23 - NEET - Code-F6 - Paper 2023

FINAL NEET(UG)–2023 (EXAMINATION)
(Held On Sunday 7th MAY, 2023)
PHYSICS TEST PAPER WITH ANSWER & SOLUTIONS


– –
 
  
 




  
 

10 400 2
G 2
10V R 2V
 
0 0 0

    
     



 

2 10V 5V 1
A B
E
 
7
 
  
  

     
 
 
  
 
 
  
 
 
  
  :-





 

 

     
   
   
     
   
   
 
  
 
  
  
 

 


   
  


  
   
  
 
 
 
 
 



   

 


    
  →
 
 
 
  
   



   
 
 
 
 
 
 
   
   
     
     
   
    
 
  
 
 

   
 

 
  
 

    



  
 
    
    

    


  


 
 
 
  
 
 



3
Gd
 
   
 
  
 


 
      
 
  
      
 
   
    
 
  

  


   
   
   
    
      
   
 
    
 

 

 
     
 
 
   
  
 
     
   
 
 
 


 

  



      
        
  
  
   
  
   

 
   
  

      
        
   
   
   
   

 
 
 
 
      

     

  

  

   
    
 
 
 
CHEMISTRY TEST PAPER WITH ANSWER & SOLUTIONS
Zn Hg

conc.HCl
(A)  2H2O
 
 
 
 
   
 
1s  *1s  2s  * 2s  2p z 
(2p x  2p y )  (* 2p x  * 2p y )  * 2p z
1s  *1s  2s  * 2s  2p z 
* 2pz  (2p x  2p y )  (* 2p x  * 2p y )
1s  *1s  2s  * 2s  (2p x  2p y ) 
(* 2p x  * 2p y )  2p z  * 2p z
1s  *1s  2s  * 2s  (2p x  2p y ) 


N O (g)
2p z  (* 2p x  * 2p y )  * 2p z

Fe(s)

1 NO

(g)

2
super/hyper valent
CH3–CH–CH–CH3
CH3 OH 
HBr

3-Methylbutan-2-ol
 
CH3–CH–CH–CH3
CH3 Br
CH3
CH3–C–CH2Br
CH3
Br
CH3–C–CH2–CH3
CH3




 

 
 

   



Θ
+ –
   
 
   
4
 Fe  CN 5 NOS
2
 Fe  SCN  Fe 4  Fe  CN 6   3 .xH2 O

         


 
 
  
  
  
  
 
 

 





l
l l

l l
 


  











  
    

 


















8
90. Which amongst the following options is the correct
relation between change in enthalpy and change in
internal energy?
(1) DH = DU + Dng RT (2) DH – DU = – DnRT
(3) DH + DU = DnR (4) DH = DU – DngRT
Ans. (1)
Sol. DH = DU + Dng RT
91. Match List-I with List-II :
List-I List-II
(Oxoacids of Sulphur) (Bonds)
A. Peroxodisul- I. Two S-OH, Four S=O,
phuric acid One S-O-S
B. Sulphuric acid II. Two S-OH, One S=O
C. Pyrosulphuric acid III. Two S-OH, Four S=O,
One S-O-O-S
D. Sulphurous acid IV. Two S-OH, Two S=O
Choose the correct answer from the options given
below:
(1) A-III, B-IV, C-I, D-II (2) A-I, B-III, C-IV, D-II
(3) A-III, B-IV, C-II, D-I (4) A-I, B-III, C-II, D-IV
Ans. (1)
Sol. A → Peroxodisulphuric acid
O O
Ans. (2)
HO–S–O–O–S–OH
O O
B → Sulphuric acid Sol.
H2SO4
O
HO–S–OH 93. Pumice stone is an example of -
O (1) gel (2) solid sol
C → Pyrosulphuric acid H2S2O7 (3) foam (4) sol
O O Ans. (2)
HO–S–O–S–OH Sol. Pumice stone is an example of solid state
O O
94. The reaction that does NOT take place in blast
D → Sulphurous acid H2SO3 furnace between 900 K to 1500 K temperature
O range during extraction of iron is :
S (1) FeO + CO ® Fe + CO2
HO OH (2) C + CO2 ® 2CO
92. Identify the major product obtained in the following (3) CaO + SiO2 ® CaSiO3
reaction: (4) Fe2O3 + CO ® 2FeO + CO2
O Ans. (4)
Sol. Reaction
+
+2[Ag(NH3)2] Fe2O3 + CO ® 2FeO + CO2
H
This reaction takes place at temperature (500 K – 800 K)
O not at (900 K to 1500 K)
+ 3 OH D
–
major product

1 1 1 1
3 4 12 2

VO34
Co  NH3   NO3  

 3 3
 CoCl 2 (en)2  NO3
Co  NH3    SO4 

 6 2 3
Co  NH3   H2O  Br   NO3 

 4  2
3 4 5
C  V2 O3  V2 O4  V2 O5
Acidic Nature 
 VO 43
aCr2O72  bSO32 (aq)  cH (aq) 
c
2aCr 3  (aq)  bSO24  (aq)  H O( )
2 2
  
    
  
   
    
