G Model

TTBDIS-310; No. of Pages 5 ARTICLE IN PRESS

Ticks and Tick-borne Diseases xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Ticks and Tick-borne Diseases

journal homepage: www.elsevier.com/locate/ttbdis

Original article

Molecular characterization of Rickettsia massiliae and Anaplasma

platys infecting Rhipicephalus sanguineus ticks and domestic dogs,
Buenos Aires (Argentina)
Gabriel L. Cicuttin a,∗ , Diego F. Brambati a , Juan I. Rodríguez Eugui a ,
Cecilia González Lebrero a , María N. De Salvo a , Fernando J. Beltrán a ,
Federico E. Gury Dohmen a , Isabel Jado b , Pedro Anda b
a
Instituto de Zoonosis Luis Pasteur, Ministerio de Salud, Buenos Aires City, Argentina
b
Laboratorio de Espiroquetas y Patógenos Especiales, Centro Nacional de Microbiología, Instituto de Salud Carlos III, Madrid, Spain

a r t i c l e i n f o a b s t r a c t

Article history: Rickettsioses, ehrlichioses and anaplasmoses are emerging diseases that are mainly transmitted by
Received 16 November 2013 arthropods and that affect humans and animals. The aim of the present study was to use molecular
Received in revised form 25 February 2014 techniques to detect and characterize those pathogens in dogs and ticks from Buenos Aires city. We stud-
Accepted 4 March 2014
ied 207 Rhipicephalus sanguineus ticks and 52 canine blood samples from poor neighborhoods of Buenos
Available online xxx
Aires city. The samples were molecularly screened for the genera Rickettsia, Ehrlichia, and Anaplasma
by PCR and sequencing. DNA of Rickettsia massiliae (3.4%) and Anaplasma platys (13.5%) was detected
Keywords:
in ticks and blood samples, respectively. For characterization, the positive samples were subjected to
Rickettsia massiliae
Anaplasma platys amplification of a fragment of the 190-kDa outer membrane protein gene (spotted fever group rickett-
Buenos Aires siae) and a fragment of the groESL gene (specific for A. platys). A phylogenetic tree was constructed using
Rhipicephalus sanguineus the neighbor-joining method, revealing that the sequences were closely related to those of strains from
Dogs other geographic regions. The results indicate that human and animal pathogens are abundant in dogs
and their ticks in Buenos Aires city and portray the potentially high risk of human exposure to infection
with these agents, especially in poor neighborhoods, where there is close contact with animals in an
environment of poor health conditions.
© 2014 Elsevier GmbH. All rights reserved.

Introduction
Rickettsioses, ehrlichioses and anaplasmoses are infectious dis-
eases caused by Gram-negative obligate intracellular bacteria from
the order Rickettsiales (Dumler et al., 2001). These bacteria are
primarily transmitted by arthropods, and are considered to be
important emerging pathogens for both humans and animals
(Parola and Labruna, 2009).
Rickettsia massiliae is commonly associated with ticks of the
genus Rhipicephalus in different regions (Parola et al., 2008).
Pathogenicity associated with R. massiliae remained unknown for
many years, until it was first confirmed as a human pathogen in
2005 following a retrospective study conducted on archived sam-
ples obtained from a patient with rickettsiosis in the 1980s (Vitale
∗ Corresponding author at: Av. Díaz Vélez 4821, Ciudad Autónoma de Buenos Aires
C1405DCD, Argentina. Tel.: +54 11 4958 9941.
E-mail address: gcicuttin@gmail.com (G.L. Cicuttin).
et al., 2006). Few cases of human disease were confirmed by this
pathogen, although it has been implicated in numerous European
cases by serological methods (Vitale et al., 2006; Parola et al., 2008;
García-García et al., 2010; Renvoisé et al., 2012). Rickettsia massiliae
may also be a health threat to domestic dogs, causing clinical signs
that are similar to those of other canine rickettsioses (Beeler et al.,
2011).
Anaplasma platys is distributed worldwide and is transmitted by
ticks from the Rhipicephalus sanguineus complex. This bacterium is
the causative agent of canine infectious cyclic thrombocytopenia,
which is usually a mild disease, though virulence may vary from
region to region (de la Fuente et al., 2006; Abarca et al., 2007; Santos
et al., 2009). According to available knowledge, the role of A. platys
as a zoonotic pathogen remains inconclusive (Tamí and Tamí, 2004;
Abarca et al., 2007; Ramos et al., 2009).
In Argentina, 3 species of rickettsia (Rickettsia rickettsii, R. park-
eri, and R. massiliae) and one of ehrlichia (Ehrlichia chaffeensis)
have been described as being associated with clinical conditions
in humans. Additionally, R. amblyommii, R. bellii, R. felis, E. canis and

