(Original PDF) Campbell Biology 11th

Australian and New Zealand Edition

Visit to download the full and correct content document:
https://ebooksecure.com/download/original-pdf-campbell-biology-11th-australian-and-
new-zealand-edition/
 eleventh Edition

campbell
B IOLO G Y
Australian and New Zealand Version

U r ry • m e y e r s • c a i n
wa s s e r m a n • m i n o r s k y • r e e c e

Copyright © Pearson Australia (a division of Pearson Australia Group Pty Ltd) 2018—9781488613715—Urry/Campbell Biology 11e
 changes in technology and knowledge in the fields of
genomics, gene editing technology (CRISPR), evolutionary
biology, microbiology, and more. In addition, significant
revisions to Unit 8, Ecology, improve the conceptual
framework for core ecological topics (such as population
growth, species interactions, and community dynamics)
and more deeply integrate evolutionary principles.
Our Hallmark Features
Teachers of general biology face a daunting challenge: to help
students acquire a conceptual framework for organising an ever-
expanding amount of information. The hallmark features of
Campbell BIOLOGY provide such a framework, while promoting
a deeper understanding of biology and the process of science.
Chief among the themes of Campbell BIOLOGY is evolution.
Each chapter of this text includes at least one Evolution section
that explicitly focuses on evolutionary aspects of the chapter
material, and each chapter ends with an Evolution Connection
Question and a Write About a Theme Question.
To help students distinguish the “forest from the trees”,
each chapter is organised around a framework of three to seven
carefully chosen Key Concepts. The text, Concept Check
Questions, Summary of Key Concepts, and MasteringBiology
resources all reinforce these main ideas and essential facts.
Because text and illustrations are equally important for learn-
ing biology, integration of text and figures has been
a hallmark of this text since the First Edition. In addition to the
new Visualising Figures, our popular Exploring Figures and Make
Connections Figures epitomise this approach. Each Exploring
Figure is a learning unit of core content that brings together re-
lated illustrations and text. Make Connections Figures reinforce
fundamental conceptual connections throughout biology, help-
ing students overcome tendencies to compartmentalise informa-
tion. The Eleventh Edition features two new Make Connections
Figures. There are also Guided Tour Figures that walk students
through complex figures as an instructor would.
To encourage active reading of the text, Campbell BIOLOGY
includes numerous opportunities for students to stop and think
about what they are reading, often by putting pencil to paper to
draw a sketch, annotate a figure, or graph data. Active reading
questions include Visual Skills Questions, Draw It Questions,
Make Connections Questions, What If? Questions, Figure Leg-
end Questions, Summary Questions, Synthesise Your Knowl-
edge Questions, and Interpret the Data Questions. Answering
these questions requires students to write or draw as well as
think and thus helps develop the core competency of communi-
cating science.
Finally, Campbell BIOLOGY has always featured scientific
inquiry, an essential component of any biology course. Com-
plementing stories of scientific discovery in the text narrative
Copyright © Pearson Australia (a division of Pearson Australia Group Pty Ltd) 2018—9781488613715—Urry/Campbell Biology 11e
and the unit-opening interviews, our standard-setting Inquiry
Figures deepen the ability of students to understand how we
know what we know. Scientific Inquiry Questions give stu-
dents opportunities to practise scientific thinking, along with
the Problem-Solving Exercises, Scientific Skills Exercises, and
Interpret the Data Questions.
MasteringBiology, the most widely used online assessment
and tutorial program for biology, provides an extensive library of
homework assignments that are graded automatically. In addi-
tion to the new Figure Walkthroughs, Problem-Solving
Exercises, and Visualising Tutorials, MasteringBiology
offers Dynamic Study Modules, Adaptive Follow-Up Assign-
ments, Scientific Skills Exercises, Interpret the Data Questions,
Solve It Tutorials, HHMI BioInteractive Short Films, BioFlix®
Tutorials with 3-D Animations, Experimental Inquiry Tutorials,
Interpreting Data Tutorials, BLAST Tutorials, Make Connec-
tions Tutorials, Video Field Trips, Video Tutor Sessions, Get Ready
for Biology, Activities, Reading Quiz Questions, Student Miscon-
ception Questions, Test Bank Questions, and MasteringBiology
Virtual Labs. MasteringBiology also includes the Campbell
BIOLOGY eText, Study Area, Instructor Resources, and Ready-
to-Go Teaching Modules. See pages xxi–xxiii and
www.masteringbiology.com for more details.
Our Partnership with Instructors
and Students
A core value underlying our work is our belief in the importance
of a partnership with instructors and students. One primary
way of serving instructors and students, of course, is providing
a text that teaches biology well. In addition, Pearson offers a
rich variety of instructor and student resources, in both print
and electronic form (see pages xx–xxiv). In our continuing
efforts to improve the book and its supplements, we benefit
tremendously from instructor and student feedback, not only
in formal reviews from hundreds of scientists, but also via email
and other avenues of informal communication.
The real test of any textbook is how well it helps instructors
teach and students learn. We welcome comments from both
students and instructors. Please address your suggestions to:
Lisa Urry (Chapter 1 and Units 1–3)
lurry@mills.edu
Michael Cain (Units 4, 5, and 8)
mcain@bowdoin.edu
Peter Minorsky (Unit 6)
pminorsky@mercy.edu
Steven Wasserman (Unit 7)
stevenw@ucsd.edu
PREFACE vii
Highlights of New Content

T his section highlights selected new content and pedagogical

changes in Campbell BIOLOGY, Eleventh Edition.
Visual Skills Question with Figure 13.6 asks students to identify
where in the three life cycles haploid cells undergo mitosis, and
what type of cells are formed. Chapter 14 includes new informa-
tion from a 2014 genomic study on the number of genes and
CHAPTER 1 Evolution, the Themes of Biology,
genetic variants contributing to height. Figure 14.15b now uses
and Scientific Inquiry “inability to taste PTC” rather than “attached earlobe.” Chapters
Chapter 1 introduces Australia’s western pygmy possum, and 14 and 15 are more inclusive, clarifying the meaning of the term
the kind of suspended animation (torpor) it uses to wait out “normal” in genetics and explaining that sex is no longer thought
poor weather. New text and a new photo (Figure 1.12) relate to be simply binary. Other updates in Chapter 15 include new
climate change to species survival. research in sex determination and a technique being developed
to avoid passing on mitochondrial diseases. New Visualising
Figure 16.7 shows students various ways that DNA is illustrated.
UNIT 1 THE CHEMISTRY OF LIFE Chapter 17 has a new opening photo and story about albino don-
In Unit 1, new content engages students in learning this keys to pique student interest in gene expression. To help students
foundational material. The opening of Chapter 3 and new understand the Beadle and Tatum experiment, new Figure 17.2
Figure 3.7 show organisms affected by loss of Arctic sea ice explains how they obtained nutritional mutants. A new Problem-
and impacts on Antarctica. Chapter 5 has updates on lactose Solving Exercise asks students to identify mutations in the insulin
intolerance, trans fats, gene and predict their effect on the protein.
the effects of diet on Figure 3.7 Effects of climate change Chapters 18–21 are extensively updated, driven by exciting
blood cholesterol, on the Arctic. new discoveries based on DNA sequencing and gene-editing
protein sequences technology. Chapter 18 has updates on histone modifications,
and structures, and Species that are benefitting from loss of ice:
nuclear location and the persistence of transcription factories,
More light and warmer Bowhead Some fish species,
intrinsically dis- waters result in more
phytoplankton, which
whales, which feed
on plankton they
such as capelin,
benefit from
chromatin remodelling
ordered proteins. are eaten by
other organ-
filter, are thriving. having more
plankton to by ncRNAs, long noncod- Figure 20.14 Gene editing
isms. eat.
Students learn Species being harmed
by loss of ice:
ing RNAs (lncRNAs), the using the CRISPR-Cas9 system.
about exoplanets Loss of ice has
Russia
Arctic
role of master regulatory
reduced feeding
and recent potential opportunities for
polar bears, which
ocean
Extent of sea ice in Sept. 2014 genes in modifying chro- Cas9 protein Guide RNA engineered to
“guide” the Cas9 protein
evidence for life on hunt from the ice.
Bering
Extent of sea ice in Sept. 1979
matin structure, and the to a target gene

