Thompson & Thompson Genetics in

Medicine E Book (Thompson and

Thompson Genetics in Medicine) 7th
Edition, (Ebook PDF)
Visit to download the full and correct content document:
https://ebookmass.com/product/thompson-thompson-genetics-in-medicine-e-book-tho
mpson-and-thompson-genetics-in-medicine-7th-edition-ebook-pdf/
RoshanKetab +98(21) 66963783-8

V l l U L
I I I V I I I
Y3 I I I V I I I
Y3 V I I

GENETICS IN MEDICINE
Seventh E d i t ~ o n

Robert L. Nussbaum, M D
Holly Smith Distinguished Professor in Science and Medicine
Chief, Division of Medical Genetics
Department of Medicine and The Institute for Human Genetics
University of California, San Francisco
San Francisco, California

Roderick R. McInnes, MD, PhD, FRS(C)

University Professor
Anne and Max Tanenbaum Chair in Molecular Medicine
Professor of Pediatrics and Molecular and Medical Genetics
University of Toronto and The Hospital for Sick Children
Toronto, Ontario, Canada
Scientific Director, Institute of Genetics
Canadian Institutes of Health Research

Huntington F. Willard, PhD

Director
Institute for Genome Sciences and Policy
Vice Chancellor for Genome Sciences
Nanaline H. Duke Professor of Genome Sciences
Duke University
Durham, North Carolina

With Clinical Case Studies updated and new cases prepared by

Ada Hamosh, MD, MPH

Clinical Director
Institute of Genetic Medicine
Scientific Director, O M I M
Associate Professor, Pediatrics
Johns Hopkins University School of Medicine
Baltimore, Maryland
RoshanKetab +98(21) 66963783-8
 RoshanKetab +98(21) 66963783-8

Chapter 5

Introduction, 1 Principles o f Clinical Cytogenetics, 59

Genetics and Genomics in Medicine, 1 Introduction to Cytogenetics, 59
Onward, 2 Chromosome Abnormalities, 65
Parent-of-Origin Effects, 77
Studies of Chromosomes in Human Meiosis, 81
Chapter 2 Mendelian Disorders with Cytogenetic Effects, 82
The Human Genome and the Chromosomal
Cytogenetic Analysis in Cancer, 82
Basis o f Heredity, 5
The Human Genome and Its Chapter 6
Chromosomes, 6 Clinical Cytogenetics: Disorders o f the
Cell Division, 13 Autosomes and the Sex Chromosomes, 89
Human Gametogenesis and Fertilization, 20
Medical Relevance of Mitosis and Autosomal Disorders, 89
Meiosis, 22 The Sex Chromosomes and Their
Abnormalities, 98
Disorders of Gonadal and Sexual
Chapter 3 Development, 109
The Human Genome: Gene Structure and
Chapter 7
Function, 25
Information Content of the Human Patterns o f Single-Gene Inheritance, 115
Genome, 25 Overview and Concepts, 115
The Central Dogma: Mendelian Inheritance, 118
DNA + RNA -+ Protein, 26 Factors Affecting Pedigree Patterns, 119
Gene Organization and Structure, 28 Correlating Genotype and Phenotype, 121
Fundamentals of Gene Expression, 30 Autosomal Patterns of Mendelian
Gene Expression in Action: The P-Globin Inheritance, 122
Gene, 33 X-Linked Inheritance, 129
Gene Regulation and Changes in Activity of the Pseudoautosomal Inheritance, 135
Genome, 36 Mosaicism, 135
Variation in Gene Expression and its Relevance Imprinting In Pedigrees, 137
to Medicine, 38 Unstable Repeat Expansions, 139
Conditions that May Mimic Mendelian
Inheritance of Single-Gene Disorders, 144
Chapter 4
Maternal Inheritance of Disorders Caused by
Tools o f Human Molecular Genetics, 41 Mutations in the Mitochondria1 Genome, 144
Analysis of Individual DNA and RNA Family History as Personalized Medicine, 146
Sequences, 41
Methods of Nucleic Acid Analysis, 48 Chapter 8
The Polymerase Chain Reaction, 50
DNA Sequence Analysis, 53 Genetics o f Common Disorders with Complex
Advanced Techniques Using Digital Image Inheritance, 151
Capture of Fluorescence-Tagged Qualitative and Quantitative Traits, 152
Nucleotides, 55 Genetic and Environmental Modifiers of
Western Blot Analysis of Proteins, 5 7 Single-Gene Disorders, 159
 RoshanKetab +98(21) 66963783-8
Contents - --
--
-
Examples of Multifactorial Traits for which
Genetic and Environmental Factors Are
Known, 160
Chapter 9
Genetic Variation in Individuals and
Populations: Mutation and
Polymorphism, 175
Mutation, 175
Types of Mutations and Their Consequences, 177
Human Genetic Diversity, 183
Inherited Variation and Polymorphism in
DNA, 184
Inherited Variation and Polymorphism in
Proteins, 186
Genotypes and Phenotypes in Populations, 192
Factors that Disturb Hardy-Weinberg
Equilibrium, 195
Ethnic Differences in the Frequency of Various
Genetic Diseases, 199
C h a p t e r 10
Human Gene Mapping and Disease Gene
Identification, 207
The Genetic Landscape of the Human
Genome, 207
Mapping Human Genes by Linkage
Analysis, 217
Mapping of Complex Traits, 222
From Gene Mapping to Gene Identification,
Clinical Case Studies Illustrating Genetic
Principles, 231
C h a p t e r 11
Principles o f Molecular Disease: Lessons from
the Hemoglobinopathies, 323
The Effect of Mutation on Protein Function, 323
How Mutations Disrupt the Formation of
Biologically Normal Proteins, 325
The Hemoglobins, 326
The Hemoglobinopathies, 329
Chapter 12
The Molecular, Biochemical, and Cellular
Basis o f Genetic Disease, 345
Diseases due to Mutations in Different Classes of
Proteins, 345
Diseases Involving Enzymes, 348
Defects in Receptor Proteins, 360
Transport Defects, 364
Disorders of Structural Proteins, 367
Neurodegenerative Disorders, 377
C h a p t e r 13
The Treatment o f Genetic Disease, 393
The Current State of Treatment of Genetic
Disease, 393
Special Considerations in Treating Genetic
Disease, 395
Treatment Strategies, 396
The Molecular Treatment of Disease, 399
'hapter 14
Developmental Genetics and Birth
Defects, 419
(with the assistance of Leslie G . Biesecker, M D )
Developmental Biology in Medicine, 419
Introduction to Developmental Biology, 422
Genes and Environment in Development, 424
Basic Concepts of Developmental Biology, 426
Cellular and Molecular Mechanisms in
Development, 434
Interaction of Developmental Mechanisms in
Embryogenesis, 440
Chapter 15
Prenatal Diagnosis, 443
Indications for Prenatal Diagnosis by Invasive
Testing, 443
Methods of Prenatal Diagnosis, 444
Laboratory Studies, 453
Emerging Technologies for Prenatal
Diagnosis, 456
Prenatal Prevention and Management of Genetic
Disease, 457
Genetic Counseling for Prenatal Diagnosis, 458
Chapter 16
Cancer Genetics and Genomics, 461
Genetic Basis of Cancer, 461
Oncogenes, 464
Tumor-Suppressor Genes, 467
Tumor Progression, 479
Applying Genomics to Individualize Cancer
Therapy, 479
Cancer and the Environment, 482
 RoshanKetab +98(21) 66963783-8

C h a p t e r 17 Application of Molecular Genetics to

Determination of Recurrence Risks, 516
Personalized Genetic Medicine, 4 8 5
Empirical Recurrence Risks, 519
Family History as Personalized Genetic
Medicine, 485
Genetic Screening in Populations, 487 C h a p t e r 20
Screening for Genetic Susceptibility to Ethical Issues i n Medical Genetics, 5 2 3
Disease, 490
Ethical Dilemmas Arising in Medical
Genetics, 523
- C h a p t e r 18

Pharmacogenetics a n d
Eugenic and Dysgenic Effects of Medical
Genetics, 528
Genetics in Medicine, 529
Pharmacogenomics, 4 9 7
Using Risk Information to Improve Care:
Pharmacogenetics, 497 Glossary, 531
Pharmacogenomics, 504 Answers to Problems, 551
Role of Ethnicity and Race in Personalized
Medicine, 504 Index, 567

