Environmental Pollution 255 (2019) 113359

Contents lists available at ScienceDirect

Environmental Pollution
journal homepage: www.elsevier.com/locate/envpol

Mitochondrial respiratory chain dysfunction mediated by ROS is a

primary point of fluoride-induced damage in Hepa1-6 cells*
Hong-wei Wang, Yan Zhang, Pan-pan Tan, Liu-shu Jia, Yu Chen, Bian-hua Zhou*
Henan Key Laboratory of Environmental and Animal Product Safety, Henan University of Science and Technology, Luoyang 471003, Henan, China

a r t i c l e i n f o a b s t r a c t

Article history: To evaluate the mechanism of fluoride (F) mitochondrial toxicity, we cultured Hepa1-6 cells with
Received 21 July 2019 different F concentrations (0, 1 and 2 mmoL/L) and determined cell pathological morphology, mito-
Received in revised form chondrial respiratory chain damage and cell cycle change. Results showed that the activities and mRNA
12 September 2019
expression levels of antioxidant enzymes considerably decreased, whereas the contents of reactive ox-
Accepted 6 October 2019
ygen species (ROS), malondialdehyde (MDA) and nitric oxide (NO) markedly increased. Breakage of
Available online 7 October 2019
mitochondrial cristae and substantial vacuolated mitochondria were observed by transmission electron
microscopy. These results indicate the F-induced oxidative damage in Hepa1-6 cells. The enzyme ac-
Keywords:
Fluoride
tivities of mitochondrial complexes I, II, III and IV were disordered in Hepa1-6 cells treated by excessive F,
Mitochondrion thereby indicating a remarkable down-regulation. Further research showed that complex subunits also
Membrane potential demonstrated the development of disorder, in which the protein expressions levels of NDUFV2 and SDHA
ATP were substantially down-regulated, whereas those of CYC1 and COX Ⅳ were markedly up-regulated.
Apoptosis Reductions in ATP and mitochondrial membrane potential were detected with the dysfunction of the
Hepa1-6 mitochondrial respiratory chain. The G2/M phase arrest of the cell cycle in Hepa1-6 cells was measured
via flow cytometry, and the up-regulated protein expressions of Cyt c, caspase 9, caspase 3 and sub-
stantial apoptotic cells were determined. In summary, this study demonstrated that ROS-mediated
mitochondrial respiratory chain dysfunction causes F-induced Hepa1-6 cell damage.
© 2019 Elsevier Ltd. All rights reserved.

1. Introduction provides approximately 40% proton power of ATP synthesis and

The mitochondrial respiratory chain is an electron transport
system composed of four main enzyme complexes (I, II, III and IV)
located in the inner membrane of mitochondria (Sander and
Garaude, 2018). Electrons are transferred from mitochondrial
complex I (NADH dehydrogenase) and II (succinate dehydrogenase)
to complex III (ubiquinol cytochrome c oxidoreductase) via the
hydrophobic electron carrier ubiquinone and then from complex III
to complex IV (cytochrome c oxidase) via cytochrome c (Cyt c)
(Davies et al., 2018). The electron transfer via the mitochondrial
respiratory chain is coupled with an electrochemical proton
gradient on the mitochondrial intima, which is then utilised by ATP
synthase to generate ATP (Pe
rez-Pe

rez et al., 2016). Complex I
*
This paper has been recommended for acceptance by Dr. Sarah Harmon.
* Corresponding author. Henan Key Laboratory of Environmental and Animal
Product Safety, Henan University of Science and Technology, Kaiyuan Avenue 263,
Luoyang 471003, Henan, China.
E-mail address: zhoubh@haust.edu.cn (B.-h. Zhou).
mediates oxidative phosphorylation (OXPHOS) (Telford et al.,
2009); complex I also is the leading site for reactive oxygen spe-
cies (ROS) production (Ait-Aissa et al., 2019) similar to complex III
(France et al., 2017). The inhibition of mitochondrial complex I can
cause the decrease in ATP synthesis (Kilbride et al., 2008), oxidative
damage and cell death (Urrutia et al., 2017). The inhibition of the
mitochondrial respiratory chain complex activity can lead to severe
mitochondrial dysfunction (Lo
pez de Figueroa et al., 2015), thereby
resulting in membrane potential loss (Wang et al., 2016), OXPHOS
disturbance, decreased ATP production (Sharaf et al., 2017) and
mitochondrial respiration inhibition (Teplova et al., 2017). Mito-
chondrial function and cell ATP content have been considered
important factors affecting cell survival, and their changes may
account for apoptosis (Bergamini et al., 2016; Song et al., 2016).
Mitochondrial respiratory chain damage can induce a sharp
increase in intracellular ROS (Sun et al., 2015). When the ROS level
exceeds the physiological threshold of the body, it will aggravate
mitochondrial damage and depress the antioxidant capacity of
cells, thus leading to a vicious cycle (Stefanatos and Sanz, 2018).
ROS can destroy organelles and suborganelles (Fan et al., 2017) and

