Module 1

QUIRINO STATE UNIVERSITY
College of Agriculture, Forestry and Engineering

Certificate in Agricultural Sciences
…setting trend towards sustainable development
B MODULE 7: GENE FUNCTION: PROTEIN AND ENZYMES
I. Module Overview
Genes provide information for building proteins. They don’t however directly
create proteins. The production of proteins is completed through two processes:
transcription and translation. Transcription is a process in which a DNA strand
provides the information for the synthesis of a specific messenger mRNA (mRNA)
strand. These mRNA are then translated into polypeptides by ribosomes. It may be said
that DNA contains a coded message, the genetic code, with instructions for the
manufacture of specific proteins. We know now that RNA participates in this process
as a messenger between the DNA and the protein.
This module will cover topics on how the genetic material – DNA, directs the
manufacture of specific proteins and the different processes involved to accomplished
such function.
II. Intended Learning Outcomes

After the module, you should be able to:
1. Discuss the genetic control of proteins;

2. explain different steps involved in the transcription and translation process;
3. enumerate the different proteins that functions to accomplish process of
transcription and translation; and,
4. differentiate inducible system and repressible system of gene regulation in
prokaryotes; and,
5. show understanding on the gene regulation of eukaryotes.
III. Take-Off
IV. Content Focus
1. Genetic Control of Proteins
Transcription and translation ensure that a linear array of nucleotides in the

DNA of a gene will be converted into a linear array of amino acids in the primary
polypeptide chain. There is a precise correspondence of codons in DNA to amino acids
in protein. This linear correspondence between gene and protein product is called
colinearity. Thus, protein function depends absolutely on the DNA sequence of its coding
gene.
Module 7: Gene Function 1 | 24

Aimee Carol R. Tangonan, M.Sc.| Principles of Genetics
Proteins can be classified into two broad types, active proteins and structural
proteins. Good examples of active proteins are enzymes, the biological catalysts that
make possible the thousands of chemical reactions that go on inside a living cell.
Enzyme-encoding genes exert an enormous control over what goes on inside a cell.
Other examples of active proteins are the microtubule proteins that produce movement
in the cell and membrane-bound proteins that regulate pumping of ions and nutrients
across the membrane. On the other hand, structural proteins, as their name suggests,
contribute to the structural properties of the cell and the organism; human hair
keratin and bone collagen are two structural proteins. Some proteins are both active
and structural, for example, the contractile proteins actin and myosin, which comprise
the great bulk of muscles and hence affect shape. Protein function is well illustrated by
enzymes.
Enzymes are biological catalysts that speed up chemical reactions that otherwise
would occur too slowly for cells to function. The substrate molecules fit into an
enzyme’s active site. Enzymes do their job of catalysis by physically grappling with the
substrate molecules, interacting with them to make or break chemical bonds (fig.
7.1).
Figure 7.1 Enzyme Activity. Schematic representation of the action of a hypothetical enzyme
in breaking (upper photo) a substrate into two product molecules and in putting two
substrates together (lower photo).
Note: Protein architecture is the key to gene function. The specific amino acid
sequence determines the general shape, binding properties, and reactivity of
the protein.
Enzyme pathways
Cells synthesize essential cellular substances step-by-step from compounds in

the environment. This is done in a series of enzyme-mediated reactions called
biochemical pathways. For example, the
haploid fungus Neurospora synthesizes its
own arginine (an amino acid) in a series of
sequential biochemical steps (fig. 7.2). The
immediate precursors in the pathway are

ornithine and citrulline, as shown in the accompanying diagram. Ornithine is made

from earlier precursors not shown; then it
is converted into citrulline, which in turn is Figure 7.2. Arginine synthesis in Neurospora
converted into arginine. These conversions are catalyzed by enzymes: we can label
them enzymes 1 to 3, coded by three different arginine-synthesizing genes that we can
designate genes 1to 3.
Hundreds of biochemical pathways involving thousands of reactions take place

inside living cells. Since most of these reactions are catalyzed by enzymes, we see a
glimmer of the pivotal position that genes play in controlling the chemistry of life.
2. Protein Synthesis
Review of the Central Dogma of Genetics
The central dogma was proposed by Francis Crick as early as 1958 — that DNA
encodes RNA, which is translated into protein (fig 7.3a). At present, this idea is now
considered overly simplistic but would still give us an overview on the flow of genetic
information in a cell.
Transcription is the process by which DNA is copied (transcribed) to mRNA, which carries
Figure 7.3a An overview of the flow of information in a eukaryotic cell. The DNA of the chromosomes
located within the nucleus contains the entire store of genetic information. Selected sites on the DNA are
transcribed into pre-mRNAs (step 1), which are processed into messenger RNAs (step 2). The messenger
RNAs are transported out of the nucleus (step 3) into the cytoplasm, where they are translated into
polypeptides by ribosomes that move along the mRNA (step 4). Following translation, the polypeptide
folds to assume its native conformation (step 5).