C h a p t e r 19

Genetic Counseling a n d Risk Assessment, 5 0 7

The Process of Genetic Counseling, 507
Determining Recurrence Risks, 509
RoshanKetab +98(21) 66963783-8
 RoshanKetab +98(21) 66963783-8
Introduction
O GENETICS A N D GENOMICS I N
MEDICINE
Genetics in medicine had its start at the beginning of
the 20th century, with the recognition by Garrod and
others that Mendel's laws of inheritance could explain
the recurrence of certain disorders in families. During
the ensuing 100 years, medical genetics grew from a
small subspecialty concerned with a few rare hereditary
disorders to a recognized medical specialty whose con-
cepts and approaches are important components of the
diagnosis and management of many disorders, both
common and rare. This is even more the case now at
the beginning of the 21st century, with the completion
of the Human Genome Project, an international effort
to determine the complete content of the human genome,
defined as the sum total of the genetic information of
our species (the suffix -ome is from the Greek for "all"
or "complete"). We can now study the human genome
as an entity, rather than one gene at a time. Medical
genetics has become part of the broader field of genomic
medicine, which seeks to apply a large-scale analysis of
the human genome, including the control of gene
expression, human gene variation, and interactions
between genes and the environment, to improve medical
care.
Medical genetics focuses not only on the patient
but also on the entire family. A comprehensive family
history is an important first step in the analysis of any
disorder, whether or not the disorder is known to be
genetic. As pointed out by Childs, "to fail to take a
good family history is bad medicine." A family history
is important because it can be critical in diagnosis, may
show that a disorder is hereditary, can provide informa-
tion about the natural history of a disease and variation
in its expression, and can clarify the pattern of inheri-
tance. Furthermore, recognizing a familial component
to a medical disorder allows the risk in other family
members to be estimated so that proper management,
prevention, and counseling can be offered to the patient
and the family.
In the past few years, the Human Genome Project
has made available the complete sequence of all human
DNA; knowledge of the complete sequence allows the
identification of all human genes, a determination of
the extent of variation in these genes in different popu-
lations, and, ultimately, the delineation of how varia-
tion in these genes contributes to health and disease. In
partnership with all the other disciplines of modern
biology, the Human Genome Project has revolutionized
human and medical genetics by providing fundamental
insights into many diseases and promoting the develop-
ment of far better diagnostic tools, preventive mea-
sures, and therapeutic methods based on a comprehensive
view of the genome.
Genetics is rapidly becoming a central organizing
principle in medical practice. Here are just a few exam-
ples of the vast array of applications of genetics and
genomics to medicine today:
A child who has multiple congenital malformations
and a normal routine chromosome analysis under-
goes a high-resolution genomic test for submicro-
scopic chromosomal deletions or duplications.
A young woman with a family history of breast
cancer receives education, test interpretation, and
support from a counselor specializing in hereditary
breast cancer.
An obstetrician sends a chorionic villus sample taken
from a 38-year-old pregnant woman to a cytogenet-
ics laboratory for examination for abnormalities in
the number or structure of the fetal chromosomes.
A hematologist combines family and medical history
with gene testing of a young adult with deep venous
 RoshanKetab +98(21) 66963783-8
thrombosis to assess the benefits and risks of initiat-
ing and maintaining anticoagulant therapy.
Gene expression array analysis of a tumor sample is
used to determine prognosis and to guide therapeutic
decision-making.
An oncologist tests her patients for genetic variations
that can predict a good response or an adverse reac-
tion to a chemotherapeutic agent.
A forensic pathologist uses databases of genetic poly-
morphism~in his analysis of DNA samples obtained
from victims' personal items and surviving relatives
to identify remains from the September 11, 2001
World Trade Center attack.
Discovery of an oncogenic signaling pathway inap-
propriately reactivated by a somatic mutation in a
form of cancer leads to the development of a specific
and powerful inhibitor of that pathway that success-
fully treats the cancer.
Genetic principles and approaches are not restricted
to any one medical specialty or subspecialty but are
permeating many areas of medicine. To give patients
and their families the full benefit of expanding genetic
knowledge, all physicians and their colleagues in the
health professions need to understand the underlying
principles of human genetics. These principles include
the existence of alternative forms of a gene (alleles) in
the population; the occurrence of similar phenotypes
developing from mutation and variation at different
loci; the recognition that familial disorders may arise
from gene variants that cause susceptibility to diseases
in the setting of gene-gene and gene-environmental
interactions; the role of somatic mutation in cancer and
aging; the feasibility of prenatal diagnosis, presymp-
tomatic testing, and population screening; and the
promise of powerful gene-based therapies. These con-
cepts now influence all medical practice and will only
become more important in the future.
Classification of Genetic Disorders
In clinical practice, the chief significance of genetics is
in elucidating the role of genetic variation and mutation
in predisposing to disease, modifying the course of
disease, or causing the disease itself. Virtually any
disease is the result of the combined action of genes and
environment, but the relative role of the genetic com-
ponent may be large or small. Among disorders caused
wholly or partly by genetic factors, three main types
are recognized: chromosome disorders, single-gene dis-
orders, and multifactorial disorders.
In chromosome disorders, the defect is due not to
a single mistake in the genetic blueprint but to an excess
or a deficiency of the genes contained in whole chro-
mosomes or chromosome segments. For example, the
presence of an extra copy of one chromosome, chromo-
some 21, produces a specific disorder, Down syndrome,
even though no individual gene on the chromosome is
abnormal. As a group, chromosome disorders are
common, affecting about 7 per 1000 liveborn infants
and accounting for about half of all spontaneous first-
trimester abortions. These disorders are discussed in
Chapter 6.
Single-gene defects are caused by individual mutant
genes. The mutation may be present on only one chro-
mosome of a pair (matched with a normal allele on the
homologous chromosome) or on both chromosomes of
the pair. In a few cases, the mutation is in the mito-
chondrial rather than in the nuclear genome. In any
case, the cause is a critical error in the genetic informa-
tion carried by a single gene. Single-gene disorders such
as cystic fibrosis, sickle cell anemia, and Marfan syn-
drome usually exhibit obvious and characteristic pedi-
gree patterns. Most such defects are rare, with a
frequency that may be as high as 1 in 500 to 1000
individuals but is usually much less. Although individu-
ally rare, single-gene disorders as a group are responsi-
ble for a significant proportion of disease and death.
Taking the population as a whole, single-gene disorders
affect 2% of the population sometime during an entire
life span. In a population study of more than 1 million
live births, the incidence of serious single-gene disor-
ders in the pediatric population was estimated to be
0.36%; among hospitalized children, 6% to 8% prob-
ably have single-gene disorders. These disorders are
discussed in Chapter 7.
Multifactorial inheritance is responsible for the
majority of diseases, all of which have a genetic contri-
bution, as evidenced by increased risk for recurrence in
relatives of affected individuals or by increased fre-
quency in identical twins, and yet show inheritance
patterns in families that do not fit the characteristic
patterns seen in single-gene defects. Multifactorial dis-
eases include prenatal developmental disorders, result-
ing in congenital malformations such as Hirschsprung
disease, cleft lip and palate, or congenital heart defects,
as well as many common disorders of adult life, such
as Alzheimer disease, diabetes, and hypertension. There
appears to be no single error in the genetic information
in many of these conditions. Rather, the disease is the
result of one, two, or more different genes that together
can produce or predispose to a serious defect, often in
concert with environmental factors. Estimates of the
impact of multifactorial disease range from 5% in the
pediatric population to more than 60% in the
entire population. These disorders are the subject of
Chapter 8.
6 ONWARD
During the SO-year professional life of today's profes-
sional and graduate students, extensive changes are
 RoshanKetab +98(21) 66963783-8
-
likely to take place in the discovery, development, and
use of genetic and genomic knowledge and tools in
medicine. It is difficult to imagine that any ~ e r i o dcould
encompass changes greater than those seen in the past
50 years, during which the field has gone from first
recognizing the identity of DNA as the active agent of
inheritance, to uncovering the molecular structure of
DNA and chromosomes and determining the complete
code of the human genome. And yet, judging from the
quickening pace of discovery within only the past
decade, it is certain that we are just at the
beginning of a revolution in integrating knowledge of
genetics and the genome into public health and the
practice An the language
and concepts of human and medical genetics and an
1
CHAPTER Introduction
appreciation of the genetic and genomic perspective on
health and disease will form a framework for lifelong
learning that is part of every health professional's
career.
43 GENERAL REFERENCES
Guttmacher AE, Collins FS: Genomic medicine-a primer. N Engl
J Med 347:1512-1520, 2002.
Peltonen L, McKusick VA: Genomics and medicine. Dissecting
human disease in the postgenomic era. Science 291:1224-1229,
2001.
Willard HF, Angrist M, Ginsburg GS: Genomic medicine: genetic
variation and its impact on the future of health care. Philos Trans
R S ~ Lond
C B Biol Sci 360:1543-1550,2005.
RoshanKetab +98(21) 66963783-8
 RoshanKetab +98(21) 66963783-8
The Human Genome and the
Chromosomal Basis o f Heredity
Appreciation of the importance of genetics to medicine
requires an understanding of the nature of the heredi-
tary material, how it is packaged into the human
genome, and how it is transmitted from cell to cell
during cell division and from generation to generation
during reproduction. The human genome consists of
large amounts of the chemical deoxyribonucleic acid
(DNA) that contains within its structure the genetic
information needed to specify all aspects of embryo-
genesis, development, growth, metabolism, and repro-
duction-essentially all aspects of what makes a human
being a functional organism. Every nucleated cell in the
body carries its own copy of the human genome, which
contains, by current estimates, about 25,000 genes.
Genes, which at this point we define simply as units of
genetic information, are encoded in the DNA of the
genome, organized into a number of rod-shaped orga-
nelles called chromosomes in the nucleus of each cell.
The influence of genes and genetics on states of health
and disease is profound, and its roots are found in the
information encoded in the DNA that makes up the
human genome. Our knowledge of the nature and iden-
tity of genes and the composition of the human genome
has increased exponentially during the past several
decades, culminating in the determination of the DNA
sequence of virtually the entire human genome in
2003.
Each species has a characteristic chromosome com-
plement (karyotype) in terms of the number and the
morphology of the chromosomes that make up its
genome. The genes are in linear order along the chro-
mosomes, each gene having a precise position or locus.
A gene map is the map of the chromosomal location of
the genes and is characteristic of each species and the
individuals within a species.
The study of chromosomes, their structure, and
their inheritance is called cytogenetics. The science of
modern human cytogenetics dates from 1956, when it
was first established that the normal human chromo-
some number is 46. Since that time, much has been
learned about human chromosomes, their normal
structure, their molecular composition, the locations of
the genes that they contain, and their numerous and
varied abnormalities.
Chromosome and genome analysis has become an
important diagnostic procedure in clinical medicine. As
described more fully in subsequent chapters, some of
these applications include the following:
Clinical Diagnosis Numerous medical disorders,
including some that are common, such as Down syn-
drome, are associated with microscopically visible
changes in chromosome number or structure and
require chromosome or genome analysis for diagnosis
and genetic counseling (see Chapters 5 and 6).
Gene Mapping and Identification A major goal of
medical genetics today is the mapping of specific genes
to chromosomes and elucidating their roles in health
and disease. This topic is referred to repeatedly but is
discussed in detail in Chapter 10.
Cancer Cytogenetics Genomic and chromosomal
changes in somatic cells are involved in the initiation
and progression of many types of cancer (see Chapter
16).
Prenatal Diagnosis Chromosome and genome analy-
sis is an essential procedure in prenatal diagnosis (see
Chapter 15).
The ability to interpret a chromosome report and
some knowledge of the methodology, the scope, and the
 RoshanKetab +98(21) 66963783-8
Thnmncnn R Thnmncnn CFNFTICZ IN MFnlCINE
- -
limitations of chromosome studies are essential skills
for physicians and others working with patients with
birth defects, mental retardation, disorders of sexual
development, and many types of cancer.
Q THE HUMAN GENOME AND ITS
CHROMOSOMES
With the exception of cells that develop into gametes
(the germline), all cells that contribute to one's body are
called somatic cells (soma, body). The genome con-
tained in the nucleus of human somatic cells consists of
x Nuclear chromosomes
...CAGGTCTTAGCCAlTCGGAAT
CGTACGCTAGCAATTCTTATGG
AAACTGTGAAGGCTTATAAT.. .
Human Genome Sequence
- - - -
-
46 chromosomes, arranged in 23 pairs (Fig. 2-1). Of
those 23 pairs, 22 are alike in males and females and
are called autosomes, numbered from the largest to the
smallest. The remaining pair comprises the sex chro-
mosomes: two X chromosomes in females and an X
and a Y chromosome in males. Each chromosome
carries a different subset of -genes that are arranged
-
linearly along its DNA. Members of a pair of chromo-
somes (referred to as homologous chromosomes or
homologues) carry matching genetic information; that
is, they have the same genes in the same sequence. At
any specific locus, however, they may have either identi-
cal or slightly different forms of the same gene, called
c:,..,, 7 1
w The human genome,
encoded on both nuclear and mitochon-
drial chromosomes. (Modified from
Brown TA: Genomes, 2nd ed. New York,
Wiley-Liss, 2002.)
 RoshanKetab +98(21) 66963783-8
- - - CHAPTER2 The Human Genome and the Chromosomal Basis o f Heredity
Purines
NH2
r. ~-.-.
w The four bases of DNA
and the general structure of a nucleotide
in DNA. Each of the four bases bonds Adenine (A)
with deoxyribose (through the nitrogen
shown in blue) and a phosphate group to
form the corresponding nucleotides.
Guanine (G)
alleles. One member of each pair of chromosomes is
inherited from the father, the other from the mother.
Normally, the members of a pair of autosomes are
microscopically indistinguishable from each other. In
females, the sex chromosomes, the two X chromo-
somes, are likewise largely indistinguishable. In males,
however, the sex chromosomes differ. One is an X,
identical to the X's of the female, inherited by a male
from his mother and transmitted to his daughters; the
other, the Y chromosome, is inherited from his father
and transmitted to his sons. In Chapter 6, we look at
some exceptions to the simple and almost universal rule
that human females are X X and human males are
XY.
In addition to the nuclear genome, a small but
important part of the human genome resides in mito-
chondria in the cytoplasm (see Fig. 2-1). The mitochon-
drial chromosome, to be described later in this chapter,
has a number of unusual features that distinguish it
from the rest of the human genome.
DNA Structure: A Brief Review
Before the organization of the human genome and its
chromosomes is considered in detail, it is necessary to
review the nature of the DNA that makes up the genome.
DNA is a polymeric nucleic acid macromolecule com-
posed of three types of units: a five-carbon sugar,
deoxyribose; a nitrogen-containing base; and a phos-
phate group (Fig. 2-2). The bases are of two types,
purines and pyrimidines. In DNA, there are two purine
bases, adenine (A) and guanine (G), and two pyrimi-
dine bases, thymine (T) and cytosine (C). Nucleotides,
each composed of a base, a phosphate, and a sugar
Pyrimidines
0
II
ti I
H
Thymine (T)
OH H
Phosphate Deoxyribose
Cytosine (C)
moiety, polymerize into long polynucleotide chains by
5'-3' phosphodiester bonds formed between adjacent
deoxyribose units (Fig. 2-3). In the human genome,
these polynucleotide chains (in the form of a double
helix; Fig. 2-4) are hundreds of millions of nucleotides
long, ranging in size from approximately 50 million
base pairs (for the smallest chromosome, chromosome
21) to 250 million base pairs (for the largest chromo-
some, chromosome 1).
The anatomical structure of DNA carries the chem-
ical information that allows the exact transmission of
genetic information from one cell to its daughter cells
and from one generation to the next. At the same time,
the primary structure of DNA specifies the amino acid
sequences of the polypeptide chains of proteins, as
described in the next chapter. DNA has elegant features
that give it these properties. The native state of DNA,
as elucidated by James Watson and Francis Crick in
1953, is a double helix (see Fig. 2-4). The helical struc-
ture resembles a right-handed spiral staircase in which
its two polynucleotide chains run in opposite direc-
tions, held together by hydrogen bonds between pairs
of bases: A of one chain paired with T of the other, and
G with C. The specific nature of the genetic informa-
tion encoded in the human genome lies in the sequence
of C'S, A's, G's, and T's on the two strands of the double
helix along each of the chromosomes, both in the
nucleus and in mitochondria (see Fig. 2-1). Because of
the complementary nature of the two strands of DNA,
knowledge of the sequence of nucleotide bases on one
strand automatically allows one to determine the
sequence of bases on the other strand. The double-
stranded structure of DNA molecules allows them to
replicate precisely by separation of the two strands,
 RoshanKetab +98(21) 66963783-8

Thompson &Thomason GENETICS IN MEDICINE

followed by synthesis of two new complementary

5' end strands, in accordance with the sequence of the original
template strands (Fig. 2-5). Similarly, when necessary,
the base complementarity allows efficient and correct
I Base 1
repair of damaged DNA molecules.