https://doi.org/10.1016/j.envpol.2019.113359
0269-7491/© 2019 Elsevier Ltd. All rights reserved.
2 H.-w. Wang et al. / Environmental Pollution 255 (2019) 113359
affect lipid metabolism, nucleic acid transcription and protein
synthesis. Oxidative damages, including increased malondialde-
hyde (MDA) generation (Zhou et al., 2015), decreased mitochon-
drial membrane potential decline (Li et al., 2017a) and DNA damage
(Suzuki et al., 2015), are induced. Studies have shown that
mitochondria-mediated apoptosis arises from oxidative damage
(Wang et al., 2017c), and cell cycle arrest at G0/G1 phase can be
triggered by the increase in intracellular ROS, thereby aggravating
cell death (Vijayalakshmi and Sindhu, 2017).
Fluorine exists widely in nature and is a kind of polar and active
small molecular element, which can cause damage to various hard
tissues and soft tissues of the whole body (Zhou et al., 2015). Latest
researches have shown that fluoride (F) can even cross the blood-
brain barrier to damage the central nervous system (Goschorska
et al., 2018); can pass through the placenta to accumulate in the
fetal brain, resulting in mental retardation in children (Green et al.,
2019), which has caused a strong response. At present, it is gener-
ally believed that mitochondrion is one of the main targets of F
toxicity. F exposure can destroy mitochondrial membrane poten-
tial, interfere with the ATP production and also cause mitochondrial
fission and fusion disorder, bringing about mitochondrial defects
and cell death (Yan et al., 2017; Sun et al., 2016; Zhao et al., 2019b).
Our previous study has also demonstrated that F induces mito-
chondrial dysfunction, causing increase in the positive expression
of ATP5J and ATP5H (Wang et al., 2017b). Mitochondrial respiratory
chain is a necessary pathway for OXPHOS and ATP synthesis.
However, the relationship between F-induced mitochondrial
dysfunction and mitochondrial respiratory chain as well as the
mechanism of F damage to mitochondrial respiratory chain remain
unclear. In this study, therefore, a model of Hepa1-6 cell exposed to
F was established to explore the role of mitochondrial respiratory
chain in F-induced cell impairment.
2. Materials and methods
2.1. Cell culture
Hepa1-6 cells were obtained from Procell Life & Technology Co.,
Ltd., Wuhan, China. Hepa1-6 cells were cultured in Dulbecco’s
Modified Eagle Medium (PM150210, Procell, China) supplemented
with 10% foetal bovine serum (164210-500, Procell, China) and 1%
penicillin-streptomycin solution (P1400, Solarbio, Beijing), grown
at 37
C in a humidifying incubator (Thermo Scientific, USA) con-
taining 5% CO2 and sub-cultured every 48 h.
2.2. Determination of F half maximal inhibitory concentration
(IC50) in Hepa1-6 cells
Hepa1-6 cells were seeded in 96-well plates for 24 h. After F (0,
0.05, 0.1, 0.5, 1, 2.5, 5, 10 and 20 mmoL/L) was administered to the
medium for 48 h, cell counting kit-8 (DJ657, Beyotime, China) was
Table 1
Sequence of primers used in qRT-PCR.
Gene symbol Accession number Primer
GAPDH GU214026.1 Forward
Reverse
Cat NM_009804 Forward
Reverse
SOD1 NM_011434.1 Forward
Reverse
GSH-PX1 NM_008160.6 Forward
Reverse
NOS2 AF065922.2 Forward
Reverse
added for 4 h. The absorbance was read at 450 nm by using a
microplate reader (Multiskan FC, Thermo Scientific, USA), and the F
IC50 of Hepa1-6 cells was calculated using GraphPad Prism 5. The
trials were confirmed by replicating the independent experiment
thrice.
2.3. Transmission electron microscopy (TEM) observation
Based on the calculated concentration of IC50, the F doses of 0, 1
and 2 mmoL/L were used in subsequent experiments. The Hepa1-6
cells were collected and fixed overnight at 4
C in 2.5% glutaral-
dehyde solution. The stationary solution was emptied. The samples
were washed thrice in a phosphate buffer (PB, pH ¼ 7.0) and fixed in
1% osmic acid solution for 1.5 h. The samples were washed thrice in
PB again, dehydrated with gradient ethanol, treated with pure
acetone for 20 min and embedded in Araldite resin. After staining
50 nm sections with uranyl acetate and lead citrate, the ultra-
structure of Hepa1-6 cells was observed using TEM (H-7500).
2.4. Analysis of the biochemical markers of oxidative damage
The Hepa1-6 cells were homogenised in cold phosphate-
buffered saline (PBS) for 60 s using an High-Speed Tissue Homog-
eniser (Servicebio, China) with vibration frequency of 60 Hz and
centrifuged at 3,000g for 5 min. Supernatant was used to detect
the activities of superoxide dismutase (SOD, A001-1-1), glutathione
peroxidase (GSH-Px, A005-1-1) and catalase (Cat, A007-1-1), and
the concentrations of MDA (A003-1-1) and total nitric oxide (T-NO,
A014-1-1). These biochemical markers were determined via spec-
trophotometry, following the standard procedures of commercially
available diagnostic kits (Nanjing Jiancheng, China). For ROS
determination, the Hepa1-6 cells were collected and incubated
with 10 mmoL/L dichloro-dihydro-fluorescein diacetate at 37
C for
20 min, washed thrice with serum-free media and detected via flow
cytometry (BD Accuri C6, Becton Dickinson and Company, USA).
2.5. Real-time PCR
Total cellular RNA was extracted from Hepa1-6 cells by using
TRIzol reagent (15596026, Invitrogen, USA), and RNase-free DNase I
was applied to remove the contaminated DNA. A small amount of
RNA solution was quantified on a nucleic acid analyser (Eppendorf,
Germany). The extracted RNA was transcribed to cDNA by using a
SuperScript™ II Reverse Transcriptase kit (18064014, Invitrogen,
USA) in accordance with the manufacturer’s instructions. The
specific primers of SOD1, GSH-Px1, Cat and nitric oxide synthase-2
(NOS2) were designed using Primer 5.0 software (Table 1). The
mRNA relative expression levels of SOD1, GSH-Px1, Cat and NOS2
were determined from the cDNA preparation by using the Bio-Rad
CFX96 Touch (Bio-Rad, USA) and the Premix Ex Taq™ (Perfect Real
Time) kit (DRR041A, Takara, Japan).
Primer Sequence (50 -30 ) Product size (bp)
ACCCAGAAGACTGTGGATGG 171
CACATTGGGGGTAGGAACAC
ACATGGTCTGGGACTTCTGG 197
CAAGTTTTTGATGCCCTGGT
CCAGTGCAGGACCTCATTTT 197
TTGTTTCTCATGGACCACCA
GAGGGTAGAGGCCGGATAAG 213
AGAAGGCATACACGGTGGAC
CACCTTGGAGTTCACCCAGT 170
ACCACTCGTACTTGGGATGC
 H.-w. Wang et al. / Environmental Pollution 255 (2019) 113359
2.6. Determination of enzyme activities of the mitochondrial
respiratory chain complex
The Hepa1-6 cells in logarithmic growth phase were seeded in a
culture flask and cultured in an incubator containing 5% CO2 at
37
C for 24 h. Culture DMEM containing 0, 1 and 2 mmoL/L of F was
added. After 48 h of F exposure, F medium was removed. Then, the
sample was washed with PBS, and the cells were collected. The cells
were ruptured using a mitochondrial extraction kit, and the total
protein was determined using Coomassie brilliant blue. The protein
content of each group was adjusted, and the enzyme activities of
mitochondrial respiratory chain complexes I, II, III and IV were
measured using a kit for the determination of respiratory chain
complex enzyme activity in mitochondria (135897573, GENMED,
China).
2.7. Western blotting assay
Hepa1-6 cells were collected and homogenised in RIPA lysis
buffer (G2002, Servicebio, China) containing 1% PMSF. The ho-
mogenisation solution was incubated on ice for 30 min and
centrifuged at 12,000g for 5 min at 4
C, and the supernatant was
collected. The protein concentration was determined using the BCA
protein assay (G2026, Servicebio, China). Afterward, 25 mg of pro-
tein per sample was ran in 10% SDS-PAGE, and proteins were
transferred onto PVDF membranes. The PVDF membranes were
blocked with 5% non-fat milk for 60 min. The membranes were
then incubated overnight at 4
C with primary antibodies against
NDUFV2 (15301-1-AP, Proteintech, China), SDHA (14865-1-AP,
Proteintech, China), CYC1 (10242-1-AP, Proteintech, China), COX Ⅳ
(11242-1-AP, Proteintech, China) and ACTIN (GB12001, Servicebio,
China). The membranes were washed thrice with 0.5% TBS-Tween
20 buffer (TBST) for 10 min each, followed by incubation with
secondary antibodies (074-1506, KPL, USA) for 30 min at room
temperature. The protein bands on membranes were detected via
enhanced chemiluminescence (G2014, Servicebio, China).
2.8. Determination of ATP content
The ATP content of Hepa1-6 cells was determined using a
luciferase-based luminescence enhanced ATP assay kit (S0027,
Beyotime, China). In accordance with the manufacturer’s in-
structions, the cells in a 6-well plate were washed twice with ice-
cold PBS and homogenised in an ice-cold ATP lysis buffer. ATP
concentrations were then measured using an ATP standard with
the SpectraMax Paradigm multi-mode microplate reader (Molec-
ular Devices, CA, USA).
2.9. Determination of mitochondrial membrane potential
The change in mitochondrial membrane potential was deter-
mined in accordance with the standard procedures by using a
mitochondrial membrane potential assay kit with JC-1 (C2006,
Beyotime, China). After exposing the Hepa1-6 cells to F, the cell
culture medium was removed. Next, 1 mL cell culture medium and
1 mL JC-1 staining working solution were added. The cells were
incubated for 20 min at 37
C. The suspension was centrifuged at
600g for 3 min, and the supernatant was discarded. After washing
twice with JC-1 staining buffer (1  ), 2 mL cell culture medium was
added, and the Hepa1-6 cells were observed under a fluorescence