The information
needed for protein
synthesis. The mRNA
formed in transcription
is transported out of
the nucleus, into the
cytoplasm, to the
ribosome (the cell's
protein synthesis
factory). Here, it directs
protein synthesis.
Messenger RNA is not
directly involved in
protein synthesis −
transfer RNA (tRNA) is
required for this. The
process by which
Figure 7.3b The Central Dogma of Molecular Genetics.
mRNA directs protein
synthesis with the assistance of tRNA is called translation. The ribosome is a very large
complex of RNA and protein molecules. Each three-base stretch of mRNA (triplet) is
known as a codon, and one codon contains the information for a specific amino acid.
Prokaryotic vs. Eukaryotic Gene Expression and Regulation
The process of gene expression and regulation: transcription and translation

between prokaryotes and eukaryotes differ mainly due to their cellular organization.
Prokaryotic organisms are single-celled organisms that lack a cell nucleus, and
their DNA therefore floats freely in the cell cytoplasm. To synthesize a protein, the
processes of transcription and translation occur almost simultaneously. When the
resulting protein is no longer needed, transcription stops. As a result, the primary
method to control what type of protein and how much of each protein is expressed in a
prokaryotic cell is the regulation of DNA transcription. All of the subsequent steps
occur automatically. When more protein is required, more transcription occurs.
Therefore, in prokaryotic cells, the control of gene expression is mostly at the
transcriptional level.
Eukaryotic cells, in contrast, have intracellular organelles that add to their

complexity. In eukaryotic cells, the DNA is contained inside the cell’s nucleus and there
it is transcribed into RNA. The newly synthesized RNA is then transported out of the
nucleus into the cytoplasm, where ribosomes translate the RNA into protein. The
processes of transcription and translation are physically separated by the nuclear
membrane; transcription occurs only within the nucleus, and translation occurs only
outside the nucleus in the cytoplasm. The regulation of gene expression can occur at
all stages of the process (Figure 1). Regulation may occur when the DNA is uncoiled
and loosened from nucleosomes to bind transcription factors (epigenetic level), when
the RNA is transcribed (transcriptional level), when the RNA is processed and exported
to the cytoplasm after it is transcribed (post-transcriptional level), when the RNA is
translated into protein (translational level), or after the protein has been made
(posttranslational level).

Figure 7.4 A. Prokaryotic transcription and translation occur simultaneously in the cytoplasm, and
regulation occurs at the transcriptional level. B. Eukaryotic gene expression is regulated during
transcription and RNA processing, which take place in the nucleus, and during protein translation, which
takes place in the cytoplasm. Further regulation may occur through post-translational modifications of
proteins.
The differences in the gene expression and regulation between prokaryotes and
eukaryotes are summarized in Table 1. The gene expression and regulation is
discussed in detail in subsequent part of this module.
Table 1. Differences in the Regulation of Gene Expression of Prokaryotic and

Eukaryotic Organisms
Prokaryotic organisms Eukaryotic organisms
Lack nucleus Contain nucleus
DNA is found in the cytoplasm DNA is confined to the
nuclear compartment
RNA transcription and protein formation RNA transcription occurs prior to
occur almost simultaneously protein formation, and it takes place in
the nucleus. Translation of RNA to
protein occurs in the cytoplasm.
Gene expression is regulated primarily at Gene expression is regulated at many
the transcriptional level levels (epigenetic, transcriptional,
nuclear shuttling, post-transcriptional,
translational, and post-translational)
Gene Action
For the purpose of demonstrating the translation and transcription process,

below is the general and simplified process of transcription and translation in
Escherichia coli.
TRANSCRIPTION
The synthesis of RNA from a DNA template can be divided into three general steps.