Organization of Human Chromosomes

The composition of genes in the human genome, as well
as the determinants of their expression, is specified in
the DNA of the 46 human chromosomes in the nucleus
plus the mitochondria1 chromosome. Each human
chromosome consists of a single, continuous DNA
double helix; that is, each chromosome in the nucleus
is a long, linear double-stranded DNA molecule, and
the nuclear genome consists, therefore, of 46 DNA mol-
ecules, totaling more than 6 billion nucleotides (see Fig.
2-1).
Chromosomes are not naked DNA double helices,
however. Within each cell, the genome is packaged as
I Base 2 chromatin, in which genomic DNA is complexed with
several classes of chromosomal proteins. Except during
3' end
cell division, chromatin is distributed throughout the
3' 5:-5: nucleus and is relatively homogeneous in appearance
under the microscope. When a cell divides, however, its
Figure 2-3 1 A portion of a DNA polynucleotide chain, genome condenses to appear as microscopically visible
showing the 3'-5' phosphodiester bonds that link adjacent chromosomes. Chromosomes are thus visible as dis-
nucleotides. crete structures only in dividing cells, although they
retain their integrity between cell divisions.
The DNA molecule of a chromosome exists in
chromatin as a complex with a family of basic chromo-
somal proteins called histones and with a heteroge-

The structure of DNA.

Lelr, LWU-dimensional
A representation of
the two complementary strands of DNA,
showing the AT and GC base pairs. Note
that the orientation of the two strands is
antiparallel. Right, The double-helix
model of DNA, as proposed by Watson
and Crick. The horizontal "rungs" repre-
sent the paired bases. The helix is said to
be right-handed because the strand going
from lower left to upper right crosses over
the opposite strand. (Based on Watson
JD, Crick FHC: Molecular structure of
nucleic acids-a structure for deoxyribose
nucleic acid. Nature 171:737-738, 1953.)
 RoshanKetab +98(21) 66963783-8

.%
- - 2
CHAPTER The Human Genome and the Chromosomal Basis o f Heredity

Five major types of histones play a critical role in

Figure 2-5 Replication of a DNA double helix, result-
ing in two identical daughter molecules, each composed of
one parental strand (gray) and one newly synthesized strand
(blue).
neous group of nonhistone proteins that are much
less well characterized but that appear to be critical
for establishing a proper environment to ensure
normal chromosome behavior and appropriate gene
expression.
the proper packaging of chromatin. Two copies each of
the four core histones H2A, H2B, H3, and H 4 consti-
tute an octamer, around which a segment of DNA
double helix winds, like thread around a spool (Fig. 2-
6). Approximately 140 base pairs of DNA are associ-
ated with each histone core, making just under two
turns around the octamer. After a short (20- to 60-base
pair) "spacer" segment of DNA, the next core DNA
complex forms, and so on, giving chromatin the appear-
ance of beads on a string. Each complex of DNA with
core histones is called a nucleosome, which is the basic
structural unit of chromatin, and each of the 46 human
chromosomes contains several hundred thousand to
well over a million nucleosomes. The fifth histone, HI,
appears to bind to DNA at the edge of each nucleosome,
in the internucleosomal spacer region. The amount of
DNA associated with a core nucleosome, together with
the spacer region, is about 200 base pairs.
In addition to the maior histone types,
. A
a number
of specialized histones can for H 3 and H2A
and confer specific characteristics on the genomic DNA
at that location. Histones H 3 and H 4 can also be modi-
fied by chemical changes to the encoded proteins. These
so-called post-translational modifications (see Chapter
3) can change the properties of nucleosomes that contain
them. The pattern of major and specialized histone
types and their modifications is often called the histone
code, which can vary from cell type to cell type and is
thought to specify how DNA is packaged and how

-100,000 bp of DNA

Double helix Nucleosome f~ber Solenoid Interphase

"'beads on a str~ng' nucleus
Figure 2-6 rn Hierarchical levels of chromatin packaging in a human chromosome.
 RoshanKetab +98(21) 66963783-8
.= -
Thompson &Thompson GENETICS IN MEDICINE
. - - -. .-
accessible it is to regulatory molecules that determine
gene expression or other genome functions.
During the cell cycle, as we will see later in this
chapter, chromosomes pass through orderly stages of
condensation and decondensation. However, even when
chromosomes are in their most decondensed state, in a
stage of the cell cycle called interphase, DNA packaged
in chromatin is substantially more condensed than it
would be as a native, protein-free double helix. Further,
the long strings of nucleosomes are themselves com-
pacted into a secondary helical chromatin structure
that appears under the electron microscope as a thick,
30-nm-diameter fiber (about three times thicker than
the nucleosomal fiber; see Fig. 2-6). This cylindrical
"solenoid" fiber (from the Greek solenoeides, "pipe
shaped") appears to be the fundamental unit of chro-
matin organization. The solenoids are themselves
packed into loops or domains attached at intervals of
about 100,000 base pairs (equivalent to 100 kilobase
pairs, or 100 kb, as 1 kb = 1000 base pairs) to a protein
scaffold or matrix within the nucleus. It has been spec-
ulated that these loops are, in fact, functional units of
DNA replication or gene transcription, or both, and
that the attachment points of each loop are fixed along
the chromosomal DNA. Thus, one level of control of
gene expression may depend on how DNA and genes
are packaged into chromosomes and on their associa-
tion with chromatin proteins in the packaging
process.
The enormous amount of genomic DNA packaged
into a chromosome can be appreciated when chromo-
somes are treated to release the DNA from the underly-
ing protein scaffold (Fig. 2-7). When DNA is released
in this manner, long loops of DNA can be visualized,
and the residual scaffolding can be seen to reproduce
the outline of a typical chromosome.
The Mitochondria1 Chromosome
As mentioned earlier, a small but important subset of
genes encoded in the human genome resides in the
cytoplasm in the mitochondria (see Fig. 2-1). Mitochon-
drial genes exhibit exclusively maternal inheritance (see
Chapter 7). Human cells can have hundreds to thou-
sands of mitochondria, each containing a number of
copies of a small circular molecule, the mitochondrial
chromosome. The mitochondrial DNA molecule is only
16 kb in length (less than 0.03% of the length of the
smallest nuclear chromosome!) and encodes only 37
genes. The products of these genes function in mito-
chondria, although the majority of proteins within the
mitochondria are, in fact, the products of nuclear genes.
Mutations in mitochondrial genes have been demon-
strated in several maternally inherited as well as spo-
radic disorders see Chapters 7 and 12).
- - -
-
Organization of the Human Genome
Regions of the genome with similar characteristics or
organization, replication, and expression are not
arranged randomly but rather tend to be clustered
together. This functional organization of the genome
correlates r p a r k a b l y well with its structural organiza-
tion as revealed by laboratory methods of chromosome
analysis (introduced later in this chapter and discussed
in detail in Chapter 5). The overall significance of this
functional organization is that chromosomes are not
just a random collection of different types of genes and
other DNA sequences. Some chromosome regions, or
even whole chromosomes, are high in gene content
("gene rich"), whereas others are low ("gene poor")
(Fig. 2-8). Certain types of sequence are characteristic
of the different structural features of human chromo-
somes. The clinical consequences of abnormalities of
genome structure reflect the specific nature of the genes
and sequences involved. Thus, abnormalities of gene-
rich chromosomes or chromosomal regions tend to be
much more severe clinically than similar-sized defects
involving gene-poor parts of the genome.
As a result of knowledge gained from the Human
Genome Project, it is apparent that the organization of
DNA in the human genome is far more varied than
was once widely appreciated. Of the 3 billion base
pairs of DNA in the genome, less than 1.5% actually
encodes proteins and only about 5% is thought to
contain regulatory elements that influence or determine
patterns of gene expression during development or
in different tissues. Only about half of the total linear
length of the genome consists of so-called single-
copy or unique DNA, that is, DNA whose nucleotide
sequence is represented only once (or at most a few
times). The rest of the genome consists of several classes
of repetitive DNA and includes DNA whose nucleotide
sequence is repeated, either perfectly or with some
variation, hundreds to millions of times in the genome.
Whereas most (but not all) of the estimated 25,000
genes in the genome are represented in single-
copy DNA, sequences in the repetitive DNA fraction
contribute to maintaining chromosome structure and
are an important source of variation between different
individuals; some of this variation can predispose to
pathological events in the genome, as we will see in
Chapter 6.
Single-Copy DNA Sequences
Although single-copy DNA makes up at least half of
the DNA in the genome, much of its function remains
a mystery because, as mentioned, sequences actually
encoding proteins (i.e., the coding portion of genes)
constitute only a small proportion of all the single-copy
DNA. Most single-copy DNA is found in short stretches
(several kilobase pairs or less), interspersed with
 RoshanKetab +98(21) 66963783-8

-
-
-- 2
CHAPTER The Human Genome and the Chromosomal Basis o f Heredity

w Electron micrograph of a protein-depleted human metaphase chromosome, showing the residual chromosome
aLaLLuId and loops of DNA. Individual DNA fibers can be best seen at the edge of the DNA loops. Bar = 2 pm. (From Paulson
JR, Laemmli UK: The structure of histone-depleted metaphase chromosomes. Cell 12:817-828, 1977. Reprinted by permission
of the authors and Cell Press.)
 RoshanKetab +98(21) 66963783-8

k0l_ Thomncon &Thomncnn GFNFTICS I N MEDICINE - - - - -

1 2 19 11 17 3 6 7 12 5 16 X 9 10 4 8 14 15 20 22 13 18 21 Y
Figure 2-8 Size and gene content of the 24 human chromosomes. A, Size of each human chromosome, in millions of
base pairs (1million base pairs = 1 Mb). Chromosomes are ordered left to right by size. B, Number of genes identified on each
human chromosome. Chromosomes are ordered left to right by gene content. (Based on data from www.ensembl.org, v36.)

