As Classifed P1 PART 2

PART 2
1 Gas Exchange 1
2 Immunity 35
3 Infections 67
4 May/June 2018 P1 V 1 101

5 May/June 2018 P1 V 2 121
6 May/June 2018 P1 V 3 137
7 October/November 2018 P1 V1 153

10 May/June 2019 P1 V 1 203

11 May/June 2019 P1 V 2 219
12 May/June 2019 P1 V 3 237

16 May/June 2020 P1 V 1 309

17 May/June 2020 P1 V 2 327
18 May/June 2020 P1 V 3 343
Dr. Dawood
Mobile: 01143067689
Dr.Dawood 1
2 Dr.Dawood
33 Which statement about chronic obstructive pulmonary disease is not correct?
A The disease can often be reversed by treatment.

B The patient coughs a lot, bringing up mucus.
C The patients are normally over 30 years old.
D The patient’s symptoms normally do not change.
34 Which statement about coronary by-pass surgery is correct?
A It is carried out to reduce the effects of atherosclerosis, improving the delivery of oxygen and
dissolved glucose to the cardiac muscle of the heart.
B It is the surgical removal of one or more coronary arteries to reduce the strain on the heart of
a person with coronary heart disease.
C Surgeons are able to divert blood around the diseased sections of the coronary arteries so
that more oxygenated blood can be pumped round the systemic circulation.
D The diseased parts of the aorta are replaced by using a section of a main artery from
elsewhere in the body of the same person, to avoid rejection.
35 How does smoking increase the risk of developing atherosclerosis?
A by damaging artery walls

B by decreasing blood pressure
C by increasing the risk of blood clotting
D by reducing the oxygen supply to cardiac muscle
Dr.Dawood 9700/11/M/J/13 3
33 What can be observed about some of the tissues in a transverse section of a mammalian
trachea?
epithelium goblet cells cartilage
A ciliated present in blocks

B ciliated present in C-shaped rings
C non-ciliated absent in blocks
D non-ciliated absent in C-shaped rings
34 There is a lot of epidemiological evidence linking smoking to disease and early death.
Which is the best description of ‘epidemiological’?
A Disease and deaths are not randomly distributed in small populations.

B Disease and deaths are not randomly distributed in the whole population.
C Disease and deaths are only randomly distributed in large populations.
D Disease and deaths are randomly distributed in the whole population.
35 Which row shows the effects of chronic bronchitis?
lymph glands alveoli bronchi infection
A destroyed damaged inflamed absent

B destroyed inflamed scarred absent
C swollen damaged scarred present
D swollen inflamed inflamed present
4 9700/12/M/J/13 Dr.Dawood
33 The photomicrograph shows a section through part of a bronchus wall.
What is the function of the tissue labelled X?

A contracts to constrict the airway
B helps to widen the airway after an allergic reaction
C produces mucus to trap dust particles and bacteria
D supports the airway to prevent collapse
34 Why is the inner lining of the bronchiole folded?
A to allow for expansion during breathing

B to facilitate gaseous exchange
C to increase the surface area
D to trap foreign particles
35 What are the effects of carbon monoxide and nicotine on the cardiovascular system?
carbon monoxide nicotine
A combines with haemoglobin increases blood pressure

B combines with haemoglobin reduces heart rate
C reduces blood pressure increases heart rate
D reduces heart rate combines with haemoglobin
Dr.Dawood 9700/13/M/J/13 5
31 What correctly describes the effect of carcinogens on lung tissue?
A Cells of the alveoli walls divide more rapidly than normal by reduction division causing a
tumour to develop.
B Cilia are paralysed and mucus accumulates in the lungs, causing DNA to change and a
tumour to develop.
C DNA changes, causing bronchial epithelial cells to divide by mitosis in an uncontrolled way,
causing a tumour to develop.
D Haemoglobin carries less oxygen, causing bronchial cells to divide by mitosis in an
uncontrolled way, causing a tumour to develop.
32 A disease damages alveoli walls.
What effect does this have on the gas exchange surface area and on the volume of the lungs?
surface area volume
A decreased decreased
B decreased increased
C decreased no change
D no change no change
33 Which is a correct description of part of the gas exchange system?
part of gas
ciliated smooth
exchange cartilage goblet cells
epithelium muscle
system
A alveolus key
B bronchus present
C bronchiole absent
D trachea
6 9700/11/O/N/13 Dr.Dawood
31 Goblet cells are found in the trachea.
Which organelles would be found in large numbers in a goblet cell?
1 lysosomes
2 mitochondria
3 rough endoplasmic reticulum
4 secretory vesicles
A 1, 2 and 3 only
B 2, 3 and 4 only
C 1 and 3 only
D 2 and 4 only
32 Which tissues are present in a bronchus?
cartilage ciliated epithelium smooth muscle
A key
B present
C absent
D
33 Which statements are correct effects of tar in tobacco smoke on the human gas exchange
system?
goblet cells are mutations may the activity of

mucus glands
stimulated to occur in epithelial cilia in the
in the trachea
secrete more cells forming airways is
are enlarged
mucus tumours inhibited
A key
B correct
C not correct
D
Dr.Dawood 9700/12/O/N/13 7
33 Which row describes emphysema?
total surface area

lung tissue
of the alveoli
A less elastic decreased

B less elastic increased
C more elastic decreased
D more elastic increased
8 9700/13/O/N/13 Dr.Dawood
32 Which cells or tissues are not correctly paired with their function?
cells / tissues function
A cartilage supports the trachea

B ciliated epithelial cells move mucus over the surface of the trachea
C goblet cells produce enzymes to destroy bacteria
D smooth muscle constriction of some of the bronchioles
33 Which could lead to chronic bronchitis?
A deposition of allergens in airways causing smooth muscles to contract

B excessive secretion and accumulation of mucus and destruction of many cilia in the airways
C infection of airways leading to phagocytes destroying the elastin in the alveoli
D mutation in epithelial cells in airways caused by inhaled chemicals
34 What is the minimum number of cell membranes a molecule of carbon dioxide and a molecule of
oxygen pass through during gas exchange between alveoli and the capillaries?
carbon dioxide oxygen
A 2 4
B 3 5
C 4 5
D 4 4
Dr.Dawood 9700/11/M/J/14 9
30 In the lungs, oxygen and carbon dioxide pass through cell membranes by diffusion.
Which row is correct?
number of cell membranes diffused through by

oxygen from air carbon dioxide to air
A 3 2
B 3 2 or 3
C 5 4
D 5 4 or 5
31 Which describes how substances in cigarette smoke increase the risk of developing
atherosclerosis?
1 Carbon monoxide damages the endothelium of the arteries.

2 Nicotine makes platelets sticky.
3 Nicotine stimulates the release of adrenaline.
A 1, 2 and 3 B 1 and 3 only C 1 only D 2 only
32 Which flow diagram correctly describes the effect of tar entering the lungs?
carcinogens
come into mutation uncontrolled cell
A → →
contact with occurs division
DNA
mucus
goblet cells phagocytes
accumulates
B secrete more → → attracted by
causing
mucus inflammation
infection
mucus phagocytes elastase

C accumulates → attracted by → destroys the
causing infection inflammation alveolar walls
phagocytes causes
mutation
D → attracted by → irritation and
occurs
inflammation coughing
33 Which could directly reduce the surface area available for gas exchange in human lungs?
1 emphysema
2 lung cancer
3 smoking
A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 and 3 only
10 9700/12/M/J/14 Dr.Dawood
33 The diagram shows a section through a type of epithelium.
80 µm
Where is this type of epithelium found in the respiratory system?
trachea bronchus all bronchioles
A key
B = present
C = absent
D
34 The diagram shows a magnified section of part of the lungs containing specialised tissues.
Where are there a high proportion of carbonic anhydrase, HCO3– ions and lysosomes?
contains high proportion of

carbonic
HCO3– ions lysosomes
anhydrase
A 1 3 4
B 2 4 5
C 3 5 6
D 4 6 1
Dr.Dawood 9700/13/M/J/14 11
35 Which row correctly identifies the effects of carbon monoxide, nicotine and tar?
effect
raises blood pressure causes gene mutation reduces oxygenation of blood
A carbon monoxide nicotine tar

B nicotine nicotine carbon monoxide
C nicotine tar carbon monoxide
D tar carbon monoxide nicotine
12 9700/13/M/J/14 Dr.Dawood
29 The photomicrograph shows a cross-section through a bronchus.
What is the function of the tissues X and Y?
X Y
A secrete mucus prevent collapse of the airway

B support the airway dilate airway
C trap dust and dirt secrete mucus
D waft dust and dirt upwards constrict airway
30 Which component(s) of tobacco smoke cause an increase in blood pressure and clot formation?
1 carcinogens
2 nicotine
3 tar
A 1, 2 and 3 B 1 and 3 only C 2 and 3 only D 2 only
31 Peak Flow is used in hospitals to diagnose some lung diseases. It measures the maximum rate at
which air can be breathed out from the lungs.
How will the Peak Flow for a person with emphysema differ from that for a healthy person?
A It falls as carbon monoxide reduces oxygen-carrying capacity of the blood.

B It falls as elastic fibres are damaged in the alveoli.
C It remains constant as the damage to the lungs does not affect the lung volume.
D It rises as larger air spaces make it easier for the air to flow.
Dr.Dawood 9700/11/O/N/14 13
32 Which are effects on the body of carbon monoxide in tobacco smoke?
1 It reduces the amount of haemoglobin available to transport oxygen.

2 It reduces the rate of diffusion of oxygen from the alveoli into the blood.
3 It inhibits the release of oxygen from haemoglobin.
33 The graph shows the volume of air breathed out quickly and with force, following a deep breath
in, for three different people, X, Y and Z.
5 X
4 Y
3
3
volume / dm
2
Z
1
0
0 1 2 3 4 5
time / s
What is a possible explanation for the differences in the volume of air breathed out by these
people shown?
chronic bronchitis emphysema normal lung function
A X Z Y
B Y X Z
C Y Z X
D Z Y X
carcinogens
uncontrolled mass of cells
A come into contact → mutation occurs → →
cell division produced
with DNA
mucus
accumulates causes irritation
B secrete more → → attracted by →
causing and coughing
mucus inflammation
infection

mass of cells
C secrete more → mutation occurs → attracted by →
produced
mucus inflammation
phagocytes
uncontrolled elastase destroys
D attracted by → mutation occurs → →
cell division the alveolar walls
inflammation
14 9700/12/O/N/14 Dr.Dawood
30 Which row correctly shows the areas of the gas exchange system that contain cartilage, ciliated
epithelium, goblet cells and smooth muscle?
cartilage ciliated epithelium goblet cells smooth muscle
A bronchiole, trachea bronchiole, trachea bronchus, trachea bronchiole, trachea
B bronchus, trachea bronchiole, bronchus bronchus, trachea bronchiole, trachea
C bronchiole, trachea bronchus, trachea bronchiole, bronchus bronchiole,

bronchus, trachea
D bronchus, trachea bronchiole, bronchus, trachea bronchiole,

bronchus, trachea bronchus, trachea
31 Which observation would indicate a difference between the structure of the gas exchange system
of a cigarette smoker and a non-smoker?
A absence of ciliated epithelium

B decrease in elastic fibres
C enlargement of goblet cells
D increase in smooth muscle
32 Asthma is a lung disease triggered by the inhalation of an allergen such as pollen or dust. The
allergen triggers;
● bronchi and bronchioles to become inflamed and narrow

● goblet cells lining these airways to secrete excess mucus.
Which effects will these responses have on the gaseous exchange system of a person with
asthma?
1 decrease the diffusion gradient for oxygen in the lungs

2 increase the diffusion distance from the alveoli into the blood
3 increase the risk of developing a lung infection
A 1 and 2 B 1 and 3 C 2 and 3 D 3 only
Dr.Dawood 9700/13/O/N/14 15
31 Which row shows a function of each of the named tissues in the gas exchange system?
cartilage ciliated epithelium smooth muscle elastic fibres
A keep the move mucus out change the allows alveoli to

airways open of the airways diameter of the expand during
bronchioles breathing in
B prevent choking secrete mucus contracts to helps to support
increase air flow the trachea
C prevent the keep a layer of trap bacteria and cause elastic recoil
trachea collapsing mucus lining the dirt in air when breathing out
when coughing air ways
D support the small trap bacteria and control the flow of allows stretching
bronchioles dirt in air air to and from the of trachea for
alveoli movement
32 The graph shows the results of a study to determine whether there is a link between the number
of cigarettes smoked by a mother and the birth weight of her baby.
birth weight
of babies / kg
0 10 20 30 40 50
number of cigarettes smoked
by mother each day
Which conclusions can be drawn from this graph?
1 As the number of cigarettes smoked increases, the weight of the baby always
decreases.
2 Factors, other than smoking, affect the birth weight of a baby.
3 Nicotine, tar and carbon monoxide slow the growth of an unborn baby.
4 The majority of all smokers smoke between 10 and 35 cigarettes per day.
A 1, 2 and 3 B 2, 3 and 4 C 2 only D 3 only
33 What is a feature of coronary bypass surgery?

A A section of a healthy vein or artery is attached to the aorta at one end and a coronary artery
at the other end to bypass diseased sections of coronary artery.
B A section of healthy vein or artery is used to bypass the diseased section of aorta in the
region where the branches to the coronary arteries occur.
C Blockages in coronary arteries with atherosclerosis are cleared surgically by temporarily
using an artificial heart to re-route blood and bypass the heart.
D The section of diseased coronary artery is removed and then replaced by using a section of
a healthy vein or artery of a similar diameter.
16 9700/11/M/J/15 Dr.Dawood
31 What correctly describes the role of elastic fibres in the lungs?
A They allow the walls of stretched alveoli to recoil as air is breathed out.
B They increase in the walls of alveoli as a result of the release of the enzyme elastase.
C They increase in the walls of the alveoli as emphysema develops.
D They prevent the walls of the alveoli from collapsing as air is breathed in.
32 The diagram represents a section through the wall of a bronchus (not to scale).
In a person with chronic obstructive pulmonary disease (COPD), what happens in each of the
numbered structures?
1 2 3 4
A contracts contracts inhibited not affected

B contracts not affected overactive inhibited
C relaxes contracts inhibited paralysed
D relaxes not affected overactive overactive
33 The symptoms of two diseases are listed.
disease 1 disease 2
persistent cough shortness of breath

pain when breathing wheezing
loss of weight fatigue
Which row identifies diseases 1 and 2?
disease 1 disease 2
A chronic bronchitis emphysema

B emphysema lung cancer
C lung cancer chronic bronchitis
D lung cancer emphysema
Dr.Dawood 9700/12/M/J/15 17
31 Which row identifies the effects on the body of nicotine in tobacco smoke?
reduces the increases the

combines with
diameter of small secretion of
haemoglobin
arteries (arterioles) adrenaline
A key
B = true
C = false
D
32 Lung cancer and chronic obstructive pulmonary disease (COPD) share a number of common
symptoms.
Which symptom is typical of lung cancer and not COPD?
A coughing up blood
B mucus production increases
C persistent cough that does not go away
D wheezing (difficulty breathing)
33 A person breathes in small particles from a very dusty environment.
What effect will this have on B-lymphocytes and goblet cells?
B-lymphocytes goblet cells
A less active more active

B less active no change
C more active more active
D no change less active
18 9700/13/M/J/15 Dr.Dawood
32 What would be seen in a photomicrograph of the wall of the trachea?
tissue
elastic fibres epidermis smooth muscle
A key
B = present
C = absent
D
33 Which process leads to atherosclerosis?
A a blood clot forming in a coronary artery

B contraction of muscles in arteries caused by nicotine
C formation of plaques in an artery wall
D loss of elasticity in an artery wall causing it to burst
34 Some symptoms of chronic obstructive pulmonary disease (COPD) are listed.
1 bursting of alveoli
2 increase in secretion of mucus
3 loss of elastic fibres
4 narrowing of airways
5 reduction in surface area for gaseous exchange
Which of these are also the symptoms of emphysema?
A 1, 2 and 4 B 1, 3 and 5 C 2, 3 and 4 D 2, 4 and 5
Dr.Dawood 9700/11/O/N/15 19
31 Which row about the human gas exchange system is correct?
trachea bronchus alveolus
A cartilage present present absent

B ciliated epithelium absent present absent
C goblet cells present absent absent
D smooth muscle present present present
32 Which of the effects are caused by breathing in both carbon monoxide and nicotine from
cigarette smoke?
1 increased heart rate

2 increased risk of cardiovascular disease
3 increased risk of emphysema
4 increased risk of lung cancer
A 1, 2 and 3 B 2, 3 and 4 C 1 and 2 only D 3 and 4 only
33 Which statements about chronic obstructive pulmonary disease (COPD) are correct?
1 The disease can often be reversed by treatment.

2 The patient’s symptoms normally do not change.
3 The patient is normally over 30 years old.
4 The patient coughs a lot, bringing up mucus.
20 9700/12/O/N/15 Dr.Dawood
32 What is a correct location of cartilage and smooth muscle in the human gas exchange system?
cartilage smooth muscle
A bronchioles bronchioles
B bronchioles trachea
C trachea alveoli
D trachea bronchi
33 Which factors maintain the diffusion gradient for carbon dioxide at the surface of the alveoli?
1 blood flow past the alveoli

2 breathing movement exchanging air in the lungs
3 thin epithelial lining of the alveoli
34 The surface tension of the layer of liquid lining the alveoli tends to pull the walls inwards so alveoli
could collapse.
Which statements could explain how this is prevented?
1 alveolar fluid is moved around by cilia

2 elastic fibres keep the alveoli open
3 epithelial cells secrete a chemical that reduces the cohesion in water
Dr.Dawood 9700/13/O/N/15 21
33 What would be seen in an electron micrograph of a bronchus wall?
1 cartilage cells
2 ciliated cells
3 exocytotic vesicles
34 Which parts of the human gas exchange system may typically contain macrophages?
trachea bronchus bronchiole alveolus
A
B = may contain macrophages
C = may not contain macrophages
D
35 An oxygen molecule diffuses from the air in an alveolus through cells to haemoglobin in a red
blood cell.
What is the minimum number of cell surface membranes through which this molecule must pass?
A 2 B 3 C 4 D 5
36 Which short-term effects of smoking are caused by carbon monoxide?
1 formation of carboxyhaemoglobin
2 increased risk of blood clotting
3 narrowing the lumen of arteries
22 9700/11/M/J/16 Dr.Dawood
32 A student was asked to describe the differences between four microscope slides of sections
taken from different parts of the gas exchange system.
slide 1 not present: cartilage, glands

present: few goblet cells, ciliated epithelial cells, smooth muscle
slide 2 present: incomplete cartilage rings, glands, goblet cells, ciliated epithelial cells, smooth
muscle
slide 3 not present: cartilage, glands, goblet cells, smooth muscle
present: squamous epithelial cells
slide 4 present: plates of cartilage, glands, goblet cells, ciliated epithelial cells, smooth muscle
Which is the correct identification of the parts of the gas exchange system?
slide 1 slide 2 slide 3 slide 4
A alveolus bronchiole bronchus trachea

B bronchiole bronchus alveolus trachea
C bronchiole trachea alveolus bronchus
D bronchus trachea bronchiole alveolus
33 Which components of the human gas exchange system help to reduce the effects of carcinogens
in tar?
A cilia and goblet cells only

B cilia and mucous glands only
C mucous glands and goblet cells only
D mucous glands, goblet cells and cilia
Dr.Dawood 9700/12/M/J/16 23
33 Goblet cells are found in the trachea.
Which organelles would be found in large numbers in a goblet cell?
Golgi
mitochondria ribosomes
body
A key
B = present in large numbers
C = not present in large numbers
D
34 What is the minimum number of layers of phospholipids that a molecule of oxygen passes
through when diffusing from the alveoli, through cells, to haemoglobin in the red blood cells?
A 4 B 6 C 8 D 10
35 Which symptoms may be seen in a person affected by chronic obstructive pulmonary disease
(COPD)?
1 persistent cough
2 less elastic alveoli
3 increased risk of lung infection
4 shortness of breath
A 1, 2, 3 and 4
B 1, 2 and 3 only
C 2, 3 and 4 only
D 1 and 4 only
24 9700/13/M/J/16 Dr.Dawood
33 A student viewed three slides at both low magnification and high magnification. Each slide was a
section through a different airway of the gas exchange system.
The student observed three features in each slide.
slide three features observed by student
irregular arrangement of cartilage

1 highly folded inner layer
cilia on epithelial cells
very few goblet cells
2 cilia on epithelial cells
thick layer of smooth muscle relative to wall thickness
smooth muscle tissue
3 blood vessels
many goblet cells
Which row is the correct set of identifications for the three slides?
slide 1 slide 2 slide 3
A bronchus bronchiole trachea

B bronchus trachea bronchiole
C trachea bronchiole bronchus
D trachea bronchus bronchiole
34 Which organelle is present in large quantities in ciliated epithelial cells?
A Golgi body
B lysosomes
C mitochondria
D rough endoplasmic reticulum
35 In some cases where a person has lung disease, the partial pressure of oxygen in the pulmonary
veins is less than the partial pressure of oxygen in the alveoli.
What could explain the difference in partial pressure of oxygen?
1 A high proportion of alveoli are collapsed and do not have enough alveolar
capillaries.
2 The partial pressure of oxygen in the pulmonary arteries is lower than in the alveolar
air.
3 The rate of diffusion of oxygen from the alveolar air to the surrounding alveolar
capillaries is too slow.
Dr.Dawood 9700/11/O/N/16 25
34 A student made some labelled drawings of lung tissue using the high-power lens of a light
microscope, but did not label two airways, P and Q.
The drawing of the lining layer of P showed both ciliated cells and goblet cells, whilst the drawing
of the lining layer of Q showed ciliated cells but very few goblet cells.
What are airways P and Q?
airway
P Q
A bronchiole trachea
B bronchiole bronchus
C bronchus bronchiole
D trachea bronchus
35 What maintains the steep concentration gradients needed for successful gas exchange in the
lungs?
1 Air flow in the alveoli is in the opposite direction to blood flow in the capillaries.
2 Blood arrives in the lungs with a lower oxygen concentration and a higher carbon
dioxide concentration than the air in the alveoli.
3 Blood is constantly flowing through and out of the lungs, bringing a fresh supply of
red blood cells.
36 The photomicrograph shows part of the lung as seen using a light microscope.
2
3
Which row is correct for the features labelled 1, 2 and 3?
1 2 3
A alveolus bronchiole capillary

B alveolus capillary bronchiole
C bronchiole alveolus small artery
D small artery alveolus bronchiole
26 9700/12/O/N/16 Dr.Dawood
32 The image shown is a photomicrograph of a transverse section of part of the gas exchange
system.
What describes the image?
A a thin inner layer of ciliated epithelial cells on top of a layer containing cartilage and
supported by elastic fibres
B a very thin epithelial lining with walls containing elastic fibres, surrounded by many blood
vessels
C an inner layer of ciliated epithelial and goblet cells on top of elastic fibres and supported by
an outer layer consisting of blocks of cartilage
D an inner layer of ciliated epithelial and goblet cells on top of loose tissue with mucous glands
supported by an outer layer of cartilage
33 The table lists some of the effects of smoking.
Which row shows the effect of nicotine and carbon monoxide?
nicotine carbon monoxide
A decreases heart rate decreases blood pressure

B increases blood flow to the feet increases blood pressure
C increases blood pressure combines with haemoglobin
D increases blood pressure increases heart rate
34 Which statement about chronic obstructive pulmonary disease (COPD) is correct?
A The disease can often be reversed by treatment.

B The disease occurs in people of all ages.
C The patient coughs a lot, bringing up mucus.
D The patient’s symptoms change over time.
Dr.Dawood 9700/13/O/N/16 27
37 Which characteristic of the human gaseous exchange surface and the lungs, maintains the
necessary concentration gradients for carbon dioxide and oxygen?
A good ventilation of the lungs

B large surface area of the alveoli
C low resistance to air flow
D the walls of the alveoli are thin
38 Which identifies the tissues present in the trachea?
cartilage A cilia
B
D C
goblet cells
28 9700/11/M/J/17 Dr.Dawood
31 The photomicrograph shows a section through lung tissue.
Which structures are present in this photomicrograph?
artery vein bronchioles bronchus trachea
A key
B = present
C = absent
D
32 An athlete who smokes just before a race may not be able to run at their maximum speed
because less oxygen is carried by the blood.
Which explanation is correct?
A Carbon dioxide binds to haemoglobin forming carbaminohaemoglobin.

B Carbon dioxide binds to haemoglobin forming carboxyhaemoglobin.
C Carbon monoxide binds to haemoglobin forming carbaminohaemoglobin.
D Carbon monoxide binds to haemoglobin forming carboxyhaemoglobin.
Dr.Dawood 9700/12/M/J/17 29
33 Some of the requirements of an efficient gas exchange system are a large surface area and a
short diffusion distance.
What is correct about how alveoli are adapted to meet these requirements?
large surface area short diffusion distance
A collagen and elastin fibres that an extracellular layer round

allow the alveoli to stretch the alveolus wall contains
blood capillaries
B gases dissolve in a layer of walls of alveoli are
liquid to speed up diffusion squamous epithelium
C many folded capillaries are next to
interconnected alveoli alveolus wall
D sac shape of alveoli formed red blood cells are very
by squamous cells close to capillary walls
34 The diagram shows three types of cell found in the human gas exchange system.
X Y Z
Apart from causing cancer, which cell types will be directly affected when a person is exposed to
tar in cigarette smoke?
A X, Y and Z B X and Y only C X and Z only D Y and Z only
30 9700/12/M/J/17 Dr.Dawood
31 Which description of part of the gas exchange system is correct?
part of gas
ciliated smooth
exchange cartilage goblet cells
epithelium muscle
system
A alveolus key
B bronchus = present
C bronchiole = absent
D trachea
32 When a person suffers an asthma attack, the tubes of the gas exchange system narrow and extra
mucus is produced.
Which changes occur during an asthma attack?
1 Activity of ciliated epithelium increases.

2 Endocytosis in goblet cells increases.
3 Smooth muscles are more active.
33 Which factors result from paralysis of cilia caused by smoking?
1 accumulation of mucus
2 increased chance of lung infection
3 emphysema
4 scarring of airway lining
A 1 and 2 B 1 and 4 C 2 and 3 D 3 and 4
34 What is the minimum number of cell membranes a molecule of carbon dioxide and a molecule of
oxygen pass through during gas exchange between alveoli and the plasma in the capillaries?
carbon dioxide oxygen
A 2 4
B 3 5
C 4 4
D 4 5
Dr.Dawood 9700/13/M/J/17 31
31 How many phospholipid bilayers does oxygen pass through in diffusing from an alveolar air
space to form oxyhaemoglobin in a red blood cell in a mammalian lung?
A 3 B 5 C 6 D 9
32 Which statements about the human gas exchange system are correct?
1 The absence of cartilage in small bronchioles allows them to expand.

2 The walls of the alveoli are made of cuboidal epithelium.
3 Alveoli secrete surfactant which reduces surface tension in the lungs.
4 The trachea and bronchi are supported by circles of cartilage.
33 A disease damages alveoli walls, causing the alveoli to burst.
What effect does this have on the gas exchange system?
surface area for maximum volume

gas exchange of air breathed out
A decreases decreases
B decreases increases
C decreases no change
D no change no change
34 What are short-term effects of nicotine on the cardiovascular system?
1 constriction of small arteries
2 increase in heart rate
3 increase in blood pressure
32 9700/11/O/N/17 Dr.Dawood
34 A good gas exchange system maintains a steep diffusion gradient, has a large total surface area
and a short diffusion distance.
Which feature of the human gas exchange system helps to maintain a steep diffusion gradient?
A A large number of alveoli are present in each lung.

B Alveoli walls contain elastic fibres allowing expansion.
C The air brought into the alveoli by ventilation is high in oxygen.
D The endothelium of the capillary wall is made of flattened cells.
35 Which statement about bronchioles is correct?
A They have cartilage and ciliated cells.

B They have cartilage and elastic tissue.
C They have cartilage and muscle tissue.
D They have elastic tissue and ciliated cells.
36 In which regions of the human gas exchange system is the function of some types of cell directly
affected by tar in cigarette smoke?
A bronchioles and alveoli only

B trachea, bronchus, bronchioles, alveoli
C trachea and bronchus only
D trachea, bronchus and bronchioles only
Dr.Dawood 9700/12/O/N/17 33
35 The photomicrograph shows a cross-section through a bronchus.
What is the function of the tissues X and Y?
X Y
A secrete mucus prevent collapse of the airway

B support the airway dilate airway
C trap dust and dirt secrete mucus
D waft dust and dirt upwards constrict airway
carcinogens
come into uncontrolled mass of cells
A → mutation occurs → →
contact with cell division produced
DNA
mucus
goblet cells phagocytes causes
accumulates
B secrete more → → attracted by → irritation and
causing
mucus inflammation coughing
infection

mass of cells
C secrete more → mutation occurs → attracted by →
produced
mucus inflammation
phagocytes elastase
uncontrolled
D attracted by → mutation occurs → → destroys the
cell division
inflammation alveolar walls
34 9700/13/O/N/17 Dr.Dawood
Dr.Dawood 35
36 Dr.Dawood
37 A graft of tissue, such as skin, from a different person is usually rejected by the body.
Which statement about graft rejection is correct?
A The graft is rejected by B-lymphocytes because they make and release antibodies which
react with the surface antigens on the graft cells.
B The graft is rejected by B-lymphocytes because T-lymphocytes are not stimulated to produce
antibodies.
C The graft is rejected by T-lymphocytes because the graft tissue causes T-lymphocytes to
release antibodies.
D The graft is rejected by T-lymphocytes because they circulate in the blood and can gather at
the graft site.
Dr.Dawood 9700/12/M/J/13 37
37 Which statement about both B-lymphocytes and T-lymphocytes is correct?
A They become active only when a specific antibody binds to their surface receptor.
B They divide to form clones when meeting an antitoxin in a cell.
C They produce memory cells to respond to an antigen when exposed in the future.
D They release hormone-like cytokines which stimulate release of antibodies.
38 9700/13/M/J/13 Dr.Dawood
36 The photomicrograph shows human blood, with three types of white cell labelled.
T R
Which row correctly identifies these white cells?
cell R cell S cell T
A lymphocyte lymphocyte lymphocyte

B lymphocyte phagocyte phagocyte
C phagocyte lymphocyte phagocyte
D phagocyte phagocyte lymphocyte
37 What are the function(s) of T-lymphocytes during an immune response?
1 destroy infected body cells

2 differentiate into memory cells
3 secrete antibodies
A 1 only B 3 only C 1 and 2 only D 2 and 3 only
38 A student wrote down three statements about antibodies.
1 Their structure depends on peptide, hydrogen and disulfide bonds.

2 They are protein molecules with both tertiary and quaternary structure.
3 Four polypeptides provide four antigen binding sites.
Which statements are true?
A 1, 2 and 3
B 1 and 2 only
C 1 and 3 only
D 2 and 3 only
Dr.Dawood 9700/11/O/N/13 39
35 New-born babies have natural passive immunity.
What is the correct explanation for this?
immunity is antibodies are

not inherited broken down
A key
B = correct
C = not correct
D
36 Which is a correct description of different types of immunity?
natural active natural passive artificial active artificial passive
A antibodies cross injection of injection of no memory

the placenta antigens antibodies cells form
B memory antibodies cross injection of injection of
cells form the placenta antigens antibodies
C injection of memory antibodies cross injection of
antibodies cells form the placenta antigens
D injection of injection of no memory antibodies cross
antigens antibodies cells form the placenta
40 9700/12/O/N/13 Dr.Dawood
36 What are the function(s) of plasma cells during an immune response?
1 destroy cancer cells

A 2 only
B 3 only
C 2 and 3 only
D 1, 2 and 3
38 Which description is correct for B-lymphocytes?
release
act in the cell can act as
processed in antibodies
mediated antigen
the thymus immediately
response presenting cells
after formation
A key
B = correct
C = incorrect
D
Dr.Dawood 9700/13/O/N/13 41
37 The following events occur when a phagocyte responds to the presence of a pathogen.
1 endocytosis
2 enzymic digestion
3 exocytosis
4 phagocytosis
5 vacuole formation
Which is the correct sequence of events?
first last
A 1 5 2 3
B 3 2 5 1
C 4 2 5 3
D 4 5 2 1
38 Which type of immunity occurs as a result of the ingestion of antibodies by an infant through its
mother’s milk?
artificial natural
active A B
passive C D
42 9700/11/M/J/14 Dr.Dawood
35 During a primary immune response, the following events occur.
1 Some B-lymphocytes form plasma cells.

2 B-lymphocytes with the specific cell surface receptors divide repeatedly by mitosis.
3 Specific antibody is produced.
4 T-helper cells secrete cytokines.
5 T-helper cells identify a specific antigen.
In which order will the events occur?
A 2→1→4→3→5
B 2→4→3→1→5
C 5→4→2→1→3
D 5→4→3→1→2
36 Which statement concerning the defence in the body against infectious disease is not correct?
A Antibodies against specific antigens are produced by plasma cells in passive immunity, but
the protection is short-lived as no memory cells are produced.
B A specific immune response involves activation of B-lymphocytes and T-lymphocytes
following recognition of, and binding to, a specific antigen.
C Following invasion by microorganisms, natural active immunity can be gained by initiating an
immune response.
D Lysosomes fuse with vacuoles that have been formed by phagocytes and which contain
invading microorganisms.
37 An antiserum to a snake toxin can be obtained by injecting the toxin into a horse. The antiserum
is made from blood plasma taken from the horse a few weeks later. The antiserum is injected into
a person who has been bitten by the same species of snake.
Which type of immunity occurs as a result of using this antiserum?
A artificial active
B artificial passive
C natural active
D natural passive
Dr.Dawood 9700/12/M/J/14 43
31 Which is not a correct statement about phagocytes?
A They are white blood cells with a lobed nucleus.