    
CH3 CHO 
i ) LiAlH4
[A] 
H2SO 4
[B]
ii ) H O 
3


Br

HBr
[C] [D]
Na/dry ether
 
CODE – F61

BIOLOGY TEST PAPER WITH ANSWER & SOLUTIONS
Botany : Section-A (Q. No. 101 to 135) 105. What is the function of tassels in the corn cob ?
101. Movement and accumulation of ions across a (1) To trap pollen grains
(2) To disperse pollen grains
membrane against their concentration gradient can
(3) To protect seeds
be explained by
(4) To attract insects
(1) Facilitated Diffusion (2) Passive Transport
Ans. (1)
(3) Active Transport (4) Osmosis
Ans. (3) Hint NCERT XII Pg # 29
106. Identify the correct statements :
Hint NCERT XI Pg # 132
A. Detrivores perform fragmentation.
102. Among ‘The Evil Quartet’, which one is considered B. The humus is further degraded by some microbes
the most important cause driving extinction of during mineralization.
species ? C. Water soluble inorganic nutrients go down into
the soil and get precipitated by a process called
(1) Over exploitation for economic gain
leaching.
(2) Alien species invasions
D. The detritus food chain begins with living
(3) Co-extinctions organisms.
(4) Habitat loss and fragmentation E. Earthworms break down detritus into smaller
Ans. (4) particles by a process called catabolism.
Choose the correct answer from the option
Hint NCERT XII Pg # 264
given below :
103. Identify the pair of heterosporous pteridophytes (1) B, C, D only (2) C, D, E only
among the following : (3) D, E, A only (4) A, B, C only
(1) Selaginella and Salvinia Ans. (4)
(2) Psilotum and Salvinia Hint NCERT XII Pg # 243
(3) Equisetum and Salvinia 107. Given below are two statements : One is labelled as
Assertion A and the other is labelled as Reason R:
(4) Lycopodium and Selaginella
Assertion A : Late wood has fewer xylary
Ans. (1)
elements with narrow vessels.
Hint NCERT XI Pg # 38 Reason R : Cambium is less active in winters.
104. Frequency of recombination between gene pairs on In the light of the above statements, choose the
same chromosome as a measure of the distance correct answer from the options given below :
(1) Both A and R are true but R is NOT the correct
between genes to map their position on
explanation of A.
chromosome, was used for the first time by
(2) A is true but R is false.
(1) Sutton and Boveri (2) Alfred Sturtevant
(3) A is false but R is true.
(3) Henking (4) Thomas Hunt Morgan
(4) Both A and R are true and R is the correct
Ans. (2)
explanation of A.
Hint NCERT XII Pg # 83 Ans. (4)
108. The process of appearance of recombination 115. Among eukaryotes, replication of DNA takes place
nodules occurs at which sub stage of prophase I in in -
meiosis ? (1) S phase (2) G1 phase
(1) Pachytene (2) Diplotene (3) G2 phase (4) M phase
(3) Diakinesis (4) Zygotene Ans. (1)
Hint NCERT XI Pg # 168 116. How many ATP and NADPH2 are required for the
109. Which of the following stages of meiosis involves
synthesis of one molecule of Glucose during Calvin
division of centromere ? cycle ?
(1) Metaphase II (2) Anaphase II
(1) 18 ATP and 12 NADPH2
(3) Telophase (4) Metaphase I
Ans. (2)
110. During the purification process for recombinant
Ans. (1)
DNA technology, addition of chilled ethanol
precipitates out
117. In gene gun method used to introduce alien DNA
(1) DNA (2) Histones
(3) Polysaccharides (4) RNA into host cells, microparticles of _______ metal are
Ans. (1) used.
Hint NCERT XII Pg # 201 (1) Zinc (2) Tungsten or gold
(3) Silver (4) Copper
111. Family Fabaceae differs from Solanaceae and
Ans. (2)
Liliaceae. With respect to the stamens, pick out the
characteristics specific to family. Fabaceae but not Hint NCERT XII Pg # 201
found in Solanaceae or Liliaceae. 118. The thickness of ozone in a column of air in the
(1) Polyadelphous and epipetalous stamens atmosphere is measured in terms of :
(2) Monoadelphous and Monothecous anthers (1) Decibels (2) Decameter
(3) Epiphyllous and Dithecous anthers (3) Kilobase (4) Dobson units
(4) Diadelphous and Dithecous anthers Ans. (4)
Hint NCERT XI Pg # 79 119. Unequivocal proof that DNA is the genetic material
112. Large, colourful, fragrant flowers with nectar are was first proposed by
seen in: (1) Alfred Hershey and Martha Chase
(1) bird pollinated plants (2) bat pollinated plants (2) Avery, Macleoid and McCarthy
(3) wind pollinated plants (4) insect pollinated plants
(3) Wilkins and Franklin
Ans. (4)
(4) Frederick Griffith
Ans. (1)
113. Spraying of which of the following phytohormone
on juvenile conifers helps in hastening the maturity
120. In the equation
period, that leads to early seed production ?
GPP – R = NPP
(1) Gibberellic Acid (2) Zeatin
(3) Abscisic Acid (4) Indole-3-butyric Acid GPP is Gross Primary Productivity
Ans. (1) NPP is Net Primary Productivity
Hint NCERT XI Pg # 249 R here is ____.
(1) Respiratory quotient
114. Axile placentation is observed in
(2) Respiratory loss
(1) China rose, Beans and Lupin
(2) Tomato, Dianthus and Pea (3) Reproductive allocation
(3) China rose, Petunia and Lemon (4) Photosynthetically active radiation
(4) Mustard, Cucumber and Primrose Ans. (2)
Hint NCERT XI Pg # 75 & 80
121. What is the role of RNA polymerase III in the 126. Cellulose does not form blue colour with Iodine
process of transcription in Eukaryotes ? because
(1) Transcription of tRNA, 5 srRNA and snRNA (1) It is a helical molecule.
(2) Transcription of precursor of mRNA
(2) It does not contain complex helices and hence
(3) Transcription of only snRNAs
(4) Transcription of rRNAs (28S, 18S and 5.8S) cannot hold iodine molecules.
Ans. (1) (3) It breakes down when iodine reacts with it.
Hint NCERT XII Pg # 111 (4) It is a disaccharide.
122. Which micronutrient is required for splitting of water Ans. (2)
molecule during photosynthesis ? Hint NCERT XI Pg # 148
(1) molybdenum (2) magnesium
(3) copper (4) manganese 127. Which hormone promotes internode/petiole
Ans. (4) elongation in deep water rice?
Hint NCERT XI Pg # 198 (1) Kinetin (2) Ethylene
123. In angiosperm, the haploid, diploid and triploid (3) 2, 4–D (4) GA3
structures of a fertilized embryo sac sequentially are: Ans. (2)
(1) Antipodals, synergids, and primary endosperm
nucleus
(2) Synergids, Zygote and Primary endosperm 128. Expressed Sequence Tags (ESTs) refers to
nucleus (1) All genes that are expressed as proteins.
(3) Synergids, antipodals and Polar nuclei (2) All genes whether expressed or unexpressed.
(4) Synergids, Primary endosperm nucleus and
(3) Certain important expressed genes.
zygote
(4) All genes that are expressed as RNA.
Ans. (2)
Hint NCERT XII Pg # 34 Ans. (4)
124. The phenomenon of pleiotropism refers to Hint NCERT XII Pg # 119
(1) presence of two alleles, each of the two genes 129. Given below are two statements :
controlling a single trait.
Statement I : The forces generated by
(2) a single gene affecting multiple phenotypic
expression. transpiration can lift a xylem-sized column of water
(3) more than two genes affecting a single over 130 meters height.
character. Statement II : Transpiration cools leaf surfaces
(4) presence of several alleles of a single gene sometimes 10 to 15 degrees, by evaporative
controlling a single crossover.
cooling.
Ans. (2)
In the light of the above statements, choose the
125. Given below are two statements : One is labelled as most appropriate answer from the options given
Assertion A and the other is labelled as Reason R: below:
Assertion A : ATP is used at two steps in (1) Both Statement I and Statement II are