► Initiation of Transcription
RNA polymerase attaches to a specific sequence in the DNA called the promoter
located upstream from the gene being transcribed. For example, the Pribnow box
(TATAAT), which is a promoter in prokaryotes, is located -10 to the initiation site (+1)
where transcription actually starts. This is accomplished with the help of the
polypeptide sigma factor (o). Sigma factor recognizes the promoter sequence so the RNA
polymerase can selectively bind to it. Once bound, the o factor dissociates and is free
for another round of initiation (fig. 7.4).
Figure
7.5 Initiation of Transcription

► Elongation of the Transcript
The RNA polymerase moves along the anticoding (antisense) strand of the DNA,
which is the 3' to 5' strand of the gene. The RNA polymerase separates the two strands
while complementing DNA template nucleotides with RNA nucleotides as it goes along
the gene. (Note: It complements A with U rather than with T). As soon as a segment is
transcribed, the DNA strands reanneal because DNA-DNA interaction is stronger than
DNA-RNA interaction. A single-stranded RNA is thus produced. This continues until
the enzyme reaches the termination point (fig. 7.5).
Figure 7.6 Elongation of the transcript
► Termination of Transcription

When RNA polymerase reaches the termination point, protein factor rho (p)
binds to the enzyme and dissociates it from the DNA to stop transcription. This
produces complementary to the anticoding strand (fig. 7.6), which could be any of three
types namely messenger RNA (mRNA), transfer RNA (tRNA), and ribosomal RNA (rRNA).
All three types are essential in translation.
Figure 7.7 Rho-dependent termination of transcription.
The mRNA (i.e. messenger RNA) provides the template that contains the
nucleotide code for the amino acid sequence of a protein. Three adjacent nucleotides in
the mRNA comprise a codon, which specifies an amino acid (fig. 7.7). The genetic code
chart (fig. 7.8) shows what amino acids are coded for by different codons.
Figure 7.8 Codons in the mRNA.

Figure
7.9 A genetic code chart.
The tRNA (i.e. transfer RNA), on the other hand, transfers amino acids from the
cytoplasm to the ribosomes. It assumes a cloverleaf configuration (fig. 7.9), and has an
anticodon arm that contains three nucleotides (anticodon) that are complementary to
the codon of the mRNA, which dictates the amino acid that the tRNA will carry. The
appropriate amino acid is then attached to the amino-acyl arm of the tRNA. This
correspondence between codons, anticodons, and amino acids explains how DNA
nucleotides code for the amino acid sequence of a protein. To date, there are at least 20
different tRNAs for the 20 different amino acids.
Ribosomal RNAs (rRNA) are complexed with ribosomal proteins to form

ribosomes— the protein synthesizing organelles of the cell. In prokaryotes, a ribosome
consists of small and large subunits with densities of 30S and 50S, respectively. These
subunits join during translation to form a 70S complex which has two important sites
namely, the A site (the amino-acyl or acceptor site) and the P site (peptidyl-binding or
donor site) (fig. 7.9).
Figure 7.10 Clover-leaf structure of tRNA (A); 16sRNA of E. coli (B); and a diagram of the ribosome (C).
TRANSLATION
► Activation of Amino Acids

Amino Acids are attached to their respective tRNAs via the action of the enzyme
amino-acyl synthetase at the expense of ATP (fig. 7.10). Different types of this enzyme
exist for different tRNAs.
Figure
7.11 Activation of an amino acid.
► Initiation of Translation
Prior to translation, initiation factor 1 (IF1) stimulates the dissociation of the

small and large subunits of ribosomes. Once the subunits have dissociated, initiation
factor 3 (IF3) binds to the 30S subunit to prevent the reassociation of the 30S and 50S
subunits, and binds the 30S subunit to the start codon of the mRNA. Initiation factor 2
(IF2), with an attached GTP, attaches the first amino acyl-tRNA (carrying formylated
methionine or fmet) to the 30S subunit. IF1 then attaches to the 30S subunit to
complete the initiation complex. The 50S subunit then joins this complex causing the
dissociation of IF3 and IF1 from the 30S subunit. GTP is then hydrolyzed to GDP and
Pi, leading to the dissociation of IF2. This results in the formation of the complete 7 OS
ribosome complexed with the mRNA to be translated (fig. 7.11).
The formyl group in fmet is postulated to prevent the elongation of the