B They have many lysosomes containing hydrolytic enzymes.
C They have many mitochondria to produce ATP for endocytosis.
D They provide specific defence against disease-causing organisms.
37 What are antigens?
A non-self macromolecules found only on bacteria that trigger the formation of antibodies
B non-self macromolecules that trigger an immune response
C proteins that consist of two light and two heavy polypeptide chains
D self macromolecules embedded in B-lymphocyte cell membranes
44 9700/13/M/J/14 Dr.Dawood
35 Which are specific immune responses?
1 phagocytosis
2 production of antibodies
3 effect of histamine
A 1 only B 2 only C 1 and 3 only D 2 and 3 only
37 A person’s blood group is determined by antigens present on the red blood cells. Most people
have antibodies in their blood plasma even if they have never received a blood transfusion. It is
these antibodies in the plasma of the person who receives the blood which makes some blood
transfusions unsafe.
The table shows the antigens and antibodies in the blood of people with different blood groups.
blood group antigens on red blood cells antibodies in plasma
A A antibodies to B
B B antibodies to A
AB A and B no antibodies to A and B
O neither A nor B antibodies to A and B
Which are the blood groups of people who can safely receive blood from a person who has blood
group A?
A A and AB
B A and O
C B and O
D AB only
Dr.Dawood 9700/11/O/N/14 45
38 Which method of gaining immunity can be described as natural active immunity?
A feeding on colostrum
B inhaling the chicken pox virus
C injection with antibodies
D through the placenta
46 9700/12/O/N/14 Dr.Dawood
36 Cells which divide and give rise to macrophages are called stem cells.
Where in the body do these stem cells divide?
A blood plasma
B bone marrow
C lymph nodes
D tissue fluid
37 Which type of immunity occurs following infection by a pathogen?
natural artificial
active A B
passive C D
Dr.Dawood 9700/13/O/N/14 47
36 During an outbreak of a very infectious disease, vulnerable people need immediate protection.
Which type of immunity would be given to these people?
natural artificial
active A B
passive C D
37 Which cells become memory cells in the immune response?
1 B-lymphocytes
2 T-lymphocytes
3 phagocytes
48 9700/11/M/J/15 Dr.Dawood
36 Which action is taken by a B-lymphocyte activated by an antigen?
A It attaches to the infected cell displaying the antigen and destroys it.
B It divides repeatedly to form a clone of genetically identical plasma cells.
C It engulfs the infected body cell which displays the antigen.
D It secretes cytokines which stimulate T-lymphocytes to produce plasma cells.
37 The synthesis of specific antibodies in response to vaccination is an example of which type of

immunity?
natural artificial
active A B
passive C D
Dr.Dawood 9700/12/M/J/15 49
36 What describes natural passive immunity?
A protection against a pathogen by an injection of antibodies

B protection against a pathogen by drinking colostrum containing antibodies
C stimulation of lymphocytes by antigens contained in a vaccine
D stimulation of lymphocytes by antigens on the surface of invading pathogens
37 What happens when people are injected with dead bacteria?
A B-lymphocytes produce antibodies.

B B-lymphocytes produce antigens.
C T-lymphocytes produce antibodies.
D T-lymphocytes produce antigens.
50 9700/13/M/J/15 Dr.Dawood
36 What describes a function of a macrophage?
A They are found in tissues and secrete cytokines in response to infection.

B They can leave the blood and accumulate at sites of inflammation.
C They can leave the blood and secrete cytotoxins when exposed to damaged cells.
D They circulate in the blood and produce antigens in response to infection.
37 There has been an increase in the number of cases of the disease whooping cough.
A pregnant woman is vaccinated against whooping cough to protect the new born baby from this
disease.
How does the immune response of the mother help to protect a new born baby from whooping
cough?
before birth, baby type of protection

receives from mother gained by baby
A antibodies natural passive

B antigens artificial active
C memory cells artificial passive
D pathogens natural active
Dr.Dawood 9700/11/O/N/15 51
35 Which statement is correct for a neutrophil?
A They are found in tissues and secrete cytokines in response to infection.

C They can leave the blood and secrete cytotoxins when exposed to damaged cells.
D They circulate in the blood and present antigens in response to infection.
36 What describes artificial passive immunity?

37 Which statements correctly describe lymphocytes?
1 Each B-lymphocyte has the ability to make several types of antibody molecules.
2 Some B-lymphocytes and T-lymphocytes become memory cells.
3 Plasma cells secrete antibodies into the blood plasma.
4 Some T-lymphocytes stimulate macrophages to kill infected cells.
A 1, 2, 3 and 4
B 1, 2 and 3 only
C 2, 3 and 4 only
D 1 and 4 only
52 9700/12/O/N/15 Dr.Dawood
36 What describes natural active immunity?

37 The bacterium that causes the disease tetanus produces a toxin that acts as an antigen.
The graph shows the concentration of an antibody in the blood of two people, G and H.
On day 0, G was injected with antibodies to the tetanus toxin and H was injected with the vaccine
for tetanus.
25
G H
20
antibody 15
concentration
/ arbitrary units 10
0
0 5 10 15 20
time / days
time of injection time of infection
with tetanus bacteria
What would be the result after G and H were infected with the tetanus bacteria on day 20?
A concentration of antibodies in H would remain constant

B G would fail to produce tetanus antibodies
C G would peak in antibody production 12 days after infection
D H would produce a new antibody peak 12 days after infection
Dr.Dawood 9700/13/O/N/15 53
39 Rabies is a viral disease which can be spread to humans by a bite from an infected animal.
One method of treatment is to inject the patient with antibodies specific to the rabies virus.
Which statements about this treatment are correct?
1 The patient will have natural passive immunity to rabies.

2 The injected antibodies will be broken down by the patient.
3 The patient’s memory cells will be able to produce this antibody more rapidly in the
future.
4 The immunity provided will only be of short duration.
40 What are the functions of T-lymphocytes during an immune response?
1 destroy infected body cells

A 1 and 2 B 2 and 3 C 1 only D 3 only
54 9700/11/M/J/16 Dr.Dawood
38 Which statement describes how passive natural immunity is obtained?
A A vaccination containing dead microorganisms is given.

B An immunisation containing specific antigens is given.
C Antibodies are passed from mother to developing baby.
D Antibodies from another individual are injected.
39 What describes a non-specific immune response?
A activation of killer T-lymphocytes by infected cells

B cloning of B-lymphocytes to form plasma cells
C ingestion of a bacterial cell by a neutrophil
D presentation of antigens on the cell surface of macrophages
40 What explains why monoclonal antibodies can be used to target cancer cells?
A Cancer cells have different antigens from normal body cells.

B Specific cancer drugs can be attached to the monoclonal antibody.
C They are one type of a specific antibody that binds to an antigen.
D They are secreted by hybridomas of cancer cells and B-lymphocytes.
Dr.Dawood 9700/12/M/J/16 55
39 The graph shows the antibody response when a person is injected first with antigen X and later
with antigens X and Y.
Which curve shows the primary response to antigen Y?
A B
antibody
concentration
D C
time
antigen X antigen X and Y
injected injected
40 Which row describes passive immunity?
involves an memory
triggered by permanent
immune cells
an antigen protection
response produced
A key
B = true
C = false
D
56 9700/13/M/J/16 Dr.Dawood
38 What describes a function of a T-lymphocyte?
A They are only found in blood and secrete cytokines in response to infection.
C They can leave the blood and secrete cytotoxins when exposed to bacteria.
D They circulate in the blood and always present antigens in response to infection.
39 A person’s blood group is determined by antigens present on the red blood cells.
The table shows the antigens and antibodies in the blood of people with different blood groups.
blood group antigens on red blood cells antibodies in plasma
A A antibodies to B
B B antibodies to A
AB A and B neither
O neither antibodies to A and B
During a blood transfusion, it is essential that the recipient’s blood does not contain antibodies to
the donor’s blood.
Which blood group can be given to a person with blood group AB?
A AB only
B O only
C B and A only
D A, B, AB and O
40 Which statement about immunity is correct?
A Antibody donation, but not antibody production, occurs with artificial active and artificial
passive immunity.
B Artificial active immunity lasts for a greater length of time than natural passive immunity.
C Natural active immunity provides a faster response to infection than artificial active immunity.
D Recognition and binding by specific B-lymphocytes only occurs with natural immunity.
Dr.Dawood 9700/11/O/N/16 57
40 What occurs when active immunity is artificially induced?
A Non-self antibodies attack self antigens.

B Non-self antigens attack self antibodies.
C Self antibodies attack non-self antigens.
D Self antigens attack non-self antibodies.
58 9700/12/O/N/16 Dr.Dawood
38 Which event will occur following antigen-antibody binding?
A agglutination of bacteria to reduce their spread

B decreased susceptibility to phagocytosis
C more helper T cells are activated by the release of cytokines
D more plasma cells are cloned to produce more antigens
39 Which statements about macrophages are correct?
1 More are found in tissues such as the lungs, than in the blood.
2 They have a role in antigen presentation.
3 They can engulf pathogens, dust particles and damaged body cells.
40 The graph shows the antibody concentration in blood following vaccination and a booster
vaccination 28 days later.
booster
vaccination secondary
response
vaccination
antibody
concentration primary
response
0 7 14 21 28 35 42 49 56 63
time / days
Which statements about the changes in antibody concentration are correct?
1 Antibody concentration falls after the primary response because antibodies are
broken down and are no longer being produced.
2 The secondary response is more rapid due to memory B cells produced from
activated B cells in the primary response.
3 The secondary response lasts longer than the primary response because memory B
cells live longer than plasma B cells.
Dr.Dawood 9700/13/O/N/16 59
40 B-lymphocytes and T-lymphocytes are often unable to respond to the antigens on pathogens that
are intracellular parasites.
What is the reason for this?
A The antigens are constantly mutating.

B The antigens can destroy the lymphocytes.
C The lymphocytes do not encounter the antigens.
D The lymphocytes do not recognise the antigens.
60 9700/11/M/J/17 Dr.Dawood
39 When a person is given a vaccination immunity to certain pathogens develops.
Which of the effects of vaccination are correct?
1 production of antibodies to protect against future infections
2 results in artificial active immunity
3 stimulation of appropriate lymphocytes
40 What is the first response by the immune system to a pathogen?
A ingestion of the pathogen by phagocytes

B production of antibodies
C production of antigens
D stimulation of B memory cells
Dr.Dawood 9700/12/M/J/17 61
39 The photomicrograph shows human blood, with three types of white cell labelled.
T R
Which row correctly identifies these white cells?
cell R cell S cell T
A lymphocyte lymphocyte lymphocyte

B lymphocyte phagocyte phagocyte
C phagocyte lymphocyte phagocyte
D phagocyte phagocyte lymphocyte
40 A monoclonal antibody specific for a virus was produced.
This antibody was treated with an enzyme to break the bonds between the variable and constant
regions.
The separated variable and constant regions were then added to cells infected with the virus.
Which statements are correct?
1 The constant regions would bind to different parts of the virus antigens.
2 The viruses could be engulfed by phagocytes if they were present.
3 The variable regions would all bind to the same part of the virus antigens.
62 9700/13/M/J/17 Dr.Dawood
39 Which statements about endocytosis are correct?
1 It is part of phagocytosis.
2 It is a passive process.
3 Materials are taken into the cell.
4 Vesicles form within the cytoplasm.
40 The statements refer to vaccination programmes for each of the diseases cholera, measles,
smallpox and tuberculosis (TB).
Which statement is correct for TB?
A Most children are vaccinated before their first birthday.

B The pathogen has not mutated or changed its antigens.
C The pathogen lives in the intestine where antibodies cannot get to it.
D The vaccine is not effective against some strains of the pathogen.
Dr.Dawood 9700/11/O/N/17 63
39 Which sequence of events occurs during an immune response?
1 development of plasma cells

2 mitosis of B-lymphocytes
3 recognition of non-self antigens
4 secretion of antibodies
A 2→3→4→1
B 2→4→3→1
C 3→1→2→4
D 3→2→1→4
40 An influenza vaccine can be made by growing the viruses in chicken eggs.
The viruses are extracted in liquid from the eggs and inactivated. The purified egg extract
containing the viruses is then used as the vaccine.
What is a side-effect of using this vaccine in some people?
A An auto-immune condition could occur.

B An immune response to egg antigens could occur.
C The egg antigens could cause infections.
D The influenza viruses could cause infections.
64 9700/12/O/N/17 Dr.Dawood
39 The flow diagram shows the events following activation of a T-lymphocyte by binding to antigens
on an infected cell.
T-lymphocyte
helper cells killer cells
B-lymphocytes X Y more
activated killer cells
Z memory
cells
Which row correctly identifies X, Y and Z?
X Y Z
A memory cells macrophages antibodies

B memory cells memory cells plasma cells
C neutrophils memory cells plasma cells
D plasma cells neutrophil memory cells
40 Smallpox was eradicated from the human population by a worldwide preventative programme.
Which type of immunity was triggered in people who were treated as part of this programme?
A artificial active immunity

B artificial passive immunity
C natural active immunity
D natural passive immunity
Dr.Dawood 9700/13/O/N/17 65
66 Dr.Dawood
Dr.Dawood 67
68 Dr.Dawood
36 Which development in vaccine production would be most important in the fight to eradicate
measles in developing countries?
A a combined vaccine to combat it and other diseases

B a single vaccine, without the need for boosters
C a vaccine containing only live measles viruses
D a vaccine produced by genetic engineering techniques
37 What could cause an outbreak of malaria in a country where it had been eliminated?
1 mosquitoes became resistant to insecticides

2 migration of population due to war
3 malarial parasites became resistant to quinine
A 1 and 2 only B 1 and 3 only C 2 and 3 only D 1, 2 and 3
Dr.Dawood 9700/11/M/J/13 69
36 A country had fewer than 2.5 deaths per 100 000 people from TB in one year and the next year
this rose to 25 deaths per 100 000.
What may have contributed to this change?
1 decrease in contact tracing

2 increase in refugee camps
3 water supply contaminated by sewage
A 1 and 2 only B 1 and 3 only C 2 and 3 only D 1, 2 and 3
70 9700/12/M/J/13 Dr.Dawood
36 Some antibiotics are used in animal feed to reduce disease.
What explains why these antibiotics should not be used in the treatment of human diseases?
A Humans may be allergic to these antibiotics.

B Human cells may stop responding to these antibiotics.
C Pathogenic bacteria may develop resistance to these antibiotics.
D Useful gut bacteria may be killed by these antibiotics.
Dr.Dawood 9700/13/M/J/13 71
34 Which is correct for TB, measles and malaria?
TB measles malaria
causative causative causative
transmission transmission transmission
agent agent agent
A bacteria air-borne virus air-borne protoctist insect vector
B bacteria water-borne protoctist air-borne virus insect vector
C virus air-borne bacteria water-borne protoctist insect vector
D virus insect vector protoctist insect vector bacteria water-borne
35 What do the causative agents of HIV / AIDS, malaria and TB have in common?
they have a cell they have they have

they respire key
surface membrane genes ribosomes
present in each
A causative agent
B
not present in
C each causative
agent
D
72 9700/11/O/N/13 Dr.Dawood
34 The diagram shows the relationship between cholera, measles and TB.
1 2 3 4 5
Which is correct?
1 2 3 4 5
A cholera bacteria TB airborne measles

B cholera virus measles waterborne TB
C measles airborne cholera bacteria TB
D measles waterborne TB virus cholera
37 The World Health Organization (WHO) set a target to eradicate polio, using vaccination, by the
year 2000. However, cases are still being reported in some parts of the world after this date.
What explains these new cases of polio?
1 Some parts of countries are difficult to reach because of poor transport or wars.
2 There is not enough research to develop more effective vaccines.
3 Records of vaccinated and unvaccinated people are incomplete.
A 1 only B 1 and 2 only C 1 and 3 only D 2 and 3 only
Dr.Dawood 9700/12/O/N/13 73
34 Which row is correct?
causative method method

disease
agent of transmission of control
A AIDS HIV intimate contact antibiotics

B cholera virus waterborne oral rehydration therapy (ORT)
C malaria bacterium insect vector antimalarial drugs
D tuberculosis (TB) bacterium airborne vaccination
35 Scientists are concerned that avian (bird) flu caused by the H5N1 virus could infect humans and
cause a pandemic.
What could help prevent humans from spreading the disease?
1 killing all poultry

2 reducing the number of air flights
3 taking a course of antibiotics
A 1 only B 2 only C 3 only D 1, 2 and 3
37 Some of the facts about a pathogen, P, are that:
1 it is transmitted in food and water
2 it lives in human intestines
3 it has many genes coding for surface proteins
4 it changes its surface antigens
5 it may or may not trigger an immune response.
Which explains why it is difficult to develop an effective vaccine for P?
A P can mutate to produce different antigens.

B P is a eukaryotic cell with many genes.
C P is found in contaminated food and water and affects the gut.
D People can be infected with P and may not show symptoms.
74 9700/13/O/N/13 Dr.Dawood
35 The statements refer to the disease tuberculosis (TB).
1 The pathogen lives inside human cells so is not accessible to the immune system.
2 The bacterial pathogen reproduces slowly.
3 The pathogen is not very sensitive to antibiotics.
Which explains why antibiotic treatment for TB takes a long time?
36 The first column in the table contains statements about disease. Columns headed 1-4 represent
four different named diseases.
disease
statement about disease 1 2 3 4
infectious disease
can be treated with antibiotics key
caused by a bacterium = true
degeneration of lung tissue
Which is the correct set of column headings for the diseases in the table?
disease
1 2 3 4
A bronchitis measles malaria smallpox

B emphysema malaria HIV / AIDS cholera
C emphysema smallpox cholera HIV/AIDS
D lung cancer smallpox HIV / AIDS cholera
Dr.Dawood 9700/11/M/J/14 75
34 The malarial parasite, Plasmodium, infects red blood cells and breaks down haemoglobin. Free
haem groups are toxic to Plasmodium and the parasite converts them into non-toxic, crystalline
haematozoin, using an enzyme, HDP, which is found in all species of Plasmodium.
What will be the long term result of giving patients with malaria a drug which inhibits HDP?
A a decreased concentration of free haem groups in infected red blood cells

B a decreased concentration of haemoglobin in infected red blood cells
C more rapid reproduction of some species of Plasmodium in infected red blood cells
D slower reproduction of all species of Plasmodium in infected red blood cells
76 9700/12/M/J/14 Dr.Dawood
36 Which factors may increase the risk of cholera in refugee camps?
1 no refrigeration of food
2 increase in the number of people
3 lack of hand washing facilities
Dr.Dawood 9700/13/M/J/14 77
32 The following are all methods of transmission of infectious diseases.
1 droplet
2 food
3 contact
4 vector
Which row shows the correct organism and method of transmission of each disease?
malaria TB HIV
A bacterium virus virus

4 1 and 2 3 and 4
B protoctist bacterium virus
4 1 and 2 3
C protoctist virus bacterium
3 1 3
D bacterium protoctist bacterium
3 1 1 and 3
33 40% of the world’s population live in an area where malaria is a threat to health. In recent years
there have been many more cases of malaria in Africa.
What is the social factor that is letting the spread of malaria get out of control?
A an increase in drug resistant forms of malaria

B climate change
C difficulty in producing a vaccine
D migration of people because of wars
78 9700/11/O/N/14 Dr.Dawood
34 Which diseases are treated with antibiotics?
cholera
A B
D
TB measles
C
36 Why has vaccination failed to eradicate cholera?
A The pathogen exists in many strains which mutate.

B The pathogen is present in the lumen of the gut.
C The pathogen is waterborne.
D There is a stage of the life cycle in other mammals.
Dr.Dawood 9700/11/O/N/14 79
35 Which statements about people infected with HIV / AIDS are correct?
1 They can be treated and completely cured.

2 They may live for many years after infection.
3 They will have symptoms.
36 The statements refer to polio and tuberculosis (TB).
1 Macrophages present antigens in vaccines to stimulate an immune response.

2 The TB antigens necessary to produce an immune response are proteins which
would be digested in the stomach and small intestine.
3 There are no B-lymphocytes and T-lymphocytes in the stomach.
Which explains why polio vaccine can be taken by mouth but TB vaccine has to be injected?
37 Which explains why sickle cell anaemia has not been eradicated?
A Identification of carriers is too difficult as they show no symptoms.

B Sickle cell anaemia gives the individual some resistance against malaria.
C Sickle cell anaemia is an inherited disease, so vaccination is not possible.
D The gene responsible for sickle cell anaemia has a high rate of mutation.
80 9700/12/O/N/14 Dr.Dawood
33 A person who returns home after a visit to a foreign country starts to have fevers at regular
intervals. Blood tests taken between the fevers and during the fevers show a decrease in the
number of red blood cells (anaemia).
Which disease does this person have?
A cholera
B HIV / AIDS
C malaria
D TB
34 Why do people in refugee camps have a high risk of being infected by cholera?
A Drinking water is likely to be contaminated with sewage.

B People live in close contact, increasing the risk of droplet infection.
C There is a shortage of antibiotics.
D There is a shortage of food and water.
35 Which statements explain why cholera has not been eradicated by vaccination?
1 Cholera is caused by the bacterium Vibrio cholerae.

2 Many people can have the disease, but show no symptoms.
3 People are mobile due to global trade and tourism.
4 The cholera pathogens target cells in the small intestine.
A 1, 2, 3 and 4
B 1 and 2 only
C 2 and 4 only
D 3 and 4 only
Dr.Dawood 9700/13/O/N/14 81
34 The first column in the table contains statements about disease. Columns headed 1-4 represent
four different named diseases.
statements 1 2 3 4
infectious disease
can be treated with antibiotics key
caused by a virus = true
degeneration of lung tissue
What is the correct set of column headings for the table above?
1 2 3 4
A bronchitis measles TB smallpox

B emphysema HIV / AIDS cholera TB
C emphysema measles cholera lung cancer
D lung cancer HIV / AIDS measles TB
35 Which row is correct for malaria?
nature of disease method of transmission pathogen
A infectious insect vector species of Plasmodium

B infectious water-borne species of Vibrio
C non-infectious insect vector species of Plasmodium
D non-infectious water-borne species of Vibrio
82 9700/11/M/J/15 Dr.Dawood
34 The graph shows the fall in cases of tuberculosis (TB) in a country between 1910 and 2000.
90 000
80 000
70 000
60 000
50 000
number of
cases per year
40 000
30 000
20 000
10 000
0
1910 1920 1940 1960 1980 2000
year
Which factors could have contributed to the fall over this period?
1 pasteurisation of milk
2 the provision of new housing
3 chemical treatment of sewage
4 identification of contacts of people infected with TB
35 Which row is correct for cholera?
nature of disease method of transmission causative agent (pathogen)
A infectious insect vector species of Plasmodium

B infectious water-borne species of Vibrio
C non-infectious insect vector species of Plasmodium
D non-infectious water-borne species of Vibrio
Dr.Dawood 9700/12/M/J/15 83
34 The diagram shows properties of diseases.
What shows the properties that are common to both tuberculosis (TB) and measles?
bacterial A infectious
B
C D
transmitted by
airborne
droplets
35 Strains of Mycobacterium have been found that are:
• multiple drug-resistant (MDR) – resistant to the drugs most commonly used to

control tuberculosis (TB)
• extensively drug-resistant (XDR) – resistant to the drugs most commonly used to

control TB and to some of the drugs less commonly used to control TB
• totally drug-resistant (TDR) – resistant to all known drugs used to control TB.
Comparisons of some of these strains of Mycobacterium found differences in the thickness of

their cell walls, as shown in the table.
thickness of cell
Mycobacterium
wall / nm
non-resistant 15
MDR 17
TDR 20
What conclusions may be drawn from this information?
A Bacteria secrete thicker cell walls when in contact with a mixture of drugs.
B The cell walls of TDR bacteria are impermeable to drugs.
C Thicker cell walls may form a physical barrier to drugs.
D XDR bacteria have cell walls between 17 and 20 nm thick.
84 9700/13/M/J/15 Dr.Dawood
35 The diagram shows one way of testing the effect of an antibiotic on bacteria.
colonies of bacteria
diameter of zone
petri dish with measured every
nutrient agar day for 5 days
grown for
containing
5 days
bacteria
disc of filter paper

soaked in antibiotic
The table shows the results of testing five different types of bacteria. Zones of less than 13 mm
show the presence of resistant bacteria.
type of diameter of zone / mm

bacteria day 1 day 2 day 3 day 4 day 5
1 24.10 21.90 19.00 17.60 14.30

2 18.60 15.40 12.20 9.00 0.00
3 17.90 12.80 12.40 11.10 10.90
4 19.40 15.30 13.20 8.10 0.00
5 22.00 21.00 20.50 20.40 20.40
Which statement can be supported by this data?
A All the types of bacteria become resistant to antibiotics over time.

B Only types 2, 3 and 4 of the bacteria show resistance to the antibiotic.
C The antibiotic can be used to treat types 1 and 3 only.
D Type 5 of the bacteria can never become resistant to the antibiotic.
Dr.Dawood 9700/11/O/N/15 85
34 Why is it necessary for a person with a bacterial infection to take antibiotics at evenly spaced time
intervals?
A to increase the concentration of antibiotic slowly to a level which is lethal to the bacteria
B to maintain a concentration of antibiotic in the body which is lethal to the bacteria

C to prevent the development of resistant strains of bacteria
D to select and kill the resistant strains of bacteria
86 9700/12/O/N/15 Dr.Dawood
35 The data shows how the number of human deaths caused by the bacterium
Staphylococcus aureus has changed over a period of five years.
Methicillin is an antibiotic used to treat a disease caused by S. aureus.

MRSA is methicillin-resistant S. aureus.
total number of deaths total number of deaths

year caused by S. aureus caused by MRSA
1 369 355
2 452 431
3 456 681
4 420 890
5 428 1512
Which statement is not supported by this data?
A More people have MRSA so the disease spreads.

B MRSA is more likely to lead to death than S. aureus.
C Resistant strains of MRSA are becoming more common.
D S. aureus will always cause humans to die.
Dr.Dawood 9700/13/O/N/15 87
37 A person whose immune system is suppressed may become more susceptible to certain
diseases.
Which disease will this person not become more susceptible to?
A cholera
B measles
C sickle cell anaemia
D TB
38 Which disease is treated with drugs that have a similar molecular structure to DNA nucleotides?
A cholera
B HIV / AIDS
C malaria
D TB
88 9700/11/M/J/16 Dr.Dawood
35 The table shows the names of five pathogens.
Which row matches the pathogens with the diseases they cause?
Morbillivirus Mycobacterium Plasmodium Variola Vibrio
A cholera measles TB malaria smallpox

B malaria smallpox cholera measles TB
C measles TB malaria smallpox cholera
D TB malaria smallpox cholera measles
36 Which disease exhibits all the following features?
• It can be transmitted by animals to other animals, including humans.
• One mode of transmission is by transfusion with contaminated blood.
• The causative organism can show multiple drug resistance.
• The majority of humans who die from the disease are children.
A cholera
B HIV / AIDS
C malaria
D tuberculosis
37 The proportion of the local population who have malaria in area R is higher than the proportion in
area S.
Which factor causes this difference?
A Area R has a more humid climate than area S.

B Area R is nearer the equator than area S.
C There is a higher population in area R than area S.
D There is less sewage treatment in area R than area S.
Dr.Dawood 9700/12/M/J/16 89
36 More people are exposed to the risk of contracting malaria due to an increase in the distribution
of Anopheles mosquitoes.
What could be the cause of this increase?
A drug resistance in Plasmodium

B global warming
C insecticide resistance
D no effective vaccine
37 An antibiotic inhibits the formation of cross-links between the molecules that form cell walls in
bacteria.
Which statements explain why bacteria are killed by the antibiotic?
1 The bacterial cell is destroyed by osmotic lysis.

2 Cellulose molecules cannot form hydrogen bonds.
3 The cell wall is no longer selectively permeable.
A 1 and 2 only B 2 and 3 only C 1 only D 2 only
38 Which of these pathogens can be transmitted by air?
1 Plasmodium
2 Morbillivirus
3 Mycobacterium
4 Vibrio
90 9700/13/M/J/16 Dr.Dawood
36 Why is it difficult to control the spread of malaria?
1 Global air travel for commerce and tourism has increased.

2 The mosquito vector rapidly evolves resistance to insecticides.
3 The Plasmodium pathogen shows great antigenic variability.
4 Civil unrest and poverty result in overcrowded living conditions.
A 1, 2 and 3 B 1, 2 and 4 C 2 and 3 only D 3 only
37 Which description gives the correct cause and transmission for TB, measles and HIV / AIDS?
TB measles HIV / AIDS

cause transmission cause transmission cause transmission
A bacteria airborne virus airborne virus bodily fluids

droplets droplets
B bacteria water bacteria airborne protoctist insect vector
borne droplets
C protoctist airborne bacteria insect vector virus airborne
droplets droplets
D virus bodily fluids protoctist bodily fluids bacteria bodily fluids
Dr.Dawood 9700/11/O/N/16 91
37 Which disease is not likely to be passed directly from parents to child?
A cholera
B malaria
C sickle cell anaemia
D tuberculosis
38 Why is it difficult to control the spread of measles?
1 Global air travel for commerce and tourism has increased.

2 The virus that causes measles rapidly evolves resistance to antibiotics.
3 The virus that causes measles shows great antigenic variability.
4 Civil unrest and poverty result in overcrowded living conditions.
A 1, 2 and 4 B 1, 2 and 3 C 1 and 4 only D 4 only
39 The following are all responses made by cells of the immune system to a pathogen.
1 mitosis
2 bind to infected cell
3 produce memory cells
Which of the responses is correct for β-lymphocytes?
A 1, 2, 3 and 4 B 1, 2 and 4 only C 1 and 3 only D 2, 3 and 4 only
92 9700/12/O/N/16 Dr.Dawood
35 Which row is correct?
disease pathogen method of infection
A cholera bacterium food borne

B malaria prokaryote insect bite
C measles bacterium water borne
D tuberculosis (TB) virus airborne
36 What do pathogens of HIV / AIDS, malaria and TB have in common?
they have a cell they have they have

surface membrane genes ribosomes
A key
B present in each causative agent
C not present in each causative agent
D
37 Which factor might have contributed to the spread of HIV / AIDS?
A few clinics and hospitals

B insufficient education
C malnutrition
D poor sanitation
Dr.Dawood 9700/13/O/N/16 93
39 The global mortality figures for some diseases in 2002 are shown in the table.
cause of millions of percentage

death deaths of all deaths
HIV / AIDS 2.8 4.4

TB 1.6 2.7
malaria 1.3 2.2
measles 0.6 1.1
How many millions of people died in 2002 from the bacterial diseases listed in the table?
A 0.6 B 1.6 C 2.2 D 2.7
94 9700/11/M/J/17 Dr.Dawood
35 Some common antibiotics are listed. The action of each antibiotic is described.
1 rifampicin – inhibits RNA polymerase

2 streptomycin – inhibits 70S ribosomes
3 neomycin – inhibits DNA synthesis
4 ampicillin – inhibits peptidoglycan synthesis
Which of these antibiotics will affect the activities of bacterial cells only?
A 1, 2, 3 and 4
B 1, 2 and 3 only
C 2 and 4 only
D 4 only
36 What could cause an outbreak of malaria in a country after it had been eliminated?
1 mosquitoes become resistant to insecticides

2 migration of population due to war
3 malarial parasites become resistant to quinine
37 Which disease is caused by a bacterium and can be spread by airborne droplets?
A cholera
B measles
C smallpox
D tuberculosis (TB)
38 Smallpox has been eradicated, but malaria and cholera have not.
Which statements correctly explain this?
1 Cholera pathogens in the intestines are not destroyed by antibiotics.

2 Plasmodium antigens change during the life cycle.
3 Smallpox antigens remain stable.
4 Vaccines only work against viruses.
Dr.Dawood 9700/12/M/J/17 95
35 Which is correct for measles?
airborne
virus transmission
A B C
rash
36 Some antibiotics are used in animal feed to reduce disease.
What explains why these antibiotics should not be used in the treatment of human diseases?
A Human cells may stop responding to these antibiotics.

B Humans may be allergic to these antibiotics.
C Pathogenic bacteria may develop resistance to these antibiotics.
D Useful gut bacteria may be killed by these antibiotics.
37 In what order do the following processes occur to produce a population of bacteria that are
resistant to a new antibiotic?
1 change in reproductive success of bacteria

2 increase in frequency of the resistance allele in the population
3 increase in genetic variation within the population
4 random mutation occurs in bacterial DNA
A 1→3→2→4
B 2→1→3→4
C 3→4→1→2
D 4→3→1→2
38 Which type of new vaccine production would be most important in the fight to eradicate measles
in developing countries?
A a combined vaccine to combat it and other diseases

B a single vaccine, without the need for boosters
C a vaccine containing only live measles pathogens
D a vaccine containing monoclonal antibodies
96 9700/13/M/J/17 Dr.Dawood
35 What is correct for tuberculosis (TB)?
airborne
transmission virus
A B C
rash
36 Which factors contribute to outbreaks of measles after natural disasters?
1 contamination of drinking water with untreated sewage

2 lack of effective vaccination coverage in the population before the disaster
3 people living in overcrowded accommodation
37 Which of these statements explain why some vaccines can be taken by mouth but tuberculosis
(TB) vaccine has to be injected?
1 Macrophages present antigens in vaccines to stimulate an immune response.

2 The TB antigens necessary to produce an immune response are proteins which
would be digested in the stomach and small intestine.
3 There are no B-lymphocytes and T-lymphocytes in the stomach.
Dr.Dawood 9700/11/O/N/17 97
37 What is the causative agent and method of transmission of smallpox?
method of
causative agent
transmission
A Morbillivirus direct contact

B Morbillivirus waterborne
C Variola direct contact
D Variola waterborne
38 A scientist investigated the effect of an antibiotic on the treatment of cholera.
320 people suffering with cholera were split into two groups. One group was treated with an
antibiotic while the other group was not given antibiotics. Both groups were given fluids
containing sugars and mineral salts (oral rehydration therapy).
The scientist recorded the number of days that each person suffered from diarrhoea.
The table shows the results.
mean time person had

treatment
diarrhoea / days
antibiotic and oral rehydration therapy 3.2

oral rehydration therapy 5.3
What is the percentage decrease in the mean time that a person suffered from diarrhoea when
they were treated with the antibiotic?
A 39.6% B 60.4% C 165.6% D 252.4%
98 9700/12/O/N/17 Dr.Dawood
37 The antibiotic penicillin prevents the formation of cross-links between peptidoglycans during
bacterial cell wall synthesis by blocking the enzyme transpeptidase.
Which statements describe the action of penicillin on bacteria?
1 It is an enzyme inhibitor.
2 It weakens the bacterial cell wall.
3 It will work at any stage during the bacterial life cycle.
38 Which pathogens are spread by droplet infection?
1 Mycobacterium tuberculosis
2 Vibrio cholerae
3 Morbillivirus
Dr.Dawood 9700/13/O/N/17 99
100 Dr.Dawood
Cambridge International Examinations
Cambridge International Advanced Subsidiary and Advanced Level
BIOLOGY 9700/11
Paper 1 Multiple Choice May/June 2018
1 hour
Additional Materials: Multiple Choice Answer Sheet
Soft clean eraser
*5924034730*
Soft pencil (type B or HB is recommended)
READ THESE INSTRUCTIONS FIRST
Write in soft pencil.