members of various repetitive DNA families. The orga-
nization of genes in single-copy DNA is addressed in
depth in Chapter 3.
Repetitive DNA Sequences
Several different categories of repetitive DNA are rec-
ognized. A useful distinguishing feature is whether the
repeated sequences ("repeats") are clustered in one or
a few locations or whether they are interspersed,
throughout the genome, with single-copy sequences
along the chromosome. Clustered repeated sequences
constitute an estimated 10% to 15% of the genome and
consist of arrays of various short repeats organized
tandemly in a head-to-tail fashion. The different types
of such tandem repeats are collectively called satellite
DNAs, so named because many of the original tandem
repeat families could be separated by biochemical
methods from the bulk of the genome as distinct ("sat-
ellite") fractions of DNA.
Tandem repeat families vary with regard to their
location in the genome, the total length of the tandem
array, and the length of the constituent repeat units that
make up the array. In general, such arrays can stretch
several million base pairs or more in length and consti-
tute up to several percent of the DNA content of an
 RoshanKetab +98(21) 66963783-8
CHAPTER2
individual human chromosome. Many tandem repeat
sequences are important as molecular tools that have
revolutionized clinical cytogenetic analysis because of
their relative ease of detection (see Chapter 5). Some
human tandem repeats are based on repetitions (with
some variation) of a short sequence such as a pentanu-
cleotide. Long arrays of such repeats are found in large
genetically inert regions on chromosomes 1, 9, and 16
and make up more than half of the Y chromosome (see
Chapter 5). Other tandem repeat families are based on
somewhat longer basic repeats. For example, the a-
satellite family of DNA is composed of tandem arrays
of different copies of an approximately 171-base pair
unit, found at the centromere of each human chromo-
some, which is critical for attachment of chromosomes
to microtubules of the spindle apparatus during cell
division. This repeat family is believed to play a role in
centromere function by ensuring proper chromosome
segregation in mitosis and meiosis, as is described later
in this chapter.
In addition to tandem repeat DNAs, another major
class of repetitive DNA in the genome consists of related
sequences that are dispersed throughout the genome
rather than localized. Although many small DNA fami-
lies meet this general description, two in particular
warrant discussion because together they make up a
significant proportion of the genome and because they
have been implicated in genetic diseases. Among the
best-studied dispersed repetitive elements are those
belonging to the so-called Alu family. The members of
this family are about 300 base pairs in length and are
recognizably related to each other although not identi-
cal in DNA sequence. In total, there are more than a
million Alu family members in the genome, making up
at least 10% of human DNA. In some regions of the
genome, however, they make up a much higher percent-
age of the DNA. A second major dispersed repetitive
DNA family is called the long interspersed nuclear
element (LINE, sometimes called L1) family. LINES are
up to 6 kb in length and are found in about 850,000
copies per genome, accounting for about 20% of the
genome. They also are plentiful in some regions of the
genome but relatively sparse in others.
Repetitive DNA and Disease Families of repeats dis-
persed throughout the genome are clearly of medical
importance. Both Alu and LINE sequences have been
implicated as the cause of mutations in hereditary
disease. At least a few copies of the LINE and Alu
families generate copies of themselves that can integrate
elsewhere in the genome, occasionally causing inser-
tional inactivation of a medically important gene. The
frequency of such events causing genetic disease in
humans is unknown currently, but they may account
for as many as 1 in 500 mutations. In addition, aberrant
recombination events between different LINE or Alu
The Human Genome and the Chromosomal Basis o f Heredity
repeats can also be a cause of mutation in some genetic
diseases (see Chapter 9).
An important additional class of repetitive DNA
includes sequences that are duplicated, often with
extraordinarily high sequence conservation, in many
different locations around the genome. Duplications
involving substantial segments of a chromosome, called
segmental duplications, can span hundreds of kilobase
pairs and account for at least 5% of the genome.
When the duplicated regions contain genes, genomic
rearrangements involving the duplicated sequences
can result in the deletion of the region (and the
genes) between the copies and thus give rise to disease
(see Chapter 6). In addition, rearrangements between
segments of the genome are a source of significant
variation between individuals in the number of
copies of these DNA sequences, as is discussed in
Chapter 9.
O CELL DIVISION
There are two kinds of cell division, mitosis and meiosis.
Mitosis is ordinary somatic cell division, by which the
body grows, differentiates, and effects tissue regenera-
tion. Mitotic division normally results in two daughter
cells, each with chromosomes and genes identical to
those of the parent cell. There may be dozens or even
hundreds of successive mitoses in a lineage of somatic
cells. In contrast, meiosis occurs only in cells of the
germline. Meiosis results in the formation of reproduc-
tive cells (gametes), each of which has only 23 chromo-
somes-one of each kind of autosome and either an X
or a Y. Thus, whereas somatic cells have the diploid
(diploos, double) or the 2n chromosome complement
(i.e., 46 chromosomes), gametes have the haploid
(haploos, single) or the n complement (i.e., 2 3 chromo-
somes). Abnormalities of chromosome number or struc-
ture, which are usually clinically significant, can arise
either in somatic cells or in cells of the germline by
errors in cell division.
The Cell Cycle
A human being begins life as a fertilized ovum (zygote),
a diploid cell from which all the cells of the body (esti-
mated at about 100 trillion in number) are derived by
a series of dozens or even hundreds of mitoses. Mitosis
is obviously crucial for growth and differentiation, but
it takes up only a small part of the life cycle of a cell.
The period between two successive mitoses is called
interphase, the state in which most of the life of a cell
is spent.
Immediately after mitosis, the cell enters a phase,
called GI, in which there is no DNA synthesis (Fig. 2-9).
Some cells pass through this stage in hours; others
 RoshanKetab
. T h o m p s o n & T h o m p s o n GENETICS I N MEDICINE
r:-...--
9 n
A typical mitotic cell cycle, described in the
text. The telomeres, the centromere, and sister chromatids
are indicated.
spend a long time, days or years, in GI. In fact, some
cell types, such as neurons and red blood cells, do not
divide at all once they are fully differentiated; rather,
they are permanently arrested during GI in a distinct,
nondividing phase known as Go ("G zero"). Other cells,
such as liver cells, may enter Gobut, after organ damage,
eventually return to G1 and continue through the cell
cycle.
Although the molecular mechanisms controlling
cell-cycle progression are incompletely understood, the
cell cycle is governed by a series of checkpoints that
determine the timing of each step in mitosis. In addi-
tion, checkpoints monitor and control the accuracy of
DNA synthesis as well as the assembly and attachment
of an elaborate network of microtubules that facilitate
chromosome movement. If damage to the genome is
detected, these mitotic checkpoints halt cell-cycle pro-
gression until repairs are made or, if the damage is
excessive, until the cell is instructed to die by pro-
grammed cell death (a process called apoptosis).
During GI, each cell contains one diploid copy of
the genome. GI is followed by the S phase, the stage of
DNA synthesis. During this stage, each chromosome,
which in G1 has been a single DNA molecule, replicates
to become a bipartite chromosome consisting of two
sister chromatids (see Fig. 2-9), each of which contains
an identical copy of the original linear DNA double
helix. The ends of each chromosome (or chromatid) are
marked by telomeres, which consist of specialized
repetitive DNA sequences that ensure the integrity of
the chromosome during cell division. Correct mainte-
nance of the ends of chromosomes requires a special
enzyme called telomerase, which ensures that DNA
synthesis includes the very ends of each chromosome.
In the absence of telomerase, chromosome ends get
shorter and shorter, eventually leading to cell death.
+98(21) 66963783-8
The two sister chromatids are held together physically
at the centromere, a region of DNA that associates with
a number of specific proteins to form the kinetochore.
This complex structure serves to attach each chromo-
some to the microtubules of the mitotic spindle and to
govern chromosome movement during mitosis. DNA
synthesis during S phase is not synchronous throughout
all chromosomes or even within a single chromosome;
rather, along each chromosome, it begins at hundreds
to thousands of sites, called origins of DNA replication.
Individual chromosome segments have their own char-
acteristic time of replication during the 6 - to 8-hour
S phase.
By the end of S phase, the DNA content of the cell
has doubled, and each cell now contains two copies of
the diploid genome. After S phase, the cell enters a brief
stage called G2. Throughout the whole cell cycle, ribo-
nucleic acids and proteins are produced and the cell
gradually enlarges, eventually doubling its total mass
before the next mitosis. G2 is ended by mitosis, which
begins when individual chromosomes begin to con-
dense and become visible under the microscope as thin,
extended threads, a process that is considered in greater
detail in the following section.
The GI, S, and G2 phases together constitute inter-
phase. In typical dividing human cells, the three phases
take a total of 16 to 24 hours, whereas mitosis lasts
only 1 to 2 hours (see Fig. 2-9). There is great variation,
however, in the length of the cell cycle, which ranges
from a few hours in rapidly dividing cells, such as those
of the dermis of the skin or the intestinal mucosa, to
months in other cell types.
Mitosis
During the mitotic phase of the cell cycle, an elaborate
apparatus is brought into play to ensure that each of
the two daughter cells receives a complete set of genetic
information. This result is achieved by a mechanism
that distributes one chromatid of each chromosome to
each daughter cell (Fig. 2-10). The process of distribut-
ing a copy of each chromosome to each daughter cell
is called chromosome segregation. The importance of
this process for normal cell growth is illustrated by the
observation that many tumors are invariably character-
ized by a state of genetic imbalance resulting from
mitotic errors in the distribution of chromosomes to
daughter cells.
The process of mitosis is continuous, but five stages
are distinguished: prophase, prometaphase, metaphase,
anaphase, and telophase.
Prophase This stage initiates mitosis and is marked by
gradual condensation of the chromosomes and the
beginning of the formation of the mitotic spindle. A
pair of microtubule organizing centers, also called cen-
trosomes, form foci from which microtubules radiate.
 RoshanKetab +98(21) 66963783-8
S ohase
Cells in G,
Figure 2-1 0 Mitosis. Only two chro-
mosorne pairs are shown. For further
<
details, see text. Cytokines~s
The centrosomes gradually move to take up positions
at the poles of the cell.
Prometaphase The cell enters prometaphase when the
nuclear membrane breaks up, allowing the chromo-
somes to disperse within the cell and to attach, by their
kinetochores, to microtubules of the mitotic spindle.
The chromosomes begin to move toward a point midway
between the spindle poles, a process called congression.
The chromosomes continue to condense throughout
this stage.
Metaphase At metaphase, the chromosomes reach
maximal condensation. They become arranged at the
equatorial plane of the cell, balanced by the equal forces
exerted on the kinetochore of each chromosome by
microtubules emanating from the two spindle poles.
The chromosomes of a dividing human cell are most
readily analyzed at the metaphase or the prometaphase
stage of mitosis (see later discussion and Chapter 5 ) .
Anaphase Anaphase begins abruptly when the chro-
mosomes separate at the centromere. The sister chro-
matids of each chromosome now become independent
daughter chromosomes, which move to opposite poles
of the cell (see Fig. 2-10).
Telophase In telophase, the chromosomes begin to
decondense from their highly contracted state, a nuclear
membrane begins to re-form around each of the two
daughter nuclei, and each nucleus gradually resumes its
interphase appearance.
Cell In G,
n
'y!uWF
lnterphase
)
Anaphase Metaphase
To complete the process of cell division, the cyto-
plasm cleaves by a process known as cytokinesis, which
begins as the chromosomes approach the spindle poles.
Eventually there are two complete daughter cells, each
with a nucleus containing all the genetic information
of the original cell.
There is an important difference between a cell
entering mitosis and one that has just completed the
process. The parent cell's chromosomes in G2 each have
a pair of chromatids, but the chromosomes of the
daughter cell each consist of only one copy of the genetic
material. This copy will not be duplicated until the
daughter cell in its turn reaches the S phase of the next
cell cycle (see Fig. 2-9). The entire process of mitosis
thus ensures the orderly duplication and distribution 9f
the genome through successive cell divisions. '
The Human Karyotype
The condensed chromosomes of a dividing human cell
are most readily analyzed at metaphase or prometa-
phase. At these stages, the chromosomes are visible
under the microscope as a chromosome spread; each
chromosome consists of its sister chromatids, although
in most chromosome preparations, the two chromatids
are held together so tightly that they are rarely visible
as separate entities.
Most chromosomes can be distinguished not only
by their length but also by the location of the centro-
 RoshanKetab +98(21) 66963783-8
rnpson GENETICS IN MEDICINE
Figure 2 - I I A chromosome spread prepared from a
lymphocyte culture that has been stained by the Giemsa-
banding (G-banding)technique. The darkly stained nucleus
adjacent to the chromosomes is from a different cell in inter-
phase, when chromosomal material is diffuse throughout the
nucleus. (Courtesy of Stuart Schwartz, University Hospitals
of Cleveland, Ohio.)
mere. The centromere is apparent as a primary con-
striction, a narrowing or pinching-in of the sister
chromatids due to formation of the kinetochore. This
is a recognizable cytogenetic landmark, dividing the
chromosome into two arms, a short arm designated p
(for petit) and a long arm designated q. All 24 types of
chromosome (22 autosomes, X, and Y) can be individu-
ally identified by a variety of cytogenetic and molecular
techniques now in common use.
Figure 2-11 shows a prometaphase cell in which the
chromosomes have been stained by the Giemsa-staining
(G-banding) method, the technique most widely used
in clinical cytogenetics laboratories. The chromosomes
are treated first with trypsin to digest the chromosomal
proteins and then with Giemsa stain. Each chromo-
some pair stains in a characteristic pattern of alternat-
ing light and dark bands (G bands) that correlates
roughly with features of the underlying DNA sequence,
such as base composition (i.e., the percentage of base
pairs that are GC or AT) and the distribution of repeti-
tive DNA elements. With G-banding and other banding
techniques, all of the chromosomes can be individually
distinguished. Further, the nature of any structural or
numerical abnormalities can be readily determined, as
we examine in greater detail in Chapters 5 and 6.
- -
Although experts can often analyze metaphase
chromosomes directly under the microscope, a common
procedure is to cut out the chromosomes from a pho-
tomicrograph and arrange them in pairs in a standard
classification (Fig. 2-12). The completed picture is called
a karyotype. The word karyotype is also used to refer
to the standard chromosome set of an individual ("a
normal male karyotype") or of a species ("the human
karyotype") and, as a verb, to the process of preparing
such a standard figure ("to karyotype").
Unlike the chromosomes seen in stained prepara-
tions under the microscope or in photographs, the chro-
mosomes of living cells are fluid and dynamic structures.
During mitosis, for example, the chromatin of each
interphase chromosome condenses substantially (see
Fig. 2-12). At prophase, when chromosomes become
visible under the light microscope, chromosome 1 (con-
taining about 250 million base pairs of DNA) has con-
densed to an overall length of about 50 ym. When
maximally condensed at metaphase, DNA in chromo-
somes is about 1110,000 of its fully extended state.
When chromosomes are prepared to reveal bands (see
Figs. 2-11 and 2-12), as many as 1000 or more bands
can be recognized in stained preparations of all the
chromosomes. Each cytogenetic band therefore con-
tains as many as 50 or more genes, although the density
of genes in the genome, as mentioned previously, is
variable. After metaphase, as cells complete mitosis,
chromosomes decondense and return to their relaxed
state as chromatin in the interphase nucleus, ready to
begin the cycle again (Fig. 2-13).
Meiosis
Meiosis, the process by which diploid cells give rise to
haploid gametes, involves a type of cell division that is
unique to germ cells. Meiosis consists of one round of
DNA synthesis followed by two rounds of chromosome
segregation and cell division (see Fig. 2-12). The cells
in the germline that undergo meiosis, primary sper-
matocytes or primary oocytes, are derived from the
zygote by a long series of mitoses before the onset of
meiosis.
Male and female gametes have different his-
tories; although the sequence of events is the same, their
timing is very different. The two successive meiotic
divisions are called meiosis I and meiosis 11. Meiosis
I is also known as the reduction division because it is
the division in which the chromosome number is
reduced by half through the pairing of homologues
in prophase and by their segregation to different
cells at anaphase of meiosis I. The X and Y chromo-
somes are not homologues in a strict sense but do have
homologous segments at the ends of their short and
long arms (see Chapter 6), and they pair in both regions
during meiosis I.
 RoshanKetab +98(21) 66963783-8

