớn và tăng ở cút có khối lượng
cơ thể thấp. Trong báo cáo hiện tại, khối lượng
cút giữa các nhóm màu lông không có sự khác
biệt đáng kể; tuy nhiên, đây cũng là một điểm
(a) Cút có màu lông vàng nâu, nuôi trại hở
(b) Cút có màu lông trắng đốm nâu, nuôi trại hở
(c) Cút có màu lông xám đen, nuôi trại hở
Hình 2. Tỷ lệ đẻ và tổng trứng tích lũy của các nhóm cút với màu lông và kiểu chuồng nuôi khác nhau
Trong chăn nuôi gia cầm đẻ trứng việc nuôi
trong chuồng hở hoặc chuồng kín có ảnh
hưởng đến năng suất trứng. Ngoài yếu tố về
kiểm soát mầm bệnh, sự khác biệt chủ yếu
giữa hai kiểu chuồng nuôi này liên quan đến
sự ổn định về nhiệt độ, ẩm độ và tốc độ trao
KHKT Chăn nuôi số 288 - tháng 5 năm 2023
cần lưu ý trong các nghiên cứu tiếp theo để từ
đó có được một bức tranh tổng thể hơn về mối
liên quan giữa đặc điểm ngoại hình và khả
năng sinh sản của cút.
(d) Cút có màu lông vàng nâu, nuôi trại kín
(e) Cút có màu lông trắng đốm nâu, nuôi trại kín
(f) Cút có màu lông xám đen, nuôi trại kín
đổi khí trong chuồng kín. Đối với chuồng hở,
các yếu tố này khó được kiểm soát, dẫn đến
gia cầm dễ bị stress và ảnh hưởng đến năng
suất. Theo Santana và ctv (2021), một chiến
lược giảm thiểu tác động tiêu cực của stress
đối với cút là tạo điều kiện môi trường lý
73
 CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC
tưởng nhất. Kết quả nghiên cứu Furtado và
ctv (2018) cho thấy, nếu ở nhiệt độ môi trường
cao (31-34°C) thì năng suất trứng của cút sẽ
giảm 10,8% so với nhiệt độ môi trường thấp
(26-30°C) bởi cút cần nhiều năng lượng cho
quá trình điều hòa của cơ thể nhiệt độ thay
vì để sản xuất trứng; đồng thời nhiệt độ môi
trường cao sẽ làm giảm tổng hợp hormone
kích thích nang trứng gonadotropin, hormone
tạo hoàng thể và estradiol, làm tỷ lệ nang
(a)
Hình 3. Tỷ lệ đẻ của các nhóm cút trong 2 kiểu chuồng nuôi: (a) theo màu lông và (b) tính chung
toàn đàn
3.2. Tần số kiểu gen và tần số alen
Đối với đa hình PRL indel, tần số kiểu
gen đồng hợp tử II xuất hiện khá cao trong
quần thể (44,6%) so với kiểu gen đồng hợp tử
DD (4,1%). Tương tự, tần số alen I chiếm đa
số (77,3%) và với giá trị HWE cũng cho thấy
quần thể cút nghiên cứu không có sự cân bằng
về di truyền, hay nói cách khác, việc chọn lọc
theo định hướng cải thiện khả năng đẻ trứng
đã phần nào ảnh hưởng đến sự cân bằng này.
Tuy nhiên, do alen I được cho là có liên quan
đến đến khả năng đẻ trứng tốt (Ngu và ctv,
2021) do đó để chọn tạo và xây dựng một đàn
giống chất lượng cao thì việc chọn lọc những
cá thể mang kiểu gen đồng hợp tử II là điều
khả thi và có thể triển khai nhanh trong điều
kiện thực tế. Kết quả phân tích trên phù hợp
với công bố trước đây của Yousefi và ctv (2012)
trên cút, báo cáo của tác giả này tìm ra hai alen
A (154bp) và B (130bp) với ba kiểu gen AA, AB
và BB. Trên cút Nhật Bản, Lotfi và ctv (2013)
cũng tìm thấy hai alen I (154bp) và D (130bp).
Tương tự, kết quả nghiên cứu của Begli và ctv
(2010) trên giống thủy cầm bản địa cho thấy có
74
trứng ít, chất lượng lòng đỏ và năng suất
trứng giảm (Aswathi và ctv, 2019). Nghiên
cứu của Raharjo và ctv (2018) cho biết, nhiệt
độ và độ ẩm ảnh hưởng đến sức khỏe và năng
suất trứng, nhiệt độ và độ ẩm lý tưởng cho
cút là 25-27oC và 60-70%. Điều này được xác
định trong nghiên cứu hiện tại, theo đó năng
suất trứng cút cao hơn khi được nuôi trong
chuồng kín.
(b)
hai alen I và D tương ứng với ba kiểu gen II,
ID và DD trên đa hình này. Trong hầu hết các
trường hợp, tần số alen I đều cao hơn alen D.
Bảng 1. Tần số kiểu gen và tần số alen của đa
hình PRL indel trong quần thể cút (n=540)
Nhóm cút Kiểu gen Alen HWE
II ID DD I D (χ2)
Vàng nâu 44,1 53,5 2,4 78,4 21,6 47,1**
Trắng đốm nâu 45,6 51,1 3,3 78,6 21,4 33,6**
Xám đen 44,1 49,4 6,5 75,0 25,0 12,4**
Toàn đàn 44,6 51,4 4,1 77,3 22,7 85,9**
Hardy-Weinberg Equilibrium; **: P<0,01
Các gen ứng viên có ý nghĩa trong chọn
giống thông qua liên kết giữa những đa hình
khác nhau của gen với các biểu hiện kiểu hình
của vật nuôi (Liu, 2007). Việc chọn lọc thông
qua kiểu gen có nhiều ưu điểm: phát hiện
nhanh, tính chính xác cao, giúp tăng năng
suất, tăng khả năng thích ứng với môi trường
của vật nuôi, đồng thời duy trì sự đa dạng di
truyền. Trên cút, prolactin là một trong những
hormone polypeptide do tuyến tụy tiết ra. Có
nhiều bằng chứng cho thấy prolactin có vai
trò quan trọng đến thói quen ấp trứng của gia
KHKT Chăn nuôi số 288 - tháng 5 năm 2023
CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC
cầm (Jiang và ctv, 2005). Sự gia tăng prolactin
trong máu có thể ảnh hưởng đến đặc tính ấp
nở (Sockman và ctv, 2000) và làm ngưng quá
trình đẻ trứng cũng như làm giảm năng suất
trứng (Reddy và ctv, 2002). Nghiên cứu Lotfi
và ctv (2013) được tiến hành nhằm đánh giá
ảnh hưởng của các điểm đột biến từ intron 3
đến exon 3, trong đó có chứa một indel 24bp
tại vị trí 358. Kết quả có một vị trí 24bp indel
tại vị trí trên. Tần số xuất hiện của các indel
này đã được xác định. Thêm vào đó, nghiên
cứu còn chỉ ra rằng kiểu gen II có mối liên kết
chặt chẽ đến với sự gia tăng số lượng trứng
(P<0,01) và vị trí này được đề nghị sử dụng
để cải thiện năng suất trứng trên đàn chim cút
Nhật Bản thông qua việc chọn lựa dựa vào sự
hỗ trợ của các chỉ thị phân tử.
4. KẾT LUẬN
Cút với màu lông xám đen có tỷ lệ đẻ tốt
hơn so với cút mang màu lông vàng nâu hoặc
trắng đốm nâu, điều kiện chăn nuôi chuồng
kín giúp cút cải thiện được tỷ lệ đẻ. Bên cạnh
đó, đối với đa hình PRL indel, cút mang kiểu
gen II chiếm số lượng khá lớn trong quần thể,
điều này góp phần thuận lợi cho công tác chọn
lọc và nhân đàn trong thực tế sản xuất.
TÀI LIỆU THAM KHẢO
1. Aswathi P.B., Bhanja S.K., Kumar P., Shyamkumar
T.S., Mehra M., Bhaisare D.B. and P.K. Rath (2019).
Effect of acute heat stress on the physiological and
reproductive parameters of broiler breeder hens - A
study under controlled thermal stress. Indian J. Ani.
Res., 53(9): 1150-55.
2. Bagh J., Panigrahi B., Panda N., Pradhan C.R., Mallik
B.K., Majhi B. and S.S. Rout (2016). Body weight, egg
production, and egg quality traits of gray, brown, and
white varieties of Japanese quail (Coturnix coturnix
japonica) in coastal climatic condition of Odisha. Vet.
World, 9: 832-36.
3. Begli H.E., Zerehdaran S., Hassani S., Abbasi
M.A. and A.K. Ahmadi (2010). Polymorphism in
prolactin and PEPCK-C genes and its association with
economic traits in native fowl of Yazd province. Iran. J.
Biotechnol., 8: 172-77.
4. Bello N., Francino O. and A. Sánchez (2001). Isolation of
genomic DNA from feathers. J. Vet. Diagn. Invest., 13: 162-64.
5. Cahyadi M., Fauzy R. and R. Dewanti (2019). Egg
production traits and egg quality characteristics in
black and brown plumage color lines of Japanese quail.
Poult. Sci. J., 7(2): 179-84.
6. Cui J.X., Du H.L., Liang Y., Deng X.M., Li N. and
X.Q. Zhang (2006). Association of polymorphisms
in the promoter region of chicken prolactin with egg
production. Poult. Sci., 85: 26-31.
KHKT Chăn nuôi số 288 - tháng 5 năm 2023
7. Furtado D.A., Braz J.R., do Nascimento J.W., Lopes
Neto J.P. and D.L. Oliveira (2018). Production
and quality of Japanese quail eggs submitted to
environments with different light spectrums. Eng.
Agric., 38: 504-09.
8. Jiang R., Xu G., Zhang X. and N. Yang (2005).
Association of polymorphisms for prolactin and
prolactin receptor genes with broody traits in chickens.
Poul. Sci., 84: 839-45.
9. Lan L.T.T., Nhan N.T.H., Hung L.T., Diep T.H., Xuan
N.H. and H.T. Loc (2021). Relationship between
plumage color and eggshell patterns with egg
production and egg quality traits of Japanese quails.
Vet. World, 14(4): 897-902.
10. Liu Z. (2007). Single nucleotide polymorphism (SNP).
Aquaculture Genome Technologies. Blackwell.
England, 584 pp.
11. Liua L., Yanga R., Luoa X., Donga K., Huanga X.,
Songa H., Gaob H., Li S. and Q. Huanga (2020). Omics
analysis of holoproteins and modified proteins of quail
egg. Food Chem., 326: 126983.
12. Lotfi E., Zerehdaran S., AhaniAzari M. and E. Dehnavi
(2013). Genetic polymorphism in prolactin gene and its
association with reproductive traits in Japanese quail
(Coturnix japonica). Poul. Sci. J., 1: 29-35.
13. Nestor K.E. and W.L. Bacon (1982). Divergent selection
for body weight and yolk precursor in Coturnix
coturnix japonica. 3. Correlated responses in mortality,
reproduction traits, and adult body weight. Poul. Sci.,
61: 2137-42.
14. Ngu N.T., Lan L.T.T., Nhan N.T.H., Hung L.T., Rachel
L.S., Gia, T.T., Anh L.H. and N.H. Xuan (2021).
Association of polymorphisms in prolactin receptor
and melatonin receptor 1c genes on egg production and
egg quality traits of Japanese quails (Coturnix coturnix
japonica). J. Ani. Plant Sci., 31: 1559-67.
15. Raharjo S., Rahayu E.S. and S.H. Purnomo (2018).
Factors affecting quail egg production under the
changing climate at Kulonprogo regency, Indonesia.
In IOP Conference Series: Earth and Env. Sci., 200(1):
012012. IOP Publishing.
16. Reddy I., David C., Sarma P. and K. Singh (2002).
The possible role of prolactin in laying performance
and steroid hormone secretion in domestic hen (Gallus
domesticus). Gen. Comp. Endocrinol., 127: 249-55.
17. Santana T.P., Gasparino E., de Souza Khatlab A., Brito
C.O., Barbosa L.T., Lamont S.J. and A.P. Del Vesco
(2021). Effect of prenatal ambient temperature on the
performance physiological parameters, and oxidative
metabolism of Japanese quail (Coturnix coturnix
japonica) layers exposed to heat stress during growth.
Sci. Rep., 11(1): 1-11.
18. Santos D.O., Coimbra J.S.R., Teixeira C.R., Barreto
S.L.T., Silva M.C.H. and A.D. Giraldo-Zuniga (2015).
Solubility of proteins from quail (Coturnix coturnix
japonica) egg white as affected by agitation time, pH,
and salt concentration. Int. J. Food Prop., 18(2): 250-58.
19. Sockman K.W., Schwabl H. and P.J. Sharp (2000). The
role of prolactin in the regulation of clutch size and
onset of incubation behavior in the American kestrel.
Horm. Behav., 38: 168-76.
20. Yousefi S., Raoufi Z., Rasouli Z. and S. Zerehdaran
(2012). Investigation of prolactin gene polymorphism
in Japanese quail. Anim. Sci. Biotech., 45: 289-92.
75
Veterinary Integrative Sciences

