AMERICAN JOURNAL OF PHYSICAL ANTHROPOLOGY 113:19 –29 (2000)

Mitochondrial DNA Polymorphisms in Chilean Aboriginal

Populations: Implications for the Peopling of the Southern
Cone of the Continent
MAURICIO L. MORAGA,1 PAOLA ROCCO,1 JUAN F. MIQUEL,2
FLAVIO NERVI,2 ELENA LLOP,1 RANAJIT CHAKRABORTY,3
FRANCISCO ROTHHAMMER,1 AND PILAR CARVALLO1*
1
Programa de Genética Humana, Instituto de Ciencias Biomédicas,
Facultad de Medicina, Universidad de Chile, Santiago 7, Chile
2
Departamento de Gastroenterologı́a, Facultad de Medicina, Pontificia
Universidad Católica de Chile, Santiago, Chile
3
Human Genetic Center, University of Texas School of Public Health,
Houston, Texas 77225

KEY WORDS Amerindian mtDNA haplogroups; sequence analy-

sis; peopling of the southern cone

ABSTRACT The mitochondrial DNAs (mtDNAs) from individuals be-

longing to three Chilean tribes, the Mapuche, the Pehuenche, and the
Yaghan, were studied both by RFLP analysis and D-loop (control region)
sequencing. RFLP analysis showed that 3 individuals (1.3%) belonged to
haplogroup A, 19 (8%) to haplogroup B, 102 (43%) to haplogroup C, and 113
(47.7%) to haplogroup D. Among the 73 individuals analyzed by D-loop
sequencing, we observed 37 different haplotypes defined by 52 polymorphic
sites. Joint analysis of data obtained by RFLP and sequencing methods
demonstrated that, regardless of the method of analysis, the mtDNA haplo-
types of these three contemporary South American aborigine groups clus-
tered into four main haplogroups, in a way similar to those previously
described for other Amerindians. These results further revealed the absence
of haplogroup A in both the Mapuche and Yaghan as well as the absence of
haplogroup B in the Yaghan. These results suggest that the people of Tierra
del Fuego are related to tribes from south-central South America. Am J Phys
Anthropol 113:19 –29, 2000. © 2000 Wiley-Liss, Inc.

The analysis of mitochondrial DNA vari-
ation has been extensively used in the re-
cent past, for genetic characterization of
contemporary aboriginal populations of the
Americas. The primary goals of this analy-
sis have been to determine the origins, re-
lationships, and migrational patterns of
New World populations. In this respect, the
study of the frequency distribution of the
four founding Amerindian haplogroups,
suggested by Schurr et al. (1990) and de-
fined by Torroni et al. (1992), has proven
useful.
The majority of these studies have fo-
cused on aboriginal populations from North
and Central America. Of those studies con-
ducted with South American groups, almost
all have involved populations from the
northern region of the continent (Torroni et
al., 1993; Easton et al., 1996; Santos et al.,
1996). Most of the data generated from
these studies were obtained through RFLP
Grant sponsor: FONDECYT; Grant number: 198-1111; Grant
sponsor: Ministero degli Affari Esteri d’Italia; Grant number:
1091-G224/ICU/CILE; Grant sponsor: NIH; Grant number: GM
41399.
*Correspondence to: Pilar Carvallo, Departamento de Biologı́a
Celular y Molecular, Facultad de Ciencias Biológicas, Pontificia
Universidad Católica de Chile, Casilla 114-D, Santiago, Chile.
E-mail: pcarvall@genes.bio.puc.cl
Received 23 November 1998; accepted 28 March 2000.

© 2000 WILEY-LISS, INC.