Mars. A new Prob- The Pacific walrus depends

on the ice to rest; its
Strait
North Pole possible role of p53 in the 5′
lem-Solving Exercise fate is uncertain. Greenland
low incidence of cancer 3′
Complementary
engages students by cannot
Black guillemots in Alaska
fly from their nests Alaska in elephants. Chapter 19 Active sites that
sequence that can
bind to a target gene
on land to their fishing
having them com- grounds at the edge
of the ice, which is features a new section that can cut DNA

pare DNA sequences young now too far from land;

birds are starving.
Canada
covers bacterial defences
Cas9–guide RNA complex

in a case of possible Sea ice in Sept. 2014

Ice lost from Sept.
against bacteriophages 1 Cas9 protein
and guide RNA
fish fraud. 1979 to Sept. 2014
and describes the CRISPR- are allowed to
bind to each other,
forming a complex
Cas9 system (Figure 19.7); that is then introduced
into a cell.
updates include the Ebola,
UNIT 2 THE CELL Chikungunya, and Zika
CYTOPLASM
Our main goal for this unit was to enhance accessibility for viruses (Figure 19.10) and
students. New Visualising Figure 6.32 shows the profusion of discovery of the largest Cas9 active sites NUCLEUS
molecules and structures in a cell, all drawn to scale. In C­ hapter virus known to date. A Guide RNA
complementary
7, a new figure illustrates levels of LDL receptors in people with discussion has been added sequence

and without familial hypercholesterolaemia. Chapter 8 ­includes of mosquito transmission 2 In the nucleus, the 5′ 5′
3′
complementary 3′ 5′
a beautiful new photo of a geyser with thermophilic bacteria in of diseases and concerns sequence of the
guide RNA binds to part
Figure 8.17, bringing to life the graphs of optimal temperatures about the effects of global of the target gene. The
active sites of the Cas9 Part of the
for enzyme function. Chapter 10 discusses current research try- climate change on disease protein cut the DNA
on both strands.
target gene

ing to genetically modify rice (a C3 crop) so that it is capable of transmission. Chapter 20 Resulting cut
in target gene
carrying out C4 photosynthesis to increase yields. Chapter 11 has a new photo of next-
includes a new Problem-Solving Exercise that guides students generation DNA sequenc-
through assessing possible new treatments for bacterial infec- ing machines (Figure 20.2)
3 The broken strands
tions by blocking quorum sensing. In Chapter 12, the mecha- and a new illustration of of DNA are “repaired” Normal
(functional)
by the cell in one
nism of chromosome movement in bacteria has been updated the widely used technique of two ways: gene for use
as a template
and more cell cycle control checkpoints have been added. of RNA sequencing OR

(Figure 20.13). A new sec- Scientists can disable

tion titled Editing Genes
UNIT 3 GENETICS and Genomes has been
In Chapters 13–17, we have incorporated changes that help added describing the
(“knock out”) the target gene
to study its normal function.
No template is provided, and
repair enzymes insert and/or
delete random nucleotides,
making the gene nonfunctional.
If the target gene has a
mutation, it can be repaired
by providing a normal copy
of the gene. Repair enzymes
use the normal gene as a
template and synthesise the
correct gene sequence.

students to grasp the more abstract concepts of genetics and their CRISPR-Cas9 system Random nucleotides Normal nucleotides
chromosomal and molecular underpinnings. For example, a new (Figure 20.14) that has

viii

Copyright © Pearson Australia (a division of Pearson Australia Group Pty Ltd) 2018—9781488613715—Urry/Campbell Biology 11e
been developed to edit genes in living cells. Finally, the discussion
of ethical considerations has been updated to include a recent
report of scientists using the CRISPR-Cas9 system to edit a gene in
human embryos, along with a discussion of the ethical questions
raised by such experiments, such as its usage in the gene drive
approach to combat carrying of diseases by mosquitoes. In Chap-
ter 21, in addition to the usual updates of sequence-related data
(speed of sequencing, number of species’ genomes sequenced,
etc.), there are several research updates, including some early
results from the new Roadmap Epigenomics Project and results
from a 2015 study focusing on 414 important yeast genes.
UNIT 4 MECHANISMS OF EVOLUTION
A major goal for this revision was to strengthen how we help
students understand and interpret visual representations of
evolutionary data and concepts. Towards this end, we have
added a new figure (Figure 25.8), “Visualising the Scale of
Geological Time,” and a new figure (Figure 23.13) on gene
flow. Several figures have been revised to improve the
presentation of data, including Figure 24.6 (on reproductive
isolation in mosquitofish), Figure 24.10 (on allopolyploid
speciation), and Figure 25.36 (on the origin of the insect body
plan). The unit also features new material that describes the
Ediacaran fauna and early life on Earth that we know from
Australian fossil materials, a new discussion in Chap­ter 24
on the impact of climate change on hybrid zones, and a new
Problem-Solving Exercise in Chapter 24 on how hybridisation
may have led to the spread of insecticide resistance genes
in mosquitoes that transmit malaria. The unit also includes
new chapter-opening stories in Chapter 22 (on a moth
whose features illustrate the concepts of unity, diversity, and
adaptation) and Chapter 25 (on the discovery of whale bones
in the Sahara Desert). Additional changes include new text in
­Concept 22.3 emphasising how populations can evolve over
short periods of time, a new table (Table 23.1) highlighting
the five ­conditions required for a population to be in Hardy-
Weinberg equilibrium, and new material in Chapter 25
introducing the newly discovered continent of Zealandia, and
the implications it holds for New Zealand biota.
Figure 23.13 Gene flow and local adaptation in the
Lake Erie water snake (Nerodia sipedon).
ONTARIO
Detroit
LAKE ERIE
OHIO Cleveland
BASS
ISLANDS
Banded N. sipedon
(Pattern C)
100
Percentage of individuals
80
60
40
20
0
A B C D
Ohio mainland
Banding patterns in snake populations
Copyright © Pearson Australia (a division of Pearson Australia Group Pty Ltd) 2018—9781488613715—Urry/Campbell Biology 11e
UNIT 5 THE EVOLUTIONARY HISTORY
OF BIOLOGICAL DIVERSITY
In keeping with our goal of improving how students interpret
and create visual representations in biology, we have added a
new figure (Figure 26.5, “Visualising Phylogenetic Relation-
ships”) that introduces the visual conventions used in phylo-
genetic trees and helps students understand what such trees
do and don’t convey. Students are also provided many oppor-
tunities to practise their visual skills, with more than ten new
Visual Skills Questions on topics ranging from interpreting
phylogenetic trees to predicting which regions of a bacterial
flagellum are hydrophobic. The unit also contains new content
on tree thinking, emphasising such key points as how sister
groups provide a clear way to describe evolutionary relation-
ships and how trees do not show a “direction” in evolution.
Other major content changes include new text in Concepts
26.6, 27.4, and 28.1 on the 2015 discovery of the Lokiarchaeota,
a group of archaea that may represent the sister group of the
eukaryotes, new text and a new figure (Figure 26.22) on hori-
zontal gene transfer from prokaryotes to eukaryotes, and new
material in Concept 29.3 describing how early forests contrib-
uted to global climate change (in this case, global cooling). A
new Problem-Solving Exercise in Chapter 34 engages students
in interpreting data from a study investigating whether frogs
can acquire resistance to a fungal pathogen through controlled
exposure to it. Other updates include the revision of many
phylogenies to reflect recent phylogenomic data, new chapter-
opening stories in Chapter 31 (on how mycorrhizae link trees
of different species) and Chapter 33 (on the “blue dragon,” a
mollusc that preys on the highly toxic Portuguese man-of-war),
new text and a new figure (Figure 34.36) on the adaptations of
the kangaroo rat to its arid environment, and new material in
Concept 34.7, including a new figure (Figure 34.51) describing
fossil and DNA evidence indicating that humans and Nean-
derthals interbred,
producing viable off- Figure 34.53 Fossils of hand and
spring. The discussion foot bones of Homo naledi.
of human evolution
also includes new
text and a new figure
(Figure 34.53) on
Homo naledi, the most
Unbanded recently discovered
N. sipedon
(Pattern D) member of the human
evolutionary lineage.
Pelee
Island
Middle
UNIT 6 PLANT FORM AND FUNCTION
Island
LAKE ERIE A major aim in revising Chapter 35 was to help students better
understand how primary and secondary growth are related.
Kelleys
Island New Visualising Figure 35.12 enables students to picture growth
OHIO at the cellular level. Also, the terms protoderm, procambium,
5 km
and ground meristem have been introduced to underscore the
transition of meristematic to mature tissues. A new flow-
chart (Figure 35.24) summarises growth in a woody shoot.
New text and a figure (Figure 35.26) focus on genome analysis
of A
­ rabidopsis ecotypes, relating plant morphology to ecology
and evolution. In Chapter 36, new Figure 36.8 illustrates the
fine branching of leaf veins, and information on phloem-
A B C D A B C D
xylem water transfer has been updated. New Make Connec-
Islands Ontario mainland tions ­Figure 37.14 highlights mutualism across kingdoms and
domains. Concept 37.1 expands considerations of Australian
HIGHLIGHTS OF NEW CONTENT ix
and New Zealand soils, and introduces some unique adapta-
tions plants use to survive Australia’s old and nutrient-poor UNIT 8 ECOLOGY
soils. New ­Figure 38.3 clarifies how the terms carpel and pistil The Ecology Unit has been extensively revised for the Eleventh
are related. The text on flower structure and the angiosperm Edition. We have reorganised and improved the conceptual
life cycle figure identify carpels as megasporophylls and stamens framework with which students are introduced to the follow-
as microsporophylls, correlating with the plant evolution ing core ecological topics: life tables, per capita population
­discussion in Unit 5. A revised Figure 39.7 helps students growth, intrinsic rate of increase (“r ”), exponential population
visualise how cells elongate. Figure 39.8 now addresses growth, logistic population growth, density dependence, spe-
apical dominance in a Guided Tour format. Information cies interactions (in particular, parasitism, commensalism, and
about the role of sugars in controlling apical dominance mutualism), and MacArthur and Wilson’s island biogeography
has been added. In Concept 39.4, a new Problem-Solving model. The revision also includes a deeper integration of evo-
Exercise highlights how global climate change affects crop lutionary principles, including a new Key Concept (52.5) and
productivity. ­Figure 39.26 on defence responses against two new figures (Figures 52.23 and 52.24) on the reciprocal
pathogens has been simplified and improved. effects of ecology and evolution, new material in Concept 52.4
on how the geographic distributions of species are shaped by
a combination of evolutionary history and ecological factors,
UNIT 7 ANIMAL FORM AND FUNCTION and five new Make Connections Questions that ask students
A major goal of the Unit 7 revision was to transform how stu- to examine how ecological and evolutionary mechanisms
dents interact with and learn from representations of anatomy interact. In keeping with our goal of expanding and strength-
and physiology. For example, gastrulation is now introduced ening our coverage of climate change, we have added a new
with a Visualising Figure (Figure 47.8) that provides a clear and discussion and a new figure (Figure 52.19) on how climate
carefully paced introduction to three-dimensional processes change has affected the distribution of a keystone species, a
that may be difficult for students to grasp. In addition, a num- new section of text in Concept 55.2 on how climate change
ber of the new and revised figures help students explore spatial affects NPP, a new Problem-Solving Exercise in Chapter 55
relationships in anatomical contexts, such as the interplay of that explores how insect outbreaks induced by climate change
lymphatic and cardiovascular circulation (Figure 42.15) and can cause an ecosystem to switch from a carbon sink to a carbon
the relationship of the limbic system to overall brain structure source, a new figure
(Figure 49.14). A new Problem-Solving Exercise in Chapter 45 (Figure 56.30) on the Figure 55.8 Climate change,
taps into student interest in medical mysteries through a case greenhouse effect wildfires, and insect outbreaks.
study that explores the science behind laboratory testing and new text in
and diagnosis. Content updates help students appreciate the Concept 56.4 on
continued evolution of our understanding of even familiar biological effects
phenomena, such as the sensation of thirst (Concept 44.4) of climate change.
and the locomotion of kangaroos and jellyfish (Concept 50.6). In addition, a new
Furthermore, new text and figures introduce students to Make Connections 104