Do not use staples, paper clips, glue or correction fluid.
Write your name, Centre number and candidate number on the Answer Sheet in the spaces provided unless
this has been done for you.
DO NOT WRITE IN ANY BARCODES.
There are forty questions on this paper. Answer all questions. For each question there are four possible
answers A, B, C and D.
Choose the one you consider correct and record your choice in soft pencil on the separate Answer Sheet.
Read the instructions on the Answer Sheet very carefully.
Each correct answer will score one mark. A mark will not be deducted for a wrong answer.
Any rough working should be done in this booklet.
Electronic calculators may be used.
This document consists of 20 printed pages.
IB18 06_9700_11/3RP
© UCLES 2018 [Turn over
Dr.Dawood 101
2
1 Which statements about resolution and magnification are correct?
resolution magnification
A the ability to distinguish between two the number of times larger an image is
separate objects that are very close compared with the real size of the object
together
B the clarity of the image formed the power of the microscope to focus
by the microscope on very small objects
C the number of times larger an image is the ability to distinguish between two
compared with the real size of the object separate objects that are very close
together
D the power of the microscope to focus the clarity of the image formed
on very small objects by the microscope
2 An eyepiece graticule has a scale with 100 divisions. A stage micrometer has a scale with
50 divisions, each of which is 0.040 mm apart.
Using a ×40 objective lens, the whole length of this stage micrometer scale lines up with
15 divisions of the eyepiece graticule.
What is the actual length of the 100 division scale of the eyepiece graticule?
A 1.3 mm B 13 mm C 75 µm D 750 µm
3 A prokaryotic cell which is 1 µm in diameter, is magnified 50 000 times in an electron micrograph.
What is the diameter of the cell in the electron micrograph?
A 5 × 10–1 mm
B 5 × 100 mm
C 5 × 101 mm
D 5 × 102 mm
102 9700/11/M/J/18 Dr.Dawood

3
4 A scientist carried out an experiment to separate cell structures in animal cells.
The cells were broken open to release the cell structures.
This extract was filtered into a centrifuge tube and then spun in a centrifuge. The heaviest cell
structure sank to the bottom forming pellet 1, as shown in the diagram.
liquid above
pellet
pellet 1
The liquid above pellet 1 was poured into a clean centrifuge tube and spun in the centrifuge at a
higher speed to separate the next heaviest cell structure. This cell structure sank to the bottom,
forming pellet 2.
This procedure was repeated twice more to obtain pellet 3 and pellet 4, each containing a single
type of cell structure.
Which row shows the order in which the cell structures were collected?
pellet 1 pellet 2 pellet 3 pellet 4
A nucleus lysosomes mitochondria ribosomes

B nucleus mitochondria lysosomes ribosomes
C ribosomes lysosomes mitochondria nucleus
D ribosomes mitochondria lysosomes nucleus
Dr.Dawood 9700/11/M/J/18 103

4
5 Radioactively-labelled nucleotides are introduced into a cell.
In which cell structures will the radioactivity first become concentrated?
6 What is the general formula for amylose?
A (C5H10O5)n B (C5H10O6)n C (C6H10O5)n D (C6H12O6)n
104 9700/11/M/J/18 Dr.Dawood

5
7 The diagram shows relationships between some important molecules and bonds.
peptide
ic
3 2
id
es
os
te
yc
r
gl
triglyceride cellulose
vegetable oil amylopectin
What is represented by circles numbered 1, 2 and 3?
1 2 3
A bonds formed carbohydrates lipids

by condensation
B bonds formed lipids carbohydrates
by condensation
C bonds formed carbohydrates lipids
by hydrolysis
D bonds formed lipids carbohydrates
by hydrolysis
8 In unsaturated lipid molecules, where are double bonds located?
A between fatty acids and glycerol

B within fatty acids and within glycerol
C within fatty acids only
D within glycerol only
Dr.Dawood 9700/11/M/J/18 105

6
9 Phospholipids and triglycerides are important biological molecules.
Which properties are correct for these molecules?
non-polar partially hydrophobic
A phospholipid phospholipid
B phospholipid triglyceride
C triglyceride phospholipid
D triglyceride triglyceride
10 The diagrams show two arrangements of amino acids in a protein.
Which row correctly names the bonds at S or T?
ionic bond hydrogen bond
A absent S and T
B S only T only
C S and T absent
D T only S and T
106 9700/11/M/J/18 Dr.Dawood

7
11 Students were asked to highlight only the R groups of two ring-shaped amino acids.
Which pair of diagrams are correct for both amino acids?
H H
O O
H 3N + C C H 2N +
C C
A O– O–
C NH
H 2C CH2
C
CH2
C NH+
H H
O O
H 3N + C C H 2N + C C
B O– O–
C NH
H 2C CH2
C
CH2
C NH+
H H
O O
H 3N + C C H 2N +
C C
C O– O–
C NH
H 2C CH2
C
CH2
C NH+
H H
O O
H 3N + C C H 2N +
C C
D O– O–
C NH
H 2C CH2
C
CH2
C NH+
Dr.Dawood 9700/11/M/J/18 107

8
12 Which words from the table correctly complete the paragraph about enzymes?
When the pH of an environment is decreased below the optimum pH of an enzyme, 1

bonds between adjacent 2 groups, holding the 3 structure, are disrupted.
1 2 3
A hydrogen and ionic R tertiary

B hydrogen hydroxyl secondary
C ionic and peptide R primary and tertiary
D peptide amine primary
13 The effect of substrate concentration on an enzyme-catalysed reaction was measured in three

different conditions:
● with no inhibitor
● with a competitive inhibitor
● with a non-competitive inhibitor.
The graph shows the results.
enzyme with
no inhibitor
inhibitor X
rate of
reaction
inhibitor Y
0
0 substrate concentration
Which statement is correct?
A X is a competitive inhibitor which binds to a site other than the active site of the enzyme.
B X is a non-competitive inhibitor which has a similar shape to the active site of the enzyme.
C Y is a competitive inhibitor which has a similar shape to the active site of the enzyme.
D Y is a non-competitive inhibitor which binds to a site other than the active site of the enzyme.
108 9700/11/M/J/18 Dr.Dawood

9
14 Which statements about the cell surface membrane are correct?
1 Channel proteins allow water soluble ions and molecules across the membrane.
2 Glucose can pass into the cell via carrier proteins.
3 Oxygen passes freely through the membrane as it is soluble in lipids.
4 Some glycoproteins act as antigens.
A 1, 2, 3 and 4
B 1, 3 and 4 only
C 1 and 2 only
D 2, 3 and 4 only
15 Which of these features increase the efficiency of ion uptake by a root hair cell?
1 many mitochondria in the cell

2 high concentration of ions in the vacuole
3 protein carriers in the cell surface membrane
A 1, 2 and 3 B 1 and 3 only C 1 only D 2 and 3 only
16 What can increase the fluidity of the cell surface membrane at low temperatures?
1 double bonds between carbon atoms in the fatty acid chains

2 cholesterol
3 fatty acids having shorter chains
Dr.Dawood 9700/11/M/J/18 109

10
17 The diagrams show the shape and size of two types of cell.
50 μm
45 μm
10 μm 5 μm
10 μm 10 μm
palisade mesophyll cell columnar epithelial cell

surface area = 2200 μm2 volume = 2250 μm3
Which statement is correct about the palisade cell and epithelial cell shown in the diagrams?
A An increase in surface area reduces the distance for gases to reach the centre of the cell.
B The surface area of the palisade mesophyll cell is 500 µm2 greater than the columnar
epithelial cell.
C The surface area to volume ratio is greater in the columnar epithelial cell than the palisade
mesophyll cell.
D The volume of the palisade mesophyll cell is 2500 µm3 greater than that of the columnar
epithelial cell.
18 A student observed the cells in the growing region (meristem) of an onion root and obtained the
data shown.
stage number of cells
interphase 886
prophase 73
metaphase 16
anaphase 14
telophase 11
Which percentage of cells contains chromosomes that appear as two chromatids?
A 7.3 B 8.9 C 95.9 D 97.5
110 9700/11/M/J/18 Dr.Dawood

11
19 Which of these events are part of mitosis?
1 interphase
2 telophase
3 cytokinesis
20 During which phase of the cell cycle does DNA replication take place?
A G1 B G2 C M D S
21 Which row is correct for guanine?
has a joins its

double ring is a purine complementary base with
structure three hydrogen bonds
A key
B = correct
C = incorrect
D
22 Meselsohn and Stahl investigated DNA in bacteria. They grew bacteria in a medium with only
heavy nitrogen, 15N, until all of the bacterial DNA was heavy.
These bacteria were moved from a heavy nitrogen medium and cultured in a medium with only
light nitrogen, 14N.
A sample of bacteria was collected from the first generation in the medium containing light
nitrogen and their DNA was analysed.
Hybrid DNA contains both heavy and light DNA.
Which row shows the percentage of heavy DNA strands and the percentage of hybrid DNA
molecules in the first generation produced in the medium containing light nitrogen?
percentage of heavy percentage of hybrid

DNA strands DNA molecules
A 25 50
B 50 50
C 50 100
D 75 100
Dr.Dawood 9700/11/M/J/18 111

12
23 Which is the correct DNA triplet on the original DNA template that codes for the amino acid
histidine (His)?
amino acid anticodon
Ala CGU
His GUA
Ser UCA
A CAU B CGT C GTA D GUA
24 The photomicrograph shows tissues in a stained transverse section of a plant stem.
Students are asked to draw four adjacent xylem vessel elements.
Which drawing, all drawn to the same scale, is correct?
A B C D
112 9700/11/M/J/18 Dr.Dawood

13
25 What is a function of the hairs (trichomes) on xerophytic leaves?
A adding a waterproof layer

B protecting the stomata
C reducing the surface area
D trapping a layer of moist air
26 Which features of companion cells are essential to their function?
1 They are connected by plasmadesmata to the sieve tube elements.

2 They have a thinner cell wall than a sieve tube element.
3 They contain a nucleus and mitochondria.
27 The photomicrograph shows a human blood smear.
Which row identifies the labelled cells?
1 2 3
A lymphocyte monocyte neutrophil

B lymphocyte neutrophil monocyte
C monocyte lymphocyte neutrophil
D monocyte neutrophil lymphocyte
Dr.Dawood 9700/11/M/J/18 113

14
28 The diagram shows the changes in electrical activity in the heart muscle during one cardiac cycle.
This is called an electrocardiograph (ECG).
sinoatrial node
stimulated
stimulates
ventricular
systole
Which electrocardiogram shows a rate of 75 beats per minute?
A B
0 1 2 3 4 0 1 2 3 4
time / s time / s
C D
0 1 2 3 4 0 1 2 3 4
time / s time / s
29 Which effect could be due to a reduced concentration of carbonic anhydrase?
A Carbaminohaemoglobin concentrations will decrease.

B Less oxygen is released from oxyhaemoglobin for active tissues.
C The pH of the blood will be lowered.
D The rate of dissociation of carbonic acid is increased.
114 9700/11/M/J/18 Dr.Dawood

15
30 Which statement correctly compares blood plasma and tissue fluid in a healthy person?
A Blood plasma contains more protein than tissue fluid.

B Both blood plasma and tissue fluid contain red blood cells.
C Tissue fluid contains white blood cells whereas blood plasma does not.
D Tissue fluid is formed from blood plasma and is not returned to blood plasma.
31 The diagram shows three features found in tissues of the gas exchange system.
ciliated goblet
epithelium cells
cartilage
Which tubes of the gas exchange system could be represented at position P in the diagram?
bronchus bronchiole trachea
A key
B = yes
C = no
D
Dr.Dawood 9700/11/M/J/18 115

16
32 The diagram shows a magnified section of part of the lungs containing specialised tissues.
Which row is correct for structures labelled 1 to 6?
contains high proportion of

carbonic
HCO3– ions lysosomes
anhydrase
A 1 3 4
B 2 4 5
C 3 5 6
D 4 6 1
33 A short-term effect of smoking is a decreased blood supply to the fingers and toes.
Which component of cigarette smoke causes this effect?
A carbon monoxide
B carcinogens
C nicotine
D tar
116 9700/11/M/J/18 Dr.Dawood

17
34 The symptoms of two diseases are listed.
disease 1 disease 2
coughing up blood shortness of breath

pain when breathing difficulty breathing out
loss of weight fatigue
Which row identifies diseases 1 and 2?
disease 1 disease 2
A chronic bronchitis emphysema

B emphysema lung cancer
C lung cancer chronic bronchitis
D lung cancer emphysema
35 Which statements about a non-infectious disease may be correct?
1 It can result from a mutation.

2 It can be transmitted by an insect vector.
3 It can be transmitted from mother to child.
Dr.Dawood 9700/11/M/J/18 117

18
36 The diagram shows one way of testing the effect of an antibiotic on bacteria.
colonies of bacteria
diameter of zone
petri dish with measured every
nutrient agar day for 5 days
grown for
containing
5 days
bacteria
disc of filter paper

soaked in antibiotic
The table shows the results of testing five different types of bacteria.
Zones of less than 13.0 mm show the presence of resistant bacteria.
type of diameter of zone / mm

bacteria day 1 day 2 day 3 day 4 day 5
1 24.1 21.9 19.0 17.6 14.3

2 18.6 15.4 12.2 9.0 2.0
3 17.9 12.8 12.4 11.1 10.9
4 19.4 15.3 13.2 8.1 2.0
5 22.0 21.0 20.5 20.4 20.4
Which statement can be supported by this data?
A All the types of bacteria become resistant to antibiotics over time.

B Only types 2, 3 and 4 of the bacteria show resistance to the antibiotic.
C The antibiotic can be used to treat types 1 and 3 only.
D Type 5 of the bacteria can never become resistant to the antibiotic.
118 9700/11/M/J/18 Dr.Dawood

19
37 Some animals have genes that code for small peptides called cathelicidins. These peptides kill a
wide range of bacteria by attaching to lipids in bacterial membranes, so weakening or disrupting
them.
Scientists have produced a synthetic version of the cathelicidin that kills bacteria that are
resistant to a number of antibiotics such as tetracycline.
Which pair of statements explain how this synthetic cathelicidin might help with the problem of
antibiotic resistance?
1 It is synthetic so bacteria can never become resistant to it.

2 It could be used instead of tetracycline, allowing tetracycline resistance to be
reduced.
3 The only way a bacterium could develop resistance to it is by altering all the lipids in
its membranes.
4 It could be used to kill multidrug-resistant strains of bacteria for which there is no
effective antibiotic.
38 Hybridomas are used as a basis for the production of large numbers of monoclonal antibodies.
Which statement describes how hybridomas are made?
A fusing activated T-lymphocytes with cancer cells

B fusing B-lymphocytes with cancer cells
C fusing memory cells with cancer cells
D fusing T-lymphocytes with cancer cells
39 Which statement about the properties of the antigen binding sites in antibody molecules is
correct?
A They are located on the light chains only.

B They have a hinge region to give flexibility for different antigens.
C They have binding sites for receptors on phagocytes.
D They have variable amino acid sequences for different antigens.
Dr.Dawood 9700/11/M/J/18 119

20
40 The statements describe ways in which different types of monoclonal antibodies can work.
1 binding to proteins on cell surfaces and triggering the immune system

2 blocking molecules on cell surfaces that inhibit T-cells
3 blocking cell signalling receptors that trigger cell division
4 blocking cell signalling receptors that trigger the immune response
Which types of monoclonal antibody could be used to treat cancer?
A 1, 2, 3 and 4
B 1, 2 and 3 only
C 1 and 4 only
D 2, 3 and 4 only
120 9700/11/M/J/18 Dr.Dawood

BIOLOGY 9700/12
1 hour
Soft clean eraser
*6240518218*

This document consists of 15 printed pages and 1 blank page.
IB18 06_9700_12/3RP
Dr.Dawood 121
2
1 Some features of cells are listed.
1 cell wall
2 cell surface membrane
3 ribosomes
Which features can be found in plant cells and in prokaryotic cells?
2 Which of these statements about light microscopy are correct?
1 The greater the resolution of a light microscope, the greater the detail that can be
seen.
2 The greater the magnification of a light microscope, the greater the detail that can
be seen.
3 Increasing the magnification of a light microscope up to its limit of resolution allows
more detail to be seen.
4 The shorter the wavelength of light used in a light microscope, the greater the detail
that can be seen.
A 1, 2, 3 and 4
B 1, 3 and 4 only
C 1 and 2 only
D 4 only
3 Which type of cell contains the highest proportion of cell structures bound by a single membrane?
A ciliated epithelial cell

B goblet cell
C red blood cell
D smooth muscle cell
122 9700/12/M/J/18 Dr.Dawood

3
4 The table shows a variety of structures which may be found in cells.
Which row shows structures that could be found in the root cells of a plant?
glycogen
plasmodesmata Golgi body mitochondria
granules
A key
B = present
C = absent
D
5 Which of these cell structures are present in Plasmodium?
Golgi
ribosomes
body
B
A
C
mitochondria
6 A student was asked to estimate the concentration of glucose in a solution using the Benedict’s
test. The student was provided with a 1.0 mol dm–3 glucose solution and was told to make a
0.6 mol dm–3 solution by proportional dilution.
Which row shows the correct volumes of both 1.0 mol dm–3 glucose solution and distilled water
needed to make the 0.6 mol dm–3 solution?
volume of
volume of
1.0 mol dm–3
distilled
glucose
water / cm3
solution / cm3
A 12 8
B 10 10
C 8 12
D 6 14
Dr.Dawood 9700/12/M/J/18 123

4
7 The diagram shows part of a carbohydrate molecule formed by glucose.
What is the name of the molecule?
A amylose
B cellulose
C glycogen
D starch
8 The diagram shows the relationship between some biological molecules.
1 2 3 4 5
1 2 3 4 5
A α-glucose carbohydrate sucrose monomer fructose

B cellulose polymer starch carbohydrate amylase
C fructose reducing sugar β-glucose monomer amino acid
D haemoglobin protein amylose polymer cellulose
124 9700/12/M/J/18 Dr.Dawood

5
9 Which diagram shows the reaction that occurs to join two of the monomers that form cellulose?
C C C C
H C O H H C O H H C O H H C O H
A C C C C C C O C C
HO C C OH HO C C OH HO C C C C OH
H2O
H2O
C C C C
H C O OH H C O OH H C O C O OH
B C C C C C C C C
HO C C H HO C C H HO C C H HO C C H
H2O
C C
H C O H HO C C OH H C O C C OH
C C C C C C C C C
HO C C OH H C O H HO C C OH H C O H
C C
H2O
C C
H C O OH HO C C H H C O C C H
D C C C C C C O C C
HO C C H H C O OH HO C C H H C O OH
C C
10 Which molecules contain C=O bonds?
1 amino acids
2 fatty acids
3 glycerol
Dr.Dawood 9700/12/M/J/18 125

6
11 Which row describes a collagen molecule?
bonds stabilising
properties primary structure helix
the molecule
A disulfide high temperatures high proportion double

increase flexibility of glycine
B disulfide resistant to repeat sequences single
stretching of three amino acids
C hydrogen high tensile repeat sequences triple
strength of three amino acids
D hydrogen insoluble high proportion alpha
in water of glycine and proline
12 A student investigated the hydrolysis of the lipid in high-fat milk, using the enzyme lipase.
• 1 cm3 of enzyme solution was added to 10 cm3 of high-fat milk.
• The temperature was kept constant.
• The pH of the reaction mixture was recorded at time 0 minutes and every minute for
20 minutes.
Which statements could be supported by the results of the investigation?
1 Less product is made as time proceeds because the substrate is decreasing.

2 The pH of the reaction mixture changes more rapidly in the first few minutes and
then changes less rapidly.
3 The product gradually causes more lipase molecules to denature.
126 9700/12/M/J/18 Dr.Dawood

7
13 A student carried out an investigation into the effect of temperature on the rate of an
enzyme-catalysed reaction.
At each temperature, the substrate concentration was measured after 10 minutes. All the other
variables were kept constant.
Which graph shows the effect of increasing temperature on the substrate concentration after
10 minutes?
A B
substrate substrate
concentration concentration
temperature / °C temperature / °C
C D
substrate substrate
temperature / °C temperature / °C
Dr.Dawood 9700/12/M/J/18 127

8
14 The graph shows how the rate of an enzyme-catalysed reaction depends on the concentration of
substrate.
0.4
0.3
initial rate
of reaction 0.2
/ mmol s–1
0.1
0.0
0.0 1.0 2.0 3.0 4.0 5.0
substrate concentration / mmol dm–3
What is the Michaelis-Menten constant (Km) for this enzyme under these conditions?
A 0.19 mmol dm–3

B 0.38 mmol dm–3
C 1.5 mmol dm–3
D 5.0 mmol dm–3
15 The formula shows how the rate of diffusion across a cell surface membrane can be calculated.
surface area × difference in concentrat ion

thickness of membrane
Which row shows how the fastest rate of diffusion can be achieved?
surface area difference in thickness of

available concentration membrane
A high high high

B high high low
C low high low
D low low high
128 9700/12/M/J/18 Dr.Dawood

9
16 The diagram shows part of the cell surface membrane of an active animal cell.
more negative water potential X
L M
less negative water potential Y
Which statements correctly describe the net movement of molecules across this membrane?
1 Oxygen diffuses through molecules M from X to Y.

2 Carbon dioxide diffuses through molecules M from X to Y.
3 Water moves from Y to X through molecule L.
17 Some epidermal cells from a well-watered plant are placed in three solutions which have different
water potentials.
Which row correctly shows the state of the plant cells in each of the solutions?
water potential of solution

lower than cells equal to cells higher than cells
A plasmolysed turgid plasmolysed

B plasmolysed turgid turgid
C turgid plasmolysed plasmolysed
D turgid plasmolysed turgid
Dr.Dawood 9700/12/M/J/18 129

10
18 One of the chromosomes in a nucleus has a telomere which contains many repeats of the base
sequence TTAGGG.
This chromosome was extracted from four different cells and the total number of bases in the
telomere was determined.
Which total number of bases was found in the cell that had undergone the most mitotic divisions?
A 5548 B 5580 C 5645 D 5700
19 The chromosome content of each daughter cell must be identical to that of the mother cell for
successful cell replacement when repairing tissues.
Which stages of mitosis make sure that each daughter cell receives one chromatid from each
chromatid pair?
A prophase and metaphase

B metaphase and anaphase
C anaphase and telophase
D telophase and interphase
20 Which of these statements about cytokinesis is always true?
1 Cell structures replicate.

2 Cell structures are shared between two cells.
3 Nuclear envelope reforms.
21 Which statement is correct about the number of telomeres present in prophase of a human body
cell?
A 46 as there is one telomere at the end of 46 chromosomes

B 92 as there is one telomere at each end of 46 chromosomes
C 92 as there is one telomere at the end of 92 chromatids
D 184 as there is one telomere at each end of 92 chromatids
22 Which statement explains why DNA replication is described as semi-conservative?
A Half of each original strand is conserved in each new molecule of DNA.

B Half of the base sequence of each strand is conserved in each new molecule of DNA.
C Only one strand of DNA is used as a template during replication.
D The template for each new molecule of DNA is one strand of the original molecule.
130 9700/12/M/J/18 Dr.Dawood

11
23 A section of a DNA molecule has the coding sequence: AGGCAATGGC.
1 This coding sequence contains 3 pyrimidines.

2 The double-stranded DNA of this section contains 26 hydrogen bonds between
complementary bases.
3 The double-stranded DNA of this section has 20 sugar-phosphate bonds.
24 XNA is a laboratory-made nucleic acid made of nucleotides in which one component has been
replaced by chemical X. The chemical X is not found in nature. The part of the molecule
responsible for coding is not changed.
Which organic component of a DNA or RNA nucleotide has been replaced by X?
A five-carbon sugar
B phosphate group
C purine base
D pyrimidine base
25 Which statements about tRNA are correct?
1 Hydrogen bonds between bases temporarily hold tRNA against mRNA.

2 The base sequences in the tRNA molecules are the same as the base sequences in
the mRNA that is being translated.
3 The specificity of the tRNA molecule for glycine and the specificity of the enzyme
that loads glycine are both necessary for correct loading.
26 What is the role of ATP in a companion cell when sucrose is loaded into a sieve tube element?
A moving sucrose into the sieve tube element

B removing protons from the sieve tube element
C removing protons out of the cytoplasm of the companion cell
D taking up sucrose into the cytoplasm of the companion cell
27 A potometer was used to measure the transpiration rate of a leafy shoot.
What could be the correct units?
A cm min B cm2 min–1 C cm3 g–1 min D cm3 min–1
Dr.Dawood 9700/12/M/J/18 131

12
28 Which combination of features is characteristic of a phloem sieve tube element as it is loaded

from a source?
water potential of
lignification of
the phloem sieve
the cell wall
tube element
A higher than source absent

B higher than source present
C lower than source absent
D lower than source present
29 The diagrams show transverse sections of parts of a plant.
1
3
Which structures, labelled 1 to 4, transport water and sucrose?
1 2 3 4
A key
B = correct
C = incorrect
D
30 Which statement explains why the ventricles contract after the atria?
A The band of fibres between the atria and the ventricles conducts the excitation wave slowly.
B The excitation wave has to pass through a small area of conducting fibres in the septum.
C The excitation wave has to travel further to reach the base of the ventricles than to spread
across the atria.
D The excitation wave travels slowly through the Purkyne tissue to reach the base of the
septum.
132 9700/12/M/J/18 Dr.Dawood

13
31 If the left atrioventricular valve in the heart does not close completely it results in blood flowing
back into the atrium during ventricular systole.
What would be the immediate effect of this back flow?
A blood flowing from the heart carries less oxygen because less blood enters the lungs
B diastolic pressure in the left ventricle falls because less blood enters the pulmonary artery
C lower systolic pressure in the left atrium and less blood enters the pulmonary artery
D raised pressure in the left atrium and less blood enters the aorta
32 The graph shows two oxygen dissociation curves, one for a tissue at rest and one for the same
tissue during exercise.
100 tissue at rest

tissue during exercise
percentage
saturation 50
with oxygen
0
pO2 / kPa
What factors have caused the difference in the position of the dissociation curve during exercise
compared with the dissociation curve for the tissue at rest?
1 increase in pH
2 decrease in pH
3 increase in haemoglobin affinity for O2
4 decrease in haemoglobin affinity for O2
33 Which of these statements about the formation of haemoglobinic acid are correct?
1 It can only occur with the dissociation of oxygen from haemoglobin.

2 It removes excess hydrogen ions preventing blood becoming too acidic.
3 It is linked to the action of carbonic anhydrase.
Dr.Dawood 9700/12/M/J/18 133

14
34 Which of these structures contain cartilage and cilia?
1 bronchi
2 bronchioles
3 trachea
35 What correctly describes the effect of carcinogens on lung tissue that causes a tumour to
develop?
A Cells in damaged alveoli walls divide more rapidly to replace damaged areas.
B Cilia are paralysed and mucus accumulates in the lungs causing DNA to change.
C DNA changes, causing bronchial epithelial cells to divide by mitosis in an uncontrolled way.
D Haemoglobin carries less oxygen, causing bronchial cells to divide by mitosis in an
uncontrolled way.
36 Which row identifies both the type of pathogen that causes cholera and the way in which cholera
is transmitted from person to person?
type of pathogen method of transmission

A bacteria drinking water contaminated
with the pathogen
B bacteria inhaling water droplets
contaminated with the pathogen
C virus drinking water contaminated
with the pathogen
D virus inhaling water droplets
contaminated with the pathogen
37 Why do people with HIV/AIDS have a higher occurrence of malaria than people without
HIV/AIDS?
A HIV/AIDS and malaria are both diseases where the pathogen travels in blood.
B HIV/AIDS and malaria are both transmitted in blood.
C HIV/AIDS infects T-lymphocytes which are used by the malaria pathogen.
D HIV/AIDS suppresses the immune response to the malaria pathogen.
38 How many variable regions are there on a typical Y-shaped antibody molecule?
A 2 B 3 C 4 D 6
134 9700/12/M/J/18 Dr.Dawood

15
39 Where are antigens found?
on the surface of on the surface of

pathogen macrophage
A key
B = antigens found
C = antigens not found
D
40 When an organ is transplanted from one person to another, rejection of the non-self organ must
be avoided. At the same time, the immune system of the recipient must be maintained to prevent
death from infections.
What prevents rejection of the transplanted organ?
A continued activity of B-lymphocytes

B natural active immunity
C natural passive immunity
D suppression of T-lymphocyte activity
Dr.Dawood 9700/12/M/J/18 135

16
BLANK PAGE
136 9700/12/M/J/18 Dr.Dawood

BIOLOGY 9700/13
1 hour
Soft clean eraser
*0862226228*

IB18 06_9700_13/3RP
Dr.Dawood 137
2
1 Which steps are needed to find the actual width of a xylem vessel viewed in transverse section
using a ×10 objective lens?
1 Convert from mm to µm by multiplying by 10–3.
2 Calibrate the eyepiece graticule using a stage micrometer on ×4 objective lens.

3 Measure the width of the xylem vessel using an eyepiece graticule.
4 Multiply the number of eyepiece graticule units by the calibration of the eyepiece
graticule.
A 1, 2, 3 and 4
B 1 and 2 only
C 2, 3 and 4 only
D 3 and 4 only
2 The diagram shows functions of four cell structures, W, X, Y and Z.
W makes
glycolipid
Z transports function X makes

protein protein
Y makes
lipid
Which row correctly matches the cell structure with the letter representing a function?
rough smooth
Golgi body ribosome endoplasmic endoplasmic
reticulum reticulum
A W X Z Y
B X Z Y W
C Y W X Z
D Z Y W X
138 9700/13/M/J/18 Dr.Dawood

3
3 Which cell structures produce ATP?
1 chloroplasts
2 mitochondria
3 nucleus
4 When mucus is secreted from a goblet cell these events take place.
1 addition of carbohydrate to protein

2 fusion of the vesicle with the cell surface membrane
3 secretion of a glycoprotein
4 separation of a vesicle from the Golgi body
What is the sequence in which these events take place?
A 1→4→2→3
B 1→4→3→2
C 4→1→2→3
D 4→1→3→2
5 Which row could be correct for a virus?
carbohydrate DNA phospholipid lipid protein RNA
A
B
C
D
key
= present
= not present
6 Which size range would include most prokaryotic cells?
A B C D
1 nm 100 nm 1 µm 100 µm 1 mm
Dr.Dawood 9700/13/M/J/18 139

4
7 Solutions of three biological molecules are tested for sugars. The table shows the colours of the
solutions after testing.
boiled with hydrochloric acid,

heated with Benedict’s
solution neutralised, then heated with
solution
Benedict’s solution
1 blue orange
2 green green
3 orange red
Which solutions contained glucose before testing?
8 A solution containing equal masses of amylose and amylopectin is completely hydrolysed.
Which molecules will be found after the hydrolysis?
A α-glucose only
B β-glucose only
C equal masses of α-glucose and β-glucose
D more α-glucose than β-glucose
9 Which molecules contain the following bonds?
ester hydrogen disulfide
A amylase haemoglobin catalase

B glycerol glycogen collagen
C lipids amylopectin amylose
D phospholipids cellulose antibodies
10 Which feature of phospholipids enables a bilayer to form?
A They are insoluble in water.

B They are polar molecules.
C They have hydrophobic and hydrophilic components.
D They may contain saturated or unsaturated fatty acids.
140 9700/13/M/J/18 Dr.Dawood

5
11 Which description is correct for collagen?
A A collagen molecule has a high proportion of the amino acid glycine, which has a very small
R group.
B A group of three collagen fibres forms a strong, insoluble coiled structure termed a triple
helix.
C Each of the collagen polypeptides in a collagen molecule has a regular spiral arrangement of
many alpha helices.
D Peptide bonds are present between amino acids of the different polypeptides forming the
collagen molecule.
12 Which statement about the properties of water is correct?
A Bonds between hydrogen atoms cause water to have a high specific heat capacity.
B The high latent heat of vaporisation of water is due to the presence of hydrogen bonds.
C The high specific heat capacity of water causes cooling during evaporation.
D Water can dissolve amylopectin as it has hydrophilic side chains.
13 Catechol is a chemical found in a number of fruits. Catechol can be oxidised to a quinone by the
enzyme catechol oxidase.
Catechol oxidase is inhibited by parahyroxybenzoic acid (PHBA) which is structurally similar to

catechol.
Catechol oxidase is also inhibited by phenylthiourea (PTU) which binds to a copper atom in the
enzyme.
How do both these inhibitors reduce the enzyme activity?
1 altering the specificity of the enzyme
2 competing with substrates for the active site
3 decreasing the Vmax of the reaction
A 1, 2 and 3 B 1 only C 2 only D 3 only
Dr.Dawood 9700/13/M/J/18 141

6
14 Four students investigated the effect of catalase on hydrogen peroxide.
Each student started a digital clock at the beginning of the experiment and stopped the clock after
25 bubbles had been counted.
The time recorded on the digital clock is shown below.
hundredths
hours minutes seconds
of a second
00 01 33 54
Which of the times recorded by the students is appropriate for this experiment?
A 1.34 minutes
B 1 minute 33.54 seconds
C 94 seconds
D 93.54 seconds
15 What is the effect of an enzyme in an enzyme-catalysed reaction?
A decreases the activation energy and decreases the energy yield

B decreases the activation energy and has no effect on the energy yield
C increases the activation energy and increases the energy yield
D increases the energy yield and decreases the activation energy
16 The diagram shows part of the cell surface membrane.
2
4
Which components act as antigens?
142 9700/13/M/J/18 Dr.Dawood

7
17 Which processes use energy in the form of ATP?
1 endocytosis
2 exocytosis
3 facilitated diffusion
18 The diagram shows a partially plasmolysed plant cell.
solution X
Z
solution Y
What is found at Z?
A air
B solution X
C solution Y
D water
19 Which features of an organism are affected by a drug that stops mitosis?
1 cell repair
2 cell replacement
3 number of stem cells
4 tissue repair
5 tumour formation
A 1, 2, 3, 4 and 5
B 1, 2 and 3 only
C 1, 4 and 5 only
D 2, 3, 4 and 5 only
Dr.Dawood 9700/13/M/J/18 143

8
20 Which row shows the appearance of a chromosome at the beginning of prophase of mitosis and
the number of DNA strands in the chromosome?
appearance of number of
one chromosome DNA strands
A 2
B 4
C 1
D 2
144 9700/13/M/J/18 Dr.Dawood

9
21 The graph shows measurements taken during one mitotic cell cycle.
X
2
1
distance
0 5 10 15 20 25
time / minutes
Which stage of mitosis begins at X and which measurements are shown by curves 1 and 2?
distance between
distance between
stage centromeres of
centromeres of
beginning at X chromosomes and
sister chromatids
poles of spindle
A anaphase 1 2
B anaphase 2 1
C metaphase 1 2
D metaphase 2 1
Dr.Dawood 9700/13/M/J/18 145

10
22 The diagram shows the outline structure of two nucleotide bases which occur in DNA.
This pair is held together by two hydrogen bonds, shown as dashed lines.
nucleotide 2
nucleotide 1
Which row correctly identifies these two nucleotide bases?
nucleotide 1 nucleotide 2
A adenine thymine
B cytosine guanine
C guanine cytosine
D thymine adenine
23 DNA polymerase catalyses condensation reactions between molecules during semi-conservative

replication of DNA.
Which two molecules are joined by DNA polymerase?
A base and base

B base and nucleotide
C nucleotide and nucleotide
D phosphate and deoxyribose
24 What occurs during each of DNA replication and transcription and translation?
1 ATP provides energy.

2 Condensation reactions occur to form a polymer.
3 Hydrogen bonds form between purine and pyrimidine bases.
146 9700/13/M/J/18 Dr.Dawood

11
25 Part of a sequence of DNA from a person with a genetic disease is:
TAGTAACCACAAAGG
The corresponding sequence of DNA from a person without this genetic disease is:
TAGTAAAAACCACAAAGG
The possible mRNA codons for some amino acids are shown in the table.
amino acid mRNA codons

1 GGU GGC GGA GGG
2 AUU AUC AUA
3 UUU UUC
4 UCU UCC UCA UCG
Which amino acid is missing from a person with this genetic disease?
A 1 B 2 C 3 D 4
26 The photomicrograph shows a section through a plant organ.
Which statement could be used to describe this organ?
A The central region of this organ has supporting tissue.

B The endodermis tissue is a thick layer around the edge of the organ.
C The epidermis tissue in this organ has unicellular extensions (trichomes).
D The xylem tissue is found in greatest density in the centre of the organ.
Dr.Dawood 9700/13/M/J/18 147

12
27 Which diagram correctly represents part of a sieve tube element?
A B
lignified cell wall dense cytoplasm
empty lumen nucleus
sieve plate sieve plate
C D
tonoplast thin layer of cytoplasm
vacuole cellulose cell wall
sieve plate sieve plate
28 Which of the processes involved in water movement through xylem vessels depends on
hydrogen bonding between water molecules?
A adhesion
B cohesion
C evaporation
D hydrostatic pressure
29 Which statements about water movement in plants are correct?
1 Water can pass through cellulose.

2 Water cannot pass through lignin.
3 Water can pass through suberin.
148 9700/13/M/J/18 Dr.Dawood

13
30 Which blood vessel has the thickest walls?
31 Which statement about the role in the mammalian circulatory system of the heart, blood vessels
and blood is correct?
A The contraction of heart muscle causes blood to enter arteries that pump the blood to
organs, causing the formation of tissue fluid between cells before returning to the heart in
veins.
B The heart connects two sets of blood vessels so that oxygen from the lungs can be
distributed by red blood cells and wastes can be collected from tissues by blood plasma for
removal.
C The heart muscle contracts and relaxes causing blood, carrying materials from one part of
the body to another, to move through blood vessels that connect the different parts of the
body.
D The heart provides enough pressure to push blood through arteries to capillaries between
cells causing filtration of blood and the formation of tissue fluid which diffuses back into
veins.
32 What explains how the maximum uptake of oxygen occurs as blood passes through the
capillaries of the lungs?
A Each haemoglobin molecule can temporarily bind to four oxygen atoms.

B Oxyhaemoglobin formation increases the capacity of red blood cells to transport oxygen.
C The binding of the first oxygen molecule to haemoglobin decreases the molecule’s affinity for
binding other oxygen molecules.
D The dissociation of carbon dioxide from carboxyhaemoglobin allows more haemoglobin to be
available for oxygen binding.
Dr.Dawood 9700/13/M/J/18 149

14
33 At high altitudes, the oxygen content of the air may be a third of that at sea level.
As a person climbs a mountain, their body gradually adjusts to the high altitude.
What is increased during this period of adjustment?
A the concentration of haemoglobin in the red blood cells

B the oxygen-carrying capacity of the haemoglobin
C the number of red blood cells per mm3 of blood
D the rate at which haemoglobin releases oxygen to the tissues
34 What helps to maintain a concentration gradient between blood and the air in the alveolus?
A the flow of blood through the lungs

B the presence of haemoglobin in blood cells
C the single-celled alveolar walls
D the squamous epithelium of capillaries
35 The diagram shows three features found in the tissues of the gas exchange system.
Y
goblet
ciliated
cells
epithelium
X
cartilage
Which structures of the gas exchange system could be represented at position X and at position
Y in the diagram?
1 bronchiole
2 trachea
3 bronchus
X Y
A 1 2 and 3
B 1 and 3 2
C 2 1 and 3
D 2 and 3 1
150 9700/13/M/J/18 Dr.Dawood

15
36 Blood tests on people who regularly smoke cigarettes show that approximately 5% of their
haemoglobin carries carbon monoxide.
People who smoke e-cigarettes inhale a vapour with no carbon monoxide. A person who smokes
cigarettes regularly, switches to e-cigarettes and a blood test is carried out after a month.
Which chemical in the blood would be found in a lower concentration in this blood test?
A carbaminohaemoglobin
B carbonic anhydrase
C carboxyhaemoglobin
D hydrogencarbonate ions
37 Emphysema is a type of chronic obstructive pulmonary disease, COPD. People with emphysema
have a very low level of a plasma protein which inhibits the enzyme elastase.
Elastase breaks down the elastic fibres in the bronchioles and alveoli.
Which are effects of the low levels of inhibitor in people with emphysema?
1 alveoli do not stretch and recoil properly during inhalation and exhalation
2 blood is poorly oxygenated resulting in a rapid breathing rate
3 bronchioles collapse during exhalation trapping air in the alveoli
38 Some antibiotics work by binding to ribosomes.
Which statement explains why these antibiotics kill bacteria cells but do not kill most human
cells?
A mRNA in bacteria is formed in the cytoplasm from naked DNA.

B The antibiotics cannot pass through human cell membranes.
C The codes used for amino acids in bacteria are different from those used by humans.
D The ribosomes of bacteria have a different structure from those of humans.
on the surface on the surface

in blood plasma
of pathogen of macrophage
A key
B = antigens found
D
Dr.Dawood 9700/13/M/J/18 151

16
40 The diagram allows the identification of different types of immunity.
immunity
short term long term

1
acquired by fetus from acquired by injection acquired as a result acquired by injection

the maternal circulation of antibodies into of infection by a of an attenuated
across the placenta the bloodstream pathogen pathogen
2 3
Which row correctly identifies the types of immunity labelled 1, 2 and 3?
1 2 3
A active artificial natural

B active natural artificial
C passive artificial natural
D passive natural artificial
152 9700/13/M/J/18 Dr.Dawood

BIOLOGY 9700/11
Paper 1 Multiple Choice October/November 2018
1 hour
Soft clean eraser
*7610296737*

IB18 11_9700_11/3RP
Dr.Dawood 153
2
1 A student made notes describing photomicrographs of four cells.
cell 1 Grey cytoplasm at edge of cell contains many black lines and spots. Large white
area in centre of cell.
cell 2 Grey cytoplasm contains many black lines and spots which fill the entire cell.
cell 3 Pale blue cytoplasm surrounds a single dark blue spot.
cell 4 Many green structures are enclosed within a rectangular shape with visible
boundaries.
Which table identifies the type of cell and the type of microscope used to take each photograph?
A B
animal cell plant cell animal cell plant cell
electron electron
1 2 1 2
microscope microscope
light light
3 4 4 3
C D
animal cell plant cell animal cell plant cell
electron electron
2 1 2 1
light light
3 4 4 3
154 9700/11/O/N/18 Dr.Dawood

3
2 The diagram shows a slide of a transverse section of a stem. This diagram is the same size as
the actual slide.
A student observed this slide using a light microscope at a magnification of ×40. The student
made a plan drawing of the stem, which was 20 cm in diameter.
The student labelled the plan ‘Transverse section of a stem ×40’.
Which statement explains why this label is not correct?
A The actual size of the stem should have been checked using an eyepiece graticule.
B The actual size of the stem was smaller under low power.
C The image size in the drawing was larger than ×40.
D The image size in the drawing was smaller than ×40.
3 Which cell structures may contain cisternae?
endoplasmic
chloroplast Golgi body mitochondrion
reticulum
A
B
C
D
key
= may contain cisternae
= does not contain cisternae
Dr.Dawood 9700/11/O/N/18 155

4
4 Which row correctly describes the function of the cell structures?
smooth
lysosomes mitochondria endoplasmic Golgi body
reticulum
A digestion of abundant in sites processing a stack of

unwanted of active transport of proteins flattened sacs
structures
B digestion of ATP synthesis lipid production glycoprotein
unwanted production
structures
C spherical sacs abundant in sites lipid production glycoprotein
containing of active transport production
hydrolytic enzymes
D spherical sacs ATP synthesis glycoprotein lipid production
containing production
hydrolytic enzymes
5 The diagram shows the relationship between various cells and their components.
1 2 3 4 5
1 2 3 4 5
A 80S ribosome eukaryotic cell mitochondrion 70S ribosome prokaryotic cell

B chloroplast plant cell cell wall prokaryotic cell 80S ribosome
C circular DNA nucleus eukaryotic cell mitochondrion 70S ribosome
D prokaryotic cell circular DNA chloroplast membrane 70S ribosome
bound
156 9700/11/O/N/18 Dr.Dawood

5
6 Which comparison of bacteria cell walls and plant cell walls is correct?
bacteria cell wall plant cell wall
A made of a polymer of α-glucose made of cellulose

B made of a polymer of β-glucose made of a polymer of amino sugars
C made of a polymer of amino sugars made of a polymer of α-glucose
D made of peptidoglycan made of a polymer of β-glucose
7 A glycosidic bond is broken and two monosaccharides are formed during a positive test for a
non-reducing sugar.
Which row identifies the catalyst and reactants in this process?
catalyst reactants
A hydrochloric acid fructose and glucose

B hydrochloric acid sucrose and water
C sucrase enzyme fructose and glucose
D sucrase enzyme sucrose and water
8 Which pair of statements are correct?
A Carbon and oxygen occur in a ratio of 2 : 1 in carbohydrates.

Triglycerides are soluble in water.
B Glycolipids are found in all cell surface membranes.
Carbohydrates are stored as starch in plants.
C Phospholipids all have two saturated hydrocarbon chains.
Polysaccharides are polymers.
D Water is released during the formation of a glycosidic bond.
Phospholipids all have three ester bonds.
9 What is the general formula for cellulose?
Dr.Dawood 9700/11/O/N/18 157

6
10 A triglyceride consists of glycerol and three different fatty acids, linoleic acid (L), oleic acid (O)
and palmitic acid (P).
The diagram shows one possible arrangement of the fatty acids L, O and P in the molecule.
glycerol O
What is the total number of different arrangements of the fatty acids in this triglyceride?
A 3 B 4 C 5 D 9
11 Which statements about a peptide bond are correct?
1 It joins two monomers which are always identical to each other.

2 It contains four different atoms.
3 It can be broken by the addition of water at room temperature.
4 It is important in the primary structure of proteins.
A 1, 2 and 3 B 1 and 3 only C 2, 3 and 4 D 2 and 4 only
12 Which statements about the primary structure of a protein are correct?
1 It may be branched.
2 It is determined by the sequence of DNA bases.
3 It is unique to that protein.
4 It determines the tertiary structure of the protein.
13 A mutation occurred within the DNA sequence coding for an enzyme, causing a decrease in the
rate of a reaction catalysed by this enzyme.
Which statements could explain the decrease in the rate of reaction?
1 An inhibitor for this enzyme has an increased affinity for the enzyme and forms an
enzyme–inhibitor complex more easily.
2 The active site of the enzyme might have changed shape and so is no longer
complementary.
3 The activation energy for the reaction with the mutated enzyme is greater than with
the non-mutated enzyme.
158 9700/11/O/N/18 Dr.Dawood

7
14 Which row is correct for an enzyme with a low Michaelis-Menten constant?
affinity of enzyme substrate concentration

for substrate at maximum reaction rate
A high high
B high low
C low high
D low low
15 The diagram shows a glycoprotein embedded in the cell surface membrane of a human red blood
cell. This glycoprotein is part of a system of cell surface blood group recognition sites.
key
= carbohydrate
P
cell surface
membrane
Which row identifies the role of this glycoprotein and regions P and Q of the molecule?
role of
region P region Q
glycoprotein
A antigen amino acids with amino acids with hydrophilic

hydrophobic R groups R groups in the cell’s cytoplasm
B carrier amino acids with amino acids with hydrophilic
hydrophilic R groups R groups in the cell’s cytoplasm
C channel amino acids with amino acids with hydrophobic
hydrophilic R groups R groups outside the cell
D receptor amino acids with amino acids with hydrophobic
hydrophobic R groups R groups outside the cell
Dr.Dawood 9700/11/O/N/18 159

8
16 The diagram shows the transport of ions across the cell surface membrane. Inside the cell there
is a low concentration of sodium ions (Na+) and a high concentration of potassium ions (K+).
Outside the cell there is a low concentration of K+ and a high concentration of Na+.
The carrier molecule is a pump which exchanges Na+ for K+.
inside cell
2
1
cell surface
membrane
4
carrier 3
molecule outside cell
Which ionic movements are represented by the arrows?
active transport active transport diffusion diffusion

of K+ of Na+ of Na+ of K+
A 2 3 1 4
B 2 3 4 1
C 3 2 1 4
D 3 2 4 1
17 The indicator cresol red changes from red to yellow when put into an acid.
Some blocks of agar containing cresol red were cut to different sizes and put in an acid. All other
variables were kept constant. The blocks were measured in mm.
Which block became completely yellow most quickly?
A 3 × 30 × 30 B 6×6×6 C 6 × 12 × 12 D 12 × 12 × 12
160 9700/11/O/N/18 Dr.Dawood

9
18 When red blood cells are put into pure water they burst (haemolysis).
Which statements explain this haemolysis?
1 The water potential of the surrounding liquid is lower than the water potential of the
contents of the red blood cell.
2 The cell surface membranes of red blood cells are not supported by cell walls.
3 More water moves into the red blood cells by osmosis than leaves the cells.
4 Water enters the red blood cells by osmosis but does not leave the cells.
19 How many copies of each DNA molecule will be found in a cell at each stage of the mitotic cell
cycle?
G1 of
cytokinesis
interphase
A 1 1
B 1 2
C 2 1
D 2 2
20 Which metabolic processes will be very active in a cell that has just completed cytokinesis?
1 ATP formation
2 DNA replication
3 protein synthesis
21 A mutation occurs in a gene which prevents the production of telomerase.
What is the effect of this mutation if it occurs in bone marrow stem cells?
A a rapid increase in the production of lymphocytes

B a tumour grows in the bone marrow
C bone marrow stem cells eventually no longer divide
D the total blood cell count will be unchanged
Dr.Dawood 9700/11/O/N/18 161

10
22 What are the products when a DNA molecule replicates?
A two molecules of DNA each made of a paired sequence of bases

B two molecules of DNA each made of a paired sequence of nucleotides
C two strands of DNA each made of a paired sequence of bases
D two strands of DNA each made of a paired sequence of nucleotides
23 Following translation, the alpha polypeptide chain of haemoglobin, α-globin, undergoes

modification. During this modification, the first amino acid is removed, leaving 141 amino acid
residues.
How many nucleotides does the gene coding for α-globin contain?
A 141 B 142 C 423 D 426
24 Which statements correctly describe transport pathways in dicotyledonous plants?
1 In the apoplast pathway, water does not move through plasmodesmata.

2 In the symplast pathway, water does not move through intercellular spaces.
3 The apoplast pathway may be blocked by the Casparian strip.
162 9700/11/O/N/18 Dr.Dawood

11
25 The photomicrograph shows a transverse section through a root.
What is the simplest ratio of the diameter of the root (excluding root hairs) to the diameter of the
vascular tissue and endodermis?
A 40 mm : 11 mm
B 40 : 11
C 8 cm : 2.2 cm
D 80 : 22
26 Which properties of water molecules are important in the upward flow of water through xylem?
1 Water molecules are attracted to each other by hydrogen bonding.

2 Water molecules are attracted to cellulose by adhesion.
3 Water molecules have high cohesion in water columns.
27 What is correct for a phloem sieve tube element that is unloading to a sink?
water potential of the

lignification of
phloem sieve tube
the cell wall
element becomes
A less negative than sink absent

B less negative than sink present
C more negative than sink absent
D more negative than sink present
Dr.Dawood 9700/11/O/N/18 163

12
28 Which statement concerning transpiration is correct?
A On a humid day, the water potential gradient between the intercellular air space and the
external atmosphere increases to stimulate water loss by evaporation.
B Water arriving at the spongy mesophyll cells via the symplast pathway must move by
osmosis through the cell surface membrane before evaporation from the surface of the cells.
C Water diffuses down the water potential gradient from the saturated air space through the
guard cells before evaporating from the surface of the cells into the atmosphere.
D Water moves up the xylem in the apoplast pathway and can continue on this pathway by
osmosis to reach the spongy mesophyll cells before evaporating into the intercellular air
space.
29 The diagram shows a section through the heart and the associated blood vessels.
What is correct for the flow of blood through the heart?
A 1→2→3→4
B 2→1→3→4
C 3→4→1→2
D 4→3→2→1
164 9700/11/O/N/18 Dr.Dawood

13
30 Blood, tissue fluid and lymph each have a different composition.
Which row shows the composition of lymph?
water antibodies lipid
A key
B = present
C = absent
D
31 Which row shows the change in concentration of some substances in red blood cells when
carbon dioxide diffuses from active cells?
carbonic hydrogencarbonate hydrogen

anhydrase ions ions
A decreases no change no change

B increases increases increases
C no change decreases increases
D no change increases increases
32 The diagram shows the pressure changes in various structures of the left side of the heart during
the cardiac cycle.
At the end of which period is the ventricle full of blood?
A B C D
pressure key
/ kPa left ventricle
aorta
left atrium
0
0 0.2 0.4 0.6 0.8
time / s
Dr.Dawood 9700/11/O/N/18 165

14
33 The photomicrographs show a cross-section through the lining of part of the respiratory system.
1 Goblet cells are visible between squamous epithelium cells.

2 Smooth muscle is visible.
3 The section cannot be from a bronchiole as cartilage is visible.
34 In the lungs, oxygen and carbon dioxide pass through cell surface membranes by diffusion.
number of cell surface membranes diffused through by

oxygen from air carbon dioxide to air
A 3 2
B 3 2 or 3
C 5 4
D 5 4 or 5
166 9700/11/O/N/18 Dr.Dawood

15
carcinogens
come into mutation uncontrolled
A → →
contact with occurs cell division
DNA
mucus
accumulates
B secrete more → → attracted by
causing
mucus inflammation
infection
mucus phagocytes elastase

C accumulates → attracted by → destroys the
causing infection inflammation alveolar walls
phagocytes causes
D mutation occurs → attracted by → irritation and
inflammation coughing
36 Which list contains only infectious diseases?
A cholera, HIV / AIDS, lung cancer and malaria

B cholera, malaria, tuberculosis (TB) and sickle cell anaemia
C HIV / AIDS, malaria, measles and tuberculosis (TB)
D lung cancer, measles, sickle cell anaemia and tuberculosis (TB)
37 Which disease is caused by a eukaryote?
A cholera
B malaria
C measles
D smallpox
38 A vaccine is available against most common strains of the influenza virus.
The virus that causes influenza often undergoes mutation in the gene coding for its antigenic
protein.
Which statements explain why vaccinated people are not immune to a mutated influenza virus?
1 They will not have primary immune response to the mutated antigen.
2 They will not have a secondary immune response to the mutated antigen.
3 Their memory cells do not recognise the mutated antigen.
Dr.Dawood 9700/11/O/N/18 167

16
39 Which statements correctly describe lymphocytes?
1 Each B-lymphocyte has the ability to make several types of antibody molecules.
2 Some B-lymphocytes and T-lymphocytes become memory cells.
3 Plasma cells secrete antibodies into the blood plasma.
4 Some T-lymphocytes stimulate macrophages to kill infected cells.
A 1, 2, 3 and 4
B 1, 2 and 3 only
C 1 and 4 only
D 2, 3 and 4 only
40 Addison’s disease can occur when antibodies are produced in response to an enzyme found in
some organs of the body.
Which statements correctly describe Addison’s disease?
1 It is a non-infectious disease.
2 It is a type of auto-immune disease.
3 Antibodies are produced against a self-antigen.
168 9700/11/O/N/18 Dr.Dawood

BIOLOGY 9700/12
1 hour
Soft clean eraser
*7687750630*

IB18 11_9700_12/3RP
Dr.Dawood 169
2
1 What is the diameter of a typical prokaryote, such as Streptococcus?
A 7.5 × 101 nm
B 7.5 × 102 nm
C 7.5 × 100 µm
D 7.5 × 101 µm
2 A specimen of plant tissue is first observed under a microscope using red light with a wavelength
of 650 nm.
The same specimen is then observed under the same conditions, but using green light with a
wavelength of 510 nm.
What happens to the magnification and resolution when using green light compared to red light?
magnification resolution
B increases increases
C remains the same decreases
D remains the same increases
3 Which structures are present in a Vibrio cholerae cell?
circular DNA
D B
80S
mitochondria C ribosomes
170 9700/12/O/N/18 Dr.Dawood

3
4 The removal of a plant cell wall by enzyme digestion leaves an intact membrane-bound structure
called a protoplast.
Which statement explains why protoplasts are easily damaged?
A Mitochondria stop producing ATP to maintain membrane integrity.

B Net movement of water is no longer limited by turgor.
C Secretory vesicles are unable to fuse with the cell surface membrane.
D The shape of the cell structures is changed by the loss of cell shape.
5 Which statements are correct for a green plant?
1 ATP is produced by mitochondria.

2 ATP is produced by chloroplasts.
3 ATP forms part of the DNA.
6 Which processes occur in eukaryotes and prokaryotes?
1 hydrolysis
2 mitosis
3 transcription
4 translation
7 A sample of a solution was tested for reducing sugar and the result was negative.
Another sample of the same solution was then tested for non-reducing sugar and the result was
positive.
Which step in the test for non-reducing sugar breaks the glycosidic bonds?
A addition of Benedict’s reagent

B addition of sodium hydroxide
C boiling with hydrochloric acid
D heating to 80 °C
Dr.Dawood 9700/12/O/N/18 171

4
8 Which row correctly identifies three polysaccharides
α-glucose α-glucose β-glucose

straight chain branching chain straight chain
A amylose amylopectin cellulose

B amylose glycogen amylopectin
C glycogen amylose amylopectin
D glycogen amylose cellulose
9 Which row describes a triglyceride?
insoluble in
hydrophobic
alcohol
A key
B = correct
C = not correct
D
10 Which diagram shows where a peptide bond would be formed?
A B
H R O H R O H R O O R H
N C C N C C N C C C C N
H H OH H H OH H H OH H O H H
C D
H R O H R O H R O
H H
N C C N C C N C C N
H H OH H H OH H H OH H C R
C
O OH
172 9700/12/O/N/18 Dr.Dawood

5
11 Which statements about collagen molecules are correct?
1 Both types of secondary structure occur within the molecules.

2 Large numbers of hydrogen bonds stabilise the molecules.
3 Repeated amino acid sequences determine the tertiary structure.
12 The protein glutenin gives bread dough its elasticity. The diagram represents a polypeptide of
glutenin.
tightly tightly
coiled coiled
region region
loose spiral
What describes the structure of glutenin?
A quaternary structure because there are both globular and fibrous regions
B quaternary structure because there are both spiral and tightly coiled regions
C secondary structure because the loose spiral is an α-helix

D tertiary structure because the different regions form a 3D shape
13 Which diagram correctly shows hydrogen bonding between water molecules?
The symbol δ indicates the partial charge on an atom in the water molecule.
A B C D
δ+ δ+ δ– δ–
O H O H
δ– δ– δ– δ– δ+ δ+ δ– δ+
H H O O H H O O
δ+ δ+ δ– δ–
O H O H
δ– δ– δ– δ– δ+ δ+ δ– δ+
H H O O H H O O
Dr.Dawood 9700/12/O/N/18 173

6
14 Aspirin inhibits an enzyme by reacting with an amino acid that forms an essential part of the
3D structure of the enzyme. Part of the aspirin molecule binds firmly with the amino acid.
What describes this inhibition?
1 competitive inhibition
2 non-competitive inhibition
3 reversible inhibition
A 1 and 3 B 1 only C 2 and 3 D 2 only
15 The table shows the Michaelis-Menten constant, Km, for three enzymes.
enzyme Km / mmoldm–3
C 1.5 × 10–2
P 3.0 × 10–4
F 5.0 × 10–6
Which interpretation of the information is correct?
A Enzyme C has a Vmax which is half that of enzyme P.

B Enzyme C will reach Vmax in the shortest time interval.
C Enzyme F has the greatest affinity for its substrate.
D Enzyme P has a Vmax of 6.0 × 10–3 mmoldm–3.
174 9700/12/O/N/18 Dr.Dawood

7
16 The diagram is a drawing from an electron micrograph of a typical animal cell.
How many layers of phospholipids will a molecule of oxygen cross to travel directly from X,
outside the cell, to Y, the matrix of the mitochondrion?
A 3 B 4 C 5 D 6
17 How could water molecules cross the cell surface membrane of animal cells?
1 carrier proteins
2 channel proteins
3 cholesterol molecules
18 The diagram shows a xylem vessel in a root and four adjacent parenchyma cells.
As water moves up the xylem vessel, it is replaced by water from cell D. Water in cell D is
replaced by water in cell C, resulting in a flow of water from cell A to the xylem.
Which cell has the least negative water potential?
xylem
A B C D
Dr.Dawood 9700/12/O/N/18 175

8
19 Agar cubes can be used to demonstrate the effect of changing surface area to volume ratio on
diffusion.
Three different agar cubes made using a dilute acid were placed into an indicator solution that
diffused into the cubes. When the indicator came into contact with the acid it changed colour.
The cubes were 1 cm3, 2 cm3 and 3 cm3 and were left in the indicator solution for 10 minutes. All
other variables were kept the same. The results were recorded as diagrams.
The results for the 2 cm3 cube are shown.
cube changed colour

not to original colour to a depth of 0.5 cm
scale
Which diagrams represent the results for the 1 cm3 and the 3 cm3 cubes?
not to
scale
cube changed colour cube changed colour

A completely to a depth of 0.5 cm
1 cm3
3 cm3

B completely to a depth of 1 cm
1 cm3
3 cm3

C to a depth of 0.25 cm to a depth of 0.5 cm
1 cm3
3 cm3

D to a depth of 0.25 cm to a depth of 1 cm
1 cm3
3 cm3
176 9700/12/O/N/18 Dr.Dawood

9
20 The photomicrograph shows cells in different stages of mitosis.
S R
1 Cell T shows metaphase.

2 DNA replication occurs in cell R.
3 The amount of DNA in cell P is the same as in cell T.
4 The correct order for the stages is S → R → T → P → Q.
21 Which changes in a group of mammalian cells, dividing by mitosis, would be necessary for the
formation of a tumour?
1 Mitosis is no longer inhibited by cell to cell contact.

2 Cells acquire the ability to migrate and set up new colonies.
3 Cells become able to divide indefinitely.
A 1 and 2 B 1 and 3 C 1 only D 2 and 3
Dr.Dawood 9700/12/O/N/18 177

10
22 Which row shows some of the events during a mitotic cycle in the correct time sequence?
time
A centromere of nucleoli become nuclear envelope spindle

each chromosome visible breaks into small microtubules
splits vesicles produced
B nuclear envelope spindle centromere of nucleoli become

breaks into small microtubules each chromosome visible
vesicles produced splits
C nucleoli become nuclear envelope spindle centromere of

visible breaks into small microtubules each chromosome
vesicles produced splits
D spindle centromere of nucleoli become nuclear envelope

microtubules each chromosome visible breaks into small
produced splits vesicles
23 What is the maximum number of hydrogen bonds in a length of DNA containing 700 base pairs?
A 350 B 700 C 1400 D 2100
24 What is the common component of the three molecules RNA, DNA, and ATP?
A adenosine
B hydrogen bonds
C phosphate
D ribose
178 9700/12/O/N/18 Dr.Dawood

11
25 Photomicrographs of a dicotyledonous plant root, stem and leaf are shown.
2
3
4 5
Which row is correct for the labels 1 to 5 on the photomicrographs?
1 2 3 4 5
A cortex phloem epidermis parenchyma endodermis

B phloem parenchyma xylem epidermis cortex
C phloem xylem endodermis cortex epidermis
D xylem phloem endodermis cortex epidermis
26 Which features apply to phloem sieve tube elements and to xylem vessel elements?
1 no cytoplasm
2 no end walls
3 no nucleus
Dr.Dawood 9700/12/O/N/18 179

12
27 Which statement correctly describes an event in the process of mass flow in phloem sieve tube
elements?
A Any part of a plant where sucrose is loaded into a sieve tube element is called a sink.
B Loading sucrose into a sieve tube element increases the water potential inside it.
C Mass flow in the phloem is a passive process occurring at the same rate as diffusion.
D Sucrose moves down a hydrostatic pressure gradient in the phloem from source to sink.
28 The diagram shows a potato tuber at different stages.
1 dormant tuber (not growing)

2 sprouting roots and shoots
3 growing roots and shoots
4 making new potato tubers
1
2
3
4
Which row identifies a stage where a potato tuber acts as a source and a stage where it acts as a
sink?
source sink
A 1 3
B 2 4
C 3 2
D 4 1
180 9700/12/O/N/18 Dr.Dawood

13
29 What describes the role of the atrio-ventricular node of the heart?
A It causes the muscles of the ventricles to contract from the apex upwards.
B It delays the transmission of a wave of electrical activity from the sinoatrial node.
C It initiates a new wave of electrical activity in the ventricles.
D It provides a non-conducting barrier between the atria and the ventricles.
30 The diagram shows pressure changes during the cardiac cycle.
Which arrow indicates ventricular systole?
20
B
D
pressure
10
/ kPa
A
C
0
–1
0 0.2 0.4 0.6 0.8 1.0 1.2 1.4
time / s
31 Which process can be carried out by a mature red blood cell?
A active transport
B cell division
C phagocytosis
D protein synthesis
32 Haemoglobin can bind to carbon dioxide, carbon monoxide and oxygen.
Which statement about the binding sites of haemoglobin is correct?
A Carbon dioxide and carbon monoxide bind to one site, oxygen binds to a different site.
B Carbon dioxide and oxygen bind to one site, carbon monoxide binds to a different site.
C Carbon monoxide and oxygen bind to one site, carbon dioxide binds to a different site.
D Carbon monoxide, oxygen and carbon dioxide all bind to different sites.
Dr.Dawood 9700/12/O/N/18 181

14
33 Which tissues are present in a bronchus?
ciliated smooth
cartilage
epithelium muscle
A key
B = present
C = absent
D
34 Cigarette smoke contains tar.
Which statements describe the effect of tar on the respiratory system?
1 Tar causes goblet cells to increase the secretion of mucus.

2 Tar increases the risk of blood clots forming inside blood vessels.
3 Tar may cause changes to the DNA in epithelial cells.
35 Symptoms of chronic obstructive pulmonary disease (COPD) include a cough, breathlessness

and chest infections.
Some of the changes in the lungs that result from smoking are listed.
1 Alveoli lose elastin and collapse.

2 Bacteria accumulate in the mucus.
3 Cilia are inactivated.
4 Goblet cells secrete more mucus.
Which changes cause the cough in COPD?
A 1, 2, 3 and 4 B 1 and 4 only C 2 and 3 only D 3 and 4 only
36 Which statements about infectious diseases are correct?
1 Cholera has a vaccine available and is caused by a bacterial pathogen of the Vibrio
group.
2 Measles has a vaccine available and is caused by a pathogen called Morbillivirus.
3 Smallpox was eradicated by vaccination and was caused by a bacterial pathogen
called Variola.
182 9700/12/O/N/18 Dr.Dawood

15
37 The antibiotic tetracycline binds to the small subunit of bacterial ribosomes, stopping protein
synthesis.
Bacteria have become resistant to tetracycline due to the effect of mutations.
Which effect could produce resistance to tetracycline?
A preventing tetracycline from binding to the bacterial cell wall

B preventing tetracycline from entering the bacterial cell
C preventing tetracycline from inhibiting transcription
D preventing the production of tetracycline by ribosomes
on the surface
in blood plasma
of macrophages
A key
B = antigens found
D
39 The graph shows how the body reacts following exposure to an antigen for the first and second
time.
first second
concentration
exposure exposure
of antibody
time
What is the direct cause of the increase in antibody production after the second exposure to
antigens?
A B-memory cells
B macrophages
C plasma cells
D T-memory cells
Dr.Dawood 9700/12/O/N/18 183

16
40 Why has it proved difficult to develop an effective vaccine against malaria?
A Mosquitoes have many stages in their life cycles.

B The human immune system does not recognise the antigens of the parasite.
C The parasites can only be attacked when outside the liver cells and red blood cells.
D Vaccines are rapidly broken down by proteases in the stomach.
184 9700/12/O/N/18 Dr.Dawood

BIOLOGY 9700/13
1 hour
Soft clean eraser
*9654955273*

This document consists of 18 printed pages and 2 blank pages.
IB18 11_9700_13/3RP
Dr.Dawood 185
2
1 Which statement explains why it is necessary to use an electron microscope to see the cristae of
a mitochondrion?
A The magnification of the electron microscope is greater than that of the light microscope.
B The membranes of the cristae are separated by a distance greater than 200 nm.
C The resolution of a student microscope using daylight is too low.
D The wavelength of an electron beam is longer than the wavelength of light.
2 A prokaryotic cell which is 0.25 µm in diameter, is magnified 50 000 times on an electron

micrograph.
How big will its diameter be in the electron micrograph?
A 1.25 × 10–1 mm
B 1.25 × 100 mm
C 1.25 × 101 mm
D 1.25 × 102 mm
3 When making measurements in experiments, which methods could have parallax errors?
1 using a calibrated eyepiece graticule to measure length

2 using a measuring cylinder to measure volume
3 using a ruler to measure length of a shoot
186 9700/13/O/N/18 Dr.Dawood

3
What is the function of the membrane system labelled X?
A lipid synthesis only

B protein synthesis and transport
C protein synthesis only
D protein transport only
Where would nucleic acid be found?
Dr.Dawood 9700/13/O/N/18 187

4
6 The diagram shows some similarities between chloroplasts, mitochondria and typical
prokaryotes.
1 2 3 4 5
1 2 3 4 5
A chloroplasts circular DNA mitochondria linear DNA prokaryotes

B mitochondria 70S ribosomes chloroplasts linear DNA prokaryotes
C mitochondria linear DNA chloroplasts 70S ribosomes prokaryotes
D prokaryotes 70S ribosomes mitochondria 70S ribosomes chloroplasts
7 A student carried out tests on the same volume of four different solutions to investigate the
presence of protein, starch and reducing sugar in each.
The results are shown in the table.
solution Benedict’s solution biuret reagent iodine solution
1 blue purple yellow

2 orange pale purple blue-black
3 orange purple yellow
4 red pale blue yellow
Which conclusion can be drawn from these results?
A Solution 1 has a lower protein and lower reducing sugar content than solution 2.
B Solution 2 has less starch compared to solutions 1, 3 and 4.
C Solution 3 has the most protein and the least starch.
D Solution 4 has a high reducing sugar content and no starch.
188 9700/13/O/N/18 Dr.Dawood

5
8 Which words correctly complete the description of amylose?
The ««1«« amylose is a ««2«« made up of ««3«« of the ««4«« glucose.
1 2 3 4
A macromolecule monomer polymers disaccharide

B macromolecule monomer polymers monosaccharide
C polysaccharide polymer monomers disaccharide
D polysaccharide polymer monomers monosaccharide
9 Which statements about glycosidic bonds are correct?
1 They occur by condensation reactions between the OH groups of two molecules.