20 M.L. MORAGA ET AL.
mapping, rather than by D-loop sequencing,
although some D-loop sequence data from
these populations are available for analysis.
Similarly, the mtDNAs taken from southern
South American groups were primarily
characterized by RFLP analysis (Merri-
wether et al., 1995; Lalueza et al., 1997).
Thus, there remains limited D-loop se-
quence information from groups inhabiting
the southern part of South America.
Studies of South Amerindians using
RFLP and D-loop sequence analysis have
revealed a concordance between the distri-
bution of haplogroups A–D, and haplo-
groups (lineage clusters) I–IV as defined by
Horai et al. (1993), based on the nucleotide
polymorphisms occurring in the D-loop of
each haplogroup (Torroni et al., 1993; Eas-
ton et al., 1996; Santos et al., 1996). How-
ever, Santos et al. (1996) found that 7% of
individuals belonging to tribes from the
Brazilian Amazon Region comprise unusual
haplogroups because of their lack of corre-
spondence between RFLP and sequencing
analysis. There is also extensive informa-
tion referring to RFLP analysis in these
populations. In addition, Bailliet et al.
(1994) described a subdivision of the classi-
cal Amerindian haplogroups A, C, and D on
the basis of the presence or absence of the
HaeIII np 16517 site. This division has led
to the creation of haplotypes A1/A2, C1/C2,
and D1/D2. However, the HaeIII np 16517
site has been shown to be highly polymor-
phic in African (Chen et al., 1995), Euro-
pean (Torroni et al., 1996), and Asian (Ball-
inger et al., 1992) populations, indicating
that it may not be useful for distinguishing
within Native American haplogroups A, C,
and D. Similarly, Forster et al. (1996) also
postulated subdivisions of founding haplo-
types, using D-loop sequence data. In this
case, they divided haplotypes A1 and A2 by
a C3 T transition at np 16111 and defined
D1 and D2 haplotypes by the presence or
absence of the 16271 T3 C transition, with
this transition being present only in North
American Indian mtDNAs. Hence, there
would appear to be specific nucleotide
changes in the D-loop, which distinguish
between North-Central and South Ameri-
can populations.
To expand our knowledge about the ex-
tent of mtDNA variation in southern South
America and to test the hypothesis of a sin-
gle wave of migration to the southern part of
South America, we performed RFLP and
sequence analysis on three Chilean aborig-
inal populations (the Pehuenche, the Mapu-
che, and the Yaghan).
MATERIALS AND METHODS
Population samples
The samples include three different Chil-
ean aboriginal populations: 105 Pehuenche
from the community of Trapa Trapa in the
Province of Bio Bio, 8th region (37° 439 S;
71° 169 W), 111 Mapuche from the Huapi
Island, Province of Valdivia, 10th region
(40° 159 S; 72° 259 W), and the 21 last sur-
viving Yaghan from Puerto Williams, Na-
varino Island, Province of Antartica, 12th
region (55° S; 67° 409 W). The three groups
analyzed correspond to Amerinds showing a
percentage of admixture between 2–13%
(Llop et al., 1993, 1994). The geographic loca-
tions of the subjects are shown in Figure 1.
DNA extraction and PCR amplification
Total DNA was prepared from peripheral
blood lymphocytes (Gustincich et al., 1991).
DNA amplification of the four polymorphic
mtDNA regions, defining the four Amerin-
dian haplogroups, was carried out by using
the following specific primers:
Haplogroup A:
L604 GTAGCTTACCTCCTCAAAGCAA
H708 AGGGTGAACTCACTGGAACG
Haplogroup B:
L8214 CACAGTTTCATGCCCATCGT
H8294 ATGCTAAGTTAGCTTTACAGTGG
Haplogroup C:
L13232 CGCCCTTACACAAAATGACATCAA
H13344 GGAGCACATAAATAGTATGGC
Haplogroup D:
L5120 CCTAACTACTACCGAATTCCTA
H5255 ATTCTTCGATAATGGCCCATTTG
PCR was performed in a final volume of
50 ml, containing 300 ng genomic DNA, 1 U
Taq DNA polymerase (Promega), 25 pmoles
of each primer, 200 nM of each deoxinucle-
otide, and the appropriate buffer. Samples
 MTDNA POLYMORPHISMS IN ABORIGINAL CHILEANS
Fig. 1. Map of Chile, showing the geographic loca-
tion of the three Chilean tribes included in the present
study.
were processed under the following PCR
conditions: 1 cycle at 95°C for 5 min, fol-
lowed by 30 cycles at 95°C for 1 min, 55°C
for 1 min, and 72°C for 1 min, and finally
one cycle at 72°C for 5 min. Haplotypes A, C,
and D were analyzed by restriction diges-
tion, using HaeIII for haplotype A, HincII
for haplotype C, and AluI for haplotype D.
The resulting restriction fragments and
the PCR product including region V, defin-
ing haplotype B, were analyzed by electro-
phoresis on 3% NuSieve-Agarose (2:1) (FMC
BioProducts) gels. PCR amplification of the
D-loop region was carried out with two
specific primers, spanning a region of
1,021 bp: L15997, CACCATTAGCACCCA-
AAGCT; and H408, CTGTTAAAAGTGCAT-
ACCGCCA.
Direct sequencing of PCR products
DNA sequencing was carried out by us-
ing the PCR dsDNA Cycle Sequencing
System (Life Technologies), with the prim-
21
ers L29, GGTCTATCACCCTATTAACCAC;
and H16401, CACCATCCTCCGTGAAATCA,
labeled at the 59 end with g-32P-ATP. DNA
sequence analysis was performed by electro-
phoresis on high-resolution 6% polyacryl-
amide gels, followed by autoradiography.
Data analysis
Sequence alignment was performed by
using the Clustal W computer program
(Thompson et al., 1994). Substitutions and
deletions were inferred from direct se-
quence comparisons. The phylogenetic trees
were obtained through two different meth-