polypeptide at the amino-end (N-terminal). The fmet-tRNA complements the initiation
codon of the mRNA.
Figure
7.12 Translation initiation complex.
► Elongation of the Peptide Chain
Once the fmet is set at the P-site with elongation factor Tu (EFTu) and GTP, a
new amino acid-tRNA complex enters the A-site complementary to the succeeding
codon (fig. 7.12). An enzyme, peptidyl transferase, present in the 50S subunit catalyzes
the formation of a peptide bond between the fmet and the amino acid carried by the
tRNA in the A-site. The tRNA in the P-site is then released to the cytoplasm for
recycling. This is followed by the movement of the ribosome along the mRNA in the 5'
to 3' direction through the action of elongation factor G (EFG) and GTP, displacing the
amino acidtRNA complex from the A-site to the P-site leaving the A-site free for the next
amino acid-tRNA complex. Elongation of the polypeptide repeats the cycle of amino
acid-tRNA entry, peptide bond formation, and displacement of the amino acid-tRNA
complex from the A-site to the P-site until the A-site encounters a termination/stop
codon.

Figure 7.13 Elongation of the peptide chain during translation.
► Termination of Translation
When the A site of the ribosome encounters any of the termination/stop codons
(i.e. UM, UAG or UGA), one of the release factors enters the A site and effect
termination of translation (fig. 7.13). Release factor 1 would recognize UAA and UAG
while release factor 2 would recognize UAA and UGA. Both RFI and RF2 effect breakage
of the bond

between the growing polypeptide chain and the tRNA it is attached to, releasing the
polypeptide product from the ribosome. Release factor 3 (RF3) aids either RFI or RF2
binds to the ribosome with the use of GTP. Once the polypeptide has been released,
the ribosome dissociates through the action of initiation factor 1 preparing the
ribosomal subunits for another round of translation.
The linear polypeptide chain may then undergo folding to become functional, or
it may undergo further processing (e.g. addition of functional groups like sugars or
phosphates) before becoming functional.
Figure 7.14 Termination of translation.

3. The Genetic Code
The genetic code is almost universal. It is the basis of the transmission of hereditary
information by nucleic acids in all organisms. There are four bases in RNA (A, G, C
and U), so there are 64
possible triplet codes. In
theory only 22 codes are
required: one for each of
the 20 naturally occurring
amino acids, with the
addition of a start codon
and a stop codon (to
indicate the beginning and
end of a protein sequence).
Many amino acids have
several codes (degeneracy),
so that all 64 possible
triplet codes are used. For
example, Arg and Ser each
have 6 codons whereas
Trp and Met have only
one. No two amino acids
have the same code but
amino acids whose side-
chains have similar
physical or chemical
properties tend to have
similar codon sequences,
e.g. the sidechains of Phe,
Leu, Ile, Val are all hydrophobic, and Asp and Glu are both
carboxylic acids (fig. 7.14). This means that if the incorrect tRNA is selected during
translation (owing to mispairing of a single base at the codon-anticodon interface) the
misincorporated amino acid will probably have similar properties to the intended tRNA
molecule. Although the resultant protein will have one incorrect amino acid it stands a
high probability of being
functional. Organisms Figure 7.15 The Genetic Code. Triplet codon assignment for the 20
show "codon bias" and use amino acids. As well as coding for methionine, AUG is used as a start
codon, initiating protein biosynthesis. certain codons for a
particular amino acid more than others. For example, the codon usage in humans is
different from that in bacteria; it can sometimes be difficult to express a human

protein in bacteria because the relevant tRNA might be present at too low a
concentration.
4. Regulation of Gene Action
Cells contain the genetic capacity for the synthesis of an enormous number of
different products. However, not all these products are present at any given time.
There is a regulatory mechanism for the control of gene expression. In most
organisms, regulation occurs at least at two levels, namely: the transcriptional and
posttranscriptional levels. These regulatory levels operate with some modifications in
prokaryotes and eukaryotes. Furthermore, in eukaryotes, control is also achieved at
the stage wherein the mRNA is released from the nucleus and even after the synthesis
of the polypeptide chain.
In prokaryotes and viruses, several experimental evidences indicate that

transcription is the primary target of controlling mechanisms. This can be inferred
from the different ways by which enzymes are synthesized. Some enzymes are
constitutive, meaning they are synthesized continuously. This would indicate that the
transcription of the mRNA for these constitutive enzymes is being constantly produced
as well. Other enzymes are inducible such that they are normally present only in small
amounts but their concentrations increase a thousand-fold or more when their
substrates are present in the medium. Hence, the synthesis of mRNA for inducible
enzymes is increased in the presence of a substrate.
Related genes in prokaryotes are generally clustered together. The gene