glycolysis. incorrect.
Reason R : First ATP is used in converting glucose (2) Statement I is correct but Statement II is
into glucose-6-phosphate and second ATP is used in incorrect.
conversion of fructose-6-phosphate into fructose-1- (3) Statement I is incorrect but Statement II is
correct
6-diphosphate.
(4) Both Statement I and Statement II are
correct.
correct answer from the options given below :
Ans. (4)
(1) Both A and R are true but R is NOT the correct Hint NCERT XI Pg # 189
explanation of A. 130. Upon exposure to UV radiation, DNA stained with
(2) A is true but R is false. ethidium bromide will show
(3) A is false but R is true. (1) Bright blue colour (2) Bright yellow colour
(4) Both A and R are true and R is the correct (3) Bright orange colour (4) Bright red colour
explanation of A. Ans. (3)
131. The historic Convention on Biological Diversity, 135. Given below are two statements:
'The Earth Summit' was held in Rio de Janeiro in Statement I : Endarch and exarch are the terms
the year: often used for describing the position of secondary
(1) 1992 (2) 1986 xylem in the plant body.
Statement II : Exarch condition is the most
(3) 2002 (4) 1985
common feature of the root system.
Ans. (1)
Hint NCERT XII Pg # 267 correct answer from the options given below;
132. The reaction centre in PS II has an absorption (1) Both Statement I and Statement II are false.
maxima at (2) Statement I is correct but Statement II is
(1) 700 nm (2) 660 nm false.
(3) 780 nm (4) 680 nm (3) Statement I is incorrect but Statement II is
Ans. (4) true.
(4) Both Statement I and Statement II are true.
Ans. (3)
133. Given below are two statements : One is labelled as
Assertion A and the other is labelled as Reason R :
Botany : Section-B (Q. No. 136 to 150)
Assertion A : The first stage of gametophyte in
136. Identify the correct statements:
the life cycle of moss is protonema stage.
A. Lenticels are the lens-shaped openings
Reason R : Protonema develops directly from permitting the exchange of gases.
spores produced in capsule. B. Bark formed early in the season is called hard
bark.
In the light of the above statements, choose the C. Bark is a technical term that refers to all tissues
most appropriate answer from the options given exterior to vascular cambium.
D. Bark refers to periderm and secondary phloem.
below:
E. Phellogen is single-layered in thickness.
(1) Both A and R are correct but R is NOT the Choose the correct answer from the options given
below:
correct explanation of A.
(1) A and D only (2) A, B and D only
(2) A is correct but R is not correct. (3) B and C only (4) B, C and E only
Ans. (1)
(3) A is not correct but R is correct.
(4) Both A and R are correct and R is the correct 137. Match List I with List II :
explanation of A. List I List II
A. Cohesion I. More attraction in
Ans. (4) liquid phase
Hint NCERT XI Pg # 36 B. Adhesion II. Mutual attraction
among water
134. In tissue culture experiments, leaf mesophyll cells molecules
are put in a culture medium to form callus. This C. Surface tension III. Water loss in liquid
phase
phenomenon may be called as: D. Guttation IV. Attraction towards
(1) Dedifferentiation polar surfaces
(2) Development
below :
(3) Senescence (1) A-IV, B-III, C-II, D-I (2) A-III, B-I, C-IV, D-II
(4) Differentiation (3) A-II, B-I, C-IV, D-III (4) A-II, B-IV, C-I, D-III
Ans. (4)
Ans. (1)
138. Match List I with List II: 141. How many different proteins does the ribosome
List I List II consist of?
A. M Phase I. Proteins are (1) 60 (2) 40
synthesized (3) 20 (4) 80
B. G2 Phase II. Inactive phase Ans. (4)
C. Quiescent stage III. Interval between Hint NCERT XII Pg # 115
mitosis and initiation 142. Which of the following combinations is required for
of DNA replication chemiosmosis?
D. G1 Phase IV. Equational division (1) membrane, proton pump, proton gradient,
Choose the correct answer from the options given NADP synthase
below: (2) proton pump, electron gradient, ATP synthase
(1) A-IV, B-II, C-I, D-III (2) A-IV, B-I, C-II, D-III (3) proton pump, electron gradient, NADP
(3) A-II, B-IV, C-I, D-III (4) A-III, B-II, C-IV, D-I synthase
Ans. (2) (4) membrane, proton pump, proton gradient, ATP
Hint NCERT XI Pg # 163 & 164 synthase
139. Which of the following statements are correct about Ans. (4)
Klinefelter's Syndrome? Hint NCERT XI Pg # 215
A. This disorder was first described by Langdon 143. Which one of the following statements is NOT
Down (1866). correct?
B. Such an individual has overall masculine (1) Algal blooms caused by excess of organic matter
development. However, the feminine in water improve water quality and promote
development is also expressed. fisheries.
C. The affected individual is short statured. (2) Water hyacinth grows abundantly in eutrophic
D. Physical, psychomotor and mental development water bodies and leads to an imbalance in the
is retarded. ecosystem dynamics of the water body.
E. Such individuals are sterile. (3) The amount of some toxic substances of
Choose the correct answer from the options given industrial waste water increases in the organisms
below: at successive trophic levels.
(1) C and D only (2) B and E only (4) The micro-organisms involved in biodegradation
(3) A and E only (4) A and B only of organic matter in a sewage polluted water
Ans. (2) body consume a lot of oxygen causing the death
Hint NCERT XII Pg # 92 of aquatic organisms.
140. Given below are two statements : Ans. (1)
Statement I : Gause's 'Competitive Exclusion Hint NCERT XII Pg # 275 & 276
Principle' states that two closely related species 144. Match List I with List II :
competing for the same resources cannot co-exist List I List II
indefinitely and competitively inferior one will be (Interaction) (Species A and B)
eliminated eventually. A. Mutualism I. +(A), O(B)
Statement II : In general, carnivores are more B. Commensalism II. –(A), O(B)
adversely affected by competition than herbivores. C. Amensalism III. +(A), –(B)
In the light of the above statements, choose the D. Parasitism IV. +(A), +(B)
correct answer from the options given below: Choose the correct answer from the options given
(1) Both Statement I and Statement II are false. below:
(2) Statement I is correct but Statement II is (1) A–IV, B–I, C–II, D–III
false. (2) A–IV, B–III, C–I, D–II
(3) Statement I is incorrect but Statement II is (3) A–III, B–I, C–IV, D–II
true. (4) A–IV, B–II, C–I, D–III
(4) Both Statement I and Statement II are true. Ans. (1)
145. Main steps in the formation of Recombinant DNA 148. Given below are two statements : One is labelled as
are given below. Arrange these steps in a correct Assertion A and the other is labelled as Reason R.
sequence. Assertion A : In gymnosperms the pollen grains
A. Insertion of recombinant DNA into the host cell. are released from the microsporangium and carried
B. Cutting of DNA at specific location by
by air currents.
restriction enzyme.
Reason R : Air currents carry the pollen grains to
C. Isolation of desired DNA fragment.
the mouth of the archegonia where the male
D. Amplification of gene of interest using PCR.
gametes are discharged and pollen tube is not
formed.
below:
(1) C, A, B, D (2) C, B, D, A
correct answer from the options given below:
(3) B, D, A, C (4) B, C, D, A
Ans. (4) (1) Both A and R are true but R is NOT the correct
Hint NCERT XII Pg # 201 explanation of A.
146. Match List I with List II : (2) A is true but R is false.

