BAR ILAN UNIVERSITY

Department of Chemistry

MSc final thesis

Design microperoxidase-11 and its derivatives as selective ligands for

the binding of G-quadruplexes

This work was carried out under the supervision of Dr.Eyal Golub

Student name: Leen Massalha

ID: 319152294

1
 ‫אוניברסיטת בר אילן‬
‫המחלקה לכימיה‬

‫עבודת מחקר (תזה) לתואר השני‬

‫תכנון ועיצוב מיקרופרוקסידאז‪ 11-‬ונגזרותיו כליגנדים סלקטיביים לקישור של‬

‫‪G-quadruplexes‬‬

‫עבודה זו נעשתה בהדרכתו של ד"ר‪ :‬אייל גולוב‬

‫שם הסטודנטית‪ :‬לין מסאלחה‬

‫ת‪.‬ז‪319152294 .‬‬

‫‪2‬‬
Table of Contents
1. Abstract................................................................................................................................4
2. Introduction..........................................................................................................................6
2.1 Secondary structure of DNA in biology..............................................................................6
2.2. Guanine-quadruplex.........................................................................................................7
2.3. GQ-binding ligands……………………............................................………………...........10
2.4. Microperoxidases............................................................................................................14
3. Methods............................................................................................................................ 16
3.1. Circular dichroism spectroscopy.....................................................................................16
3.2. Electrophoretic mobility shift assay.................................................................................18
3.3. Crystallography...............................................................................................................18
3.4. Ultraviolet-visible spectroscopy.......................................................................................19
4. Experimental Section ........................................................................................................20
5. Preliminary Results............................................................................................................20
5.1. Characterization of the complexation between GQs and MP-11....................................20
5.2. Establishing the sequence specificity of MP-11 towards GQs........................................27
6. Conclusion……...…………………………….............……………………………………........28
7. Future plans.......................................................................................................................29
8. Abstract in hebrew.............................................................................................................30
9. References……...…………………………….............……………………………………...….31

3
1. Abstract

Guanine quadruplexes (GQs) are globular guanine-rich DNA structures that constitute
a unique family of biologically relevant DNA structures. GQs are widely present in all
life forms as they have been identified in both eukaryotic and prokaryotic cells. Their
formation inside cells have been associated with various fundamental biological
processes including the regulation of gene expression and transcription, protein
translation and proteolysis, DNA repair, maintenance of the stability of chromosome
ends, and epigenetic regulation. Interestingly, GQs have been implicated as an
accomplice in various diseases and syndromes including cancer, neurodegenerative
diseases, and genetic disorders, rendering GQs as highly interesting targets in drug
discovery.

Accordingly, many GQ-selective ligands have been developed with the potential for
either diagnostics or regulation of biological activity. These ligands target either the
ends of the G-tetrads via π stacking or bind to the grooves of the GQs via hydrophobic
and H-bonds. While these ligands often bind strongly to GQ, they rarely exhibit
specificity for individual GQ sequences. On the contrary, in cases of specific GQ
ligands, the binding constants are too low such that efficient binding inside cells may
not take place.
Accordingly, we are developing a novel family of metallopeptide ligands for GQs,
namely microperoxidases (MPs). MPs exhibit a versatile structure and functional
groups and can bind multiple regions within GQs simultaneously. Its structure includes
the heme group and a short peptide chain. The MP ligands exhibit a molecular
structure characterized by the heme moiety and a covalently attached peptide chain
containing multiple DNA-interacting amino acid residues. This unique structural
arrangement enables the ligands to engage in specific interactions, potentially
including π-π stacking and hydrogen bonding, with DNA. The planar and aromatic
nature of the heme moiety contributes to its potential role as a versatile recognition
element to the planar aromatic surfaces at the edges of GQs, suggesting the ligands'
suitability for various GQ sequences. Additionally, the metal center at the porphyrin
ring allows modulation modification. The unique structure and binding capabilities of
MPs make them essential players in biochemical systems.

4
Thus, this family is more likely to exhibit both high affinity and stability and have
specificity specification for GQ sequences along with high affinity. In this study, we
characterize the MP-11/GQ complexes formation and determine its properties using
various biophysical methods. MP-11/GQ complexes formation was characterized by
employing various biophysical methods including EMSA, CD, and UV-Vis, that clearly
indicated that MP-11 binds GQs selectively contrary to dsDNA and single-stranded
DNA.

Moreover, MP-11 exhibits binding preference towards specific GQ sequences bearing

specific topology, i.e., parallel one, implying on a specific spatial recognition between
the ligand and the GQ sequence. We have developed a model for the binding mode
based on comparison between the MP-11 ligand and the parent hemin subcomponent,
where the hemin moiety binds to the external tetrad and the peptide chain engages in
non-covalent interactions with the GQ. These results pave the way for further
development of the MP-11-based ligands with controlled specificity for certain GQ
sequences. This will include modification of either the peptide chain composition or
the metal ion identity in the porphyrin ring.

5
 2. Introduction:
2.1 Secondary structure of DNA in biology
Deoxyribonucleic acid (DNA) is a naturally occurring biopolymer that serves as the
repository of genetic information and is crucial for the sustenance of life. Its sequence
holds invaluable instructions that dictate the proper functioning of cells. DNA structure
consists of a single strand characterized by an arrangement of phosphodiester bonds,
which are linked to sugar-deoxyribose moieties, forming the backbone of the
biopolymer. Each of these sugar units is attached to one of four nitrogenous bases,
namely adenine (A), cytosine (C), guanine (G), or thymine (T). It is within this precise
amalgamation of components that the very essence of life is encoded.
Typically, the DNA is found in cells in the double helix form, where two complementary
DNA strands link up. These strands stay together because of two mutual hydrogen
bonds that bond the bases together in a specific manner. Adenine pairs with thymine,
while cytosine binds with guanine engaging in the classical Watson-Crick H-bonds

A C

Figure 1.
A.Watson-Crick and Hoogsteen hydrogen bonds in triplex DNA molecules. B. Noncanonical
DNA secondary structures: i-motif. Bottom right: a hemi-protonated cytosine-cytosine (C-C+)
base pair. C. A variety of triplex structures are shown involving three separate bases. Each
triplex includes two bases that form hydrogen bonds following the standard (Watson-Crick)
pattern (red), plus one additional base form base-pair where the interactions are stabilized by
Hoogsteen pairing (green).

6
interactions. Accordingly, the conventional understanding of the functions of DNA
revolves around its classic double helix conformation. However, the nucleobases can
engage in additional H-bonds interactions that can give rise to additional secondary
structures and configurations. Indeed, recent scientific exploration has unearthed a
plethora of alternative conformations that DNA can adopt. These include three-
stranded triplex DNA structures formed by a third strand binding to a double helix, i-
motifs where cytosine-rich form globular structure thanks to the protonation of cytosine
at acidic conditions, and guanine quadruplexes (GQs) (Blanco., 2017). These
structures play various roles in the cells and are of prominent importance during
processes where the DNA is unwinded from its chromatin configuration, and as such,
they play roles in gene regulation and DNA repair.

