Antonio Robles - Marcos Pérez Brena

1.Read And comment on the green section on page 112. Explain the Meselson and Stahl
evidence.
This section talks about the scientific theory of semi-conservative replication and the
experimental evidence. Semi-conservative replication says that during DNA replication,
each strand of the original DNA molecule serves as a template for the synthesis of a new
complementary strand, creating two daughter DNA molecules, each with a newly
synthesized strand. The passage expresses how Matthew Meselson and Franklin Stahl
used the very rare isotope 15N as a tracer to label the DNA of E. coli bacteria and then
separated the labeled and unlabeled DNA using caesium chloride density gradient
centrifugation. This experiment concluded that the replication of DNA in E. coli was
indeed semi-conservative, making the theory true.
2.Answer the Data-based question on page 113 and 114.
1. The fourth generation of bacteria was transferred to a n14 medium after four generations
making DNA with lower density. N15 would pass the semiconservative description by
generations and it would diminish eventually, even though when combined with N14 it
would appear as if percentage actually rises.
2. 1.724-1.710=0.014 0.014/4=0.0035 0.014
3.Solve the first activity on page 113.
A technique which was used in the 1930s by Urey was when made a glass with “primitive earth
conditions” which created an ancient environment.
4.Explain widely the PCR process and its utility by reading the orange section in pages 115 and
116.
In molecular biology, PCR is a technique used to create many copies of a certain DNA segment.
To create the new DNA strands, they utilize a specialized enzyme known as DNA polymerase.
PCR may be used to determine what genes you have, how much of a gene is utilised by the
body, and even to determine by examining DNA if a person was present at a crime scene. It
functions by heating the DNA to cause it to divide into two strands, then introducing certain
unique components called primers that adhere to the DNA and aid in the formation of new
strands. The enzyme then enters and creates new DNA strands, and this process is repeated
again.
5.Answer the Data-based question in pages 118 and 119.
1. Transcription and translation since it is being pulled like a zipper.
2. DNA RNA and the polypeptides.
a. RNA
b. Antisense strand of DNA
c. DNA
d. DNA
e. polypeptides
6.Read and comment on the purple section on page 120 and answer the question within that
section.
Antonio Robles - Marcos Pérez Brena

1. A. UGG B. UAU and UAC C. CGU, CGC, CGA and CGG

2. A. UCS= Cysteine B. GUGCCC= Valine+Proline C. GCGCGCUCC=
Alanine+Arganine+Serine
3. A. GAGUAGCUUAUUGGG= Glutamine, stop
B. GAGTAGCTTATTGGGK
7.Read and comment on the orange section on page 121 and 122.
The text emphasizes how important genetic engineering is to the process of creating human
insulin, which is used to treat diabetes. The synthesis of human insulin utilizing yeast cells,
safflower plants, and genetically altered E. coli bacteria has changed the management of
diabetes. The text also highlights the astonishing universality of the genetic code, which makes
it possible to transmit genes between other creatures. The human insulin gene can be
successfully transferred despite the species gap, and as long as each tRNA carrying a specific
anticodon has the same amino acid as in humans, the insulin produced has the exact same
amino acid sequence as if the gene were being translated and transcribed in human cells.
8. Answer the crossword
Across: 1 PCR, 2 histidine, 3 Ribose, 4 translation, 5 Codon, 6 five, 7 gene
Down: 1 peptide, 2 twenty, 3, 4 Helicase, 5 Ribosome, 6 six
9. Answer the Worksheet
Antonio Robles - Marcos Pérez Brena

2.7 DNA Replication, Transcription and Translation

DNA Replication

Explain how DNA replication is semi-conservative

Because when a new double-stranded DNA molecule is created, one strand is from the
original template molecule and one strand is newly synthesized, DNA replication is
semi-conservative.

Outline how the results of the Meselson-Stahl experiment supported semi-conservative

DNA replication

Meselson and Stahl treated DNA with a higher nitrogen isotope (15N) and then
replicated it in the presence of a lighter nitrogen isotope (14N) to distinguish template
DNA from newly synthesized DNA. The findings backed up a semi-conservative concept
of DNA replication:

• Following a single division, all molecules had both 15N and 14N.

• Following two divisions, some molecules included both 15N and 14N, whilst others
contained 14N.

Describe the role of the following enzymes in DNA replication

Helicase: Helicase is a protein that unwinds and splits double-stranded DNA molecules.

DNA Polymerase: DNA polymerase creates a new strand that is complementary to the
template strand. Nucleotides align in the opposite direction as their partner, and DNA
Pol III covalently bonds them together.

State when and where DNA replication happens in a typical eukaryotic cell

During the S phase of interphase, DNA replication occurs within the nucleus.

Describe the purpose and process of the polymerase chain reaction (PCR)
 Antonio Robles - Marcos Pérez Brena

PCR is used to rapidly amplify small amounts of DNA. It consists of a heat cycler and three
processes that are repeated: Denaturation is the process of heating DNA to separate the
strands. Annealing - Primers are used to identify copying places. Taq polymerase*
synthesizes a new strand during elongation. Because these three processes double the
amount of DNA, a typical reaction of 30 cycles will yield over 1 billion copies of the
required DNA sequence.

sequence from a DNA template (gene).

Transcription

Define transcription

Transcription is the process of creating an RNA

Distinguish between sense and antisense strands

Outline the role of RNA polymerase in the process of transcription

The antisense strand is the transcribed DNA strand (complementary to the eventual RNA sequence). The
sense strand is the strand that is not transcribed (it is identical to the RNA sequence except for the
substitution of T for U).

Convert the following DNA sequence into an RNA transcript

T A C A A A T T C G T A C T G C A C T C C G G A A C A A C T

AUGUUUAAGCAUGACGUGAGGCCUUGUUGA

Translation

Define translation: Translation is the process of protein synthesis in which genetic information contained by
mRNA is translated at the ribosome into an amino acid sequence

Describe the function of the genetic code (including degeneracy)

Antonio Robles - Marcos Pérez Brena

There are 64 possible codon combinations (4 x 4 x 4), but only 20 possible amino acids. This means that
some codons code for the same amino acid (degeneracy). The genetic code is the set of rules by which
information encoded by mRNA is translated into polypeptides.