microscope (Olympus, Japan).
2.10. Determination of cell cycle
The cells were harvested in a flow tube and cleaned with PBS.
3
After centrifugation, 5 mL of precooled 80% ethanol was added to
the cells, and the vortex-mixed cells were kept in the dark over-
night (>18 h) at 4
C. The cells were centrifuged at 1,200g for
10 min, and the supernatant was discarded. Then, the cells were
washed with PBS and stain buffer to remove ethanol. The cells were
resuspended in 0.5 mL PI/RNase A staining buffer, incubated for
15 min at room temperature and detected using a flow cytometer
(BD Accuri C6, Becton Dickinson and Company, USA).
2.11. Immunofluorescence staining
Hepa1-6 cells were seeded on slides in a 6-well plate with a
concentration of 2  104 cells/mL. The slides were fixed with 4%
paraformaldehyde for 15 min. After washing with PBS thrice, the
slides were added with 0.5% Triton X-100 (T8200, Solarbio, China)
to permeabilise the cells for 20 min at room temperature, and
bovine serum albumin (Servicebio, China) was used for blocking for
30 min. Caspase 3 (GB13009-1, Servicebio, China), caspase 9 (9502,
CST, USA) and Cyt c (PB0291, Boster, China) were added and incu-
bated with the cells overnight at 4
C. After rinsing the unbound
monoclonal antibody, the slides were incubated with a fluorescent
second antibody (GB21301, Servicebio, China) in a dark room for
1 h. DAPI (G1012, Servicebio, China) was added to stain the nuclei,
and the slides were sealed with a mounting medium containing an
anti-fluorescence quenching agent. The images were observed
under a fluorescence microscope (Olympus, Japan).
2.12. TUNEL assay
The degree of damage in Hepa1-6 cells was determined via
TUNEL assay. Frozen slices were fixed with cold acetone for 10 min.
After complete drying, the frozen slices were washed thrice on a
decolorising shaking bed in PBS. The tissues were covered with
protease k solution and incubated at 37
C for 25 min. The slides
were also washed thrice in PBS on a decolorising shaking bed. The
tissues were covered with broken membrane solution and incu-
bated at room temperature for 20 min. After cleaning with PBS,
proper amounts of reagents 1 (TdT) and 2 (dUTP) in the TUNEL kit
(11684817910, Roche, Shanghai) were mixed at 1:9 ratio and added
to the slices, which were then incubated at 37
C for 2 h. Afterward,
3% BSA was added for blocking at 37
C for 30 min. After removing
the sealing solution, a primary antibody was added, and the slices
were incubated overnight in a wet box at 4
C. Next, a second
antibody was added and incubated at 37
C for 50 min. The nuclei
were retained with DAPI solution and incubated at 37
C for 10 min.
The slices were sealed with anti-fluorescence quenching agents.
Finally, the images were observed under a fluorescence microscope
and then collected. Green fluorescent nuclei were verified as pos-
itive for impaired Hepa1-6 cells.
2.13. Statistical analysis
Experimental data were expressed as the mean ± standard de-
viation. Statistical analyses were performed via t-test. Significance
was considered at P < 0.05.
3. Results
3.1. IC50 of F-induced Hepa1-6 cells
As shown in Fig. 1, the survival rate of Hepa1-6 cells decreased
with the increase in F dosage, and the F IC50 of 2.074 mmoL/L was
obtained in Hepa1-6. Thus, F concentrations of 0 (control group), 1
and 2 mmoL/L were selected in this study.
4 H.-w. Wang et al. / Environmental Pollution 255 (2019) 113359
Fig. 1. F IC50 of Hepa1-6 cells. After 48 h of F (0, 0.05, 0.1, 0.5, 1, 2.5, 5, 10 and 20 mmoL/
L) exposure, the survival rate of Hepa1-6 cells decreased with the increase in F doses,
and the IC50 of this was showed to be 2.074 mmoL/L.
3.2. Ultrastructure of the Hepa1-6 cells
Fig. 2 depicts the changes in the ultrastructure of the Hepa1-6
cells. Clear nuclear membrane and mitochondrial cristae and a
normal structure of endoplasmic reticulum (ER) were observed in
the control group (Fig. 2a, a1, a2 and a3). By contrast, vague nuclear
membrane, dilated ER and distinctly increased lysosomes were
observed in F-treated Hepa1-6 cells (Fig. 2b, b1, c and c1), especially
changes in mitochondria with the breakage of mitochondrial
cristae and generation of substantial vacuolated mitochondria.
(Fig. 2b2, b3, c2 and c3).
3.3. Effect of F on the biochemical markers of oxidative damage in
Hepa1-6 cells
In comparison with the control group, the ROS contents of
Hepa1-6 cells were significantly increased in F groups (P < 0.01;
Fig. 3a and b). The activities of SOD, GSH-Px, and total antioxidant
capacity (T-AOC) decreased significantly in the cells exposed to F,
especially at 2 mmoL/L F (P < 0.01; Fig. 3c). The concentrations of
MDA and T-NO significantly increased in the F groups (P < 0.01;
Fig. 3d).
As shown in Fig. 3e, in comparison with the control group, the
mRNA expression levels of SOD1, GSH-Px1 and Cat were signifi-
cantly decreased in the F groups (P < 0.05 or P < 0.01). NOS2
exhibited significantly increased mRNA expression levels with the
increase in F doses (P < 0.05 or P < 0.01). These results indicated
that F induces oxidative stress, thereby leading to the damage in the
ultrastructure of Hepa1-6 cells.
3.4. Effect of F on ATP concentration, mitochondrial complexes, and
relative subunits in Hepa1-6 cells
The ATP concentration of Hepa1-6 cells was significantly
decreased (Fig. 4a). The enzyme activities of mitochondrial com-
plexes I, II, III and IV, as displayed in Fig. 4b, were markedly down-
regulated after exposure to F, especially at 2 mmoL/L F (P < 0.01). In
comparison with those in the control groups, the protein expres-
sion levels of NDUFV2 and SDHA were markedly down-regulated in
the F groups (P < 0.05 or P < 0.01). CYC1 and COX Ⅳ protein
expression levels showed remarkable up-regulation in Hepa1-6
cells with the increase in F concentrations (P < 0.01; Fig. 4c and d).
3.5. F-induced changes in the mitochondrial membrane potential
and cell cycle in Hepa1-6 cells
Fig. 5 displays the changes in mitochondrial membrane poten-
tial. With the increase in F doses, JC-aggregates decreased, and JC-
monomers simultaneously increased compared with the control
group, which illustrated that mitochondrial membrane potential
collapsed.
In comparison with the control group, the number of G2/M
phase Hepa1-6 cells in the F groups distinctly increased (blue peak;
Fig. 6a). The proportion of G2/M phase Hepa1-6 cells significantly
increased given excessive F, particularly at 2 mmoL/L F (P < 0.01),
and the proliferation index (PI) of Hepa1-6 cells was significantly
decreased at 2 mmoL/L F (P < 0.05; Fig. 6b and c).
3.6. F-induced changes in Cyt c, caspase 9 and caspase 3 protein
expression levels in Hepa1-6 cells
Fig. 7a, b and 7c show the higher fluorescence intensities of Cyt
c, caspase 9 and caspase 3, respectively, in the F 1 and 2 mmoL/L
groups than those in the control group. These results indicated the
protein expression levels of Cyt c, caspase 9 and caspase 3 increased
compared with the control group.
3.7. TUNEL assay
Numerous Hepa1-6 cells that lacked apparent signs of apoptosis
were observed in the control group (Fig. 7dd1 and dd2). The pos-
itive expressions became increasingly evident with the increase in F
doses (Fig. 7dd3, dd4, dd5 and dd6). Especially in the F 2 mmoL/L
group, a large area of green fluorescence Hepa1-6 cells was
observed (Fig. 7dd5 and dd6).
4. Discussion
Hepa1-6 cells, which are representatives of a mouse hepatoma
cell line, are frequently used to evaluate the toxicity of substances
toxic to cells. In this study, Hepa1-6 cells were selected to investi-
gate F cytotoxicity. Accumulating evidences have demonstrated
that F can cause oxidative stress in the liver (Lu et al., 2017), kidney
(Adedara et al., 2017), brain (Sarkar et al., 2014; Wang et al., 2018),
thyroid (Banji et al., 2013) and embryo (Zhao et al., 2017). We
observed that F has caused severe damage to the ultrastructure of
Hepa1-6 cells; the cell injuries include vague nuclear membrane,
dilated ER, cracked mitochondrial cristae, vacuolated mitochondria
in large quantities and increased lysosomes. The main cause of
damage in the ultrastructure induced by F may be the significant
increase in ROS in Hepa1-6 cells. Excessive ROS can destroy the
activities of SOD, GSH-Px and Cat (Mohamed, 2019) and engender
lipid peroxidation (LPO). After exposure to F, the antioxidant ca-
pacity decreased, and oxidative stress was triggered by the inability
of cells to convert superoxide (Li et al., 2017b). In the present study,
F remarkably inhibited the protein expression levels and activities
of SOD, GSH-Px and Cat and promoted the generation of MDA and
NO in Hepa1-6 cells. These results confirm that excessive ROS in-
duces the oxidative damage in the ultrastructure of Hepa1-6 cells,
especially in the mitochondria.
Mitochondrial cristae represent a specialised chamber that
harbours respiratory chain and ATP synthase, and the integrity of
the crista membrane is a prerequisite to drive OXPHOS (Ikon and
Ryan, 2017; Rampelt et al., 2017). The breakage and loss of mito-
chondrial cristae in Hepa1-6 cells, inevitably affected the respira-
tory chain function and destroyed the OXPHOS course. Complexes I,
II, III and IV constitute the respiratory chain with ubiquinone and
Cyt c; their inhibition can decrease electron transfer kinetics and
 H.-w. Wang et al. / Environmental Pollution 255 (2019) 113359 5