2.2 Guanine-quadruplex:
Guanine quadruplexes (GQs) are unique globular DNA structures enriched with
guanine that have been extensively studied in various organisms. The GQ structure
was initially discovered in the aggregation of guanine molecules in the 1960s rather
than in DNA, as opposed to the case of the well-known double helix (W. Eimer., 1992).
This aggregation of guanine molecules was the first catalyst for the identification and
understanding of the GQ structure. Subsequently, GQ structures were also found in
genomes and RNA of cells. Nowadays, the understanding of these structures has
significantly expanded, and they are at the forefront of research in cellular cognition
and genetic regulation (Jinglei X., 2021). The identification of the aggregation of
guanine-rich sequences into GQ structures during the 1960s marked a significant
advancement in our understanding of nucleic acid structures and paved the way for
ongoing investigations into the functional roles and applications of GQs in diverse
biological contexts. Through advanced next-generation sequencing methods, multiple
GQ sequences have been mapped in genomic DNA and within the chromatin of
different cell types and states.
The fundamental building block of GQs is the G-quartet, where four guanines form a
square planar structure held together by Hoogsteen hydrogen bonding. The GQ
grooves are the spaces between the stacked G-tetrads in a GQ structure. These
grooves is in different sizes: wide, narrow, and medium, along their helical structures
depending on a syn–anti, anti–anti (syn–syn), or anti–syn pattern between nucleobase
7
 Figure 2. A. Molecular structure of G-quartet and its main structural features. B. The
main 3 topologies of intramolecular GQs.

and the sugar moiety of adjacent residues within the G-quartet when going from H-
bond donor to H-bond acceptor. These G-tetrads are connected by DNA loops, it is
created by the hydrogen bonding interactions between the guanine bases within each
G-tetrad, and the grooves between them are where ligands, proteins, and other
molecules can interact with the GQ structure.
Stable GQ formation is driven by the stacking of 2-4 G-quartets, facilitated by
monovalent cations like Na+ and K+ in the central channel of the GQ. GQs can be
formed from the same strand (intramolecular) or different strands (intermolecular).
Also different GQ topologies can be formed originating from the polarity of the strands,
the number of stacked G-quartets, and the conformation of the guanine bases.
Different topologies include parallel intramolecular quadruplexes with uniform strand
polarity and propeller-type loops, antiparallel quadruplexes with two strands running
in opposite directions, and mixed topologies with one strand exhibiting a different
polarity, Figure 2. These GQ structures are prevalent in guanine-rich regions of the
human genome, such as gene promoters and telomeres, with studies of telomeric
repeats demonstrating GQ formation in G-rich repeats at the ends of telomeres.

Initial efforts aimed to demonstrate the biological significance of GQs by utilizing

advanced techniques such as next-generation sequencing, genome mapping, and
functional elucidation. In 2001, the presence of GQ structures in cells was confirmed
through immunostaining of telomeric GQs using a specific antibody (Schaffitzel, 2001).
The visualization of GQ structures in cells was mainly achieved through techniques
like immunofluorescence and immunocytochemistry. In these techniques, primary
antibodies that specifically recognize GQ structures are used to label the GQs within

8
cellular DNA. Then, secondary antibodies labeled with fluorophores are introduced to
bind to the primary antibodies. The fluorophores emit light when excited by a specific
wavelength, allowing researchers to visualize the location of GQ structures within the
cell (Dubrovin, 2022). Additionally, the development of GQ-specific single-chain
antibodies (scFv antibodies) enabled the mapping of DNA or RNA GQ sequences
within cells (Biffi, 2013). Since then, there have been additional direct visualization of
GQ formation in cells with various GQ-specific ligands. These findings collectively
provide substantial evidence supporting the existence of GQ structures in the genome.
GQ structures were found to be very dynamic in vivo and depend on the cell type and
the chromatin state (Spiegel, 2019). The formation of GQs within cells has been linked
to a diverse array of diseases and syndromes, such as their involvement in telomere
maintenance, gene expression regulation, and DNA replication, with their instability
linked to cancer development and progression. GQs in non-coding regions, like the
FMR1 gene, underlie genetic disorders such as Fragile X syndrome. In
neurodegenerative diseases like ALS and FTD, GQs in non-coding RNA contribute to
pathogenesis. GQs can also impact immune response regulation and have
implications in autoimmune disorders. GQ formation within the genome can potentially
reduce its mechanical stability, leading to DNA strand breaks and contributing to
genomic instability. During transcription and translation, GQs' presence can act as a
regulatory switch, either accelerating or inhibiting these processes based on their
stabilization or unwinding. Furthermore, GQs are often found at promoter regions of
key oncogenes, like Cmyc, Ckit and Kras and as such has a pivotal role in cancer

Figure 3. G-quadruplexes and their regulatory roles in biology.

development. In the chromosome the G-rich sequences are in an equilibrium between

9
dsDNA and GQ structures, where the stability of these structures is often modulated
by GQ binding proteins (GQBPs), thus exerting influence over a wide range of
biological processes. Various endogenous proteins, including helicases, transcription
factors, and epigenetic and chromatic repressors, have been discovered to interact
with DNA GQs, unraveling the intricate web of GQBP interactions and providing
invaluable insights into their biological roles (Spiegel, 2019). These proteins can be
categorized into three distinct types based on their effects on GQs: (i) proteins that
promote GQ formation or stabilization, (ii) proteins that unwind GQs, and (iii) proteins
that degrade GQs. Dysfunctions in GQBPs can significantly contribute to the
development of a multitude of diseases, underscoring the critical need to comprehend
the multifaceted roles of GQs and devise effective strategies to counteract their
detrimental effects, as well as understanding the role of the individual GQs. These
genes are challenging to target using traditional methods but developing ligands that
selectively interact with the GQ sequences offers a promising strategy to potentially
modulate gene expression and treat cancer. Thus, understanding the intricate
interplay between GQs and their interacting proteins not only sheds light on their roles
in normal cellular function but also opens avenues for therapeutic interventions in
various diseases. Consequently, there has been a surge of interest in the synthesis of
GQ-specific ligands, encompassing small molecules and engineered antibodies,
which hold great promise for diagnostic and therapeutic applications. By inhibiting
DNA damage and impeding growth arrest in cancer cells or identifying pivotal GQ sites
within the genome, these synthetic ligands have emerged as indispensable tools in
the exploration of the existence, functions, and associated activities of GQs within the
intricate realm of cellular processes.

2.3 GQ-binding ligands

There are mainly four types of ligands that bind GQs: (i) polyaromatic ligands, (ii)
metalloorganic ligands (metalloligands), (iii) macrocyclic ligands and (iv) (hetro)arenes
ligands.
GQ-binding molecular ligands contain multiple planar aromatic rings that bind to the
G-tetrads through π-π stacking and peripheral functional groups that interact with
surrounding nucleobases and pyranose rings through hydrogen bonding, and

10
electrostatic interactions, for instance telomestatin, pyridostatin, BRACO-19, and
berberine.
Another class of ligands are organometallic complexes where a polyaromatic ligand
coordinates to a central metal ion. Specifically, the complexes contain metal ions with
vacant d-orbitals that can form coordination complexes efficiently with the electron-
rich sites of the GQs, Such as: Co(III) Polypyridyl Complexes, Ni(II) Complexes, and
Cu(II) Complexes (Jaccoline., 2022).