http://dx.doi.org/10.1016/j.ttbdis.2014.03.001
1877-959X/© 2014 Elsevier GmbH. All rights reserved.

Please cite this article in press as: Cicuttin, G.L., et al., Molecular characterization of Rickettsia massiliae and Anaplasma
platys infecting Rhipicephalus sanguineus ticks and domestic dogs, Buenos Aires (Argentina). Ticks Tick-borne Dis. (2014),
http://dx.doi.org/10.1016/j.ttbdis.2014.03.001
G Model
TTBDIS-310; No. of Pages 5 ARTICLE IN PRESS
2 G.L. Cicuttin et al. / Ticks and Tick-borne Diseases xxx (2014) xxx–xxx

Table 1
Primers used in this study.

Organism Name Target Sequence (5 –3 ) Ref

Rickettsia spp. RCK/23-5-F 23S-5S intergenic spacer GATAGGTCRGRTGTGGAAGCAC Jado et al. (2006)
RCK/23-5-R 23S-5S intergenic spacer TCGGGAYGGGATCGTGTGTTTC Jado et al. (2006)
Rickettsia spp. (spotted Rr190.70p ompA ATGGCGAATATTTCTCCAAAA Regnery et al. (1991)
fever group) Rr190.602n ompA AGTGCAGCATTCGCTCCCCCT Regnery et al. (1991)
Anaplasma-taceae family EHR16SD 16S rRNA GGTACCYACAGAAGAAGTCC Parola et al. (2000)
EHR16SR 16S rRNA TAGCACTCATCGTTTACAGC Parola et al. (2000)
Anaplasma platys PLA-HS475F groESL AAGGCGAAAGAAGCAGTCTTA Inokuma et al. (2002)
PLA-HS1198R groESL CATAGTCTGAAGTGGAGGAC Inokuma et al. (2002)