ods: neighbor joining (Saitou and Nei, 1987),
using the Clustal W program, and parsi-
mony analysis (Swofford and Olson, 1990).
Maximum parsimony trees were generated
through random addition of sequences us-
ing the tree bisection and reconnection
(TBR) algorithm, with the PAUP (Swofford,
1993) computer program.
RESULTS
RFLP analysis
All individuals analyzed showed one of
the characteristic haplogroups, A, B, C, or
D. As shown in Table 1, haplogroups C and
D were the most frequent in the three pop-
ulations, appearing at very similar frequen-
cies in all of them. Haplogroup A was
present in the Pehuenche at a very low fre-
quency (2.8%), while both haplogroups A
and B were absent in the Yaghan group. We
tested the gain of the HaeIII site at position
16517 only in individuals belonging to hap-
logroup B, since this is a specific marker to
differentiate Amerindians from non-Amer-
indian B individuals (Torroni et al., 1992,
1993). The gain of the HaeIII site was
present in all individuals exhibiting haplo-
group B, including 8 Mapuche and 11 Pehu-
enches.
A 3 3 4 contingency table analysis sug-
gests that in terms of haplogroup frequen-
cies, these three populations cannot be sta-
tistically distinguished (chi-square 5 6.78,
exact P-value 5 0.32 with 10,000 permuta-
tions). However, in terms of haplotype di-
versity (Nei, 1978) defined by these four
haplogroups, the Yaghan have the lowest
diversity (52.4%), and the Pehuenche the
22 M.L. MORAGA ET AL.
TABLE 1. MTDNA haplogroup distribution in three Chilean aboriginal populations
Populations N A
Mapuche 111
Pehuenche (Trapa-Trapa) 105
Yaghan 21
Total 237
highest (61.7%), with the Mapuche being
intermediate (56.8%), the differences being
statistically insignificant (P 5 0.11).
Sequence analysis
The two hypervariable regions of the D-
loop were analyzed by direct sequencing of
the DNA from 73 individuals from the three
native populations, which were representa-
tive of the four haplogroups described pre-
viously. As shown in Table 2, 37 different
haplotypes were observed, defined by 52
polymorphic sites. It is important to note
that two haplotypes shared by individuals
from different populations are shown sepa-
rately. This gives a total of 40 lines in Table
2, corresponding to only 37 haplotypes. In
haplotype C, lineages PE3C, YA4C, and
HU4C are the same, as well as YA2C and
HU1C.
Only nucleotide changes at np 73 and np
263 are shared by all haplogroups. One of
these, transition A3 G at position 73, has
also been described in all individuals from
an Argentinean Mapuche group (Ginther et
al., 1993), as well as in half of the individu-
als from a Huétar sample of Costa Rica
(Santos et al., 1994). Two types of adenine
deletions, an A at np 248 and an AA at
286 –291, were found at hypervariable re-
gion II (HVS-II). These A deletions have
been found in all haplogroup C individuals
from the three Chilean aboriginal popula-
tions, as well as the Argentinean Mapuche
sample (Ginther et al., 1993). Since these A
deletions have not been described for other
populations (Handt et al., 1998), they may
be characteristic nucleotide changes at least
for South American aboriginal populations.
In these three Chilean groups, as with
haplogroup diversity, we found the highest
sequence diversity in the Pehuenche sam-
ple, showing 38 out of 52 total polymorphic
sites at the D-loop, amounting to 93.2% se-
Haplogroups (%)
B C D
0.0 7.2 44.1 48.7
2.8 10.5 41.0 45.7
0.0 0.0 47.6 52.4
1.3 8.0 43.0 47.7
quence diversity. The Yaghan, likewise,
showed the smallest sequence diversity of
91.4%, although this was not significantly
smaller than the others.
Disregarding the phylogenetic relation-
ships of the observed sequences, at the se-
quence level, the Yaghan appear to be al-
most 3–5 times as distant from the
Pehuenche and the Mapuche, (the standard
distance of Nei (1978) being 0.31 between
the Pehuenche and the Mapuche, 1.55 be-
tween the Pehuenche and the Yaghan, and
1.09 between the Mapuche and the Yaghan).
The contingency table analysis of sequence-
lineage frequency differences suggests that
the genetic distances among these three
populations are statistically significant (chi-
square 5 15.12, P , 1025, with 10,000 per-
mutations).
Haplogroup D was the most diverse at the
sequence level, revealing 30 polymorphic
sites, in contrast to haplogroups A with 13
changes, B with 14 changes, and C with 16
changes. We also found that, from all indi-
viduals classified in the four haplogroups
A–D (Torroni et al., 1992), only haplogroups
A–C corresponded perfectly to 3 of the 4
clusters described by Horai et al. (1993).
The T nucleotide at position 16290 and A
16319 define haplogroup A/cluster III. Hap-
logroup B/cluster I is defined by C 16189
and C 16217. Haplogroup C/cluster IV is
defined by a C 16298 and T 16327.
Regarding haplogroup D/cluster II, C nu-
cleotides at position 16325 and 16362 have
been described by Horai et al. (1993) as
characteristics of cluster II, since they were
shared by 72 native Americans, including
45 Chilean aborigines. From our study, one
Mapuche individual lacked the 16362 T3 C
transition, and the other 13 individuals be-
longing to the three Chilean populations did
not show the characteristic 16325 T3 C
transition. Hence, our results do not corrob-
 TABLE 2. Polymorphic mtDNA D-loop sites in a sample of Chilean aborigines1
Anderson

Individuals

Lineages
286–291
16086
16092
16111
16129
16153
16187
16189
16207
16209
16213
16217
16218
16223
16234
16241
16249
16270
16286
16290
16291
16298
16301
16304
16311
16319
16325
16327
16342
16343
16362

129
143
146
150
152
153
195
207
215
234
248
258
263
53
55
56
64
73
77
94
T T C G G C T A T G T C C C A T C C C C T C T T G T C T A T G T A C A A G T G T C T A T G A A A C A A A

z z T A z z z z z z z z T z z z z z T z z z z z A z z z z C z z z T G z z z z C z z G C z z G z z G z z 3 PE1A
z z z z z z C z z z C z z z z z z z z z z z z z z z z z z z z z z z G z z z z z z z z z A z z z z G z z 2 PE6B
z z z z z z C z z z C z z z z z z z z T z z z z z z z z z z z z z z G z z z z z z z z z A z z z z G z z 1 PE5B
z z z z z z C z z z C T z z z z z z z z z z z z z z z z z z z z z z G z z z z z z C z z A z z z z G z z 1 PE4B
z z z z z z C G z z C z z z z z z z z T z z z z z z z z z z z z z z G z z z z z z z z C z z z z z G z z 1 PE1B
z z z z z z C G z z C z z z z z z z z T z z z z z z z z z z z z z z G z z z z z z z z z z z z z z G z z 4 HU1B
z z z z z z C G z z C z z z z C z z z T z z z z z z z z z z z z z z G z z z z z z z z z z z z z z G z z 3 HU3B
z z z z z z C G z z C z z z z z z z z T z z z z z z z z z z z z z z G z z G z z z z z z z z z z z G z z 1 HU2B
z z z z z z C z z A C z z z z C z z z z z z z z z z z z z z z z z z G z z z z z z z z z z z z z z G z z 1 PE2B
z z z z z z C z z A C z z T z C z z z z z z z z z z z z z z z z z z G z z z z z z z z z z z z z z G z z 1 PE3B
z z z z z z z z z z z z T z z z z z z z C z z C z C T z z z z z z z G z z z z z z z z z z z z — T G — — 1 PE2C
z z z z z z z z z z z z T z z z z z z z C z z C z C T z G z z z z z G z z z z z z z z z z z z — T G — — 1 YA3C
z z z z z z z z z z z z T z z z z z z z C z z z z C T z z z z z z z G z z z z z z z z C z z z — T G — — 1 PE1C
z z z z z z z z z z z z T z z z z z z z C z z z z C T z z z z z z z G z z z z z z z z z z z z — T G — — 6 PE3C
z z z z z z z z z z z z T z z z z z z z C z z z z C T z z z z z z z G z z z z z z z z z z z z — T G — — 1 YA4C
z z z z z z z z z z z z T z z z z z z z C z z z z C T z z z z z z z G z z z z z z z z z z z z — T G — — 7 HU4C
z z z z z z z z z z z z T z z z z z z z C z z z z C T z z z z z z z G z z z z z z z z z z z z — z G — — 2 YA2C
z z z z z z z z z z z z T z z z z z z z C z z z z C T z z z z z z z G z z z z z z z z z z z z — z G — — 3 HU1C
z z z z z z z z z z z z T z z z z z z z C z z z z C T z z z z z z z G z z z z z T z z z z z z — z G — — 1 HU2C
z z z z z z z z z z z z T z z z z z z z C z z z z C T z z z z z z z G z T z z z z z z z z z z — T G — — 1 HU3C
z z z z z z z z z z z z T z z z z z z T C z z z z C T z z z z z z z G z z z z z z z z C z z z — z G — — 2 YA1C
z z z z z z z z z z z z T z z z z z z z z z z z z C z z z C z z z z G z z z z z z C z C z z z z z G z z 2 YA4D
z z z z z z z z z z z z T T G z z z z z z z z C z z z C z C z z z z G z z z z z z C z z z z z z z G z z 2 YA3D
z z z z z z z z z z z z T z G z z z z z z T z z z z z C z C z z z z G z z z z z z C z z z z z z z G z z 2 HU10D
z z z z z T z z z z z z T z z z z z z z z z z z z C z z z z z z z z G z z z z z z z z z z z z z z G z z 1 HU9D
z z z z z T z z z z z z T z z z z z z z z z z z z C z z z C z z z z G z z z z C z C z z z G z z z G z z 1 HU1D
z z z z z T C z C z z z T z z z z z z z z z z z z C z z z C z C G T G z z z z z z z z z z z z z z G z z 1 PE3D
z z z z z T C z C z z z T z z z z z z z z z z z z C z z z C z C G T G z z z z z z z z C z z z z z G z z 1 PE4D
z z z z z T z z z z z z T z z z z z z z z z C z z C z z z C z z z z G z z z z z z z z z z z z z z G z z 2 PE5D
z C z z z T C z z z z z T z z z z z z z z z z z z z z z z C z z z z G z z z A z z z z z z z z z z G z z 1 PE2D
z z z z z T C z z z z z T z z z z z z z z z z z z z z z z C z z z z G z z z A z z z z z z z z z z G z z 1 PE1D
z z z z z T C z z z z z T z z z T z z z z z z z z z z z z C z z z z G T z z A z z z z z z z z z z G z z 1 HU7D
z C z z z T C z z z z z T z z z T z z z z z z z z z z z z C T z z z G z z z A z z z z z z z z z z G z z 1 HU4D
z z z z z T z z z z z z T z z z z z z z z z z z z C z z z C T z z z G z z z A z z z z z z z z z z G z z 1 HU2D
z C z z z T C z z z z z T z z z T z z z z z z z z z z z z C z z z z G z z z A z z z z z z z z z z G z z 3 HU5D
z z z z z T C z z z z z T z z z T z z z z z z z z z z z z C z z z z G z z z A z z z z z z z z z z G z z 1 HU6D
z z z z A z z z z z z z T z z z z z z z z z z z z C z z z C z z z z G z z z z z z z z z z z z z z G z z 2 HU8D
z z z z z T C z z z z z T z z z T z z z z z z z z z z z z C z z z z G z z z z z z z z z z z z z z G z z 1 HU3D
C z z z z T C z z z z z T z z z z T z z z z z z z C z z z C z z z z G z z z z z z z z z z z z z z G z z 4 YA2D
C z z z z T C z z z C z T z z z z T z z z z z z z C z z z C z z z z G z z z z z z z z z z z z z z G z z 1 YA1D
1
The number of individuals for each lineage is shown. In the right column each lineage is named by its corresponding population (PE, Pehuenche; HU, Mapuche (Huapi Island); YA, Yaghan) the
sample number, and the RFLP haplogroup. Individuals highlighted in bold share the same sequence and belong to different groups (PE3C, YA4C, HU4C, and YA2C, HU1C). The sequence
published by Anderson et al. (1981) was used as a reference.
24 M.L. MORAGA ET AL.
orate the classification of haplogroup
D/cluster II on the basis of these mutations,
but are in agreement with the results of
Ginther et al. (1993), who also observed the
absence of the 16325 T3 C mutation in hap-
logroup D mtDNAs from the Argentinean
Mapuche group.
It is interesting to note that one of these
nucleotide changes, C 16325, is present in
all individuals of haplogroup C/cluster IV
from our study, in the Argentinean Mapu-
che, and in Amazonian individuals (Santos
et al., 1996). Also, in our study, C in position
16362 is present in individuals from cluster
III/haplogroup A. Therefore it seems that
there are no characteristic and exclusive nu-
cleotide changes in either hypervariable re-
gion defining haplogroup D, at least for
these aboriginal populations from South
America. However, we found a C3 T change
at nucleotide 16187 which is present in the
majority of South Amerindians of haplo-
group D, which is absent from haplogroups
A–C. This change is also present in 6/10
Argentinean Mapuche (Ginther et al.,
1993), and in 14/18 native Americans (Horai
et al., 1993). From this analysis, we suggest
that this change is the most characteristic
one for South Amerindian populations.
Phylogenetic analysis
The D-loop DNA sequences, spanning hy-
pervariable regions I and II from the 37
Chilean lineages, were aligned and submit-
ted to phylogenetic analysis through neigh-
bor-joining (NJ) (Fig. 2) and parsimony
methods (data not shown). In the NJ tree,
we can see that all lineages fall into four
differentiated branches, including haplo-
groups A–D. Nevertheless, it is noteworthy
that three D lineages, HU8D, HU9D, and
YA4D, cluster close to the C branch, while
HU10D and YA3D cluster close to branch A.
All the other D lineages fall into one clade.
The majority rule consensus (data not
shown) shows that two branches B and C
cluster independently in 100% of maximum
parsimony trees. Seven out of 19 lineages
corresponding to haplogroup D cluster in
one branch, with 74 % consensus from a
total of 500 maximum parsimony trees. The
remaining lineages, also corresponding to
haplogroup D, appeared unresolved in this
analysis. D-loop sequences from the 3 Pehu-
enche individuals leading to haplogroup A
correspond to one lineage, clustering obvi-
ously in one branch of 100% consensus.
DISCUSSION
In the present paper we report on the
results of a mtDNA RFLP and sequence
polymorphism analysis of three Chilean ab-
original populations. The RFLP analysis
showed that all individuals belong to one of
the previously defined Amerindian haplo-
groups, A, B, C, or D. In terms of haplogroup
frequencies, the three Chilean aboriginal
groups studied here cannot be genetically
distinguished. However, as shown in Table
3, combining the present data with other
published haplogroup frequencies of South
American aborigines, it is noteworthy that
the frequencies of haplogroups A and B de-
crease from north to south in meridian
South America, whereas haplogroups C and
D tend to increase. This trend is most likely
the result of founder effect, which occurred
during the initial peopling of the southern
cone of the continent. As Paleoindians
moved south, new territory was probably
colonized by small bands that were carriers
of a subsample of genes from the ancestral
populations they left behind. Haplogroups A
and B probably got lost as a consequence of
this process. An alternative hypothesis, e.g.,
gene flow from migrant populations carry-
ing A and B into more ancient groups pos-
sessing C and D, would imply that more
than one migration event occurred during
the peopling of the southern cone of South
America. This hypothesis is not supported
by recently published gene geography maps
of South America (Rothhammer and Silva,
1992; Rothhammer et al., 1997).
Turning now to the sequence data, we note
that the three Chilean aboriginal groups, can
be genetically distinguished at the D-loop se-
quence level, making the Yaghan most dis-
tant (as well as least diverse) from the Pehu-
enche and the Mapuche.
Further, the nucleotide changes described
by Forster et al. (1996), including one base
substitution at nucleotide 16111 leading to
subhaplogroups A1/A2, and another substi-
tution at 16271 defining subhaplogroups
D1/D2, have been tested in the present
 MTDNA POLYMORPHISMS IN ABORIGINAL CHILEANS 25