Figure 4. GQ-ligands
mediated by different types of
interactions: (i) π-π stacking of
aromatic residues / molecules
onto the tetrad (face) of the GQ
or inter-tetrad intercalation, (ii)
groove binding, and (iii) loop
interactions.

Macrocyclic ligands are large, cyclic molecules with ring structures comprised of
covalently attached aromatic molecules that can effectively encircle and interact with
other molecules, particularly metal ions or biomolecules. They are known for their
ability to form stable complexes and exhibit high selectivity. These ligands can
influence GQ structures by binding to metal ions within the GQ through non-covalent
interactions, such as π-π stacking and hydrogen bonding and induce structural
changes, affecting their stability, conformation, and potential interactions with other
molecules. Some members are purely synthetic such as meso-tetrakis(N-methyl-4-
pyridyl)porphyrin (TMPyP4) or natural such as telomestatin, the secondary metabolite
isolated from Streptomyces Anulatus.
Additionally, arenes and heteroarenes ligand contain aromatic hydrocarbon rings, like
benzene, while heteroarenes contain aromatic rings with at least one non-carbon atom
in the ring, such as pyridine, thiophene and quinoline. They can bind to GQs through
π-π stacking interactions between their aromatic rings and the planar G-tetrads of the
GQ structure. These interactions allow them to stabilize or modulate the conformation
and stability of GQs, influencing their biological functions.
All these ligands can modulate the stability and conformational dynamics of GQ
structures. First, they can stabilize GQs by forming stable supramolecular complexes,

11
thereby preventing their unfolding or denaturation while exhibiting high melting
temperatures. On the other hand, some ligands can induce structural changes in GQs
by either modifying the three-dimensional arrangement of GQ structures in existing
topology or interconverting the GQs between different topologies, leading to the
formation of alternative GQ conformations or GQ unfolding. Their use in GQ research
provides valuable tools for studying GQ structures and functions. Ligands can
elucidate their interactions with the GQs, and, maybe, the biological role of the specific
GQs. Selective ligands that target specific GQ sequences or topologies hold potential
as therapeutic agents to modulate GQ-related cellular activities in diseases like
cancer. these ligands can selectively bind to GQ structures, stabilizing or destabilizing
them based on their interaction strengths and structural compatibility. This can lead to
modulation of GQ-related processes, impacting gene expression and cellular
functions.
Overall benefits of ligand use with GQ include understanding GQ biology, by studying
the interactions of different ligands with GQs, researchers can gain deeper insights
into the structure, dynamics, and functions of GQs, by forming a complex between
ligands and GQ, the activation or deactivation of gene and protein expression can be
effectively influenced and controlled. Ligands that selectively stabilize or destabilize
GQs hold promise as potential drug candidates for targeted therapies in diseases
where GQs play significant roles, such as cancer and neurodegenerative disorders.
Numerous GQ-selective ligands have been devised with potential applications in
diagnostics and the regulation of biological activity. These ligands exhibit diverse
modes of interaction, with a notable group known as "end-stackers" comprising
polyaromatic molecules that bind to the ends of G-tetrads via π stacking, including

12
BRACO-19, RHPS4, and telomestatin.

Figure 5. Structures of quadruplex-binding ligands.

In contrast, a distinct class of
ligands termed "groove binders". The groove in a GQ is the space or channel between
adjacent G-tetrads along the GQ structure. It is created by the hydrogen bonding
interactions between the guanine bases within each G-tetrad. The groove can be
visualized as a cavity or indentation running along the length of the GQ, formed by the
aligned edges of the G-tetrads. The groove in GQ plays a crucial role in various
biological functions and interactions. It serves as the site for specific ligands, ions
including potassium ions (K+) and sodium ions (Na+), or proteins to interact with the
GQ structure. The groove can accommodate various ligands, which can bind through
non-covalent interactions such as π-π stacking, hydrogen bonding, and electrostatic
interactions. Groove binders ligands can selectively bind to the grooves of GQs,
recognizing specific groove conformations in different DNA structures. Regrettably,
none of these ligands have successfully advanced to clinical trials due to their limited
drug-like properties and selectivity (Neidle, 2010). Despite efforts to develop potent
and selective groove binders, only a few examples have been reported in current
literature. While these ligands exhibit strong binding to GQs, they lack specificity and
possess low binding constants, potentially hindering efficient binding within cells. As a
result, we are striving to design a ligand capable of binding to both regions, featuring

13
a versatile structure and functional groups that offer high affinity, stability, and
specificity for GQ sequences. To achieve this, we plan to utilize a semisynthetic
metallopeptide ligand incorporating an aromatic moiety for end-stacking interactions
with GQs, along with a peptide chain capable of versatile interactions with the GQ
structure that has been designed to interact with and bind to the grooves of GQ
structures, that strategically designed to have complementary chemical properties that
allow it to fit into these grooves, forming a stable interaction.

2.4 Microperoxidases
Microperoxidases (MPs) have emerged as an intriguing class of molecules, offering
an attractive alternative to heme peroxidases (Khosraneh., 2007). One notable
example is MP-11, a semisynthetic undecamer derived from cytochrome c. MP-11
consists of a polypeptide chain that contains imidazole group, forming covalent
thioester bonds with cysteine residues, thereby binding a heme group. Additionally,
the imidazole side chain of histidine coordinates with the heme iron from the proximal
site whereas a water molecule occupies the distal site, resulting in a six-coordinate,
high-spin complex. The lability of the water molecule allows it to be replaced by other
tighter-binding species such H2O2 that activates its peroxidase activity. Despite its
minimalistic structure, MP-11 and its homologues exhibit remarkable peroxidase
activity, making them valuable models for studying heme active sites and investigating
the mechanisms of oxidoreductase reactions (Tanabe., 2018). This has spurred
extensive research on the application of MPs as oxidation catalysts in various
chemical and biochemical contexts (Ramanavicius A., 2008).
The spectral properties of MP-11, characterized through techniques such as UV-Vis
spectroscopy, stem from its heme moiety, which is known to undergo specific
electronic transitions. These transitions manifest as absorption bands in the UV-Vis
spectrum, providing valuable insights into MP-11's structural state and its interactions
with other molecules such as hydrogen peroxide, phenol and mesoporous silica
(MCM-41).
MP-11 have two main types of bands that provide insights into its electronic structure
and behavior. The Q bands, and the Soret band. The Q bands correspond to specific
absorption bands in the UV-Vis spectrum of MP, which arise from the electronic
transitions within its molecular structure. These bands reveal information about the
arrangement and interaction of electrons within the heme moiety of MP, allowing
14
researchers to discern various characteristics such as molecular conformation and
ligand binding. The Soret band, on the other hand, is a prominent absorption band
within the UV-Vis spectrum of MP, occurring in the shorter wavelength region. This
band arises from the electronic transition involving the heme's iron center, specifically
from the ground state to a higher-energy excited state. The Soret band's position and
intensity can provide valuable insights into the coordination environment of the heme
iron and any alterations in its electronic configuration due to interactions with ligands
or changes in the molecular environment. Both the Q bands and Soret band are
essential tools for studying MP's electronic properties, ligand interactions, and overall
molecular behavior.