Area burned by wildfires

cutting-edge technology relating to such topics as RNA-based Figure (Figure 56.31) 2

Drought-stress index:
103

(km2, log scale):

antiviral defence in invertebrates (Figure 43.4) and rapid, com- on how climate
102
prehensive characterisation of viral exposure (Figure 43.24), as change affects all 0

well as recent discoveries regarding brown fat in adult humans levels of biologi- 10

(Figure 40.16), the microbiome (Figure 41.17), partheno- cal organisation 1

–2
genesis (Concept 46.1), and magnetoreception (Concept 50.1). includes work from
104
In Concept 46.2, we have expanded and clarified differences a group of Univer-

Drought-stress index:
Area affected by

1
(km2, log scale):

in the reproductive systems of placental and marsupial mam-

bark beetles

sity of Queensland 103

mals. The groups have evolved in response to Australia’s drying Researchers who 102
0

climate in the last tens of millions of years. have identified what –1

may be the first
1997 2000 2005 2010 2014
recorded extinc- Year
Figure 41.17 Variation in human gut microbiome at tion due to climate
different life stages. change: the Bramble
Cay melomys. Additional updates include a new figure
(Figure 53.25) on per capita ecological footprints, a new
On breastmilk Healthy Healthy 65–80 chapter-opening story in C ­ hapter 54 on a seemingly unlikely
years old
mutualism between a shrimp and a much larger predatory
fish, new text in Concept 54.1 emphasising that each partner
On formula On antibiotic
treatment
Obese >100
years old in a mutualism experiences both benefits and costs, new text
Key in Concept 54.1 describing how the outcome of an ­ecological
On solid food Malnourished
Firmicutes
Bacteroidetes interaction can change over time, two new figures (Figures
Actinobacteria
Proteobacteria
54.31 and 54.33) on the island equilibrium model, a new figure
Other bacterial
phyla
(Figure 54.34) documenting two shrew species as unexpected
hosts of Lyme disease, new text in Concept 56.1 comparing
Infant Toddler Adult Elderly person

extinction rates today with those typically seen in the fossil

record, and a new discussion and figure (Figure 56.23) on the
restoration of a degraded urban stream.

x HIGHLIGHTS OF NEW CONTENT

Copyright © Pearson Australia (a division of Pearson Australia Group Pty Ltd) 2018—9781488613715—Urry/Campbell Biology 11e
Ready-to-Go Teaching Modules for Instructors
NEW! Ready-to-Go Teaching Modules help instructors efficiently make
use of the best teaching tools before, during, and after class.

The Ready-to-Go Teaching

Modules incorporate
the best that the text,
MasteringBiology, and
Learning Catalytics have to
offer, along with new ideas for
in-class activities. The modules
can be accessed through the
Instructor Resources area of
MasteringBiology.

Instructors can easily incorporate active learning

into their courses using suggested activity ideas and
questions. Videos demonstrate how the activities can
be used in class.

Learning CatalyticsTM
allows students to use
their smartphone, tablet,
or laptop to respond to
questions in class. Visit
learningcatalytics.com

xi

Copyright © Pearson Australia (a division of Pearson Australia Group Pty Ltd) 2018—9781488613715—Urry/Campbell Biology 11e
See the Big Picture
Each chapter is organised around a framework of three to seven Key Concepts that
focus on the big picture and provide a context for supporting details.

An organism’s heritable traits can influence not only its Figure 22.12 Camouflage as an example of evolutionary
own performance, but also how well its offspring cope with adaptation. Related species of the insects called mantises have diverse

environmental challenges. For example, an organism might
have a trait that gives its offspring an advantage in escaping
predators, obtaining food, or tolerating physical conditions.
27
shapes and colours that evolved in different environments, as seen in
this South African flower-eyed mantis (Pseudocreobotra wahlbergii; top)
and Malaysian orchid mantis (Hymenopus coronatus; bottom).

Bacteria and Archaea

When such advantages increase the number of offspring
that survive and reproduce, the traits that are favoured will
probably appear at a greater frequency in the next generation.
Every chapter opens
Thus, over time, natural selection resulting from factors
with a visually such as predators, lack of food, or adverse physical condi-
dynamic photo tions can lead to an increase in the proportion of favourable
accompanied by traits in a population.
an intriguing How rapidly do such changes occur? Darwin reasoned that
question that if artificial selection can bring about dramatic change in a
invites students relatively short period of time, then natural selection should
into the chapter. be capable of substantial modification of species over many
hundreds of generations. Even if the advantages of some
heritable traits over others are slight, the advantageous varia-
tions will gradually accumulate in the population, and less
favourable variations will diminish. Over time, this process
will increase the frequency of individuals with favourable
adaptations, hence increasing the degree to which organisms
Figure 27.1 Why is this lake’s water pink?
are well suited for life in their environment.
The List of Key
Key Features ofKEY Natural CONCEPTSSelection Masters of Adaptation
Concepts 27.1 Structural and functional After heavy summer rains, Australia’s hyper-saline lakes appear pink (Figure 27.1).