products or enzymes of this cluster belong to the same metabolic pathway. This
cluster comprises a genetic unit called an operon (i.e. group of functionally related
genes). Operon systems are either inducible, wherein effector molecules induce weakly
transcribed operons to be active, or repressible, where effector molecules repress the
transcription of an operon.
The Lactose Operon (An Inducible Operon)
The E. coli lactose or lac operon consists of the following adjacent parts: the
regulator (lacl) gene, the promoter (P) site, and the operator (O) site, and three
structural genes z, y and a (Fig. 7.16). Recall that the promoter is the site where RNA
polymerase binds to start transcription. The operator, which is situated between the
promoter and the structural genes serve as the binding site for the repressor that
stops transcription.
Figure 7.16 Diagram of E. coli with a lac operon turned off.

The repressor is a tetramer or a protein that is made up of four (4) subunits. In
the lac repressor, all the subunits are identical. Each subunit is a polypeptide that is
coded for by the lacl gene. The tetramer is active by itself, and binds to operator
blocking the movement of the RNA polymerase from the promoter through the

structural genes, thus hindering transcription. Therefore, the operon is said to be

"turned off" or repressed. However, we should not liken the repressor to a roadblock,
which hinders the passage of vehicles along the road. Sometimes the bound repressor
is momentarily released, allowing minimal transcription of the structural genes to
proceed, before it is replaced by another or the same repressor. Hence, even in the
repressed state, there is a low concentration of proteins coded by the structural genes.
The three structural genes, lacZ, lacy, and lacA, code for enzymes that are
involved in the metabolism of lactose for energy release. LacZ codes for the enzyme
ßgalactosidase, which breaks down lactose into glucose and galactose; this same
enzyme also catalyzes the conversion of lactose to allolactose. Lacy codes for ß-
galactoside permease, which is a transmembrane transport protein that allows entry of
ßgalactosides, like lactose, from the environment into the bacterial cell. LacA codes for
ßgalactoside transacetylase that is involved in other aspects of ß-galactoside
metabolism.
When lactose is present in the environment, the low concentration permeases in

the cell membrane of the bacterium allows the entry of lactose. Some of the lactose
that enters the cell is broken down by ß-galactosidase into glucose and galactose for
energy production, while others are converted to allolactose. Allolactose, an isomer of
lactose, serves as an inducer by binding to the repressor that is bound to the operator
of the lac operon causing the change in conformation/shape of the repressor. This
change in shape causes the release of the repressor from the operator. At this point,
the operon is said to have been induced or "turned on Transcription of the structural
genes then proceeds at a high rate leading to an increase in the concentrations of their
products (Fig. 7.17). The operon is "turned off" again once all the lactose molecules in
the cell have been used up and the repressor reverts to its original shape allowing it to
"lind again to the operator.
Figure
7.17 Diagram of E. coli with a lac operon turned on.
The Tryptophan Operon (A Repressible Operon)

The tryptophan operon consists of the following parts: a regulator gene (trpR), a
promoter site (trpP), an operator site (trpO), an attenuator site (trpL), and five
structural genes (i.e. trpE, trpD, rpC, trpB, and trpA). In contrast to the lac operon,
the regulator gene trpR is situated far from the rest of the operon, and the operator
trpO lies wholly within the promoter trpP, such that the binding of a repressor to the
operator prevents the binding of the RNA polymerase to the promoter site.
The trp repressor is a dimer with identical subunits. Each subunit is a

polypeptide that is coded for by the trpR gene. Unlike the lac operon, the protein dimer
formed is initially inactive; meaning the repressor by itself cannot bind the operator.
This inactive repressor is called an aporepressor. The active repressor is formed by the
attachment of a corepressor to the aporepressor. For the trp operon, the corepressor is
tryptophan.
The structural genes of the trp operon code for enzymes involved in the
biosynthesis of tryptophan, which is needed in many metabolic processes in the cell,
such as translation. Therefore, a constant supply of this amino acid must be present.
Because of this, the trp operon is, by default, "turned on" (Fig. 7.18). The trpR is
constitutively "turned on" but since the repressor produced is inactive, there is no
repression of the operon. The RNA polymerase is free to transcribe continuously the
structural genes.
Figure 7.18 Diagram of E. coli cell with a trp operon turned on.
The first two structural genes, trpE, and trpD, code for two polypeptides that
form one functional enzyme called anthranilate synthetase. The structural gene trpC
codes for the enzyme indole glycerol phosphate synthetase. The last two structural
genes, trpB, and trpA, code for two polypeptides that form the enzyme tryptophan
synthetase.