Figure 6. Absorption spectrum of

the Soret and Q bands of MP.

In the context of MP-11, a notable phenomenon that comes to light is the

intermolecular aggregation observed within its structure. This intriguing aspect refers
to the propensity of multiple MP-11 molecules to form associations with each other,
culminating in the creation of aggregates within the solution. It arises from the
interaction between the heme moiety and the lysine at position 13 (the N-terminus) of
the MP-11 peptide, where the lysine acts as a sixth ligand binding to the heme by
replacing the labile water molecule and it is a function of the concentration.
Aggregation has implications that extend to MP-11's spectral properties, particularly
in its UV-Vis absorption profile. As these aggregates emerge, they influence the optical
and electronic behavior of MP-11, inducing shifts in absorption wavelengths and
modifications in the intensity of absorption bands. In the aggregated form the binding
of ligands to the distal, solution exposed face of the heme is essentially blocked, thus
reducing the affinity of MP-11 towards other ligands. To address this issue, acetylation
was employed, which can help prevent aggregation by modifying the N-terminal and
lysine residue within the peptide. This chemical alteration reduces the likelihood of

15
multiple MP-11 molecules binding to heme or other ligands simultaneously, minimizing
the formation of aggregates and stabilizing the individual MP-11 molecules in solution.
Additionally, the MPs compositional inherent flexibility allows for manipulation to
enhance their interactions with GQ structures. By modifying the metal ion within the
central porphyrin ring or introducing mutations within the peptide sequence, the
properties of MPs can be tailored to improve their binding affinity and specificity for
GQs. This versatility provides a powerful platform for the rational design and
development of ligands that can effectively interact
with and modulate GQ structures.

Figure 7. Cartoon representation of a putative structure

of MP-11 derived from cytochrome c crystal structure
(PDB: 1HRC).

3. Methods:
3.1. Circular dichroism spectroscopy
Circular dichroism (CD) spectroscopy is a vital analytical method utilized for studying
the chirality of molecules based on their optical properties. This technique leverages
the "Cotton Effect," a fundamental characteristic where an optically active molecule,
situated close to a chromophore, selectively absorbs circularly polarized light. By
measuring the difference in the absorption of left and right circularly polarized light in
optically active substances, CD spectroscopy detects CD signals associated with
chiral materials.
While CD signals are typically observed in naturally chiral substances, chirality can
also be induced when molecules are covalently bonded to a chiral chromophore or
placed within an asymmetric environment. CD spectroscopy can be applied to various
molecular structures, but it is especially favored in the scientific community for
investigating macromolecules, particularly proteins and nucleic acids.
CD spectroscopy has proven to be an effective tool for determining the topology of G-
quadruplexes (GQs), where each topology exhibits a distinct CD spectrum.
Additionally, the stability of GQs and their complexes with ligands can be assessed by
16
monitoring their thermal stability. By subjecting the GQ-ligand complexes to high
temperatures and observing the melting temperature, CD spectroscopy allows us to
evaluate the stability of these complexes. Through CD spectroscopy, we were able to
distinguish between different topologies of GQs, with MP (presumably a specific
ligand) showing a preference for particular topologies.
There are three main topologies: (i)Parallel GQs typically display a positive CD band
at around 260-290 nm and a negative CD band at approximately 240 nm. These bands
arise due to the arrangement of G-tetrads in a parallel orientation and the stacked
bases along the GQ structure. (ii) Antiparallel GQs exhibit characteristic CD signals
with a positive band at around 295 nm and a negative band at approximately 260 nm.
The specific CD pattern results from the orientation of G-tetrads in an antiparallel
manner and the stacked bases within the GQ structure. (iii) Hybrid GQs show a CD
spectrum with features that lie between those of parallel and antiparallel GQs. The CD
signal may have a positive band around 280 nm and a negative band at approximately
260 nm. The hybrid topology arises from a combination of parallel and antiparallel
arrangements within the GQ structure.

Figure 8. Types of GQ tertiary structures and their CD spectra with characteristics peaks
(S. suzuki., 2023).

17
3.2. Electrophoretic mobility shift assay
The gel electrophoresis mobility shift assay (EMSA) is a technique employed to
identify protein complexes with nucleic acids and assess their binding affinity. This
method serves as a fundamental tool for conducting a wide array of qualitative and
quantitative analyses, enabling the characterization of interacting systems. To perform
EMSA, solutions containing proteins and nucleic acids are combined, and the resulting
mixtures are subjected to electrophoresis under native conditions using either
polyacrylamide or agarose gel.
Following electrophoresis, the distribution of species containing nucleic acid is
determined, typically achieved through autoradiography of 32P-labeled nucleic acid.
While this approach is sensitive and feasible, it involves working with hazardous
radioisotopes and lacks ease of quantification. As an alternative, fluorescence-based
non-radioactive DNA sequences are utilized to overcome these challenges. This
substitution offers several advantages, including easier handling, timesaving, cost
reduction, and improved safety. By employing different concentrations, it becomes
possible to determine the binding constants of the protein-nucleic acid complexes
using EMSA gel.

3.3. Crystallography
Crystallography involves the investigation of how atoms are arranged and bonded
within crystalline solids, as well as the geometric layout of crystal lattices. In the past,
mineralogy and chemistry relied on crystal properties to identify different substances.
Nowadays, modern crystallography heavily relies on analyzing the diffraction of X-rays
by crystals, which act as optical gratings. By using X-ray crystallography, chemists can
unveil the internal structure and bonding arrangements of minerals and molecules,
including complex structures like proteins and DNA.

To achieve this, scientists measure the diffraction patterns produced by crystals when
exposed to X-rays, and from these patterns, they can extrapolate an electron density
map. This map allows them to construct a model of the crystallized sample in high
detail. As a result, valuable and precise structural data can be obtained, offering
important insights into the forces that stabilize various biomolecular complexes.

18
3.4. Ultraviolet-visible spectroscopy
Ultraviolet–visible spectroscopy (UV-Vis) is a technique that measures the absorption
of ultraviolet (UV) and visible (Vis) light by molecules. It is commonly used to analyse
the electronic transitions of compounds, providing information about their structure and
properties.
In the context of GQ, UV-Vis spectroscopy is used to study their structural
characteristics and stability. GQs exhibit unique UV-Vis absorption spectra due to the
presence of G-quartets and specific electronic transitions within the guanine bases.
By measuring the absorbance of UV and visible light at different wavelengths,
researchers can gain valuable insights into the folding, stability, and interactions of GQ
structures.
Melting temperature (Tm) of the GQ and the complex GQ/MP can be determined using
UV-vis spectroscopy by monitoring the changes in absorbance as the temperature is
gradually increased. Measuring the Tm allows us to understand the thermal stability
of GQ structures and their complexes with ligands, by comparing the Tm values of GQ
alone and the GQ-MP complex, one can assess how MP affects the stability of the GQ
structure, providing valuable insights into the interaction between the ligand and the
GQ.
The melting of GQW at 295 nm is depicted. Determining upper and lower baselines
is subjective. After baseline selection, the median line is drawn between the two
baselines. This median can be calculated using the formula: median (T) = (AU(T) +
AF(T))/2, where AU(T) and AF(T) are the baseline values of the unfolded and folded
species, respectively. The Tm corresponds to where the experimental curve crosses
the median line.
An alternative approach is determining the maximum of the first derivative of the
absorbance signal (Tmax). However, Tmax doesn't exactly correspond to the true Tm.
This distinction is significant, particularly for broad transitions. Once baselines are
established, absorbance versus temperature can be converted to "fraction folded"
versus temperature. The fraction folded (θ) ranges from 0 to 1, indicating θ = 0 for T
>> Tm, θ = 1 for T << Tm, and θ = 0.5 for T = Tm.