Fig. 2. Tree obtained by the neighbor-joining method for 37 Chilean haplogroups. Individuals highlighted
in bold share the same sequence and belong to different groups (PE3C, YA4C, HU4C, and YA2C, HU1C). An
African sequence was used as an outgroup in order to root the tree. The alignment was performed over 549
bp, including hypervariable regions I and II. Letters on the side indicate respective RFLP haplogroups.

study (Table 2). All individuals from haplo- Forster et al. (1996). Indeed, all haplotype D
group A did have the C3 T transition at individuals lacked the T3 C transition and,
16111, and therefore are subhaplotype A2 of therefore, are haplotype D1.
26 M.L. MORAGA ET AL.

TABLE 3. Frequency distribution of founding haplogroups in aboriginal populations of Chile and Argentina1
Haplogroups
Populations N A B C D Others References
Aymara 172 0.06 0.68 0.12 0.14 Merriwether et al., 1995
Atacameño 50 0.12 0.72 0.10 0.06 Merriwether et al., 1995
Whichi 72 0.06 0.63 0.03 0.26 0.03 Bravi et al., 1995
Chorote 20 0.15 0.40 0.30 0.15 Bravi et al., 1995
Mapuche 1 58 0.05 0.31 0.21 0.30 0.14 Ginther et al., 1993
Mapuche 2 111 0.07 0.44 0.49 This study
Pehuenche 1 100 0.02 0.09 0.37 0.52 Merriwether et al., 1995
Pehuenche 2 105 0.03 0.10 0.41 0.46 This study
Huilliche 80 0.04 0.28 0.19 0.49 Merriwether et al., 1995
Tehuelche 29 0.21 0.24 0.55 Bravi (pers. Comm.)
Fueguian 45 0.42 0.56 0.02 Lalueza et al., 1997
Yaghan 21 0.48 0.52 This study
1
Populations are listed from top to bottom in order of distribution along Chile and Argentina, from northernmost to southernmost.

Comparison of the two hypervariable D-
loop regions reveals a high variability of
haplogroup D, in comparison to the other
three haplogroups, and especially with hap-
logroup C, including a similar number of
individuals, as shown in Table 2. This vari-
ability is expressed by 19 different lineages
defined by 30 polymorphic sites. We were
unable to find any nucleotide change shared
by 100% of D individuals, as described pre-
viously by Horai et al. (1993) in a similar
sample. Nevertheless, our results indicate a
C3 T 16187 change which is present in the
majority of D individuals, and is absent in
haplogroups A–C (Table 2), concordant with
lineages found by Ginther et al. (1993) in an
Argentinean Mapuche sample, as well as
Chilean lineages described by Horai et al.
(1993). However, this change seems to be
exclusive to Chilean and Argentinean
southern aborigines, since it is not present
in other populations from South America.
As shown in Figure 3, it is noteworthy
that 26/26 individuals from this study be-
longing to haplogroup C, two lineages from
Chilean aborigines described by Horai et al.
(1993), and 7/8 Argentinean aborigine indi-
viduals (Ginther et al. 1993), are grouped in
one cluster. This extreme low diversity
within haplogroup C for southern Chilean
and Argentinean groups could also be ex-
plained by a founder effect.
Comparing our findings with other Amer-
indian mtDNA sequences from South Amer-
ica, we found that the retrieved sequences of
the three Chilean groups cluster into the
four basic mtDNA haplogroups, together
with the Amazonian tribes and the Argen-
tinean Mapuche (Fig. 3). These findings are
noteworthy in relation to unconventional
speculations concerning the origin of the ab-
origines of Tierra del Fuego. More than half
a century ago, it was proposed that people of
Tierra del Fuego had direct ancestral links
to Australoid populations (Frenguelli, 1963;
Imbelloni, 1938). This hypothesis was based
on the unusual morphological characteris-
tics, particularly the cranial robustness
(supposedly a sign of antiquity), of the ab-
origines of Patagonia and Tierra del Fuego,
that is to say the Ona (Selk’nam), Yaghan
(Yamana), and Alacaluf (Kaweskar).
In the interim, a consensus among an-
thropologists was reached in the sense that
Amerinds were derived from Mongoloids
who, moving from Asia, crossed the Bering
Land Bridge as suggested by Hrdlicka
(Frenguelli, 1963). There are, however, still
anthropologists with different views. Re-
cently, on the basis of the statistical manip-
ulation of craniometric means, Neves and
Pucciarelli (1991) suggested the existence of
a pre-Mongoloid migration to South Amer-
ica, coming close to reviving the old ideas of
Imbelloni (1938) in a more current context.
In contrast, our results indicate that the
Yaghan do not exhibit divergent D-Loop se-
quences, clustering together with the corre-
sponding haplogroup sequences from other
South Amerindian populations (Fig. 3), and
presenting similar haplogroup frequencies
compared to the Mapuche and Pehuenche.
In other words, our data do not support the
hypothesis that the Yaghan descend from a
different Paleoindian migration lacking
haplogroups A and B, as suggested by Lalu-
 MTDNA POLYMORPHISMS IN ABORIGINAL CHILEANS 27