When the concentration of tryptophan inside the cell becomes high, due to
either overproduction or the availability of tryptophan in the environment, a
tryptophan molecule binds aporepressor to form the active repressor that will bind the
operator. This prevents the polymerase from binding the promoter and transcribing the
structural genes. Thus, the operon "turned off" (Fig. 7.19).
Figure 7.19 Diagram of E. coli cell with a trp operon turned off.
Regulation of Differentiation
Through gene regulation, each cell type in your body has a different set of active
genes—despite the fact that almost all the cells of your body contain the exact same
DNA. During development, a complex multicellular organism arises through
differentiation of a mass of genotypically identical cells originating from a single zygote
(i.e. fertilized egg) through mitosis. Differentiation causes the distinction between
parts of an organism. It consists of changes in the quantity, quality, and efficiency of
gene products in different parts of the organism. These different patterns of gene
expression cause your various cell types to have different sets of proteins, this leads to
the cells' expression of particular phenotypes. Thus, making each cell type uniquely
specialized to do its job.
For example, one of the jobs of the liver is to remove toxic substances like
alcohol from the bloodstream. To do this, liver cells express genes encoding subunits
(pieces) of an enzyme called alcohol dehydrogenase. This enzyme breaks alcohol down
into a nontoxic molecule. The neurons in a person’s brain don’t remove toxins from the
body, so they keep these genes unexpressed, or “turned off.” Similarly, the cells of the
liver don’t send signals using neurotransmitters, so they keep neurotransmitter genes
turned off (Fig. 7.20).

Figure 7.20 Different cells have different genes “turned on.”
There are many other genes that are expressed differently between liver cells
and neurons (or any two cell types in a multicellular organism like yourself).
How do cells “decide” which genes to turn on?
Now there’s a tricky question! Many factors that can affect which genes a cell
expresses. Different cell types express different sets of genes, as we saw above.
However, two different cells of the same type may also have different gene expression
patterns depending on their environment and internal state.
Broadly speaking, we can say that a cell’s gene expression pattern is determined
by information from both inside and outside the cell.
Examples of information from inside the cell: the proteins it inherited from its
mother cell, whether its DNA is damaged, and how much ATP it has.
Examples of information from outside the cell: chemical signals from other cells,
mechanical signals from the extracellular matrix, and nutrient levels.
How do these cues help a cell “decide” what genes to express? Cells don’t make
decisions in the sense that you or I would. Instead, they have molecular pathways that
convert information—such as the binding of a chemical signal to its receptor—into a
change in gene expression.
As an example, let’s consider how cells respond to growth factors. A growth

factor is a chemical signal from a neighboring cell that instructs a target cell to grow
and divide. We could say that the cell “notices” the growth factor and “decides” to
divide, but how do these processes actually occur?

Figure 7.21 Growth factor prompting cell division
► The cell detects the growth factor through physical binding of the growth factor to a
receptor protein on the cell surface.
► Binding of the growth factor causes the receptor to change shape, triggering a series
of chemical events in the cell that activate proteins called transcription factors.
► The transcription factors bind to certain sequences of DNA in the nucleus and
cause transcription of cell division-related genes.
► The products of these genes are various types of proteins that make the cell divide
(drive cell growth and/or push the cell forward in the cell cycle).
► This is just one example of how a cell can convert a source of information into a
change in gene expression. There are many others, and understanding the logic of
gene regulation is an area of ongoing research in biology today.
► Growth factor signaling is complex and involves the activation of a variety of targets,
including both transcription factors and non-transcription factor proteins.