i e Human Genome and the Chromosomal Basis o f Heredity

SEX CHROMOSOMES
, 2-12 A human male karyotype with Giemsa banding (G-banding). The chromosomes are at the prometaphase
sta,- ~f mitosis and are arranged in a standard classification, numbered 1 to 22 in order of length, with the X and Y chro-
mosomes shown separately. (Courtesy of Stuart Schwartz, University Hospitals of Cleveland, Ohio.)

Meiosis I is also notable because it is the stage at
which genetic recombination (also called meiotic cross-
ing over) occurs. In this process, homologous segments
of DNA are exchanged between non-sister chromatids
of a pair of homologous chromosomes, thus ensuring
that none of the gametes produced by meiosis is identi-
cal to another. The concept of recombination is funda-
mental to the process of mapping genes responsible for
inherited disorders, as we discuss at length in Chapter
10. Because recombination involves the physical inter-
twining of the two homologues until the appropriate
point during meiosis I, it is also critical for ensuring
proper chromosome segregation during meiosis. Failure
to recombine properly can lead to chromosome misseg-
regation in meiosis I and is a frequent cause of chromo-
some abnormalities like Down syndrome (see Chapters
5 and 6).
Meiosis I1 follows meiosis I without an intervening
step of DNA replication. As in ordinary mitosis, the
chromatids separate, and one chromatid of each chro-
mosome passes to each daughter cell (Fig. 2-14).
The First Meiotic Division (Meiosis I)
Prophase I The prophase of meiosis I is a complicated
process that differs from mitotic prophase in a number
of ways, with important genetic consequences. Several
stages are defined. Throughout all the stages, the chro-
mosomes continually condense and become shorter and
thicker (Fig. 2-15).
Leptotene The chromosomes, which have already
replicated during the preceding S phase, become visible
as thin threads that are beginning to condense. At this
early stage, the two sister chromatids of each chromo-
some are so closely aligned that they cannot be
distinguished.
Zygotene At this stage, homologous chromosomes
begin to align along their entire length. The process of
 RoshanKetab +98(21) 66963783-8

T h o r n ~ o n& T h o r n ~ o nGENETICS IN MEDICINE -

- -- - -

Decondensation
as cell returns to
. interphase

+ 24) Cycle of condensation

*ad dec&lfmsation as a chromoscme pro-
ceeds through the cell cycle.

Decondensed
chromatin

Condensation as
\ rn~tosisbeg~ns - ,

pairing or synapsis is normally precise, bringing corre-

sponding DNA sequences into alignment along the
length of the entire chromosome.
Although the molecular basis of synapsis is not
completely understood, electron microscopy reveals
that the chromosomes are held together by a synapto-
Chromosome replication nemal complex, a ribbon-like protein-containing struc-
ture (Fig. 2-16). The s~naptonemalcomplex is essential
to the process of recombination.
Pachytene During this stage, the chromosomes
Meiosis I
become much more tightly coiled. Synapsis is complete,
and each pair of homologues appears as a bivalent
(sometimes called a tetrad because it contains four
chromatids). Pachytene is the stage at which meiotic
crossing over takes place (see Fig. 2-15).
Diplotene After recombination, the synaptonemal
complex begins to break down, and the two compo-
nents of each bivalent now begin to separate from each
other. Eventually the two homologues of each bivalent
are held together only at points called chiasmata
(crosses), which are believed to mark the locations of
Four haploid gametes
crossovers. The average number of chiasmata seen in
human spermatocytes is about 50, that is, several per
Figure 2-14 w A simplified representation of the essential
steps in meiosis, consisting of one round of DNA replication bivalent.
followed by two rounds of chromosome segregation, meiosis Diakinesis In this stage, the chromosomes reach
I and meiosis 11. maximal condensation.
Metaphase I Metaphase I begins, as in mitosis, when
the nuclear membrane disappears. A spindle forms, and
 RoshanKetab +98(21) 66963783-8

P- - CHAPTER2 a The Human Genome a

- - -
n
-
d
-
G

the paired chromosomes align themselves on the equa-

torial plane with their centromeres oriented toward
different poles.
Anaphase I The two members of each bivalent move
apart, and their respective centromeres with the
attached sister chromatids are drawn to opposite poles
of the cell, a process termed disjunction (see Fig. 2-15).
Thus, the chromosome number is halved, and each cel-
lular product of meiosis I has the haploid chromosome
number. The different bivalents assort independently of
one another, and as a result, the original paternal and
maternal chromosome sets are sorted into random com- -
binations. The possible number of combinations of the .-In
23 chromosome pairs that can be present in the gametes .-8
is 223(more than 8 million). In fact, the variation in the
Metaphase I 4-
genetic material that is transmitted from parent to child \ ,

is actually much greater than this because of the process

of crossing over. As a result of this process, each chro-
matid typically contains segments derived from each
member of the parental chromosome pair; for example,
at this stage, a typical chromosome 1 is composed of
three to five segments, alternately paternal and mater-
nal in origin. (See additional discussion in Chapter
10.)
Many errors can occur in cell division. Some result
in meiotic arrest and the death of the cell, whereas
others lead to missegregation of chromosomes at ana-
phase. For example, both homologues of a chromosome
pair may travel to the same rather than opposite poles
during anaphase I. This pathogenic process is termed
nondisjunction. Some of the consequences of meiotic
irregularities are discussed in Chapters 5 and 6.
Telophase I By telophase, the two haploid sets of
chromosomes have normally grouped at opposite poles
of the cell.
Cytokinesis
After telophase I, the cell divides into two haploid
daughter cells and enters meiotic interphase. In sper-
matogenesis, the cytoplasm is more or less equally

Figure 2-1 5 Meiosis and its consequences. A single chro-

mosome pair and a single crossover are shown, leading
to formation of four distinct gametes. The chromosomes
replicate during interphase and begin to condense as the cell
enters prophase of meiosis I. In meiosis I, the chromosomes
synapse and recombine. Chiasmata are visible as the homo-
logues align at metaphase I, with the centromeres oriented
toward opposite poles. In anaphase I, the exchange of DNA
between the homologues is apparent as the chromosomes are
pulled to opposite poles. After completion of meiosis I and
cvtokinesis. meiosis I1 ~ r o c e e d swith a mitosis-like division.
The sister kinetochoresseparate and move to opposite poles
in anaphase 11, yielding four haploid products.
 RoshanKetab +98(21) 66963783-8
~hnmn<&&mn<nn CtFNFTlCS IN MEDICINE - -
divided between the two daughter cells (Fig. 2-17);
but in oogenesis, one product (the secondary oocyte)
receives almost all the cytoplasm, and the reciprocal
product becomes the first polar body (Fig. 2-18). In
contrast to mitosis, interphase is brief, and meiosis I1
begins. The notable point that distinguishes meiotic
and mitotic interphase is that there is no S phase (i.e.,
no DNA synthesis) between the first and second meiotic
divisions.
The Second Meiotic Division (Meiosis 11)
The second meiotic division is similar to an ordinary
mitosis except that the chromosome number of the
cell entering meiosis I1 is haploid. The end result is that
the two daughter cells from meiosis I divide to form
four haploid cells, each containing 23 chromosomes
(see Fig. 2-15). As mentioned earlier, because of
crossing over in meiosis I, the chromosomes of the
resulting gametes are not identical. Just as each mater-
nal and paternal chromosome in a hon~ologouspair
segregates randomly into a daughter cell in meiosis I,
segregation of the different paternal and maternal
alleles of each gene also takes place during meiosis.
However, whether the alleles segregate during the first
or the second meiotic division (see Box) depends on
whether they have been involved in a crossover event in
meiosis I.
-- - -
w Electron mi-
crograph of a human primary
spermatocyte in meiosis, show-
ing the 22 autosomal synapto-
nemal complexes and the XY
pair (nvrow). The DNA of each
bivalent is not visible but
extends laterally on each side of
the synaptonemal complexes.
(Courtesy of A. C . Chandley,
Western General Hospital,
Edinburgh, Scotland.)
-
1
ei. Genetic Consequences o f Meiosis
Reduction of the chromosome number from diploid to
haploid, the essential step in the formation of
gametes.
Segregation of alleles, at either meiosis I or meiosis 11,
in accordance with Mendel's first law.
Shuffling of the genetic material by random assortment
of the homologues, in accordance with Mendel's second
I law.
Additional shuffling of the genetic material by crossing
over, which is thought to have evolved as a mechanism
for substantially increasing genetic variation but is, in
addition, critical to ensure normal chromosome
, disjunction.
The human primordial germ cells are recognizable by
the fourth week of development outside the embryo
proper, in the endoderm of the yolk sac. From there,
they migrate during the sixth week to the genital ridges
and associate with somatic cells to form the primitive
gonads, which soon differentiate into testes or ovaries,
 RoshanKetab +98(21) 66963783-8

i e Human Genome and the Chromosomal Basis o f Heredity

depending on the cells' sex chromosome constitution

(XY or XX), as we examine in greater detail in Chapter
6. Both spermatogenesis and oogenesis require meiosis
but have important differences in detail and timing that
may have clinical and genetic consequences for the off-
spring. Female meiosis is initiated once, early during
fetal life, in a limited number of cells. In contrast, male
meiosis is initiated continuously in many cells from a
dividing cell population throughout the adult life of a
male.
It is difficult to study human meiosis directly. In
the female, successive stages of meiosis take place in the
fetal ovary, in the oocyte near the time of ovulation,
and after fertilization. Although postfertilization stages
can be studied in vitro, access to the earlier stages is
limited. Testicular material for the study of male meiosis
is less difficult to obtain, inasmuch as testicular biopsy
is included in the assessment of many men attending
infertility clinics. Much remains to be learned about the
cytogenetic, biochemical, and molecular mechanisms
involved in normal meiosis and about the causes and
consequences of meiotic irregularities. .-U)
.-8 Secondary
Spermatogenesis spermatocytea

The stages of spermatogenesis are shown in Figure 2-17.

Sperm (spermatozoa) are formed in the seminiferous
tubules of the testes after sexual maturity is reached.
The tubules are lined with spermatogonia, which are
in different stages of differentiation. These cells have
developed from the primordial germ cells by a long
series of mitoses. The last cell type in the developmental
sequence is the primary spermatocyte, which under-
goes meiosis I to form two haploid secondary spermato-
cytes. Secondary spermatocytes rapidly undergo meiosis
11, each forming two spermatids, which differentiate
without further division into sperm. In humans, the
entire process takes about 64 days. The enormous
number of sperm produced, typically about 200 million
per ejaculate and an estimated 10l2in a lifetime, requires
several hundred successive mitoses.

Oogenesis

In contrast to spermatogenesis, which is initiated at

puberty and continues throughout adult life, oogenesis
begins during prenatal development (see Fig. 2-18). The
ova develop from oogonia, cells in the ovarian cortex
that have descended from the primordial germ cells by
a series of about 2 0 mitoses. Each oogonium is the
central cell in a developing follicle. By about the third
month of prenatal development, the oogonia of the
embryo have begun to develop into primary oocytes,
most of which have already entered prophase of meiosis
I. The process of oogenesis is not synchronized, and
both early and late stages coexist in the fetal ovary.
Human spermatogenesis in relation to the
two meiotic divisions. The sequence of events begins at
puberty and takes about 64 days to be completed. The chro-
mosome number (46 or 23) and the sex chromosome consti-
tution ( X or Y ) of each cell are shown. (Modified from Moore
KL, Persaud TVN: The Developing Human: Clinically
Oriented Embryology, 6th ed. Philadelphia, WB Saunders,
1998.)
 RoshanKetab +98(21) 66963783-8
Thompson &Thompson GENETICS IN MEDICINE - --
- -
I
Fertilization
Mature ovum
Human oogenesis and fertilization in rela-
ro rne two meiotic divisions. The primary oocytes are
~IUII
formed prenatally and remain suspended in prophase of
meiosis I for years until the onset of puberty. An oocyte
completes meiosis I as its follicle matures, resulting in a sec-
ondary oocyte and the first polar body. After ovulation, each
oocyte continues to metaphase of meiosis 11. Meiosis I1 is
completed only if fertilization occurs, resulting in a fertilized
mature ovum and the second polar body.
-
-- - -
There are several million oocytes at the time of birth,
but most of these degenerate, and only about 400 even-
tually mature and are ovulated. The primary oocytes
have all nearly completed prophase I by the time of
birth, and those that do not degenerate remain arrested
in that stage for years, until ovulation as part of a
woman's menstrual cycle.
After a woman has reached sexual maturity, indi-
vidual follicles begin to grow and mature, and a few
(on average one per month) are ovulated. Just before
ovulation, the oocyte rapidly completes meiosis I, divid-
ing in such a way that one cell becomes the secondary
oocyte (an egg or ovum), containing most of the cyto-
plasm with its organelles, and the other becomes the
first polar body (see Fig. 2-18). Meiosis I1 begins
promptly and proceeds to the metaphase stage during
ovulation, where it halts, only to be completed if fertil-
ization occurs.
Fertilization
Fertilization of the egg usually takes place in the fallo-
pian tube within a day or so of ovulation. Although
multiple sperm may be present, the penetration of a
single sperm into the ovum sets up a series of biochemi-
cal events that helps prevent the entry of other sperm.
Fertilization is followed by the completion of
meiosis 11, with the formation of the second polar body
(see Fig. 2-18). The chromosomes of the fertilized egg
and sperm become pronuclei, each surrounded by a
nuclear membrane. The chromosomes of the diploid
zygote replicate soon after fertilization, and the zygote
divides by mitosis to form two diploid daughter cells.
This mitosis is the first of the series of cleavage divisions
that initiate the process of embryonic development (see
Chapter 14).
Although development begins with the formation
of the zygote (conception), in clinical medicine, the
stage and duration of pregnancy are usually measured
as the "menstrual age," dating from the beginning of
the mother's last menstrual period, about 14 days before
conception.
The biological significance of mitosis and meiosis lies
in ensuring the constancy of chromosome number-
and thus the integrity of the genome-from one cell to
its progeny and from one generation to the next. The
medical relevance of these processes lies in errors of one
or the other mechanism of cell division, leading to for-
mation of an individual or of a cell lineage with an
abnormal number of chromosomes and thus abnormal
dosage of genomic material.
 RoshanKetab +98(21) 66963783-8
- - 2
CHAPTER
As we see in detail in Chapter 5 , meiotic nondis-
junction, particularly in oogenesis, is the most common
mutational mechanism in our species, responsible for
chromosomally abnormal fetuses in at least several
percent of all recognized pregnancies. Among pregnan-
cies that survive to term, chromosome abnormalities
are a leading cause of developmental defects, failure
t o thrive in the newborn period, and mental
retardation.
Mitotic nondisjunction also contributes to genetic
disease. Nondisjunction soon after fertilization, either
in the developing embryo or in extraembryonic tissues
like the placenta, leads to chromosomal mosaicism that
can underlie some medical conditions, such as a pro-
portion of patients with Down syndrome. Further,
abnormal chromosome segregation in rapidly dividing
tissues, such as in cells of the colon, is frequently a step
in the development of chromosomally abnormal tumors,
and thus evaluation of chromosome and genome balance
is an important diagnostic and prognostic test in many
cancers.
O GENERAL REFERENCES
Brown TA: Genomes, 3rd ed. New York, Garland, 2007.
Miller OJ, Therman E: Human Chromosomes, 4th ed. New York,
Springer-Verlag, 2001.
Moore KL, Persaud TVN: Developing Human: Clinically Oriented
Embryology, 7th ed. Philadelphia, WB Saunders, 2003.
1. At a certain locus, a person has two alleles A and
a.
a. What are the genotypes of this person's gametes?
b. When do A and a segregate (i) if there is no crossing
over between the locus and the centromere of th;
chromosome? (ii) if there is a single crossoverm
between the locus and the centromere?
2. What is the main cause of numerical chromosome
abnormalities in humans?
3. Disregarding crossing over, which increases the amount
of genetic variability, estimate the probability that all
your chromosomes have come to you from your father's
mother and your mother's mother. Would you be male
or female?
The Human Genome and the Chromosomal Basis of Heredity W
O REFERENCES FOR SPECIFIC TOPICS
Deininger PL, Batzer MA: Alu repeats and human disease. Mol
Genet Metab 67:183-193, 1999.
International Human Genome Sequencing Consortium: Initial
sequencing and analysis of the human genome. Nature 409:860-
921,2001.
International Human Genome Sequencing Consortium: Finishing
the euchromatic sequence of the human genome. Nature 431:931-
945,2004.
Kazazian H H , Moran JV: The impact of L1 retrotransposons on the
human genome. Nat Genet 19:19-24, 1998.
Trask BJ: Human cytogenetics: 46 chromosomes, 46 years and
counting. Nat Rev Genet 3:769-778, 2002.
Venter JC, Adams MD, Myers EW, et al: The sequence of the human
genome. Science 291:1304-1351, 2001.
O USEFUL WEBSITES
Human Genome Resources: A compilation of useful websites for the
study of genes, genomes and medicine. http:/lwww.ncbi.nlm.nih.
gov/genome/guide/human/
University of California, Santa Cruz: Genome Bioinformatics.
http://genome.ucsc.edu/
Ensembl genome browser: European Bioinformatics Institute1
Wellcome Trust Sanger Institute, Hinxton, Cambridge, United
Kingdom. http://www.ensembl.org/Homo~sapiens/index.html
4. A chromosome entering meiosis is composed of two
chromatids, each of which is a single DNA molecule.
a. In our species, at the end of meiosis I, how many
chromosomes are there per cell? How many
chromatids?
b. At the end of meiosis 11, how many chromosome^
are there per cell? How many chromatids?
c. When is the diploid chromosome number restored?
When is the two-chromatid structure of a typical
metaphase chromosome restored?
5. From Figure 2-8, estimate the number of genes pet
million base pairs on chromosomes 1, 13, 18, 19, 21.
and 22. Would a chromosome abnormality of equal sin
on chromosome 18 or 19 be expected to have greater
clinical impact? on chromosome 21 or 22?
Another random document with
no related content on Scribd:
 DANCE ON STILTS AT THE GIRLS’ UNYAGO, NIUCHI

Newala, too, suffers from the distance of its water-supply—at least

the Newala of to-day does; there was once another Newala in a lovely
valley at the foot of the plateau. I visited it and found scarcely a trace
of houses, only a Christian cemetery, with the graves of several
missionaries and their converts, remaining as a monument of its
former glories. But the surroundings are wonderfully beautiful. A
thick grove of splendid mango-trees closes in the weather-worn
crosses and headstones; behind them, combining the useful and the
agreeable, is a whole plantation of lemon-trees covered with ripe
fruit; not the small African kind, but a much larger and also juicier
imported variety, which drops into the hands of the passing traveller,
without calling for any exertion on his part. Old Newala is now under
the jurisdiction of the native pastor, Daudi, at Chingulungulu, who,
as I am on very friendly terms with him, allows me, as a matter of
course, the use of this lemon-grove during my stay at Newala.
 FEET MUTILATED BY THE RAVAGES OF THE “JIGGER”
(Sarcopsylla penetrans)