Fig. 3. Twenty-seven distinct Chilean haplogroups,
as well as 105 previously published Amerindian lin-
eages from 9 different South American populations,
were analyzed using the neighbor-joining method with
a 254-bp fragment, including only the hypervariable
region I. An African sequence was used as an outgroup
in order to root the tree. Letters on the side indicate
respective RFLP haplogroups. PE, Pehuenche; HU, Ma-
puche (Huapi Island); YA, Yaghan; HOCH, Chilean ab-
origine; HOCO, Colombian aborigine; HOBR, Brazilian
aborigine (Horai et al., 1993); WBR, Brazilian aborigine
(Handt et al., 1998); GMA, Argentinean Mapuche
(Ginther et al., 1993); SBR, Brazilian aborigine (Santos
et al., 1996); TARG, Argentinean aborigine; TBR, Bra-
zilian aborigine (Torroni et al., 1993); EYA, Yanomama
(Easton et al., 1996).
28 M.L. MORAGA ET AL.
eza et al. (1997). Our results are rather in
agreement with the view that the Yaghan
are related to tribes from south-central
Chile and Argentina such as the Huilliche,
Pehuenche, and Tehuelche, as previously
suggested by Rothhammer et al. (1986) and
Llop (1996). Furthermore, we note that the
haplogroup distribution of the Yaghan is
similar to the distribution obtained by Lalu-
eza Fox (1996) for extinct groups from
Tierra del Fuego-Patagonia. All samples
from these geographic areas lack haplo-
groups A and B and are therefore most prob-
ably descendants of one common ancestral
Paleoindian population. In this context, it is
interesting to note that Bennett and Bird
(1964) reported a complete archeological se-
quence linking the first Paleoindian mi-
grants to contemporary Ona (Shelknam)
populations.
LITERATURE CITED
Anderson S, Bankier AT, Barrell BG, de Bruijn MHL,
Coulson AR, Drouin J, Eperon IC, Nierlich DP, Roe
BA, Sanger F, Schreier PH, Smith AJH, Staden R,
Young IG. 1981. Sequence and organization of the
human mitochondrial genome. Nature 290:457– 465.
Bailliet G, Rothhammer F, Carnese F, Bravi C, Bianchi
NO. 1994. Founder mitochondrial haplogroups in
Amerindian populations. Am J Hum Genet 55:27–33.
Ballinger SW, Schurr TG, Torroni A, Gan YY, Hodge
JA, Hassan K, Chen KH, Wallace DC. 1992. Southern
Asian mitochondrial DNA analysis reveals genetic
continuity of ancient Mongoloid migrations. Genetics
130:139 –152.
Bernnett WC, Bird JB. 1964. Andean culture history.
New York: Natural History Press. Doubleday & Co.,
Inc.
Chen Y-S, Torroni A, Excoffier L, Santachiara-Benere-
cetti AS, Wallace DC. 1995. Analysis of mtDNA vari-
ation in African populations reveals the most ancient
of all human continent-specific haplogroups. Am J
Hum Genet 57:133–149.
Easton R, Merriwether, DA, Crews D, Ferrell R. 1996.
mtDNA variation in the Yanomami: evidence for ad-
ditional New World founding lineages. Am J Hum
Genet 59:213–225.
Forster P, Harding R, Torroni A, Bandelt H-J. 1996.
Origin and evolution of Native American mtDNA
variation: a reappraisal. Am J Hum Genet 59:935–
945.
Frenguelli J. 1963. The present status of the theories
concerning primitive man in Argentina. In: Steward
JH, editor. Handbook of South American Indians, Vol
6. New York: Cooper Square Publisher, Inc. p 11–17.
Ginther C, Corach D, Penacino GA, Rey JA, Carnese
FR, Hutz MH, Anderson A, Just J, Salzano FM, King
MC. 1993. Genetic variation among the Mapuche In-
dians from the Patagonian region of Argentina: mito-
chondrial DNA sequence variation and allele frequen-
cies of several nuclear genes. EXS 67:211–219.
Gustincich S, Manfioletti G, Del Sal G, Schneider C,
Carninci P. 1991. A fast method for high quality
genomic DNA extraction from whole blood. Biotech-
niques 11:298 –302.
Handt O, Meyer S, von Haeseler A. 1998. Compilation
of human mtDNA control region sequences. Nucleic
Acids Res 26:126 –129.
Horai S, Kondo R, Nakagawa-Hattori Y, Hayashi S,
Sonoda S, Tajima K. 1993. Peopling of the Americas,
founded by four major lineages of mitochondrial DNA.
Mol Biol Evol 10:23– 47.
Imbelloni G. 1938. Tabla clasificatoria de los Indios:
regiones biologicas y grupos raciales en America. Phy-
sis 12:229 –249.
Lalueza C, Perez-Perez A, Prats E, Cornudella L, Tur-
bon D. 1997. Lack of founding Amerindian mitochon-
drial DNA lineages in extinct aborigines from Tierra
del Fuego-Patagonia. Hum Mol Genet 6:41– 46.
Lalueza Fox C. 1996. Mitochondrial DNA haplogroups
in four tribes from Tierra del Fuego-Patagonia: infer-
ences about the peopling of the Americas. Hum Biol
68:853– 871.
Llop E. 1996. Genetic composition of Chilean aboriginal
populations: HLA and other genetic marker varia-
tion. Am J Phys Anthropol 101:325–332.
Llop E, Harb Z, Acuña M, Moreno R, Barton S, As-
pillaga E, Rothhammer F. 1993. Composición ge-
nética de la población chilena: los Pehuenches de
Trapa-Trapa. Rev Med Chil 121:494 – 498.
Llop E, Harb Z, Acuña M, Moreno R, Aspillaga E, Van
de Maele M, Rothhammer F. 1994. Composición ge-
nética de la población chilena: los Yamanas de Ukika.
Rev Med Chil 122:979 –985.
Merriwether DA, Rothhammer F, Ferrell RE. 1995. Dis-
tribution of the four founding lineage haplotypes in
Native Americans suggests a single wave of migra-
tion for the New World. Am J Phys Anthropol 98:411–
430.
Nei M. 1978. Estimation of average heterozygosity and
genetic distance from a small number of individuals.
Genetics 89:583–590.
Neves W, Pucciarelli H. 1991. Morphological affinities
of the first Amerindian: an exploratory analysis based
on early South American human remains. J Hum
Evol 21:261–273.
Rothhammer F, Silva C, Cocilovo J, Quevedo S. 1986.
Una hipótesis sobre el poblamiento de Chile basada
en el análisis multivariado de medidas craneomét-
ricas. Rev Chung 16 –17:115–118.
Rothhammer F, Silva C. 1992. Gene geography of South
America: testing models of population displacement
based on archeological evidence. Am J Phys An-
thropol 89:441– 446.
Rothammer F, Silva C, Callegari-Jacques SM, Llop E,
Salzano FM. 1997. Gradients of HLA diversity in
South American Indians. Ann Hum Biol 24:197–208.
Saitou N, Nei M. 1987. The neighbor-joining method: a
new method for reconstructing phylogenetic trees.
Mol Biol Evol 4:406 – 425.
Santos M, Ward RH, Barrantes R. 1994. mtDNA vari-
ation in the Chibcha Amerindian Huetar from Costa
Rica. Hum Biol 66:963–977.
Santos SE, Ribeiro-Dos-Santos AK, Meyer D, Zago MA.
1996. Multiple founder haplotypes of mitochondrial
DNA in Amerindians revealed by RFLP and sequenc-
ing. Ann Hum Genet 60:305–319.
Schurr TG, Ballinger SW, Gan YY, Hodge JA, Merri-
wether DA, Lawrence DN, Knowler WC. 1990. Amer-
indian mitochondrial DNAs have rare Asian muta-
tions at high frequencies suggesting they derived
from four primary maternal lineages. Am J Hum
Genet 46:613– 623.
 MTDNA POLYMORPHISMS IN ABORIGINAL CHILEANS
Swofford DL. 1993. Phylogenetic analysis using parsi-
mony (PAUP), version 3.1. Champaign: Illinois Nat-
ural History Survey.
Swofford DL, Olsen GJ. 1990. Phylogeny reconstruc-
tion. In: Hillis DM, Moritz C, editors. Molecular sys-
tematics. Sunderland, MA: Sinauer. p 411–500.
Thompson JD, Higgins DG, Gibson TJ. 1994.
CLUSTAL W: improving the sensitivity of progres-
sive multiple sequence alignment through sequence
weighting, positions-specific gap penalties and
weight matrix choice. Nucleic Acids Res 22:4673–
4680.
Torroni A, Schurr TG, Yang CC, Szathmary EJE, Wil-
liams RC, Schanfield MS, Troup GA, Knowler WC,
29
Lawrence DN, Weiss KM, Wallace DC. 1992. Native
American mitochondrial DNA analysis indicated that
the Amerind and the Nadene populations were
founded by two independent migrations. Genetics
130:153–162.
Torroni A, Schurr TG, Cabell MF, Brown MD, Neel JV,
Larsen M, Smith DG, Vullo CM, Wallace DC. 1993.
Asian affinities and continental radiation of the four
founding Native American mtDNAs. Am J Hum
Genet 53:563–590.
Torroni A, Huoponen K, Francalacci P, Petrozzi M, Mo-
relli L, Scozzari R, Obinu D. 1996. Classification of
European mtDNAs from an analysis of three Euro-
pean populations. Genetics 144:1835–1850.