Fig. 2. Effect of F on the ultrastructure of Hepa1-6 cells. a, a1, a2 and a3: Hepa1-6 cells from the control group. b, b1, b2 and b3: Hepa1-6 cells from the F 1 mmoL/L group. c, c1, c2
and c3: Hepa1-6 cells from the F 2 mmoL/L group. Nu, NM, Mi, ER and Ly represent nucleus, nucleus membrane, mitochondrion, endoplasmic reticulum and lysosome, respectively.

impair cell respiratory function (Sanderson et al., 2013; Luo et al.,
2019). In addition, complexes I, III and IV feature a proton-
pumping function. When their activities decline, the function of
the proton pump is impaired, thereby causing decreased mito-
chondrial membrane potential, power-deficient ADP phosphory-
lation and reduced ATP synthesis (Connolly et al., 2018). Swollen
mitochondria and increased outer membrane permeability touch
off the release of pro-apoptotic factor Cyt c in the mitochondria
(Poo
r et al., 2019; Wang et al., 2017a). Here, the decreased ATP
content and the release of Cyt c were detected; these events are
important indicators of mitochondrial dysfunction. The mito-
chondrial function disorder of Hepa1-6 cells might be attributed to
the damage of respiratory chain complex and LPO impairment of
membrane as the site of the complex. The results showing that F
remarkably inhibited the activities of complexes I, II, III and IV and
protein expression levels of complex subunits NDUFV2 and SDHA
and promoting the generation of MDA also provide considerable
evidence. In addition, an evident sign of mitochondrial respiratory
chain damage is the remarkable increase in ROS (Matsuhashi et al.,
2017; Chauhan et al., 2013). Complexes I and III are the main sites of
electron leakage in the mitochondria, and leaked electron can react
with O2 to form superoxides (Sun et al., 2015). Under abnormal
conditions, other respiratory chain complexes can also cause an
increase in ROS. The dysfunction of complex II mainly caused the
excessive generation of H2O2 in the brain of Rett syndrome mice
(De Filippis et al., 2015). The blockage of complex IV can lead to a
reverse electron transfer in the respiratory chain, that is, ubiqui-
none transfers electrons to complex I, resulting in the leakage of
numerous electrons and a high level of ROS (Scialo  et al., 2017). ROS
bursts further aggravate the oxidative damage of crista membrane
6 H.-w. Wang et al. / Environmental Pollution 255 (2019) 113359