Eq. 1. The equation for calculating

the melting temperature.

19
4. Experimental section:
Characterization of the complexation between GQs and MP-11 with UV-vis and
circular dichroism spectroscopy:
Sample solutions containing 5 μM GQ in 10 mM tris and 50 mM KCl were prepared
and has undergone annealing in a PCR device in order to obtain the properly folded
and thermodynamically stable GQ structures. 5 μM of commercially available MP was
added in titration of 0.5 μM each add to 18 μM. In melting temperature experiments
we heated the samples from 20 0C to 95 0C and cooled them slowly to room
temperature.

Electrophoretic Mobility Shift Assay (EMSA) experiment:

EMSA experiment were carried out with 100 μM of MP and 5 μM GQ at RT for 30
minutes in Tris-acetate-EDTA (TAE) buffer which is a buffer solution containing a
mixture of tris base, acetic acid, and Ethylenediaminetetraacetic acid (EDTA).
Crystallography:
We performed crystallography experiments containing the complex and apo GQ under
different conditions of Natrix kit that has conditions that promote crystallization of
protein-DNA complexes by employing the sitting drop method. Specifically, GQW, 532
and CMYC_1 sequences were employed.
Peroxidase inhibition experiment:
Samples solution containing 0.1 μM MP-11 in 50 mM KCl and 10 mM tris, and 1 mM
2,2-azino-bis-3-ethylbenzothiazoline-6-sulphonic acid (ABTS2-) and different
concentration of GQ (0-15 μM). Absorbance was measured at 412 nm before and after
adding 300 μM of H2O2 In order to monitor the oxidation of ABTS2- to it corresponding
radical cation form.
5. Results:
5.1. Characterization of the complexation between GQs and MP-11
EMSA measurements confirmed the complex formed, you see that we have a shift
which can indicate the formation of the complex, Figure 9A.

20
 Name Sequence Topology Origin

cMYC_1 TGAGGGTGGGGAGGGTGGGGAA Parallel GQ Present on

the promoter
oncogene
VEGF GGGCGGGCCGGGGGCGGG Parallel GQ Naturally
occurring
cKit21 CGGGCGGGCGCGAGGGAGGGG Parallel GQ Naturally
occurring
cKit G4 AGGGAGGGCGCTGGGAGGAGGG Parallel GQ Naturally
occurring
EA2 CTGGGAGGGAGGGAGGGA Parallel GQ Naturally
occurring
EAD CTGGGTGGGTGGGTGGGA Parallel GQ Naturally
occurring
Htel AGGGTTAGGGTTAGGGTTAGGG Antiparallel GQ Naturally
occurring
Htel2 TAGGGTTAGGGTTAGGGTTAGGG Antiparallel GQ Naturally
occurring
424 GGGTTTTGGGTTGGGTTTTGGG Antiparallel GQ Synthetic
design
442 GGGTTTTGGGTTTTGGGTTGGG Antiparallel GQ Synthetic
design
TBA GGTTGGTGTGGTTGG Antiparallel GQ Synthetic
design
PW17 GGGTAGGGCGGGTTGGG Mixed Synthetic
type/hybrid of
design
both GQ
rPS2M GTGGGTAGGGCGGGTTGG Mixed Synthetic
type/hybrid of
design
both GQ
532 GGGTTTTTGGGTTGGGTTTGGG Mixed Synthetic
type/hybrid of
design
both GQ
GQW TTTGGGTAGGGCGGGTTGGG Mixed Synthetic
type/hybrid of
design
both GQ

21
Forward 5'-GACGTGTGGACTGTGA double helix Synthetic
dsDNA
design
Reverse 5'-TCACAGTCCACACGTC double helix Synthetic
dsDNA
design

Table 1. A Few GQ sequences were examined for their interactions with MP-11.

Moreover, the affinity towards dsDNA was significantly lower, suggesting that MP-11
binds better to GQs. This was corroborated by CD spectroscopy, Figure 9C, where
the chiral signal of the MP-11 increased dramatically in the presence of parallel GQ
with little change in the presence of dsDNA. Also, the unchanged CD bands of the
parallel topology upon GQ binding coupled with the sharp, increase in the CD signal
of the Soret band indicates that the MP-11 recognizes and locks the GQ in this state.
GQ name Tm for free GQ (0C) Tm for GQ/MP-11 (0C)
GQW 50 74
424 43 72
PW17 70 >90
PS2m 50 80
VEGF 65 >90
532 60 75

Table 2. Tm of GQ comparing to Tm of GQ/MP-11.

This trend was complemented by determining the ΔT M where ΔTM = GQ/MP-11 – GQ,
via monitoring the signal of the characteristic band of the GQ topologies (λmax, parallel
= 264 nm, λmax, antiparallel = 290 nm) with about ~15 ⁰C difference for parallel
sequences also, Figure 9B.

22
 Figure 9. A. EMSA gel of GQ/MP-11 complex. Lanes 1+2: MP alone at a concentration of
100 μM. Lanes 3+4: MP-11 in the presence of GQW sequence. The observed shift in the
presence of both components indicates the formation of the complex. B. CD melting curve
of c-MYC GQ in the presence and absence of MP-11. C. UV-vis spectra of MP-11 in the
presence and absence of c-MYC GQ and corresponding dsDNA control.

In order to better design MP-11-based ligands we wanted to first characterize the

binding mode of MP-11 to GQs. Accordingly, we examined both the hemin and peptide
chain separately. As the heme is known to bind to GQ as an axial ligand (Ibrahim.,
2019) a similar binding mode was assumed for the MP-11. If the heme of the MP-11
is binding as an axial ligand to the GQ then it will be blocked from binding to other
molecules, thus reducing their affinity. This can be easily measured by the formation
of an MP-11/complex through specific interactions. Published NMR and X-ray
crystallography structures of (metallo)porphyrins/GQ complexes revealed that these
ligands mainly bind GQs of parallel topologies via π-π stacking as they contain
sterically exposed G-tetrads (Ibrahim., 2019). Thus, we hypothesize that the exposed
distal site of the heme moiety of MP-11 will exhibit similar behavior. Indeed, GQ
binding was inhibited by blocking the distal site of MP-11 with imidazole, a ligand that

23
 coordinated the Fe ion of the heme. Similarly, monitoring the peroxidase activity of
MP-11 is also a good indication of complex formation as the rate-determining step for
the catalytic cycle involves the binding of H2O2 to the distal site. Indeed, the peroxidase
activity of the MP-11 was inhibited in the presence of GQ, implying that the distal site
is blocked due to the coordination of the GQ ligand, Figure 10. Thus, we postulate that
the heme cofactor binds to the GQ via the distal site to the external tetrad, similarly to
other porphyrins.
Initial concentrations of MP-11 were chosen at 0.5 µM and 1 µM was not successful,
to observe inhibition, we needs to be able to see different concentrations, Figure 10A.
The selected concentration of 0.1 µM yielded a successful and clearly visible inhibition
process for MP-11, Figure 10B.