2 They occur only between glucose molecules.
3 The bonds can only be formed between carbon 1 and carbon 4 or carbon 1 and
carbon 6 of adjacent molecules.
4 Hydrolysis of the bonds releases energy.
A 1, 2 and 3 B 1 and 4 C 2 and 4 D 3 and 4
10 What is the general formula for glycogen?
11 Which statements are correct?
1 In a triglyceride molecule the bonds between the fatty acids and the glycerol
molecule are called ester bonds.
2 Triglycerides are formed by a condensation reaction between the hydroxyl group of
a fatty acid molecule and one of the carboxyl groups of the glycerol molecule.
3 Triglycerides are insoluble in water because the fatty acid carbon chain is non-polar.
Dr.Dawood 9700/13/O/N/18 189

6
12 The table shows the diameter of some atoms when they form bonds.
single bond double bond

atom
/ nm / nm
H 0.060 –
O 0.132 0.110
N 0.140 0.120
C 0.154 0.134
The approximate length of the amino acid shown was estimated using the figures in the table.
R O
H N C C O H
H H
0.7 nm
What would be the approximate length of a dipeptide formed using this amino acid?
A 0.9 nm B 1.2 nm C 1.4 nm D 1.7 nm
13 Which statement about the typical modes of action of a competitive inhibitor and a
non-competitive inhibitor is correct?
A Competitive inhibitors can bind to alternative (allosteric) sites of an enzyme, non-competitive

inhibitors have an irreversible effect on the enzyme.
B Competitive inhibitors have exactly the same shape as the substrate, non-competitive
inhibitors can have any shape.
C Competitive inhibitors may be used to regulate enzyme activity, non-competitive inhibitors
have no functions in enzyme regulation.
D Competitive inhibitors will not alter Vmax, non-competitive inhibitors will reduce Vmax.
190 9700/13/O/N/18 Dr.Dawood

7
14 Some animals produce antimicrobial proteins which protect them from pathogens. These proteins
could be used to kill human pathogens, however when used as a medicine they are broken down
by protein-digesting enzymes.
Replacing one of the amino acids found in the protein with one that had been synthesised in the
laboratory resulted in a modified protein that was not broken down.
What could explain why this modified protein was not broken down by the protein digesting
enzymes?
1 The modified protein has a different tertiary structure to the original protein.
2 The modified protein is not complementary in shape to the enzyme’s active site.
3 The modified protein is unable to induce a fit with the protein digesting enzyme.
15 An investigation was carried out on the effect of temperature on an enzyme-catalysed reaction.
The enzyme and its substrate were initially placed into separate test-tubes and raised to the
temperature required. They were then mixed and placed into four tubes A, B, C and D.
These tubes were incubated for the time and at the temperature stated. The mass of the product
formed was then measured.
In which tube was the rate of reaction highest?
incubation incubation mass of

time / s temperature / °C product / µg
A 30 25 2.5
B 30 45 5.0
C 600 25 32.0
D 600 45 10.0
Dr.Dawood 9700/13/O/N/18 191

8
16 In an experiment the proteins in the cell surface membrane of a living cell were labelled with a
fluorescent dye.
A small area of the membrane was observed using a microscope. A laser was then used to
permanently destroy the fluorescence of the dye molecules in this field of view.
The fluorescence in this field of view was later seen to return.
What does this experiment show?
A Proteins are found only on the outer surface of cell surface membranes.
B Proteins in the outer layer of a bilayer do not penetrate into the inner layer.
C Proteins move freely in the phospholipids of a bilayer.
D The cell surface membrane of the cell is a bilayer.
17 In plants adapted to cold conditions, their cell surface membranes change as the weather gets
colder, allowing the plants to carry out exocytosis.
Which change occurs in their cell surface membranes?
A a decrease in the ratio of proteins to saturated phospholipids

B a decrease in the ratio of unsaturated phospholipids to saturated phospholipids
C an increase in the ratio of proteins to unsaturated phospholipids
D an increase in the ratio of unsaturated phospholipids to saturated phospholipids
18 Which statement describes endocytosis?
A movement across a membrane against the concentration gradient and requiring energy
B movement across a membrane down the concentration gradient using a carrier molecule
C movement across a membrane into a cell using a vesicle and requiring energy
D movement across a membrane using a vesicle and requiring no energy
192 9700/13/O/N/18 Dr.Dawood

9
19 An indicator is colourless in acid and pink in alkali.
In an experiment a petri dish of agar was prepared using an acidic solution of this indicator.
A disc of agar 1 cm in diameter was removed from the centre to create a well.
A white card showing circular marker lines 1 cm apart was placed underneath the petri dish.
1 cm3 alkali solution was put into the well in the agar and a stop-watch was started.
A circular disc of pink colour appeared and spread through the agar. It reached the first marker
line in a short time but took longer to reach the second marker line and a very long time to reach
the third marker line.
What explains these observations?
A facilitated diffusion of alkali solution

B facilitated diffusion of the indicator
C simple diffusion of alkali solution
D simple diffusion of the indicator
20 How many copies of each DNA molecule will be found in a cell at each stage of the mitotic cell
cycle?
G2 of
metaphase cytokinesis
interphase
A 1 1 1
B 1 2 2
C 2 1 1
D 2 2 2
Dr.Dawood 9700/13/O/N/18 193

10
21 Centromere, chromatids and telomeres are parts of a chromosome in a eukaryotic cell.
Which row correctly describes these structures?
centromere chromatid telomere

A binds the two sister contains histone proteins protects the tips of each
chromatids of a and a molecule of chromatid from shortening at
chromosome together double-stranded DNA each mitotic division
B site of attachment of contains histone proteins prevents the genes nearest

spindle microtubules and a molecule of the ends of each chromatid
single-stranded DNA from being lost
C site of production of contains a molecule of contains DNA with many

spindle microtubules double-stranded DNA with no repeats of short base
associated histone proteins sequences
D splits at metaphase contains a molecule of ensures that when DNA is

of mitosis single-stranded DNA with no replicated, the ends of the
associated histone proteins molecule are included
22 Which bases found in nucleic acids are purines?
A adenine and cytosine

B guanine and adenine
C thymine and cytosine
D uracil and guanine
23 A length of double-stranded DNA contains 120 nucleotides and codes for a section of a
polypeptide.
What is the maximum length of this section of a polypeptide?
A 20 amino acids
B 40 amino acids
C 60 amino acids
D 120 amino acids
194 9700/13/O/N/18 Dr.Dawood

11
24 Four students were asked to suggest a set of four labels to add to a plan diagram of a transverse
section of a dicotyledonous leaf.
Which student suggested a correct set of labels?
label 1 label 2 label 3 label 4

A lower phloem spongy palisade
epidermis mesophyll mesophyll
B phloem sieve upper spongy xylem vessel
tubes epidermis mesophyll elements
C spongy endodermis xylem vessel palisade
mesophyll elements mesophyll
D waxy cuticle xylem companion spongy
cells mesophyll
25 Photomicrograph X shows a transverse section through a typical stem. Photomicrograph Y

shows a longitudinal section through one type of cell shown in photomicrograph X.
Which letter represents the cells from photomicrograph Y?
photomicrograph X photomicrograph Y
Dr.Dawood 9700/13/O/N/18 195

12
26 By which process would water rise up through xylem vessels in a plant root when the shoot has
been removed?
A capillarity, root pressure and transpiration pull

B capillarity and root pressure only
C capillarity and transpiration pull only
D root pressure only
27 Which changes occur to the water potential and the volume of liquid in the phloem sieve tube
element when carbohydrate is moved into a sink?
water potential volume of liquid

of the sieve of the sieve
tube element tube element
A lowers decreases
B lowers increases
C raises decreases
D raises increases
28 The graph shows the diameter of a tree trunk over time.
diameter of
tree trunk
12:00 00:00 12:00 00:00 12:00

time of day
Which statement explains these changes?
A Cohesive tension forces increased during the day.

B Columns of water break up during the day.
C Mass flow of sucrose decreased during the day.
D Root pressure increased during the day.
196 9700/13/O/N/18 Dr.Dawood

13
29 What is found in all blood vessels, lymph and tissue fluid?
1 carbon dioxide
2 glucose
3 white blood cells
4 antibodies
A 1, 2, 3 and 4
B 1, 2 and 3 only
C 1, 3 and 4 only
D 2 and 4 only
30 Which reactions will be taking place in blood that is passing through active tissues?
1 HbO8 → Hb + 4O2
2 HbO8 + H+ → HHb + 4O2
3 HCO3– + H+ → H2CO3
4 H2O + CO2 → H2CO3
A 1, 2, 3 and 4
B 1, 2 and 4 only
C 1, 3 and 4 only
D 2 and 3 only
Dr.Dawood 9700/13/O/N/18 197

14
31 The graph shows the percentage saturation of haemoglobin with oxygen at a range of partial
pressures of oxygen and at two partial pressures of carbon dioxide.
One curve is at the partial pressure of carbon dioxide in the lungs and the other curve at the
partial pressure of carbon dioxide in the liver.
100 L
M
percentage
saturation of
haemoglobin
with oxygen
J
K
0
0 partial pressure
of oxygen / kPa
Which points on the curves correspond to the percentage saturation of haemoglobin at the lungs
and at the liver?
A L and J B L and K C M and J D M and K
32 A person moves from sea level to live at a high altitude.
After three months living at high altitude, which change would be found in this person when at
rest?
A increased volume of blood per heartbeat

B increased breathing rate
C increased heart rate
D increased mass of red blood cells
198 9700/13/O/N/18 Dr.Dawood

15
33 The diagram shows three of the features found in tissues of the gas exchange system.
ciliated goblet
epithelium cells
cartilage
Which structures of the gas exchange system could be represented at position X in the diagram?
1 bronchiole
2 trachea
3 bronchus
34 Chronic obstructive pulmonary disease (COPD) includes bronchitis and emphysema.
Which row shows the effects of bronchitis?
T-helper cells bronchioles infection
A destroyed inflamed absent

B destroyed narrowed present
C increased scarred present
D increased stiffened absent
35 Which factors affect the distribution of the disease malaria?
1 draining swamps
2 vaccination
3 antibiotics
4 migration of people due to conflict
5 climate
Dr.Dawood 9700/13/O/N/18 199

16
36 Which diseases cannot be treated with antibiotics?
1 cholera
2 HIV/AIDS
3 measles
37 A West African country introduced a measles vaccination during a measles epidemic.
Later, it was realised that vaccinated children were more likely to survive childhood than
unvaccinated children, even when there were no measles epidemics.
The vaccine had given the children some protection against other pathogenic infections.
Which statement could account for this extra protection?
A B-lymphocytes produced memory cells which gave the children passive immunity to these
infections.
B Memory cells produced plasma cells which secreted anti-measles antibodies that bound to
antigens that closely resembled measles antigens.
C Memory cells produced plasma cells which secreted anti-measles antibodies that bound to
any antigen.
D T-lymphocytes produced memory cells which gave the children natural immunity against
these other infections.
200 9700/13/O/N/18 Dr.Dawood

17
38 Which graph shows the changes in antibody concentration following a second exposure to the
same infection?
1000
antibody 100
A concentration
1
0 10 20 30 40 50 60 70 80
time / days
first exposure second exposure
1000
antibody 100
B concentration
1
0 10 20 30 40 50 60 70 80
time / days
1000
antibody 100
C concentration
1
0 10 20 30 40 50 60 70 80
time / days
1000
antibody 100
D concentration
1
0 10 20 30 40 50 60 70 80
time / days
Dr.Dawood 9700/13/O/N/18 201

18
on surface in blood
of pathogen plasma
A key
B = antigens found
D
40 Whooping cough is a highly infectious disease of the gas exchange system, caused by the
bacterium Bordetella pertussis.
Which method provides protection to infants against whooping cough and reduces the chance of
developing this disease later in life?
A a short course of more than one type of antibiotic

B a six month course of one type of antibiotic
C injections of antibody specific to Bordetella pertussis
D injections of dead Bordetella pertussis bacteria
202 9700/13/O/N/18 Dr.Dawood

Cambridge Assessment International Education
BIOLOGY 9700/11
1 hour
Soft clean eraser
*7713874507*

Write your name, centre number and candidate number on the Answer Sheet in the spaces provided unless
IB19 06_9700_11/4RP
Dr.Dawood 203
2
1 A student was told that the actual length of a cell structure is 5 µm.
The student was asked to state an equation that can be used to calculate the magnification of an
electron micrograph of this cell structure. The student used some of the letters q to u in the
equation.
q = the length of the cell structure image on the micrograph in centimetres

r = the length of the cell structure image on the micrograph in millimetres
s = 1000
1
t= 5
u= 5
Which is the correct equation to calculate the magnification?

q r ×u
A ×u B q×s×t C D r×s×t
s s
2 Which features of cilia and root hairs are correct?
cannot be
more than one
increase cell resolved with contain
present on a
surface area the light vacuoles
cell
microscope
A cilia cilia root hairs root hairs

B cilia root hairs cilia cilia
C root hairs cilia root hairs cilia
D root hairs root hairs cilia root hairs
3 Which are functions of microtubules?
1 allowing movement of cilia in a bronchus

2 attachment of centromeres during metaphase
3 moving secretory vesicles around a cell
204 9700/11/M/J/19 Dr.Dawood

3
4 Some cell structures are listed.
1 mitochondria
2 nucleus
3 chloroplasts
4 ribosomes
What is the correct order of these cell structures when listed from largest to smallest?
A 1, 2, 3, 4 B 2, 3, 1, 4 C 2, 4, 1, 3 D 3, 4, 2, 1
5 Which cell structures have ribosomal RNA (rRNA)?
1 chloroplast
2 mitochondrion
3 nucleus
4 rough endoplasmic reticulum
A 1, 2, 3 and 4
B 1, 2 and 3 only
C 1, 2 and 4 only
D 2, 3 and 4 only
6 A cell structure in the macrophage destroys bacteria. Some bacteria stop this cell structure from
functioning.
Which cell structure in the macrophage is stopped from functioning by the bacteria?
A Golgi body
B lysosome
C ribosome
D vesicle
Dr.Dawood 9700/11/M/J/19 205

4
7 A solution of amylase was added to a suspension of starch. After 30 seconds, three samples of
the mixture were tested with iodine solution, Benedict’s solution or with biuret reagent.
Which are the expected results?
colour with test reagent

iodine solution Benedict’s solution biuret reagent
A black green purple

B black red blue
C brown blue purple
D brown yellow blue
8 A student carried out a Benedict’s test on several different known concentrations of α-glucose.
Which graph represents the results correctly?
A B
time to first concentration

colour change of α-glucose
0 0
0 concentration 0 time to first
of α-glucose colour change
C D
concentration time to first

of α-glucose colour change
0 0
0 time to first 0 concentration
colour change of α-glucose
206 9700/11/M/J/19 Dr.Dawood

5
9 The diagram shows three hexose sugars.
CH2OH CH2OH
CH2OH
O
C O C O
H H H OH OH
H H
C C C C C C
OH H OH H H OH
HO OH HO H H CH2OH
C C C C C C
H OH H OH OH H
1 2 3
Which row correctly shows examples of carbohydrates in which these three hexose sugars
occur?
sucrose cellulose starch
A 1 2 3
B 1 3 2
C 2 3 1
D 3 2 1
10 What can occur during condensation of carbohydrates?
A a disaccharide is produced from monosaccharides

B glycosidic bonds are broken
C molecules of water are used up
D monosaccharides are produced
11 What is true about triglycerides?
hydrophobic insoluble in alcohol
A key
B = correct
C = not correct
D
12 What is the minimum number of carbon atoms in an amino acid?
A 1 B 2 C 3 D 4
Dr.Dawood 9700/11/M/J/19 207

6
13 In an investigation, the same concentration of the enzyme phosphorylase was added to different
concentrations of glucose phosphate and incubated at 30 °C. At 1 minute intervals, one drop of
the reaction mixture was removed and added to a drop of iodine solution on a white tile.
The diagram shows the results of this investigation.
concentration of glucose
phosphate / mg dm–3
0 5 10 15 20 25 30 35
colour of
0 iodine solution
1
2 brown
3 black
time / minutes
4
5
6
7
8
9
What explains the trend in the results of this investigation?
A Phosphorylase catalyses a reaction converting glucose phosphate to starch.

B The maximum rate of reaction is reached at 20 mg dm–3 of glucose phosphate.
C Substrate concentration is limiting at concentrations of glucose phosphate 25 mg dm–3 or
less.
D Enzyme concentration is limiting at concentrations of glucose phosphate 25 mg dm–3 or less.
14 What is the definition of the Michaelis-Menten constant, Km, for an enzyme?
A Vmax
B half Vmax
C the substrate concentration that gives Vmax
D the substrate concentration that gives half Vmax
208 9700/11/M/J/19 Dr.Dawood

7
15 The graph shows how the rate of entry of glucose into a cell changes as the concentration of
glucose outside the cell changes.
rate of entry
of glucose
into the cell
concentration of glucose
outside the cell
What is the cause of the plateau at X?
A All the carrier proteins are saturated with glucose.

B The carrier proteins are denatured and no longer able to function.
C The cell has used up its supply of ATP.
D The concentrations of glucose inside and outside the cell are equal.
16 The diagram shows the movement of substance Z across a cell surface membrane.
Z outside cell
membrane Z
Z inside cell
time
Which process is involved in this movement?
A endocytosis
B exocytosis
C phagocytosis
D pinocytosis
Dr.Dawood 9700/11/M/J/19 209

8
17 Visking tubing is often used as a model during experiments to investigate osmosis in plants.
What could Visking tubing be used to represent?
cell surface
cell wall tonoplast
membrane
A key
B = represents
C = does not represent
D
18 A scientist stains the chromosomes of a diploid plant cell with a fluorescent dye to observe the
telomeres.
This cell has 38 chromosomes.
How many telomeres will the scientist observe in one of the nuclei during telophase of mitosis?
A 38 B 76 C 114 D 152
19 The photomicrograph shows a cell during mitosis.
What is happening in this cell?
1 Centrioles are replicating.

2 Spindle microtubules are shortening.
3 Chromatin is condensing.
210 9700/11/M/J/19 Dr.Dawood

9
20 Which events listed are part of mitosis?
1 interphase
2 prophase
3 cytokinesis
A 1, 2 and 3
B 1 and 2 only
C 1 only
D 2 only
21 The graph shows the length of the spindle fibres during mitosis.
Which region of the graph shows when all the centromeres have detached from the spindle
fibres?
B
C
length of
spindle
fibres A
D
time
22 A short piece of DNA, 19 base pairs long, was analysed to find the number of nucleotide bases in
each of the polynucleotide strands. Some of the results are shown below.
number of nucleotide bases
A C G T
strand 1 4
strand 2 7 5
How many nucleotide bases containing C were present in strand 1?
A 2 B 3 C 5 D 7
Dr.Dawood 9700/11/M/J/19 211

10
23 Which nucleic acid bases are purines?
A adenine and cytosine

B cytosine and thymine
C guanine and adenine
D uracil and cytosine
24 In a genetic engineering experiment a piece of double-stranded DNA containing 6000 nucleotides

coding for a specific polypeptide is transcribed and translated.
What is the total number of amino acids in this polypeptide?
A 500 B 1000 C 2000 D 3000
25 Which statements about tRNA are correct?
1 Hydrogen bonds between bases temporarily hold tRNA against mRNA.

2 The base sequences in the tRNA molecules are the same as the base sequences in
the mRNA that is being translated.
3 tRNA translates the base sequence in mRNA into the amino acid sequence in a
protein.
212 9700/11/M/J/19 Dr.Dawood

11
26 The photomicrograph shows a transverse section of part of a dicotyledonous leaf.
What are the correct labels for 1, 2, 3 and 4?
1 2 3 4
A phloem xylem palisade mesophyll spongy mesophyll

B phloem xylem spongy mesophyll palisade mesophyll
C xylem phloem palisade mesophyll spongy mesophyll
D xylem phloem spongy mesophyll palisade mesophyll
27 Some of the features present in transport tissues in plants are listed.
1 lignified walls
2 cytoplasm
3 mitochondria
4 pits
5 plasmodesmata
Which of these features are present in phloem sieve tube elements?
Dr.Dawood 9700/11/M/J/19 213

12
28 The diagram shows the relationship between phloem sieve tube elements, xylem vessel
elements and companion cells.
1 3 5
2 4
1 2 3 4 5
A companion endoplasmic phloem sieve no xylem vessel
cells reticulum tube elements nucleus elements
B companion nucleus phloem sieve cytoplasm xylem vessel
cells tube elements elements
C phloem sieve mitochondria companion nucleus xylem vessel
tube elements cells elements
D xylem vessel no phloem sieve vacuole companion
elements cytoplasm tube elements cells
29 Which statement correctly describes a transport pathway in plants?
A In the apoplast pathway, water may move through plasmodesmata.

B In the symplast pathway, water may move through intercellular spaces.
C The apoplast pathway may be blocked by the Casparian strip.
D The symplast pathway may be blocked by the tonoplast.
214 9700/11/M/J/19 Dr.Dawood

13
30 The photograph shows an external view of the front of a mammalian heart.
S
P
Which row identifies the position of the structures labelled P, Q, R and S?
P Q R S
A left atrium cardiac muscle Purkyne tissue pulmonary vein

B left atrium left ventricle coronary artery vena cava
C right atrium cardiac muscle Purkyne tissue aorta
D right atrium right ventricle coronary artery pulmonary artery
31 What happens during ventricular systole?
1 The atrioventricular node transmits an electrical signal to the apex of the heart.
2 The pressure in the ventricles drops below the pressure in the atria.
3 The atrioventricular valves close and the semilunar valves open.
Dr.Dawood 9700/11/M/J/19 215

14
32 Athletes often move from low altitude to high altitude to train for a race.
Which statements about the effect of training at high altitude are correct?
1 Higher concentrations of carbon dioxide stimulate greater oxygen dissociation.

2 Lower concentrations of oxygen stimulate the uptake of more oxygen by red blood
cells.
3 Lower partial pressures of oxygen stimulate higher production of red blood cells.
33 The graph shows the oxygen haemoglobin dissociation curves at pH 7.6 and at pH 7.2.
Which point on the graph shows the percentage saturation of haemoglobin in the blood leaving
an active muscle?
pH 7.6
C
pH 7.2
A D
percentage B
saturation of
haemoglobin
partial pressure of oxygen
34 Which row correctly describes the short-term effects of carbon monoxide and nicotine on the
body of a smoker?
demand for oxygen concentration of oxygen in blood
A decreased by carbon monoxide increased by nicotine

B decreased by nicotine increased by carbon monoxide
C increased by carbon monoxide decreased by nicotine
D increased by nicotine decreased by carbon monoxide
216 9700/11/M/J/19 Dr.Dawood

15
35 Which statements about bronchioles are correct?
1 They have ciliated cells.

2 They have goblet cells.
3 They have muscle tissue.
36 Which features are important for the diffusion of oxygen out of an alveolus?
1
blood pressure
forces red blood cells
through capillaries
2
4
epithelium is
surfactant present to features permeable to
reduce surface tension
respiratory gases
3
moist squamous
epithelium present
37 The diagram shows some of the pathogens that cause disease in humans and some of the ways
they are transmitted.
1 2 W
bacterium protoctist contaminated water
pathogen method of
transmission
3 Y X
Morbillivirus contaminated coughs and
food sneezes
What is the correct pathogen and method of transmission for measles?
A 1 and X B 2 and W C 3 and W D 3 and X
Dr.Dawood 9700/11/M/J/19 217

16
38 Which row is correct for each disease?
cholera HIV / AIDS malaria measles
A caused by a can be transmitted eradication caused by

bacterium in breast milk programme a virus
and across placenta unsuccessful
B eating raw may be carried carried by male can cause

shellfish can be by a vector Anopheles blindness
a source of infection mosquitoes
C air borne caused by causative agent is a symptoms usually

infection a retrovirus eukaryote include a rash
D can be caught by causes reduction mainly kills children no effective

swimming in in number of under five years vaccination available
contaminated water T-lymphocytes
39 Which statements describe myasthenia gravis?
1 Antibodies attack proteins within the body.

2 T-lymphocytes are involved in an inflammatory response.
3 The immune system blocks receptors at the neuromuscular junction.
4 The immune system attacks the central nervous system.
40 Which row shows the cells that are able to divide continuously and are involved in monoclonal
antibody production?
mouse
hybridoma
cancer cells B-lymphocyte
cells
plasma cells
A key
B = correct
C = not correct
D
218 9700/11/M/J/19 Dr.Dawood

BIOLOGY 9700/12
1 hour
Soft clean eraser
*9874289435*

IB19 06_9700_12/4RP
Dr.Dawood 219
2
1 The actual length of a cell structure is 8 µm.
Which steps are used to calculate the magnification of an electron micrograph of this cell
structure?
step 1 measure the length of the cell structure image on the micrograph in centimetres
step 2 measure the length of the cell structure image on the micrograph in millimetres
step 3 divide the image length by 1000
step 4 multiply the image length by 1000
step 5 divide by 8
step 6 multiply by 8
A steps 1, 3 and 6
B steps 1, 4 and 6
C steps 2, 3 and 5
D steps 2, 4 and 5
2 What is the typical resolution of a microscope using daylight as a light source with a ×10 eyepiece
lens and a ×40 objective lens?
A 0.20 nm B 200 nm C 100 µm D 400 µm
3 Two different types of cell, P and Q, were broken up using ultrasound and their contents
analysed. Both types of cell contained small circular DNA. The circular DNA from P all carried the
same base sequence, but those from Q were of two types, with different base sequences.
What may be concluded about the identity of cell types P and Q?
P Q
A heart muscle fibres root cortical cells

B lymphocytes mature red blood cells contaminated by bacteria
C mature red blood cells phloem sieve tube element
D root cortical cells leaf mesophyll cells
220 9700/12/M/J/19 Dr.Dawood

3
4 Which features shown in the diagram can be present in viruses?
4 1
RNA DNA
feature
3 2
70S protein coat
ribosomes
5 After boiling a sample of milk with Benedict’s solution, a yellow colour is observed.
Which conclusion about the sample of milk is correct?
A Reducing sugars are not present.

B Reducing sugars are present.
C There is a high concentration of fructose.
D There is a low concentration of sucrose.
6 Which of the statements about polysaccharides can be used to describe amylose and cellulose?
1 contains 1,4 glycosidic bonds
2 contains 1,6 glycosidic bonds
3 polymer of glucose
A 1 and 2
B 1 and 3
C 1 only
D 2 and 3
Dr.Dawood 9700/12/M/J/19 221

4
7 Which diagram shows the formation of a peptide bond?
A B
H H O H H O H H O O H H
H H OH H H OH H H OH HO H H
H2 O H 2O
C D
H H O H H O H H O O H H
H H OH H H OH H H OH HO H H
H 2O
H 2O
8 In enzyme-catalysed reactions, the position of the amino acids found at the active site is
important.
During the synthesis of enzymes, amino acids are brought together in the correct position to form
the active site.
Which levels of protein structure must be involved in forming the active site?
level of protein structure

primary secondary tertiary quaternary
A key
B = involved
C = not involved
D
222 9700/12/M/J/19 Dr.Dawood

5
9 Which features affect the tensile strength of collagen?
1 the helical structure of collagen chains

2 the small R group of the amino acids in collagen
3 the insoluble nature of collagen
4 the bonds between collagen molecules
A 1, 2, 3 and 4
B 1, 2 and 4 only
C 1 and 3 only
D 2, 3 and 4 only
10 A fixed volume of the enzyme catalase was added to a fixed volume of hydrogen peroxide
solution. The diagram shows how the concentration of product changed over the course of the
reaction.
concentration
of product
0
0 time
What explains the shape of this graph?
A The active sites become saturated.

B The enzyme was denatured.
C The hydrogen peroxide inhibited the reaction.
D The substrate molecules were used up.
Dr.Dawood 9700/12/M/J/19 223

6
11 A fixed volume and concentration of substrate and enzyme were mixed. All other variables were
kept constant. The enzyme-catalysed reaction was left until it was complete.
Which graph shows how the rate of reaction changes with time?
A B
rate of rate of
reaction reaction
0 0
0 time 0 time
C D
rate of rate of
reaction reaction
0 0
0 time 0 time
224 9700/12/M/J/19 Dr.Dawood

7
12 The fatty acids elaidic acid and oleic acid have exactly the same structural formulae, with one
double bond in the chain. However, the shapes of the chains are different, as shown in the
diagram.
elaidic acid oleic acid
COOH COOH
Which row shows the effect of the presence of these fatty acids on the structure and behaviour of
a cell surface membrane?
elaidic acid oleic acid
A does not fit closely with other fits closely with other fatty
fatty acids so that the membrane acids so that the membrane is
is less fluid at high temperatures less fluid at low temperatures
B does not fit closely with other fits closely with other fatty
fatty acids so that the membrane acids so that the membrane is
is more fluid at low temperatures less fluid at low temperatures
C fits closely with other fatty does not fit closely with other
acids so that the membrane is fatty acids so that the membrane
less fluid at high temperatures is more fluid at low temperatures
D fits closely with other fatty does not fit closely with other
acids so that the membrane is fatty acids so that the membrane
more fluid at low temperatures is more fluid at high temperatures
Dr.Dawood 9700/12/M/J/19 225

8
13 The diagram shows a cell surface membrane.
X
Y
Which is a correct role for a labelled molecule?
A W is involved in controlling membrane stability.

B X is involved in active transport.
C Y is involved in cell signalling.
D Z is involved in diffusion of ions.
14 The diagram shows a simple cell signalling pathway in which a signal molecule leads to a
response, such as a secretion.
signal
→ P → Q → response
molecule
Which row identifies P and Q?
P Q
A activated enzyme in cytoplasm target in cell surface membrane

B lipid in cell surface membrane extracellular enzyme
C protein in cell surface membrane activated enzyme in cytoplasm
D target in cytoplasm protein in cell surface membrane
226 9700/12/M/J/19 Dr.Dawood

9
15 Three parts of a chromosome and their functions are listed.
part function
P1 centromere F1 holds the coils of DNA together

P2 histone proteins F2 holds two chromatids together
P3 telomere F3 prevents loss of genes
Which part is matched with its correct function?
A P1 and F1 B P2 and F1 C P2 and F3 D P3 and F2
16 The enzyme telomerase prevents loss of telomeres after many mitotic cell cycles.
Which cells need to transcribe telomerase enzyme?
1 cancer cells
2 stem cells
3 activated memory B-lymphocytes
17 The diagram shows some of the stages which take place during the cell cycle.
1
number of DNA
molecules in
cell doubles
4 stages
2
nuclear envelope during cell
cell grows
disappears cycle
3
chromosomes
become visible
Which two stages take place during interphase?
Dr.Dawood 9700/12/M/J/19 227

10
18 Which statement correctly describes the base pairing in a molecule of DNA?
A The purine adenine forms bonds with the pyrimidine thymine.

B The purine adenine forms bonds with the pyrimidine uracil.
C The purine cytosine forms bonds with the pyrimidine guanine.
D The purine guanine forms bonds with the pyrimidine thymine.
19 Which statements about complementary base pairing are correct?
1 It allows translation to occur.

2 Purines and pyrimidines are the same size.
3 The base pairs are of equal length.
4 Uracil forms two hydrogen bonds with adenine.
A 1, 2, 3 and 4
B 1, 3 and 4 only
C 1 and 4 only
D 2 and 3 only
20 The diagram shows the possible organisation of DNA molecules after one replication.
Which organisation is correct?
one strand
of DNA
A B C D
228 9700/12/M/J/19 Dr.Dawood

11
21 The diagram shows part of the DNA sequence of a gene and a mutated sequence of the same
gene.
normal DNA sequence ... CCG GAT TAT TGC GAG AAA TGG CAT TCT AGG ...
mutated DNA sequence ... CCG GAT GTA TTG CGA GAA ATG CAT TCT AGG ...
What are possible effects of the mutated sequence?
1 the presence of mRNA stop codons, UAG, UAA or UGA

2 a change in the sequence of amino acids
3 a non-functional protein
4 ribosomes cannot translate the mRNA
22 What is correct for phloem sieve tube elements?
A Companion cells provide structural support to the phloem sieve tube elements.
B Lignified walls of phloem sieve tube elements prevent transport of mineral salts by mass
flow.
C Phloem sieve tube elements become narrower as movement of sucrose occurs.
D Plasmodesmata allow movement of water and solutes across cell walls of phloem sieve tube
elements.
23 The diagrams show transverse sections of parts of a plant.
Transport tissues are labelled 1 to 6.
leaf stem root

3
1
4 5
Which combination shows the tissues that have a main function of transporting water?
1 2 3 4 5 6
A key
B = transporting water is a main function
C = transporting water is not a main function
D
Dr.Dawood 9700/12/M/J/19 229

12
24 The statements are descriptions of how water moves across the root to the xylem vessel
elements.
1 Water enters cell walls.

2 Water enters cytoplasm by osmosis.
3 Water moves from cell to cell through plasmodesmata.
4 Water moves through cell walls.
Which statements describe the apoplast pathway?
A 1, 2, 3 and 4
B 1, 2 and 3 only
C 1 and 4 only
D 4 only
25 Four plants, A, B, C and D, were grown in the same conditions and their transpiration rates
measured.
Which plant is most likely to be a xerophyte?
transpiration A
rate / mg cm–2 B
C
00:00 12:00 24:00
time of day / hours
26 Sucrose moves from a mesophyll cell in a leaf into a phloem sieve tube element.
Which changes to the water potential and the volume of liquid in the phloem sieve tube element
are correct?
water potential
volume of liquid
becomes
A less negative decreases

B less negative increases
C more negative decreases
D more negative increases
230 9700/12/M/J/19 Dr.Dawood

13
27 The diagram shows a cross-section through a mammalian heart.
Which chambers of the heart are represented by W and X?
W X
A left ventricle right ventricle

B right atrium left atrium
C right atrium right ventricle
D right ventricle left ventricle
28 At a certain point in a cardiac cycle, the pressure in the right ventricle is lower than that in the
right atrium and lower than that in the pulmonary artery.
atrioventricular
semilunar valve
valve
A closed closed
B closed open
C open closed
D open open
Dr.Dawood 9700/12/M/J/19 231

14
29 The diagram shows the pathway for the transport of carbon dioxide that occurs in red blood cells.
CO2
H 2O
2
haemoglobin 3 4
1 2 3 4
A carbaminohaemoglobin haemoglobinic hydrogen ions hydrogencarbonate
acid ions
B carbonic anhydrase carbonic acid hydrogen ions hydrogencarbonate
ions
C carboxyhaemoglobin carbonic carbonic acid carbon dioxide
anhydrase
D haemoglobinic acid carbonic acid hydrogencarbonate hydrogen ions
ions
30 The diagram shows a transverse section through an artery.
Which statement describes the tissues present in layer X?
A collagen and smooth muscle only

B elastic fibres and collagen only
C elastic fibres and smooth muscle only
D elastic fibres, collagen and smooth muscle
232 9700/12/M/J/19 Dr.Dawood

15
31 The large arteries close to the heart have a thick elastic layer in their walls.
Which statements about this layer are correct?
1 helps to maintain the blood pressure in arteries

2 reduces friction within the arteries
3 prevents too much pressure bursting the artery wall
32 Which tissues are present in the walls of a trachea and an alveolus?
tissue
epithelium with smooth
goblet cells muscle
A trachea
alveolus key
B trachea = present
alveolus = absent
C trachea
alveolus
D trachea
alveolus
33 The surface tension of the layer of liquid lining the alveoli tends to pull the walls inwards so alveoli
could collapse.
Which statements could explain how this is prevented?
1 Alveolar fluid is moved around by cilia.

2 Elastic fibres keep the alveoli open.
3 Epithelial cells secrete a chemical that reduces the cohesion in water.
Dr.Dawood 9700/12/M/J/19 233

16
34 The diagram shows some of the effects of nicotine and carbon monoxide in cigarette smoke.
1 3
carbon
nicotine monoxide
1 2 3
A increase in heart rate short-term effect on combines more readily with
cardiovascular system haemoglobin than oxygen
B increases diameter can cause combines irreversibly
of small arteries chronic bronchitis with haemoglobin
C reduces the oxygen short-term effect on reduces the blood
carrying capacity of blood gas exchange system supply to hands and feet
D stimulates goblet cells highly addictive increases risk
to secrete more mucus of blood clotting
35 Which row correctly identifies the causative organism of each disease?
cholera measles smallpox tuberculosis
A Variola Morbillivirus Vibrio Mycobacterium

B Variola Mycobacterium Vibrio Morbillivirus
C Vibrio Morbillivirus Variola Mycobacterium
D Vibrio Mycobacterium Variola Morbillivirus
234 9700/12/M/J/19 Dr.Dawood

17
36 The following advice was given to a person travelling to a country where there had been an
outbreak of an infectious disease.
● cook food well and eat it hot

● peel fruit and vegetables
● drink only cool, boiled water
● wash hands often with soap and cool, boiled water
Which infectious disease would this advice help to protect against?
A cholera
B malaria
C measles
D tuberculosis
37 What is a social factor that affects the spread of malaria?
A an increase in drug resistant forms of malaria

B climate change
C difficulty in producing a vaccine
D migration of people because of wars
38 Which are specific immune responses?
1 phagocytosis
2 production of antibodies
3 production of memory cells
A 1 and 3 only B 1 only C 2 and 3 only D 2 only
39 Newborn babies have natural passive immunity.
What is correct for this type of immunity?
immunity is antibodies are

temporary broken down
A key
B = correct
C = not correct
D
Dr.Dawood 9700/12/M/J/19 235

18
40 The diagrams show three different types of antibody structure.
IgG IgA IgM
IgG IgA IgM

A one binding site for two light chains two heavy chains
an antigen molecule
B two heavy chains four binding sites five hinge regions
for antigen molecules
C two hinge regions four heavy chains five light chains
D two light chains four hinge regions ten binding sites

for antigen molecules
236 9700/12/M/J/19 Dr.Dawood

BIOLOGY 9700/13
1 hour
Soft clean eraser
*8538879965*

IB19 06_9700_13/4RP
Dr.Dawood 237
2
1 Which combination of lenses for a light microscope will give the greatest magnification?
eyepiece lens objective lens
A ×5 ×100
B ×10 ×40
C ×15 ×40
D ×15 ×100
2 The photomicrograph shows some mesophyll tissue from a dicotyledonous leaf.
5 µm
What is the magnification of the photomicrograph?
A × 280 B × 2800 C × 3570 D × 7000
238 9700/13/M/J/19 Dr.Dawood

3
3 The diagram shows a typical animal cell as seen using an electron microscope.
Which of the numbered structures are needed for proteins to be secreted at the cell surface
membrane?
A 2, 3, 4 and 5 B 1, 2 and 4 C 1 and 3 D 5 only
4 Lysosomes vary in shape and size, making them difficult to identify.
What describes a lysosome?
A a vesicle containing enzymes, enclosed by a double membrane, that is budded off the
endoplasmic reticulum
B a vesicle containing hydrolytic enzymes and surrounded by a single membrane, found only in
phagocytes
C a vesicle enclosed by a single membrane, containing several different hydrolytic enzymes
that may act inside or outside the cell
D a vesicle surrounded by a double membrane, containing enzymes which can hydrolyse
damaged organelles in a cell
5 Which statements about ATP are correct?
1 It is produced in mitochondria only.

2 It can be hydrolysed to form ADP.
3 It contains deoxyribose.
A 1 and 3 B 1 only C 2 and 3 D 2 only
Dr.Dawood 9700/13/M/J/19 239

4
6 A single-celled organism lives inside the body of a fish. This single-celled organism is
rod-shaped, 700 µm long, enclosed in a cell wall and has cytoplasm containing thousands of
copies of small, circular DNA.
Which statement about this single-celled organism is correct?
A It is a eukaryote, because it can be seen without using a microscope.

B It is a eukaryote, because it is too large to be a prokaryote.
C It is a plant, because it is enclosed in a cell wall.
D It is a prokaryote, because it has small, circular DNA in its cytoplasm.
7 A solution of amylase was added to a suspension of starch. The mixture was stirred and kept at
40 °C for 45 minutes.
Samples were then tested with various reagents.
What is the expected set of results?
test and resulting colour

iodine test Benedict’s test biuret test
A black blue blue

B black orange purple
C brown blue blue
D brown orange purple
240 9700/13/M/J/19 Dr.Dawood

5
8 The diagram shows three hexose sugars.
CH2OH CH2OH
CH2OH
O
C O C O
H H H OH OH
H H
C C C C C C
OH H OH H H OH
HO OH HO H H CH2OH
C C C C C C
H OH H OH OH H
1 2 3
Which row correctly shows examples of carbohydrates in which these three hexose sugars
occur?
sucrose cellulose amylose
A 1 2 3
B 1 3 2
C 2 3 1
D 3 2 1
9 What can occur as a result of a condensation reaction?
1 A disaccharide is formed.
2 A glycosidic bond is broken.
3 A molecule of water is produced.
4 Two monosaccharides join together.
Dr.Dawood 9700/13/M/J/19 241

6
10 The diagram shows some relationships between features of carbohydrates.
α-glucose 1,4 bonds

1 4
3
2
branched
Which row correctly matches the carbohydrate with some of its features?
1 2 3 4
A amylopectin sucrose glycogen cellulose

B amylose glycogen amylopectin cellulose
C cellulose amylopectin glycogen sucrose
D glycogen cellulose amylose amylopectin
11 Which row describes a triglyceride?
insoluble
hydrophilic
in alcohol
A key
B = correct
C = not correct
D
242 9700/13/M/J/19 Dr.Dawood

7
12 The diagram shows three triglycerides, X, Y and Z.
O
H2COC
O
X HCOC
O
H2COC
O
H2COC
O
Y HCOC
O
H2COC
O
H2COC
O
Z HCOC
O
H2COC
What is correct for these triglycerides?
contains contains contains more

saturated unsaturated than two different
fatty acids fatty acids fatty acids
A X, Y and Z X and Y X and Y

B X, Y and Z Z X and Y
C X and Y X, Y and Z X, Y and Z
D Z X and Y X, Y and Z
Dr.Dawood 9700/13/M/J/19 243

8
13 Which features of collagen result in it having high tensile strength?
1 Bonds form between adjacent molecules.

2 Each three-stranded molecule is held together by hydrogen bonds.
3 Every third amino acid in the polypeptide is small.
4 The primary structure is held together by peptide bonds.
A 1, 2 and 3 B 1, 3 and 4 C 1 and 2 only D 2, 3 and 4
14 Which levels of protein structure would always be changed if an enzyme works by the induced fit
hypothesis?
primary secondary tertiary quaternary
A key
B = always changed
C = not changed
D
15 The enzyme β-galactosidase can catalyse the hydrolysis of four substrates, A, B, C and D, with
similar structures.
Each substrate has a different Km value.
For which substrate does β-galactosidase have the lowest affinity?
A Km = 4 × 10–3 mol dm–3
B Km = 1 × 10–3 mol dm–3
C Km = 2 × 10–4 mol dm–3
D Km = 1 × 10–4 mol dm–3
16 Which is correct for competitive inhibitors of enzymes?
1 They occupy the active site of an enzyme.

2 They have exactly the same shape as the substrate.
3 They can be used to control the rate of enzyme activity.
4 They can bind to a site on an enzyme other than the active site.
A 1, 2 and 3 B 1 and 3 only C 1 only D 2, 3 and 4
244 9700/13/M/J/19 Dr.Dawood

9
17 The diagram represents the fluid mosaic model of membrane structure.
3
2
1
4
6 5
Which two of the numbered components contribute to the fluidity of the membrane?
18 The cell surface membranes of some cells are largely made up of phospholipids and cholesterol,
with few proteins.
Which transport mechanisms will be reduced across these membranes?
1 facilitated diffusion
2 active transport
3 diffusion
19 One of the glycoproteins present in the cell surface membrane of human cells is called ICAM-1.
ICAM-1 is a cell adhesion molecule and it is also used by the common cold virus to attach to
human cells.
Which statements are true about ICAM-1?
1 A drug binding to ICAM-1 to block the common cold virus could stop cells attaching
to each other.
2 Part of the ICAM-1 structure must be complementary to proteins in the coat of the
common cold virus.
3 The ICAM-1 structure must have hydrophobic parts to stabilise it within the cell
membrane.
Dr.Dawood 9700/13/M/J/19 245

10
20 A student weighed a cylinder of potato and then put it into a test-tube containing a salt solution.
The potato cylinder was removed from the salt solution after one hour. It was blotted dry and then
reweighed. The student recorded that the potato had lost mass.
Which row shows the correct explanation for the results the student collected?
water potential condition of the

of the potato cells potato cells
before soaking after soaking
A higher plasmolysed
B higher turgid
C lower plasmolysed
D lower turgid
21 Some parts of a typical human chromosome are more numerous than others.
Which of the parts are listed in order from the most numerous to the least numerous?
A centromere, nucleotide, histone

B DNA molecule, telomere, centromere
C histone, telomere, DNA molecule
D telomere, centromere, nucleotide
Which cells need to transcribe telomerase enzyme?
1 stem cells
2 activated memory B-lymphocytes
3 helper T-lymphocytes secreting cytokines
246 9700/13/M/J/19 Dr.Dawood

11
23 The diagram shows a cell during mitosis.
Which description correctly identifies the cell?
A a plant cell during anaphase

B a plant cell during metaphase
C an animal cell during anaphase
D an animal cell during metaphase
24 A gene codes for the production of a protein, p53, that binds to damaged DNA during interphase
and prevents its replication. A carcinogen in cigarette smoke mutates this gene.
Which statement explains why this mutation may cause cancer?
A Cells with no p53 are allowed to undergo mitosis.

B Cells with no p53 allow their damaged DNA to replicate.
C The carcinogen in cigarette smoke increases the rate of cell division.
D The p53 causes uncontrolled cell division.
25 What is the role of DNA polymerase?
A condensation reactions to produce DNA nucleotides for replication

B correct alignment of RNA nucleotides along a template strand of DNA
C formation of bonds to complete the sugar-phosphate backbone
D formation of glycosidic bonds between complementary base pairs
26 Which row represents the correct features of the nitrogenous base thymine?
has a forms two hydrogen

pairs with
single ring is a purine bonds with its
cytosine
structure complementary base
A key
B = correct
C = not correct
D
Dr.Dawood 9700/13/M/J/19 247

12
27 Meselson and Stahl investigated DNA in bacteria. They grew bacteria in a medium with only
A sample of bacteria was collected from the second generation and their DNA analysed.
Hybrid DNA contains both heavy and light DNA.
Which row shows the percentage of heavy DNA strands and the percentage of hybrid DNA
molecules in the second generation produced in the medium containing light nitrogen?
percentage of heavy percentage of hybrid

A 25 25
B 25 50
C 50 25
D 50 50
28 The table shows the DNA triplet codes for some amino acids.
amino acid DNA triplet code amino acid DNA triplet code
arginine GCA glycine CCA

arginine GCC glycine CCG
arginine GCG glycine CCT
asparagine TTA lysine TTC
asparagine TTG lysine TTT
STOP ATC proline GGA
cysteine ACA proline GGC
cysteine ACG valine CAC
The base sequence on the DNA strand coding for a polypeptide is shown.
CCA TTC ACG GCG TTA GCA
Two mutations occur in this sequence during DNA replication.
Which mutated DNA would have no effect on the polypeptide synthesised?
A CCA ATC ACG GCG TTG GCA

B CCA TTC ACA GCA TTA GCA
C CCA TTC ACG CCG TTA GCC
D CCT TTC ACG GCG TTA GGA
248 9700/13/M/J/19 Dr.Dawood

13
29 A group of students were asked to look at the photomicrograph of a cross-section of unfamiliar

material and make observations.
The students described X as:
1 circular
2 a hollow tube
3 a spherical structure.
Which descriptions are correct?
30 Irrigating crop plants with water containing low concentrations of salt causes an increase in the
concentration of salt in the soil.
What explains why the increase in salt concentration eventually kills the crop?
water potential water potential direction of water

in roots in soil movement
A ↓ into the roots key

B ↑ into the soil solution ↑ = water potential increases
C ↓ out of the roots ↓ = water potential decreases
D ↑ into the roots
Dr.Dawood 9700/13/M/J/19 249

14
31 The photomicrograph shows a transverse section through part of a plant root.
Which tissue inhibits the path of water through the apoplastic pathway?
D
A
32 The table shows some information about three blood vessels, P, Q and R, from a mammal.
wall percentage composition of wall

diameter
thickness
/ mm muscle collagen elastin
/ mm
P 25 2 22 33 40
Q 20 1 25 40 25
R 4 1 35 25 30
Which row identifies blood vessels P, Q and R?
P Q R
A artery vein artery

B artery vein capillary
C vein artery capillary
D vein artery vein
33 Which row correctly identifies the locations in which a type of molecule or cell is present?
tissue
type of molecule or cell blood lymph
fluid
A antigen key
B glucose = is present
C lymphocyte = is not present
D neutrophil
250 9700/13/M/J/19 Dr.Dawood

15
34 The graph shows the percentage saturation of haemoglobin with oxygen at different partial
pressures of oxygen.
Which range of partial pressures of oxygen results in the greatest change of percentage
saturation of haemoglobin per kPa?
100 D
C
80
60
percentage B
saturation of
haemoglobin
with oxygen
40
A
20
0
0 5 10 15 20
partial pressure of oxygen / kPa
35 How many layers of cell surface membrane separate an oxygen molecule in the air space of an
alveolus from the nearest haemoglobin molecule?
A 3 B 4 C 5 D 6
36 Which biochemical is formed and what happens to the oxygen dissociation curve of adult
haemoglobin when carbon dioxide combines with haemoglobin?
biochemical formed oxygen dissociation curve
A carbaminohaemoglobin shifts to the left

B carbaminohaemoglobin shifts to the right
C carboxyhaemoglobin shifts to the left
D carboxyhaemoglobin shifts to the right
Dr.Dawood 9700/13/M/J/19 251

16
37 The diagram has been used to identify four infectious diseases.
infectious disease
waterborne not waterborne

1
virus not a virus

4
airborne not airborne

2 3
Which row correctly identifies the infectious diseases?
1 2 3 4
A cholera measles HIV / AIDS TB

B cholera smallpox malaria measles
C malaria HIV / AIDS TB cholera
D malaria TB measles cholera
38 How does penicillin affect bacteria?
A It inhibits DNA replication by binding to nucleotides.

B It inhibits translation by preventing tRNA binding to ribosomes.
C It is a competitive inhibitor of an enzyme in cell wall synthesis.
D It is a competitive inhibitor of an enzyme in protein synthesis.
252 9700/13/M/J/19 Dr.Dawood

17
39 Growth factors are chemicals that stimulate a cell to divide.
Growth factors are transported around the body in the blood, and they attach to cells that have
complementary growth factor receptors on their surface.
Some cells have too many growth factor receptors on their surface and so the cells continue to
divide, forming a tumour.
Trastuzumab is used as a treatment for some cancers.
Trastuzumab works by binding to a specific growth factor receptor on a tumour cell. This stops
the cell dividing and the cell dies.
What is trastuzumab?
A a monoclonal antibody
B a vaccine
C an antibiotic
D an enzyme inhibitor
40 What describes artificial active immunity?

Dr.Dawood 9700/13/M/J/19 253

18
BLANK PAGE
254 9700/13/M/J/19 Dr.Dawood

BIOLOGY 9700/11
1 hour
Soft clean eraser
*7089766514*

IB19 11_9700_11/4RP
Dr.Dawood 255
2
1 Which cell structure contains cytoplasm?
A chloroplasts
B mitochondria
C plasmodesmata
D smooth endoplasmic reticulum
2 Some cell structures are listed in a particular order.
1 nucleus
2 ribosome
3 Golgi body
4 vesicle
What determines the order in which these cell structures are listed?
A sequence used in synthesis of a lipid

B sequence used in synthesis of an antibody
C size from largest to smallest
D size from smallest to largest
3 The drawing has been made from a section showing part of an alveolus and a red blood cell in a
capillary. The magnification of the drawing is ×5000.
alveolus
red blood cell
What is the minimum distance that oxygen must diffuse from air in an alveolus into the red blood
cell?
A 0.1 nm B 1.0 nm C 0.1 µm D 1.0 µm
256 9700/11/O/N/19 Dr.Dawood

3
4 Four students were asked to match the function with the appearance of some cell structures in an
animal cell.
The functions were listed by a number.
1 mRNA passes through to the ribosome

2 synthesis of polypeptides
3 packaging of hydrolytic enzymes that will remain in the cell
The appearances were listed by a letter.
V membranes which surround an enclosed inner cavity

W non-membrane bound, spherical structures
X a double membrane interspersed with pores
Y non-membrane bound, cylindrical structures
Z membrane-bound sacs, arranged as a flattened stack
Which student correctly matched the numbered functions with the appearance of the cell
structure?
1 2 3
A V X Y
B V Z Z
C X W Z
D X Z W
5 The antibiotic chloramphenicol inhibits protein synthesis in mitochondria and in some

prokaryotes. Chloramphenicol does not inhibit protein synthesis in the cytoplasm of eukaryotic
cells.
What would be the effect on the cells of a person being treated with chloramphenicol?
rate of ATP production transcription of nuclear DNA
B decreases no effect
C increases decreases
D no effect no effect
Dr.Dawood 9700/11/O/N/19 257

4
6 The diagram shows the monosaccharide xylose.
H C O OH
H
C OH H C
HO C C H
H OH
Many xylose monomers can be joined by glycosidic bonds to form a polysaccharide which is
found in plant cell walls.
Which diagram shows the formation of a glycosidic bond between two xylose monomers?
H H
H C O OH H C O OH
H H
A C OH H C C OH H C
HO C C H HO C C H
H OH H OH
H H
H C O OH H C O OH
H H
B C OH H C C OH H C
HO C C H HO C C H
H OH H OH
H OH
H
HO C C H
H C O OH
H C OH H C
C C OH H C
H
H C O OH
HO C C H
H
H OH
H OH
H
HO C C H
H C O OH
H C OH H C
D C OH H C
H
H C O OH
HO C C H
H
H OH
258 9700/11/O/N/19 Dr.Dawood

5
7 Which colour indicates the lowest concentration of reducing sugar present in a solution after
testing with Benedict’s solution?
A brown
B green
C red
D yellow
8 Which molecules are monomers?
1 ribose
2 glucose
3 deoxyribose
4 sucrose
9 Which molecules have properties that are dependent on hydrogen bonds?
1 cellulose
2 glycogen
3 haemoglobin
4 water
10 Some features of triglycerides are listed.
1 can be liquid or solid at room temperature

2 contains a high proportion of carbon–hydrogen bonds
3 insoluble in water
4 less dense than water
Which of these features make triglycerides suitable energy stores?
A 1 and 2 B 1 and 4 C 2, 3 and 4 D 2 and 3 only
Dr.Dawood 9700/11/O/N/19 259

6
11 Some foods contain hydrogenated vegetable oils. These are unsaturated fats that have been
converted to saturated fats.
Which property of the fats will have changed?
A Their hydrocarbon chains will fit together more closely.

B Their solubility in water will increase.
C They will have more double bonds in their molecules.
D They will remain liquid at room temperature.
12 Which statements could be used to describe enzyme molecules and antibody molecules?
1 Hydrogen bonds stabilise the structure of the protein and are important for it to
function efficiently.
2 Hydrophilic R-groups point in to the centre of the molecule and cause it to curl into a
spherical shape.
3 The tertiary structure of the protein molecule plays an important role in the
functioning of the protein.
13 The Vmax and Km are determined for an enzyme-catalysed reaction.
What will be the effects on the Vmax and Km in the presence of a competitive inhibitor?
Vmax Km
A decreases increases
B increases decreases
C stays the same decreases
D stays the same increases
260 9700/11/O/N/19 Dr.Dawood

7
14 The graph shows how the concentration of components,1, 2, 3 and 4, of an enzyme-catalysed

reaction changes with time.
concentration
2
3
4
time
Which row identifies the components of this reaction?
component 1 component 2 component 3 component 4
A enzyme–substrate unbound enzyme product substrate

complex
B enzyme–substrate product substrate unbound enzyme
complex
C product enzyme–substrate unbound enzyme substrate
complex
D product unbound enzyme substrate enzyme–substrate
complex
15 Which statement suggests that a membrane protein is involved in active transport?
A It allows movement of molecules across a membrane if concentration differences exist.

B It can only function if mitochondria are supplied with sufficient oxygen.
C It has a tertiary structure with a binding site with a specific shape.
D It is found in the cell surface membranes and the mitochondrial membranes.
16 Cell surface receptors used in cell signalling are usually proteins that extend from one side of the
membrane to the other side of the membrane.
What is the role of the extracellular part of the protein?
A binding the signalling molecule

B functioning as an enzyme
C increasing the solubility of the receptor
D transmitting the signal from the target cell
Dr.Dawood 9700/11/O/N/19 261

8
17 Which substances can pass directly through cell surface membranes and do not use a carrier
protein or channel protein?
1 K+ and Cl –
2 CO2
3 C6H12O6
18 A student put a layer of plant epidermal cells on a microscope slide. The student put a drop of
potassium nitrate solution on the layer of cells and observed that:
• the cell surface membrane of many of the cells had separated from the cell wall
• the cytoplasm and cell contents had shrunk.
What explains these observations?
direction of net water water potential of cells water potential of

movement at start / kPa solution at start / kPa
A cells to solution –100 –500

B cells to solution –500 –100
C solution to cells –100 –500
D solution to cells –500 –100
Which cells transcribe a high concentration of telomerase?
1 neutrophils
2 mature red blood cells
3 activated memory T-lymphocytes
A 1 and 2 B 1 and 3 only C 1 only D 3 only
20 At which stage of mitosis do these events occur?
chromosomes become
centromeres separate
shorter and thicker
A anaphase interphase
B anaphase prophase
C metaphase interphase
D metaphase prophase
262 9700/11/O/N/19 Dr.Dawood

9
21 Which components could be found in nucleotides of rRNA?
1 any one of two different nitrogenous bases with a double ring structure
2 any one of two different purine bases
3 any one of three different nitrogenous bases with a single ring structure
4 any one of three different pyrimidine bases
22 How many statements are true for semi-conservative replication of DNA in a prokaryotic cell?
1 the process takes place in the cytoplasm

2 an adenine nucleotide will line up against a uracil on the template strand
3 each new DNA molecule will contain one strand from the parent molecule
4 if the parent molecule contained 40% guanine nucleotides each new DNA molecule
will contain 20% guanine nucleotides
A 1 B 2 C 3 D 4
23 Sickle cell anaemia is caused by a mutation in an allele of the gene that codes for the β-globin
polypeptide of haemoglobin.
The diagram shows the sequence of bases in a small section of the coding strand of DNA for
both the HbA (normal) and HbS (sickle cell) β-globin alleles.
HbA CTGACTCCTGAGGAGAAGTCT
HbS CTGACTCCTGTGGAGAAGTCT
How will the mutation in the allele result in the production of an altered version of the
β-globin polypeptide?
A A tRNA molecule with the anticodon GUG will hydrogen bond to the altered codon on mRNA.
B All the amino acids coded for after the mutation will differ from those in the HbA protein.
C mRNA transcribed from the HbS allele will contain the codon CAC instead of the codon CTC.
D The ribosome will be unable to continue translation of the HbS mRNA after the altered codon.
Dr.Dawood 9700/11/O/N/19 263

10
24 The diagrams show some tissue types in plant organs.
1
2
4
Which row identifies the tissue types?
1 2 3 4
A phloem phloem phloem xylem

B phloem xylem phloem xylem
C xylem phloem xylem phloem
D xylem xylem phloem xylem
25 Which row correctly describes the adaptations of companion cells, phloem sieve tube elements
and xylem vessel elements for their roles?
companion cell phloem sieve tube element xylem vessel element

A a thin layer of cytoplasm strong, lignified cell walls many plasmodesmata
to reduce resistance to flow for supporting the plant for communication
between cells
B empty cells allowing many plasmodesmata strong, lignified cell walls

water to flow freely for communication for supporting the plant
between cells
C many plasmodesmata a thin layer of cytoplasm empty cells allowing

for communication to reduce resistance to flow water to flow freely
between cells
D strong, lignified cell walls empty cells allowing a thin layer of cytoplasm
for supporting the plant water to flow freely to reduce resistance to flow
264 9700/11/O/N/19 Dr.Dawood

11
26 Irrigating crop plants with water containing low concentrations of salt causes an increase in the
concentration of salt in the soil.
What explains why the increase in salt concentration could eventually kill the crop?
water potential water potential direction of water

in roots in soil movement
A decreases out of the roots

B increases into the roots
C decreases out of the roots
D increases into the roots
27 The diagram shows the pathway of water across root cells to the xylem.
Which cell is in the endodermis?
A B C D xylem
28 Which row shows the cause of mass flow in the phloem and the direction of movement of phloem
sap by mass flow?
cause of mass flow direction of movement

in the phloem of phloem sap by mass flow
A hydrostatic pressure gradient sink to source

B hydrostatic pressure gradient source to sink
C water potential gradient sink to source
D water potential gradient source to sink
29 Which statement about oxygen combining with haemoglobin is correct?
A All oxygen molecules which combine stop the haemoglobin molecule changing shape.
B Four oxygen molecules can combine with each haem group.
C The first oxygen molecule to combine does not affect the shape of haemoglobin.
D The second oxygen molecule to combine makes it easier for the third to combine.
Dr.Dawood 9700/11/O/N/19 265

12
30 The diagram shows the Bohr effect.
100
80
X
percentage 60
saturation of
haemoglobin Y
with oxygen 40
20
0
0 2 4 6 8 10
What causes the shift from X to Y?
A decreased concentration of carbon dioxide and high pH

B decreased concentration of carbon dioxide and low pH
C increased concentration of carbon dioxide and high pH
D increased concentration of carbon dioxide and low pH
266 9700/11/O/N/19 Dr.Dawood

13
31 Which plan diagram represents the tissues in a major vein?
A B
C D
32 Ventricular septal defect (VSD) is a heart defect that people can have from birth. People with
VSD have a hole in the wall (septum) that separates the left and right ventricles.
What could happen in a person with VSD?
1 Blood will leak through the hole, mostly from right to left.
2 The volume of blood circulating through the lungs will be higher than in a person
without VSD.
3 Less oxygen will be delivered to the body tissues.
Dr.Dawood 9700/11/O/N/19 267

14
33 The diagram shows the pressure changes in some structures of the right side of the heart during
the cardiac cycle.
pressure X
/ kPa
0
0 0.2 0.4 0.6 0.8
time / s
Which structure is represented by X?
A pulmonary artery
B right atrium
C right ventricle
D vena cava
34 The diagram shows a section through a type of epithelium.
80 µm
Where is this type of epithelium found in the respiratory system?
trachea bronchus all bronchioles
A key
B = present
C = not present
D
268 9700/11/O/N/19 Dr.Dawood

15
35 In chronic obstructive pulmonary disease (COPD), airflow through the airways is reduced.
Which statements explain the reduced airflow?
1 More mucus is secreted into the airways.

2 Airways and alveoli lose their elasticity.
3 Many of the alveoli are destroyed.
4 Carbon monoxide binds irreversibly to haemoglobin.
A 1, 2, 3 and 4
B 1, 2 and 3 only
C 1, 3 and 4 only
D 2, 3 and 4 only
36 Outbreaks of cholera commonly occur in refugee camps that are set up after a major natural
disaster such as earthquakes.
The list shows some measures that can be taken to limit the spread of cholera in the refugee
camps.
1 treating all drinking water supplies with a high concentration of chlorine

2 setting up an emergency treatment centre to isolate cases of cholera and treat them
with antibiotics
3 using concentrated disinfectant to clean sewage disposal areas and infected
bedding
4 health workers visiting regularly to detect cases
5 keeping good records of the number of cases and deaths at treatment centres
Which features of these control measures involve an economic factor?
A 1, 2, 3, 4 and 5
B 1, 3 and 5 only
C 2, 3, 4 and 5 only
D 2 and 4 only
37 Which use of antibiotics helps to reduce the spread of resistance in bacteria?
A using high concentrations of the antibiotic to kill all the bacteria

B giving routine preventative antibiotics to people who are having an operation
C regularly changing the type of antibiotic used to treat particular bacterial infections
D giving antibiotics to treat low level infection caused by a bacterium
Dr.Dawood 9700/11/O/N/19 269

16
38 The graph shows the amount of antibody produced in response to an antigen.
concentration
of antibody
in the blood
0 10 20 30 40
time in days
first exposure to an antigen
From the graph, which statement is correct?
A It takes 25 days to achieve active immunity.

B Memory cells for this antigen are present in the body within 20 days.
C T-helper lymphocytes are activated on day 12.
D The second exposure to the antigen occurred on day 25.
39 Which sequence summarises the hybridoma method for the production of monoclonal
antibodies?
A B C D
inject mammal inject mammal inject mammal inject mammal
with antibodies with antibodies with antigens with antigens
↓ ↓ ↓ ↓
harvest harvest harvest harvest
antibodies B-lymphocytes antibodies B-lymphocytes
from blood from spleen from blood from spleen
↓ ↓ ↓ ↓
test for fuse with test for fuse with
wanted antibody cancer cells wanted antibody cancer cells
↓ ↓ ↓ ↓
fuse with test for fuse with test for
cancer cells wanted antibody cancer cells wanted antibody
↓ ↓ ↓ ↓
large scale large scale large scale large scale
culture culture culture culture
270 9700/11/O/N/19 Dr.Dawood

17
40 The vaccination programme for smallpox was a medical success story which resulted in the
World Health Organisation finally declaring the world free from smallpox in 1980.
Which statement correctly identifies the reasons for the success of the smallpox vaccination
programme?
A The virus also infected animals making it easy to stop the transmission cycle.
B The virus remained in the body following infection and could become active later.
C The virus was stable and not prone to mutations.
D The virus was unstable and prone to mutations.
Dr.Dawood 9700/11/O/N/19 271

18
BLANK PAGE
272 9700/11/O/N/19 Dr.Dawood

BIOLOGY 9700/12
1 hour
Soft clean eraser
*2599123414*

IB19 11_9700_12/4RP
Dr.Dawood 273
2
1 A student calibrated the scale on an eyepiece graticule in the eyepiece lens of a light microscope.
The student was given a stage micrometer scale to use.
The divisions on the stage micrometer scale were 0.1 mm apart.
Which data must the student collect in order to calibrate the eyepiece graticule?
1 magnification of the eyepiece lens of the microscope

2 number of divisions of the stage micrometer scale seen in one field of view of the
microscope
3 number of divisions of the eyepiece graticule scale equivalent to each division of the
stage micrometer scale
2 The diameter of living cells varies considerably.
The diameter of a typical eukaryotic cell is 1.5 × 101 µm.

The diameter of a typical prokaryotic cell is 7.5 × 102 nm.
Using these measurements, what is the maximum number of each cell type which could fit along
a line 1 cm long?
number of white number of

blood cells Streptococcus cells
A 6.7 × 104 1.3 × 102

B 6.7 × 103 1.3 × 105
C 6.7 × 102 1.3 × 104
D 6.7 × 101 1.3 × 103
3 Which structures are found in animal cells and in plant cells?
1 centriole
2 lysosome
3 nucleolus
4 vacuole
A 1 and 3 only
B 2 and 4 only
C 2, 3 and 4 only
D 1, 2, 3 and 4
274 9700/12/O/N/19 Dr.Dawood

3
4 Which features shown in the diagram can be present in eukaryotes?
4
peptidoglycan 1
cell wall DNA
feature
3 2
70S RNA
ribosomes
animal cell.
1 organises microtubules to produce the spindle during cell division

3 synthesis of lipids

Which student correctly matched the numbered functions with the appearance of the cell
structure?
1 2 3
A W X Z
B W Z V
C Y W V
D Y Z W
Dr.Dawood 9700/12/O/N/19 275

4
6 Which types of RNA are present in prokaryotic cells and in eukaryotic cells?
mRNA rRNA tRNA
A key
B = present
C = not present
D
7 A student carried out four tests for biological molecules on a solution. The results are shown in
the table.
test for biological

observation
molecules
iodine orange-brown
biuret purple
Benedict’s orange
emulsion clear
Which three molecules may be present in this solution?
A glucose, starch, globin

B globin, glucose, collagen
C starch, sucrose, collagen
D sucrose, globin, collagen
8 A student was asked to estimate the concentration of reducing sugar in an unknown solution
using the Benedict’s test. Five reducing sugar solutions with different concentrations were
provided in order to produce a calibration curve.
The student added 2 cm3 of Benedict’s solution to each of the reducing sugar solutions, heated
them in a water-bath and recorded the time taken for the first appearance of a colour change.
Which variables should the student standardise, when carrying out the Benedict’s test on each
reducing sugar solution, to ensure the results are comparable?
1 volume of reducing sugar used

2 the temperature of the water-bath
3 the time the solutions are heated
276 9700/12/O/N/19 Dr.Dawood

5
9 Which rows show the chemical groups present in the biological molecules listed?
biological presence of carboxyl presence of two or more

molecule (COOH) groups hydroxyl (OH) groups
1 amino acid yes no

2 β-glucose no yes
3 glycerol no no
4 fatty acid yes no
10 The diagram shows the formation of a biological macromolecule.
O O
OH C (CH2)16 CH3 CH2 O C (CH2)16 CH3

CH2 OH
O O
CH2 OH + → + 3H2O
CH2 OH O O
Which type of bonds are formed in the macromolecule product?
A ester bonds
B glycosidic bonds
C hydrogen bonds
D peptide bonds
Dr.Dawood 9700/12/O/N/19 277

6
11 Fibrous proteins are composed of chains of amino acids held together by bonds. An example of
part of a fibrous protein is shown.
O R H
N
N
H O X
Y
O R H
N
N
H O
Which type of bond is at X and Y?
X Y
A disulfide hydrophobic interaction

B hydrogen peptide
C hydrophobic interaction ionic
D ionic peptide
12 Which row about the structure of proteins is correct?
primary structure secondary structure quaternary structure
A is the number is the left-handed is the sub-unit

of amino acids spiral formed by the polypeptides that
present in a protein primary structure link together to
form a protein
B is the order of is the coiling of a contains two types

amino acids present in chain of amino acids of polypeptide that
a protein to form a β-pleated interact forming the
encoded by DNA sheet or α-helix shape of a protein
C is the result of occurs because of is formed by four

translation of an attraction between polypeptides and
mRNA molecule by hydrogen and an additional reactive
a ribosome into a oxygen atoms in group attached to the
chain of amino acids the peptide bonds protein
D is the sequence is formed by is formed by the

of amino acids in hydrogen bonding linking together
a protein coded by between amino acids of more than one
an mRNA molecule forming the polypeptide to
primary structure form a protein
278 9700/12/O/N/19 Dr.Dawood

7
13 A student wrote four statements about water.
1 Water has a high specific heat capacity which maintains the temperature of water
within cells.
2 Mammals rely on water having a relatively low latent heat of vapourisation to keep
them cool.
3 When a negatively charged ion is added to water, the δ+ charge on the hydrogen
atom is attracted to the ion.
4 When surrounded by water, non-polar molecules tend to be pushed apart from one
another.
1 2 3 4
A key
B = correct
C = not correct
D
14 Which statement about the active site of an enzyme is correct?
A It always has a specific fixed shape.