Fig. 3. Analysis of the biochemical markers of oxidative damage and real-time PCR of different gene levels in Hepa1-6 cells. (a) ROS fluorescence intensity in Hepa1-6 cells. (b) The
analysis of ROS generation in Hepa1-6 cells. (c) SOD, GSH-Px and T-AOC activities in Hepa1-6 cells. (d) MDA and T-NO concentrations in Hepa1-6 cells. (e) mRNA relative expression
levels of Cat, SOD1, GSH-Px1 and NOS2 in Hepa1-6 cells. *P < 0.05, **P < 0.01.

Fig. 4. ELISA, Western blotting assay and ATP concentration analysis. (a) The change in ATP concentration in Hepa1-6 cells. (b) The activities of mitochondrial complex I, II, III and IV.
“COX” is the abbreviation of “complex”. (c) Western blotting electrophoretic pattern of complex subunits. (d) Relative protein expression levels of complex subunits.
 H.-w. Wang et al. / Environmental Pollution 255 (2019) 113359 7

Fig. 5. Determination of Mitochondrial membrane potential in Hepa1-6 cells. Red fluorescence and green fluorescence are represent JC-aggregates and JC-monomers, respectively.
After F exposure for 48 h, the red fluorescence intensity of Hepa1-6 cells in F 1 and 2 mmoL/L groups was down-regulated, while green fluorescence intensity was up-regulated
compared with the control group. These changes indicate the decreased membrane potential.

Fig. 6. Cell cycle determination. (a) The changes in number of different phase Hepa1-6 cells. Red, gray and blue peak represent G0/G1, S and G2/M phase, respectively. (b) The
proportion of cell cycle of Hepa1-6 cells. (c) The proliferation index (PI) of Hepa1-6 cells.

and destroy the mitochondrial respiratory chain, thereby causing a
vicious cycle that substantially affects the mitochondrial function
(Lin et al., 2018).
The alteration of mitochondrial function is a strong indicator of
apoptosis (Meng et al., 2018; Song et al., 2019). ROS can trigger the
apoptosis of caspase-9-dependent endogenous mitochondrial
pathway (Zhang et al., 2015; Liu et al., 2016; Gong et al., 2019)
considering the elevated ROS-mediated dysfunction of the respi-
ratory chain. We detected a remarkable decrease in the mito-
chondrial membrane potential of Hepa1-6 cells. This decrease led
to the release of intracellular pro-apoptotic factor Cyt c. Cyt c has
been combined with apoptosis protease-activating factor-1 (Apaf-
1) to induce conformational change and oligomerisation of Apaf-1
(Su et al., 2016), which further recruits and activates pro-caspase 9
8 H.-w. Wang et al. / Environmental Pollution 255 (2019) 113359

Fig. 7. Immunofluorescence assay and TUNEL assay. (a), (b) and (c) respectively showed the fluorescence intensities of Cyt c, caspase 9 and caspase 3 protein expressions levels in
Hepa1-6 cells. (d) Showed the result of TUNEL assay. d1 and d2 are control groups, d3 and d4 represent F 1 mmoL/L groups, d5 and d6 mean F 2 mmoL/L groups. The green
fluorescence part showed the apoptotic cells.

via the caspase 9 recruitment domain at the N-terminal. Activated
caspase 9 continuously cleaves and induces caspase 3 to initiate
caspase cascade reaction, thus touching off cell apoptosis and DNA
degradation (Lee et al., 2016; Zhang et al., 2016). This process was
demonstrated by the increased expression levels of caspase 9,
caspase 3 and Cyt c and the increased apoptosis of Hepa1-6 cells in
the TUNEL assay after F exposure. Moreover, caspase activation and
the increased intracellular ROS, which are accompanied by cell
cycle S-phase arrest, result in cell apoptosis (Tania et al., 2019; Zhao
et al., 2019a). Increased ROS level leads to the cell cycle arrest at the
G2/M phase, thereby causing cell apoptosis, which can eliminate
cancer cells (Hirata et al., 2019). The present study determined that
the content of ROS increased, and the cell cycle of Hepa1-6 cells was
arrested at the G2/M phase, thereby indicating the development of
apoptosis in the Hepa1-6 cells. This conclusion is consistent with
previous findings. The decrease in the ATP content is an important
factor for cell cycle delay and cell death (Du et al., 2017). Accord-
ingly, in this study, the decline in the ATP content caused by
mitochondrial respiratory chain damage may be another method
for inducing apoptosis in Hepa1-6 cells.
5. Conclusions
As illustrated in Fig. 8, this study demonstrated that ROS-
mediated mitochondrial respiratory chain dysfunction and
apoptotic mechanism cause F-induced Hepa1-6 cell damage.
 H.-w. Wang et al. / Environmental Pollution 255 (2019) 113359
Fig. 8. The schema indicates that fluoride induces mitochondrial respiratory chain
damage and thus triggers apoptosis. After F exposure, ROS increased and mitochon-
drial respiratory chain was impaired in Hepa1-6 cells, thus resulting in remarkably
decreased enzyme activities of complex I, II, III and IV. The protein expression levels of
NDUFV2 and SDHA were markedly down-regulated, whereas CYC1 and COX Ⅳ protein
expression levels were remarkably up-regulated. Simultaneously, reductions in ATP
synthesis and mitochondrial membrane potential caused Cyt c release, which further
triggered caspase cascade reaction, thereby touching off cell apoptosis.
Declaration of competing interest
The authors declare that there is no conflict of interest.
Acknowledgements
This work is sponsored by the National Natural Science Foun-
dation of China (grant no. 31201963) and Young Backbone Teachers
Training Project of Colleges and Universities in Henan Province,
China (grant no. 2016GGJS-061).
References
Adedara, I.A., Ojuade, T.J.D., Olabiyi, B.F., et al., 2017. Taurine ameliorates renal
oxidative damage and thyroid dysfunction in rats chronically exposed to fluo-
ride. Biol. Trace Elem. Res. 175 (2), 388e395.
Ait-Aissa, K., Blaszak, S.C., Beutner, G., et al., 2019. Mitochondrial oxidative phos-
phorylation defect in the heart of subjects with coronary artery disease. Sci.
Rep. 9 (1), 7623.
Banji, D., Banji, O.J., Pratusha, N.G., Annamalai, A.R., 2013. Investigation on the role
of spirulina platensis in ameliorating behavioural changes, thyroid dysfunction
and oxidative stress in offspring of pregnant rats exposed to fluoride. Food
Chem. 140 (1‒2), 321e331.
Bergamini, C., Moruzzi, N., Volta, F., et al., 2016. Role of mitochondrial complex I and
protective effect of CoQ 10 supplementation in propofol induced cytotoxicity.
J. Bioenerg. Biomembr. 48 (4), 413e423.
Chauhan, S.S., Mahmood, A., Ojha, S., 2013. Ethanol and age enhances fluoride
toxicity through oxidative stress and mitochondrial dysfunctions in rat intes-
tine. Mol. Cell. Biochem. 384 (1‒2), 251e262.
Connolly, N.M.C., Theurey, P., Adam-Vizi, V., et al., 2018. Guidelines on experimental
methods to assess mitochondrial dysfunction in cellular models of neurode-
generative diseases. Cell Death Differ. 25 (3), 542.
Davies, K.M., Blum, T.B., Kühlbrandt, W., 2018. Conserved in situ arrangement of
complex I and III2 in mitochondrial respiratory chain supercomplexes of
mammals, yeast, and plants. Proc. Natl. Acad. Sci. 115 (12), 3024e3029.
De Filippis, B., Valenti, D., de Bari, L., et al., 2015. Mitochondrial free radical over-
production due to respiratory chain impairment in the brain of a mouse model
of Rett syndrome: protective effect of CNF1. Free Radic. Biol. Med. 83, 167e177.
Du, X., Fu, X.F., Yao, K., et al., 2017. Bcl-2 delays cell cycle through mitochondrial ATP
and ROS. Cell Cycle 16 (7), 707e713.
Fan, W.T., Shen, T.T., Ding, Q.Q., et al., 2017. Zearalenone induces ROS-mediated
mitochondrial damage in porcine IPEC-J2 cells. J. Biochem. Mol. Toxicol. 31
(10), e21944.
France, J., Ashoor, I., Craver, R., 2017. Renal tubular mitochondrial abnormalities in
9
complex II/III respiratory chain deficiency. Fetal Pediatr. Pathol. 36 (3),
263e264.
Gong, Z.G., Wang, X.Y., Wang, J.H., Fan, R.F., Wang, L., 2019. Trehalose prevents
cadmium-induced hepatotoxicity by blocking Nrf2 pathway, restoring auto-
phagy and inhibiting apoptosis. J. Inorg. Biochem. 192, 62e71.
Goschorska, M., Baranowska-Bosiacka, I., Gutowska, I., Metryka, E., Sko
rka-
Majewicz, M., Chlubek, D., 2018. Potential role of fluoride in the etiopatho-
genesis of alzheimer’s disease. Int. J. Mol. Sci. 19 (12), 3965.
Green, R., Lanphear, B., Hornung, R., et al., 2019. Association between maternal
fluoride exposure during pregnancy and IQ scores in offspring in Canada. JAMA
Pediatr.
Hirata, T., Cho, Y.M., Suzuki, I., et al., 2019. 4-Methylthio-3-butenyl isothiocyanate
(MTBITC) induced apoptotic cell death and G2/M cell cycle arrest via ROS
production in human esophageal epithelial cancer cells. J. Toxicol. Sci. 44 (2),
73e81.
Ikon, N., Ryan, R.O., 2017. Cardiolipin and mitochondrial cristae organization. Bio-
chim. Biophys. Acta Biomembr. 1859 (6), 1156e1163.
Kilbride, S.M., Telford, J.E., Tipton, K.F., Davey, G.P., 2008. Partial inhibition of
complex I activity increases Ca2þ-independent glutamate release rates from
depolarized synaptosomes. J. Neurochem. 106 (2), 826e834.
Lee, M.H., Hong, S.H., Park, C., et al., 2016. Hwang-Heuk-San induces apoptosis in
HCT116 human colorectal cancer cells through the ROS-mediated activation of
caspases and the inactivation of the PI3K/Akt signaling pathway. Oncol. Rep. 36
(1), 205e214.
Li, A.X., Sun, M., Li, X., 2017a. Withaferin-A induces apoptosis in osteosarcoma U2OS
cell line via generation of ROS and disruption of mitochondrial membrane
potential. Eur. Rev. Med. Pharmacol. Sci. 21 (6), 1368e1374.
Li, W.S., Jiang, B.H., Cao, X.L., Xie, Y.J., Huang, T., 2017b. Protective effect of lycopene
on fluoride-induced ameloblasts apoptosis and dental fluorosis through
oxidative stress-mediated caspase pathways. Chem. Biol. Interact. 261, 27e34.
Lin, J., Xia, J., Zhao, H.S., et al., 2018. Lycopene triggers Nrf2-AMPK cross talk to
alleviate atrazine-induced nephrotoxicity in mice. J. Agric. Food Chem. 66 (46),
12385e12394.
Liu, G., Wang, Z.K., Wang, Z.Y., Yang, D.B., Liu, Z.P., Wang, L., 2016. Mitochondrial
permeability transition and its regulatory components are implicated in
apoptosis of primary cultures of rat proximal tubular cells exposed to lead.
Arch. Toxicol. 90 (5), 1193e1209.