The water-supply of New Newala is in the bottom of the valley,

some 1,600 feet lower down. The way is not only long and fatiguing,
but the water, when we get it, is thoroughly bad. We are suffering not
only from this, but from the fact that the arrangements at Newala are
nothing short of luxurious. We have a separate kitchen—a hut built
against the boma palisade on the right of the baraza, the interior of
which is not visible from our usual position. Our two cooks were not
long in finding this out, and they consequently do—or rather neglect
to do—what they please. In any case they do not seem to be very
particular about the boiling of our drinking-water—at least I can
attribute to no other cause certain attacks of a dysenteric nature,
from which both Knudsen and I have suffered for some time. If a
man like Omari has to be left unwatched for a moment, he is capable
of anything. Besides this complaint, we are inconvenienced by the
state of our nails, which have become as hard as glass, and crack on
the slightest provocation, and I have the additional infliction of
pimples all over me. As if all this were not enough, we have also, for
the last week been waging war against the jigger, who has found his
Eldorado in the hot sand of the Makonde plateau. Our men are seen
all day long—whenever their chronic colds and the dysentery likewise
raging among them permit—occupied in removing this scourge of
Africa from their feet and trying to prevent the disastrous
consequences of its presence. It is quite common to see natives of
this place with one or two toes missing; many have lost all their toes,
or even the whole front part of the foot, so that a well-formed leg
ends in a shapeless stump. These ravages are caused by the female of
Sarcopsylla penetrans, which bores its way under the skin and there
develops an egg-sac the size of a pea. In all books on the subject, it is
stated that one’s attention is called to the presence of this parasite by
an intolerable itching. This agrees very well with my experience, so
far as the softer parts of the sole, the spaces between and under the
toes, and the side of the foot are concerned, but if the creature
penetrates through the harder parts of the heel or ball of the foot, it
may escape even the most careful search till it has reached maturity.
Then there is no time to be lost, if the horrible ulceration, of which
we see cases by the dozen every day, is to be prevented. It is much
easier, by the way, to discover the insect on the white skin of a
European than on that of a native, on which the dark speck scarcely
shows. The four or five jiggers which, in spite of the fact that I
constantly wore high laced boots, chose my feet to settle in, were
taken out for me by the all-accomplished Knudsen, after which I
thought it advisable to wash out the cavities with corrosive
sublimate. The natives have a different sort of disinfectant—they fill
the hole with scraped roots. In a tiny Makua village on the slope of
the plateau south of Newala, we saw an old woman who had filled all
the spaces under her toe-nails with powdered roots by way of
prophylactic treatment. What will be the result, if any, who can say?
The rest of the many trifling ills which trouble our existence are
really more comic than serious. In the absence of anything else to
smoke, Knudsen and I at last opened a box of cigars procured from
the Indian store-keeper at Lindi, and tried them, with the most
distressing results. Whether they contain opium or some other
narcotic, neither of us can say, but after the tenth puff we were both
“off,” three-quarters stupefied and unspeakably wretched. Slowly we
recovered—and what happened next? Half-an-hour later we were
once more smoking these poisonous concoctions—so insatiable is the
craving for tobacco in the tropics.
Even my present attacks of fever scarcely deserve to be taken
seriously. I have had no less than three here at Newala, all of which
have run their course in an incredibly short time. In the early
afternoon, I am busy with my old natives, asking questions and
making notes. The strong midday coffee has stimulated my spirits to
an extraordinary degree, the brain is active and vigorous, and work
progresses rapidly, while a pleasant warmth pervades the whole
body. Suddenly this gives place to a violent chill, forcing me to put on
my overcoat, though it is only half-past three and the afternoon sun
is at its hottest. Now the brain no longer works with such acuteness
and logical precision; more especially does it fail me in trying to
establish the syntax of the difficult Makua language on which I have
ventured, as if I had not enough to do without it. Under the
circumstances it seems advisable to take my temperature, and I do
so, to save trouble, without leaving my seat, and while going on with
my work. On examination, I find it to be 101·48°. My tutors are
abruptly dismissed and my bed set up in the baraza; a few minutes
later I am in it and treating myself internally with hot water and
lemon-juice.
Three hours later, the thermometer marks nearly 104°, and I make
them carry me back into the tent, bed and all, as I am now perspiring
heavily, and exposure to the cold wind just beginning to blow might
mean a fatal chill. I lie still for a little while, and then find, to my
great relief, that the temperature is not rising, but rather falling. This
is about 7.30 p.m. At 8 p.m. I find, to my unbounded astonishment,
that it has fallen below 98·6°, and I feel perfectly well. I read for an
hour or two, and could very well enjoy a smoke, if I had the
wherewithal—Indian cigars being out of the question.
Having no medical training, I am at a loss to account for this state
of things. It is impossible that these transitory attacks of high fever
should be malarial; it seems more probable that they are due to a
kind of sunstroke. On consulting my note-book, I become more and
more inclined to think this is the case, for these attacks regularly
follow extreme fatigue and long exposure to strong sunshine. They at
least have the advantage of being only short interruptions to my
work, as on the following morning I am always quite fresh and fit.
My treasure of a cook is suffering from an enormous hydrocele which
makes it difficult for him to get up, and Moritz is obliged to keep in
the dark on account of his inflamed eyes. Knudsen’s cook, a raw boy
from somewhere in the bush, knows still less of cooking than Omari;
consequently Nils Knudsen himself has been promoted to the vacant
post. Finding that we had come to the end of our supplies, he began
by sending to Chingulungulu for the four sucking-pigs which we had
bought from Matola and temporarily left in his charge; and when
they came up, neatly packed in a large crate, he callously slaughtered
the biggest of them. The first joint we were thoughtless enough to
entrust for roasting to Knudsen’s mshenzi cook, and it was
consequently uneatable; but we made the rest of the animal into a
jelly which we ate with great relish after weeks of underfeeding,
consuming incredible helpings of it at both midday and evening
meals. The only drawback is a certain want of variety in the tinned
vegetables. Dr. Jäger, to whom the Geographical Commission
entrusted the provisioning of the expeditions—mine as well as his
own—because he had more time on his hands than the rest of us,
seems to have laid in a huge stock of Teltow turnips,[46] an article of
food which is all very well for occasional use, but which quickly palls
when set before one every day; and we seem to have no other tins
left. There is no help for it—we must put up with the turnips; but I
am certain that, once I am home again, I shall not touch them for ten
years to come.
Amid all these minor evils, which, after all, go to make up the
genuine flavour of Africa, there is at least one cheering touch:
Knudsen has, with the dexterity of a skilled mechanic, repaired my 9
× 12 cm. camera, at least so far that I can use it with a little care.
How, in the absence of finger-nails, he was able to accomplish such a
ticklish piece of work, having no tool but a clumsy screw-driver for
taking to pieces and putting together again the complicated
mechanism of the instantaneous shutter, is still a mystery to me; but
he did it successfully. The loss of his finger-nails shows him in a light
contrasting curiously enough with the intelligence evinced by the
above operation; though, after all, it is scarcely surprising after his
ten years’ residence in the bush. One day, at Lindi, he had occasion
to wash a dog, which must have been in need of very thorough
cleansing, for the bottle handed to our friend for the purpose had an
extremely strong smell. Having performed his task in the most
conscientious manner, he perceived with some surprise that the dog
did not appear much the better for it, and was further surprised by
finding his own nails ulcerating away in the course of the next few
days. “How was I to know that carbolic acid has to be diluted?” he
mutters indignantly, from time to time, with a troubled gaze at his
mutilated finger-tips.
 Since we came to Newala we have been making excursions in all
directions through the surrounding country, in accordance with old
habit, and also because the akida Sefu did not get together the tribal
elders from whom I wanted information so speedily as he had
promised. There is, however, no harm done, as, even if seen only
from the outside, the country and people are interesting enough.
The Makonde plateau is like a large rectangular table rounded off
at the corners. Measured from the Indian Ocean to Newala, it is
about seventy-five miles long, and between the Rovuma and the
Lukuledi it averages fifty miles in breadth, so that its superficial area
is about two-thirds of that of the kingdom of Saxony. The surface,
however, is not level, but uniformly inclined from its south-western
edge to the ocean. From the upper edge, on which Newala lies, the
eye ranges for many miles east and north-east, without encountering
any obstacle, over the Makonde bush. It is a green sea, from which
here and there thick clouds of smoke rise, to show that it, too, is
inhabited by men who carry on their tillage like so many other
primitive peoples, by cutting down and burning the bush, and
manuring with the ashes. Even in the radiant light of a tropical day
such a fire is a grand sight.
Much less effective is the impression produced just now by the
great western plain as seen from the edge of the plateau. As often as
time permits, I stroll along this edge, sometimes in one direction,
sometimes in another, in the hope of finding the air clear enough to
let me enjoy the view; but I have always been disappointed.
Wherever one looks, clouds of smoke rise from the burning bush,
and the air is full of smoke and vapour. It is a pity, for under more
favourable circumstances the panorama of the whole country up to
the distant Majeje hills must be truly magnificent. It is of little use
taking photographs now, and an outline sketch gives a very poor idea
of the scenery. In one of these excursions I went out of my way to
make a personal attempt on the Makonde bush. The present edge of
the plateau is the result of a far-reaching process of destruction
through erosion and denudation. The Makonde strata are
everywhere cut into by ravines, which, though short, are hundreds of
yards in depth. In consequence of the loose stratification of these
beds, not only are the walls of these ravines nearly vertical, but their
upper end is closed by an equally steep escarpment, so that the
western edge of the Makonde plateau is hemmed in by a series of
deep, basin-like valleys. In order to get from one side of such a ravine
to the other, I cut my way through the bush with a dozen of my men.
It was a very open part, with more grass than scrub, but even so the
short stretch of less than two hundred yards was very hard work; at
the end of it the men’s calicoes were in rags and they themselves
bleeding from hundreds of scratches, while even our strong khaki
suits had not escaped scatheless.