List I List II (3) A is false but R is true
A. Iron I. Synthesis of auxin (4) Both A and R are true and R is the correct
B. Zinc II. Component of explanation of A.
nitrate reductase Ans. (2)
C. Boron III. Activator of catalase
D. Molybdenum IV. Cell elongation and
149. Given below are two statements : One is labelled as
differentiation
Assertion A and the other is labelled as Reason R.
below: Assertion A : A flower is defined as modified
(1) A-II, B-III, C-IV, D-I shoot wherein the shoot apical meristem changes to
(2) A-III, B-I, C-IV, D-II floral meristem.
(3) A-II, B-IV, C-I, D-III Reason R : Internode of the shoot gets condensed
(4) A-III, B-II, C-I, D-IV to produce different floral appendages laterally at
Ans. (2) successive nodes instead of leaves.
Hint NCERT XI Pg # 197 & 198 In the light of the above statements, choose the
147. Match List I with List II : correct answer from the options given below:
List I List II (1) Both A and R are true but R is NOT the correct
A. Oxidative I. Citrate explanation of A.
decarboxylation synthase
B. Glycolysis II. Pyruvate
dehydrogenase (3) A is false but R is true.
C. Oxidative III. Electron (4) Both A and R are true and R is the correct
phosphorylation transport sytem explanation of A.
D. Tricarboxylic IV. EMP pathway Ans. (4)
acid cycle Hint NCERT XI Pg # 71
below: 150. Melonate inhibits the growth of pathogenic bacteria
(1) A-II, B-IV, C-I, D-III by inhibiting the activity of