pez de Figueroa, P., Lotz, M.K., Blanco, F.J., Carame
Lo
s, B., 2015. Autophagy activation
and protection from mitochondrial dysfunction in human chondrocytes.
Arthritis Rheumatol. 67 (4), 966e976.
Lu, Y.J., Luo, Q., Cui, H.M., et al., 2017. Sodium fluoride causes oxidative stress and
apoptosis in the mouse liver. Aging (Albany NY) 9 (6), 1623.
Luo, Y., Li, X.N., Zhao, Y., Du, Z.H., Li, J.L., 2019. DEHP triggers cerebral mitochondrial
dysfunction and oxidative stress in quail (Coturnix japonica) via modulating
mitochondrial dynamics and biogenesis and activating Nrf2-mediated defense
response. Chemosphere 224, 626e633.
Matsuhashi, T., Sato, T., Kanno, S.I., et al., 2017. Mitochonic Acid 5 (MA-5) facilitates
ATP synthase oligomerization and cell survival in various mitochondrial dis-
eases. EBioMedicine 20, 27e38.
Meng, L., Xin, G., Li, B., et al., 2018. Anthocyanins extracted from aronia melanocarpa
protect SH-SY5Y cells against amyloid-beta (1e42)-induced apoptosis by
regulating Ca2þ homeostasis and inhibiting mitochondrial dysfunction. J. Agric.
Food Chem. 66 (49), 12967e12977.
Mohamed, H.R.H., 2019. Estimation of genomic instability and mitochondrial DNA
damage induction by acute oral administration of calcium hydroxide normal-
and nano-particles in mice. Toxicol. Lett. 304, 1e12.

rez-Pe
Pe
rez, R., Lobo-Jarne, T., Milenkovic, D., et al., 2016. COX7A2L is a mito-
chondrial complex III binding protein that stabilizes the III2þIV supercomplex
without affecting respirasome formation. Cell Rep. 16 (9), 2387e2398.
Poo
r, P., Patyi, G., Taka