introduces the Let’s now recap the main adaptations

big ideas covered Natural selection
in the chapter. that have certain heritable
After reading a Key Concept
selection occurs through interactions
section, students can check
organisms and their environment,
Rather, it is the population that evolves
their understanding using
the Concept Check or diminish only those heritable traits that differ among the
individuals in a population. Thus,
Questions.
all the individuals in a population are genetically identical for apply
ideas of natural
contributeselection:
to If you poured a cup of water from this lake onto your skin, you would receive third-
prokaryotic success degree burns. You would burn because salt concentrations in hyper-saline lakes
27.is2 aRapid
process in which individuals
reproduction, mutation,
can reach 37% (about 10 times greater than seawater). Lakes Eyre, Torrens, and
traits
and genetic Gairdner represent some of Australia’s largest hyper-saline lakes, covering more than
survive and reproduce
recombination
promote genetic diversity in 25,000 km2. When the water evaporates into the tinder-dry air, little remains except
at a higher rate than prokaryotes
do other individuals because saltof
pans. Burning waters, or frying salt pans, provide some of the harshest environ-
those traits. 27.3 Diverse nutritional and metabolic ments for life. Yet, in the pinkish waters, life abounds.
The pink colour of Hutt Lagoon
VIsual in Western
skIlls Use Australia
evidence(Figure 27.1) comes
from these from to explain how
two images
Over time, natural selection
adaptationscan
haveincrease
evolved in the frequency
prokaryotes trillions of prokaryotes in the
these domains
mantises Archaea andthe
demonstrate Bacteria,
three including archaea about
key observations in life introduced
of adaptations that are favourable in a given environ- the genus Halobacterium at the beginning
. These archaeaof thisred
have chapter:
membranethe unity and (carotenoids),
pigments diversity of life and the match
27.4 Prokaryotes have radiated into
ment (Figure 22.12).a diverse set of lineages some of which capture between organisms
light energy and their
that is used environments.
to drive ATP synthesis. Halobacterium
species are among the most salt-tolerant organisms on Earth; they thrive in salini-
If an environment27.5changes,
Prokaryotesorplay
if individuals
crucial roles move to a
ties that dehydrate and kill other cells. A Halobacterium cell compensates for water
in the biosphere
new environment, natural selection may result inlost adap-
through osmosis by pumping potassium ions (K+) into the cell until the ionic
27.6 Prokaryotes have both beneficial
tation to these new conditions, sometimes giving
and harmful impacts on humans
rise to
concentration inside the cell matches the concentration outside.
Next, we’ll survey the wide range of observations that sup-
Like Halobacterium, many other prokaryotes can tolerate extreme conditions.
new species. port a Darwinian view of evolution by natural selection.
Examples include Deinococcus radiodurans, which can survive 3 million rads of radia-
Archaea in
the genus tion (3,000 times the dose fatal to humans), and Picrophilus oshimae, which can
One subtle but important point is that although natural
Halobacterium. grow at a pH of 0.03 (acidic enough to dissolve metal). Other prokaryotes live in
Questions
between throughout
individual
environments that areCONCEPt hot for most22.
too cold or tooChECk other2organisms, and some have
the chapterdo encourage
individuals not evolve . found living in rocks 3.2 km below Earth’s surface.
even been
1. How does the concept of descent with modification
studentsovertotime.
read the
explain both the unity and diversity of life?
A second key point is that natural textselection
actively. can amplify 2. What IF? if you discovered a fossil of an 585 extinct reptile
What If?
even if Questions
a trait is heritable, if
that lived high in new Zealand’s Southern Alps, would you
predict that it would more closely resemble present-day
M27_URRY3715_11_SE_C27.indd 585 ask students to
reptiles from lowland new Zealand forests or
reptiles that live high in European mountains? Explain.
present-day
01/06/17 2:18 PM

that trait, evolution by natural selection what they’ve learned.

cannot occur. 3. MakE CONNECtIONs review the relationship between
Third, remember that environmental factors vary from genotype and phenotype (see Figures 14.5 and 14.6).
Make Connections
place to place and over time. A trait that is favourable in Suppose that in a particular pea population, flowers with
Questions ask the white phenotype are favoured by natural selection.
one place or time may be useless—or even detrimental—in
students to relate Predict what would happen over time to the frequency
other places or times. Natural selection is always operating, of the p allele in the population, and explain your
content in the chapter
but which traits are favoured depends on the context in reasoning.
to material presented
which a species lives and mates. For suggested answers, see Appendix A.
earlier in the course.

476 Unit FoUr Mechanisms of Evolution

xii

Copyright © Pearson Australia (a division of Pearson Australia Group Pty Ltd) 2018—9781488613715—Urry/Campbell Biology 11e
M22_URRY3715_11_SE_C22.indd 476 01/06/17 1:49 PM
 What, then, is theoretical about evolution? Keep in mind
that the scientific meaning of the term theory is very differ-
ent from its meaning in everyday use. The colloquial use
of the word theory comes close to what scientists mean by
a hypothesis. In science, a theory is more comprehensive
than a hypothesis. A theory, such as the theory of evolution
by natural selection, accounts for many observations and
explains and integrates a great variety of phenomena. Such a
unifying theory does not become widely accepted unless its
predictions stand up to thorough and continual testing by
experiment and additional observation (see Concept 1.3). As
the rest of this unit demonstrates, this has certainly been the
case with the theory of evolution by natural selection.
The scepticism of scientists as they continue to test theories
prevents these ideas from becoming dogma. For example,
although Darwin thought that evolution was a very slow pro-
use a wide range of experimental approaches and genetic
analyses to test predictions based on natural selection and
other evolutionary mechanisms.
Although Darwin’s theory attributes life’s diversity to
natural processes, the diverse products of evolution are nev-
ertheless elegant and inspiring. As Darwin wrote in the final
sentence of The Origin of Species, “There is grandeur in this
view of life … [in which] endless forms most beautiful and
most wonderful have been, and are being, evolved.”
CONCEPt ChECk 22.3
1. Explain how the following statement is inaccurate:
“Antibiotics have created drug resistance in MrSA.”
2. How does evolution account for (a) the similar mammalian
forelimbs with different functions shown in Figure 22.15
and (b) the similar forms of the two distantly related

The Summary of Key Concepts refocuses

cess, we now know that this isn’t always true. Populations can
evolve rapidly, and new species can form in relatively short
mammals shown in Figure 22.18?
3. What IF? Fossils show that dinosaurs originated
200–250 million years ago. Would you expect the geo-

students on the main points of the chapter.

periods of time: a few thousand years or less. Furthermore,
evolutionary biologists now recognise that natural selection
is not the only mechanism responsible for evolution. Indeed,
the study of evolution today is livelier than ever as scientists
graphic distribution of early dinosaur fossils to be broad
(on many continents) or narrow (on one or a few conti-
nents only)? Explain.
For suggested answers, see Appendix A.

22 Chapter Review
suMMaRY OF kEY CONCEPts
CONCEPt 22.1
the Darwinian revolution challenged traditional
views of a young Earth inhabited by unchanging
species (pp. 469–471)
Darwin proposed that life’s diversity arose from ancestral
species through natural selection, a departure from prevailing
views.
Cuvier studied fossils but denied that evolution occurs; he pro-
posed that sudden catastrophic events in the past caused species
to disappear from an area.
Hutton and Lyell thought that geological change could result
from gradual mechanisms that operated in the past in the same
manner as they do today.
Lamarck hypothesised that species evolve, but the underlying
mechanisms he proposed are not supported by evidence.
? Why was the age of Earth important for Darwin’s ideas about evolution?
CONCEPt 22.2
Descent with modification by natural selection
explains the adaptations of organisms and the
unity and diversity of life (pp. 471–476)
Darwin’s experiences during the voyage of the Beagle gave rise to
his idea that new species originate from ancestral forms through
the accumulation of adaptations. He refined his theory for
many years and finally published it in 1859 after learning that
Wallace had come to the same idea.
484 Unit FoUr Mechanisms of Evolution
M22_URRY3715_11_SE_C22.indd 484
In The Origin of Species, Darwin proposed that over long periods of
time, descent with modification produced the rich diversity
of life through the mechanism of natural selection.
Observations
Individuals in a population Organisms produce more
vary in their heritable offspring than the
characteristics. environment can support.
Inferences
Individuals that are well suited
to their environment tend to leave more Organisms share characteristics because of common descent 5. DNA sequences in many human genes are very similar to the
offspring than other individuals. (homology) or because natural selection affects independently sequences of corresponding genes in chimpanzees. The most
evolving species in similar environments in similar ways likely explanation for this result is that
and
(convergent evolution). (A) humans and chimpanzees share a relatively recent com-
Over time, favourable traits Fossils show that past organisms differed from living organisms, mon ancestor.
accumulate in the population. that many species have become extinct, and that species have (B) humans evolved from chimpanzees.
evolved over long periods of time; fossils also document the (C) chimpanzees evolved from humans.
evolutionary origin of new groups of organisms. (D) convergent evolution led to the DNA similarities.
? Describe how overreproduction and heritable variation relate to
evolution by natural selection. Evolutionary theory can explain some biogeographical patterns.
level 3: synthesis/Evaluation
? Summarise the different lines of evidence supporting the hypothesis
CONCEPt 22.3 that cetaceans descended from land mammals and are closely related 6. EVOlutION CONNECtION Explain why anatomical and
to even-toed ungulates. molecular features often fit a similar nested pattern. In addition,
Evolution is supported by an overwhelming describe a process that can cause this not to be the case.
amount of scientific evidence (pp. 477–484)
7. sCIENtIFIC INQuIRY • DRaW It Mosquitoes resistant to the
Researchers have directly observed natural selection leading tEst YOuR uNDERstaNDING pesticide DDT first appeared in India in 1959, but now are found
to adaptive evolution in many studies, including research on throughout the world. (a) Graph the data in the table below.
soapberry bug populations and on MRSA. (b) Examine the graph, then hypothesise why the percentage
level 1: knowledge/Comprehension of mosquitoes resistant to DDT rose rapidly. (c) Suggest an
1. Which of the following is not an observation or inference on explanation for the global spread of DDT resistance.
which natural selection is based?
(A) There is heritable variation among individuals. Month 0 8 12
(B) Poorly adapted individuals never produce offspring.
(C) Species produce more offspring than the environment can Mosquitoes Resistant* to DDT 4% 45% 77%
01/06/17 1:51 PM
support. *Mosquitoes were considered resistant if they were not killed within 1 hour of receiving
(D) Only a fraction of an individual’s offspring may survive. a dose of 4% DDT.

Summary of Key Summary Figures 2. Which of the following observations helped Darwin shape his
Data from C. F. Curtis et al., Selection for and against insecticide resistance and
possible methods of inhibiting the evolution of resistance in mosquitoes, Ecological
concept of descent with modification? Entomology 3:273–287 (1978).

Concepts Questions recap key information (A) Species diversity declines further from the equator.
(B) Fewer species live on islands than on the nearest
8. WRItE aBOut a thEME: INtERaCtIONs Write a short
essay (about 100–150 words) evaluating whether changes
check students’ visually. continents.
(C) Birds live on islands located further from the mainland
to an organism’s physical environment are likely to result
in evolutionary change. Use an example to support your
than the birds’ maximum nonstop flight distance.
understanding of a key (D) Australian temperate plants are more similar to
Australian tropical plants than to the temperate
reasoning.
9. sYNthEsIsE YOuR kNOWlEDGE

idea from each concept. plants of Europe.

level 2: application/analysis
3. Within six months of effectively using methicillin to treat
S. aureus infections in a community, all new S. aureus infections
were caused by MRSA. How can this best be explained?
(A) A patient must have become infected with MRSA from
another community.
(B) In response to the drug, S. aureus began making drug-
resistant versions of the protein targeted by the drug.

Evolution, the fundamental

(C) Some drug-resistant bacteria were present at the start
of treatment, and natural selection increased their
frequency.
(D) S. aureus evolved to resist vaccines.

theme of biology, is emphasised 4. The upper forelimbs of humans and bats have fairly similar
skeletal structures, whereas the corresponding bones in
whales have very different shapes and proportions. However,

throughout. Every chapter has genetic data suggest that all three kinds of organisms diverged This honeypot ant (genus Myrmecocystus) can store liquid food
from a common ancestor at about the same time. Which of inside its expandable abdomen. Consider other ants you are
the following is the most likely explanation for these data? familiar with, and explain how a honeypot ant exemplifies

a section explicitly relating the

(A) Forelimb evolution was adaptive in people and bats, but three key features of life: adaptation, unity, and diversity.
not in whales. For selected answers, see Appendix A.
(B) Natural selection in an aquatic environment resulted in

chapter content to evolution:

significant changes to whale forelimb anatomy.
For additional practice questions, check out the Dynamic study
(C) Genes mutate faster in whales than in humans or bats.
Modules in MasteringBiology. You can use them to study on
(D) Whales are not properly classified as mammals.
your smartphone, tablet, or computer anytime, anywhere!

Evolution Connection
Questions are included CHAPtEr 22 Descent with Modification: A Darwinian View of Life 485

in every Chapter Review. Synthesise Your

M22_URRY3715_11_SE_C22.indd 485
Knowledge Questions 01/06/17 1:51 PM

ask students to apply their

ConCEPt 17.2
Figure 17.7 Evidence for evolution: expression of genes
from different species. Because diverse forms of life share a
common genetic code due to their shared ancestry, one species can be understanding of the
Transcription is the DNA-directed
programmed to produce proteins characteristic of a second species by
introducing DNA from the second species into the first. synthesis of RNA: chapter
a closercontent
look to explain
an intriguing
Now that we have considered photo.
the linguistic logic and evo-
lutionary significance of the genetic code, we are ready to
reexamine transcription, the first stage of gene expression,
in greater detail.

Molecular Components of Transcription

(a) Tobacco plant expressing a
firefly gene. The yellow glow
is produced by a chemical
reaction catalysed by the
protein product of the firefly
gene.
striking results, as shown in Figure 17.7. Bacteria can be
Copyright © Pearson Australia (a division of Pearson Australia
programmed GroupofPty
by the insertion
(b) Pig expressing a jellyfish
gene. Researchers injected a
jellyfish gene for a fluorescent
protein into fertilised pig eggs.
One developed into this
fluorescent pig.
humanLtd) 2018—9781488613715—Urry/Campbell
genes to synthesise
Messenger RNA, the carrier of information from DNA to
the cell’s protein-synthesising machinery, is transcribed
from the template strand of a gene. An enzyme called an
RNA polymerase pries the two strands of DNA apart and
joins together RNA nucleotides complementary to the DNA
template strand, thus elongating the RNA polynucleotide
( Figure 17. 8 ) . Like the DNA polymerases that function in
DNA replication, RNA polymerases can assemble a poly-
nucleotide only in its 5¿ S 3¿ direction, adding onto its 3¿
end. Unlike DNA polymerases, however, RNA polymerases
are able to start a chain from scratch; they don’t need to add
the first nucleotide onto a pre-existing primer.
SEE
Specific sequences of nucleotides THE
along BIG
the DNA markPICTURE xiii
where transcription of a gene begins and ends. The DNA
sequence where RNA polymerase attaches and initiates
transcription is known as the promoter; in bacteria, the
Biology 11e
sequence that signals the end of transcription is called the
 Build Visual Skills

NEW! Visualising Figures teach students how to interpret

diagrams and models in biology. Embedded questions give students For more practice, each
practice applying visual skills as they read the figure. Visualising Figure is
accompanied by an
automatically graded
assignment in
Figure 26.5 Visualising Phylogenetic Relationships
MasteringBiology with
a phylogenetic tree visually represents a hypothesis of how a group of organisms Instructors: additional questions related
are related. this figure explores how the way a tree is drawn conveys information. to this visualising figure can be assigned
in MasteringBiology.
feedback for students.
Parts of a Tree this tree shows how the five groups of organisms at the tips of the branches, called taxa,
are related. each branch point represents the common ancestor of the evolutionary lineages
diverging from it.
Each horizontal branch represents an evolutionary lineage.
Visualising Figures include:
This branch point represents
Fishes
The length of the branch is arbitrary unless the diagram
specifies that branch lengths represent information such as Figure 5.16 Visualising
Figure The human digestive system. After food is
41.8 26.13). Saliva is a complex mixture of mater
chewed and swallowed, it takes 5–10 secondsProteins,
time or amount of genetic change (see Figure
the common ancestor of all p. 79
for it to pass down the
the animal groups shown in of vital functions. One major compone
this tree. Frogs oesophagus and into the stomach, where it spends 2–6 hours being
partially
Each position along a branch digested.
represents an Figure 6.32 Visualising
Further digestion and nutrient absorption occur in
cous mixture of water, salts, cells, and s
teins (carbohydrate–protein complexes
ancestor in the lineage leading
named at the tip.
to the intestine
the small taxon
the Scale of the Molecular
over a period of 5–6 hours. Within 12–24 hours,
Lizards any undigested material passes through the large intestine, and faeces food for easier swallowing, protects the
are expelled through the anus. Machinery in a Cell,
sion, and facilitates taste and smell. Sali
1 According to this tree, which
group or groups of organisms are pp. 122–123 buffers, which help prevent tooth decay
most closely related to frogs? Chimps Tongue Oral cavity
acid, and antimicrobial agents (such as
2 Label the part of the diagram that
Sister taxa are groups of organisms that share
a common ancestor that is not shared by any
Figure 16.7 Visualising
Figure 5.16), which protect against bact
represents the most recent common
ancestor of frogs and humans.
Humans other group. Chimps and humans Salivary
glands
example of sister taxa in this tree.
are an DNA, p. 321
Pharynx mouth with food.
Scientists have long been puzzled by th
Figure 25.8 Visualising
tains a large amount of the enzyme amyl
Alternative these diagrams are referred to as “trees” because they use the visual analogy of branches
the ScaleOesophagus
of Geological Time,
down starch (a glucose polymer from plan
Forms of Tree to represent evolutionary lineages diverging over time. in this text, trees are usually drawn pp. 534–535 (a glucose polymer from animals). Most c
horizontally, as shown above, but the same tree can be drawn vertically or diagonally Liver
Diagrams without changing the relationships it conveys. Figure 26.5 Visualising occurs not in the mouth but in the small i
lase is also present. Why, then, does saliva
Fishes Frogs Lizards Chimps Humans Fishes Frogs Lizards Chimps Humans Phylogenetic Relationships, amylase? A current hypothesis is that amy
shown at left and on p.food 568particles that are stuck to the teeth, t
Gallbladder nutrients available to microorganisms liv
3 How many sister taxa are shown
in these two trees? Identify them. Stomach
Figure 35.12 Visualising The tongue also has important roles i
Vertical tree 4 Redraw the horizontal tree in Figure 26.2 as Pancreas Diagonal tree Primary and Secondary Much as a doorman screens and assists p
a vertical tree and a diagonal tree.
Growth, p. 789 fancy hotel, the tongue aids digestive p
Small
ing ingested material, distinguishing w
Rotating
intestine
rotating the branches of a tree around a branch point does not change what they convey about Figure 47.8 Visualising be processed further and then enabling
Large
Around evolutionary relationships. as a result, the order in which taxa appear at the branch tips is not
intestine Gastrulation, p. 1078Concept 50.4 for a discussion of the sen
significant. What matters is the branching pattern, which signifies the order in which the lineages
Branch Points have diverged from common ancestors. food is deemed acceptable and chewing
Rectum Figure 55.12 Visualising movements manipulate the mixture of s
Fishes Anus Frogs Biogeochemical Cycles, ing shapep. 1284
it into a ball called a bolus (Fi
swallowing, the tongue provides further
Rotating the branches in
Frogs Humans the bolus to the back of the oral cavity an
the tree at left around the
three blue branch points Each bolus of f
yields the tree on the right.
Figure 41.9 intersection of the human airway and digestive tract. In humans, the the pharynx, or
Lizards Chimps
pharynx connects to the trachea and the oesophagus. (a) At most times, a contracted sphincter seals
leads to two passa
5 Redraw the tree on the off the oesophagus while the trachea remains open. (b) When a food bolus arrives at the pharynx,
right, rotating around the swallowing reflex is triggered. Movement of the larynx, the upper part of the airway, tips a flap gus and the trache
Chimps the green branch point. Lizards
Note: The order of of tissue called the epiglottis down, preventing food from entering the trachea. At the same time, is a muscular tube
the taxa does NOT Identify the two closest
relatives of humans as the oesophageal sphincter relaxes, allowing the bolus to pass into the oesophagus. The trachea then the stomach; the t
represent a sequence of
shown in each of the three reopens, and peristaltic contractions of the oesophagus move the bolus to the stomach.
evolution “leading to” Humans
trees. Explain your answer.
Fishes leads to the lungs
the last taxon shown
(in this tree, humans). therefore be carefu
to keep food and l
Bolus of ing the trachea an
568 Unit five The Evolutionary History of Biological Diversity food
Tongue blockage of the tra
Epiglottis lack of airflow int
Pharynx up fatal if the materia
M26_URRY3715_11_SE_C26.indd 568 02/06/17 7:04 AM by vigorous cough
Oesophageal Oesophageal
sphincter back slaps, or a for
Glottis sphincter
contracted Epiglottis relaxed of the diaphragm
Larynx down
manoeuvre).
Trachea Glottis up Within the oeso
NEW! Visual Skills Questions Oesophagus
and closed pushed along by p
give students practice interpreting To lungs To stomach ing waves of smoo
illustrations and photos in the text. (a) Trachea open (b) Oesophagus open and relaxation. Up
Visual skills If you laugh while drinking water, the liquid may be ejected from your nostrils. Use this of the oesophagus
diagram to explain why this happens, taking into account that laughing involves exhaling. ters a sphincter, a
xiv
932 Unit seven Animal Form and Function
Copyright © Pearson Australia (a division of Pearson Australia Group Pty Ltd) 2018—9781488613715—Urry/Campbell Biology 11e
 NEW! Figure Walkthroughs guide students through key figures with narrated
explanations, figure markups, and questions that reinforce important points.

A note in the print book lets

students and instructors know when
a Figure Walkthrough is available in
the Study Area.

Questions embedded in each Figure Walkthrough encourage

students to be active participants in their learning. The Figure
Walkthroughs can also be assigned in MasteringBiology with
higher-level questions.

EXPANDED! Draw It exercises give students

practice creating visuals. Students are asked
to put pencil to paper and draw a structure,
annotate a figure, or graph experimental data.

BUILD VISUAL SKILLS xv

Copyright © Pearson Australia (a division of Pearson Australia Group Pty Ltd) 2018—9781488613715—Urry/Campbell Biology 11e
Make Connections Visually
Eleven Make Connections Figures pull together content from different
chapters, providing a visual representation of “big picture” relationships.

Make Connections
Figures include:
Figure 5.26 Contributions of Figure 23.19 MAKE CONNECTIONS
Genomics and Proteomics to
Biology, p. 88 The Sickle-Cell Allele
Figure 10.23 The Working Cell, This child has sickle-cell disease, a genetic disorder that strikes individuals
pp. 210–211 who have two copies of the sickle-cell allele. This allele causes an
abnormality in the structure and function of haemoglobin, the oxygen-
Figure 18.27 Genomics, Cell carrying protein in red blood cells. Although sickle-cell disease is lethal if not
treated, in some regions the sickle-cell allele can reach frequencies as high as
Signalling, and Cancer, pp. 392–393
15–20%. How can such a harmful allele be so common?
Figure 23.19 The Sickle-Cell Allele,
shown at right and on pp. 504–505
Events at the Molecular Level
Figure 33.9 Maximising Surface • Due to a point mutation, the sickle-cell allele differs
Area, p. 715 from the wild-type allele by a single nucleotide. (See Figure 17.26.)
• The resulting change in one amino acid leads to hydrophobic
NEW! Figure 37.14 Mutualism interactions between the sickle-cell haemoglobin proteins under
low-oxygen conditions.
Across Kingdoms and Domains, • As a result, the sickle-cell proteins bind to each other in chains
p. 839 that together form a fibre. Consequences for Cells
• The abnormal haemoglobin fibres distort the red blood
Figure 39.27 Levels of Plant Defences Template strand cell into a sickle shape under low-oxygen conditions,
such as those found in blood vessels returning to the hea
Against Herbivores, pp. 894–895 Sickle-cell allele
on chromosome
T C
T
Figure 40.24 Life Challenges and T C
A G
C C G A
Solutions in Plants and Animals, G
A C A G G
T
A
G T G
pp. 920–921 T
A
G T C
C
C C
A G A

Figure 44.18 Ion Movement G T

C Fibre

and Gradients, p. 1019

Figure 55.17 The Working An adenine replaces a thymine in the
template strand of the sickle-cell allele,
Ecosystem, pp. 1290–1291 changing one codon in the mRNA Low-oxygen
produced during transcription. This Sickle-cell conditions
NEW! Figure 56.31 Climate Change change causes an amino-acid change in
sickle-cell haemoglobin: A valine replaces
haemoglobin

Has Effects at All Levels of Biological a glutamic acid at one position. (See Figure 5.19.)

Organisation, pp. 1316–1317 Sickled red blood ce

Wild-type
allele
T C
C T
T A G
C C A G A
A
C T G G
G G A
A
G
C
T
T
G
T C
C A C
A
G T G
C

Normal haemoglobin
(does not aggregate into fibres)

Normal red blood cell

504 UNIT FOUR Mechanisms of Evolution

M23_URRY3715_11_SE_C23.indd 504

xvi

Copyright © Pearson Australia (a division of Pearson Australia Group Pty Ltd) 2018—9781488613715—Urry/Campbell Biology 11e
 Infected mosquitoes
spread malaria when they
bite people. (See Figure
28.16.)

Evolution in Populations
•Homozygotes with two sickle-cell alleles are strongly
selected against because of mortality caused by
sickle-cell disease. In contrast, heterozygotes
experience few harmful effects from sickling yet are
more likely to survive malaria than are homozygotes.
•In regions where malaria is common, the net effect
of these opposing selective forces is heterozygote
advantage. This has caused evolutionary change in
populations—the products of which are the areas of
relatively high frequencies of the sickle-cell allele
Effects on Individual Organisms shown in the map below.
• The formation of sickled red blood cells causes homozygotes
with two copies of the sickle-cell allele to have sickle-cell disease.
art. • Some sickling also occurs in heterozygotes, but not enough to
cause the disease; they have sickle-cell trait. (See Figure 14.17.)

The sickled blood cells of a

homozygote block small blood
vessels, causing great pain and
damage to organs such as the
heart, kidney, and brain.

ell

Key
Frequencies of
Normal red blood cells the sickle-cell allele
are flexible and are able
to flow freely through 3.0 –6.0%
small blood vessels.
6.0 –9.0%
Make
9.0 –12.0%
12.0 –15.0%
Distribution of malaria
caused by Plasmodium falciparum
Connections
>15.0% (a parasitic unicellular eukaryote) Questions in
every chapter
MAKE CONNECTIONS In a region free of malaria, would individuals who are
ask students to
heterozygous for the sickle-cell allele be selected for or selected against? Explain. relate content
l in the chapter
The Evolution of Populations 505
CHAPTER 23
to material
presented
06/06/17 9:21 AM M23_URRY3715_11_SE_C23.indd 505 06/06/17 9:23 AM earlier in the
course.

MAKE CONNECTIONS VISUALLY xvii

Copyright © Pearson Australia (a division of Pearson Australia Group Pty Ltd) 2018—9781488613715—Urry/Campbell Biology 11e
Practise Scientific Skills
Scientific Skills Exercises use real data to build key skills needed for biology,
including data analysis, graphing, experimental design and maths skills.

SCIENTIFIC SKILLS EXERCISE

Interpreting a Scatter Plot with Two Sets Glucose Uptake over Time in Guinea Pig Red Blood Cells
of Data
100
Is Glucose Uptake into Cells Affected by Age? Glucose,
an important energy source for animals, is transported into
cells by facilitated diffusion using protein carriers. In this
Each Scientific Skills Exercise 80

radioactive glucose (mM)

exercise, you will interpret a graph with two sets of data from

Concentration of
is based on an experiment an experiment that examined glucose uptake over time in
red blood cells from guinea pigs of different ages. You will 60
related to the chapter determine if the cells’ rate of glucose uptake depended on the
age of the guinea pigs.
content. 40
How the Experiment Was Done researchers incubated guinea
pig red blood cells in a 300 mM (millimolar) radioactive glucose 15-day-old guinea pig
solution at ph 7.4 at 25°c. every 10 or 15 minutes, they removed 20
1-month-old guinea pig
a sample of cells and measured the concentration of radioactive
glucose inside those cells. the cells came from either a 15-day-old
0
or a 1-month-old guinea pig. 0 10 20 30 40 50 60
Incubation time (min)
Most Scientific Skills Exercises Data from the Experiment when you have multiple sets of
data, it can be useful to plot them on the same graph for compari- Data from T. Kondo and E. Beutler, Developmental changes in glucose trans-
use data from published son. in the graph here, each set of dots (of the same colour) forms port of guinea pig erythrocytes, Journal of Clinical Investigation 65:1–4 (1980).

research, which is cited in a scatter plot, in which every data point represents two numerical
values, one for each variable. For each data set, a curve that best fits
2. From the data points on the graph, construct a table of the data.
the exercise. the points has been drawn to make it easier to see the trends. (For
put “incubation time (min)” in the left column of the table.
additional information about graphs, see the Scientific Skills review
in appendix F.) 3. what does the graph show? compare and contrast glucose
uptake in red blood cells from 15-day-old and 1-month-old
guinea pigs.
Questions build in INTERPRET THE DATA 4. Develop a hypothesis to explain the difference between glucose
1. First make sure you understand the parts of the graph. (a) which uptake in red blood cells from 15-day-old and 1-month-old guinea
difficulty, walking students variable is the independent variable—the variable controlled by pigs. (think about how glucose gets into cells.)
through new skills step by the researchers? (b) which variable is the dependent variable— 5. Design an experiment to test your hypothesis.
the variable that depended on the treatment and was measured
step and providing by the researchers? (c) what do the red dots represent? (d) the Instructors: a version of this Scientific Skills exercise
blue dots? can be assigned in MasteringBiology.
opportunities for higher-
level critical thinking.
Scientific Skills Exercises are available as
interactive assignments in MasteringBiology
molecules or small ions to diffuse very quickly from one
thatleave
arethe cell. (See the potassium ion channel at the begin-
automatically graded.
side of the membrane to the other. Aquaporins, the water ning of this chapter.) This restores the cell’s ability to fire
channel proteins, facilitate the massive levels of diffusion of again. Other gated channels open or close when a specific

SCIENTIFIC SKILLS EXERCISES are available for every chapter:

water (osmosis) that occur in plant cells and in animal cells substance other than the one to be transported binds to
such as red blood cells (see Figure 7.13). Certain kidney cells the channel. These gated channels are also important in
also have a high number of aquaporins, allowing them to the functioning of the nervous system, as we explain in
reclaim water from urine before it is excreted. If the kidneys Concepts 48.2 and 48.3.
1 Interpreting a Pair of Bar Graphs,did
p. not
23 perform this function, you would excrete 15 Using the Chi-Square
about
(x2) Test, p. 306
Carrier proteins, such as the glucose transporter mentioned
2 Calibrating a Standard Radioactive180Isotope
L of urine Decay Curve
per day—and 16volume
have to drink an equal Working with Data
earlier, seem in a Table,
to undergo p. 320
a subtle change in shape that somehow
and Interpreting Data, p. 33 of water!
17
translocates the solute-binding site across the membrane
Interpreting a Sequence Logo, p. 353
Channel proteins that transport ions are called ion ( Figure 7. 15b ) . Such a change in shape may be triggered
3 Interpreting a Scatter Plot with achannels
Regression . ManyLine, p. 54 function as gated18
ion channels Analysing
channels , DNA
by the Deletion
binding and Experiments, p. 375molecule.
release of the transported
4 Working with Moles and Molar Ratios,
which open or close in response to a stimulus. For some
p. 58 Like ion channels, carrier proteins involved in facilitated
19 Analysing a DNA Sequence-Based Phylogenetic Tree
gated channels, the stimulus is electrical. In a nerve cell, diffusion result in the net movement of a substance down
5 Analysing Polypeptide Sequence forData, p. 89
example, an ion channel opens in response to an
to Understand Viral Evolution, p. 411
its concentration gradient. No energy input is thus required:
6 Using a Scale Bar to Calculate Volume and Surface Area
electrical stimulus, allowing a stream of 20 Analysing Quantitative
potassium ions to This is and Spatial
passive transport. Gene
The Scientific Expression
Skills Exercise givesData*
of a Cell, p. 99 21 Reading an Amino Acid Sequence Identity Table, p. 457
7 Interpreting a Scatter Plot with Two Sets of Data, 22 Making and Testing Predictions, p. 483
chapter 7 Membrane Structure and Function 137
shown above and on p. 137
23 Using the Hardy-Weinberg Equation to Interpret Data
8 Making a Line Graph and Calculating a Slope, p. 159 and Make Predictions, p. 494
9 Making a Bar Graph andM07_URRY3715_11_SE_C07.indd
Evaluating a Hypothesis, 137
p. 181 24 Identifying Independent and Dependent Variables, Making
01/06/17 11:46 AM

10 Making Scatter Plots with Regression Lines, p. 207 a Scatter Plot, and Interpreting Data, p. 515
11 Using Experiments to Test a Model* 25 Estimating Quantitative Data from a Graph and Developing
12 Interpreting Histograms, p. 252 Hypotheses, p. 540
13 Making a Line Graph and Converting Between Units 26 Using Protein Sequence Data to Test an Evolutionary
of Data, p. 266 Hypothesis, p. 582
14 Making a Histogram and Analysing a Distribution Pattern, p. 285 27 Calculating and Interpreting Means and Standard Errors, p. 602

xviii

Copyright © Pearson Australia (a division of Pearson Australia Group Pty Ltd) 2018—9781488613715—Urry/Campbell Biology 11e
 Data from the Experiments in the data below, the letters give
the sequence of the 146 amino acids in β-globin from humans, rhesus
Species Alignment of Amino Acid Sequences of 𝛃𝛃-globin
2. For each nonhuman species, what percentage of its amino acids
are identical to the human sequence of β-globin?
3. Based on these data alone, state a hypoth-
esis for which of these two species is more

Apply Scientific Skills to Solving Problems

human 1 VHLTPEEKSA VTALWGKVNV DEVGGEALGR LLVVYPWTQR FFESFGDLST closely related to humans. What is your
Monkey 1 VHLTPEEKNA VTTLWGKVNV DEVGGEALGR LLLVYPWTQR FFESFGDLSS reasoning?
Gibbon 1 VHLTPEEKSA VTALWGKVNV DEVGGEALGR LLVVYPWTQR FFESFGDLST 4. What other evidence could you use to
support your hypothesis?
human 51 PDAVMGNPKV KAHGKKVLGA FSDGLAHLDN LKGTFATLSE LHCDKLHVDP
Data from Human: www.ncbi.nlm.nih.gov/protein/
Monkey 51 PDAVMGNPKV KAHGKKVLGA FSDGLNHLDN LKGTFAQLSE LHCDKLHVDP
AAA21113.1; rhesus monkey: www.ncbi
Gibbon 51 PDAVMGNPKV KAHGKKVLGA FSDGLAHLDN LKGTFAQLSE LHCDKLHVDP .nlm.nih.gov/protein/122634; gibbon: www.ncbi

NEW! Problem-Solving Exercises guide Instructors: students in applying scientific skills

.nlm.nih.gov/protein/122616
human 101 ENFRLLGNVL VCVLAHHFGK EFTPPVQAAY QKVVAGVANA LAHKYH
Monkey 101 ENFKLLGNVL VCVLAHHFGK EFTPQVQAAY QKVVAGVANA LAHKYH a version of this Scientific

and interpreting real data in the context ofMasteringBiology.

Gibbon 101 ENFRLLGNVL VCVLAHHFGK EFTPQVQAAY QKVVAGVANA LAHKYH solving a real-world problem.
Skills exercise can be assigned in

PROBLEM-SOLVING EXERCISE Problem-Solving

Are you a victim
of fish fraud?
When buying salmon, perhaps you
prefer the more expensive wild-caught
pacific salmon (Oncorhynchus species) over
farmed atlantic salmon (Salmo salar). But
studies reveal that about 40% of the time,
you aren’t getting the fish you paid for!
M05_URRY3715_11_SE_C05.indd 89
Exercises include:
In this exercise, you will investigate whether a piece of salmon has been fraudulently labelled. Ch. 5: Are you a victim
Your Approach the principle guiding your investigation is that Dna sequences from
of fish fraud? Shown at left
within a species or from closely related species are more similar to each and on p. 89
other than are sequences from more distantly related species.
Ch. 11: Can a skin wound
Your Data You’ve been sold a piece of salmon labelled as coho salmon (Oncorhynchus turn deadly? p. 216
kisutch). to see whether your fish was labelled correctly, you will compare a
short Dna sequence from your sample to standard sequences from the same Ch. 17: Are insulin mutations
gene for three salmon species. the sequences are:
the cause of three infants’
Sample labelled as O. kisutch 5’-CGGCACCGCCCTAAGTCTCT-3’
(coho salmon) neonatal diabetes? p. 361
Sequence for O. kisutch (coho salmon)
Standard
5’- AGGCACCGCCCTAAGTCTAC-3’
Ch. 24: Is hybridisation
µ Sequence for O. keta (chum salmon) 5’- AGGCACCGCCCTGAGCCTAC -3’
sequences
Sequence for Salmo salar (atlantic salmon) 5’-CGGCACCGCCCTAAGTCTCT-3’
promoting insecticide
resistance in mosquitoes that
Your Analysis 1. Scan along the standard sequences (O. kisutch, O. keta, and S. salar), transmit malaria? p. 520
base by base, circling any bases that do not match the sequence from
your fish sample. Ch. 34: Can declining
2. how many bases differ between (a) O. kisutch and your fish sample?
(b) O. keta and the sample? (c) S. salar and the sample? amphibian populations be
3. For each standard, what percentage of its bases are identical to your saved by a vaccine? p. 754
sample?
4. Based on these data alone, state a hypothesis for the species identity Ch. 39: How will climate
of your sample. What is your reasoning?
change impact crop
productivity? p. 889
chapter 5 The Structure and Function of Large Biological Molecules 89 Ch. 45: Is thyroid regulation
normal in this patient? p. 1036
01/06/17 11:50 AM
Ch. 55: Can an insect
outbreak threaten a forest’s
ability to absorb CO2 from
the atmosphere? p. 1280

28 Interpreting Comparisons of Genetic Sequences, p. 607 43 Comparing Two Variables on a Common x-Axis, p. 999
29 Making Bar Graphs and Interpreting Data, p. 641 44 Describing and Interpreting Quantitative Data, p. 1007
30 Using Natural Logarithms to Interpret Data, p. 651 45 Designing a Controlled Experiment, p. 1040
31 Interpreting Genomic Data and Generating Hypotheses, p. 677 46 Making Inferences and Designing an Experiment, p. 1058
32 Calculating and Interpreting Correlation Coefficients, p. 698 47 Interpreting a Change in Slope, p. 1077
33 Understanding Experimental Design and Interpreting 48 Interpreting Data Values Expressed in Scientific Notation, p. 1110
Data, p. 720 49 Designing an Experiment using Genetic Mutants, p. 1123
34 Determining the Equation of a Regression Line, p. 773 50 Interpreting a Graph with Log Scales, p. 1164
35 Using Bar Graphs to Interpret Data, p. 784 51 Testing a Hypothesis with a Quantitative Model, p. 1178
36 Calculating and Interpreting Temperature Coefficients, p. 812 52 Making a Bar Graph and a Line Graph to Interpret Data, p. 1215
37 Making Observations, p. 838 53 Using the Logistic Equation to Model Population
38 Using Positive and Negative Correlations to Interpret Growth, p. 1230
Data, p. 860 54 Making a Bar Graph and a Scatter Plot, p. 1251
39 Interpreting Experimental Results from a Bar Graph, p. 890 55 Interpreting Quantitative Data, p. 1282
40 Interpreting Pie Charts, p. 918 56 Graphing Cyclic Data, p. 1314
41 Interpreting Data from an Experiment with Genetic
Mutants, p. 944
* Available only in MasteringBiology. All other Scientific Skills Exercises are in the
42 Making and Interpreting Histograms, p. 964 print book, eText, and MasteringBiology.

xix

Copyright © Pearson Australia (a division of Pearson Australia Group Pty Ltd) 2018—9781488613715—Urry/Campbell Biology 11e
Bring Biology to Life
NEW! More than 450 carefully chosen and edited videos and animations have
been integrated into the print book and MasteringBiology at point of use to help
students learn biology visually.

Media references in the print book direct students to digital resources in the Study Area:
• BioFlix Animations

Access the complete textbook online!

The Campbell eText includes powerful inter-
active and customisation functions, such
as instructor and student note-taking,
highlighting, bookmarking, search,
and links to glossary terms.

xx

Copyright © Pearson Australia (a division of Pearson Australia Group Pty Ltd) 2018—9781488613715—Urry/Campbell Biology 11e
Succeed with MasteringBiology
MasteringBiology improves results by engaging students before, during,
and after class.

Before Class
Dynamic Study Modules provide students with
multiple sets of questions with extensive feedback so
that they can test, learn, and retest until they achieve
mastery of the textbook material.

NEW! Get Ready for This Chapter quizzes help

students review content they need to understand from
previous chapters.

Pre-Class Reading Quizzes help students pinpoint

concepts that they understand and concepts that they
need to review.

During Class
NEW! For ideas for in-class activities, see the
Ready-to-Go Teaching Modules.

After Class
Hundreds of self-paced tutorials and coaching
activities provide students with individualised
coaching with specific hints and feedback on the
toughest topics in the course.

Optional Adaptive Follow-up Assignments

are based on each student’s performance on the
original MasteringBiology assignment and provide
additional questions and activities tailored
to each student’s needs.

Learning CatalyticsTM allows students

to use their smartphone, tablet, or laptop
to respond individually or in groups to
questions in class. Visit learningcatalytics.
com to learn more.

xxi

Copyright © Pearson Australia (a division of Pearson Australia Group Pty Ltd) 2018—9781488613715—Urry/Campbell Biology 11e
Personalised Coaching in MasteringBiology
Instructors can assign self-paced
MasteringBiology tutorials that
provide students with individualised
coaching with specific hints and
feedback on the toughest topics
in the course.

1. If a student gets stuck...

2. Specific wrong-answer feedback
appears in the purple feedback box.

3. Hints coach students to the

correct response.

4. Optional Adaptive Follow-Up

Assignments are based on the original
homework assignment
and provide additional coaching
and practice as needed.

Question sets in the Adaptive

Follow-Up Assignments
continuously adapt to each
student’s needs, making efficient
use of study time.

xxii

Copyright © Pearson Australia (a division of Pearson Australia Group Pty Ltd) 2018—9781488613715—Urry/Campbell Biology 11e
MasteringBiology offers thousands of tutorials,
activities, and questions that can be assigned as
homework. A few examples are shown below.

BioFlix Tutorials use 3D, movie-
quality animations and coaching
exercises to help students master
tough topics outside of class.
Animations are also available in
the Study Area and can be shown
in class.
NEW! Galápagos
Evolution Video
Activities, filmed on
the Galápagos Islands by
Peter and Rosemary Grant,
bring to life the dynamic
EXPANDED! HHMI BioInteractive Short evolutionary processes that
Films, documentary-quality movies from impact Darwin’s finches
the Howard Hughes Medical Institute, on Daphne Major Island.
engage students in topics from the Videos explore important
discovery of the double helix to evolution, concepts and data from the
with assignable questions. Grants’ field research, with
assignable activities.

The MasteringBiology Gradebook provides instructors

with quick results and easy-to-interpret insights into student
performance. Every assignment is automatically graded. Shades
of red highlight vulnerable students and challenging assignments.

Student scores on the optional

Adaptive Follow-Up Assignments
are recorded in the gradebook
and offer additional diagnostic
information for instructors to monitor
learning outcomes and more.

PERSONALISED COACHING IN MASTERINGBIOLOGY xxiii

Copyright © Pearson Australia (a division of Pearson Australia Group Pty Ltd) 2018—9781488613715—Urry/Campbell Biology 11e
Instructor Resources
Instructor’s Resource USB Set for Campbell Biology,
Eleventh Edition
The Instructor’s Resource USB consists of a set of assets for each
chapter. Specific features include:
• Editable figures (art and photos) and tables from the text in
PowerPoint®
• Test Bank questions.

The Instructor Resources area of MasteringBiology

includes:
• NEW! Ready-to-Go Teaching Modules help instructors efficiently
make use of the available teaching tools for the toughest
topics. Before-class assignments, in-class activities, and after-
class assignments are provided for ease of use. Instructors can
incorporate active learning into their course with the suggested
activity ideas and clicker questions or Learning Catalytics questions.

• Editable figures (art and photos) and tables from the text in
PowerPoint
• Testbank questions.

All of the art, graphs, and photos from the text

are provided with customisable labels. More than 1,600
photos from the text and other sources are included.

xxiv

Copyright © Pearson Australia (a division of Pearson Australia Group Pty Ltd) 2018—9781488613715—Urry/Campbell Biology 11e
Another random document with
no related content on Scribd:
prohibition against accepting unsolicited donations from donors in
such states who approach us with offers to donate.

International donations are gratefully accepted, but we cannot make

any statements concerning tax treatment of donations received from
outside the United States. U.S. laws alone swamp our small staff.

Please check the Project Gutenberg web pages for current donation
methods and addresses. Donations are accepted in a number of
other ways including checks, online payments and credit card
donations. To donate, please visit: www.gutenberg.org/donate.

Section 5. General Information About Project

Gutenberg™ electronic works
Professor Michael S. Hart was the originator of the Project
Gutenberg™ concept of a library of electronic works that could be
freely shared with anyone. For forty years, he produced and
distributed Project Gutenberg™ eBooks with only a loose network of
volunteer support.

Project Gutenberg™ eBooks are often created from several printed

editions, all of which are confirmed as not protected by copyright in
the U.S. unless a copyright notice is included. Thus, we do not
necessarily keep eBooks in compliance with any particular paper
edition.

Most people start at our website which has the main PG search
facility: www.gutenberg.org.

This website includes information about Project Gutenberg™,

including how to make donations to the Project Gutenberg Literary
Archive Foundation, how to help produce our new eBooks, and how
to subscribe to our email newsletter to hear about new eBooks.