A. platys were detected in several regions of the country (Venzal
and Nava, 2011; Cicuttin et al., 2012; Eiras et al., 2013).
The aim of this study was to investigate the presence of Rick-
ettsia, Ehrlichia, and Anaplasma species in ticks and domestic dogs
from poor neighborhoods in Buenos Aires city, as well as to char-
acterize the positive samples.
Materials and methods
From November 2009 to February 2011, ticks and whole blood
samples were collected from domestic dogs (Canis familiaris) in
poor neighborhoods in Buenos Aires city. These areas are char-
acterized by the abundance of free-roaming dogs, high levels of
parasitism by ticks, and close human–animal coexistence.
Clinically healthy dogs were selected randomly from a subpo-
pulation of animals included in a surgical neutering program. With
the consent of the owners, blood samples were collected by jugular
or cephalic venipuncture with EDTA (ethylenediaminetetraacetic
acid) anticoagulant. Ticks were collected manually from each ani-
mal and identified by using previously described taxonomic keys
(Boero, 1957). All samples were stored at −70 ◦ C until processing.
Nymphs were grouped in pools of 3–6 specimens by dog,
and adults were processed individually. Each individual or pool
was resuspended in Tris–EDTA buffer, sectioned with scalpel, and
macerated. DNA extraction was performed by using the guanidine
thiocyanate method (Casas et al., 1995). DNA from whole-blood
samples was extracted by using the AxyPrep Multisource Genomic
DNA Miniprep Kit (Axygen Biosciences, USA), according to the man-
ufacturer’s instructions. Nuclease-free water was used as a negative
control for the extraction.
The initial screening for Rickettsia was performed by PCR that
amplifies a fragment of the 23S-5S rRNA intergenic spacer (Jado
et al., 2006). The size of the amplicon ranges from 329 bp in R. typhi
to 519 bp in R. helvetica. PCR-positive samples were further con-
firmed by amplifying an approximately 532-bp fragment of the
190-kDa outer membrane protein gene (ompA) (Regnery et al.,
1991). Rickettsia parkeri was used as a positive control. To detect
Ehrlichia and Anaplasma, a 345-bp fragment of the 16S rRNA was
amplified (Parola et al., 2000), and positives were confirmed by
an A. platys groESL gene-specific PCR protocol (724 bp) (Inokuma
et al., 2002). Anaplasma bovis was used as a positive control for 16S
rRNA PCR. No positive control was performed in A. platys groESL PCR
to avoid any source of sample contamination. Nuclease-free water
was used as a negative control. PCRs were performed according to
methods previously described by authors cited in Table 1.
PCR products were purified by using PureLinkTM Quick
Gel Extraction and PCR Purification Combo Kit (Invitrogen-Life
Technologies, Carlsbad, CA, USA) and sequenced with a 3500
Genetic Analyzer sequencer (Applied Biosystems, Foster City,
CA, USA) at the Servicio de Neurovirosis, Instituto Nacional de
Enfermedades Infecciosas (ANLIS Dr. Carlos G. Malbrán, CABA,
Argentina). Sequences obtained were first analyzed by using BLAST
(www.ncbi.nlm.nih.gov/blast). A phylogenetic analysis was further
performed using MEGA version 5 (Tamura et al., 2011). The DNA
sequences obtained (23S-5S rRNA intergenic spacer, ompA, 16S
rRNA, and groESL) were aligned with sequences available from Gen-
Bank. For each analyzed gene, a dendogram was constructed by
using neighbor-joining (NJ) with Kimura 2-parameter model. The
confidence values for individual branches of the resulting tree were
determined by bootstrap analysis with 1000 replicates. Branches
corresponding to partitions reproduced in less than 50% bootstrap
replicates were collapsed.
Nucleotide sequence accession numbers
Representative sequences obtained in this study have been
deposited in the GenBank database under the following accession
numbers: KC525896 (23S-5S intergenic spacer fragment of R. mas-
siliae), KC525893 (ompA gene fragment of R. massiliae), KC525894
(16S rRNA fragment of A. platys), and KC525895 (groESL gene frag-
ment of A. platys).
Results
A total of 52 domestic dogs was sampled, from which 207 ticks
(128 nymphs, 60 females, and 19 males) were collected. All ticks
were identified as belonging to the Rh. sanguineus complex.
PCR amplification of the 23S-5S intergenic space of Rickettsia
spp. was positive for 6 pools of nymphs and 1 male tick, whereas
it was negative for all dogs (Table 2). Positive ticks were collected
from 4 dogs. Sequencing of positive products was successful in 5/6
pools of nymphs and 1 male tick. The sequences were 100% identi-
cal to each other and to the corresponding partial sequence 23S-5S
rRNA of R. massiliae strain AZT80 (CP003319) and to Rickettsia sp.
Bar29 (AY125014) and 99.7% to R. massiliae MTU5 (CP000683).
Three of the 7 positive samples also tested positive for the ompA

Table 2
Summary of results obtained.

Total Rickettsia spp. F. Anaplasmataceae A. platys

n 23S-5S ompA 16S rRNA groESL

n % n % n % n %

Rh. sanguineus 207 7 3.4a 3/7 42.8 0 0 – –

Dogs 52 0 0 – – 7 13.5 7/7 100
a
Minimum infection rate.

Please cite this article in press as: Cicuttin, G.L., et al., Molecular characterization of Rickettsia massiliae and Anaplasma
platys infecting Rhipicephalus sanguineus ticks and domestic dogs, Buenos Aires (Argentina). Ticks Tick-borne Dis. (2014),
http://dx.doi.org/10.1016/j.ttbdis.2014.03.001
G Model
TTBDIS-310; No. of Pages 5 ARTICLE IN PRESS
G.L. Cicuttin et al. / Ticks and Tick-borne Diseases xxx (2014) xxx–xxx 3

Fig. 1. Phylogenetic tree inferred from comparison of the Rickettsia ompA (A) and Ehrlichia/Anaplasma groESL (B) partial sequences. The numbers at nodes are the bootstrap
values. The scale bar represents the difference in nucleotide sequences. Sequences obtained in this study are identified as KC525893 (ompA gene fragment of R. massiliae)
and KC525895 (groESL gene fragment of A. platys).

fragment. Sequencing of PCR products revealed 100% identity with Discussion

each other and with the ompA of R. massiliae strain 017 from Buenos
Aires city (JX101680), R. massiliae str. AZT80 (CP003319), Rickettsia
sp. Bar29 (U43792), and R. massiliae MTU5 (CP000683), among
other sequences. Analysis of sequencing data by the NJ method for
the ompA gene fragment is illustrated in Fig. 1A.
Blood samples from 7 dogs (13.5%) were positive for the 16S
rRNA PCR for Ehrlichia/Anaplasma. Twenty-one ticks (8 females,
3 males, and 10 nymphs) were collected from these animals.
However, all ticks were negative. All PCR products obtained were
sequenced, evidencing 100% identity with each other and with A.
platys isolate 165495 from Buenos Aires province (JX261979) and A.
platys Lara (AF399917), among other published sequences. Specific
fragments of A. platys groESL were also detected in the positive sam-
ples. Three positive products of the groESL gene were sequenced,
resulting in 100% identity with each other and with E. platys Lara
(AF399916), and 99.6% identity with A. platys isolate Santiago 17
(EF201806). Analysis of sequencing data by the NJ method for the
groESL gene fragment is illustrated in Fig. 1B.
To the best of our knowledge, this is the first report where dogs
and their ticks were evaluated simultaneously for the presence of
the genera Rickettsia, Ehrlichia, and Anaplasma in Buenos Aires city.
Our study provides strong evidence for the endemic presence of R.
massiliae and A. platys infecting ticks and dogs, respectively, in poor
neighborhoods in Buenos Aires city. The analysis of sequence data
showed high identity among positive products and high homol-
ogy to sequences previously found in the region and around the
world.
Rickettsia massiliae has been described infecting ticks of the
genus Rhipicephalus with different prevalences, 2.5–18% in Europe
and 5–6% in Africa from ticks collected from hosts (Psaroulaki
et al., 2003; Márquez et al., 2008; Sarih et al., 2008; Khaldi et al.,
2012), 25% in Israel from ticks collected from vegetation and ground
(Harrus et al., 2011), and more than 25% in the United States from
ticks collected by flagging, from ground, and from dogs (Eremeeva
et al., 2006; Beeler et al., 2011). These differences are possibly