cs, Z., et al., 2019. Salicylic acid-induced ROS production by
mitochondrial electron transport chain depends on the activity of mitochon-
drial hexokinases in tomato (Solanum lycopersicum L.). J. Plant Res. 132 (2),
273e283.
Rampelt, H., Zerbes, R.M., van der Laan, M., Pfanner, N., 2017. Role of the mito-
chondrial contact site and cristae organizing system in membrane architecture
and dynamics. Biochim. Biophys. Acta Mol. Cell Res. 1864 (4), 737e746.
Sander, L.E., Garaude, J., 2018. The mitochondrial respiratory chain: a metabolic
rheostat of innate immune cell-mediated antibacterial responses. Mitochon-
drion 41, 28e36.
Sanderson, T.H., Reynolds, C.A., Kumar, R., Przyklenk, K., Hüttemann, M., 2013.
Molecular mechanisms of ischemia-reperfusion injury in brain: pivotal role of
the mitochondrial membrane potential in reactive oxygen species generation.
Mol. Neurobiol. 47 (1), 9e23.
Sarkar, C., Pal, S., Das, N., Dinda, B., 2014. Ameliorative effects of oleanolic acid on
fluoride induced metabolic and oxidative dysfunctions in rat brain: experi-
mental and biochemical studies. Food Chem. Toxicol. 66, 224e236.
Scialo, F., Fern
andez-Ayala, D.J., Sanz, A., 2017. Role of mitochondrial reverse elec-
tron transport in ROS signaling: potential roles in health and disease. Front.
Physiol. 8, 428.
Sharaf, M.S., Stevens, D., Kamunde, C., 2017. Mitochondrial transition ROS spike
(mTRS) results from coordinated activities of complex I and nicotinamide
nucleotide transhydrogenase. Biochim. Biophys. Acta Bioenerg. 1858 (12),
955e965.
Song, B., Aoki, S., Liu, C., Ito, K., 2019. A toll-like receptor 9 agonist sensitizes mice to
mitochondrial dysfunction-induced hepatic apoptosis via the Fas/FasL pathway.
10 H.-w. Wang et al. / Environmental Pollution 255 (2019) 113359
Arch. Toxicol. 1e12.
Song, X.B., Liu, G., Wang, Z.Y., Wang, L., 2016. Puerarin protects against cadmium-
induced proximal tubular cell apoptosis by restoring mitochondrial function.
Chem. Biol. Interact. 260, 219e231.
Stefanatos, R., Sanz, A., 2018. The role of mitochondrial ROS in the aging brain. FEBS
Lett. 592 (5), 743e758.
Su, K., Wang, C.F., Zhang, Y., Ca, Y.J., Zhang, Y.Y., Zhao, Q., 2016. The inhibitory effects
of carnosic acid on cervical cancer cells growth by promoting apoptosis via
ROS-regulated signaling pathway. Biomed. Pharmacother. 82, 180e191.
Sun, Q., Zhong, W., Zhang, W.L., Zhou, Z.X., 2015. Defect of mitochondrial respiratory
chain is a mechanism of ROS overproduction in a rat model of alcoholic liver
disease: role of zinc deficiency. Am. J. Physiol. Gastrointest. Liver Physiol. 310
(3), G205eG214.
Sun, Z.L., Zhang, W., Xue, X.C., et al., 2016. Fluoride decreased the sperm ATP of mice
through inhabiting mitochondrial respiration. Chemosphere 144, 1012e1017.
Suzuki, M., Bandoski, C., Bartlett, J.D., 2015. Fluoride induces oxidative damage and
SIRT1/autophagy through ROS-mediated JNK signaling. Free Radic. Biol. Med.
89, 369e378.
Tania, M., Shawon, J., Saif, K., et al., 2019. Cordycepin downregulates Cdk-2 to
interfere with cell cycle and increases apoptosis by generating ROS in cervical
cancer cells: in vitro and in silico study. Curr. Cancer Drug Targets 19 (2),
152e159.
Telford, J.E., Kilbride, S.M., Davey, G.P., 2009. Complex I is rate-limiting for oxygen
consumption in the nerve terminal. J. Biol. Chem. 284 (14), 9109e9114.
Teplova, V.V., Belosludtsev, K.N., Kruglov, A.G., 2017. Mechanism of triclosan
toxicity: mitochondrial dysfunction including complex II inhibition, superoxide
release and uncoupling of oxidative phosphorylation. Toxicol. Lett. 275,
108e117.
Urrutia, P.J., Aguirre, P., Tapia, V., Carrasco, C.M., Mena, N.P., Nún ~ ez, M.T., 2017. Cell
death induced by mitochondrial complex I inhibition is mediated by Iron
Regulatory Protein 1. Biochim. Biophys. Acta (BBA) - Mol. Basis Dis. 1863 (9),
2202e2209.
Vijayalakshmi, A., Sindhu, G., 2017. Umbelliferone arrest cell cycle at G0/G1 phase
and induces apoptosis in human oral carcinoma (KB) cells possibly via oxidative
DNA damage. Biomed. Pharmacother. 92, 661e671.
Wang, C., Liang, C., Ma, J., et al., 2018. Co-exposure to fluoride and sulfur dioxide on
histological alteration and DNA damage in rat brain. J. Biochem. Mol. Toxicol. 32
(2), e22023.
Wang, H., Chen, Y., Zhai, N., et al., 2017a. Ochratoxin A-induced apoptosis of IPEC-J2
cells through ROS-mediated mitochondrial permeability transition pore open-
ing pathway. J. Agric. Food Chem. 65 (48), 10630e10637.
Wang, H.W., Zhao, W.P., Liu, J., Tan, P.P., Tian, W.S., Zhou, B.H., 2017b. ATP5J and
ATP5H proactive expression correlates with cardiomyocyte mitochondrial
dysfunction induced by fluoride. Biol. Trace Elem. Res. 180 (1), 63e69.
Wang, H.W., Zhao, W.P., Liu, J., Tan, P.P., Zhang, C., Zhou, B.H., 2017c. Fluoride-
induced oxidative stress and apoptosis are involved in the reducing of oocytes
development potential in mice. Chemosphere 186, 911e918.
Wang, L., Zhang, X.J., Cui, G.Z., et al., 2016. A novel agent exerts antitumor activity in
breast cancer cells by targeting mitochondrial complex II. Oncotarget 7 (22),
32054.
Yan, X.Y., Wang, L., Yang, X., et al., 2017. Fluoride induces apoptosis in H9c2 car-
diomyocytes via the mitochondrial pathway. Chemosphere 182, 159e165.
Zhang, J.H., Xia, Y.F., Xu, Z.F., Deng, X.M., 2016. Propofol suppressed hypoxia/
reoxygenation-induced apoptosis in HBVSMC by regulation of the expression
of Bcl-2, Bax, Caspase3, Kir6.1, and p-JNK. Oxid. Med. Cell. Longev. 2016.
Zhang, M., Harashima, N., Moritani, T., Huang, W., Harada, M., 2015. The roles of ROS
and caspases in TRAIL-induced apoptosis and necroptosis in human pancreatic
cancer cells. PLoS One 10 (5), e0127386.
Zhao, C.K., Wang, M.S., Cheng, A.C., et al., 2019a. Duck plague virus promotes DEF
cell apoptosis by activating caspases, increasing intracellular ROS levels and
inducing cell cycle S-phase arrest. Viruses 11 (2), 196.
Zhao, J.M., Fu, B.B., Peng, W., Mao, T.C., Wu, H.B., Zhang, Y., 2017. Melatonin protect
the development of preimplantation mouse embryos from sodium fluoride-
induced oxidative injury. Environ. Toxicol. Pharmacol. 54, 133e141.
Zhao, Q., Niu, Q., Chen, J.W., et al., 2019b. Roles of mitochondrial fission inhibition in
developmental fluoride neurotoxicity: mechanisms of action in vitro and as-
sociations with cognition in rats and children. Arch. Toxicol. 93 (3), 709e726.
Zhou, B.H., Zhao, J., Liu, J., Zhang, J.L., Li, J., Wang, H.W., 2015. Fluoride-induced
oxidative stress is involved in the morphological damage and dysfunction of
liver in female mice. Chemosphere 139, 504e511.