V. Take-Action
Direction: USE A SEPARATE SHEET OF PAPER TO ANSWER THE ACTIVITY GIVEN

BELOW. Follow the format provided.
Take-Action No. 7: Score:

The Central Dogma of Genetics and Gene Regulation ___/50
Name: CHRISTIAN PASTOE Instructor: Course/Year/Section: CAS

1A Date:
Direction: Compare and contrast replication, transcription and translation based on the
criteria given below.
CRITERIA REPLICATION TRANSCRIPTION TRANSLATION
each strand of the which is the second translation files that

Template used original DNA serves major step in gene contain only the
as a template for the expression, the source text
synthesis of a mRNA is "read"
complementary strand according to the genetic
code, which relates the
DNA sequence to the
amino acid sequence in
proteins
always synthesized in RNA polymerase Proteins are
Direction the 5'-to-3' direction, synthesizes an RNA synthesized from
synthesis meaning that transcript mRNA templates by a
of nucleotides are added complementary to the process that has been
only to the 3' end of the DNA template strand in highly conserved
growing strand. the 5' to 3' direction throughout evolution

Protein/enzyme
requirements:
Initiation
Elongation
Termination
Products
Direction: Enumerate and define the functions of the different enzymes or proteins
involved in replication, transcription and translation
Protein/enzyme
requirements: REPLICATION TRANSCRIPTION TRANSLATION

Signals the DNA to Bringing in a new

Initiation Binding triggers events unwind so the amino acid to
that unwind the DNA enzyme can ''read'' lengthen the chain
double helix into two the bases in one of
single-stranded DNA the DNA strands
molecules.
Thanks to the Continues to

Elongation addition of new translate each
DNA polymerase adds nucleotides. codon in turn
DNA nucleotides to the
3′ end of the newly
synthesized
polynucleotide strand
Termination
Gene Regulation

1. Given the following genotypes, explain how the mutation (identified by a (-)
superscript) will affect E. coli grown in lactose medium. Will the lac operon be on or
off? Will there be a complete set of gene products from the lac operon? What will
the implicant of the missing gene product, if ever? Will be the implication of the
missing gene product? If ever, will the cell be able to survive in the lactose medium
or not?
Note: Mutation cause changes in DNA, thus, changing also protein products and gene
expression.
a. i+ p+ o+ z- y+
b. i- p+ o+ z+ y+
c. i+ p+ o- z+ y+
d. i+ p- o+ z+ y+
2. In terms of the trp operon, differentiate between two normal bacterial-cultures, one
grown in a medium supplied with tryptophan and the other medium without
tryptophan.

VI. Self-Check
Direction: USE A SEPARATE SHEET OF PAPER TO ANSWER THE ACTIVITY
GIVEN BELOW. Follow the format provided.
Self-Check No. 7: Score:

Central Dogma
___/40
Name: Christian Pastor Instructor: Course/Year/Section CAS
1A Date:
I. Identification: Read the descriptions/statements below and provide the best answer
that corresponds to each statement.
1. These are short, newly synthesized DNA fragments that are formed on the lagging
template strand during DNA replication. Okazaki fragments
2. Enzyme that separates double-stranded DNA into single strands allowing each
strand to be copied helicase
3. Enzyme that corrects “overwinding” ahead of replication forks by breaking,
swiveling, and rejoining DNA strands. Topoisomerase
4. Cellular organelle where translation occurs and is a factory for the synthesis of
proteins. Ribosomes
5. The Coding sections of a RNA transcript that are translated into protein. exon
6. Enzyme which forms peptide bonds between adjacent amino acids using tRNAs
during translation. Elongation of the Peptide Chain
7. The amino acid coded by the start codon AUG. Methionine
8. The entire stretch of bacterial DNA which includes the promoter, operator and
structural genes.
9. A molecule that regulates gene expression by disabling repressors turning a lac
operon on. LACTOSE MOLECULE
10.Proteins that controls the rate of transcription of genetic information from DNA to
messenger RNA, by binding to a specific DNA sequence
II. Complete the table. Given the DNA strand, provide the resulting mRNA sequence
after transcription; Anti-codon strand on translation and the polypeptide
sequence after translation process.
MRNA STRAND AUGGAGCCGAUACAAAUUGAAAGAGUGUAA
ANTI CODON STRAND UAGCUCGGCUAUGUUUAACUUUGACACAUU
AMINO ACID , leucine ,glycine , tyrocine , valine , ,

leucine, , histidine , isoleucine
Questions to Answer:
1. What will happen to DNA replication/transcription/translation if one of its

initiation proteins is absent?