Please cite this article in press as: Cicuttin, G.L., et al., Molecular characterization of Rickettsia massiliae and Anaplasma
platys infecting Rhipicephalus sanguineus ticks and domestic dogs, Buenos Aires (Argentina). Ticks Tick-borne Dis. (2014),
http://dx.doi.org/10.1016/j.ttbdis.2014.03.001
G Model
TTBDIS-310; No. of Pages 5 ARTICLE IN PRESS
4 G.L. Cicuttin et al. / Ticks and Tick-borne Diseases xxx (2014) xxx–xxx
related to the populations and tick species studied, the hosts, or
the environment from which they were collected and the diagnos-
tic methods used. Moreover, the levels of infection may vary among
unfed, partially, or fully fed ticks, since it is expected that fed ticks
may be infected with microorganisms circulating in the blood of
the host (Estrada-Peña et al., 2013). In a previous study conducted
in similarly poor areas from Buenos Aires city, 20% of ticks collected
from dogs tested positive for R. massiliae (Cicuttin et al., 2004). This
higher level of infection may be attributed to differences in the diag-
nostic methods used for testing (i.e., PCR combined with reverse
hybridization) or in the demography of dog and tick populations
under study. Phylogenetic analysis based on partial sequences of
the 23S-5S intergenic spacer and the ompA gene showed that all
positive samples shared 100% identity and were identical to strains
previously found in Buenos Aires city.
Previous studies in dogs with Rickettsia massiliae-infected Rh.
sanguineus revealed Rickettsia antibodies; however, it was not pos-
sible to detect nucleic acid in blood samples (Beeler et al., 2011).
This coincides with our observations. Interestingly, acute canine
infection with R. conorii and R. rickettsii produce rickettsiemia
detectable from day 2 to day 12 post infection, although canine
susceptibility to R. massiliae has not yet been proven, either clini-
cally nor experimentally (Cicuttin et al., 2004; Beeler et al., 2011).
Further studies with other more sensitive methods of detection are
necessary to elucidate the role of dogs as reservoirs.
Anaplasma platys has been found infecting domestic dogs in
several continents with differences in prevalence rates (e.g., 4–9%
in Europe; 16–20% in America) (de la Fuente et al., 2006; Abarca
et al., 2007; Santos et al., 2009; Cicuttin et al., 2012). Variations in
prevalence seem to be associated with differences in certain deter-
minants, such as the demography of dog populations, the type and
number of specimens tested, the extent of tick infestations, and the
used diagnostic methods (Cicuttin et al., 2012). In a previous study
conducted in similarly poor areas of Buenos Aires city, 33% of the
animals were found infected (Cicuttin et al., 2012). Differences in
infection rates between previous (33%) and current findings (13.5%)
are likely to be a consequence of variation in diagnostic meth-
ods and in the number of samples analyzed. Infections by A. platys
and E. canis have been recently reported in dogs in the vicinity of
Buenos Aires city, showing a compatible clinical picture (Eiras et al.,
2013). Sequence analyses of the 16S rRNA and groESL gene frag-
ments revealed high sequence homology among positive samples,
and also in comparison with isolates obtained in the surroundings
of Buenos Aires and in other countries.
Molecular detection of A. platys in ticks is poorly described in
the scientific literature (Inokuma et al., 2000; Sanogo et al., 2003).
Interestingly, this pathogen was detected infecting Rh. sanguin-
eus ticks in an urban area of Corrientes (north-eastern Argentina)
(Oscherov et al., 2011). No DNA of A. platys in ticks was detected in
the present study, and possible reasons for this are the differences
in the diagnostic methods used for testing (i.e., different methods
for nucleic acid extraction utilized or PCR combined with reverse
hybridization) and different tick populations studied.
In addition, our findings are consistent with reports that
revealed that the taxon Rh. sanguineus is represented by 2 lineages
in the Southern Cone of South America with a possibly different
vectorial competence, but more studies are needed to elucidate this
issue (Nava et al., 2012).
In terms of public health importance, the description of a
human case due to R. massiliae (García-García et al., 2010) and
the confirmation that Rh. sanguineus feed on humans from Buenos
Aires city (Cicuttin et al., 2011), highlights the importance of this
pathogen in the region. For A. platys, previous studies conducted
in Venezuela have identified the presence of morulae in the cyto-
plasm of platelets of HIV-seropositive patients, which showed
morphological characteristics similar to those observed in infected
Please cite this article in press as: Cicuttin, G.L., et al., Molecular characterization of Rickettsia massiliae and Anaplasma
platys infecting Rhipicephalus sanguineus ticks and domestic dogs, Buenos Aires (Argentina). Ticks Tick-borne Dis. (2014),
http://dx.doi.org/10.1016/j.ttbdis.2014.03.001
dogs, also detected by PCR, but without identifying the species of
ehrlichia or anaplasma involved (Tamí and Tamí, 2004). Recently,
A. platys was also detected in a veterinarian with clinical disease
(Maggi et al., 2013). Therefore, it is necessary to conduct further
studies to demonstrate its potential role as a zoonotic pathogen.
In conclusion, results obtained in this study indicate the pres-
ence of R. massiliae and A. platys in domestic dogs and their ticks
from Buenos Aires city. These findings are a valuable input to bet-
ter understand the ecoepidemiology of tick-borne pathogens in
urban areas, especially in those of low socioeconomic status, where
transmission from vector to man is facilitated by close contact with
animals in an environment of poor health conditions. In this con-
text, a multidisciplinary approach seems to be the most appropriate
strategy to respond to a multiplicity of determinants, for which
scientific research and sustained surveillance are necessary com-
ponents for success.
Acknowledgements
This work was partially supported by the Alberto J. Roemmers
Foundation (grant for medical research health medicine and epi-
demiology 2010).
References
Abarca, K., López, J., Perret, C., Guerrero, J., Godoy, P., Veloz, A., Valiente-Echeverría,
F., León, U., Gutjahr, C., Azócar, T., 2007. Anaplasma platys in dogs, Chile. Emerg.
Infect. Dis. 13 (9), 1392–1395.
Beeler, E., Abramowicz, K.F., Zambrano, M.L., Sturgeon, M.M., Khalaf, N., Hu, R., Dasch,
G.A., Eremeeva, M.E., 2011. A focus of dogs and Rickettsia massiliae-infected
Rhipicephalus sanguineus in California. Am. J. Trop. Med. Hyg. 84 (2), 244–249.
Boero, J.J., 1957. Ticks of Argentina (Acarina–Ixodoidea). Depto. Edit. Univ. Buenos
Aires, Buenos Aires, 113 pp.
Casas, I., Powell, L., Klapper, P.E., Cleator, G.M., 1995. New method for the extraction
of viral RNA and DNA from cerebrospinal fluid for use in the polymerase chain
reaction assay. J. Virol. Methods 53 (1), 25–36.
Cicuttin, G.L., Brambati, D.F., Rodríguez-Eugui, J., González-Lebrero, C., De Salvo,
M.N., Vidal, P., Gury-Dohmen, F.E., 2011. Hard ticks (Family Ixodidae) on domes-
tic dogs of the Buenos Aires city and Bahia Blanca (Argentina). In: Symposium
Proceedings. 2nd National Meeting on Neglected Diseases and XIV International
Symposium on Epidemiological Control of Vector-Borne Diseases, Buenos Aires,
Argentina, 2012, October 20–21. Fundación Mundo Sano.
Cicuttin, G.L., Rodríguez-Vargas, M., Jado, I., Anda, P., 2004. First detection of Rick-
ettsia massiliae in Buenos Aires city. Rev. Argent. Zoon. I (I), 8–10.