A. B.

300 μM of H2O2 300 μM of H2O2

C.

300 μM of H2O2

Figure 10. A. Catalytic oxidation of ABTS2- by MP-11 in the presence of H2O2 and C-MYC
GQ.

To explore the role of the heme in the MP-11/GQ complex we will employ UV-Vis
spectroscopy experiments. In the absence of GQ binding, MP-11 is known to partially

24
homodimerize via nitrogenous ligands (Nterm and 13K) which leads to a low-spin
species with characteristic optical absorption bands, Figure 11. In the presence of
various GQs that bind MP-11, a clear spectral shift of the Q bands of MP-11 was
observed, with the appearance of a charge-transfer band at 625 nm, along with both
narrowing of the Soret band and a blue shift (~2 nm). These phenomena represent
both the monomerization of MP-11 as well as the transition of the heme moiety from
a low-spin to a high-spin state, presumably by exchanging the N-donor ligand with a
water molecule. In contrast to that, the addition of dsDNA or non-binding GQs yielded
a red shift of the Soret band with no apparent charge-transfer (CT) band, implying the
non-specific binding of the MP-11 to the DNA.

Figure 11. UV-vis spectra of

MP-11 in the presence and
absence of c-MYC GQ and
corresponding dsDNA control.

Performing the acetylation experiment to address the aggregation issue revealed that
MP-11 lost its specificity for GQ and also bound to dsDNA. Therefore, we hypothesize
that the N-terminal and N13 residues are involved in GQ binding, having a positive
influence. Additionally, the peptide provides non-specific binding to DNA.

Figure 12. A titration

graph by UV-vis
depicting that dsDNA
also binds to acetylated
MP-11.

25
The investigation of the peptide chain's role in binding GQs will commence by
examining its synergistic interactions with the heme moiety. Multiple potential effects
of the peptide chain will be considered. It can stabilize preformed GQ structures. Even
when GQs are already stable, the peptide chain can further enhance their stability. To
evaluate the impact of the peptide chain on complex stabilization, we will compare the
TM of GQ/MP-11 complexes to that of GQ/hemin complexes. Notably, we observed a
distinct shift in various sequences, Figure 13A, with a positive ΔTM, suggesting the
peptide chain's involvement in complex stabilization.

Such interconversions have been observed for different ligands and peptides implying
that a transition state might be involved. We will explore this transition by monitoring
both the CD signal of a specific topology as well as the UV-Vis spectrum of the formed
MP-11/GQ complex. When employing a non-MP-11-binding synthetic GQ sequence,
termed 424, that bears an antiparallel topology, an interconversion into a parallel
topology was observed at a temperature that is slightly lower than the T M of the free
GQ (43 ˚C and 47 ˚C, respectively), Figure 13B. TM of the formed complex were more
influenced by MP-11 as compared to the hemin suggesting that the peptide chain
plays an active role in both the conversion as well as the stabilization of the complex.

Figure 13. A. Normalized CD melting curves of c-KIT. B. CD melting curve at λ = 267 nm

of the parallel band of the 424 GQ and the influence of both hemin and MP-11.

26
 5.2.Establishing the sequence specificity of MP-11 towards GQs:
Topological interconversion: The topology of GQs is not static and can be attenuated
by various factors through different mechanisms. Many sequences have been shown
to alter their topology based on environmental factors such as pH and ion identity as
well as compositional ones including flanking bases. Moreover, in some cases, a
single sequence can adopt various structures simultaneously. Accordingly, an efficient
ligand should be able to bind the various topologies of a targeted sequence, either
stabilizing an existing topology or interconverting it. In fact, the selectivity for parallel
topologies was observed almost to all of the parallel-folded sequences. To verify that
the topological preference is general and not linked to certain sequences, several of
the measured sequences were folded in Na+-containing buffer instead of K+-containing
buffer. Under these conditions they adopted other topologies, albeit with lower
structural stability as compared with the K+ buffer. The addition of MP-11 in these
cases also led to binding of the GQs that was accompanied with a topological
conversion into a parallel topology, implying that MP-11 had structural preference for
parallel topology.
The binding of the MP-11 ligand to GQs with non-parallel topologies exhibited varied
affinities:
(1) GQ sequences that are characterized by hybrid topologies, feature a single exposed
site and another site that is covered with a single chain that blocks ligand binding to
that tetrad. These sequences displayed a degree of affinity for MP-11, although
lowered as compared to the parallel topologies. This interaction was accompanied by
a notable transition to a parallel configuration. This behavior contrasts with the system
of dsDNA, where the introduction of MP-11 didn’t induce significant changes in the
spectral profile of CD.
(2) GQ sequences that are characterized by antiparallel topologies have both of their
tetrad blocked by single-stranded chains. As observed in the UV-vis absorption
spectra, the addition of MP-11 did not lead to binding of MP-11 to GQ sequences that
exhibit parallel topology. Interestingly, MP-11 can be induced to bind certain anti-
parallel topology by co annealing them. It is observed that in the Tm of the 424 GQ
sequence, instead of unfolding it is gradually converted into a parallel topology, that is
accompanied with a characteristic changes in the UV-Vis absorption spectrum
marking the binding of the MP-11 peptide to the 424 sequence. Importantly, the
synergistic interactions between the peptide chain and the heme moiety of the MP-11
27
are observable as the Ttransition of GQ in the presence of MP-11 is lower at 5 ˚C as
compared in the presence of heme only. Also, the Tm(MP-11) is 5 ˚C higher as
compared with heme only. This implies that the peptide chain plays an important role
in initial binding to the GQ that both contributes both to the stabilization of the transition
as well as that of the final complex.

Figure 14. A. CD spectra showing the 532 sequence (Figure 10) as a hybrid sequence
that changes its’ structure upon binding to MP-11. B. A CD spectrum showing a 424
antiparallel sequence that doesn't bind to MP-11, since the loops are sterically hindered.

6.Conclusions:
GQ is a unique nucleic acid secondary structure composed of stacked guanine tetrads
that plays critical roles in various biological processes.
GQ structures are characterized by the presence of planar G-tetrads, stabilized by
Hoogsteen hydrogen bonding between guanine bases, and can form within guanine-
rich DNA or RNA sequences.
MPs are a class of molecules that have gained attention for their unique properties,
offering an attractive alternative to heme peroxidases. Specifically, MP-11 is a semi-
synthetic undecamer derived from cytochrome c, composed of a polypeptide chain
with covalent thioester bonds and a heme group that plays a central role in its function.
We aim to design MP and its derivatives as selective ligands for GQ binding holds the
potential to address various disease-related challenges.