B It reduces the total energy of the product.
C It does not form chemical bonds with its substrate.
D It is determined by the primary structure of the enzyme.
15 When investigating the rate of reaction of the enzyme lipase on the hydrolysis of triglycerides, the
pH must be maintained at an optimum to prevent the lipase denaturing.
What is the reason for this?
A The addition of water molecules produced by hydrolysis increases the pH.

B The products of hydrolysis decrease the pH.
C The products of hydrolysis increase the pH.
D The removal of water molecules used in hydrolysis decreases the pH.
Dr.Dawood 9700/12/O/N/19 279

8
16 An experiment was carried out to compare the effect of pH on the activity of an enzyme that was
in solution and the same enzyme that had been immobilised on a gel. All other variables were
kept the same.
The results are shown in the graph.
enzyme key
activity
immobilised enzyme
enzyme in solution
4 5 6 7 8 9 10 11
pH
Which statement explains these results when the enzyme is immobilised?
A The primary structure has changed.

B The secondary structure has changed.
C The tertiary structure has changed.
D The quaternary structure has changed.
17 High concentrations of ethanol can disrupt cell membrane structure and make the cell surface
membrane leaky.
Yeast cells release ethanol as a waste product of metabolism.
Yeast cells can alter the composition of the cell surface membrane to reduce the effect of
ethanol.
● A saturated fatty acid, X, is replaced by an unsaturated fatty acid, Y.

● Y has a shorter hydrocarbon chain than X.
● There is an increase in the phospholipid to protein ratio.
Which statement would explain why the effect of ethanol is reduced?
A A greater proportion of phospholipid may increase the entry of ethanol via channel proteins.
B An increase in hydrophobic interaction by phospholipid tails improves membrane stability.
C An increase in the proportion of fatty acids with double bonds decreases membrane fluidity.
D The shorter hydrocarbon chain of Y decreases membrane fluidity.
280 9700/12/O/N/19 Dr.Dawood

9
18 The photomicrograph shows the appearance of onion epidermal cells after they have been
soaked in solution X for one hour.
What fills the space labelled Y?
A air
B cytoplasm
C solution X
D water
19 Equal sized potato pieces were placed into a test-tube and covered with a sucrose solution. The
test tube was left for 30 minutes. All other variables were controlled.
After 30 minutes, the potato piece had not changed in size.
What can be concluded from this result?
A The concentration of sucrose is the same in the potato and in the solution and there is no
more movement of water into or out of the potato.
B The concentration of sucrose is the same in the potato and in the solution and there is no net
movement of water into the potato.
C The water potential is the same in the potato and in the sucrose solution and there is no
more movement of water into or out of the potato.
D The water potential is the same in the potato and in the sucrose solution and there is no net
movement of water into or out of the potato.
Dr.Dawood 9700/12/O/N/19 281

10
20 Which row shows the correct number of each component of a single chromosome during
prophase of mitosis?
polynucleotide
centromeres chromatids telomeres
strands
A 1 0 2 2
B 1 2 4 4
C 2 0 4 2
D 2 2 2 4
21 The cell cycle includes mitosis.
Which are features of nuclear division?
1 forms cells of equal size to the parent cell

2 forms genetically identical nuclei
3 semi-conservative replication of DNA
22 The RNA triplet UAG acts as a stop codon terminating the synthesis of a polypeptide. The
diagram shows a strand of DNA which codes for four amino acids.
Where would an insertion mutation of a thymine nucleotide result in the termination of

translation?
TC CACTC GATG C
A B C D
23 What is correct for uracil?
It joins its
It has a single complementary
It is a purine
ring structure base with 2
hydrogen bonds
A key
B = correct
C = not correct
D
282 9700/12/O/N/19 Dr.Dawood

11
24 The photomicrograph shows a vascular bundle.
3 2
Which describes the relationship of water potential in the labelled cells?
A Cell 3 is less negative than cell 1.

B Cell 2 is less negative than cell 3.
C Cell 3 is more negative than cells 1 and 2.
D Cells 1, 2 and 3 have the same water potential.
25 Which features have a role in the transport of water in xylem vessel elements?
1 capillary action
2 cohesion
3 hydrogen bonding
Dr.Dawood 9700/12/O/N/19 283

12
26 What is a definition of transpiration?
A the evaporation of water vapour from a leaf due to the diffusion of water from an area of low
water potential to high water potential
B the loss of water vapour from a plant to its environment by diffusion down a water potential
gradient
C the movement of water from root to leaf due to the adhesion of water molecules to one
another
D the uptake of water by plant roots by movement of water down a continuous water potential
gradient from air to soil
27 Which are present in the walls of arteries?
smooth collagen
endothelium elastic tissue
muscle fibres
A key
B = present
C = not present
D
28 The statements list some of the events in the cardiac cycle. They are not in the correct order.
Which statement describes the fifth of these events to occur in the cardiac cycle?
1 The impulse travels through Purkyne tissue.

2 A wave of excitation sweeps across the atria.
3 The atrioventricular node delays the impulse for a fraction of a second.
4 The sinoatrial node contracts.
5 The wave of excitation sweeps upwards from the base of the ventricles.
6 The ventricles contract.
7 The atria contract.
A 1 B 3 C 4 D 7
284 9700/12/O/N/19 Dr.Dawood

13
29 Which row correctly identifies the molecules or cells that are present in the different locations?
type of molecule or cell blood lymph tissue fluid
A antibodies key
B large plasma proteins = present
C lymphocytes = not present
D phagocytes
30 When active tissues have high carbon dioxide concentrations, oxyhaemoglobin releases oxygen
to these tissues.
What encourages this release in the presence of high concentrations of carbon dioxide?
1 carboxyhaemoglobin forms more readily

2 oxyhaemoglobin dissociates more readily
3 haemoglobin needs higher concentrations of oxygen to become saturated
Dr.Dawood 9700/12/O/N/19 285

14
31 The graph shows oxygen dissociation curves of haemoglobin at two different carbon dioxide
concentrations.
The partial pressure of oxygen in the lungs is 100 mmHg.
The partial pressure of oxygen in metabolically active tissues is 35 mmHg.
100
90
80
70
60
percentage
saturation of
haemoglobin 50
with oxygen
40
30
20
10
0
0 20 40 60 80 100
partial pressure of oxygen / mmHg
What is the percentage saturation of haemoglobin with oxygen at the lungs and in metabolically
active tissues?
percentage saturation of
haemoglobin with oxygen
metabolically
lungs
active tissue
A 92 40
B 92 66
C 94 40
D 94 66
286 9700/12/O/N/19 Dr.Dawood

15
32 Which statement is correct?
A Alveoli have goblet cells to produce mucus to trap pathogens from the air.
B Cartilage in the bronchi keeps the bronchi open and allows air to flow through freely.
C Complete rings of cartilage in the bronchioles make sure that air can reach the alveoli.
D During exercise, muscles in the bronchioles and alveoli relax to allow a greater flow of air.
33 Four types of cell in the gas exchange system are listed.
J alveolus epithelium cell

K ciliated cell
L goblet cell
M smooth muscle cell
The ticks () in the table show specialised features of three of these types of cell.
lots of
many many Golgi
endoplasmic
mitochondria bodies
reticulum
1
2
3
Which row correctly matches the specialised feature with the correct cell?
1 2 3
A J M K
B K J M
C K M L
D M K J
Dr.Dawood 9700/12/O/N/19 287

16
34 Some symptoms of chronic obstructive pulmonary disease (COPD) are listed.
1 bursting of alveoli
2 loss of elastic fibres
3 increase in secretion of mucus
4 reduction in surface area for gaseous exchange
5 narrowing of airways
Which of these are also the symptoms of emphysema?
35 The diagram shows properties of diseases.
Which shows the properties that are common to tuberculosis (TB) and measles?
bacterial infectious
A
B
C D
transmitted by
airborne droplets
1 2 W
bacterium protoctist contaminated water
pathogen method of
transmission
3 X Y
Morbillivirus mosquito bite coughs and
sneezes
What is the correct pathogen and method of transmission for cholera?
A 1 and W B 1 and X C 2 and X D 3 and Y
288 9700/12/O/N/19 Dr.Dawood

17
37 Different antibiotics function in different ways. It is important that the antibiotic kills the bacteria,
but does not harm the infected human.
The antibiotic tetracycline has been found to affect the way in which human mitochondria
function.
Which statements could explain why human mitochondria function is affected by tetracycline?
A The antibiotic prevents the synthesis of peptidoglycan cell walls.

B The antibiotic prevents synthesis of linear DNA.
C The antibiotic prevents translation of circular DNA.
D The antibiotic prevents translation by binding to 70S ribosomes.
38 Immune response to a vaccination against a virus can be assessed by making three

measurements:
1 the concentration of anti-virus antibody in the blood

2 the time taken to increase the antibody concentration significantly after a booster
vaccination
3 the number of virus-specific lymphocytes per cm3 blood.
What describes the immunity of an individual when the values of 1, 2 and 3 are all low ten years
after vaccination?
A active immunity due to the presence of memory cells

B low immunity due to the absence of antibodies
C low immunity due to the absence of memory cells
D passive immunity due to the presence of antibodies
Which types of white blood cell involved in an autoimmune condition will contain active
telomerase?
mature helper
B-lymphocyte neutrophils T-lymphocyte
plasma cells memory cells
A key
B = contain active telomerase
C = do not contain active telomerase
D
Dr.Dawood 9700/12/O/N/19 289

18
40 Which features of monoclonal antibodies make them useful in the diagnosis and treatment of
disease?
1 A particular monoclonal antibody attaches to a specific antigen.

2 Identical monoclonal antibodies can be produced in large numbers.
3 Binding a monoclonal antibody to its specific antigen may mark that antigen for
destruction by white blood cells.
4 Fluorescent or radioactive markers can be attached to a monoclonal antibody to
show where the antigen is in the body.
A 1, 2, 3 and 4
B 1, 2 and 3 only
C 2 and 3 only
D 3 and 4 only
290 9700/12/O/N/19 Dr.Dawood

BIOLOGY 9700/13
1 hour
Soft clean eraser
*5573000885*

IB19 11_9700_13/4RP
Dr.Dawood 291
2
1 Plant cells are stained and then seen with a simple light microscope using daylight as the only
light source.
Which cell structures are clearly visible at a magnification of ×400?
A chloroplast grana
B lysosomes
C nucleoli
D ribosomes
2 How many nanometres are there in one millimetre?
A 1000 B 10 000 C 100 000 D 1 000 000
3 Which cell structures contain 70S ribosomes?
1 chloroplasts
2 mitochondria
3 nucleus
4 cytoplasm
A 1 and 2 only B 1 only C 2, 3 and 4 D 2 and 4 only
292 9700/13/O/N/19 Dr.Dawood

3
4 The electron micrograph shows part of a plant cell.
5 μm
Which combination correctly identifies the labelled cell structures?
P Q R S
A cell surface membrane cytoplasm mitochondrion nucleus

B cell surface membrane vacuole chloroplast nucleus
C cell wall cytoplasm mitochondrion nucleolus
D cell wall vacuole chloroplast nucleolus
Dr.Dawood 9700/13/O/N/19 293

4
animal cell.
1 mRNA passes through to the ribosome


Which student correctly matched the numbered function with the appearance of the cell
structure?
1 2 3
A V W Y
B V Y Z
C X W Y
D X Y Z
294 9700/13/O/N/19 Dr.Dawood

5
6 Tests for biological molecules were carried out on food samples.
Which correctly matches the biological molecules in the food samples with the colour for a
positive result?
A B
fructose black fructose black

purple purple
starch starch
red red
triglyceride white triglyceride white
C D
fructose black fructose black

purple purple
starch starch
red red
triglyceride white triglyceride white
7 What occurs during the formation of a glycosidic bond between two α-glucose molecules?
A a 1, 4 bond is always formed

B a hydrogen bond is always formed
C a molecule of water is always formed
D a hydroxyl (OH) group is always formed
8 What is the maximum number of condensation reactions that occur when a triglyceride is
synthesized?
A 1 B 2 C 3 D 4
Dr.Dawood 9700/13/O/N/19 295

6
9 Three proteins that have a quaternary structure are listed.
• Type IX collagen is formed from three different polymers.
• The main form of haemoglobin contains two alpha globins and two beta globins.
• HIV protease consists of two identical polymers.
Which row shows the correct number of genes needed to code for each protein?
number of genes
type IX HIV
haemoglobin
collagen protease
A 1 2 2
B 1 4 1
C 3 2 1
D 3 4 2
296 9700/13/O/N/19 Dr.Dawood

7
10 The diagrams show the structure of an amino acid with some parts of the molecule shaded.
Which diagram shows the shaded part of the molecule that is common to all amino acids?
A B
H H
C C
NH2 NH2
CH3 CH3
COOH COOH
C D
H H
C C
NH2 NH2
CH3 CH3
COOH COOH
11 Some extracellular protease enzymes are synthesised in an inactive form called zymogen.
Zymogen is converted to the active protease in the Golgi body.
What is the purpose of producing zymogen before converting it to the extracellular protease?
A to avoid unwanted digestion of proteins inside the cell

B to avoid unwanted digestion of proteins outside the cell
C to catalyse digestion of proteins in the cytoplasm
D to catalyse digestion of proteins in the rough endoplasmic reticulum
Dr.Dawood 9700/13/O/N/19 297

8
12 The Michaelis-Menten constant for an enzyme-catalysed reaction is referred to as Km, and the
maximum velocity of such a reaction is known as Vmax.
Which statement about Km and Vmax is correct?
A An enzyme with a high value of Km can reach its Vmax at a low substrate concentration.
B An enzyme with a high value of Km has a high affinity to its substrate.
C An enzyme with a low value of Km can reach its Vmax at a high substrate concentration.
D An enzyme with a low value of Km has a high affinity to its substrate.
13 The diagram represents part of the fluid mosaic model of a cell surface membrane.
Which parts of the membrane are hydrophilic?
A 1, 2 and 3 B 2 and 3 only C 3 and 4 D 4 only
14 Which statements about the proteins and glycoproteins in cell surface membranes are correct?
1 They can allow cells to bond together to form tissues.

2 They can recognise messenger molecules like hormones.
3 They can be antigens and allow cell to cell recognition.
A 1, 2 and 3
B 1 and 2 only
C 1 and 3 only
D 2 and 3 only
298 9700/13/O/N/19 Dr.Dawood

9
15 Which pair of factors is inversely proportional to the rate of diffusion?
A concentration gradient and surface area over which diffusion occurs

B distance over which diffusion occurs and size of diffusing molecule
C size of diffusing molecule and concentration gradient
D surface area over which diffusion occurs and distance over which diffusion occurs
16 Raisins are dried fruit that contain high concentrations of sugar.
Which row is correct when raisins are first put into water?
water potential in the raisin

direction of water movement
compared to surrounding water
A less negative into the raisin

B less negative out of the raisin
C more negative into the raisin
D more negative out of the raisin
17 Which processes that occur in cell division are represented in the diagram?
3
mass of nuclear
DNA in a cell 2
/ arbitrary units
1
0
time
A DNA replication and nuclear division only

B DNA replication, nuclear division and cytokinesis
C mitosis and cytokinesis
D mitosis only
Dr.Dawood 9700/13/O/N/19 299

10
18 What happens to the telomeres during mitosis of a cancer cell?
A The length increases.

B The length decreases.
C They are completely lost.
D They stay the same length.
19 The graph shows three measurements obtained after metaphase of mitosis.
2
distance
time
What measurements do the curves represent?
distance between distance between

distance between
centromeres and centromeres of sister
poles of spindle
poles of spindle chromatids
A 1 2 3
B 1 3 2
C 3 1 2
D 3 2 1
300 9700/13/O/N/19 Dr.Dawood

11
20 The diagram represents a nucleotide containing guanine.
base
Which statements about this nucleotide are correct?
1 The carbohydrate can be ribose or deoxyribose.

2 Base pairing occurs with three hydrogen bonds.
3 Guanine is a purine.
21 What is the maximum number of codon-anticodon interactions within one ribosome?
A 2 B 3 C 4 D 6
22 Meselson and Stahl investigated DNA in bacteria. They grew bacteria in a medium with only
A sample of bacteria was collected from the first generation and their DNA analysed.
Hybrid DNA contains heavy DNA and light DNA.
Which row shows the percentage of light DNA strands and the percentage of hybrid DNA
molecules in the first generation produced in the medium containing light nitrogen?
percentage of light percentage of hybrid

A 25 50
B 50 50
C 50 100
D 75 100
Dr.Dawood 9700/13/O/N/19 301

12
23 Which statements about tRNA structure are correct?
1 There is a binding site for the attachment of a specific amino acid and a different
binding site for the attachment to the ribosome, so that translation can occur.
2 There is a ribose-phosphate backbone with strong phosphodiester bonds and areas
within the polynucleotide chain where base pairing occurs.
3 There is an anticodon that contains the same triplet of bases as the triplet of DNA
bases that has been transcribed to produce the mRNA codon.
24 Which row explains why xylem vessels have no cytoplasm?
to increase
to contain a larger to transport water the cellulose
volume of water faster content of the
vessel walls
A key
B = explains
C = does not explain
D
25 What causes water to move from the root hair cells to the endodermis?
A diffusion through cell walls, osmosis down a water potential gradient in the cytoplasm
B diffusion through the symplast, osmosis and root pressure through the apoplast
C osmosis from cell vacuole to cell vacuole, active transport into the endodermis
D osmosis through the intercellular spaces, diffusion in cell walls and cytoplasm
26 What is true about a Casparian strip?
location formed from effect
A cell wall of cortical cell lignin closes symplastic pathway

B cell wall of endodermis cell suberin closes apoplastic pathway
C cytoplasm of cortical cell lignin closes apoplastic pathway
D cytoplasm of endodermis cell suberin closes symplastic pathway
302 9700/13/O/N/19 Dr.Dawood

13
27 Which xerophytic adaptations reduce the water potential gradient between leaf surface and
atmosphere?
1 rolled leaves
2 hairy leaves
3 sunken stomata
4 fewer stomata
5 fleshy leaves
A 1, 2, 3, 4 and 5
B 1, 2 and 3 only
C 1, 3 and 4 only
D 2 and 5 only
28 When sucrose is loaded into the phloem it has to travel from mesophyll cells to a companion cell
and then into the phloem.
In many plants, proton pumps and co-transporter molecules are involved in this process.
Which row shows the relative concentrations of sucrose in each type of cell?
relative concentration of sucrose / arbitrary units

mesophyll companion phloem sieve
cell cell tube element
A 5 10 15
B 5 15 10
C 15 10 5
D 15 5 10
Dr.Dawood 9700/13/O/N/19 303

14
29 The image shows three white blood cells labelled X, Y and Z.
Z
X
Which row correctly identifies these cells?
cell X cell Y cell Z
A lymphocyte neutrophil monocyte

B lymphocyte monocyte neutrophil
D neutrophil lymphocyte monocyte
30 Which is the correct sequence for the opening of the valves in the mammalian heart during one
cardiac cycle?
A B
right atrioventricular valve left atrioventricular valve

↓ ↓
pulmonary semilunar valve aortic semilunar valve
↓ ↓
left atrioventricular valve right atrioventricular valve
↓ ↓
aortic semilunar valve pulmonary semilunar valve
C D
left atrioventricular valve left atrioventricular valve

and and
aortic semilunar valve right atrioventricular valve
↓ ↓
right atrioventricular valve aortic semilunar valve
and and
pulmonary semilunar valve pulmonary semilunar valve
304 9700/13/O/N/19 Dr.Dawood

15
31 Red blood cells may contain a molecule known as 2,3-bisphosphoglycerate (2,3-BPG).
When 2,3-BPG binds to haemoglobin a higher partial pressure of oxygen is needed to bring
about 50% saturation of haemoglobin with oxygen.
Which statements about the effect of 2,3-BPG are correct?
1 2,3-BPG in red blood cells causes the oxygen dissociation curve to shift to the right.
2 The binding of 2,3-BPG to haemoglobin reduces the Bohr effect.
3 The binding of 2,3-BPG to haemoglobin lowers the affinity of the haemoglobin for
oxygen.
4 When 2,3-BPG is absent, oxyhaemoglobin is less likely to unload oxygen.
32 Aortic stenosis is a heart valve disorder in which the aortic semilunar valve opening is narrow.
Which effect could aortic stenosis have on heart structure and function?
A The cardiac muscle of the left ventricle wall is thinned by blood leaking out of the left
ventricle during ventricular diastole.
B There is less cardiac muscle in the left ventricle and reduced diastolic blood pressure,
caused by the smaller blood volume entering the left atrium.
C The tendons of the heart valves are weakened by blood being forced back through the left
atrioventricular valve into the left atrium.
D The wall of the left ventricle thickens, leading to an enlarged heart and inability to relax and
fill completely during diastole.
33 What explains why the red blood cell count of humans increases when they remain at high
altitudes?
A Haemoglobin is not saturated with oxygen in the lungs.

B The partial pressure of oxygen in the air is higher.
C The percentage of oxygen in the air has decreased.
D There is more carbon dioxide, increasing the Bohr effect.
34 Which may contain ciliated epithelium?
A trachea only
B trachea and bronchi only
C trachea, bronchi and bronchioles
D bronchi, bronchioles and alveoli
Dr.Dawood 9700/13/O/N/19 305

16
35 Which row shows the effects of chronic bronchitis?
lymph glands alveoli bronchi infection
A destroyed damaged inflamed absent

B destroyed inflamed scarred present
C swollen damaged scarred present
D swollen inflamed inflamed absent
36 The statements refer to the disease tuberculosis (TB).
1 The pathogen lives inside human cells so is not accessible to the immune system.
2 The bacterial pathogen reproduces slowly.
3 The pathogen is not very sensitive to antibiotics.
Which explains why antibiotic treatment for TB takes a long time?
37 Scientists studied the multidrug resistant bacterial infections in children, caused by one type of
bacteria, between 2007 and 2015. The percentage of multidrug resistant infections rose from
0.2% to 1.5%.
What was the percentage increase in multidrug resistant infections between 2007 and 2015?
A 1.3% B 87% C 130% D 650%
38 Why is it necessary for a person with a bacterial infection to take antibiotics at evenly spaced time
intervals?
A to increase the concentration of antibiotic slowly to a level which is lethal to the bacteria
B to maintain a concentration of antibiotic in the body which is lethal to the bacteria
C to prevent the development of resistant strains of bacteria
D to select and kill the resistant strains of bacteria
39 The enzyme telomerase prevents loss of telomeres after many mitotic cell cycles. Three types of
cell are used to produce monoclonal antibodies.
1 cancer cells undergoing uncontrolled cell division

2 mature B-lymphocytes
3 hybridoma cells
Which cells involved in this technique contain active telomerase enzyme?
306 9700/13/O/N/19 Dr.Dawood

17
40 What explains why monoclonal antibodies are useful in the diagnosis of disease?
A They bind to and neutralise one type of antibody.

B They bind to and neutralise one type of pathogen.
C Their shape is complementary to one specific antibody.
D Their shape is complementary to one specific antigen.
Dr.Dawood 9700/13/O/N/19 307

18
BLANK PAGE
308 9700/13/O/N/19 Dr.Dawood

Cambridge International AS & A Level
BIOLOGY 9700/11
1 hour
You must answer on the multiple choice answer sheet.

*9944619739*
You will need: Multiple choice answer sheet

Soft clean eraser
INSTRUCTIONS
• There are forty questions on this paper. Answer all questions.
• For each question there are four possible answers A, B, C and D. Choose the one you consider correct
and record your choice in soft pencil on the multiple choice answer sheet.
• Follow the instructions on the multiple choice answer sheet.
• Write in soft pencil.
• Write your name, centre number and candidate number on the multiple choice answer sheet in the
spaces provided unless this has been done for you.
• Do not use correction fluid.
• Do not write on any bar codes.
• You may use a calculator.
INFORMATION
• The total mark for this paper is 40.
• Each correct answer will score one mark. A mark will not be deducted for a wrong answer.
• Any rough working should be done on this question paper.
This document has 20 pages. Blank pages are indicated.
IB20 06_9700_11/3RP
Dr.Dawood 309
2
1 The photomicrograph shows the ultrastructure of part of a cell.
Which statement about the type of cell shown in the photomicrograph is correct?
A It is a plant cell because it has both chloroplasts and a nucleus.

B It is a plant cell because it has chloroplasts.
C It is an animal cell because it has a cell membrane.
D It is an animal cell because it has mitochondria.
310 9700/11/M/J/20 Dr.Dawood

3
2 Which structures are found in typical eukaryotic cells?
1 70S ribosomes
2 80S ribosomes
3 linear DNA (chromosomes)
4 circular DNA
A 1, 2, 3 and 4
B 1, 2 and 3 only
C 1 and 4 only
D 2 and 3 only
3 A student examined a slide of human blood with a light microscope and made a careful drawing
of the different cell types. The student used an eyepiece graticule so that the relative sizes of the
different cell types were drawn accurately.
In the drawing:
● red blood cells were 7 mm in diameter

● lymphocytes were 6 mm in diameter
● neutrophils were 14 mm in diameter.
What is the linear magnification of the drawing?
A ×10 B ×40 C ×100 D ×1000
Dr.Dawood 9700/11/M/J/20 311

4
4 The diagram shows a graduated slide, with divisions of 0.1 mm viewed using an eyepiece
graticule.
0 10 20 30 40 50 60 70 80 90 100
Pollen grains were grown in a sugar solution and viewed using the eyepiece graticule.
Diagram 1 shows the pollen grains at the start. Diagram 2 shows the pollen grains after four
hours.
diagram 1 diagram 2
pollen
tube
0 10 20 30 40 50 60 70 80 90 100 0 10 20 30 40 50 60 70 80 90 100
at start after 4 hours
What is the growth rate of the pollen tubes?
A 5 µmh–1 B 10 µmh–1 C 5 mmh–1 D 10 mmh–1
312 9700/11/M/J/20 Dr.Dawood

5
5 The table shows a comparison between two features of a typical eukaryotic cell and a typical
prokaryotic cell.
Which row shows the correct comparison between these cells?
presence of centromeres presence of telomeres

eukaryotic prokaryotic eukaryotic prokaryotic
cell cell cell cell
A key
B = present
C = not present
D
6 The flow diagram shows the results of a number of tests on a solution of biochemicals.
solution of biochemicals
Benedict’s test non-reducing iodine test biuret test

blue sugar test blue-black purple
yellow
Which substances are present in the solution?
A amylose, amylopectin and lipid

B glucose, starch and catalase
C sucrose, amylase and triglyceride
D sucrose, starch and catalase
7 Maltose and sucrose are disaccharides. Maltose is formed from two molecules of glucose, whilst
sucrose is formed from fructose and glucose.
Which row shows the molecular formulae of the two disaccharides?
maltose sucrose
A C12H22O11 C12H22O11
B C12H22O11 C12H24O12
C C12H24O12 C12H22O11
D C12H24O12 C12H24O12
Dr.Dawood 9700/11/M/J/20 313

6
8 The diagrams show short sections of some common polysaccharides and modified
polysaccharides.
CH2OH H NHCOCH3 CH2OH H OH

O O
H O H H O H
H OH H H OH H
O OH H H O O OH H H O
H H H H
O O
H NHCOCH3 CH2OH H OH CH2OH
1 2
CH2OH CH2OH
O H H O
H H
H H
O OH H O OH H O
H OH H OH
The polysaccharides can be described as:
● F is composed of β-glucose monomers with 1,4 glycosidic bonds
● G is composed of α-glucose monomers with 1,4 glycosidic bonds
● H is composed of N-acetylglucosamine monomers with β-1,4 glycosidic bonds.
Which row correctly matches the numbered diagrams to the descriptions of the polysaccharides?
polysaccharide polysaccharide polysaccharide

F G H
A 2 1 3
B 2 3 1
C 3 1 2
D 3 2 1
9 Which molecules contain at least two double bonds?
1 unsaturated fatty acid

2 collagen
3 haemoglobin
314 9700/11/M/J/20 Dr.Dawood

7
10 The diagram shows a protein molecule.
globular
head
key
long polypeptide
short polypeptide
Two long polypeptides each form α-helices for much of their length and these twist together into a
fibre.
At one end, each of these polypeptides coils into a globular head.
Two short polypeptides bind to each globular head.
What describes the protein structure of this molecule?
A quaternary structure because each molecule consists of six polypeptides
B secondary structure because the long polypeptides form α-helices
C tertiary structure because the α-helices form a fibre

D tertiary structure because the heads form globular proteins
11 Which types of bond will keep a folded protein in its precise shape for the longest time as the
temperature rises?
A disulfide
B hydrogen
C hydrophobic interactions
D ionic
Dr.Dawood 9700/11/M/J/20 315

8
12 Protease enzymes are found in many locations inside and outside the cells. Four of these
locations are listed.
1 lysosomes
2 lumen of the stomach
3 at a telophase spindle
4 mucus in the trachea
Which of these locations are sites of intracellular hydrolysis?
A 1, 2, 3 and 4
B 1, 2 and 4 only
C 1 and 3 only
D 2 and 4 only
13 An enzyme is modified for industrial use. It has a lower Michaelis-Menten constant (Km) than the
unmodified enzyme.
What is true of the modified enzyme?
A It is more specific.
B It has a higher affinity for its substrate.
C It has a lower maximum rate of reaction (Vmax).
D It needs more substrate to become saturated.
14 A decrease in some factors will increase the fluidity of the cell surface membrane.
Which pair of factors, when decreased, will increase the fluidity of the cell surface membrane?
a decrease in
A • distance between phospholipid molecules

• proportion of short fatty acid chains
B • distance between phospholipid molecules
• temperature
C • proportion of phospholipids with saturated fatty acid chains
• proportion of long fatty acid chains
D • proportion of phospholipids with unsaturated fatty acid chains
• temperature
316 9700/11/M/J/20 Dr.Dawood

9
15 The diagram shows a cell surface membrane.
2
3
Which statements about the labelled molecules in the membrane are correct?
● 1 is involved in the diffusion of ions.

● 2 is involved in facilitated diffusion.
● 3 is involved in the recognition of antigens.
● 4 is involved in membrane fluidity.
A 1, 2 and 3 B 1 and 3 only C 1 and 4 D 2 and 4 only
16 Equal sized potato pieces were placed into test-tubes containing equal volumes of different
concentrations of sucrose solution and left for 30 minutes. All other variables were controlled.
After 30 minutes, the potato piece in one of the concentrations of sucrose solution had not
changed in size.
What can be concluded from this result?
1 There is no net movement of water into or out of the potato.

2 The water potential of the potato is the same as the water potential of the sucrose
solution.
3 The concentration of sucrose in the potato is the same as the concentration of the
sucrose solution.
Dr.Dawood 9700/11/M/J/20 317

10
17 Which feature of stem cells enables them to replace cells in tissues such as the skin?
A They are undifferentiated cells that are present at birth.

B They differentiate to form skin cells.
C They divide by mitosis to supply some cells that can differentiate.
D They have the full number of chromosomes.
18 During prophase, a scientist stains the chromosomes of a diploid animal cell with a fluorescent
dye to stain telomeres. This cell has 32 chromosomes.
How many telomeres will the scientist observe?
A 32 B 64 C 96 D 128
19 The diagram shows the cell cycle.
During which phase do chromosomes condense and become visible?
cytokinesis
C A
20 What is correct for thymine?
joins its
has a single ring
is a pyrimidine complementary base
structure
with 3 hydrogen bonds
A key
B = correct
C = incorrect
D
318 9700/11/M/J/20 Dr.Dawood

11
21 A short piece of DNA 15 base pairs long was analysed to find the number of nucleotide bases in
each of the polynucleotide strands. Some of the results are shown below.
number of nucleotide bases
A C G T
strand 1 6 3
strand 2 4
How many nucleotides containing guanine were present in strand 1?
A 2 B 3 C 4 D 6
15
22 Scientists grew bacteria in a medium containing heavy nitrogen, N, as the only source of
nitrogen.
After many generations, all of the bacterial DNA contained heavy nitrogen.
These bacteria were then moved from the heavy nitrogen medium into a medium with only light
nitrogen, 14N.
Some bacteria were collected from each of the next three generations and their DNA was
analysed.
Hybrid DNA contains both heavy and light nitrogen.
Which row shows the correct DNA of the first and third generations?
DNA of first generation DNA of third generation
A all hybrid half hybrid, half light
B all hybrid one quarter hybrid,

three quarters light
C half hybrid, half heavy half hybrid, one quarter
heavy, one quarter light
D half hybrid, half light one quarter hybrid,
three quarters light
Dr.Dawood 9700/11/M/J/20 319

12
23 A population of bacteria is exposed to the antibiotic penicillin. Most of the bacteria die.
However, some bacteria in the population have an allele coding for an enzyme that breaks down
penicillin. These bacteria are able to survive.
Which could explain how these bacterial cells acquired this allele?
1 An error during DNA replication.

2 An error during transcription.
3 An error during translation.
24 A dicotyledonous leaf has a palisade mesophyll layer that is approximately twice as thick as the
spongy mesophyll layer.
Which plan diagram is correct?
A B
upper surface upper surface
of leaf of leaf
xylem phloem
phloem xylem
C D
upper surface upper surface
of leaf of leaf
xylem phloem
phloem xylem
25 A number of processes contribute to maintaining a water potential gradient in plants allowing

water to reach the highest parts of a plant.
Which processes are responsible for maintaining this water potential gradient?
1 capillarity
2 osmosis
3 transpiration
320 9700/11/M/J/20 Dr.Dawood

13
26 What is a correct statement about the movement of substances absorbed by roots?
A Ions have to pass through cell walls to cross the endodermis.

B Ions move through the symplastic pathway only until they reach the Casparian strip.
C Soil water has a more negative water potential than the xylem sap.
D Water passes through the symplastic pathway along a water potential gradient.
27 Which arrangement of four molecules of water shows how water may cohere when moving up a
xylem vessel?
A B
key
oxygen atom
hydrogen atom
hydrogen bond
C D
28 Which statement about sucrose loading into companion cells and then into the phloem sieve tube
element is not correct?
A Hydrogen ions and sucrose molecules move into the companion cells using a carrier protein.
B Hydrogen ions are pumped out of the companion cells by active transport.
C Sucrose molecules are carried into the companion cells down the concentration gradient for
sucrose.
D Sucrose molecules move from a companion cell into the sieve tubes of the phloem through
plasmodesmata.
29 What explains why the left and right sides of the heart contract simultaneously?
A Both atria have a sinoatrial node.

B Both sides of the heart are supplied by the same coronary artery.
C Purkyne tissue links the two sides of the heart.
D There is no barrier to electrical excitation between two sides of the heart.
Dr.Dawood 9700/11/M/J/20 321

14
30 The statements list some of the events in the cardiac cycle. They are not in the correct order.
1 The impulse travels through Purkyne tissue.