(2) A-III, B-I, C-II, D-IV (1) Amylase
(3) A-II, B-IV, C-III, D-I (2) Lipase
(4) A-III, B-IV, C-II, D-I (3) Dinitrogenase
Ans. (3) (4) Succinic dehydrogenase
Hint NCERT XI Pg # 228, 231 & 232 Ans. (4)
Zoology : Section-A (Q. No. 151 to 185) 154. Given below are statements : one is labelled as
151. Given below are two statements :
Assertion A : Nephrons are of two types : Cortical
Statement I : A protein is imagined as a line, the
& Juxta medullary, based on their relative position
left end represented by first amino acid (C-terminal)
in cortex and medulla.
and the right end represented by last amino acid (N-
Reason R : Juxta medullary nephrons have short
terminal).
loop of Henle whereas, cortical nephrons have
Statement II : Adult human haemoglobin, consists
longer loop of Henle.
of 4 subunits (two subunits of  type and two
subunits  type.)
explanation of A.
(1) Both statement I and Statement II are false.
(2) Statement I is true but Statement II is false.
(3) A is false but R is true.
(3) Statement I is false but Statement II is true.
(4) Both statement I and Statement II are true.
explanation of A.
Ans. (3)
Ans. (2)
152. Radial symmetry is NOT found in adults of
155. Match List I with List II with respect to human
phylum _________.
eye.
(1) Hemichordata (2) Coelenterata List I List II
(3) Echinodermata (4) Ctenophora A. Fovea I. Visible coloured portion
Ans. (1) of eye that regulates

diameter of pupil.
B. Iris II. External layer of eye
153. Which of the following statements are correct
formed of dense
regarding female reproductive cycle ?
connective tissue.
A. In non-primate mammals cyclical changes
C. Blind spot III. Point of greatest visual
during reproduction are called oestrus cycle.
acuity or resolution.
B. First menstrual cycle begins at puberty and is
D. Sclera IV. Point where optic nerve
called menopause.
leaves the eyeball and
C. Lack of menstruation may be indicative of
photoreceptor cells are
pregnancy.
absent.
D. Cyclic menstruation extends between menarche
and menopause. below :
Choose the most appropriate answer from the (1) A-IV, B-III, C-II, D-I
options given below : (2) A-I, B-IV, C-III, D-II
(1) A and B only (2) A, B and C only (3) A-II, B-I, C-III, D-IV
(3) A, C and D only (4) A and D only (4) A-III, B-I, C-IV, D-II
Ans. (3) Ans. (4)
Hint NCERT XII Pg # 49 & 50 Hint NCERT XI Pg # 323 & 324

156. Which of the following are NOT considered as the 160. Match List I with List II.
part of endomembrane system ? List I List II
A. Mitochondria (Cells) (Secretion)
B. Endoplasmic Reticulum A. Peptic cells I.
Mucus
C. Chloroplasts B. Goblet cells II.
Bile juice
C. Oxyntic cells III.
Proenzyme pepsinogen
D. Golgi complex
D. Hepatic cells IV.
HCl and intrinsic factor
E. Peroxisomes
for absorption of vitamin
Choose the most appropriate answer from the B12
options given below : Choose the correct answer from the options given
(1) A, C and E only (2) A and D only below :
(3) A, D and E only (4) B and D only (1) A-II, B-I, C-III, D-IV (2) A-III, B-I, C-IV, D-II
Ans. (1) (3) A-II, B-IV, C-I, D-III (4) A-IV, B-III, C-II, D-I
Ans. (2)
157. Broad palm with single palm crease is visible in a
161. Given below are two statements : one is labelled as
person suffering from -
(1) Turner's syndrome
Assertion A : Endometrium is necessary for
(2) Klinefelter's syndrome implantation of blastocyst.
(3) Thalassemia Reason R : In the absence of fertilization, the
(4) Down's syndrome corpus luteum degenerates that causes
Ans. (4) disintegration of endometrium.
Hint NCERT XII Pg # 91 In the light of the above statements, choose the
158. Match List I with List II.
List I List II
explanation of A.
A. P - wave I. Beginning of systole (2) A is true but R is false.
B. Q - wave II. Repolarisation of (3) A is false but R is true.
ventricles
explanation of A.
C. QRS complex III. Depolarisation of atria Ans. (1)
D. T - wave IV. Depolarisation of Hint NCERT XII Pg # 51 & 53
ventricles 162. Which of the following is not a cloning vector ?
Choose the correct answer from the options given (1) YAC (2) pBR322
below : (3) Probe (4) BAC
(1) A-IV, B-III, C-II, D-I Ans. (3)
(2) A-II, B-IV, C-I, D-III Hint NCERT XII Pg # 199 & 119
(3) A-I, B-II, C-III, D-IV 163. Match List I with List II.
(4) A-III, B-I, C-IV, D-II List I List II
Ans. (4) A. Taenia I. Nephridia
B. Paramoecium II. Contractile vacuole
C. Periplaneta III. Flame cells
159. Which one of the following common sexually D. Pheretima IV. Urecose gland
transmitted diseases is completely curable when Choose the correct answer from the options give
detected early and treated properly ? below :
(1) Gonorrhoea (2) Hepatitis-B
(1) A-I, B-II, C-IV, D-III (2) A-III, B-II, C-IV, D-I
(3) HIV Infection (4) Genital herpes
(3) A-II, B-I, C-IV, D-III (4) A-I, B-II, C-III, D-IV
Ans. (1)
Ans. (2)
Hint NCERT XI Pg # 134, 114 & 291
164. Given below are two statements : 168. Which one of the following symbols represents
Statement I : Ligaments are dense irregular tissue. mating between relatives in human pedigree
Statement II : Cartilage is dense regular tissue. analysis?
(1) (2)
(1) Both Statement I and Statement II are false.
(2) Statement I is true but Statement II is false. (3) (4)
(3) Statement I is false but Statement II is true. Ans. (1)
(4) Both Statement I and Statement II are true. Hint NCERT XII Pg # 88
Ans. (1)
169. Once the undigested and unabsorbed substances
enter the caecum, their backflow is prevented by -
165. Which of the following functions is carried out by
(1) Ileo - caecal valve
cytoskeleton in a cell ?
(2) Gastro - oesophageal sphincter
(1) Protein synthesis
(3) Pyloric sphincter
(2) Motility
(3) Transportation (4) Sphincter of Oddi
(4) Nuclear division Ans. (1)
Ans. (2) Hint NCERT XI Pg # 264
Hint NCERT XI Pg # 136 170. Which one of the following techniques does not
166. Match List I with List II. serve the purpose of early diagnosis of a disease for
List I List II its early treatment ?
A. Gene 'a' I. -galactosidase (1) Serum and Urine analysis
B. Gene 'y' II. Transacetylase
(2) Polymerase Chain Reaction (PCR) technique
C. Gene 'i' III. Permease
(3) Enzyme Linked Immuno-Sorbent Assay (ELISA)
D. Gene 'z' IV. Repressor protein
technique
(4) Recombinant DNA Technology
below :
(1) A-II, B-III, C-IV, D-I Ans. (1)
(2) A-III, B-IV, C-I, D-II Hint NCERT XII Pg # 212
(3) A-III, B-I, C-IV, D-II 171. Given below are two statements :
(4) A-II, B-I, C-IV, D-III Statement I : Low temperature preserves the
Ans. (1)
enzyme in a temporarily inactive state whereas high
temperature destroys enzymatic activity because
167. Which of the following statements is correct ?
proteins are denatured by heat.
(1) Biomagnification refers to increase in Statement II : When the inhibitor closely
concentration of the toxicant at successive resembles the substrate in its molecular structure
trophic levels. and inhibits the activity of the enzyme, it is known
(2) Presence of large amount of nutrients in water as competitive inhibitor.
restricts 'Algal Bloom' In the light of the above statements, choose the
(3) Algal Bloom decreases fish mortality correct answer from the options given below :
(4) Eutrophication refers to increase in domestic (1) Both Statement I and Statement II are false.
sewage and waste water in lakes. (2) Statement I is true but Statement II is false.
Ans. (1) (3) Statement I is false but Statement II is true.