Many types of DNA damage and in its absence the cell has persistent single
stranded breaks that promote DNA recombination.
VII. Self-Reflect
Direction: USE A SEPARATE SHEET OF PAPER TO ANSWER THE ACTIVITY GIVEN

BELOW. Follow the format provided.
Self-Reflect No. 7:
Gene Function
Score:
Name: Instructor: ___/15
Course/Year/Section: Date:
Journal Entry
1. Hormones participate in the regulation of expression of genes. Write a narrative of

the changes (e.g. having your first menstrual period, the development of Adams
apple in male) that you went through during your puberty or adolescent stage
(pagdadalaga/pagbibinata) to further appreciate the ability of hormones to regulate
gene expression.
In fact Adam’s apple in men are starting at the age of 13-18 years old, at my
age of 15 I have the Adams apple it is small compare it now at the age of this I was
wondering why I have this and my voice are changing my voice used to be low tone
but when I had Adams apple my voice are change and pity I'm getting older my Adams
apple is also changing my times.

VIII. References
Mendioro, M. S., Laude, R. P., Diaz, M. Q., Mendoza, J. C., & Ramirez, D. A. (2013).
GENETICS: Laboratory Manual, 13th edition. Genetics and Molecular Biology
Division, Institute of Biological Sciences, College of Arts and Sciences,
University of Los Banos, Philippines: 7 Lakes Printing Press, 12 A. fule Street,
San Pablo City 4000.


Module 1

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Module 1

Uploaded by

Copyright:

Available Formats

QUIRINO STATE UNIVERSITY

College of Agriculture, Forestry and Engineering

B MODULE 7: GENE FUNCTION: PROTEIN AND ENZYMES

II. Intended Learning Outcomes

1. Discuss the genetic control of proteins;

IV. Content Focus

1. Genetic Control of Proteins

Transcription and translation ensure that a linear array of nucleotides in the

Module 7: Gene Function 1 | 24

Cells synthesize essential cellular substances step-by-step from compounds in

Module 7: Gene Function 2 | 24

ornithine and citrulline, as shown in the accompanying diagram. Ornithine is made

Hundreds of biochemical pathways involving thousands of reactions take place

Review of the Central Dogma of Genetics

Module 7: Gene Function 3 | 24

Prokaryotic vs. Eukaryotic Gene Expression and Regulation

The process of gene expression and regulation: transcription and translation

Eukaryotic cells, in contrast, have intracellular organelles that add to their

Module 7: Gene Function 4 | 24

Table 1. Differences in the Regulation of Gene Expression of Prokaryotic and

For the purpose of demonstrating the translation and transcription process,

Module 7: Gene Function 5 | 24

7.5 Initiation of Transcription

Figure 7.6 Elongation of the transcript

Module 7: Gene Function 6 | 24

Figure 7.7 Rho-dependent termination of transcription.

Figure 7.8 Codons in the mRNA.

Module 7: Gene Function 7 | 24

Ribosomal RNAs (rRNA) are complexed with ribosomal proteins to form

► Activation of Amino Acids

Module 7: Gene Function 8 | 24

7.11 Activation of an amino acid.

Prior to translation, initiation factor 1 (IF1) stimulates the dissociation of the

The formyl group in fmet is postulated to prevent the elongation of the

7.12 Translation initiation complex.

► Elongation of the Peptide Chain

Module 7: Gene Function 9 | 24

Figure 7.13 Elongation of the peptide chain during translation.

Module 7: Gene Function 10 | 24

Figure 7.14 Termination of translation.

Module 7: Gene Function 11 | 24

4. Regulation of Gene Action

In prokaryotes and viruses, several experimental evidences indicate that

Related genes in prokaryotes are generally clustered together. The gene

The Lactose Operon (An Inducible Operon)

Figure 7.16 Diagram of E. coli with a lac operon turned off.

Module 7: Gene Function 12 | 24

structural genes, thus hindering transcription. Therefore, the operon is said to be

When lactose is present in the environment, the low concentration permeases in

7.17 Diagram of E. coli with a lac operon turned on.

The Tryptophan Operon (A Repressible Operon)

Module 7: Gene Function 13 | 24

The trp repressor is a dimer with identical subunits. Each subunit is a

Module 7: Gene Function 14 | 24

Module 7: Gene Function 15 | 24

Figure 7.20 Different cells have different genes “turned on.”

As an example, let’s consider how cells respond to growth factors. A growth

Module 7: Gene Function 16 | 24

Figure 7.21 Growth factor prompting cell division

Module 7: Gene Function 17 | 24

Direction: USE A SEPARATE SHEET OF PAPER TO ANSWER THE ACTIVITY GIVEN

Take-Action No. 7: Score: