ORIGINAL RESEARCH

GPR30 Promotes Prostate Stromal Cell Activation via

Suppression of ER␣ Expression and Its Downstream
Signaling Pathway

Bona Jia, Yu Gao, Mingming Li, Jiandang Shi, Yanfei Peng, Xiaoling Du,

Downloaded from https://academic.oup.com/endo/article/157/8/3023/2422352 by biomedicas user on 06 February 2024

Helmut Klocker, Natalie Sampson, Yongmei Shen, Mengyang Liu, and Ju Zhang
Department of Biochemistry and Molecular Biology (B.J., Y.G., M.L., J.S., X.D., Y.S., J.Z.), College of Life
Sciences, Bioactive Materials Key Lab of the Ministry of Education, Nankai University, Tianjin 300071,
China; School of Integrative Medicine (Y.P.), Tianjin University of Traditional Chinese Medicine, Tianjin
300193, China; Department of Urology (H.K., N.S.), Division of Experimental Urology, Medical University
of Innsbruck, A-6020 Innsbruck, Austria; and Department of Nutrition and Food Science (M.L.), Texas
A&M University, College Station, Texas 77843

Cancer-associated fibroblasts (CAFs) play a vital role in malignant transformation and progression
of prostate cancer (PCa), and accumulating evidence suggests an enhancing effect of estrogens on
PCa. The present study aimed to investigate the possible origin of prostate CAFs and the effects of
estrogen receptors, G protein-coupled receptor 30 (GPR30) and estrogen receptor (ER)-␣, on stro-
mal cell activation. High expression of fibroblast activation protein (FAP), CD44, and nonmuscle
myosin heavy chain B (SMemb) accompanied by low expression of smooth muscle differentiation
markers was found in the stromal cells of PCa tissues and in cultured human prostate CAFs. Ad-
ditionally, SMemb expression, which is coupled to cell phenotype switching and proliferation, was
coexpressed with FAP, a marker of activated stromal cells, and with the stem cell marker CD44 in
the stromal cells of PCa tissue. Prostate CAFs showed high GPR30 and low ER␣ expression. More-
over, GPR30 was coexpressed with FAP, CD44, and SMemb. Furthermore, the study demonstrated
that the overexpression of GPR30 or the knockdown of ER␣ in prostate stromal cells induced the
up-regulation of FAP, CD44, Smemb, and the down-regulation of smooth muscle markers. The
conditioned medium from these cells promoted the proliferation and migration of LNCaP and PC3
PCa cells. GPR30 knockdown or ER␣ overexpression showed opposite effects. Finally, we present
a novel mechanism whereby GPR30 limits ER␣ expression via inhibition of the cAMP/protein kinase
A signaling pathway. These results suggest that stem-like cells within the stroma are a possible
source of prostate CAFs and that the negative regulation of ER␣ expression by GPR30 is centrally
involved in prostate stromal cell activation. (Endocrinology 157: 3023–3035, 2016)

lthough the vast majority of adenocarcinomas stem
A from the epithelial compartment, there is evidence
indicating that tumorigenesis is not merely determined by
the malignant cancer cells themselves but also by the tu-
mor stroma (1–3). Carcinomas with abundant stroma
show higher malignant degrees (4, 5), and cancer-associ-
ated fibroblasts (CAFs), which constitute most tumor
stroma, are prominent modifiers of cancer initiation and
progression. In a tissue recombination model, CAFs es-
tablished from prostate cancer (PCa) tissue have been
ISSN Print 0013-7227 ISSN Online 1945-7170
Printed in USA
Copyright © 2016 by the Endocrine Society
Received January 19, 2016. Accepted May 3, 2016.
First Published Online May 10, 2016
shown to induce human benign prostatic hyperplasia ep-
ithelial cell line (BPH-1) to form tumors (2), and CAFs
show a vital role in extracellular matrix remodeling and
promoting cancer cell survival, proliferation and invasion
(6 – 8).
CAFs are broadly defined as all fibroblast cells within
the tumor-associated stroma, thus including fibroblasts
Abbreviations: AR, androgen receptor; CAF, cancer-associated fibroblast; CM, conditioned
medium; DAPI, 4⬘,6⬘-diamino-2-phenylindole; DMSO, dimethylsulfoxide; E2, estradiol; ER,
estrogen receptor; FAP, fibroblast activation protein; FBS, fetal bovine serum; FSK, fors-
kolin; GPR30, G protein-coupled receptor 30; HE, hematoxylin and eosin; hTERT, human
telomerase reverse transcriptase; IF, immunofluorescence; IHC, immunohistochemical;
MFI, mean fluorescence intensity; MMP, matrix metalloproteinase; NAF, normal fibroblast;
NP, normal prostate; PCa, prostate cancer; PKA, protein kinase A; P/S, penicillin/strepto-
mycin; RFP, red fluorescence protein; siRNA, small interfering RNA; SM, smooth muscle;
␣-SMA, ␣-smooth muscle actin; SMC, SM cell; SMemb, nonmuscle myosin heavy chain B.

doi: 10.1210/en.2016-1035 Endocrinology, August 2016, 157(8):3023–3035 press.endocrine.org/journal/endo 3023

3024 Jia et al GPR30 Promotes Prostate Stromal Cell Activation
and myofibroblasts (9). The origin of CAFs has been ex-
tensively investigated, and they have been shown to orig-
inate from different components. The most immediate
source are resident fibroblasts (9). Smooth muscle cells
(SMCs) are a plausible second source because the tumor
stroma undergoes a progressive loss of SMCs in parallel to
the appearance of CAFs (10, 11). According to other re-
ports, CAFs originate from mesenchymal stem cells or
other mesenchymal cell types within the tumor such as
vascular smooth muscle cells, pericytes, or adipocytes,
which transdifferentiate into CAFs (12–14). Finally, epi-
thelial cells, which have undergone epithelial-to-mesen-
chymal transition, may also serve as a source of CAFs (4).
Inconsistencies between these reports call for greater ef-
forts in elucidating the source and inductors of CAFs.
In addition, the factor(s) responsible for stromal cell
activation are not completely known. In prostatic carci-
nogenesis sex hormones play a pivotal role (15, 16), and
accumulating evidence suggests that androgens and also
estrogens participate in PCa progression (2, 17). The bi-
ological effects of estrogens are mainly mediated through
estrogen receptors. Estrogen receptor (ER)-␣ and ER␤ are
ligand-inducible transcription factors belonging to the nu-
clear receptor superfamily and mediate classical estrogen
actions. In addition, G protein-coupled receptor 30
(GPR30), also called G protein-coupled estrogen receptor,
an orphan receptor, has been recently discovered to be
involved in mediating some estrogen actions, in particular
the nongenomic ones (18). Estrogen actions reported in
stromal cells are mainly mediated by ER␣ and GPR30.
Previous studies reported that estradiol (E2) regulates ma-
trix metalloproteinase (MMP)-2 expression and enolase 1
secretion through ER␣ in prostate stromal WPMY-1 cells
(19, 20). Another study showed ER␣ regulates thrombos-
pondin 2 expression in CAFs and thereby decreases the
invasive capability of PCa cells (21). In breast cancer
CAFs, E2, and the GPR30-selective ligand G-1 up-regulated
connective tissue growth factor and vascular endothelial
growth factor in a GPR30-dependent manner (22, 23). Both,
ER␣ and GPR30 have been reported to be involved in SMC
differentiation in several tissue types (24, 25).
In this study, we investigated the possible origin of
CAFs in PCa. We studied the contribution of GPR30 and
ER␣ on phenotypic changes of stromal cells and on PCa
cell proliferation and migration. Furthermore, we dem-
onstrated the interconnected regulation between GPR30
and ER␣ and described the molecular mechanism thereof.
Materials and Methods
Cell culture and treatment
Primary human prostate normal fibroblasts (NAFs) estab-
lished from normal prostate tissue and prostate CAFs established
Endocrinology, August 2016, 157(8):3023–3035
from prostate tumor tissue were obtained from the Department
of Urology, Medical University of Innsbruck (Innsbruck, Aus-
tria). The primary stromal cells were isolated from prostate can-
cer patients undergoing radical prostatectomy after diagnosis of
PCa according to the procedure described previously (26, 27).
The use of prostate tissue samples was approved by the Ethics
Committee of the Medical University of Innsbruck. Three pairs
of primary NAFs/CAFs and one pair of human telomerase re-
verse transcriptase (hTERT)-immortalized NAFs/CAFs (11)
were used in the experiments. The NAFs/CAFs were routinely
maintained in DMEM phenol red-free medium (Sigma-Aldrich)
Downloaded from https://academic.oup.com/endo/article/157/8/3023/2422352 by biomedicas user on 06 February 2024
supplemented with 100 U/mL penicillin/streptomycin (P/S; In-
vitrogen) and 10% fetal bovine serum (FBS; Invitrogen) at 37°C
under 5% CO2. The human prostate stromal cell line WPMY-1,
which was derived from normal stromal cells of the peripheral
zone in the adult prostate and defined as myofibroblasts (28),
was obtained from the American Type Culture Collection. These
cells were maintained in DMEM phenol red-free medium sup-
plemented with P/S and 5% FBS. WPMY-1 cells were treated
with vehicle (dimethylsulfoxide [DMSO]) or 1 ␮M of the ad-
enylyl cyclase agonist forskolin (FSK; Beyotime) for 24 hours.
Then cells were collected and lysed for protein extraction. The
human PCa cell lines LNCaP and PC3 were obtained from the
American Type Culture Collection. All PCa cell lines were grown
in RPMI 1640 phenol red-free medium (Sigma) supplemented
with P/S and 10% FBS.
Plasmids and small interfering RNA (siRNA)
transfection
Human cDNA fragments encoding GPR30 and ER␣ were
PCR amplified from reverse transcribed WPMY-1 cell total
RNA. Red fluorescence protein (RFP) cDNA was amplified from
plasmid pDsRed-N1. The resulting cDNA fragments were
cloned into the PLenti6.4-R4R2-V5-Dest vector to generate
RFP, GPR30, and ER␣ expression constructs. The three expres-
sion plasmids were transfected into WPMY-1 cells using Lipo-
fectamine 3000 reagent (Invitrogen). Transfected cells, labeled
as WPMY1-RFP/GPR30/ER␣, were harvested 72 hours after
transfection for RNA or protein extraction.
siRNAs targeting GPR30 or ER␣ and a negative control siRNA
that did not match any known human cDNA were purchased from
GenePharma. The sequences used were 5-GCUGUACAUUGAG
CAGAAATT-3 (forward) and 5-UUUCUGCUCAAUGUA
CAGCTT-3 (reverse) for GPR30, 5-UCAUCGCAUUCCUUG
CAAATT-3 (forward) and 5-UUUGCAAGGAAUGCGAU
GATT-3 (reverse) for ER␣, and 5-UUCUCCGAACGUGU
CACGUTT-3 (forward) and 5-ACGUGACACGUUCG
GAGAATT-3 (reverse) for the negative control siRNA. A second
pair of siRNAs was used to exclude off-target effects (see Supple-
mental Materials for these siRNA sequences and Supplemental
Figure 1 for the knockdown verification). WPMY-1 cells and im-
mortalized NAFs/CAFs were transfected with the corresponding
siRNA using Lipofectamine 3000 reagent (Invitrogen) according
to the manufacturer’s instructions. For treatment, the transfected
cells were incubated with 2 ␮M protein kinase A (PKA) inhibitor
H89 (Beyotime) in DMSO or an equivalent amount of the solvent.
Cells were collected for RNA or protein extraction 72 hours after
transfection.
doi: 10.1210/en.2016-1035 press.endocrine.org/journal/endo 3025

Preparation of conditioned medium (CM) Cell proliferation assay

Prostate stromal cells were transfected with expression plas-
mids or siRNA in DMEM with 5% FBS for 24 hours. Afterward
the media were changed to DMEM with 2% FBS. After a further
48 hours, media were collected, centrifuged at 400 ⫻ g for 5
minutes to remove the floating cells, and used immediately or
frozen at ⫺20°C until use. The CM volumes were normalized to
cell numbers.
Real-time RT-PCR assay
For quantitative proliferation assay, 20 000 PCa cells sus-
pended in complete medium were seeded in 24-well plates to-
gether with an equal volume of CM. All treatments were repeated
three times. For the determination of cell numbers after 24, 48,
72, and 96 hours, respectively, cells were trypsinized and
counted using a hemacytometer.
Transwell migration assay
PCa cells were seeded in Transwell inserts with 8 ␮m pore size
(BD Biosciences) at 20 000 cells per well in DMEM/F12 serum-

Downloaded from https://academic.oup.com/endo/article/157/8/3023/2422352 by biomedicas user on 06 February 2024

Total RNA was extracted using Trizol reagent (Invitrogen).
Reverse transcription was performed as described previously
(24). SYBR Green I-based real-time quantitative PCR was per-
formed on an MJ Research DNA engine Opticon continuous
fluorescence detection system (Opticon Monitor II; MJ Re-
search, Inc). Specific primer pairs are listed in Table 1. The rel-
ative gene expression was determined using the comparative CT
method and normalized to the housekeeping gene hypoxanthine
phosphoribosyltransferase 1 (HPRT).
Western blot assay
Cells were lysed with radioimmunoprecipitation assay buffer
to extract the total protein. Protein was quantified using the
bicinchoninic acid method. Equal amounts of proteins were sep-
arated by SDS-PAGE and then transferred to a polyvinyl diflu-
oride membrane. The membrane was blotted with primary an-
tibodies and secondary antibodies (goat antirabbit or goat
antimouse horseradish peroxidase conjugated, 1:5000; Bio-Rad
Laboratories). The primary antibody dilutions used are given in
Table 2. After the treatment with enhanced chemiluminescence
reagent (Pierce), the membrane was exposed to an x-ray film
(Kodak) and ImageJ software (National Institutes of Health,
Bethesda, Maryland) used for densitometry quantification.
free medium with 10 ng/mL mitomycin C to inhibit cell growth.
CMs were added to the bottom chamber. After 24 hours, cells on
the upper surface of the filter were removed using a cotton swab.
Cells that had migrated through the filter to the lower surface
were fixed with 4% paraformaldehyde and stained with 0.5%
crystal violet. Cells were counted from five randomly selected
fields per chamber.
Wound-healing assay
PCa cells were seeded in equal numbers in six-well plates.
Once 90% confluent, the medium was changed to DMEM/F12
serum-free medium for 24 hours. Then three vertical wounds per
well were scratched using a 10-␮L pipette tip and cells incubated
with the indicated CM from prostate stromal cells supplemented
with 10 ng/mL mitomycin C to inhibit cell growth. Images were
collected at the designated time thereafter at 100-fold magnifi-
cation to assess wound closure.
Histological and immunohistochemical studies
PCa (seven patients who underwent radical prostatectomy
for prostate carcinoma, Gleason 4⫹3 ⫽ 7) and normal prostate
(six autopsy cases of patients who died due to illness other than
malignancy) tissues were obtained from the Department of Pa-

Table 1. Nucleotide Sequence of Primers Used in Real-Time RT-PCR

Gene Primer Sequences Annealing Temperature, Product
Name (5ⴕ–3ⴕ) °C Size, bp
␣-SMA Forward, GGGACATCAAGGAGAAACTG 56 219
Reverse, TGATGCTGTTGTAGGTGGTT
Calponin Forward, TTGAGGCCAACGACCTGTTT 56 137
Reverse, TTTCCGCTCCTGCTTCTCTG
CD44 Forward, TCCAACACCTCCCAGTATG 58 149
Reverse, TTCTGGACATAGCGGGTG
ER␣ Forward, GGACCATATCCACCGAGTCCTG 56 348
Reverse, GCCTCCCCCGTGATGTAATAC
FAP Forward, CCCTGCGTATGTAGGTCC 60 175
Reverse, TGTCTGCCAGTCTTCCCT
GPR30 Forward, TTGTGGGCAACATCCTGA 56 252
Reverse, CGATGTAGCGGTCGAAGC
HPRT Forward, TGACACTGGCAAAACAATGCA 56 94
Reverse, GGTCCTTTTCACCAGCAAGCT
MYH11 Forward, AGAAGCCAGGGAGAAGGAAACCAA 68 131
Reverse, TGGAGCTGACCAGGTCTTCCATTT
SM22␣ Forward, GGTTAGGCCAAGGCTCTACTGT 56 184
Reverse, GGGCCACACTGCACTATGAT
SMemb Forward, TCTTGGGATGAATGTGATG 56 172
Reverse, ATTGATGCGATGAACGAG
Abbreviation: HPRT, hypoxanthine phosphoribosyltransferase 1.
3026 Jia et al GPR30 Promotes Prostate Stromal Cell Activation Endocrinology, August 2016, 157(8):3023–3035

Table 2. Antibody Table

Manufacturer,
Catalog Number,
Peptide/ and/or Name of Species Raised
Protein Antigen Sequence Name of Individual Providing (Monoclonal or Dilution
Target (if Known) Antibody the Antibody Polyclonal) Used
␣-SMA ␣-smooth muscle Boster, BM0002 Mouse monoclonal 1:100 (IHC)
actin 1:300 (WB)
␤-Actin ␤-Actin Boster, BM0627 Mouse monoclonal 1:400 (WB)
Calponin Calponin 1 Santa Cruz Biotechnology, Mouse monoclonal 1:100 (IHC)
sc-58707 1:400 (WB)

Downloaded from https://academic.oup.com/endo/article/157/8/3023/2422352 by biomedicas user on 06 February 2024

CD44 CD44 Abcam, ab51037 Rabbit monoclonal 1:100 (IHC/IF)
1:2000 (WB)
CD44 CD44 Cell Signaling, 3570 Mouse monoclonal 1:100 (IF)
ER␣ Amino acids 1–300 ER␣ Abcam, ab108398 Rabbit monoclonal 1:100 (IHC/IF)
1:1000 (WB)
FAP Fibroblast activation Abcam, ab53066 Rabbit polyclonal 1:100 (IHC/IF)
protein, ␣ 1:500 (WB)
FAP FAP Santa Cruz Biotechnology, Mouse monoclonal 1:100 (IF)
sc-65398
GPR30 Amino acids 307–375 GPR30 Abcam, ab154069 Rabbit polyclonal 1:100 (IHC/IF)
1:1000 (WB)
MYH11 MYH11 Santa Cruz Biotechnology, Mouse monoclonal 1:100 (IHC)
sc-6956 1:500 (WB)
SM22␣ N-terminus amino acids Transgelin Santa Cruz Biotechnology, Rabbit polyclonal 1:100 (IHC)
16 –90 sc-50446 1:300 (WB)
SMemb Nonmuscle myosin Yamasa, 7602 Mouse monoclonal 1:1000 (IHC/IF)
heavy chain 1:2000 (WB)
Abbreviation: WB, Western blot.

thology and the Department of Urology, the Second Affiliated
Hospital of Tianjin Medical University (Tianjin, China). Use of
the tissue samples in this study was approved by the institutional
review board. Hematoxylin and eosin (HE) staining and immu-
nohistochemical (IHC) staining were carried out as previously
described (29). Briefly, 5-␮m sections were deparaffinized in xy-
lene and rehydrated in a graded series of alcohol. One section was
HE stained for histological examination, and the other sections
were processed for immunohistochemistry using the avidin-bi-
otin-peroxidase complex method. The poach method with ci-
trate buffer (pH 6.0) was used for antigen retrieval. Sections were
incubated with the primary antibodies in 10% bovine serum in
PBS overnight at 4°C, followed by the respective biotinylated
secondary antibodies and horseradish-peroxidase streptavidin.
Primary antibody dilutions used are given in Table 2. The stained
slides were mounted and visualized in the bright field with an
Olympus CX41 microscope. Pictures were obtained using a mag-
nification of ⫻200. Positively stained cells were counted in at
least nine randomly selected microscopic fields and the mean
values were calculated.
Immunofluorescence (IF) double-staining assay
Before blocking of paraffin sections with 10% normal bovine
serum in PBS, the poach method with citrate buffer (pH 6.0) was
performed for antigen retrieval. Then sections were incubated
with two types of primary antibodies at 4°C overnight using
antibody dilutions specified in Table 2. Sections were subse-
quently washed and incubated with Alexa Flour 594 anti-mouse
IgG (1:500 dilution; Invitrogen) and Alexa Flour 488 anti-rabbit
IgG (1:1000 dilution; Invitrogen) for 1 hour at room tempera-
ture, and the DNA of cell nuclei was counterstained with 4⬘,6⬘-
diamino-2-phenylindole (DAPI; 1:100 dilution; Roche;
236276). The sections were then analyzed with a confocal laser-
scanning microscope. The mean fluorescence intensity (MFI) in
the stromal compartment was quantified with Photoshop soft-
ware. At least nine randomly selected microscopic fields were
analyzed, and the mean values were calculated.
cAMP measurement
WPMY-1 cells were transfected with plasmids or siRNA as
described above. Forty-eight hours after transfection, cells were
rinsed once with PBS and lysed. As positive control, WPMY-1
cells were treated with DMSO or 1 ␮M FSK for 10 minutes. The
lysates were subsequently collected and subjected to a cAMP
luminescence assay according to the manufacturer’s instruction
(cAMP-Glo assay, V1501; Promega).
Statistical analysis
Data are expressed as the mean ⫾ SD. Significance was as-
sessed using a Student’s paired t test. P ⬍ .05 was considered as
significant.
Results
Increasing number of nonmuscle myosin heavy
chain B (SMemb)-positive stem-like cells
accompanies a decrease of SMCs in PCa stroma
To better understand the phenotypic characteristic of
activated stromal cells in human PCa, PCa tissues were
doi: 10.1210/en.2016-1035 press.endocrine.org/journal/endo 3027

whereas no positive staining was de-

tected in NP stroma. Moreover, the
positive rate of CD44, a marker of
prostate-resident mesenchymal stem
cells (31), was 26.5% ⫾ 7.5% in PCa
stroma in contrast to only 1.8% ⫾
0.5% in the NP stroma. Whereas
92.7% ⫾ 5.2% of PCa stromal cells
stained positive for ␣-smooth muscle
actin (␣-SMA), the positive cells ex-

Downloaded from https://academic.oup.com/endo/article/157/8/3023/2422352 by biomedicas user on 06 February 2024

hibited lower immunostaining inten-
sity compared with NP stroma. The
positive rates of smooth muscle (SM)
differentiation markers SM22␣, cal-
ponin, and MYH11 in PCa stroma
(30.5% ⫾ 4.2%, 25.7% ⫾ 6.4%,
and 21.3% ⫾ 7.5%, respectively)
were much lower than in the NP
stroma (93% ⫾ 5.7%, 85.5% ⫾
6.3%, and 93.7% ⫾ 4%, respec-
tively), whereas the SMemb, a
marker indicating the cell phenotype
switch, increased from 0.3% ⫾
0.2% in the NP stroma to 25.2% ⫾
7.1% in the PCa stroma (Figure 1, A
and B).
In addition, basal expression lev-
els of these markers were measured
in primary human prostate NAFs
and CAFs. Consistent with tissue
IHC, a 1.66-, 4.17-, and 2.15-fold
increase of FAP, CD44, and SMemb
mRNA expressions, respectively,
were observed in CAFs compared
with NAFs by real-time RT-PCR.
These changes were accompanied by
a 2.56-, 2.28-, 4-, and 11.1-fold de-
Figure 1. Increased SMemb-positive stem-like cells and decreased SMCs in PCa stroma. A, IHC
analysis of SM differentiation markers and FAP, CD44, and SMemb expression in human NP and crease in ␣-SMA, SM22␣, calponin,
PCa tissue. Bar, 100 ␮m. B, Mean (SE) percentage of stromal area per high-power field (n ⫽ 9) and MYH11 mRNA expression, re-
stained positive for FAP, CD44, Smemb, and SM differentiation markers in NP (n ⫽ 6) and PCa spectively (Figure 1C, upper panel).
(n ⫽ 7) tissue. *, P ⬍ .05, PCa vs NP. C, Real-time RT-PCR and Western blot analysis of FAP,
CD44, Smemb, and SM differentiation markers expression at mRNA (upper panel) and protein
Comparable changes of these mark-
level (lower panel) in primary NAFs and CAFs. ImageJ software (National Institutes of Health) was ers were also observed at the protein
used for densitometric quantification of proteins. Results are presented as mean ⫾ SD (n ⫽ 3). level via Western blotting (Figure
*, P ⬍ .05, CAFs vs NAFs. D, Real-time RT-PCR analysis of FAP, CD44, Smemb, and SM
1C, lower panel). These differences
differentiation markers expression in hTERT-immortalized NAFs and CAFs. Results are presented
as mean ⫾ SD (n ⫽ 3). *, P ⬍ .05, CAFs vs NAFs. E, Serial sections from each group were in gene expression were also detected
analyzed by HE staining and double-IF staining of SMemb with FAP or SMemb with CD44 in PCa in the hTERT-immortalized NAFs
tissue. Cell nuclei were counterstained with DAPI (blue). Bar, 100 ␮m. and CAFs (Figure 1D).
To address the coexpression of
compared with normal prostate (NP) tissues by IHC. The FAP, CD44, and SMemb, double-IF staining was per-
well-established activated fibroblast marker fibroblast ac- formed in PCa tissue sections. Of interest, all SMemb-
tivation protein (FAP) (6, 30) was specifically detected in positive cells strongly coexpressed FAP and thus constitute
PCa stroma with a positive rate of 65.9% ⫾ 7.5%, an SMemb⫹FAP⫹ subtype within the FAP-positive cells.
3028 Jia et al GPR30 Promotes Prostate Stromal Cell Activation Endocrinology, August 2016, 157(8):3023–3035

Nearly all SMemb-positive cells also coexpressed CD44 (Figure
1E). Taken together, the IHC and IF results suggest that the
appearance of prostate CAFs coincides with a substantial re-
duction in numbers of differentiated SMCs and a significant
increase of SMemb/CD44/FAP-positive stem-like cells.
Prostate CAFs show high GPR30 but low ER␣
expression
To investigate which ER(s) may be involved in stromal
cell activation, double-IF staining for FAP and ERs was
performed in tissue sections. As shown in Figure 2, A and
B, all cells with strong FAP-positive staining and some cells
with low FAP-positive staining coexpressed GPR30; how-
ever, no FAP⫹ER␣⫹ cells were detected in PCa stroma. In
NP stromal cells, GPR30 was not only expressed at lower
levels compared with PCa stromal cells, but it was also
found to be primarily localized to the nucleus (Figure 2B,
arrow). By contrast, GPR30 was present in the cell mem-
brane and the cytoplasm of PCa stromal cells (Figure 2B,
arrowhead). Quantification revealed GPR30 up-regula-

Downloaded from https://academic.oup.com/endo/article/157/8/3023/2422352 by biomedicas user on 06 February 2024

Figure 2. Prostate CAFs show high GPR30 but low ER␣ expression. A, Serial sections from each group were analyzed by HE staining and double-
IF staining of FAP with ER␣ in NP and PCa tissue (upper panel) and mean of florescent intensity of the images (MFI) of stromal ER␣ (lower panel)
(n ⫽ 6). Cell nuclei were counterstained with DAPI (blue). Bar, 100 ␮m. *, P ⬍ .05, PCa vs NP. B, Serial sections from each group were analyzed by
HE staining and double-IF staining of FAP with GPR30 in NP and PCa tissue (upper panel) and MFI of stromal GPR30 (lower panel). Bar, 100 ␮m.
*, P ⬍ .05, PCa vs NP. C and D, Real-time RT-PCR and Western blot analysis of ER␣ and GPR30 expression at mRNA (C) and protein level (D) in
primary NAFs and CAFs. Results are presented as mean ⫾ SD (n ⫽ 3). *, P ⬍ .0,5 CAFs vs NAFs. E, Real-time RT-PCR analysis of ER␣ and GPR30
expression in hTERT-immortalized NAFs and CAFs. Results are presented as mean ⫾ SD (n ⫽ 3). *, P ⬍ .05, CAFs vs NAFs. F, Serial sections from
each group were analyzed by HE staining and double-IF staining of CD44 with GPR30 and SMemb with GPR30 in PCa tissue. Bar, 100 ␮m.
doi: 10.1210/en.2016-1035 press.endocrine.org/journal/endo 3029

CAF cells and obtained congruent

results (Figure 2E). Furthermore,
double-IF staining revealed that
in addition to FAP, GPR30 was
strongly coexpressed with CD44 and
SMemb (Figure 2F).
Taken together, our results sug-
gest that the acquisition of an acti-
vated fibroblasts phenotype is posi-
tively related to the expression of

Downloaded from https://academic.oup.com/endo/article/157/8/3023/2422352 by biomedicas user on 06 February 2024

GPR30 but negatively to the expres-
sion of ER␣ in the PCa stroma.

Overexpression of GPR30 or
knockdown of ER␣ in stromal
cells promote PCa cell
proliferation and migration in a
paracrine manner
The inverse expression of GPR30
and ER␣ in prostate CAFs prompted
us to investigate their roles in PCa
progression via a stromal to epithe-
lial stimulation. WPMY-1 cells were
transfected with expression plasmid
or siRNA for GPR30 and ER␣, re-
spectively (Figure 3, A and C), and
the CM was subsequently collected
to study the effects on PCa cells. We
used two prostate epithelial cell
lines, the less invasive PCa cell line
LNCaP and the highly malignant
Figure 3. High expression of GPR30 or low expression of ER␣ in stromal cells promote PCa cell
proliferation in a paracrine manner. A, C, E, and G, Prostate stromal cells were transfected with PCa cell line PC3 as models. As
expression plasmid (A) or siRNA (C, E, and G) for GPR30 and ER␣. Overexpression and shown in Figure 3, B and D, the CM
knockdown were verified by Western blot analysis after 72 hours. Notice that Western blot collected from WPMY-1 cells over-
images were obtained using different sensitivity settings for overexpression and knockdown
experiments in WPMY-1 cells, lower sensitivity for overexpression (A), and higher sensitivity for expressing GPR30 promoted LN-
knockdown experiments (C). B, D, F, and H, PCa cell lines LNCaP and PC3 were treated with CM CaP and PC3 cell proliferation,
from transfected stromal cells. Cells were counted after 24, 48, 72, and 96 hours, respectively. whereas the silencing of GPR30 ab-
The proliferation curves of LNCaP and PC3 cells are depicted (n ⫽ 3).
rogated the promotion effect. In
contrast, the CM collected from
tion by 3.4-fold and ER␣ down-regulation by 5-fold, re- WPMY-1 cells overexpressing ER␣
spectively, in PCa stroma (Figure 2, A and B, lower panel). suppressed LNCaP and PC3 cell proliferation, whereas
The up-regulation of GPR30 and down-regulation of ER␣ the silencing of ER␣ enhanced the CM ability of the
in the stroma of PCa tissues were confirmed by IHC stain- WPMY-1 cells to promote PCa cell proliferation. The
ing (Supplemental Figure 2). same results were obtained using hTERT-immortalized
In vitro, using real-time RT-PCR, we confirmed that prostate NAF and CAF cells. The CM from immortalized
GPR30 mRNA expression is increased by 5.1-fold in CAF cells with GPR30 knockdown showed a diminished
CAFs compared with NAFs, which is accompanied with a ability to promote PCa cell proliferation (Figure 3, E and
2.5-fold decrease in ER␣ mRNA (Figure 2C). Western F), whereas the CM collected from immortalized NAF
blotting revealed a 2.9-fold increase of GPR30 and 4-fold cells with ER␣ knockdown promoted LNCaP and PC3 cell
decrease of ER␣ at protein levels in CAFs compared with proliferation (Figure 3, G and H).
NAFs (Figure 2D). We confirmed the expression of On the other hand, we investigated the effects of the
GPR30 and ER␣ mRNA in the immortalized NAF and CMs obtained above in a Transwell migration assay (BD
3030 Jia et al GPR30 Promotes Prostate Stromal Cell Activation Endocrinology, August 2016, 157(8):3023–3035

Biosciences). Results showed in-

creased numbers of migrated LNCaP
and PC3 cells with the CM from
WPMY-1 GPR30 cells, whereas the
numbers of migrated LNCaP and
PC3 cells were decreased with the
CM from WPMY-1 ER␣ cells (Fig-
ure 4A). Conversely, the CM of
WPMY-1 siGPR30 significantly re-
duced LNCaP and PC3 cell migra-

Downloaded from https://academic.oup.com/endo/article/157/8/3023/2422352 by biomedicas user on 06 February 2024

tion, whereas the CM of WPMY-1
siER␣ increased LNCaP and PC3
cell migration (Figure 4B). Similarly,
the CM from immortalized CAF
cells with GPR30 knockdown
showed a diminished ability to pro-
mote PCa cell migration (Figure 4C),
whereas the silencing of ER␣ en-
hanced the CM ability of the immor-
talized NAF cells to promote LNCaP
and PC3 cell migration (Figure 4D).
Additionally, these findings were
confirmed by wound-healing assays
(Figure 4, E–H). Taken together, our
data suggest that the expression of
GPR30 in the tumor stroma may
play a promoting role, whereas ER␣
expression may have a suppressing
role upon PCa progression.

High expression of GRP30 and/

or low expression of ER␣ is
positively related to the CAF-
like phenotype of prostate
stromal cells
To elucidate the mechanism by
which stromal GPR30 and ER␣ were
able to exert their effects on PCa pro-
gression, we further investigated
their functions on stromal cell phe-
notypic switching. We scrutinized
Figure 4. CM from stromal cells with high expression of GPR30 or low expression of ER␣ the expression of FAP, CD44,
stimulate PCa cell migration. A–D, The Transwell assay was performed to evaluate the effect of Smemb, and the differentiation
CM from transfected stromal cells on migration of LNCaP and PC3 cells. CMs were placed into
markers at both the mRNA and pro-
the lower chamber of the Transwell plates (BD Biosciences). LNCaP and PC3 cells were put
into the top chamber and allowed to migrate for 24 hours. The Transwell inserts were fixed tein levels in WPMY-1 cells, which
and stained before light microscopy visualization and cell number counting. Results are were transfected with expression
presented as mean ⫾ SD (n ⫽ 5). *, P ⬍ .05 vs controls. Bar, 200 ␮m. E–H, Wound-healing plasmids or siRNA for GPR30 and
assay of LNCaP and PC3 cells incubated for 0 or 24 hours with CM from transfected stromal
cells. ImageJ software (National Institutes of Health) was used for the quantification of ER␣. As shown in Figure 5, A and B,
wound closure. Results are presented as mean ⫾ SD (n ⫽ 3). *, P ⬍ .05 vs controls. Bar, FAP, CD44, and SMemb were sig-
200 ␮m. nificantly up-regulated in WPMY-1
cells upon GPR30 overexpression,
together with the substantial down-
doi: 10.1210/en.2016-1035 press.endocrine.org/journal/endo 3031

regulation of ␣-SMA, SM22␣, cal-

ponin, and MYH11. In contrast, the
expression levels of FAP, CD44, and
SMemb were dramatically reduced
in WPMY-1 cells and the immortal-
ized CAFs upon GPR30 knock-
down, whereas the expression levels
of differentiation markers were in-
creased (Figure 5, C–F).
On the other hand, in WPMY-1

Downloaded from https://academic.oup.com/endo/article/157/8/3023/2422352 by biomedicas user on 06 February 2024

cells with ER␣ overexpression, FAP,
CD44, and SMemb were down-reg-
ulated, but ␣-SMA, SM22␣, cal-
ponin, and MYH11 were up-regu-
lated (Figure 5, G and H), and
knocking down ER␣ resulted in a re-
markable opposite regulation in
both WPMY-1 cells and the immor-
talized NAFs (Figure 5, I–L). All re-
sults suggest that high GPR30 ex-
pression and/or low ER␣ expression
facilitate the induction of a CAF-like
phenotype in prostate stromal cells.

GPR30 represses ER␣ expression

in prostate stromal cells via
inhibition of the cAMP/PKA
signaling pathway
Because GPR30 and ER␣ show
opposite roles in stromal cell activa-
tion, we further investigated whether
GPR30 and ER␣ could regulate each
other’s expression. Interestingly, the
overexpression of GPR30 resulted in
a significant down-regulation of
ER␣ at both the mRNA and protein
levels, whereas the knockdown of
GPR30 resulted in a dramatic up-
regulation of ER␣ in WPMY-1 cells
(Figure 6, A and B). Conversely, the
overexpression or knockdown of
ER␣ induced no significant regula-
Figure 5. High expression of GPR30 and/or low expression of ER␣ is related to the CAF-like
phenotype in prostate stromal cells. A–D, Real-time RT-PCR and Western blot analysis of gene
tion of GPR30 expression (Figure 6,
expression in WPMY-1 cells transfected with GPR30 expression plasmid (A and B) or siRNA (C C and D). The interconnected regu-
and D) at the mRNA level and protein level. E and F, Real-time RT-PCR and Western blot analysis lation was also confirmed in the im-
of gene expression in immortalized CAFs transfected with siGPR30 at the mRNA (E) and protein
mortalized NAFs and CAFs (Figure
level (F). G–J, Real-time RT-PCR and Western blot analysis of gene expression in WPMY-1 cells
transfected with ER␣ expression plasmid (G and H) or siRNA (I and J) at the mRNA and protein 6, E and F).
level. K and L, Real-time RT-PCR and Western blot analysis of gene expression in immortalized It was reported that FSK stimu-
NAFs transfected with siER␣ at mRNA (K) and protein level (L). Results are presented as mean ⫾ lates ER␣ expression by activating
SD (n ⫽ 3). *, P ⬍ .05 vs controls.
the PKA pathway (32), whereas
other reports indicated that GPR30
suppresses PKA activity by inhibit-
3032 Jia et al GPR30 Promotes Prostate Stromal Cell Activation Endocrinology, August 2016, 157(8):3023–3035

ing cAMP production (33, 34). This

led us to examine whether GPR30
represses ER␣ expression though in-
hibiting PKA activity. Thus, we
quantified cAMP concentrations af-
ter transfection of WPMY-1 with
GPR30 expression plasmid or spe-
cific siRNA. As shown in Figure 6G,
cAMP levels were reduced 3.1-fold
in WPMY-1 cells upon GPR30 over-

Downloaded from https://academic.oup.com/endo/article/157/8/3023/2422352 by biomedicas user on 06 February 2024

expression, whereas knockdown in-
creased cAMP concentration by 2.3-
fold. FSK, a cAMP activator used as
a positive control, rapidly stimulated
cAMP production and, as expected,
increased ER␣ protein expression in
WPMY-1 cells (Figure 6H). We then
treated stromal cells with the selec-
tive PKA inhibitor H89 after trans-
fection of siGPR30. As shown in
Figure 6I, H89 blocked the up-regu-
lation of ER␣ protein expression
by GPR30 knockdown in both
WPMY-1 cells and immortalized
CAFs. Thus, these data provide the
evidence that GPR30 negatively reg-
ulates ER␣ expression through in-
hibiting the cAMP/PKA signaling
pathway in prostate stromal cells.
Overall, our data reveal a mecha-
nism summarized in Figure 7:
GPR30 inhibits ER␣ expression and
ER␣ downstream signaling path-
ways. A high GPR30/ER␣ ratio sub-
sequently induces a CAF-like pheno-
type switch of prostate stromal cells.

Discussion
In this study, we found an increased
expression of FAP accompanied by
Figure 6. GPR30 represses ER␣ expression in prostate stromal cell via inhibition of the cAMP/PKA
an enhanced expressions of CD44
signaling pathway. A and B, Real-time RT-PCR and Western blot analysis of ER␣ expression in WPMY1-
GPR30 or WPMY1-siGPR30 at mRNA (A) and protein level (B). C and D, Real-time RT-PCR and Western and SMemb and a substantial down-
blot analysis of GPR30 expression in WPMY1-ER␣ or WPMY1-siER␣ at the mRNA (C) and protein level (D). regulation of SM differentiation
E, Real-time RT-PCR and Western blot analysis of ER␣ expression in immortalized CAFs transfected with
siGPR30 at mRNA (left panel) and protein level (right panel). F, Real-time RT-PCR and Western blot analysis markers in stromal cells of prostate
of GPR30 expression in immortalized NAFs transfected with siER␣ at mRNA (left panel) and protein level cancer tissues and cultured stromal
(right panel). G, WPMY-1 cells were transfected with GPR30 expression plasmid or siRNA for 48 hours or cells derived therefrom. Moreover,
treated with 1 ␮M FSK for 10 minutes, and then concentrations of cAMP were quantified using the
cAMP-Glo assay (n ⫽ 3). *, P ⬍ .05 vs corresponding controls (CTLs). H, WPMY-1 cells were treated with 1 CD44 and SMemb were largely co-
␮M FSK for 24 hours, and ER␣ protein expression was demonstrated by Western blot. I, Western blot expressed in PCa stromal cells, and
analysis of ER␣ protein expression in WPMY-1 cells (left panel) and immortalized CAFs (right panel)
transfected with siGPR30 and treated with 2 ␮M H89 (upper panel), and quantification by densitometry
double-positive CD44⫹SMemb⫹ cells
(lower panel). Results are presented as mean ⫾ SD (n ⫽ 3). *, P ⬍ .05. strongly coexpress FAP.
doi: 10.1210/en.2016-1035
Figure 7. A schematic illustration of the proposed mechanism. GPR30
lowers cAMP and inhibits PKA activity, which represses ER␣ expression
and attenuates ER␣-mediated stimulation of SM differentiation and
inhibition of CAF-like phenotype switching. High GPR30/low ER␣
supports the CAF phenotype, which enhances the release of
proliferation and migration-promoting factors into the supernatant for
paracrine stimulation of prostate tumor cells.
SMemb, an embryonic-type member of the nonmuscle
myosin heavy chain isoform family was previously re-
ported to be abundantly expressed by activated mesen-
chymal cells in cardiac myxomas and atherosclerosis (35,
36), and its expression was coupled to the cell phenotype
switch and proliferation (37). Coexpression of SMemb
and the stem cell marker CD44 in PCa stroma indicates
that most stromal stem-like cells have been abnormally
reawakened/reactivated and undergone a phenotypic
change to gain a higher proliferative capacity. It is well
accepted that stem cells have a high plasticity (38), and the
existence of CD44⫹SMemb⫹FAP⫹ cells indicates that the
reactivated stromal stem-like cells differentiate into FAP-
positive CAFs during PCa development. Yet we also de-
tected FAP⫹CD44⫺ cells within the PCa stroma. Accord-
ing to a previous report CD44-positive cells are able to
generate CD44-negative cells by undergoing asymmetric
division and to develop into fully differentiated myofibro-
blasts with reduced CD44 expression upon TGF-␤ stim-
ulation (31, 39). By this mechanism the FAP⫹CD44⫺ cells
may be derived from the FAP⫹CD44⫹SMemb⫹ cells. The
proliferation of stem-like cells and their transit-amplifying
progeny contribute to the generation of reactive stroma. In
view of the several hypotheses about the origin of CAFs,
our study supports stromal stem-like cells as a source of
prostate CAFs.
In prostate CAFs we found a significantly increased
expression level of GPR30. Moreover, the FAP-positive
stromal cells, especially the FAP⫹CD44⫹SMemb⫹ sub-
type, coexpressed GPR30, which was mainly localized to
press.endocrine.org/journal/endo 3033
the cell membrane and the cytoplasm, whereas GPR30
showed predominant nuclear localization in NP stromal
cells. In the vast majority of previous studies, GPR30 ap-
peared to be expressed on the cell surface and the endo-
plasmic reticulum of several cancer or stromal cells (40 –
42). However, in cultured breast CAFs, GPR30 was
reported to translocate into the nucleus through an im-
portin-dependent mechanism, and its nuclear localization
is required to stimulate the up-regulation of c-fos, one of
Downloaded from https://academic.oup.com/endo/article/157/8/3023/2422352 by biomedicas user on 06 February 2024
the GPR30 target genes (22, 43). These data suggest that
the cellular localization of GPR30 may be related to its
physiological function and its tissue specificity.
We further demonstrate that the high expression of
GPR30 in prostate stromal cells up-regulates FAP, CD44,
and SMemb and down-regulates SM differentiation mark-
ers. Opposite to GPR30, the high expression of ER␣ in
stromal cells is accompanied by the low expression of FAP,
CD44, and SMemb and the high expression of SM differ-
entiation markers. This suggests that high GPR30 and/or
low ER␣ levels facilitate the phenotype switch of stromal
cells toward CAFs. A role of ER␣ in prostate stromal cells
phenotype modulation was reported previously (24).
However, to our knowledge, our report is the first to link
GPR30 to prostate CAF induction, identifying it as a cru-
cial modifier of the stromal cell phenotype.
Another important finding of our study is the repres-
sion of ER␣ expression by GPR30, whereas ER␣ demon-
strated no effect on GPR30 expression in prostate stromal
cells. Contrary to our finding, Ariazi et al (44) previously
reported the E2-mediated down-regulation of GPR30
mRNA via ER in breast cancer cells. Similarly, the group
of Gao et al (45) found that the activation of GPR30 by
G-1 inhibited ER␣ (Ser118) phosphorylation signals in the
mouse uterus.
The CM from the stromal cells with high GPR30 or low
ER␣ expression have promoting effects on the growth and
migration of PCa cells. These findings are consistent with
a large body of literature demonstrating that activated
stromal cells secrete an abundance of paracrine-acting
growth factors and cytokines that modulate the prolifer-
ation and motility/invasion of cancer cells. For example,
hepatocyte growth factor secreted by prostate stromal
cells can drive proliferation of adjacent epithelial cells
(46); its production was found induced by estrogens in
mammary fibroblasts (47). Similarly, Slavin et al (21) re-
ported the down-regulation of MMP3 by ER␣ in prostate
CAFs, and Yeh et al (48) reported the abrogation of IL-6
secretion by ER␣ in prostate CAFs. Both MMP3 and IL-6
promote the migration of tumor cells (4, 48, 49) and are
also candidate mediators for the observed effects on tumor
cell migration.
3034 Jia et al GPR30 Promotes Prostate Stromal Cell Activation
As we discussed above, GPR30 is up-regulated in pros-
tate CAFs, and the overexpression of GPR30 in WPMY-1
cells induced a CAF-like phenotype to promote PCa cell
proliferation and migration in a paracrine manner. In ad-
dition, a role for GPR30 in prostate epithelium has been
reported previously. Chan et al (50) reported the activa-
tion of GPR30 by the nonestrogenic ligand G-1 inhibited
the proliferation of PCa cells. Additionally, G-1 effectively
inhibited the growth of castration-resistant tumors and
elicited neutrophil infiltration-associated necrosis in
xenograft models (51). This seems to disclose an opposing
role of stromal and epithelial GPR30 in PCa progression,
which is similar to the prostatic androgen receptor (AR)
that epithelial AR functions as a suppressor and stromal
AR functions as a promoter for PCa cell invasion (52).
Moreover, G-1 inhibits PCa cell proliferation through the
sustained activation of ERK1/2 and a c-jun/c-fos-depen-
dent up-regulation of p21 (50), whereas in our study
GPR30 suppresses ER␣ expression and was critically
identified through inhibiting the cAMP/PKA signaling
pathway in prostate stromal cell lines, although GPR30
overexpression or knockdown had no effect on ERK1/2
phosphorylation in WPMY-1 cells (data not shown).
Therefore, the specific downstream signaling of epithelial
and stromal GPR30 could be taken into account for the
development of PCa therapies targeting GPR30.
Although our result of the down-regulation of SM dif-
ferentiation makers in prostate CAFs is in agreement with
previous reports (5, 6), no mechanism has been demon-
strated before. Here we propose two possible mechanisms
according to our results: 1) with PCa development, the
stromal stem-like cells stimulated via GPR30 up-regula-
tion preferentially propagate over the preexisting SMCs,
resulting in the decrease of SM markers in PCa stroma; or
2) GPR30 up-regulation directly down-regulates SM dif-
ferentiation marker expression in stromal cells by sup-
pressing ER␣. Therefore, GPR30 and its downstream sig-
naling pathway may be a crucial event involved in prostate
CAF formation.
In conclusion, we provide evidence that stromal stem-
like cells are a possible source of prostate CAFs, and
GPR30 plays a central role in promoting stromal cell ac-
tivation by inhibiting ER␣ signaling. Further studies will
be required to identify the mechanism(s) underlying stro-
mal GPR30 up-regulation and cellular translocalization
during PCa development. The crucial role of GPR30 in the
induction and stimulation of a reactive tumor stroma sug-
gests that treatment for PCa by targeting stromal GPR30
should be considered in the future.
Endocrinology, August 2016, 157(8):3023–3035
Acknowledgments
Address all correspondence and requests for reprints to: Ju
Zhang, PhD, or Jiandang Shi, PhD, Department of Biochemistry
and Molecular Biology, College of Life Sciences, Bioactive Ma-
terials Key Lab of Ministry of Education, Nankai University,
Tianjin 300071, China; E-mail: zhangju@nankai.edu.cn (J.Z.);
or shijd@nankai.edu.cn (J.S.).
This work was supported by the National Natural Science
Foundation of China Grant 81370859 and The 111 Project
Downloaded from https://academic.oup.com/endo/article/157/8/3023/2422352 by biomedicas user on 06 February 2024
Grant B08011.
Disclosure Summary: The authors have nothing to disclose.
References
1. Clark AK, Taubenberger AV, Taylor RA, et al. A bioengineered
microenvironment to quantitatively measure the tumorigenic prop-
erties of cancer-associated fibroblasts in human prostate cancer.
Biomaterials. 2013;34:4777– 4785.
2. Cunha GR, Hayward SW, Wang YZ, Ricke WA. Role of the stromal
microenvironment in carcinogenesis of the prostate. Int J Cancer.
2003;107:1–10.
3. Barron DA, Rowley DR. The reactive stroma microenvironment
and prostate cancer progression. Endocr Relat Cancer. 2012;19:
R187–R204.
4. Kalluri R, Zeisberg M. Fibroblasts in cancer. Nat Rev Cancer. 2006;
6:392– 401.
5. Ayala G, Tuxhorn JA, Wheeler TM, et al. Reactive stroma as a
predictor of biochemical-free recurrence in prostate cancer. Clin
Cancer Res. 2003;9:4792– 4801.
6. Tuxhorn JA, Ayala GE, Smith MJ, Smith VC, Dang TD, Rowley DR.
Reactive stroma in human prostate cancer: induction of myofibro-
blast phenotype and extracellular matrix remodeling. Clin Cancer
Res. 2002;8:2912–2923.
7. Josson S, Matsuoka Y, Chung LW, Zhau HE, Wang R. Tumor-
stroma co-evolution in prostate cancer progression and metastasis.
Semin Cell Dev Biol. 2010;21:26 –32.
8. Tripathi M, Billet S, Bhowmick NA. Understanding the role of stro-
mal fibroblasts in cancer progression. Cell Adh Migr. 2012;6:231–
235.
9. Micke P, Ostman A. Tumour-stroma interaction: cancer-associated
fibroblasts as novel targets in anti-cancer therapy? Lung Cancer.
2004;45(suppl 2):S163–S175.
10. Williams G. Aromatase up-regulation, insulin and raised intracel-
lular oestrogens in men, induce adiposity, metabolic syndrome and
prostate disease, via aberrant ER-alpha and GPER signalling. Mol
Cell Endocrinol. 2012;351:269 –278.
11. Madar S, Brosh R, Buganim Y, et al. Modulated expression of
WFDC1 during carcinogenesis and cellular senescence. Carcinogen-
esis. 2009;30:20 –27.
12. Karnoub AE, Dash AB, Vo AP, et al. Mesenchymal stem cells within
tumour stroma promote breast cancer metastasis. Nature. 2007;
449:557–563.
13. Mishra PJ, Humeniuk R, Medina DJ, et al. Carcinoma-associated
fibroblast-like differentiation of human mesenchymal stem cells.
Cancer Res. 2008;68:4331– 4339.
14. Zeisberg EM, Potenta S, Xie L, Zeisberg M, Kalluri R. Discovery of
endothelial to mesenchymal transition as a source for carcinoma-
associated fibroblasts. Cancer Res. 2007;67:10123–10128.
15. Montie JE, Pienta KJ. Review of the role of androgenic hormones in
the epidemiology of benign prostatic hyperplasia and prostate can-
cer. Urology. 1994;43:892– 899.
doi: 10.1210/en.2016-1035
16. Cunha GR, Hayward SW, Wang YZ. Role of stroma in carcino-
genesis of the prostate. Differentiation. 2002;70:473– 485.
17. Ho S-M, Leung Y-K, Chung I. Estrogens and antiestrogens as eti-
ological factors and therapeutics for prostate cancer. Ann NY Acad
Sci. 2006;1089:177–193.
18. Prossnitz ER, Barton M. Signaling, physiological functions and clin-
ical relevance of the G protein-coupled estrogen receptor GPER.
Prostaqlandins Other Lipid Mediat. 2009;89:89 –97.
19. Yu L, Shi J, Cheng S, et al. Estrogen promotes prostate cancer cell
migration via paracrine release of ENO1 from stromal cells. Mol
Endocrinol. 2012;26:1521–1530.
20. Yu L, Wang CY, Shi J, et al. Estrogens promote invasion of prostate
cancer cells in a paracrine manner through up-regulation of matrix
metalloproteinase 2 in prostatic stromal cells. Endocrinology. 2011;
152:773–781.
21. Slavin S, Yeh CR, Da J, et al. Estrogen receptor ␣ in cancer-associ-
ated fibroblasts suppresses prostate cancer invasion via modulation
of thrombospondin 2 and matrix metalloproteinase 3. Carcinogen-
esis. 2014;35:1301–1309.
22. Pupo M, Vivacqua A, Perrotta I, et al. The nuclear localization signal
is required for nuclear GPER translocation and function in breast
cancer-associated fibroblasts (CAFs). Mol Cell Endocrinol. 2013;
376:23–32.
23. De Francesco EM, Pellegrino M, Santolla MF, et al. GPER mediates
activation of HIF1/VEGF signaling by estrogens. Cancer Res. 2014;
74:4053– 4064.
24. Zhang Z, Wang L, Mei M, et al. Both nongenomic and genomic
effects are involved in estradiol’s enhancing the phenotype of
smooth muscle cells in cultured prostate stromal cells. Prostate.
2010;70:317–332.
25. Li F, Yu X, Szynkarski CK, et al. Activation of GPER induces dif-
ferentiation and inhibition of coronary artery smooth muscle cell
proliferation. PloS One. 2013;8:e64771.
26. Cronauer MV, Eder IE, Hittmair A, et al. A reliable system for the
culture of human prostatic cells. In Vitro Cell Dev Biol Anim. 1997;
33:742–744.
27. Corvin S, Boesch S, Maneschg C, Radmayr C, Bartsch G, Klocker
H. Effect of heat exposure on viability and contractility of cultured
prostatic stromal cells. Eur Urol. 2000;37:499 –504.
28. Webber MM, Trakul N, Thraves PS, et al. A human prostatic stro-
mal myofibroblast cell line WPMY-1: a model for stromal-epithelial
interactions in prostatic neoplasia. Carcinogenesis. 1999;20:1185–
1192.
29. Zhou Y, Xiao XQ, Chen LF, et al. Proliferation and phenotypic
changes of stromal cells in response to varying estrogen/androgen
levels in castrated rats. Asian J Androl. 2009;11:451– 459.
30. Brennen WN, Rosen DM, Wang H, Isaacs JT, Denmeade SR. Tar-
geting carcinoma-associated fibroblasts within the tumor stroma
with a fibroblast activation protein-activated prodrug. J Natl Can-
cer Inst. 2012;104:1320 –1334.
31. Kim W, Barron DA, San Martin R, et al. RUNX1 is essential for
mesenchymal stem cell proliferation and myofibroblast differenti-
ation. Proc Natl Acad Sci USA. 2014;111:16389 –16394.
32. Tsai H-W, Katzenellenbogen JA, Katzenellenbogen BS, Shupnik
MA. Protein kinase A activation of estrogen receptor ␣ transcription
does not require proteasome activity and protects the receptor from
ligand-mediated degradation. Endocrinology. 2004;145:2730 –
2738.
33. Broselid S, Berg KA, Chavera TA, et al. G protein-coupled receptor
30 (GPR30) forms a plasma membrane complex with membrane-
associated guanylate kinases (MAGUKs) and protein kinase A-an-
choring protein 5 (AKAP5) that constitutively inhibits cAMP pro-
duction. J Biol Chem. 2014;289:22117–22127.
34. Ding Q, Gros R, Limbird LE, Chorazyczewski J, Feldman RD. Es-
press.endocrine.org/journal/endo 3035
tradiol-mediated ERK phosphorylation and apoptosis in vascular
smooth muscle cells requires GPR 30. Am J Physiol Cell Physiol.
2009;297:C1178 –C1187.
35. Rabkin E, Aikawa M, Stone JR, Fukumoto Y, Libby P, Schoen FJ.
Activated interstitial myofibroblasts express catabolic enzymes and
mediate matrix remodeling in myxomatous heart valves. Circula-
tion. 2001;104:2525–2532.
36. Suzuki J, Takayama K, Mitsui F, et al. In situ interleukin-6 tran-
scription in embryonic nonmuscle myosin heavy chain expressing
immature mesenchyme cells of cardiac myxoma. Cardiovasc Pathol.
2000;9:33–37.
37. Shao R, Shi J, Liu H, et al. Epithelial-to-mesenchymal transition and
estrogen receptor ␣ mediated epithelial dedifferentiation mark the
Downloaded from https://academic.oup.com/endo/article/157/8/3023/2422352 by biomedicas user on 06 February 2024
development of benign prostatic hyperplasia. Prostate. 2014;74:
970 –982.
38. Verfaillie CM. Adult stem cells: assessing the case for pluripotency.
Trends Cell Biol. 2002;12:502–508.
39. Patrawala L, Calhoun T, Schneider-Broussard R, et al. Highly pu-
rified CD44⫹ prostate cancer cells from xenograft human tumors
are enriched in tumorigenic and metastatic progenitor cells. Onco-
gene. 2006;25:1696 –1708.
40. Funakoshi T, Yanai A, Shinoda K, Kawano MM, Mizukami Y. G
protein-coupled receptor 30 is an estrogen receptor in the plasma
membrane. Biochem Biophys Res Commun. 2006;346:904 –910.
41. Thomas P, Pang Y, Filardo EJ, Dong J. Identity of an estrogen mem-
brane receptor coupled to a G protein in human breast cancer cells.
Endocrinology. 2005;146:624 – 632.
42. Revankar CM, Mitchell HD, Field AS, et al. Synthetic estrogen de-
rivatives demonstrate the functionality of intracellular GPR30. ACS
Chem Biol. 2007;2:536 –544.
43. Madeo A, Maggiolini M. Nuclear alternate estrogen receptor
GPR30 mediates 17␤-estradiol-induced gene expression and migra-
tion in breast cancer-associated fibroblasts. Cancer Res. 2010;70:
6036 – 6046.
44. Ariazi EA, Brailoiu E, Yerrum S, et al. The G protein-coupled re-
ceptor GPR30 inhibits proliferation of estrogen receptor-positive
breast cancer cells. Cancer Res. 2010;70:1184 –1194.
45. Gao F, Ma X, Ostmann AB, Das SK. GPR30 activation opposes
estrogen-dependent uterine growth via inhibition of stromal
ERK1/2 and estrogen receptor ␣ (ER␣) phosphorylation signals.
Endocrinology. 2011;152:1434 –1447.
46. Lim A, Shin K, Zhao C, Kawano S, Beachy PA. Spatially restricted
Hedgehog signalling regulates HGF-induced branching of the adult
prostate. Nat Cell Biol. 2014;16:1135–1145.
47. Zhang HZ, Bennett JM, Smith KT, Sunil N, Haslam SZ. Estrogen
mediates mammary epithelial cell proliferation in serum-free culture
indirectly via mammary stroma-derived hepatocyte growth factor.
Endocrinology. 2002;143:3427–3434.
48. Yeh CR, Slavin S, Da J, et al. Estrogen receptor ␣ in cancer associated
fibroblasts suppresses prostate cancer invasion via reducing CCL5,
IL6 and macrophage infiltration in the tumor microenvironment.
Mol Cancer. 2016;15:7.
49. DiNatale BC, Schroeder JC, Perdew GH. Ah receptor antagonism
inhibits constitutive and cytokine inducible IL6 production in head
and neck tumor cell lines. Mol Carcinog. 2011;50:173–183.
50. Chan QKY, Lam HM, Ng CF, et al. Activation of GPR30 inhibits
the growth of prostate cancer cells through sustained activation of
Erk1/2, c-jun/c-fos-dependent upregulation of p21, and induction of
G2 cell-cycle arrest. Cell Death Differ. 2010;17:1511–1523.
51. Lam HM, Ouyang B, Chen J, et al. Targeting GPR30 with G-1: a
new therapeutic target for castration-resistant prostate cancer. En-
docr Relat Cancer. 2014;21:903–914.
52. Niu Y, Altuwaijri S, Lai KP, et al. Androgen receptor is a tumor
suppressor and proliferator in prostate cancer. Proc Natl Acad Sci
USA. 2008;105:12182–12187.