Cicuttin, G.L., Navarro O’Connor, M., Lobo, B., Jado, I., Anda, P., 2011. Molecular evi-
dence of Anaplasma platys in domestic dogs of the Autonomous City of Buenos
Aires. Rev. FAVE 10 (2), 19–24.
de la Fuente, J., Torina, A., Naranjo, V., Nicosia, S., Alongi, A., La Mantia, F., Kocan,
K.M., 2006. Molecular characterization of Anaplasma platys strains from dogs in
Sicily, Italy. BMC Vet. Res. 2, 24.
Dumler, J.S., Barbet, A.F., Bekker, C.P., Dasch, G.A., Palmer, G.H., Ray, S.C., Rikihisa, Y.,
Rurangirwa, F.R., 2001. Reorganization of genera in the families Rickettsiaceae
and Anaplasmataceae in the order Rickettsiales: unification of some species of
Ehrlichia with Anaplasma. Cowdria with Ehrlichia and Ehrlichia with Neorick-
ettsia, descriptions of six new species combinations and designation of Ehrlichia
equi and ‘HGE agent’ as subjective synonyms of Ehrlichia phagocytophila. Int. J.
Syst. Evol. Microbiol. 51, 2145–2165.
Eiras, D.F., Craviotto, M.B., Vezzani, D., Eyal, O., Baneth, G., 2013. First description of
natural Ehrlichia canis and Anaplasma platys infections in dogs from Argentina.
Comp. Immunol. Microbiol. Infect. Dis. 36 (2), 169–173.
Eremeeva, M.E., Bosserman, E.A., Demma, L.J., Zambrano, M.L., Blau, D.M., Dasch, G.A.,
2006. Isolation and identification of Rickettsia massiliae from Rhipicephalus sang-
uineus ticks collected in Arizona. Appl. Environ. Microbiol. 72 (8), 5569–5577.
Estrada-Peña, A., Gray, J.S., Kahl, O., Lane, R.S., Nijhof, A.M., 2013. Research on the
ecology of ticks and tick-borne pathogens – methodological principles and
caveats. Front. Cell. Infect. Microbiol. 3, 29.
García-García, J.C., Portillo, A., Núñez, M.J., Santibáñez, S., Castro, B., Oteo, J.A., 2010.
A patient from Argentina infected with Rickettsia massiliae. Am. J. Trop. Med.
Hyg. 82 (4), 691–692.
Harrus, S., Perlman-Avrahami, A., Mumcuoglu, K.Y., Morick, D., Baneth, G., 2011.
Molecular detection of Rickettsia massiliae. Rickettsia sibirica mongolitimonae
and Rickettsia conorii israelensis in ticks from Israel. Clin. Microbiol. Infect. 17
(2), 176–180.
Inokuma, H., Fujii, K., Okuda, M., Onishi, T., Beaufils, J.P., Raoult, D., Brouqui, P., 2002.
Determination of the nucleotide sequences of heat shock operon groESL and the
citrate synthase gene (gltA) of Anaplasma (Ehrlichia) platys for phylogenetic and
diagnostic studies. Clin. Diagn. Lab. Immunol. 9 (5), 1132–1136.
G Model
TTBDIS-310; No. of Pages 5 ARTICLE IN PRESS
G.L. Cicuttin et al. / Ticks and Tick-borne Diseases xxx (2014) xxx–xxx
Inokuma, H., Raoult, D., Brouqui, P., 2000. Detection of Ehrlichia platys DNA in brown
dog ticks (Rhipicephalus sanguineus) in Okinawa Island, Japan. J. Clin. Microbiol.
38 (11), 4219–4221.
Jado, I., Escudero, R., Gil, H., Jiménez-Alonso, M.I., Sousa, R., García-Pérez, A.L.,
Rodríguez-Vargas, M., Lobo, B., Anda, P., 2006. Molecular method for identifica-
tion of Rickettsia species in clinical and environmental samples. J. Clin. Microbiol.
44 (12), 4572–4576.
Khaldi, M., Socolovschi, C., Benyettou, M., Barech, G., Biche, M., Kernif, T.,
Raoult, D., Parola, P., 2012. Rickettsiae in arthropods collected from the
North African Hedgehog (Atelerix algirus) and the desert hedgehog (Paraech-
inus aethiopicus) in Algeria. Comp. Immunol. Microbiol. Infect. Dis. 35 (2),
117–122.
Maggi, R.G., Mascarelli, P.E., Havenga, L.N., Naidoo, V., Breitschwerdt, E.B., 2013. Co-
infection with Anaplasma platys. Bartonella henselae and Candidatus Mycoplasma
haematoparvum in a veterinarian. Parasit. Vectors 6, 103.
Márquez, F.J., Rodríguez-Liébana, J.J., Soriguer, R.C., Muniaín, M.A., Bernabeu-Wittel,
M., Caruz, A., Contreras-Chova, F., 2008. Spotted fever group Rickettsia in brown
dog ticks Rhipicephalus sanguineus in southwestern Spain. Parasitol. Res. 103 (1),
119–122.