The interactions were validated through spectral changes observed in the Q and Soret
bands using UV-Vis and CD spectroscopy, providing evidence of the binding between

28
 MP and GQ. In addition EMSA measurements confirmed the complex formed, due to
shift which can indicate the formation of the complex.
Comparison experiments with dsDNA and GQ revealed that MP exhibits specific
binding to GQ, as evidenced by the distinct spectral changes observed, which were
absent in the dsDNA experiments.
To enhance the development of MP-11-based ligands, we aimed to understand the
binding interactions between MP-11 and GQs. We conducted separate examinations
of hemin and the peptide chain. Remarkably, we detected a significant shift in multiple
sequences, characterized by a positive ΔTM, indicating the role of the peptide chain in
stabilizing the complex.
The topology of GQs is not static and can be attenuated by various factors through
different mechanisms. The selectivity for parallel topologies was observed almost to
all of the parallel-folded sequences, the addition of MP-11 led to binding of the GQs
that was accompanied with a topological conversion into a parallel topology, implying
that MP-11 had structural preference for parallel topology.
7.Future plans:
The preliminary results of our experiments indicate that there is complexation between
MP and certain sequences of GQ, indicating that there is specificity in topologies and
titration experiments have also demonstrated that GQ is highly specific for GQ.
Thus,our future plans include on further characterizing the biophysical properties of
the MP/GQ complexes. This includes:
1. Improve our understanding of the complex by identifying more GQ sequences and
their binding to MP. The binding constants between the complexes will be determined
by EMSA experiments with different concentrations of the complex
2. Determine the key residues that are essential for GQ binding by an alanine scan.
3. Determine the structure of the complex. We have generated several crystals of the
apo DNA and several semi-ordered aggregates of MP-11/GQ complexes that we will
be further screen to gain high quality crystals.
4. By introducing point mutations, we aim to improve MP binding to GQs by altering
composition and structure. Key positions that will be identified will be mutated into
generally DNA binding residues i.e., arginine and lysine. The rationale for this is that
inserting such residues in locations that influence either the kinetics of stability of the
complex are likely to have an impact over the complex formation and may also
participate in selection mechanisms.
29
 ‫‪ .8‬תקציר‪:‬‬
‫)‪ Guanine quadruplexes (GQs‬הם מבני ‪ DNA‬עשירים בגואנין כדוריים המהווים משפחה ייחודית‬
‫של מבני ‪ DNA‬רלוונטיים ביולוגית ‪ GQs .‬נוכחים באופן נרחב בכל צורות החיים שכן הם זוהו בתאים‬
‫איקריוטים ופרוקריוטיים כאחד‪ .‬היווצרותם בתוך התאים נקשרה לתהליכים ביולוגיים בסיסיים שונים‪,‬‬
‫כולל ויסות ביטוי ותעתוק גנים‪ ,‬תרגום חלבונים ופרוטוליזה‪ ,‬תיקון ‪ DNA,‬שמירה על יציבות קצוות‬
‫הכרומוזומים וויסות אפיגנטי‪ GQs .‬מעורבים במחלות ותסמונות שונות‪ ,‬כולל סרטן‪ ,‬מחלות ניווניות‬
‫עצביות והפרעות גנטיות‪ ,‬מה שהופך את ‪ GQs‬כיעדים מעניינים ביותר בגילוי תרופות‪.‬‬
‫בהתאם‪ ,‬פותחו ליגנים סלקטיביים רבים של ‪ GQ‬עם פוטנציאל לאבחון או ויסות של פעילות ביולוגית‪.‬‬
‫ליגנדים אלו מכוונים לקצוות ה ‪-G-tetrads‬באמצעות קשרי ‪ π‬או נקשרים לחריצים של ‪ GQs‬באמצעות‬
‫קשרי הידרופוביים וקשרי מימן ‪ .‬בעוד שליגנדים אלה נקשרים לעתים קרובות חזק ל ‪ ,GQ‬הם מפגינים‬
‫רק לעתים נדירות ספציפיות עבור רצפי ‪ GQ‬בודדים‪ .‬להיפך‪ ,‬במקרים של ליגנדים ספציפיים של ‪,GQ‬‬
‫קבועי הקישור נמוכים מדי כך שקישור יעיל בתוך התאים עלול שלא להתקיים‪.‬‬
‫בהתאם לכך‪ ,‬אנו מפתחים משפחה חדשה של ליגנים מטאלופפטידים עבור ‪,GQs‬‬
‫מיקרופרוקסידאזים )‪ .(MPs‬הם מציגים מבנה רב תכליתי וקבוצות פונקציונליות ויכולים לקשור מספר‬
‫אזורים בתוך ‪ GQs‬בו זמנית‪ .‬המבנה שלהם כולל את קבוצת ההמה ושרשרת פפטידים קצרה‪.‬‬
‫הליגנדים של ‪ MP‬מציגים מבנה מולקולרי המאופיין בחלקת ה ‪-heme‬ושרשרת פפטיד המחוברת‬
‫קוולנטית המכילה שיירי חומצות אמינו מרובים בעלי אינטראקציה עם ‪ .DNA‬סידור מבני ייחודי זה‪,‬‬
‫מאפשר לליגנדים לעסוק באינטראקציות ספציפיות‪ ,‬הכוללות פוטנציאל הקשירה ‪ π-π‬וקשירת מימן‪,‬‬
‫עם ‪ .DNA‬האופי המישורי והארומטי של חלק ההם תורם לתפקידו הפוטנציאלי כאלמנט זיהוי וורסטילי‬
‫למשטחים הארומטיים המישוריים בקצוות של ‪ ,GQs‬מה שמרמז על התאמתם של הליגנדים לרצפי‬
‫‪ GQ‬שונים‪ .‬בנוסף‪ ,‬מרכז המתכת בטבעת הפורפירין מאפשר שינוי מודולציה‪ .‬המבנה הייחודי ויכולות‬
‫הקישור של ‪ MPs‬הופכים אותם לשחקנים חיוניים במערכות ביוכימיות‪.‬‬
‫לפיכך‪ ,‬סביר יותר שמשפחה זו תציג גם זיקה וגם יציבות גבוהה ויש לה מפרט ספציפי לרצפי ‪ GQ‬יחד‬
‫עם זיקה גבוהה‪ .‬במחקר זה‪ ,‬אנו מאפיינים את היווצרות הקומפלקסים ‪ MP-11/GQ‬וקובעים את‬
‫תכונותיהם באמצעות שיטות ביו‪-‬פיזיקליות שונות‪ .‬היווצרות קומפלקסים ‪ MP-11/GQ‬אופיינה בשימוש‬
‫בשיטות ביו‪-‬פיזיקליות שונות כולל ‪ EMSA, CD‬ו ‪-UV-Vis,‬שהצביעו בבירור על כך ש ‪-MP-11‬קושר‬
‫‪ GQs‬באופן סלקטיבי בניגוד ל ‪-dsDNA‬ו ‪-DNA‬חד‪-‬גדילי‪.‬‬
‫יתר על כן ‪, MP-11‬מציג העדפה כלפי רצפי ‪ GQ‬ספציפיים הנושאים טופולוגיה ספציפית‪ ,‬מקבילה‪,‬‬
‫מה שמרמז על זיהוי מרחבי ספציפי בין הליגנד לרצף ‪ .GQ‬פיתחנו מודל למצב הקישור המבוסס על‬
‫השוואה בין הליגנד ‪ MP-11‬לבין חלק ההמין המקורי‪ ,‬שבו חלק ההמין נקשר לטטראד החיצוני‬
‫ושרשרת הפפטידים עוסקת באינטראקציות לא קוולנטיות עם ה ‪ .GQ‬תוצאות אלו סוללות את הדרך‬
‫לפיתוח נוסף של ליגנדים מבוססי ‪ MP-11‬עם ספציפיות מבוקרת עבור רצפי ‪ GQ‬מסוימים‪ .‬זה יכלול‬
‫מודיפקציות בשרשרת הפפטידים או בזהות המתכת בטבעת הפורפירין‪.‬‬

‫‪30‬‬
 9. References:
1. Biomolecules | Free Full-Text | G-Quadruplex-Binding Proteins: Promising Targets for
Drug Design. (n.d.). Retrieved August 23, 2023.

2. Bugaut, A., & Balasubramanian, S. (2008). A Sequence-Independent Study of the

Influence of Short Loop Lengths on the Stability and Topology of Intramolecular DNA
G-Quadruplexes. Biochemistry, 47(2), 689–697.

3. Burge, S., Parkinson, G. N., Hazel, P., Todd, A. K., & Neidle, S. (2006). Quadruplex
DNA: Sequence, topology and structure. Nucleic Acids Research, 34(19), 5402–
5415.

4. Burger, A. M., Dai, F., Schultes, C. M., Reszka, A. P., Moore, M. J., Double, J. A., &
Neidle, S. (2005). The G-Quadruplex-Interactive Molecule BRACO-19 Inhibits Tumor
Growth, Consistent with Telomere Targeting and Interference with Telomerase
Function. Cancer Research, 65(4), 1489–1496.

5. Extending Photoinduced Charge Separation Lifetimes by Using Supramolecular

Design: Guanine–Perylenediimide G-Quadruplex | Journal of the American Chemical
Society. (n.d.). Retrieved August 23, 2023.

6. Galli, S., Melidis, L., Flynn, S. M., Varshney, D., Simeone, A., Spiegel, J., Madden, S.
K., Tannahill, D., & Balasubramanian, S. (2022). DNA G-Quadruplex Recognition In
Vitro and in Live Cells by a Structure-Specific Nanobody. Journal of the American
Chemical Society, 144(50), 23096–23103.

7. G-quadruplexes: A promising target for cancer therapy | Molecular Cancer | Full Text.
(n.d.). Retrieved August 23, 2023.

8. G-quadruplexes are transcription factor binding hubs in human chromatin | Genome

Biology. (n.d.). Retrieved August 23, 2023.

9. Guanine quadruplex structures localize to heterochromatin | Nucleic Acids Research |

Oxford Academic. (n.d.). Retrieved August 23, 2023.
31
10. Haider, S., Parkinson, G. N., & Neidle, S. (2002). Crystal Structure of the Potassium
Form of an Oxytricha nova G-quadruplex. Journal of Molecular Biology, 320(2), 189–
200.

11. Huppert, J. L. (2010). Structure, location and interactions of G-quadruplexes. The

FEBS Journal, 277(17), 3452–3458.

12. Identifying G-Quadruplex-DNA-Disrupting Small Molecules | Journal of the American

Chemical Society. (n.d.). Retrieved August 23, 2023.

13. Jain, A. K., & Bhattacharya, S. (2011). Interaction of G-Quadruplexes with

Nonintercalating Duplex-DNA Minor Groove Binding Ligands. Bioconjugate
Chemistry, 22(12), 2355–2368.

14. Keating, L. R., & Szalai, V. A. (2004). Parallel-Stranded Guanine Quadruplex

Interactions with a Copper Cationic Porphyrin. Biochemistry, 43(50), 15891–15900.

15. Majee, P., Pattnaik, A., Sahoo, B. R., Shankar, U., Pattnaik, A. K., Kumar, A., &
Nayak, D. (2021). Inhibition of Zika virus replication by G-quadruplex-binding ligands.
Molecular Therapy - Nucleic Acids, 23, 691–701.

16. Matsumoto, K., Okamoto, K., Okabe, S., Fujii, R., Ueda, K., Ohashi, K., & Seimiya, H.
(2021). G-quadruplex-forming nucleic acids interact with splicing factor 3B subunit 2
and suppress innate immune gene expression. Genes to Cells, 26(2), 65–82.

17. Mergny, J.-L., & Lacroix, L. (2009). UV Melting of G-Quadruplexes. Current Protocols
in Nucleic Acid Chemistry, Chapter 17, 17.1.1-17.1.15.

18. Nanosecond Molecular Dynamics Simulations of Parallel and Antiparallel Guanine

Quadruplex DNA Molecules | Journal of the American Chemical Society. (n.d.).
Retrieved August 23, 2023.

32
19. Neidle, S., & Balasubramanian, S. (2006). Quadruplex Nucleic Acids. Royal Society
of Chemistry.
Nucleic Acid-metal Ion Interactions Google. (n.d.). Retrieved August 23, 2023.

20. On Characterizing the Interactions between Proteins and Guanine Quadruplex

Structures of Nucleic Acids. (n.d.). Retrieved August 23, 2023.

21. Promoter G-quadruplex folding precedes transcription and is controlled by chromatin |

Genome Biology. (n.d.). Retrieved August 23, 2023.

22. Ramanavicius, A., Kausaite, A., & Ramanaviciene, A. (2008). Enzymatic biofuel cell
based on anode and cathode powered by ethanol. Biosensors and Bioelectronics,
24(4), 761–766.

23. Rhodes, D., & Lipps, H. J. (2015). G-quadruplexes and their regulatory roles in
biology. Nucleic Acids Research, 43(18), 8627–8637.

24. Schaffitzel, C., Berger, I., Postberg, J., Hanes, J., Lipps, H. J., & Plückthun, A. (2001).
In vitro generated antibodies specific for telomeric guanine-quadruplex DNA react
with Stylonychia lemnae macronuclei. Proceedings of the National Academy of
Sciences, 98(15), 8572–8577.

25. Smirnov, I., & Shafer, R. H. (2000). Lead is unusually effective in sequence-specific
folding of DNA11Edited by I. Tinoco. Journal of Molecular Biology, 296(1), 1–5.

26. Sun, D., & Hurley, L. H. (2010). Biochemical Techniques for the Characterization of
G-Quadruplex Structures: EMSA, DMS Footprinting, and DNA Polymerase Stop
Assay. In P. Baumann (Ed.), G-Quadruplex DNA: Methods and Protocols (pp. 65–
79). Humana Press.

27. Tarsounas, M., & Tijsterman, M. (2013). Genomes and G-Quadruplexes: For Better
or for Worse. Journal of Molecular Biology, 425(23), 4782–4789.

33
28. Vorlíčková, M., Kejnovská, I., Sagi, J., Renčiuk, D., Bednářová, K., Motlová, J., &
Kypr, J. (2012). Circular dichroism and guanine quadruplexes. Methods, 57(1), 64–
75.

29. Yamashita, T., Uno, T., & Ishikawa, Y. (2005). Stabilization of guanine quadruplex
DNA by the binding of porphyrins with cationic side arms. Bioorganic & Medicinal
Chemistry, 13(7), 2423–2430.

34