Hint NCERT XII Pg # 275 & 276
Ans. (4)
172. Match List I with List II. 176. Vital capacity of lung is______ .
List I List II (1) IRV + ERV + TV + RV
(Type of Joint) (Found between) (2) IRV + ERV + TV - RV
A. Cartilaginous I. Between flat skull bones
(3) IRV + ERV + TV
Joint
B. Ball and II. Between adjacent (4) IRV + ERV
Socket Joint vertebrae in vertebral Ans. (3)
column Hint NCERT XI Pg # 272
C. Fibrous Joint III. Between carpal and
177. Select the correct group/set of Australian
metacarpal of thumb
D. Saddle Joint IV. Between Humerus and Marsupials exhibiting adaptive radiation.
Pectoral girdle (1) Numbat, Spotted cuscus, Flying phalanger
Choose the correct answer from the options given (2) Mole, Flying squirrel, Tasmanian tiger cat
below : (3) Lemur, Anteater, Wolf
(1) A-II, B-IV, C-I, D-III
(4) Tasmanian wolf, Bobcat, Marsupial mole
(2) A-I, B-IV, C-III, D-II
(3) A-II, B-IV, C-III, D-I Ans. (1)
(4) A-III, B-I, C-II, D-IV Hint NCERT XII Pg # 133
Ans. (1) 178. Match List I with List II.
173. Given below are two statements : List I List II
Statement I : Vas deferens receives a duct from (A) CCK (I) Kidney
seminal vesicle and opens into urethra as the
(B) GIP (II) Heart
ejaculatory duct.
Statement II : The cavity of the cervix is called (C) ANF (III) Gastric gland
cervical canal which along with vagina forms birth (D) ADH (IV) Pancreas
canal.
In the light of the above statements, choose the Choose the correct answer from the options given
correct answer from the options given below : below :
(1) Both Statement I and Statement II are false.
(1) A-III, B-II, C-IV, D-I
(2) Statement I is correct but Statement II is
false. (2) A-II, B-IV, C-I, D-III
(3) Statement I incorrect but Statement II is (3) A-IV, B-II, C-III, D-I
true.
(4) A-IV, B-III, C-II, D-I
Ans. (4) Ans. (4)
Hint NCERT XII Pg # 46 Hint NCERT XI Pg # 333, 337 & 338
174. In which blood corpuscles, the HIV undergoes
replication and produces progeny viruses ? 179. Given below are two statements: one is labelled as
(1) B-lymphocytes (2) Basophils Assertion A and the other is labelled as Reason R.
(3) Eosinophils (4) TH cells Assertion A : Amniocentesis for sex determination
Ans. (4)
is one of the strategies of Reproductive and Child
Health Care Programme.
List I List II Reason R : Ban on amniocentesis checks
A. Heroin I. Effect on cardiovascular increasing menace of female foeticide.
system In the light of the above statements, choose the
B. Marijuana II. Slow down body function
C. Cocaine III. Painkiller
D. Morphine IV. Interfere with transport of (1) Both A and R are true and R is NOT the
dopamine correct explanation of A.
below :
(1) A-I, B-II, C-III, D-IV (3) A is false but R is true.
(2) A-IV, B-III, C-II, D-I (4) Both A and R are true and R is the correct
(3) A-III, B-IV, C-I, D-II
(4) A-II, B-I, C-IV, D-III explanation of A.
Ans. (4) Ans. (3)
180. Given below are two statements: 183. Given below are two statements:
Statement I : RNA mutates at a faster rate. Statement I : In prokaryotes, the positively
Statement II : Viruses having RNA genome and charged DNA is held with some negatively charged
proteins in a region called nucleoid.
shorter life span mutate and evolve faster.
Statement II : In eukaryotes, the negatively
charged DNA is wrapped around the positively
charged histone octamer to form nucleosome.
(1) Both Statement I and Statement II are false. In the light of the above statements, choose the
(2) Statement I is true but Statement II is false. correct answer from the options given below :
(3) Statement I false but Statement II is true. (1) Both Statement I and Statement II are false.
(4) Both Statement I and Statement II are true. (2) Statement I is correct but Statement II is
Ans. (4) false.
(3) Statement I incorrect but Statement II is
true.
List I List II
Ans. (3)
A. Vasectomy I. Oral method
B. Coitus interruptus II. Barrier method
C. Cervical caps III. Surgical method
D. Saheli IV. Natural method List I List II
Choose the correct answer from the options given A. Ringworm I. Haemophilus
below : influenzae
(1) A-III, B-IV, C-II, D-I B. Filariasis II. Trichophyton
(2) A-II, B-III, C-I, D-IV C. Malaria III. Wuchereria bancrofti
(3) A-IV, B-II, C-I, D-III D. Pneumonia IV. Plasmodium vivax
(4) A-III, B-I, C-IV, D-II Choose the correct answer from the options given
Ans. (1) below :
Hint NCERT XII Pg # 60 & 61 (1) A-II, B-III, C-I, D-IV (2) A-III, B-II, C-I, D-IV
(3) A-III, B-II, C-IV, D-I (4) A-II, B-III, C-IV, D-I
182. Given below are two statements:
Ans. (4)
Statement I : Electrostatic precipitator is most
widely used in thermal power plant.
Statement II : Electrostatic precipitator in thermal List I List II
power plant removes ionising radiations (Interacting species) (Name of Interaction)
In the light of the above statements, choose the A. A Leopard and I. Competition
most appropriate answer from the options given a Lion in a
forest/grassland
below : B. A Cuckoo laying II. Brood parasitism
(1) Both Statement I and Statement II are egg in a Crow's nest
incorrect. C. Fungi and root of a III. Mutualism
higher plant in
(2) Statement I is correct but Statement II is
Mycorrtizae
incorrect. D. A cattle egret and IV. Commensalism
(3) Statement I incorrect but Statement II is a Cattle in a field
correct. Choose the correct answer from the options given
below :
(4) Both Statement I and Statement II are (1) A-I, B-II, C-IV, D-III (2) A-III, B-IV, C-I, D-II
correct. (3) A-II, B-III, C-I, D-IV (4) A-I, B-II, C-III, D-IV
Ans. (2) Ans. (4)
Zoology : Section-B (Q. No. 186 to 200) 189. In cockroach, excretion is brought about by-
186. Which of the following statements are correct ? A. Phallic gland
A. Basophils are most abundant cells of the total B. Urecose gland
WBCs C. Nephrocytes
B. Basophils secrete histamine, serotonin and D. Fat body
heparin E. Collaterial glands
C. Basophils are involved in inflammatory response Choose the correct answer from the options given
D. Basophils have kidney shaped nucleus below:
E. Basophils are agranulocytes (1) A, B and E only
Choose the correct answer from the options given (2) B, C and D only
below: (3) B and D only
(1) C and E only (2) B and C only (4) A and E only
(3) A and B only (4) D and E only
Ans. (2)
Ans. (2)
Hint NCERT XI Pg #114
190. Given below are two statements:
Statement I : During G0 phase of cell cycle, the
List I List II cell is metabolically inactive.
A. Mast cells I. Ciliated epithelium Statement II : The centrosome undergoes
B. Inner surface of II. Areolar duplication during S phase of interphase.
bronchiole connective tissue In the light of the above statements, choose the
most appropriate answer from the options given
C. Blood III. Cuboidal epithelium
below :
D. Tubular parts IV. specialised
of nephron connective tissue incorrect.
Choose the correct answer from the options give (2) Statement I is correct but Statement II is
below : incorrect.
(1) A-II, B-III, C-I, D-IV (3) Statement I incorrect but Statement II is
correct.
(2) A-II, B-I, C-IV, D-III
(3) A-III, B-IV, C-II, D-I
correct.
(4) A-I, B-II, C-IV, D-III Ans. (3)
Ans. (2) Hint NCERT XI Pg # 163 & 164
Hint NCERT XI Pg # 101 & 103 191. Select the correct statements with reference to
188. Select the correct statements. chordates.
A. Tetrad formation is seen during Leptotene. A. Presence of mid-dorsal, solid and double nerve
B. During Anaphase, the centromeres split and cord.
chromatids separate. B. Presence of closed circulatory system
C. Terminalization takes place during Pachytene. C. Presence of paired pharyngeal gillslits
D. Nucleolus, Golgi complex and ER are reformed
D. Presence of dorsal heart
during Telophase.
E. Crossing over takes place between sister E. Triploblastic pseudocoelomate animals
chromatids of homologous chromosome. Choose the correct answer from the options given
Choose the correct answer from the options given below:
below: (1) B and C only
(1) B and D only (2) A, C and E only (2) B, D and E only
(3) B and E only (4) A and C only (3) C, D and E only
Ans. (1) (4) A, C and D only
Ans. (1)
192. Match List I with List II. 195. Which of the following statements are correct
List I List II regarding skeletal muscle ?
A. Logistic growth I. Unlimited resource A. Muscle bundles are held together by
availability condition collagenous connective tissue layer called
B. Exponential growth II. Limited resource fascicle.
availability condition B. Sarcoplasmic reticulum of muscle fibre is
C. Expanding age III. The percent
a store house of calcium ions.
pyramid individuals of pre-
C. Striated appearance of skeletal muscle fibre
reproductive age is
is due to distribution pattern of actin and
largest followed by
reproductive and post myosin proteins.
reproductive age groups D. M line is considered as functional unit of
D. Stable age IV. The percent contraction called sarcomere.
pyramid individuals of pre- Choose the most appropriate answer from the
reproductives and options given below:
reproductive age group (1) B and C only
are same (2) A, C and D only
Choose the correct answer from the options given (3) C and D only
below : (4) A, B and C only
(1) A-II, B-III, C-I, D-IV (2) A-II, B-IV, C-I, D-III
Ans. (1)
(3) A-II, B-IV, C-III, D-I (4) A-II, B-I, C-III, D-IV
Ans. (4) Hint NCERT XI Pg # 304
196. The unique mammalian characteristics are :
Hint NCERT XII Pg # 227, 230 & 231
(1) hairs, pinna and mammary glands
193. Which one of the following is the sequence on
(2) hairs, pinna and indirect development
corresponding coding strand, if the sequence on (3) pinna, monocondylic skull and mammary glands
mRNA formed is as follows (4) hairs, tympanic membrane and mammary glands
5' AUCGAUCGAUCGAUCGAUCG AUCG Ans. (1)
AUCG 3'? Hint NCERT XI Pg # 59 & 60
(1) 3' UAGCUAGCUAGCUAGCUA 197. Which one of the following is NOT an advantage of
inbreeding?
GCUAGCUAGC 5'
(1) It exposes harmful recessive genes that are
(2) 5' ATCGATCGATCGATCGATCG
eliminated by selection.
ATCGATCG 3' (2) Elimination of less desirable genes and
(3) 3' ATCGATCGATCGATCGATCG accumulation of superior genes takes place due
ATCGATCG 5' to it.
(3) It decreases the productivity of inbred
(4) 5' UAGCUAGCUAGCUAGCUAGC
population, after continuous inbreeding.
UAGC UAGC 3'
(4) It decreases homozygosity.
Ans. (2) Ans. (3)
Hint NCERT XII Pg # 108 Hint NCERT XII Pg # 167
194. Which of the following is characteristic feature of 198. The parts of human brain that helps in regulation of
sexual behaviour, expression of excitement,
cockroach regarding sexual dimorphism?
pleasure, rage, fear etc. are :
(1) Presence of anal styles (1) Corpora quadrigemina & hippocampus
(2) Presence of sclerites (2) Brain stem & epithalamus
(3) Presence of anal cerci (3) Corpus callosum and thalamus
(4) Dark brown body colour and anal cerci (4) Limbic system & hypothalamus
Ans. (4)
Ans. (1)
199. Which of the following statements are correct? 200. Which of the following are NOT under the control
A. An excessive loss of body fluid from the body of thyroid hormone?
switches off osmoreceptors.
B. ADH facilitates water reabsorption to prevent A. Maintenance of water and electrolyte balance
diuresis. B. Regulation of basal metabolic rate
C. ANF causes vasodilation. C. Normal rhythm of sleep-wake cycle
D. ADH causes increase in blood pressure.
D. Development of immune system
E. ADH is responsible for decrease in GFR.
Choose the correct answer from the options given E. Support the process of R.B.Cs formation
below: Choose the correct answer from the options given
(1) B, C and D only (2) A, B and E only
below:
(3) C, D and E only (4) A and B only
Ans. (1) (1) B and C only (2) C and D only
Hint NCERT XI Pg # 297 (3) D and E only (4) A and D only
Ans. (2)

23 - NEET - Code-F6 - Paper 2023

Uploaded by

Copyright:

Available Formats

You might also like

23 - NEET - Code-F6 - Paper 2023

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

23 - NEET - Code-F6 - Paper 2023

Uploaded by

Copyright:

Available Formats

FINAL NEET(UG)–2023 (EXAMINATION)

(Held On Sunday 7th MAY, 2023)

PHYSICS TEST PAPER WITH ANSWER & SOLUTIONS

CHEMISTRY TEST PAPER WITH ANSWER & SOLUTIONS

Co  NH3   NO3  

 CoCl 2 (en)2  NO3

Co  NH3    SO4 

Co  NH3   H2O  Br   NO3 

FINAL NEET(UG)–2023 (EXAMINATION)

BIOLOGY TEST PAPER WITH ANSWER & SOLUTIONS

(2) Psilotum and Salvinia Hint NCERT XII Pg # 243

Hint NCERT XII Pg # 201 explanation of A.

146. Match List I with List II : (2) A is true but R is false.

(1) A-II, B-IV, C-I, D-III by inhibiting the activity of

Ans. (1) of eye that regulates

options given below : (2) A-I, B-IV, C-III, D-II

Ans. (3) Ans. (4)

Hint NCERT XII Pg # 49 & 50 Hint NCERT XI Pg # 323 & 324

Ans. (1) (3) Statement I is false but Statement II is true.

You might also like