Nava, S., Mastropaolo, M., Venzal, J.M., Mangold, A.J., Guglielmone, A.A., 2012.
Mitochondrial DNA analysis of Rhipicephalus sanguineus sensu lato (Acari:
Ixodidae) in the Southern Cone of South America. Vet. Parasitol. 190 (3–4),
547–555.
Oscherov, E.B., Milano, A.M.F., Lobo, B., Anda, P., Escudero, R., 2011. Detection of
Anaplasma platys and other pathogens in ectoparasites from urban hosts in
Northeast Argentine. Rev. Ibero-Latinoam. Parasitol. 70 (1), 42–47.
Parola, P., Roux, V., Camicas, J.L., Baradji, I., Brouqui, P., Raoult, D., 2000. Detection
of ehrlichiae in African ticks by polymerase chain reaction. Trans. R. Soc. Trop.
Med. Hyg. 94, 707–709.
Parola, P., Labruna, M.B., 2009. Tick-borne rickettsioses in America: unanswered
questions and emerging diseases. Curr. Infect. Dis. Rep. 11 (1), 40–50.
Parola, P., Socolovschi, C., Jeanjean, L., Bitam, I., Fournier, P.E., Sotto, A., Labauge, P.,
Raoult, D., 2008. Warmer weather linked to tick attack and emergence of severe
rickettsioses. PLoS Negl. Trop. Dis. 2 (11), e338.
Please cite this article in press as: Cicuttin, G.L., et al., Molecular characterization of Rickettsia massiliae and Anaplasma
platys infecting Rhipicephalus sanguineus ticks and domestic dogs, Buenos Aires (Argentina). Ticks Tick-borne Dis. (2014),
http://dx.doi.org/10.1016/j.ttbdis.2014.03.001
5
Psaroulaki, A., Spyridaki, I., Ioannidis, A., Babalis, T., Gikas, A., Tselentis, Y., 2003.
First isolation and identification of Rickettsia conorii from ticks collected in the
tregion of Fokida in central Greece. J. Clin. Microbiol. 41 (7), 3317–3319.
Ramos, C.A., Ramos, R.A., Araújo, F.R., Guedes, D.S., Souza, I.I., Ono, T.M., Vieira, A.S.,
Pimentel, D.S., Rosas, E.O., Faustino, M.A., Alves, L.C., 2009. Comparison of nested-
PCR with blood smear examination in detection of Ehrlichia canis and Anaplasma
platys in dogs. Rev. Bras. Parasitol. Vet. 18 (1), 58–62.
Regnery, R.L., Spruill, C.L., Plikaytis, B.D., 1991. Genotypic identification of rickett-
siae and estimation of intraspecies sequence divergence for portions of two
rickettsial genes. J. Bacteriol. 173 (5), 1576–1589.
Renvoisé, A., Delaunay, P., Blanchouin, E., Cannavo, I., Cua, E., Socolovschi, C., Parola,
P., Raoult, D., 2012. Urban family cluster of spotted fever rickettsiosis linked
to Rhipicephalus sanguineus infected with Rickettsia conorii subsp. caspia and
Rickettsia massiliae. Ticks Tick Borne Dis. 3 (5–6), 388–391.
Santos, F., Coppede, J.S., Pereira, A.L., Oliveira, L.P., Roberto, P.G., Benedetti, R.B.,
Zucoloto, L.B., Lucas, F., Sobreira, L., Marins, M., 2009. Molecular evaluation of
the incidence of Ehrlichia canis, Anaplasma platys and Babesia spp. in dogs from
Ribeirão Preto, Brazil. Vet. J. 179 (1), 145–148.
Sanogo, Y.O., Davoust, B., Inokuma, H., Camicas, J.L., Parola, P., Brouqui, P., 2003.
First evidence of Anaplasma platys in Rhipicephalus sanguineus (Acari: Ixodida)
collected from dogs in Africa. Onderstepoort J. Vet. Res. 70 (3), 205–212.
Sarih, M., Socolovschi, C., Boudebouch, N., Hassar, M., Raoult, D., Parola, P., 2008.
Spotted fever group rickettsiae in ticks, Morocco. Emerg. Infect. Dis. 14 (7),
1067–1073.
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5:
molecular evolutionary genetics analysis using maximum likelihood, evolution-
ary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739.
Tamí, C.D., Tamí, I.C., 2004. Morphological identification of Ehrlichia sp. in platelets
from patients infected with human immunodeficiency virus in Venezuela. Rev.
Panam. Salud Publica 16 (5), 345–349.
Venzal, D.J.M., Nava, S., 2011. The genus Rickettsia causing zoonoses in the Southern
Cone of South America. Rev. Med. Urug. 27, 98–106.
Vitale, G., Mansuelo, S., Rolain, J.M., Raoult, D., 2006. Rickettsia massiliae human
isolation. Emerg. Infect. Dis. 12 (1), 174–175.