2 A wave of excitation sweeps across the atria.
3 The atrioventricular node delays the impulse for a fraction of a second.
4 The sinoatrial node contracts.
5 The wave of excitation sweeps upwards from the base of the ventricles.
6 The ventricles contract.
7 The atria contract.
Which statement describes the third of these events to occur in the cardiac cycle?
A 1 B 3 C 4 D 7
31 The diagram shows pressure changes in different parts of the heart during one cardiac cycle.
During which period are the semilunar valves open and the atrioventricular valves closed?
A B C D
pressure key
aortic pressure
ventricle pressure
atrial pressure
time
322 9700/11/M/J/20 Dr.Dawood

15
32 Which diagram shows the events that occur during transport of carbon dioxide by the blood?
A B
CO2 CO2
tissue fluid tissue fluid
plasma plasma
CO2 + water CO2 + CO2 +

carbonic carbaminohaemoglobin water
anhydrase haemoglobin
carbonic
H+ + HCO3– H2CO3 CO2 + anhydrase
haemoglobin
H2CO3
carbamino-
haemoglobin H+ + HCO3–
red blood red blood
cell cell
C D
CO2 CO2
tissue fluid tissue fluid
plasma plasma
CO2 + CO2 + CO2 + CO2 +

water haemoglobin H2CO3
haemoglobin water
carbonic
anhydrase H+ +
carbamino- carbonic HCO3–
H+ + HCO3– H2CO3 carbaminohaemoglobin anhydrase
haemoglobin
red blood red blood

cell cell
Dr.Dawood 9700/11/M/J/20 323

16
33 Which structures are found in bronchi?
smooth muscle
A C
B
goblet
cartilage
D cells
34 Which tissue in the respiratory system is correctly linked to its function?
tissue function
A cartilage stretch and recoil to force air out
B ciliated epithelium gives protection from suspended particles in the air
C elastic fibres contract and relax to adjust diameter of bronchioles
D smooth muscle keeps trachea and bronchi open
35 Chronic obstructive pulmonary disease (COPD) includes emphysema.
Which effects does emphysema have on gaseous exchange?
1 surface area to volume ratio of lungs decreases

2 distance of the diffusion pathway decreases
3 volume of oxygen diffused per unit time decreases
324 9700/11/M/J/20 Dr.Dawood

17
X
1 2 contaminated
bacterium protoctist water
pathogen method
of
transmission
3 Z Y
virus using a coughs and
vector sneezes
Which row matches the correct number for the pathogen with the correct letter for their mode of
transmission for cholera and measles?
cholera measles
A 1 and X 3 and Y
B 1 and Y 3 and Y
C 2 and X 2 and Z
D 3 and Z 1 and X
37 Which factors would increase the global distribution of malaria?
1 a fall in annual rainfall

2 an increase in the use of antibiotics
3 a rise in global air temperatures
4 increasing irrigation of land for farming
A 1, 2 and 3 B 1 and 2 only C 2, 3 and 4 D 3 and 4 only
Dr.Dawood 9700/11/M/J/20 325

18
38 The antibiotic teixobactin was discovered in January 2015. Teixobactin kills some bacteria such
as Staphylococcus and Mycobacterium.
Most antibiotics work by binding to proteins. Teixobactin binds to lipids that are used in the
synthesis of bacterial cell walls. This means that it is unlikely that bacteria will quickly develop
resistance to teixobactin.
Which statements explain why bacteria are unlikely to quickly develop resistance to teixobactin?
1 A mutation in the gene coding for a protein allows selection for resistance.
2 Teixobactin binds to a lipid rather than to a protein.
3 The structure of a lipid is not encoded by DNA.
39 Which row correctly describes the type of immunity gained from being injected with an antitoxin?
active artificial passive natural
A key
B = correct
C = not correct
D
40 Where are antibodies found during an immune response?
on surface of in blood
pathogen plasma
A key
B = antibodies found
C = antibodies not found
D
326 9700/11/M/J/20 Dr.Dawood

BIOLOGY 9700/12
1 hour

*4216422056*

Soft clean eraser
INSTRUCTIONS
INFORMATION
IB20 06_9700_12/3RP
Dr.Dawood 327
2
1 What is the definition of the resolution of a light microscope?
A the degree of sharpness produced by the microscope

B the greatest distance between two objects visible in the same field of view
C the minimum distance that allows two objects to be viewed as separate
D the size of the smallest object visible using the microscope
2 The electron micrograph shows a type of virus at a magnification of ×30 000.
What is the length of the virus?
A 2.2 × 103 nm
B 2.2 × 102 nm
C 2.2 × 101 nm
D 2.2 × 100 nm
3 Which row correctly shows a feature of a cell structure?
site of protein
makes lysosomes
synthesis
A smooth endoplasmic rough endoplasmic
reticulum reticulum
B ribosomes Golgi body

C rough endoplasmic ribosomes
reticulum
Golgi body smooth endoplasmic
D
reticulum
328 9700/12/M/J/20 Dr.Dawood

3
animal cell.


X a double membrane with many pores
Which student correctly matched the numbered function with the appearance of the cell
structure?
1 2 3
A W X Y
B W Z W
C Y W Z
D Y Z Z
5 The features of some cells and cell structures that make ATP are listed.
1 has outer boundary membrane and folded inner membrane

2 has peptidoglycan cell wall outside an outer boundary membrane
3 has a double boundary membrane and stacks of inner membranes
Which row identifies these components?
1 2 3
A bacterium chloroplast mitochondrion

B chloroplast bacterium mitochondrion
C chloroplast mitochondrion bacterium
D mitochondrion bacterium chloroplast
Dr.Dawood 9700/12/M/J/20 329

4
6 Mitochondria are thought to have evolved from prokaryotic cells that were ingested by an
ancestral cell.
Which feature have these prokaryotes lost during their evolution into mitochondria?
A cell wall
B circular chromosome
C internal membranes
D ribosomes
7 A student carried out the Benedict’s test on a sample and got a negative result.
What should the student do to confirm there are no sugars present in the sample?
A boil the sample for 5 minutes then repeat the Benedict’s test
B boil with alkali, neutralise with hydrochloric acid and repeat the Benedict’s test
C boil with hydrochloric acid, neutralise with alkali and repeat the Benedict’s test
D repeat the Benedict’s test but add more Benedict’s reagent
8 The diagrams show three hexoses.
CH2OH CH2OH
O
C O C O
H H HOH2C OH H OH
H H
C C C C C C
OH H H OH OH H
HO OH H CH2OH HO H
C C C C C C
H OH OH H H OH
1 2 3
In which carbohydrates do these three hexoses occur?
sucrose cellulose glycogen
A 1 2 3
B 1 3 2
C 2 3 1
D 3 2 1
330 9700/12/M/J/20 Dr.Dawood

5
9 The diagram shows part of the chemical structure of a naturally occurring polysaccharide.
COOH CH2OH COOH CH2OH

O O O O O O
OH O OH
HO HO HO
OH HN CH3 OH HN CH3
O O
What types of glycosidic bonds are present?
A α-1,3 and α-1,4
B α-1,4 and α-1,6
C β-1,3 and β-1,4
D β-1,4 and β-1,6
10 What is the maximum number of water molecules produced when a triglyceride is synthesised?
A 3 B 2 C 1 D 0
11 What occurs during the formation of a peptide bond between two amino acids?
A OH is removed from COOH and H is removed from an R group.

B OH is removed from COOH and H is removed from NH2.
C H is removed from COOH and OH is removed from an R group.
D O is removed from COOH and 2H is removed from NH2.
Dr.Dawood 9700/12/M/J/20 331

6
12 The diagram represents roles of water in living organisms.
1
carries dissolved
substances
role of
water in living
organisms 2
3 provides a constant
temperature control environment for
due to evaporation aquatic organisms
Which roles are dependent upon hydrogen bonds between water molecules?
13 The diagram shows a metabolic pathway.
enzyme 1 enzyme 2 enzyme 3

reactant substance X substance Y end product
What would be the effect of adding a small amount of a non-competitive inhibitor of enzyme 2?
A Enzyme 2 would be partially denatured.

B Substance X would increase in concentration.
C Substance Y would no longer be formed.
D The initial reactant would no longer be metabolised.
14 Two enzymes are added to a solution containing a low concentration of a substrate that they can
both use.
Which statement is correct?
A Both enzymes will use equal amounts of the substrate.

B Neither enzyme will be able to use the substrate.
C The enzyme with the lower Vmax will use less of the substrate than the other enzyme.
D The enzyme with the lower Vmax will use more of the substrate than the other enzyme.
332 9700/12/M/J/20 Dr.Dawood

7
15 The diagram shows the fluid mosaic model of membrane structure.
Structures 1, 2, 3 and 4 are types of molecule.
2 3
Which types of molecules are always identical?
A 1, 2 and 3 B 1 and 4 C 2 and 3 only D 4 only
16 What is the role of G protein in cell signalling?
A to act as a membrane-bound enzyme

B to act as a switch releasing a second messenger
C to amplify the original signal
D to change the shape of the protein receptor
17 When a small quantity of phospholipid is added to a test-tube of water and then shaken
vigorously, an emulsion is formed by small droplets called liposomes.
Which diagram shows the arrangement of phospholipid molecules in a cross-section of a

liposome?
A B C D
Dr.Dawood 9700/12/M/J/20 333

8
18 What are the features of facilitated diffusion?
1 It uses protein channels in the membrane and is driven by the energy from ATP.
2 It moves molecules from regions of higher concentration to lower concentration and
is driven by the kinetic energy of the molecules which are diffusing.
3 It uses protein channels in the membrane, and the maximum rate of diffusion
depends on the number of these channels.
19 Which description of chromosome structure is correct?
A A chromosome at the beginning of interphase consists of two identical chromatids, each

containing one linear molecule of DNA.
B Telomeres are lengths of non-coding DNA found at one end of each chromatid to prevent
loss of genes during cell division.
C The two identical chromatids of a chromosome are held together by a centromere in which
there is no DNA.
D The very long DNA molecule of each chromatid is coiled and held together by proteins called
histones.
20 Which processes involve mitosis?
clonal selection forming cells at the

of T-lymphocytes tip of a growing root
B
A C
replacing skin cells

damaged by an injury
334 9700/12/M/J/20 Dr.Dawood

9
21 A drug has been developed to treat certain types of cancer. It prevents mitosis by binding to the
spindle and preventing sister chromatids being separated and moving to opposite poles of the
cell.
The photomicrograph shows cells in different phases of mitosis.
3
4
What represents the stages of mitosis that will be able to occur in a cell which is entering
prophase when treated with this drug?
A 1 and 2 B 2 and 3 C 2 only D 3 and 4
22 Some viruses have single-stranded DNA as their genetic material. This DNA molecule has to be
folded to fit in the protein coat.
Which statements about single-stranded DNA are correct?
1 Single-stranded DNA cannot replicate semi-conservatively.

2 If only the percentage of cytosine is known, then the percentage of guanine can be
calculated, but the percentage of adenine and thymine cannot be calculated.
3 Hydrogen bonds may be present within the DNA molecule.
23 How many statements are true for semi-conservative replication of DNA in a eukaryotic cell?
1 The process takes place in the nucleus.

2 Adenine will line up against uracil on the complementary strand.
3 Each new molecule will contain one strand of the original molecule.
4 If the original molecule contained 40% guanine each new molecule will contain 20%
guanine.
A 1 B 2 C 3 D 4
Dr.Dawood 9700/12/M/J/20 335

10
24 Part of the nucleotide sequence of an mRNA molecule is shown, with spaces between the
codons.
CAG UAC AGC AAU CUA UAA
The translation of the codons is provided.
amino acid
codon
or STOP
AAU asn
AGC ser
CAG gln
CUA leu
UAA STOP
UAC tyr
UAU tyr
Which events will cause the termination of polypeptide synthesis during translation?
1 Deletion of C from the leu codon.

2 Deletion of C from the tyr codon.
3 The ribosome reaching the UAA codon.
25 External factors change the rate of transpiration, which also affects the water potential gradient of
cells in the leaf.
Which combination is correct?
external factor changing the water potential gradient

rate of transpiration in the leaf
A decreasing temperature increases

B decreasing wind speed increases
C increasing relative humidity decreases
D increasing sunlight decreases
336 9700/12/M/J/20 Dr.Dawood

11
26 The photomicrograph shows a transverse section through a leaf.
×50
Which features of a xerophytic leaf are visible in this section?
1 sunken stomata
2 two layers of epithelium
3 thick cuticle
4 small surface area to volume
27 Which changes occur as carbohydrates move out of a root cell into a phloem sieve tube?
water potential in a volume of liquid

phloem sieve tube in phloem
becomes sieve tube
A less negative decreases

B less negative increases
C more negative decreases
D more negative increases
Dr.Dawood 9700/12/M/J/20 337

12
28 The photomicrograph shows three white blood cells labelled X, Y and Z.
Z
Y
A lymphocyte monocyte neutrophil

B lymphocyte neutrophil monocyte
C monocyte neutrophil lymphocyte
D neutrophil monocyte lymphocyte
29 The graph represents data on blood vessels and blood flow.
key
X
Y
Z
arteries small capillaries small veins

arteries veins
Which row correctly identifies the curves?
speed of pressure of total cross-

blood flow blood sectional area
A X Y Z
B X Z Y
C Y Z X
D Z X Y
338 9700/12/M/J/20 Dr.Dawood

13
30 Which components of blood are present in lymph?
white blood sodium

proteins
cells ions
A key
B = present
C = not present
D
31 What correctly describes the significance of the increase of the red blood cell count of humans
who move from living at low altitude to high altitude?
A After a few weeks at high altitude, the number of red blood cells increases to compensate for
the lower availability of oxygen in the air.
B At high altitude, the bone marrow produces more red blood cells to provide binding sites for
the increased number of oxygen molecules available.
C At high concentrations of oxygen in the blood, a cytokine stimulates the production of red
blood cells to increase the oxygen-carrying capacity of the blood.
D After only a few days at high altitude the number of red blood cells increases considerably to
compensate for the lower availability of oxygen in the air.
32 Which structures of the human gas exchange system are supported by cartilage?
bronchus bronchiole trachea
A key
B = cartilage present
C = cartilage not present
D
Dr.Dawood 9700/12/M/J/20 339

14
33 Carbon monoxide, nicotine and tar are components of tobacco smoke.
Which row correctly describes their effect on a smoker’s body?
carbon monoxide nicotine tar

A causes loss of consciousness increases the destroys cilia on cells
at very low concentrations diameter of lining the airways
blood vessels
B forms a stable increases blood stimulates goblet cells

compound with pressure to secrete mucus
haemoglobin
C forms increases the settles on cells

carbaminohaemoglobin diameter of the lining the airways
coronary artery
D forms decreases the contains carcinogens

carboxyhaemoglobin heart rate
34 Which statements about chronic obstructive pulmonary disease (COPD) are correct?
1 The disease can often be reversed by treatment.

2 The patient’s symptoms normally do not change.
3 The patient is normally over 30 years old.
4 The patient coughs frequently, producing a lot of mucus.
35 Which of these causative agents of disease can be transmitted by droplet infection?
1 Vibrio
2 Mycobacterium
3 Morbillivirus
340 9700/12/M/J/20 Dr.Dawood

15
36 The table compares total antibiotic use (X) and the percentage of antibiotic-resistant pneumonia
cases (Y) in five countries.
(X) total antibiotic use (Y) percentage of

country / defined dose per 1000 penicillin-resistant
people per day pneumonia cases
Austria 13 10
Denmark 11 4
Iceland 17 15
Spain 30 50
USA 24 33
What is supported by the data?
A When X decreases there is an increase in Y.

B When X increases there is an increase in Y.
C When X increases it causes an increase in Y.
D There is no relationship between X and Y.
37 Which statement about the development of resistance to antibiotics in bacteria is correct?
A All mutations in bacteria result in resistance to antibiotics.

B Antibiotics increase the rate of mutation in bacteria.
C Mutations leading to antibiotic resistance only occur when antibiotics are used to treat
pathogenic bacteria.
D The proportion of antibiotic-resistant bacteria in a population only increases if the antibiotic is
used.
38 A blood cell count can indicate how many white blood cells there are in the blood.
Where else in the body are white blood cells found?
1 bone marrow
2 lymph
3 lungs
Dr.Dawood 9700/12/M/J/20 341

16
39 Myasthenia gravis is a disease that results from the immune system failing to distinguish between
self and non-self. Antibodies bind to a component of the junctions between a muscle and its
nerve.
What correctly describes Myasthenia gravis?
A Impulses in the nerve to the affected muscle cannot be blocked.

B The affected muscle cannot be repeatedly stimulated.
C The affected muscle is permanently stimulated.
D The nerve to the affected muscle does not carry any nerve impulses.
40 A monoclonal antibody, specific for a virus, was treated with an enzyme to break the bonds
between the variable and constant regions.
The separated variable and constant regions were then added to cells infected with the virus.
1 The constant regions would bind to different parts of the virus antigens.
2 The viruses could be engulfed by phagocytes if they were present.
3 The variable regions would all bind to the same part of the virus antigens.
342 9700/12/M/J/20 Dr.Dawood

BIOLOGY 9700/13
1 hour

*7008547425*

Soft clean eraser
INSTRUCTIONS
INFORMATION
IB20 06_9700_13/3RP
Dr.Dawood 343
2
1 A student was given a photomicrograph of a cell and told the magnification of the image.
The student was asked to calculate the actual size of the cell.
Which row in the table explains how to do this?
measure the convert to µm by rearrange the

image in multiplying by formula to
M
A cm 1.0 × 104
I
B cm 1.0 × 106 I×M
I
C mm 1.0 × 103
M
D mm 1.0 × 104 I×M
2 The electron micrograph shows part of a eukaryotic cell.
Which cell structure is a site of protein synthesis?
344 9700/13/M/J/20 Dr.Dawood

3
3 Some stains can be used to identify cell structures in living cells.
A dilute solution of one stain causes the whole cell to appear blue.
The blue colour rapidly disappears in most cell structures. Those cell structures that release
energy stay blue.
Which type of cell structure is likely to stay blue?
A endoplasmic reticulum
B Golgi body
C lysosome
D mitochondrion
4 A molecule of carbon dioxide is in the centre of a mitochondrion.
Assuming there are no other cell structures in its path, how many phospholipid layers will the
carbon dioxide molecule have to pass through in order to leave the cell?
A 2 B 3 C 6 D 8
5 Which row identifies the type of ribosome found in each of the different structures?
cytoplasm of
chloroplast prokaryotic cell mitochondrion
eukaryotic cell
A 70S 70S 80S 70S

B 70S 80S 70S 70S
C 80S 70S 80S 80S
D 80S 80S 70S 80S
Dr.Dawood 9700/13/M/J/20 345

4
6 The colour of a positive Benedict’s test is due to the formation of copper oxide. The mass of
copper oxide is proportional to the mass of reducing sugar present.
Samples of fruit juice were tested for the presence of reducing sugars and non-reducing sugars
using the Benedict’s test.
The table shows the mass of copper oxide after boiling with Benedict’s solution and after acid
hydrolysis and boiling with Benedict’s solution.
Which sample contained the most non-reducing sugar?
mass of copper oxide / mg

after boiling with after acid hydrolysis and
Benedict’s solution boiling with Benedict’s solution
A 20 20
B 30 45
C 50 55
D 65 75
7 Which polysaccharides contain 1, 4 and 1, 6 glycosidic bonds?
1 amylopectin
2 amylose
3 cellulose
4 glycogen
346 9700/13/M/J/20 Dr.Dawood

5
8 The diagram shows a small part of a polypeptide.
CH3 CH3
H O CH
H
CH N C CH
N C CH N C
H H
O CH CH3 O
CH2
CH3
What would the products be if the part shown was completely hydrolysed?
H O H O H O
A H N C C H N C C H N C C
H OH OH CH OH
CH CH3 CH3 CH3
CH2
CH3
H H O H H O H H O
B N C C N C C N C C
H H H H H H CH H
CH CH3 CH3 CH3
CH2
CH3
H O H O H O
C N C C N C C N C C
H H OH H OH H CH OH
CH CH3 CH3 CH3
CH2
CH3
H H O H H O H H O
D N C C N C C N C C
H H OH H OH H CH OH
CH CH3 CH3 CH3
CH2
CH3
Dr.Dawood 9700/13/M/J/20 347

6
9 The enzyme trypsin hydrolyses proteins to amino acids. Trypsin does not function when the pH is
very low as its 3D shape would be changed.
What explains this change in 3D shape?
A Hydrogen ions attach themselves to negatively charged R groups.

B Hydrogen ions disrupt disulfide bonds.
C Hydrogen ions increase hydrogen bonding between amino acids.
D Hydrogen ions reduce the affinity of hydrophilic R groups for water.
10 The flow chart shows some of the steps in the formation of collagen.
three polypeptide chains
held together by X bonds
triple helix
held together by intermolecular bonds
Which row correctly identifies X, Y and Z?
X Y Z
A disulfide fibres fibrils

B hydrogen fibrils fibres
C hydrogen microfibrils fibres
D peptide and hydrogen fibres microfibrils
11 Which molecules contain at least two double bonds?
1 saturated fatty acid

2 collagen
3 haemoglobin
348 9700/13/M/J/20 Dr.Dawood

7
12 Two experiments, X and Y, were carried out using an enzyme from humans.
Experiment X was carried out at a constant temperature of 37 °C. During experiment Y, the
temperature was increased from 37 °C to 80 °C. All other factors were kept the same.
Which graph shows the results?
A B
X X
product product
concentration Y concentration
0 1 2 3 4 5 0 1 2 3 4 5
time / minutes time / minutes
C D
X
Y
product X product
Y
0 1 2 3 4 5 0 1 2 3 4 5
time / minutes time / minutes
13 What affects the rate of an enzyme-catalysed reaction when in the presence of a

non-competitive inhibitor?
1 enzyme concentration
2 inhibitor concentration
3 substrate concentration
14 What describes the fluid-mosaic model of membrane structure?
A Cholesterol makes the membrane more fluid.

B Fluids can cross the membrane by diffusion or osmosis.
C Proteins act as receptors for cell signalling.
D Proteins and phospholipids move and change places.
Dr.Dawood 9700/13/M/J/20 349

8
15 Blocks of agar are stained with a pH indicator and used to investigate the diffusion of an acid
solution.
Which block would completely change colour the fastest?
A 1mm × 1mm × 1 mm
B 1mm × 0.25mm × 0.25 mm
C 1mm × 0.5mm × 0.5 mm
D 2mm × 0.5mm × 0.5 mm
16 The diagram shows the water potential of three adjacent plant cells, P, Q and R.
–198 kPa Q
R –224 kPa
–212 kPa
Which shows the net movement of water between cells P, Q and R?
A P → Q and P → R and R → Q
B P → Q and P → R
C Q → P and Q → R and R → P
D Q → P and R → P
350 9700/13/M/J/20 Dr.Dawood

9
17 Which row correctly describes parts of chromosome structure present during mitosis?
centromere chromatid telomere

A region of a single DNA region of DNA with
chromosome polynucleotide with many cytosine and
with no DNA histone proteins guanine bases
B region of non-coding DNA double-stranded region of DNA with

holding two DNA molecule with many short repeated
chromatids together histone proteins sequences of bases
C region of DNA with no DNA molecule coiled region of DNA with no

histone proteins that allows round histone proteins proteins that protects
separation of chromatids to form a chain of the end of a chromatid
during anaphase nucleosomes
D region that attaches one of two identical region of non-coding

to spindle microtubules DNA molecules that DNA holding the
and divides was replicated ends of the
during prophase during interphase chromatids together
18 The diagram shows the relative time taken for each stage in the cell cycle.
X
Y
Which row identifies the correct sequence of the stages in the cell cycle?
cytokinesis interphase mitosis
A X Y Z
B X Z Y
C Y Z X
D Z X Y
Dr.Dawood 9700/13/M/J/20 351

10
19 Scientists have made a nucleic acid, HNA, that has a sugar with the same number of carbon
atoms as glucose instead of deoxyribose. Although genetic information can be stored by HNA,
naturally occurring DNA polymerase cannot replicate HNA.
Which statements could explain why naturally occurring DNA polymerase cannot replicate HNA?
1 DNA polymerase cannot form bonds between the sugars of two HNA nucleotides.
2 DNA polymerase cannot form hydrogen bonds between two HNA nucleotides.
3 HNA nucleotides do not fit into the active site of DNA polymerase.
4 The shape of an HNA nucleotide is slightly larger than that of a DNA nucleotide.
20 Which statements about the nucleotide containing uracil are correct?
1 Uracil is a pyrimidine.
2 The carbohydrate is always ribose.
3 Base pairing occurs with 3 hydrogen bonds.
21 DNA replication involves several stages.
1 Each strand of DNA double helix acts as a template for the opposite strand.
2 The enzyme DNA polymerase links bases together.
3 Hydrogen bonds between bases A and T and between C and G are broken.
Which statements about DNA replication are correct?
352 9700/13/M/J/20 Dr.Dawood

11
22 The sequence of bases in mRNA for the first eight amino acids in the β-polypeptide of adult
haemoglobin is:
GUG–CAC–CUG–ACU–CCU–GAG–GAG–AAG.
In haemoglobin C, which is a cause of haemolytic anaemia, the sequence is:
GUG–CAC–CUG–ACU–CCU–AAG–GAG–AAG.
The coding for seven of the amino acids is listed.
amino acid DNA triplet
glu CTC
his GTG
leu GAG
lys TTC
pro GGA
thr TGA
phe AAG
Which change occurs to the amino acid sequence of adult haemoglobin to make haemoglobin C?
A Histidine is changed to leucine.

B Proline is changed to threonine.
C Glutamic acid is changed to lysine.
D Leucine is changed to phenylalanine.
23 Some antibiotics kill prokaryotes by binding to RNA polymerase.
What effect will this have on protein synthesis?
A Codons on mRNA will be unable to hydrogen bond to complementary anticodons on tRNA.

B Condensation reactions joining RNA nucleotides will not take place to form mRNA.
C DNA will not unwind and unzip to allow for base pairing with RNA nucleotides.
D Free RNA nucleotides will not base pair to exposed bases on the DNA template strand.
Dr.Dawood 9700/13/M/J/20 353

12
24 The diagrams show transverse sections through parts of plants.
Which of the labelled regions contains cells which are dead?
C
A
D
25 The diagram shows the distribution of tissues in part of a transverse section through a plant
organ.
2
3
Which row correctly identifies tissues 1, 2 and 3?
1 2 3
A cortex endodermis phloem

B cortex epidermis xylem
C endodermis epidermis pith
D pith endodermis phloem
354 9700/13/M/J/20 Dr.Dawood

13
26 The circumference of a tree stem was measured continually for 48 hours.
The results are shown on the chart recording.
circumference
of tree stem
12 00 24 00 12 00 24 00 12 00
time of day
What explains the changes in circumference recorded during the 48 hours?
A Adhesion forces decrease during the night.

B Cohesive tension forces increase during the day.
C Mass flow of sucrose increases during the night.
D Root pressure decreases during the day.
27 Which description of movement in phloem is correct?
A Adding sucrose to a sieve tube element increases its water potential so that water enters and
increases the hydrostatic pressure.
B At a sink, such as a storage organ, sucrose is removed from a sieve tube element and
polymerised into starch.
C At a source, such as a photosynthesising leaf, sucrose enters a sieve tube element by
facilitated diffusion.
D At a source, sucrose is loaded into a companion cell using a protein that carries both
hydrogen ions and sucrose molecules.
Dr.Dawood 9700/13/M/J/20 355

14
28 Which statements about blood vessels are correct?
1 Collagen fibres in the walls of arteries and veins prevent overstretching.

2 Elastic fibres in large arteries allow stretching during ventricular systole.
3 Smooth muscle in arteries controls the distribution of blood to different parts of the
body.
4 Veins have valves because their walls are thin.
A 1, 2, 3 and 4
B 1, 2 and 3 only
C 2 and 4 only
D 3 and 4 only
29 The photomicrograph shows three white blood cells labelled X, Y and Z.
X
Z
A lymphocyte neutrophil monocyte

B lymphocyte monocyte neutrophil
D neutrophil lymphocyte monocyte
30 The enzyme carbonic anhydrase catalyses the reaction:
CO2 + H2O → HCO3– + H+
Which statements describe the role of the enzyme carbonic anhydrase?
1 to speed up the decrease in pH of blood in the presence of carbon dioxide

2 to facilitate the Bohr effect in haemoglobin
3 to speed up the reaction between carbon dioxide and water
A 1, 2 and 3 B 1 only C 2 only D 3 only
356 9700/13/M/J/20 Dr.Dawood

15
31 The graph shows the oxygen dissociation curves of adult haemoglobin at two partial pressures of
carbon dioxide W and X.
100
80
curve X
60
percentage curve W
saturation of
haemoglobin
with oxygen
40
20
0
0 1 2 3 4 5 6 7 8 9 10 11 12
Which pair of statements are correct?
1 Curve W shows the oxygen dissociation curve at a higher concentration of carbon

dioxide than curve X.
2 Curve X shows the oxygen dissociation curve at a higher concentration of carbon
dioxide than curve W.
3 At a partial pressure of oxygen of 7.0 kPa the haemoglobin from curve W has a
higher affinity for oxygen than haemoglobin from curve X.
4 At a partial pressure of oxygen of 7.0 kPa the haemoglobin from curve X has a
higher affinity for oxygen than haemoglobin from curve W.
Dr.Dawood 9700/13/M/J/20 357

16
32 A person has two blood tests one month apart. The number of each type of cell in a fixed sample
size is counted.
type of cell first test after one month
red blood cells normal higher

lymphocytes normal higher
What could this suggest about the person based on the results after one month?
body temperature moved to higher ATP synthesis

higher altitude in cells is higher
A no no yes
B no yes no
C yes no no
D yes yes yes
33 A student was asked to describe the differences between four microscope slides of sections
taken from different parts of the gas exchange system.
slide 1 not present: cartilage, glands

present: few goblet cells, ciliated epithelial cells, smooth muscle
slide 2 present: incomplete cartilage rings, glands, goblet cells, ciliated epithelial cells, smooth
muscle
slide 3 not present: cartilage, glands, goblet cells, smooth muscle
present: squamous epithelial cells
slide 4 present: plates of cartilage, glands, goblet cells, ciliated epithelial cells, smooth muscle
Which is the correct identification of the parts of the gas exchange system?
slide 1 slide 2 slide 3 slide 4
A alveolus bronchiole bronchus trachea

B bronchiole bronchus alveolus trachea
C bronchiole trachea alveolus bronchus
D bronchus trachea bronchiole alveolus
358 9700/13/M/J/20 Dr.Dawood

17
34 Cigarette smoke contains carbon monoxide, nicotine and tar.
Which row correctly describes how these substances affect the body?
carbon monoxide nicotine tar

A stimulates stimulates the nervous leads to obstructive
nerve endings system to reduce the lung disease
diameter of the arteries
B forms increases the risk blocks goblet cells
carbaminohaemoglobin of blood clots
C causes increased combines with increases the risk
blood pressure haemoglobin of blood clots
D combines with stimulates carcinogenic
haemoglobin nerve endings
35 Chronic obstructive pulmonary disease (COPD) includes chronic bronchitis and emphysema.
In what order do these events occur as emphysema develops?
1 Macrophages move into alveolar air spaces.

2 Tar paralyses cilia.
3 Macrophages secrete elastase.
4 Bacteria accumulate in alveoli.
A 2→4→1→3
B 2→4→3→1
C 4→1→3→2
D 4→2→3→1
36 If someone smokes cigarettes, what will be the immediate result of this action on the red blood
cells?
A Carbon monoxide will combine with the globin in haemoglobin.

B Carbon monoxide replaces carbon dioxide in carbaminohaemoglobin.
C Less oxyhaemoglobin will form.
D More haemoglobinic acid will be formed.
Dr.Dawood 9700/13/M/J/20 359

18
37 What is correct for tuberculosis (TB)?
airborne
transmission virus
A B C
rash
38 Some common antibiotics are listed. The action of each antibiotic is described.
1 rifampicin – inhibits RNA polymerase

2 streptomycin – inhibits 70S ribosomes
3 neomycin – inhibits DNA synthesis
4 ampicillin – inhibits peptidoglycan synthesis
Which of these antibiotics will affect the activities of bacterial cells only?
A 1, 2, 3 and 4
B 1, 2 and 3 only
C 2 and 4 only
D 4 only
40 Which statements correctly explain why smallpox has been eradicated, but not malaria or
cholera?
1 Cholera vaccines provide only short-term immunity.

2 Plasmodium antigens change during the life cycle.
3 Smallpox antigens remain stable.
4 Vaccines only work against viruses.
360 9700/13/M/J/20 Dr.Dawood

As Classifed P1 PART 2

Uploaded by

Copyright:

Available Formats

You might also like

As Classifed P1 PART 2

Uploaded by

Document Information

Original Description:

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

As Classifed P1 PART 2

Uploaded by

Copyright:

Available Formats

PART 2

4 May/June 2018 P1 V 1 101

6 May/June 2018 P1 V 3 137

7 October/November 2018 P1 V1 153

9 October/November 2018 P1 V3 185

10 May/June 2019 P1 V 1 203

12 May/June 2019 P1 V 3 237

13 October/November 2019 P1 V1 255

15 October/November 2019 P1 V3 291

16 May/June 2020 P1 V 1 309

18 May/June 2020 P1 V 3 343

A The disease can often be reversed by treatment.

34 Which statement about coronary by-pass surgery is correct?

35 How does smoking increase the risk of developing atherosclerosis?

A by damaging artery walls

epithelium goblet cells cartilage

A ciliated present in blocks

Which is the best description of ‘epidemiological’?

A Disease and deaths are not randomly distributed in small populations.

35 Which row shows the effects of chronic bronchitis?

lymph glands alveoli bronchi infection

A destroyed damaged inflamed absent

D swollen inflamed inflamed present

What is the function of the tissue labelled X?

34 Why is the inner lining of the bronchiole folded?

A to allow for expansion during breathing

carbon monoxide nicotine

A combines with haemoglobin increases blood pressure

32 A disease damages alveoli walls.

surface area volume

33 Which is a correct description of part of the gas exchange system?

Which organelles would be found in large numbers in a goblet cell?

32 Which tissues are present in a bronchus?

cartilage ciliated epithelium smooth muscle

goblet cells are mutations may the activity of

total surface area

A less elastic decreased

cells / tissues function

A cartilage supports the trachea

33 Which could lead to chronic bronchitis?

A deposition of allergens in airways causing smooth muscles to contract

carbon dioxide oxygen

Which row is correct?

number of cell membranes diffused through by

1 Carbon monoxide damages the endothelium of the arteries.

A 1, 2 and 3 B 1 and 3 only C 1 only D 2 only

mucus phagocytes elastase

A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 and 3 only

Where is this type of epithelium found in the respiratory system?

trachea bronchus all bronchioles

contains high proportion of

A carbon monoxide nicotine tar

What is the function of the tissues X and Y?

A secrete mucus prevent collapse of the airway

A 1, 2 and 3 B 1 and 3 only C 2 and 3 only D 2 only

A It falls as carbon monoxide reduces oxygen-carrying capacity of the blood.

1 It reduces the amount of haemoglobin available to transport oxygen.

A 1, 2 and 3 B 2 and 3 only C 1 only D 3 only