Veterinary Integrative Sciences 2023; 21(3): 657 - 665 DOI; 10.12982/VIS.2023.047

Vet Integr Sci

Veterinary Integrative Sciences
ISSN; 2629-9968 (online)
Website; www.vet.cmu.ac.th/cmvj

Research article
Cattle fetal sex determination using cell-free fetal DNA from maternal
blood in the Mekong Delta, Vietnam
Tran Thi Thanh Khuong1* Nguyen Dang Khoa1,4, Nguyen Van Loi1, Tran Van Be Nam 1, Tran Gia Huy1, Nguyen
Trong Ngu2, Lam Phuoc Thanh2, Cao Thi Tai Nguyen3

1
Institute of Food and Biotechnology, Can Tho University, Can Tho 900000, Vietnam
Department of Animal Sciences, College of Agriculture, Can Tho University, Can Tho 900000, Vietnam
2

3
Biology Genetics Department, Faculty of Basic Science, Can Tho University of Medicine and Pharmacy, Can Tho 900000, Vietnam
4
Department of Life Science in Dentistry, School of Dentistry, Pusan National University, Yangsan 50612, Republic of Korea

Abstract
Cell-free fetal DNA (cffDNA) from fetal calves was isolated in the bovine maternal plasma in the fifth week of pregnancy,
accounting for around 10% of the total. Recently, cffDNA has been used as a non-invasive prenatal screening technique for
aneuploidy, genetic disorders in humans, early pregnancy diagnosis, and animal fetal sex determination. This study's objective
was to identify the presence of cffDNA in the blood of 13 dairy cows (11 pregnant, 2 non-pregnant, and 1 unmarred) gathered
from farms in Can Tho, the Mekong Delta, Vietnam. Plasma / Serum cfc-DNA Purification Midi Kit (Product # 55600)
was used to separate cffDNA. Two PCR-designed primers named SRY-137 and GAPDH-109 were employed to amplify
the Y-chromosome-specific sequences SRY and the housekeeping gene GAPDH, respectively. The fetal sex was indicated
by PCR data corresponding to the calf's sex at birth in 11 cases. The study's findings first proved the existence of cell-free
fetal DNA circulating in the plasma of a pregnant cow in Vietnam and established the calf's sex using simple, high-precision
procedures. The use of cffDNA for sex screening brings up the possibility of quickly determining the gender and screening
for genetic diseases in a big herd of cattle and animals with long gestation periods.

Keywords: : Cell-free fetal DNA, Dairy cow, GAPDH, PCR, Plasma, SRY

Corresponding author: Tran Thi Thanh Khuong, Institute of Food and Biotechnology, Can Tho University, Can Tho 900000 Vietnam. Email:
tttkhuong@ctu.edu.vn
Funding; This research was supported by funding from the Scientific Research Fund of Can Tho University, project code: TSV2019-139.
Article history; received manuscript: 05 October 2022
revised manuscript: 15 February 2023

accepted manuscript: 21 April 2023
published online: 12 May 2023
Academic editor; Korakot Nganvongpanit

Open Access Copyright: ©2023 Author (s). This is an open access article distributed under the term of the Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution, and
reproduction in any medium or format, as long as you give appropriate credit to the original author (s) and the source.

Vet Integr Sci Khuong et al., Vet Integr Sci. 2023; 21(3): 657- 665 657
Veterinary Integrative Sciences

INTRODUCTION
Short DNA fragments (about 200-300 bp) circulate freely in blood
plasma and are referred to as cell-free DNA (cfDNA) which are normally
present at a low concentration. The cfDNA was first described properly to be
present in human blood by Mandel and Metais in 1948. Nearly 50 years later,
the blood from a pregnant woman was found to contain cell-free fetal DNA
(cffDNA) (Lo et al., 1998). These short DNA can provide valuable genetic
information about the fetus or pregnancy. This discovery sparked interest in
developing clinical applications based on fetal genetic material analysis for
non-invasive prenatal diagnostics. Following that was the indication in plenty
of other papers and studies on cffDNA that it may be used to screen for and
diagnose fetal genetic disorders during pregnancy (Kelly and Farrimond, 2012;
Bunnik et al., 2020; Kjeldsen-Kragh and Hellberg, 2022).
Aside from human research, there are a number of animal experiments
aimed at determining fetal sex identity. Jimenez and Tarantal (2003a) examined
the amount of cffDNA, the existence of the sex-determining region Y gene
(SRY), and the beta-globin gene in the plasma of Gravid Rhesus monkeys
(Macaca mulatta). The SRY sequences were discovered during the 1st month
of pregnancy and the concentrations of cffDNA increased with gestational
age and peaked at around the last month of pregnancy from day 130 to 160.
Following this work, the research group discovered the existence of fetal DNA
in maternal plasma, presenting a new non-invasive method for prenatal gender
determination. Serum samples were taken from 72 Gravid Rhesus monkeys
between 20 and 32 days of gestation (term 165 ± 10 days) for this investigation.
Real-time PCR (RT-PCR) analysis of rhesus Y-chromosomal DNA sequences
was used to establish fetal gender and the amount of circulating fetal DNA.
By 30 days of pregnancy, the sensitivity for detecting a male fetus was 100%
without false-positive results (Jimenez and Tarantal, 2003b). This study shows
that maternal serum samples can be used to consistently establish fetal gender
in the early first trimester, which is a non-invasive method. Similarly, Yasmin
et al. (2015) employed multiplex quantitative RT-PCR to evaluate cffDNA in
maternal blood serum taken from 46 pregnant monkeys at gestational weeks
5, 12, and 22. Of 28 monkeys with male-bearing pregnancies, the existence
of the SRY gene and DYS14 Y chromosomal sequences was identified.
When comparing to postnatal monkeys, the results validated the SRY and
DYS14 sequences on the Y chromosome in 28 monkeys, obtaining 100% sex
correctness. Since its inception, cffDNA has been used to determine prenatal
fetal sex in a variety of mammals, including cattle (Lemos et al., 2011; da Cruz
et al., 2012; Ristanic et al., 2018), sheep ( Kadivar et al., 2013; Asadpour et al.,
2015), mare (de Leon et al., 2012; Tonekaboni et al., 2020), elephant (Vincze
et al., 2019) and rhinoceros (Stoops et al., 2018). According to da Cruz et al.,
(2012) and Wang et al.(2010), polymerase chain reaction (PCR) analysis of
fetal DNA in maternal plasma of 35 pregnant calves ranging in age from 5 to
35 weeks allowed them to determine the sex of the fetus at various stages of
pregnancy in cows. The fetal sex predicted by this approach 88.6% matched
the calf's sex at delivery. Kadivar et al. (2013) used the ovine maternal plasma
to screen the SRY gene for fetal sex prediction. Vincze et al. (2019) used two
Y-specific markers (AmelY and SRY) to assess fetal sex in elephants. The

Vet Integr Sci Khuong et al., Vet Integr Sci. 2023; 21(3): 657- 665 658
Veterinary Integrative Sciences

presence of these markers suggested a male fetus, while the absence of these
markers indicated a female fetus. In particular, this research has ushered in a
new era in early gender diagnosis in animals with long gestation periods, with
implications for the management of uncommon animal populations. Indeed,
cffDNA has been extensively researched and used in both humans and animals.
In Vietnam, however, the use of cffDNA in animals has not been conducted.
With the purpose of carrying out more research and application in rare and
long-pregnant animals, this study initially attempted to detect cffDNA in
bovine maternal plasma acquired from farms in the Mekong Delta of Vietnam,
and assess fetal sex using a simple, non-invasive method.

MATERIALS AND METHODS

Blood sampling and plasma separation
The experiment was conducted at three dairy cattle farms in Can Tho
city, Vietnam. The pregnant crossbred HF and Lai Sind cows (n=11) at different
stages of gestation (days 84-235) and non-pregnants (n=2) were chosen for this
study. The 8-10 ml blood samples were withdrawn via coccygeal vein using
20G needles and intermediately transferred to BD vacutainer K2E (ref 367525,
UK). All samples were stored at 4°C and intermediately transferred to the
laboratory. The plasma from the blood samples was extracted by centrifuge at
2,000 rpm for 10 minutes, and then stored at -20°C in the laboratory. The study
was conducted with ethical approval for animal care, housing, blood collection
under the Animal Welfare Assessments (BQ2019-02/VNCPTCNSH).

Cell free fetal DNA isolation

Cell free fetal DNA (cffDNA) of 13 dairy cows were isolated from the
plasma samples using the Plasma/Serum cfc-DNA Purification Midi Kit (Cat No.
#55600, Norgen, Canada) according to the manufacturer's instructions. DNA
concentration and purity estimation were evaluated spectrophotometrically
(Nanodrop ND-2000, Nanodrop Technologies, USA).

Designed-primers used in this study

The 137 bp fragment of the SRY gene was amplified using
primer pairs (Table 1) which were self-designed using Primer BLAST
software from NCBI according to the Bos taurus, Bos indicus, and
Bos taurus x Bos indicus sequence: EU294189.1, XM_19956600.1,
KY012736.1, respectively. Similarly, the 109 bp fragment of
the GAPDH gene was amplified using a sequence of cattle:
NM_001034034.2, XM_027541122.1, and XM_019960295.1,
respectively.

Vet Integr Sci Khuong et al., Vet Integr Sci. 2023; 21(3): 657- 665 659
Veterinary Integrative Sciences

Table 1 Sequence of designed primers used in PCR amplification.

Gene Primers Sequence (5-3’) Product size
SRY Forward GTCTCGTGAACGAAGACGAA 137 bp
Reverse GTCTCTGTGCCTCCTCAAAG
GAPDH Forward TCCAAGGAGTAAGGTCCCTG 109 bp
Reverse CAGGAGATTCTCAGTGTGGC

PCR amplification
The C1000 Touch Thermal Cycler (Bio-Rad, USA) was used to conduct
the PCR amplifications for the detection of SRY and GAPDH fragments. The
reaction volume was 20 (10 µL PCR Master Taq Mix 2X, 0.5 µL forward primer,
0.5 µL reverse primer, 7 µL of nuclease-free water, 2 µL DNA template). The
in-house developed amplification was performed using initial denaturation at
94°C for 5 min, followed by 30 cycles with an initial denaturation at 94°C for
40s, the annealing temperature of 58°C for 30s, and extension at 72°C for 30s,
followed by a final extension at 72°C for 5 min. The PCR products were loaded
on 2.0 % agarose gel by electrophoresis and visualized under UV light. The
positive controls were male gDNA samples and negative controls were female
gDNA samples. These gDNA were extracted from meat samples.

RESULTS

cffDNA isolation
The results of cffDNA quantify were showed in Table 2. The A260/
A280 ratio was used to determine the purity of each extracted cffDNA sample.
'Pure' samples were those with a 260/280 ratio of 1.8 to 2.0. The 260/A280 ratio
measurements revealed in this study that the cffDNA samples were of good
quality, ranging from 1.8 to 1.9, and could be used in further PCR experiments.
Regarding the concentration of cffDNA through the spectrophotometric index,
the results showed that cffDNA samples had low concentration (< 200 ng/
µL). Notably, the plasma of cow that was 84 days pregnant yielded a DNA
concentration of 118,5 ng/µL which value can be applied to PCR reactions
as a template. Additionally, these samples of non-pregnant cows with DNA
codes 12 and 13 have low DNA concentrations, at 53,7 ng/µL and 50,2 ng/µL,
respectively.

Table 2 Concentration and purity estimation were evaluated spectrophotometrically of DNA

isolated from maternal plasma

DNA code 1 2 3 4 5 6 7 8 9 10 11 12 13
Acid nucleic
73.9 116.9 118.5 99.8 80 82.7 89 61.6 87.6 82.2 90.7 53.7 50.2
(ng/µL)
A260/A280 1.8 1.8 1.8 1.9 1.9 1.8 1.9 1.9 1.9 1.9 1.8 1.8 1.9
Note P P P P P P P P P P P NP U

P: Pregnant, NP: Non-pregnant, U: Unmarred

Vet Integr Sci Khuong et al., Vet Integr Sci. 2023; 21(3): 657- 665 660
Veterinary Integrative Sciences

PCR amplification of GAPDH and SRY gene fragments

On the acquired cffDNA samples, the SRY and GAPDH genes were
amplified. The findings of electrophoresis on 2 % agarose gel demonstrated
that the PCR products successfully amplified the SRY and GAPDH genes on
cffDNA (Figure 1 and 2). The band size of SRY and GAPDH genes are 137 pb
and 109 pb, respectively. All samples including the cffDNA samples and the
control gDNA samples were positive for the GAPDH gene as shown in Figure
1 The results Figure 2 revealed that 9 of the 13 lanes (Figure 1, lanes 2, 3, and
5 to 11) were positive for the SRY gene, while 4 samples were negative (Figure
1, lane 1, 4 for 11 of pregnant cows, 12, and 13: cffDNA samples of non-
pregnant and unmarred cow, respectively). Nine pregnant cows were expected
to produce male calves based on PCR results, whereas two were anticipated to
have female calves. The genders of the newborn calves that were recorded at
the farm after calving were 100% the same including male and female calves
as those predicted by the cffDNA test, as shown in Table 3.

Table 3 Summary of correlations between cffDNA-based PCR pre-determined calves' sex and
postnatally determined real sex.
Sex after birth Numbers of case SRY gene DNA code
expression
Male 9/11 Positive 2, 3, 5, 6, 7, 8, 9, 10, 11
Female 2/11 Negative 1, 4

Figure 1 Agarose gel 2% electrophoresis of the GAPDH gene-PCR products from

cffDNA, 50V for 30 minutes (L: DNA ladder, (-): Negative control, M: male gDNA
sample, F: Female gDNA sample, lane: 1 – 11: cffDNA samples 11 of pregnant cows,
12: cffDNA samples of non-pregnant cow, 13: cffDNA samples of unmarred cow)

Figure 2 Agarose gel 2% electrophoresis of the SRY gene-PCR products from

cffDNA, 50V for 30 minutes. (L: DNA ladder, (-): Negative control, M: male gDNA
sample, F: Female gDNA sample, lane: 1 – 11: cffDNA samples 11 of pregnant cows,
12: cffDNA samples of non-pregnant cows, 13: cffDNA samples of unmarred cows)

Vet Integr Sci Khuong et al., Vet Integr Sci. 2023; 21(3): 657- 665 661
Veterinary Integrative Sciences

DISCUSSION
Cell-free fetal DNA is derived from fetal and/or placental cells that
undergo apoptosis, hence the concentration of cffDNA is potentially low. In
this investigation, the cffDNA concentration in bovine maternal blood was
low. This conclusion was in line with the findings of other investigations (da
Cruz et al., 2012; Ershova et al., 2017). Because samples 12 and 13 were from
non-pregnant cows, there was a lower concentration than in the other samples,
indicating that no cffDNA from a fetal calf was collected. The variation in
cffDNA concentration is dependent on several factors, including the stage of
pregnancy, health circumstances, and cow species (Wang et al., 2010; Lemos
et al., 2011;).
Primary sex determination in mammals is purely chromosomal. The sex-
determining region Y gene is responsible for the formation of male phenotypes.
According to Koopman et al. (1991), the existence of this Y chromosomal
region causes proper male development. The SRY gene was employed as a
molecular marker to determine the sex of the bovine fetus in this study. The
designed SRY 137 primers were developed to exclusively amplify the 137-
bp SRY gene. In animals, this marker was commonly employed to determine
fetal sex using cffDNA (Kadivar et al., 2013; Stoops et al., 2018; Vincze et al.,
2019).
To minimize false positives caused by the lack of SRY amplification
in the female fetus, we employed the GAPDH gene as a housekeeping gene
and performed PCR in both male and female bovine gDNA. Negative controls
included nuclease-free water samples as well as female gDNA samples. The
electrophoresis PCR findings indicated that PCR products amplifying the
GAPDH gene showed 15/15 (13 cffDNA samples, 1 female gDNA sample, 1
male gDNA sample) were positive at 109 bp, which is the size of the GAPDH
gene. Along with SRY, this housekeeping marker was utilized as an internal
control in humans, horses, and cattle (Robinson et al., 2007; Kazachkova et al.,
2019; Kadivar et al., 2021).
Crossbreeding between HF cows and indigenous beef breeds results
in dairy cows on farms in Vietnam (Nguyen et al., 2022). Even though bovine
SRY and GAPDH sequences have been extensively studied globally, the
genomic DNA samples we acquired from the farms in the Mekong Delta do
not respond to the primer pairs used to detect these two sequences. Thus, we
developed primer pairs to identify SRY and GADPH processes for dairy cows
and beef cattle grown in our area. This is the first study in bovine SRY, GAPDH
sequences, and fetal gender based on cffDNA to be conducted in Vietnam.
Animal production, care, nutrition, breeding, and genetics all benefit from
fetal gender prediction (Stévant et al., 2018). Furthermore, using cffDNA for
prenatal sex diagnosis is a simple and reliable procedure. Hundreds of samples
can be analyzed quickly by taking blood from cows, rendering this diagnosis
appropriate for intensive dairy farms and helping to overcome the limits of
manual or ultrasonic examination methods. CffDNA also creates the potential
for study and applications in the early detection of genetic abnormalities in
cattle and animals with long gestation periods.

Vet Integr Sci Khuong et al., Vet Integr Sci. 2023; 21(3): 657- 665 662
Veterinary Integrative Sciences

One limitation of the study is the relatively small sample size, which may
limit the generalizability of the findings. Additionally, the study only focused
on the use of cffDNA for fetal sex determination and did not investigate the use
of cffDNA for genetic disease screening. However, the strengths of the study
include its non-invasive approach to fetal sex determination and the successful
isolation of cffDNA in the blood of pregnant cows in Vietnam. These findings
suggest that cffDNA-based sex determination could be a reliable and practical
method for cattle farmers and veterinarians in the Mekong Delta region and
beyond.

CONCLUSIONS

High-purity cell-free fetal DNA could be isolated from the maternal

peripheral blood of pregnant cows at different stages of gestation (days 84 -
235). With universal designed primers, the results of the PCR product on the
SRY gene and the housekeeping gene GAPDH gene exhibited obvious bands
on both gDNA and cffDNA. The results match the actual sex results of calves
after delivery (9/13 male calves, 4/13 female calves). It is concluded from this
study that cffDNA extracted from the blood of pregnant cows can accurately
determine fetal sex using PCR.

ACKNOWLEDGEMENTS
This research was supported by funding from the Scientific Research
Fund of Can Tho University, project code: TSV2019-139.

AUTHOR CONTRIBUTIONS
This work was conducted with contribution of all authors. TTTK,
NDK, NVL, and CTTN designed the experimental procedures. TTTK, NVL,
TVBN, and TGH performed the experiments. TTTK, NTN and LPT interpreted
the data and prepared the manuscript. All authors read and approved the final
manuscript

CONFLICT OF INTEREST
Regarding the publishing of this article, the authors declare that there
are no conflicts of interest.

Vet Integr Sci Khuong et al., Vet Integr Sci. 2023; 21(3): 657- 665 663
Veterinary Integrative Sciences

REFERENCES
Asadpour, R., Asadi, M., Jafari-Joozani, R., Hamidian, G., 2015. Ovine fetal sex determination
using circulating cell-free fetal DNA (ccffDNA) and cervical mucous secretions.
Asian. Pac. J. Reprod. 4(1), 65-69.
Bunnik, E.M., Kater-Kuipers, A., Galjaard, R.J. H., de Beaufort, I.D., 2020. Should pregnant
women be charged for non-invasive prenatal screening? Implications for reproductive
autonomy and equal access. J. Med. Ethics. 46(3), 194-198.
da Cruz, A.S., Silva, D.C., Costa, E.O.A., De M-Jr., P., da Silva, C.C., Silva, D.M., da Cruz,
A.D., 2012. Cattle fetal sex determination by polymerase chain reaction using DNA
isolated from maternal plasma. Anim. Reprod. Sci. 131(1-2), 49-53.
de Leon, P.M.M., Campos, V.F., Dellagostin, O.A., Deschamps, J.C., Seixas, F.K., Collares,
T., 2012. Equine fetal sex determination using circulating cell-free fetal DNA
(ccffDNA). Theriogenology. 77(3), 694-698.
Ershova, E., Sergeeva, V., Klimenko, M., Avetisova, K., Klimenko, P., Kostyuk, E., Veiko, N.,
Veiko, R., Izevskaya, V., Kutsev, S., Kostyuk, S., 2017. Circulating cell-free DNA
concentration and DNase I activity of peripheral blood plasma change in case of
pregnancy with intrauterine growth restriction compared to normal pregnancy.
Biomed. Rep. 7(4), 319-324.
Jimenez, D.F., Tarantal, A.F., 2003a. Quantitative analysis of male fetal DNA in maternal
serum of gravid rhesus monkeys (Macaca mulatta). Pediatr. Res. 53(1), 18-23.
Jimenez, D.F., Tarantal, A.F., 2003b. Fetal gender determination in early first trimester
pregnancies of rhesus monkeys (Macaca mulatta) by fluorescent PCR analysis of
maternal serum. J. Med. Primatol. 32(6), 315-319.
Kadivar, A., Hassanpour, H., Mirshokraei, P., Azari, M., Gholamhosseini, K., Karami, A, 2013.
Detection and quantification of cell-free fetal DNA in ovine maternal plasma; use it
to predict fetal sex. Theriogenology. 79(6), 995-1000.
Kadivar, A., Rashidzadeh, H., Davoodian, N., Nazari, H., Dehghani Tafti, R., Heidari Khoei,
H., Seidi Samani, H., Modaresi, J., Ahmadi, E, 2021. Evaluation of the efficiency of
TaqMan duplex real‐time PCR assay for non‐invasive pre‐natal assessment of foetal
sex in equine. Reprod. Domest. Anim. 56(2), 287-291.
Kazachkova, N., Gontar, J., Verlinsky, O., Ilyin, I., 2019. Successful early fetal sex determination
using cell-free fetal DNA isolated from maternal capillary blood: a pilot study. Eur. J.
Obstet. Gynecol. Reprod. Biol. X. 3, 100038.
Kelly, S.E., Farrimond, H.R., 2012. Non-invasive prenatal genetic testing: a study of public
attitudes. Public. Health. Genom. 15(2), 73-81.
Kjeldsen-Kragh, J., Hellberg, Å, 2022. Noninvasive prenatal testing in immunohematology -
clinical, technical and ethical considerations. J. Clin. Med. 11(10), 2877.
Koopman, P., Gubbay, J., Vivian, N., Goodfellow, P., Lovell-Badge, R., 1991. Male
development of chromosomally female mice transgenic for Sry. Nature. 351(6322),
117-121.
Lemos, D.C., Takeuchi, P.L., Rios, Á.F.L., Araújo, A., Lemos, H.C., Ramos, E.S., 2011.
Bovine fetal DNA in the maternal circulation: Applications and implications. Placenta.
32(11), 912-913.
Lo, Y.M.D., Hjelm, N.M., Fidler, C., Sargent, I.L., Murphy, M.F., Chamberlain, P.F., Poon,
P.M.K., Redman, C.W.G., Wainscoat, J.S, 1998. Prenatal diagnosis of fetal RhD
status by molecular analysis of maternal plasma. N. Engl. J. Med. 339(24),
1734-1738.
Thuan, N.K., Lam, N.T., Chien, N.T.P., Khanh, N.P., Bich, T.N., 2022. Prevalence of antibiotic
resistance genes and genetic relationship of Escherichia coli serotype O45, O113,
O121, and O157 isolated from cattle in the Mekong Delta, Vietnam. Vet. Integr. Sci.
20(3), 695-707.
Ristanic, M., Stanisic, L., Maletic, M., Glavinic, U., Draskovic, V., Aleksic, N., Stanimirovic,
Z., 2018. Bovine foetal sex determination - Different DNA extraction and amplification
approaches for efficient livestock production. Reprod. Domest. Anim. 53(4),
947-954.
Robinson, T.L., Sutherland, I.A., Sutherland, J., 2007. Validation of candidate bovine reference
genes for use with real-time PCR. Vet. Immunol. Immunopathol. 115(1-2), 160-165.
Stévant, I., Papaioannou, M.D., Nef, S., 2018. A brief history of sex determination. Mol. Cell.
Endocrinol. 468, 3-10.
Vet Integr Sci Khuong et al., Vet Integr Sci. 2023; 21(3): 657- 665 664
Veterinary Integrative Sciences

Stoops, M.A., Winget, G.D., De Chant, C.J., Ball, R.L., Roth, T.L, 2018. Early fetal sexing in
the rhinoceros by detection of male-specific genes in maternal serum. Mol. Reprod.
Dev. 85(3), 197-204.
Tonekaboni, F.R., Narenjisani, R., Staji, H., Ahmadi-Hamedani, M., 2020. Comparison of
cell-free fetal DNA plasma content used to sex determination between three trimesters
of pregnancy in torkaman pregnant mare. J. Equine Vet. Sci. 95, 103273.
Vincze, B., Gáspárdy, A., Biácsi, A., Papp, E.Á., Garamvölgyi, L., Sós, E., Cseh, S., Kovács,
G., Pádár, Z., Zenke, P., 2019. Sex determination using circulating cell-free fetal DNA
in small volume of maternal plasma in elephants. Sci. Rep. 9(1), 15254.
Wang, G., Cui, Q., Cheng, K., Zhang, X., Xing, G., Wu, S., 2010. Prediction of fetal sex by
amplification of fetal dna present in cow plasma. J. Reprod. Dev. 56(6), 639-642.
Yasmin, L., Takano, J.I., Nagai, Y., Otsuki, J., Sankai, T., 2015. Detection and quantification of
male-specific fetal DNA in the serum of pregnant cynomolgus monkeys (Macaca
fascicularis). Comp Med. 65(1), 70-76.

How to cite this article;

Khuong, T.T.T., Khoa, N.D., Loi, N.V., Nam, T.V.B., Huy, T.G., Ngu, N.T., Thanh, L.P., Nguyen,
C.T.T. Cattle fetal sex determination using cell-free fetal DNA from maternal blood in the
Mekong Delta, Vietnam. Veterinary Integrative Sciences. 2023; 21(3): 657- 665.

Vet Integr Sci Khuong et al., Vet Integr Sci. 2023; 21(3): 657- 665 665
Veterinary Integrative Sciences

Veterinary Integrative Sciences 2023; 21(3): 783 - 797 DOI; 10.12982/VIS.2023.055

Vet Integr Sci

Veterinary Integrative Sciences
ISSN; 2629-9968 (online)
Website; www.vet.cmu.ac.th/cmvj

Research article
Identification of prevalence and antibiotic resistance property as
a basis for establishing an efficient treatment of bacteria causing
mastitis in beef cows
Tran Hoang Diep1, Nguyen Trong Ngu2*
1
Department of Animal and Veterinary Science, Faculty of Agriculture and Food Technology, Tien Giang University,
My Tho 84100 Vietnam
2Faculty of Animal Sciences, College of Agriculture, Can Tho University, Can Tho 900000, Vietnam

Abstract
The purpose of the study was to examine the occurrence of metritis on reproduction of beef cows. A total of 2,962 cows were
examined, and samples were collected from those displaying clinical symptoms of bovine metritis for bacterial analysis.
Bacterial species identification was performed using culture and PCR techniques. The findings revealed that bovine metritis
affected 5.5% of the reproductive cow population with the presence of Streptococcus spp., Staphylococcus aureus, Escherichia
coli, and Salmonella spp. at the rates of 87.7%, 61.1%, 59.9% and 17.3%, respectively. The results also demonstrated that
Streptococcus spp. was the most prevalent group, while Salmonella spp. had the lowest prevalence across different breeds
and litters. However, in the Limousin crossbred cows, the infection rate of E. coli surpassed that of the other bacteria and a
significantly higher infection rate for E. coli was observed in litter 4 and litter ≥6 compared to the others. The disk diffusion
method was utilized to assess antibiotic resistance patterns of the isolated bacteria. Among the bacteria, marbofloxacin
exhibited the lowest prevalence of antibiotic resistance (16.9%), while doxycycline had the highest prevalence (82.2%). All
cows recovered from the disease within 3-5 days of treatment, and all of them resumed estrus in the subsequent reproductive
cycle. The pregnancy rate ranged from 66.7% to 80.0% for the first insemination in the next reproductive cycle.

Keywords: Bovine metritis, Escherichia coli, S. aureus, Salmonella spp., Streptococcus spp.

Corresponding author: Nguyen Trong Ngu, Faculty of Animal Sciences, College of Agriculture, Can Tho University, Can Tho 900000, Vietnam. Email:
ntngu@ctu.edu.vn

Funding; This study was financially supported by The Department of Science and Technology of Tien Giang Province (Grant No. DTNN 04/19).
Article history; received manuscript: 15 January 2023,
revised manuscript: 20 May 2023

accepted manuscript: 29 May 2023
published online: 9 June 2023
Academic editor; Korakot Nganvongpanit

Open Access Copyright: ©2023 Author (s). This is an open access article distributed under the term of the Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution, and
reproduction in any medium or format, as long as you give appropriate credit to the original author (s) and the source.

Vet Integr Sci Diep and Ngu, Vet Integr Sci. 2023; 21(3): 783 - 797 783
Veterinary Integrative Sciences

INTRODUCTION
Bovine metritis is a common disease in reproductive cows, and the
consequences often lead to reproductive disorders, delayed birth, infertility
and loss of milk (Sheldon and Dobson, 2004; Le Blanc, 2008). Hansen et al.
(2013) demonstrated that the development of metritis or endometritis in some
cows might be caused by the exposure to a high amount of bacteria during the
calving process than others. Further, Staphylococcus spp., Streptococcus spp.,
and Escherichia coli (E. coli) were widely accepted as the dominant bacteria
in the uterus. Among them, E. coli was unanimously regarded as the most
predominant bacteria (Baishya et al., 1998; Sheldon et al., 2004; Williams et
al., 2005; Wagener et al., 2014; Abreham et al., 2017). These bacteria were
found in the uterine environment of cows after calving in more than 95% of
cases (Sheldon and Dobson, 2004). In particular, the bacteria are detected in
the uterus from the first week after the birth of 90% of reproduction cows
(Sheldon et al., 2002). Usually, cows are susceptible to bacteria such as E. coli,
Salmonella spp., Staphylococcus spp., Streptococcus spp., etc. These bacteria
enter and colonise in the genital tract, and under favorable conditions, they will
proliferate to a sufficient quantity to cause diseases in cattle.
Recently, Madhumeet et al. (2018) revealed that the bacteria were found
in 22 out of 24 endometritis cows (91.7%). Among them, the most frequent were
Streptococcus spp. and E. coli (20.8% each), followed by S. aureus (12.5%),
and none of Salmonella spp. was found. A study by Moges et al. (2013) revealed
the presence of E. coli, Streptococcus spp., Staphylococcus aureus (S. aureus),
and some other bacteria in the inflammatory fluid of metritis cows. In addition,
Yang et al. (2016) revealed that cow uterine could be damaged easily during
the parturition process and the regular existence of E. coli was triggering and
prolonging the inflammation of the uterus. This phenomenon leads to high
economic losses due to prolonged calving cycles, lower conception rates, and
increased elimination rates. As a consequence, bovine metritis can result in
economic losses of farmers, and it is also one of the reasons hindering the
development of the herd in terms of both quantity and quality (Bromfield et al.,
2015).
According to Sheldon et al. (2006), the damage to reproductive ability
depends on the characteristics of the bacteria population, severity of infection,
and duration of inflammation. Therefore, antibiotics were used commonly
for the treatment of the bacteria causing metritis to shorten the inflammation
stage (Singh et al., 2014). However, the excessive and indiscriminate use of
antibiotics to treat bacterial infections in the uterus has led to the emergence of
antibiotic-resistant strains. Indeed, antibiotic overuse has resulted in multiple
drug resistance and increased the proportion of mortality (Gurunathan, 2015;
Yah and Simate, 2015). Furthermore, this increased risk of antimicrobial
resistance leads to less effective conventional treatments. The focus of the
current study is to identify the causative bacteria by isolating them from the
inflammatory fluid in the uterus of beef cows, which enables the evaluation of
antibiotic resistance patterns and the proposal of effective treaments.

Vet Integr Sci Diep and Ngu, Vet Integr Sci. 2023; 21(3): 783 - 797 784
Veterinary Integrative Sciences

MATERIALS AND METHODS

Collecting and preserving samples

Samples of uterine swab fluids were collected from metritis-affected
beef cows in Tien Giang province, Vietnam, for the purpose of isolating and
identifying bacteria. A total of 2,962 cows from different breeds and litters were
investigated and samples of suspected cows were collected during estrous. All
inflammatory fluid samples were collected before antibiotic administration.
The sample collection process was applied as follows: (1) wiped the vulva
area with a tissue and disinfected with 70° alcohols, (2) inserted a sterilized
colposcope into the cow's vagina, (3) pushed a sterilized swab through these
tools to collect pus. The swabs were stored in a test tube containing the storage
medium and later the samples were refrigerated at 2°C to 8°C until bacteria
isolation and identification (Moriarty et al., 2008; Bicalho et al., 2017).

Bacterial isolation
In the first step after collection, the samples were proliferated in
Nutrient Broth (NB) and NB supplemented with 5% sheep blood. The isolation
of specific bacteria was conducted using a specialized medium, such as E. coli
on Tryptone Bile X-glucuronide agar (TBX, Blake et al., 2003), Salmonella
spp. on Mannitol Lysine Crystal Violet Brilliant green (MLCB)/Xylose Lysine
Desoxycholate (XLD) (Yoshihiko et al., 2000), S. aureus on Mannitol Salt Agar
(MSA) (Kateete et al., 2010), and Streptococcus spp. on Selective Strep Agar
with 5% Sheep Blood (Jorgensen et al., 2015). When typical colonies were
obtained, the selected colonies were cultured on Trypticase Soy Agar (TSA)
medium for a second proliferation. The isolated bacteria including Salmonella
spp., S. aureus, and Streptococcus spp. were then re-confirmed by Polymerase
Chain Reaction (PCR) technique.

Identification of Salmonella spp., S. aureus, and Streptococcus

spp. by PCR technique
Bacterial DNA was extracted using the heat shock method of Soumet
et al. (1994). The primers used to amplify the specific genes of S. aureus
(Nuc-F 5’-GCGATTGATGGTGATACGGTT-3’; Nuc-R 5’-AGCCAA
GCCTTGACGAACTAAAGC-3’), Salmonella spp. (invA-F 5’-GTGAAA
TTATCGCCACGTTCGGGCAA-3’; invA-R 5’-TCATCGCACCGTCAA
AGGAACC-3’), and Streptococcus spp. (Str-F 5’-GTACAGTTGCTTCAG
GACGTATC-3’; Str-R 5’-ACGTTCGATTTCATCACGTTG-3’) were picked
up from Brakstad et al. (1992), Zahraei et al. (2005), and Irmler et al. (2009).
PCR products were electrophoresed on 1.5% agarose gel at 110 V, 400 mA for
15 minutes and the images were visualized under a UV light.

Antibiogram method
Antibiogram was performed based on the method of Kirby-Bauer,
(1996) and the sensitivity of antibiotics resistance bacteria was determined by
the zone of inhibition around the antibiotic-impregnated disks (CLSI, 2008).
The antibiotics were ampicillin 10 μg (Am), colistin 10 μg (Co), doxycycline 30
μg (Dx), gentamicin 10 μg (Ge), ceftiofur 30 μg (FUR30), marbofloxacin 5 μg

Vet Integr Sci Diep and Ngu, Vet Integr Sci. 2023; 21(3): 783 - 797 785
Veterinary Integrative Sciences

(MAR5), and florfenicol 30 μg (FFC30). After being taken out from the freezer,
antibiotics must be thawed for 15 to 30 minutes before administration.
Purely cultured colonies were placed in a tube containing 9 ml of 0.9%
NaCl, and the mixture was adjusted for a concentration of 108 CFU/ml. Spread
100 µl of the above mixture evenly on the surface of the Mueller-Hinton Agar
(MHA) and placed the antibiotic-impregnated disks in full contact with the agar
surface (minimum distance 24 mm) followed by incubating at 37°C for 16-24
hours. In case of Streptococcus spp., the MHA was added with 5% sheep blood
and incubated for 24 hours under anaerobic conditions at 37°C. The diameters
of inhibition zones (mm) were measured and compared with CLSI (2010,
2016), EUCAST (2017), and BSAC (2013) to determine whether the antibiotic
resistance profile was sensitive (S), intermediate (I), or resistance (R).

Treatment regimen
Two antibiotics with the highest sensitivity were selected and combined
with the other supplements to optimize their effectiveness. Regimen A (30
animals), marbofloxacin in combination with 0.2% rivanol, ADE vitamin,
and anti-inflammatory dexamethasone. Regimen B (30 animals): Gentamycin
intramuscularly in combination with prostaglandin, ADE vitamin, and anti-
inflammatory dexamethasone. Sixty cows with metritis were used for two
treatment regimens within 3-5 days. After being treated, cows were confirmed
to have recovered from metritis if the following signs were observed: no
more inflammatory discharge from the vagina after 3-5 days of treatment, no
inflammatory fluid oozing from the uterus when dilated in the next breeding
cycle. Later, pregnancy was confirmed after artificial insemination by the
following signs: no estrous in the next cycle, ultrasound confirmation at 32
days, and rectal examination at 60 days.
Two highly sensitive antibiotics were chosen and combined with
additional supplements to enhance their effectiveness. Regimen A included
marbofloxacin along with 0.2% rivanol, ADE vitamin, and the anti-
inflammatory dexamethasone. Regimen B involved the intramuscular
administration of gentamycin combined with prostaglandin, ADE vitamin,
and the anti-inflammatory dexamethasone. A total of 60 cows (30 animals /
regimen) with metritis were treated using these two regimens for a duration of
3-5 days. Recovery from metritis was confirmed based on specific indicators
including the absence of inflammatory discharge from the vagina after the
treatment period and no inflammatory fluid leaking from the uterus during
dilation in the subsequent breeding cycle. Subsequently, pregnancy was
confirmed by evaluating signs such as the absence of estrus in the following
cycle, ultrasound confirmation at 32 days, and rectal examination at 60 days.

Statistical analysis
Data were collected, coded, and processed using Microsoft excel 2016.
The prevalence of pathogenic bacteria groups was calculated by dividing the
cows that were positive for the bacteria by the total number of cows. Statistical
differences in the prevalence of bacteria were tested using the Chi-square and
Fisher's exact test in the Minitab (version 16.0) software.

Vet Integr Sci Diep and Ngu, Vet Integr Sci. 2023; 21(3): 783 - 797 786
Veterinary Integrative Sciences

RESULTS
Prevalence of bovine metritis
In reproductive beef cows, the prevalence of bovine metritis was
determined to be 162 out of 2,962 individuals, accounting for 5.5% of the total.
Streptococcus spp. (87.7%), S. aureus (61.1%), and E. coli (59.9%) were the
most commonly identified bacteria in the uterine fluid of 162 affected cows.
Non-permanent bacteria in bovine metritis Salmonella spp. constituted 17.3%
of the whole (Figure 1).

Figure 1 Prevalence (%) of bacteria groups in clinical samples

Bacteria prevalence by breed

The findings of bacterial isolation from samples of inflammatory
fluid by breeds are shown in Table 1. Except for the BBB crossbred cattle,
the prevalence of bacteria groups detected in other breeds differs statistically
(P≤0.05). In detail, Streptococcus spp. ranged in incidence from 82.2% to
95.8%, followed by Staphylococcus spp. (52.9%-71.4%), E. coli (42.1%-
100%), and Salmonella spp. (0.0%-29.8%).

Table 1 Prevalence (%) of metritis-associated bacteria in different cattle breeds

Bacteria
Breed P
E. coli Sal Sta Strep
Crossbred BBB (n=8) 62.5 37.5 75.0 75.0 0.362
Crossbred Brahman (n=24) 66.7 b
29.2 c
54.2 bc
95.8a
0.000
Crossbred Charolais (n=35) 68.6 ab
20.0 c
57.1 b
85.7a
0.000
Crossbred Sindhi (n=34) 44.1 b
8.82 c
52.9 b
88.2a
0.000
Crossbred Limousin (n=7) 100 a
28.6 b
71.4 ab
85.7a
0.020
Crossbred Red Angus (n=35) 62.9 a
17.1 b
71.4 a
82.9a
0.000
Local cattle (n=19) 42.1 b
0.0c
63.2 b
94.7a
0.000
: Values within a row with different superscripts are significantly different (P≤0.05); Sal: Salmonella,
a,b,c

Sta: Staphylococcus, Strep: Streptococcus

Vet Integr Sci Diep and Ngu, Vet Integr Sci. 2023; 21(3): 783 - 797 787
Veterinary Integrative Sciences

Bacteria coinfection by breed

The analysis of the bacteria examined revealed that there was no
significant difference in coinfection rates among the different breed groups.
However, a notable distinction was observed in the coinfection of bacteria
groups in most specific breeds, except for Brahman and Limousin crossbred
cows. Table 2 displays the findings indicating that the highest proportion of
bacterial infections was observed in BBB, Charolais, Red Angus crossbred and
local cows, with two groups of bacteria being the most prevalent.
Table 2 Bacteria coinfection by breed
No. of bacteria group in the coinfection
Breed P
1 2 3 4
Crossbred BBB (n=8) 0.0b 50.0a 50.0a 0.0b 0.014
Crossbred Brahman (n=24) 16.7 37.5 29.2 16.7 0.261
Crossbred Charolais (n=35) 17.1 b
40.0 a
37.1 ab
5.71 c
0.002
Crossbred Sindhi (n=34) 32.4 a
41.2 a
26.5 a
0.0 b
0.001
Crossbred Limousin (n=7) 0.0 28.6 57.1 14.3 0.083
Crossbred Red Angus (n=35) 8.6 b
57.1 a
25.7 b
8.6 b
0.000
Local cattle (n=19) 21.1 b
57.9 a
21.1 b
0.0 c
0.001
: Values within a row with different superscripts are significantly different (P≤0.05)
a,b,c

1 group: single infection of E. coli or Salmonella or Staphylococcus or Streptococcus

2 groups: coinfection of two bacteria
3 groups: coinfection of three bacteria
4 groups: coinfection of four bacteria

Bacteria prevalence by litter

Table 3 presents the results of bacterial isolation from inflammatory
fluid obtained from metritis cows, categorized by litter. The findings indicated
that the presence of E. coli, Salmonella spp., Streptococcus spp., and S. aureus
in clinical samples varied significantly across different litters. Among them,
the highest prevalence was Streptococcus spp. (75-100%), followed by S.
aureus (47.4-70.0%), E. coli (45.0-68.4%), and the lowest was Salmonella spp.
(5.3-66.7%). At litter ≥6, the highest prevalence was still Streptococcus spp.
(89.5%), but the presence of E. coli increased (68.4%) compared to S. aureus
(47.4%), and the lowest was still Salmonella spp. (5.3%). It can be seen that
cows in litters 1, 2, and 3 have higher prevalence of bacteria causing metritis
than cows in litters 4 and ≥5.
Table 3 Prevalence of bacteria groups in metritis cows by litter
Bacteria
Parity P
E. coli Sal Sta Strep
Heifers (n=6) 66.7 66.7 83.3 83.3 0.828
Litter 1 (n=20) 45.0 b
20.0 c
70.0bc
100 a
0.000
Litter 2 (n=44) 54.4 b
20.5 c
63.6 b
90.9 a
0.000
Litter 3 (n=36) 66.7 b
13.9 c
63.9 b
86.1 a
0.000
Litter 4 (n=25) 68.0 a
12.0 b
56.0 a
80.0 a
0.000
Litter 5 (n=12) 50.0 ab
16.7 b
50.0ab
75.0 a
0.041
≥ Litter 6 (n=19) 68.4 b
5.26 b
47.4 b
89.5 a
0.000
: Values within a row with different superscripts are significantly different (P≤0.05);
a,b,c

Sal: Salmonella, Sta: Staphylococcus, Strep: Streptococcus

Vet Integr Sci Diep and Ngu, Vet Integr Sci. 2023; 21(3): 783 - 797 788
Veterinary Integrative Sciences

Bacteria coinfection by litter

The results on coinfection rates of bacterial groups by litter are presented
in Table 4. Except for the 5th litter, a significant difference was observed among
the groups. In heifers, the coinfection was recorded only by 2 and 4 bacteria
with a rate of 50%. For the remaining litters, coinfection by two bacteria groups
was highest, followed by three groups, the lowest was one group and four
groups.

Table 4 Bacteria coinfection by litter

No. of bacteria group in the coinfection
Litter P
1 2 3 4
Heifers (n=6) 0 (0.00)b 3 (50.0)a 0 (0.00)b 3 (50.0)a 0.046
Litter 1 (n=20) 1 (5.00) b
12 (60.0) a
6 (30.0) a
1 (5.00) b
0.000
Litter 2 (n=44) 7 (15.9) b
19 (43.2) a
16 (36.4) a
2 (4.55) b
0.000
Litter 3 (n=36) 5 (13.9) b
17 (47.2) a
12 (33.3) a
2 (5.56) b
0.000
Litter 4 (n=25) 6 (24.0) a
10 (40.0) a
8 (32.0) a
1 (4.00) b
0.023
Litter 5 (n=12) 5 (41.7) 4 (33.3) 2 (16.7) 1 (8.33) 0.217
≥ Litter 6 (n=19) 4 (21.1) a
9 (47.4) a
6 (31.6) a
0 (0.00) b
0.007
: Values within a row with different superscripts are significantly different (P≤0.05)
a,b,c

1 group: single infection of E. coli or Salmonella or Staphylococcus or Streptococcus

2 groups: coinfection of two bacterial
3 groups: coinfection of three bacterial
4 groups: coinfection of four bacterial

Antibiotic resistance patterns of bacterial groups

The findings from Table 5 indicate that the bacteria in the inflammatory
fluid of cows display the highest resistance rate (66.6%) to Co, which is
significantly different from the resistance rates observed for other antibiotics
(P<0.001). It is followed by FUR30 (57.9%), Am (45.2%), DX (40.7%),
FFC30 (29.2%), Ge (24.9%) and the lowest MAR5 (16.9) %). The above
results showed that the bacteria strains were highly resistant to Co, whereas
these bacteria were relatively sensitive to MAR5. Furthermore, a notable and
statistically significant difference was observed in the antibiotic resistance
patterns among the various groups of bacteria, except for MAR5 and FUR30.
However, it is worth noting that the resistance of bacteria groups to FUR30
was relatively high (36.7-62.6%). Conversely, the resistance of bacteria groups
to MAR5 was relatively low (6.7-19.7%, and it was the lowest among most
bacteria groups. Therefore, this antibiotic group should be considered more in
the treatment process.

Vet Integr Sci Diep and Ngu, Vet Integr Sci. 2023; 21(3): 783 - 797 789
Veterinary Integrative Sciences

Table 5 Antibiotic resistance patterns of infected bacteria

Bacteria
Antibiotic E. coli Sta Strep Total P
Sal (n=30)
(n=115) (n=117) (n=163) (n=425)
Am C
33.9c B
56.7a AB
45.3b C
50.9a C
45.2 0.022
Dx D
13.0c BC
50.0 b E
7.7c A
82.2 a C
40.7 0.000
Ge C
31.3a C
26.7 a CD
29.9 a D
16.6b D
124.9 0.017
FUR30 B
57.4 BC
36.7 A
57.3 B
62.6 B
57.9 0.071
Co A
79.1a A
86.7a C
31.6b A
79.1a A
66.6 0.000
FFC30 C
31.3a BC
46.7 a BC
34.2 a D
20.9b D
29.2 0.009
MAR5 D
13.9 D
6.7 D
19.7 D
19.0 E
16.9 0.249
P 0.000 0.000 0.000 0.000 0.000
: Values within a row with different superscripts are significantly different (P≤0.05)
a, b, c

: Values within a column with different superscripts are significantly different (P≤0.05)
A, B, C, D, E

Sal: Salmonella, Sta: Staphylococcus, Strep: Streptococcus, Am: Ampicillin, FUR30: Ceftiofur, Co:
Colistin, Dx: Doxycycline, FFC30: Florfenicol, Ge: Getamicin, MAR5: Marbofloxacin.

For Am antibiotic, Salmonella is the most resistant bacteria (56.7%),

followed by Streptococcus spp. (50.9%), Staphylococcus spp. (45.3%), and the
lowest E. coli (33.9%). Similarly, for Co and FFC30 antibiotics, Salmonella
spp. showed the highest resistance, the lowest resistance was Staphylococcus
spp. (Co) and Streptococcus spp. (FFC30). For the Dx antibiotic, the highest
resistance was Streptococcus spp., followed by Salmonella spp., and the lowest
was Staphylococcus spp. Antibiotics Ge, E. coli showed the highest resistance
rate, followed by Staphylococcus spp., and the lowest was Streptococcus spp.
In the present study, E. coli was resistant to Ge at 31.3%, while the FUR30
resistance rate was 57.4%.
Regimens and results of treatment for bovine metritis
Based on the results of the antibiogram, Marbofloxacin and Gentamicin
were selected for treatment experiment. The results in Table 6 indicate that both
treatment regimens can stop 100% of inflammation in treated cows after 3-5
days of treatment. This result confirmed the effectiveness of using MAR5 and
Ge for metritis treatment in cows. After recovery from the metritis, 100% of
cows were re-estrus. Importantly, there was no inflammatory fluid in the uterus
of 60 treated cows in the next reproductive cycle. In addition, the pregnancy
rate was high (from 66.7% to 80.0%) with two regimens when cows were
estrous and inseminated in the next reproductive cycle.

Vet Integr Sci Diep and Ngu, Vet Integr Sci. 2023; 21(3): 783 - 797 790
Veterinary Integrative Sciences

Table 6 The recovery of metritis cows in two treatment regimens

Healing No. of estrus returns No. of cows pregnant
Treatment Treatment
regimen number Rate Rate
Head Rate (%) Head Head
(%) (%)
1 30 30 100 30 100 24 80.0
2 30 30 100 30 100 20 66.7

DISCUSSION

Prevalence of bovine metritis and the identification of bacteria

The objective of this study was to examine the presence of commonly
encountered bacteria responsible for metritis in beef cows and evaluate their
susceptibility to commonly used antibiotics for treating metritis in cows. The
findings from the antibiotic resistance testing on the four groups of bacteria
revealed significant resistance to Co and FUR30. However, a majority of the
bacteria examined in this study exhibited high sensitivity to MAR5. Therefore,
cows affected by metritis caused by the aforementioned four groups of bacteria
can be effectively treated using MAR5 antibiotics.
According to Sheldon et al. (2006), approximately 15% of dairy cows
showed clinical signs of chronic uterine disease three weeks after calving.
This phenomenon is called clinical endometritis and is characterized by the
presence of pus in the uterus, which can often be detected in the vagina. The
current findings (Figure 1) showed a lower prevalence of bovine metritis
(5.5%) compared to the previous study (7.2%) conducted in Tien Giang by
Dong (2016). The frequency of bovine metritis varied based on location and
historical period. Within Vietnam, Nha and Anh (2008) reported a low metritis
prevalence of 3.2% in reproductive cows in Quang Nam province. Duong
(2011) reported a bovine metritis prevalence of 5.6% in reproductive cows
in Nghe An province while Kien (2012) discovered a high bovine metritis
prevalence (22.9%) in reproductive cows in the Ba Vi district of Hanoi city.
The aforementioned outcomes validate the relatively low occurrence of
bovine metritis observed in this study. This could potentially be attributed
to the progress made in artificial insemination techniques for reproductive
cows, which has led to enhanced safety measures and a reduced risk of genital
infections like metritis. Moreover, it was also indicated that a majority of cows
received vaccinations, the farming conditions were satisfactory, and the rearing
environment was deemed acceptable. These combined factors likely contribute
to a decreased prevalence of metritis among cows in the region.
The findings of the present study (Figure 3) are similar to those of
Tien (2006) which focused on the indicators of bovine metritis in dairy cows
in some districts of Hanoi and Bac Ninh. These authors indicated that the
dominant bacteria population in the inflammatory fluid were E. coli, S. aureus,
Streptococcus spp. with a prevalence of 100%, unclassified bacteria accounted
for 76.0% and non-permanent bacteria are Salmonella spp. constituting 28.0%.
However, in the current work (Table 1), the highest prevalence of E. coli was
observed only in the Limousin crossbred cattle. Streptococcus spp. was the
dominant bacteria in the inflammatory fluid samples. Extraordinarily, the

Vet Integr Sci Diep and Ngu, Vet Integr Sci. 2023; 21(3): 783 - 797 791
Veterinary Integrative Sciences

persistence of microorganisms in utero of the cow population changed with

time, highest in the first two weeks after calving (more than 90%), followed by
the period from day 16 to day 30 (78%), 31 to 45 (50%), and 45 and 60 (9%)
(Smith and Risco, 2002). Therefore, monitoring the bacteria population in
utero of cows should be considered a regular activity to control bovine metritis.
In our study, cows in litters 1, 2, and 3 have a higher prevalence of bacteria
causing metritis than cows in litters 4 and ≥5 (Table 3). This tendency may be
explained by the immature sexual characteristics of cows in the first calving,
which might cause difficulty in mating. In addition, the pelvis may not adapt
perfectly to the parturition process, thereby causing injury endometrial leads
to inflammation. This hypothesis was supported by the study of Lohuis et al.
(1994) in which E. coli, Staphylococcus spp., and Streptococcus spp. were
isolated regularly from cows with residual placenta and cows with clinical
endometritis. Furthermore, Huszenicza et al. (1999) confirmed that E. coli was
found in the uterus of cows with the postpartum disease. In addition, a significant
role of E. coli in the metritis-endometritis syndrome complex was revealed in
previous studies (Williams et al., 2005; Donofrio et al., 2008). E. coli can infect
and be persistent in the epithelial layer of the endometrium leading to the high
prevalence of E. coli infection. Moreover, the interaction between E. coli and
α-Streptococcus in bovines at week 7 was revealed previously (Huszenicza
et al., 1999). The coincidence of bacterial persistence and the immaturity of
the reproductive tract was the critical factor leading to the high prevalence of
bovine metritis in the early litters of the reproductive period in cows. Therefore,
carefully monitoring during the first reproductive cycle is necessary for early
countermeasures to reduce the damage of the infection.
The coinfection of bacteria in bovine metritis is common in the early
postpartum period, occurring in the first two weeks postpartum (days 4-10),
and characterized by a large amount of vaginal discharge with a foul, reddish-
brown, watery with some necrotic debris in the uterus. In the first half of this
period, the uterine wall became thin. In the next few days, a small amount of foul-
smelling, purulent uterine was discharged and thickened uterine wall (bloody)
(Sheldon and Dobson, 2004; Sheldon et al., 2006). The study of Ghanem et al.
(2014) mentioned that more than one bacteria species was found in the uterus of
some cows at week 5. Interestingly, some cows that were negative for bacterial
infection at week five developed an infection at week 7. These results may be
related to the interaction of uterine immune response and the ability to clear the
infection of the uterus. This result was consistent with a study by Huszenicza et
al. (1999), who discovered that metritis pathogens could also be isolated from
the uterus of cows without clinical signs of endometritis. On the other hand,
Bacha and Regassa (2010) reported that most cows negative for endometritis
at week 4 were also negative at week 8. In addition, a higher proportion of
endometritis cows in week 4 compared to week 8 was recorded. In general,
the development of many bacteria species at the same time was common in
bovine metritis. The interaction among bacteria to obtain a synergistic effect
aggravated clinical signs that were reported previously. Based on the current
study, coinfection by 2 and 3 groups of bacteria was the most common, meaning
that treatments should consider the characteristics of coinfected bacteria to
optimize their efficiency.

Vet Integr Sci Diep and Ngu, Vet Integr Sci. 2023; 21(3): 783 - 797 792
Veterinary Integrative Sciences

The antibiotic resistance profile of bacterial groups

To avoid failure of treatments due to antibiotic resistance, the previous
study tried to apply other methods such as the mixture of lauric acid with acetic
and lactic acid (Pangprasit et al., 2020) or ethanolic extract of Morus alba
leaves (Phengvongsone et al., 2022) for bovine metritis treatments. However,
the success of the above treatments was reported in vitro only. Therefore,
antibiotics are still considered as an effective counter to control bacterial
infection or prevent the progression of the disease. Antibiotic compounds such
as tetracyclines, sulfonamides, aminoglycosides, β-lactams, and cephalosporins
have been used together or alone to treat postpartum metritis. The massive use
of antibacterial agents in dairy cows may lead to bacterial resistance strains
(El-Khadrawy et al., 2015). The research of Benko et al. (2015) showed that
E. coli and Streptococcus spp. have less resistance to marbofloxacin (ranging
from 2.3% to 7.4%), while Staphylococcus was not resistant to this antibiotic.
In this study, the authors also found a difference in resistance to the same
antibiotic of the same bacteria group. Specifically, the gentamycin resistance
of β-hemolytic Streptococcus was 82.2% while that of Streptococcus spp.
was 48.2%. Similarly, the gentamycin resistance of haemolytic E. coli was
16.7%, and non-haemolytic E. coli was up to 41.6%. For the marbofloxacin,
the authors found a similar trend, but the resistance rate to this antibiotic was
low (0%-7.4%). According to the ASTS report (1997-1998), in Vietnam, many
bacterial strains such as E. coli, Enterobacter, Shigella flexneri, Salmonella
typhi, S. aureus were resistant to doxycycline (Vietnam Ministry of Health,
2018). Research by Moges et al. (2013) indicated the gentamicin resistance of
E. coli, Staphylococcus spp, and Streptococcus spp. isolated from metritis cows
was up to 33.3% and higher than the present results (24.9%).
When evaluating the antibiotic sensitivity of bacterial groups,
Madhumeet et al. (2018) showed that all isolates of S. aureus were resistant to
ampicillin; 40% of E. coli to gentamycin. Meanwhile, Streptococcus spp. were
sensitive to all tested antibiotics. According to other studies, E. coli isolated
from utero was sensitive to gentamycin (Noakes et al., 1989) or ceftiofur
(Drillich et al., 2001). In the present study (Table 5), E. coli were resistant to
gentamycin at 31.3%, while the ceftiofur resistance rate was 57.4%. The above
results showed that antibiotic resistance of bacteria was different by location
and objects. Particularly, the antibiotic resistance of bacteria isolated in the
tropical region may vary, meaning that the selection of appropriate antibiotics
for treatment highly depended on the antibiogram of the current bacteria. This
phenomenon was a limiting factor that reduced the effectiveness of popular
antibiotic treatment regimens used in these regions.

Regimens and results of treatment for bovine metritis

The major reason for the low conception rate was that cows have
uterine inflammation, giving rise to reduced reproductive performance and an
increased number of insemination times per conception. Besides, it also delays
the first day of artificial insemination and prolongs the day of calving to the
time of the next conception, thereby reducing conception rates in cows (Le
Blanc, 2008). Endometritis was associated with increased days of reproductive
maturation and low conception rates in cows (Sheldon and Dobson, 2004).
Therefore, minimizing the burden due to prolonging the inflammation is of

Vet Integr Sci Diep and Ngu, Vet Integr Sci. 2023; 21(3): 783 - 797 793
Veterinary Integrative Sciences

utmost importance in treatment. The current regimens show high efficacy for
bovine metritis treatment with the recovery reaching 100%. However, the
pregnancy rate did not reach the appropriate level in the two regimens. The
lower conception rate of cows in regimen two compared to cows in regimen one
might relate to a higher resistance rate against gentamicin than marbofloxacin.
In addition, metritis has influenced the uterus even after cows had recovered.
Cows recovering from metritis might lack the optimal conditions for sperm
transport and storage, oocyte maturation and ovulation, zygote development,
implantation, and growth of embryo (Gilbert, 2011). Therefore, asymptomatic
metritis significantly reduces the productivity of cow's milk (Sheldon et al.,
2006). What can be implied from these is that controlling bovine metritis at
early stages is better than using antibiotics to treat infected cows.

CONCLUSION
This study revealed the status of bovine metritis in reproductive cows
in Tien Giang province. The prevalence of bovine metritis in reproductive
cows was low at 5.5%. In metritis cows, permanent bacteria such as E. coli, S.
aureus, and Streptococcus spp., were discovered. Besides, Salmonella spp. was
confirmed as non-permanent bacteria in the metritis cow population. In general,
the isolated bacteria exhibited a high resistance to colistin and were sensitive to
marbofloxacin. When applied for treatment, the regimen with marbofloxacin
showed a high recovery (100%) and a high number of pregnancies after
treatment (80%).

ACKNOWLEDGEMENTS
We would like to thank the farm owners and staff for their assistance
with the animal procedures.

AUTHOR CONTRIBUTIONS
Tran Hoang Diep; Investigation, laboratory analysis, manuscript
preparation.
Nguyen Trong Ngu; Conceptualization and design the experiment,
investigation, supervision, editing and finalization.

CONFLICT OF INTEREST
We have no conflict of interest.

Vet Integr Sci Diep and Ngu, Vet Integr Sci. 2023; 21(3): 783 - 797 794
Veterinary Integrative Sciences

REFERENCES
Abreham, S., Hailu, M., Worku, A., Tsegaye, S., 2017. Antibiotic resistance of aerobic
bacteria isolated from uteri of slaughtered cows in and around Addis Ababa,
Ethiopia. J. Vet. Sci. Technol. 8(406), 1-5.
Bacha, B., Regassa, F.G., 2010. Subclinical endometritis in Zebu x Friesian crossbred
dairy cows: its risk factors, association with subclinical mastitis and effect on
reproductive performance. Trop. Anim. Health. Prod. 42, 397-403.
Baishya, S., Das, K., Rahman, H., Borgohain, B., 1998. Antibiogram of bacteria isolated
from uterine discharge of repeated cattle. Indian J. Com. Microbiol. Immunol.
Infect. Dis. 19, 130-131.
Benko, T., Boldizar, M., Novotny, F., Hura, V., Valocky, I., Dudrikova, K., Petrovic, V., 2015.
Incidence of bacterial pathogens in equine uterine swabs, their antibiotic resistance
patterns, and selected reproductive indices in English thoroughbred mares during
the foal heat cycle. Vet. Med. 60(11), 613-620.
Bicalho, M.L.S., Machado, V.S., Higgins, C.H., Lima, F.S., Bicalho, R.C., 2017. Genetic and
functional analysis of the bovine uterine microbiota. Part I: Metritis versus healthy
cows. J. Dairy Sci. 100(5), 3850-3862.
Blake, D.P., Humphry, R.W., Scott, K.P., Hillman, K., Fenlon, D.R., Low, J.C., 2003.
Influence of tetracycline exposure on tetracycline resistance and the carriage
of tetracycline resistance genes within commensal Escherichia coli populations. J.
Appl. Microbiol. 94, 1087-1097.
Brakstad, O.G., Aasbakk, K., Maeland, J.A., 1992. Detection of S. aureus by polymerase
chain reaction amplification of the nuc gene. J. Clin. Microbiol. 30(7), 1654-1660.
Bromfeld, J.J., Santos, J.E.P., Block, J., Williams, R.S., Sheldon, I.M., 2015. Physiology and
endocrinology symposium: Uterine infection: Linking infection and innate
immunity with infertility in the high-producing dairy cow. Anim. Sci. J. 93,
2021-2033.
BSAC, 2013. BSAC Method for Antimicrobial Susceptibility Testing. Available online:
https://bsac.org.uk/wp-content/uploads/2012/02/Version-12-Apr-2013_final.pdf.
CLSI, 2008. Development of in vitro susceptibility testing criteria and quality control
parameters; approved guideline, 3rd edition. CLSI document M23-A3. Clinical and
Laboratory Standards Institute, Wayne, PA.
CLSI, 2010. Methods for antimicrobial dilution and disk susceptibility testing of infrequently
isolated or fastidious bacteria. Approved Guideline, 2nd edition. Clinical Laboratory
Standards Instittute, USA.
CLSI, 2016. Performance standards for antimicrobial susceptibility testing m100s, 26th
edition. Clinical Laboratory Standards Instittute, USA.
Dong, V.V., 2016. Investigate some factors affecting conception in dairy cows in Tien Giang
(Thesis Master of Veterinary Medicine). Nong Lam University, Ho Chi Minh.
Donofrio, G., Ravanetti, L., Cavirani, S., Herath, S., Capocefalo, A., Sheldon, I.M., 2008.
Bacterial infection of endometrial stromal cells influences bovine herpesvirus 4
immediate early gene activation: a new insight into bacterial and viral interaction
for uterine disease. Reproduction. 136, 361-366.
Drillich, M., Beetz, O., Pfutzner, A., Sabin, M., Sabin, H.J., Kutzner, P., Nattermann, H.,
Heuwieser, W., 2001. Evaluation of systemic antibiotictreatment of toxic puerperal
metritis in dairy cows. J. Dairy Sci. 84, 2010-2017.
Duong, C.V., 2011. Research on determining some reproductive indicators, obstetric diseases
and testing the treatment of metritis on dairy cows in some localities in Nghe An
province (Master Thesis of Agriculture). Hanoi Agricultural University, Ha Noi.
El-Khadrawy, H., Wahid, M., Zaabal, M., Emtenan, M., 2015. Strategies for diagnosis and
treatment of uterine infection in bovines. Glob. Vet. 15, 98-105.
EUCAST, 2017. Breakpoint tables for interpretation of MICs and zone diameters. Version
7.1. European Committee on Antimicrobial Susceptibility Testing, Sweden.
Ghanem, M.E., Tezuka, E., Devkota, B., Izaike, Y., Osawa, T., 2014. Persistence of uterine
bacterial infection, and its associations with endometritis and ovarian function in
postpartum dairy cows. J. Reprod. Dev. 61(1), 54-60.
Gilbert, R.O., 2011. The effect of endometritis on the establishment of pregnancy in cattle.
Reprod. Fertil. Dev. 24, 252-257.

Vet Integr Sci Diep and Ngu, Vet Integr Sci. 2023; 21(3): 783 - 797 795
Veterinary Integrative Sciences

Gurunathan, S., 2015. Biologically synthesized silver nanoparticles enhances antibiotic

activity against Gram-negative bacteria. J. Ind. Eng. Chem. 29, 217-226.
Hansen, P.J., 2013. Physiology and endocrinology symposium: maternal immunological
adjustments to pregnancy and parturition in ruminants and possible implications for
postpartum uterine health: is there a prepartum-postpartum nexus?. J. Anim Sci. 91,
1639-1649.
Huszenicza, G.M., Fodor, M., Gags, M., Kucsar, M.J., Dohmen, W., Varmos, M., Porkolas,
L., Kegel, T., Bartyik, J., Lohuis, J.C.M., Janos, S., 1999. Uterine bacteriology,
resumption of cyclic ovarianactivity and fertility in postpartum cows kept inlarge-
scale dairy herd. Reprod. Domest. Anim. 34, 237-245.
Irmler, S., Schafer, H., Beisert, B., Rauhut, D., Berthoud, H., 2009. Identication and
characterization of a strain-dependent cystathionine β/γ - lyase in Lactobacillus casei
potentially involved in cysteine biosynthesis. FEMS Microbiol. Lett. 295, 67-76.
Jorgensen, H.J., Pfaller, A.H., Carroll, C.K., Landry, L.M., Funke, G., Richter, S.S., Warnock,
W.D., 2015. Manual of Clinical Microbiology, 11th edition. ASM Press, Washington,
D.C.
Kateete, P.D., Kimani, C.N., Katabazi, F.A., Okeng, A., Okee, M.S., Nanteza, A., Joloba,
M.L., Najjuka, F.C., 2010. Identification of S. aureus: Dnase and Mannitol salt agar
improve the efficiency of the tube coagulase test. Ann. Clin. Microbiol. 9, 23.
Kien, P.T., 2012. Study on the current status of metritis in dairy cows raised in the Red River
Delta and test preventive measures (Master's Thesis in Agriculture). Hanoi
University of Agriculture, Ha Noi city, Viet Nam.
Kirby-Bauer, 1996. Antimicrobial sensitivity testing by agar diffusion method. J. Clin. Pathol.
44, 493.
LeBlanc, S.J., 2008. Postpartum uterine disease and dairy herd reproductive performance: a
review. Vet. J. 176, 102-114.
Lohuis, J.A.C.M., Dohmen, M.J.W., Nagy, P., Huszenicza, C., Ague, D., 1994. Bacteriological
andclinical findings in cows with subacute/chronic endometritis. Proc. of the 6th
Intern. EAVPT, Edinburgh, pp. 7-11.
Madhumeet, S., Pravesh, K., 2018. Isolation and antimicrobial susceptibility of bacteria from
dairy cows with sub-clinical endometritis. Haryana Veterinarian. 57(1), 103-105.
Moges, N., Regassa, F., Yilma, T., Unakal, C.G., 2013. Isolation and antimicrobial
susceptibility of bacteria from dairy cows with clinical endometritis. J. Reprod.
Infertil. 4(1), 04-08.
Moriarty, E.M., Sinton, L.W., Mackenzie, M.L., Karki, N., Wood, D.R., 2008. A survey of
enteric bacteria and protozoans in fresh bovine faeces on New Zealand dairy farms.
J. Appl. Microbiol. 105(6), 2015-2025.
Nha, G.T., Anh, N.H., 2008. Situation of obstetric diseases in reproductive cows in Duy
Xuyen district, Quang Nam province and remedial measures. Hue. Univ. J. Sci. 46,
2008.
Noakes, D.E., Till, D., Smith, G.R., 1989. Bovine uterine flora post partum: a comparison of
swabbing and biopsy. Vet. Rec. 124, 563-564.
Pangprasit, N., Srithanasuwan, A., Suriyasathaporn, W., Chaisri, W., 2020. Antibacterial
properties of lauric acid in combination with organic acids against major pathogens
causing dairy mastitis. Vet. Integr. Sci. 19(1), 37-44.
Phengvongsone, X., Thamrongyoswittayakul, C., Sukon, P., Aimsaard, J., Mektrirat, R.,
2022. Antibacterial effect of ethanolic Morus alba Linn. leaf extract against mastitis-
causing Escherichia coli and S. aureus in vitro. Vet. Integr. Sci. 20(3), 517-529.
Sheldon, I.M., Dobson, H., 2004. Postpartum uterine health in cattle. Anim. Reprod. Sci. 82-
83, 295-306.
Sheldon, I.M., Lewis, G., LeBlanc, S., Gilbert, R., 2006. Defining postpartum uterine disease
in dairy cattle. Theriogenology. 65(8), 1516-1530.
Sheldon, I.M., Nookes, D.E., Rycroft, A.N., Dobson, H.E., 2002. Influence of uterine bacterial
contamination after parturition on ovarian dominant follicle selection and follicle
growth and function in cattle. Reproduction. 123, 837-845.
Singh, K.P., Singh, B., Singh, S.V., Singh, J.P., Singh, P., Singh, H.N., 2014. Comparative
evaluation of anti-microbials in treatment and improving conception rate in
endometritic crossbred cows. Intas. Polivet. 15(1), 79-82.
Smith, B.I., Risco, C.A., 2002. Predisposing factors and potential causes of postpartum
metritis in dairy cattle. Comp. Cont. Vet. Ed. 24, 74-80.

Vet Integr Sci Diep and Ngu, Vet Integr Sci. 2023; 21(3): 783 - 797 796
Veterinary Integrative Sciences

Soumet, C., Ermel, G., Fach, P., Colin, P., 1994. Evaluation of different DNA extraction
procedures for the detection of Salmonella from chicken products by polymerase
chain reaction. J. Appl. Microbiol. 19, 294-298.
Tien, L.T., 2006. Study on transformation of some clinical, non-clinical, bacteriological and
experimental treatment of metritis in dairy cows (Master Thesis of Veterinary
Medicine). Hanoi Agricultural University, Ha Noi City, Vietnam.
Vietnam Ministry of Health, 2018. A report on antibiotic usage and antibiotic resistance in
fifteen Vietnamese hospitals from 2008-2009. Vietnamese Ministry of Health in
partnership with the Global Cooperation Project on Antibiotic Resistance (GARP
Vietnam) and the Oxford University Clinical Research Unit, Ho Chi Minh.
Wagener, K., Grunert, T., Prunner, I., Ehling-Schulz, M., Drillich, M., 2014. Dynamics of
uterine infections with Escherichia coli, Streptococcus uberis and Trueperella
pyogenes in post-partum dairy cows and their association with clinical endometritis.
Vet. J. 202, 527-532.
Williams, E.J., Fischer, D.P., Pfeiffer, D.U., England, G.C., Noakes, D.E., Dobson, H.,
Sheldon, I.M., 2005. Clinical evaluation of postpartum vaginal mucus reflects
uterine bacterial infection and the immune response in cattle. Theriogenology. 63,
102-117.
Yah, C.S., Simate, G.S., 2015. Nanoparticles as potential new generation broad spectrum
antimicrobial agents. DARU J. Pharm. Sci. 23, 1-14.
Yang, LM., Wang, Y.H., Peng, Y., Min, J.T., Hang, S.Q., Zhu, W.Y., 2016. Genomic
characterization and antimicrobial susceptibility of bovine intrauterine Escherichia
coli and its relationship with postpartum uterine infections. J. Integr. Agr. 15(6),
1345-1354.
Yoshihiko, S., Tetsuo, M., Toshie, K. Hiroshi, N., 2000. Salmonella virchow infection in an
infant transmitted by household dogs. J. Vet. Med. Sci. 62(7), 767-769.
Zahraei, S.T., Mahzounieh, M. Saeedzadeh, A., 2005. Dectection of InvA gene in isolated
Salmonella from broilers by PCR method. Int. J. Poult. Sci. 4(8), 557-559.

How to cite this article;

Tran Hoang Diep, Nguyen Trong Ngu. Identification of prevalence and antibiotic resistance
property as a basis for establishing an efficient treatment of bacteria causing mastitis in beef
cows. Veterinary Integrative Sciences. 2023; 21(3): 783 - 797.

Vet Integr Sci Diep and Ngu, Vet Integr Sci. 2023; 21(3): 783 - 797 797