NATIVE PATH THROUGH THE MAKONDE BUSH, NEAR

MAHUTA

I see increasing reason to believe that the view formed some time
back as to the origin of the Makonde bush is the correct one. I have
no doubt that it is not a natural product, but the result of human
occupation. Those parts of the high country where man—as a very
slight amount of practice enables the eye to perceive at once—has not
yet penetrated with axe and hoe, are still occupied by a splendid
timber forest quite able to sustain a comparison with our mixed
forests in Germany. But wherever man has once built his hut or tilled
his field, this horrible bush springs up. Every phase of this process
may be seen in the course of a couple of hours’ walk along the main
road. From the bush to right or left, one hears the sound of the axe—
not from one spot only, but from several directions at once. A few
steps further on, we can see what is taking place. The brush has been
cut down and piled up in heaps to the height of a yard or more,
between which the trunks of the large trees stand up like the last
pillars of a magnificent ruined building. These, too, present a
melancholy spectacle: the destructive Makonde have ringed them—
cut a broad strip of bark all round to ensure their dying off—and also
piled up pyramids of brush round them. Father and son, mother and
son-in-law, are chopping away perseveringly in the background—too
busy, almost, to look round at the white stranger, who usually excites
so much interest. If you pass by the same place a week later, the piles
of brushwood have disappeared and a thick layer of ashes has taken
the place of the green forest. The large trees stretch their
smouldering trunks and branches in dumb accusation to heaven—if
they have not already fallen and been more or less reduced to ashes,
perhaps only showing as a white stripe on the dark ground.
This work of destruction is carried out by the Makonde alike on the
virgin forest and on the bush which has sprung up on sites already
cultivated and deserted. In the second case they are saved the trouble
of burning the large trees, these being entirely absent in the
secondary bush.
After burning this piece of forest ground and loosening it with the
hoe, the native sows his corn and plants his vegetables. All over the
country, he goes in for bed-culture, which requires, and, in fact,
receives, the most careful attention. Weeds are nowhere tolerated in
the south of German East Africa. The crops may fail on the plains,
where droughts are frequent, but never on the plateau with its
abundant rains and heavy dews. Its fortunate inhabitants even have
the satisfaction of seeing the proud Wayao and Wamakua working
for them as labourers, driven by hunger to serve where they were
accustomed to rule.
But the light, sandy soil is soon exhausted, and would yield no
harvest the second year if cultivated twice running. This fact has
been familiar to the native for ages; consequently he provides in
time, and, while his crop is growing, prepares the next plot with axe
and firebrand. Next year he plants this with his various crops and
lets the first piece lie fallow. For a short time it remains waste and
desolate; then nature steps in to repair the destruction wrought by
man; a thousand new growths spring out of the exhausted soil, and
even the old stumps put forth fresh shoots. Next year the new growth
is up to one’s knees, and in a few years more it is that terrible,
impenetrable bush, which maintains its position till the black
occupier of the land has made the round of all the available sites and
come back to his starting point.
The Makonde are, body and soul, so to speak, one with this bush.
According to my Yao informants, indeed, their name means nothing
else but “bush people.” Their own tradition says that they have been
settled up here for a very long time, but to my surprise they laid great
stress on an original immigration. Their old homes were in the
south-east, near Mikindani and the mouth of the Rovuma, whence
their peaceful forefathers were driven by the continual raids of the
Sakalavas from Madagascar and the warlike Shirazis[47] of the coast,
to take refuge on the almost inaccessible plateau. I have studied
African ethnology for twenty years, but the fact that changes of
population in this apparently quiet and peaceable corner of the earth
could have been occasioned by outside enterprises taking place on
the high seas, was completely new to me. It is, no doubt, however,
correct.
The charming tribal legend of the Makonde—besides informing us
of other interesting matters—explains why they have to live in the
thickest of the bush and a long way from the edge of the plateau,
instead of making their permanent homes beside the purling brooks
and springs of the low country.
“The place where the tribe originated is Mahuta, on the southern
side of the plateau towards the Rovuma, where of old time there was
nothing but thick bush. Out of this bush came a man who never
washed himself or shaved his head, and who ate and drank but little.
He went out and made a human figure from the wood of a tree
growing in the open country, which he took home to his abode in the
bush and there set it upright. In the night this image came to life and
was a woman. The man and woman went down together to the
Rovuma to wash themselves. Here the woman gave birth to a still-
born child. They left that place and passed over the high land into the
valley of the Mbemkuru, where the woman had another child, which
was also born dead. Then they returned to the high bush country of
Mahuta, where the third child was born, which lived and grew up. In
course of time, the couple had many more children, and called
themselves Wamatanda. These were the ancestral stock of the
Makonde, also called Wamakonde,[48] i.e., aborigines. Their
forefather, the man from the bush, gave his children the command to
bury their dead upright, in memory of the mother of their race who
was cut out of wood and awoke to life when standing upright. He also
warned them against settling in the valleys and near large streams,
for sickness and death dwelt there. They were to make it a rule to
have their huts at least an hour’s walk from the nearest watering-
place; then their children would thrive and escape illness.”
The explanation of the name Makonde given by my informants is
somewhat different from that contained in the above legend, which I
extract from a little book (small, but packed with information), by
Pater Adams, entitled Lindi und sein Hinterland. Otherwise, my
results agree exactly with the statements of the legend. Washing?
Hapana—there is no such thing. Why should they do so? As it is, the
supply of water scarcely suffices for cooking and drinking; other
people do not wash, so why should the Makonde distinguish himself
by such needless eccentricity? As for shaving the head, the short,
woolly crop scarcely needs it,[49] so the second ancestral precept is
likewise easy enough to follow. Beyond this, however, there is
nothing ridiculous in the ancestor’s advice. I have obtained from
various local artists a fairly large number of figures carved in wood,
ranging from fifteen to twenty-three inches in height, and
representing women belonging to the great group of the Mavia,
Makonde, and Matambwe tribes. The carving is remarkably well
done and renders the female type with great accuracy, especially the
keloid ornamentation, to be described later on. As to the object and
meaning of their works the sculptors either could or (more probably)
would tell me nothing, and I was forced to content myself with the
scanty information vouchsafed by one man, who said that the figures
were merely intended to represent the nembo—the artificial
deformations of pelele, ear-discs, and keloids. The legend recorded
by Pater Adams places these figures in a new light. They must surely
be more than mere dolls; and we may even venture to assume that
they are—though the majority of present-day Makonde are probably
unaware of the fact—representations of the tribal ancestress.
 The references in the legend to the descent from Mahuta to the
Rovuma, and to a journey across the highlands into the Mbekuru
valley, undoubtedly indicate the previous history of the tribe, the
travels of the ancestral pair typifying the migrations of their
descendants. The descent to the neighbouring Rovuma valley, with
its extraordinary fertility and great abundance of game, is intelligible
at a glance—but the crossing of the Lukuledi depression, the ascent
to the Rondo Plateau and the descent to the Mbemkuru, also lie
within the bounds of probability, for all these districts have exactly
the same character as the extreme south. Now, however, comes a
point of especial interest for our bacteriological age. The primitive
Makonde did not enjoy their lives in the marshy river-valleys.
Disease raged among them, and many died. It was only after they
had returned to their original home near Mahuta, that the health
conditions of these people improved. We are very apt to think of the
African as a stupid person whose ignorance of nature is only equalled
by his fear of it, and who looks on all mishaps as caused by evil
spirits and malignant natural powers. It is much more correct to
assume in this case that the people very early learnt to distinguish
districts infested with malaria from those where it is absent.
This knowledge is crystallized in the
ancestral warning against settling in the
valleys and near the great waters, the
dwelling-places of disease and death. At the
same time, for security against the hostile
Mavia south of the Rovuma, it was enacted
that every settlement must be not less than a
certain distance from the southern edge of the
plateau. Such in fact is their mode of life at the
present day. It is not such a bad one, and
certainly they are both safer and more
comfortable than the Makua, the recent
intruders from the south, who have made USUAL METHOD OF
good their footing on the western edge of the CLOSING HUT-DOOR
plateau, extending over a fairly wide belt of
country. Neither Makua nor Makonde show in their dwellings
anything of the size and comeliness of the Yao houses in the plain,
especially at Masasi, Chingulungulu and Zuza’s. Jumbe Chauro, a
Makonde hamlet not far from Newala, on the road to Mahuta, is the
most important settlement of the tribe I have yet seen, and has fairly
spacious huts. But how slovenly is their construction compared with
the palatial residences of the elephant-hunters living in the plain.
The roofs are still more untidy than in the general run of huts during
the dry season, the walls show here and there the scanty beginnings
or the lamentable remains of the mud plastering, and the interior is a
veritable dog-kennel; dirt, dust and disorder everywhere. A few huts
only show any attempt at division into rooms, and this consists
merely of very roughly-made bamboo partitions. In one point alone
have I noticed any indication of progress—in the method of fastening
the door. Houses all over the south are secured in a simple but
ingenious manner. The door consists of a set of stout pieces of wood
or bamboo, tied with bark-string to two cross-pieces, and moving in
two grooves round one of the door-posts, so as to open inwards. If
the owner wishes to leave home, he takes two logs as thick as a man’s
upper arm and about a yard long. One of these is placed obliquely
against the middle of the door from the inside, so as to form an angle
of from 60° to 75° with the ground. He then places the second piece
horizontally across the first, pressing it downward with all his might.
It is kept in place by two strong posts planted in the ground a few
inches inside the door. This fastening is absolutely safe, but of course
cannot be applied to both doors at once, otherwise how could the
owner leave or enter his house? I have not yet succeeded in finding
out how the back door is fastened.

MAKONDE LOCK AND KEY AT JUMBE CHAURO

 This is the general way of closing a house. The Makonde at Jumbe
Chauro, however, have a much more complicated, solid and original
one. Here, too, the door is as already described, except that there is
only one post on the inside, standing by itself about six inches from
one side of the doorway. Opposite this post is a hole in the wall just
large enough to admit a man’s arm. The door is closed inside by a
large wooden bolt passing through a hole in this post and pressing
with its free end against the door. The other end has three holes into
which fit three pegs running in vertical grooves inside the post. The
door is opened with a wooden key about a foot long, somewhat
curved and sloped off at the butt; the other end has three pegs
corresponding to the holes, in the bolt, so that, when it is thrust
through the hole in the wall and inserted into the rectangular
opening in the post, the pegs can be lifted and the bolt drawn out.[50]

MODE OF INSERTING THE KEY

With no small pride first one householder and then a second

showed me on the spot the action of this greatest invention of the
Makonde Highlands. To both with an admiring exclamation of
“Vizuri sana!” (“Very fine!”). I expressed the wish to take back these
marvels with me to Ulaya, to show the Wazungu what clever fellows
the Makonde are. Scarcely five minutes after my return to camp at
Newala, the two men came up sweating under the weight of two
heavy logs which they laid down at my feet, handing over at the same
time the keys of the fallen fortress. Arguing, logically enough, that if
the key was wanted, the lock would be wanted with it, they had taken
their axes and chopped down the posts—as it never occurred to them
to dig them out of the ground and so bring them intact. Thus I have
two badly damaged specimens, and the owners, instead of praise,
come in for a blowing-up.
The Makua huts in the environs of Newala are especially
miserable; their more than slovenly construction reminds one of the
temporary erections of the Makua at Hatia’s, though the people here
have not been concerned in a war. It must therefore be due to
congenital idleness, or else to the absence of a powerful chief. Even
the baraza at Mlipa’s, a short hour’s walk south-east of Newala,
shares in this general neglect. While public buildings in this country
are usually looked after more or less carefully, this is in evident
danger of being blown over by the first strong easterly gale. The only
attractive object in this whole district is the grave of the late chief
Mlipa. I visited it in the morning, while the sun was still trying with
partial success to break through the rolling mists, and the circular
grove of tall euphorbias, which, with a broken pot, is all that marks
the old king’s resting-place, impressed one with a touch of pathos.
Even my very materially-minded carriers seemed to feel something
of the sort, for instead of their usual ribald songs, they chanted
solemnly, as we marched on through the dense green of the Makonde
bush:—
 “We shall arrive with the great master; we stand in a row and have
no fear about getting our food and our money from the Serkali (the
Government). We are not afraid; we are going along with the great
master, the lion; we are going down to the coast and back.”
With regard to the characteristic features of the various tribes here
on the western edge of the plateau, I can arrive at no other
conclusion than the one already come to in the plain, viz., that it is
impossible for anyone but a trained anthropologist to assign any
given individual at once to his proper tribe. In fact, I think that even
an anthropological specialist, after the most careful examination,
might find it a difficult task to decide. The whole congeries of peoples
collected in the region bounded on the west by the great Central
African rift, Tanganyika and Nyasa, and on the east by the Indian
Ocean, are closely related to each other—some of their languages are
only distinguished from one another as dialects of the same speech,
and no doubt all the tribes present the same shape of skull and
structure of skeleton. Thus, surely, there can be no very striking
differences in outward appearance.
 Even did such exist, I should have no time
to concern myself with them, for day after day,
I have to see or hear, as the case may be—in
any case to grasp and record—an
extraordinary number of ethnographic
phenomena. I am almost disposed to think it
fortunate that some departments of inquiry, at
least, are barred by external circumstances.
Chief among these is the subject of iron-
working. We are apt to think of Africa as a
country where iron ore is everywhere, so to
speak, to be picked up by the roadside, and
where it would be quite surprising if the
inhabitants had not learnt to smelt the
material ready to their hand. In fact, the
knowledge of this art ranges all over the
continent, from the Kabyles in the north to the
Kafirs in the south. Here between the Rovuma
and the Lukuledi the conditions are not so
favourable. According to the statements of the
Makonde, neither ironstone nor any other
form of iron ore is known to them. They have
not therefore advanced to the art of smelting
the metal, but have hitherto bought all their
THE ANCESTRESS OF
THE MAKONDE
iron implements from neighbouring tribes.
Even in the plain the inhabitants are not much
better off. Only one man now living is said to
understand the art of smelting iron. This old fundi lives close to
Huwe, that isolated, steep-sided block of granite which rises out of
the green solitude between Masasi and Chingulungulu, and whose
jagged and splintered top meets the traveller’s eye everywhere. While
still at Masasi I wished to see this man at work, but was told that,
frightened by the rising, he had retired across the Rovuma, though
he would soon return. All subsequent inquiries as to whether the
fundi had come back met with the genuine African answer, “Bado”
(“Not yet”).
 BRAZIER

Some consolation was afforded me by a brassfounder, whom I

came across in the bush near Akundonde’s. This man is the favourite
of women, and therefore no doubt of the gods; he welds the glittering
brass rods purchased at the coast into those massive, heavy rings
which, on the wrists and ankles of the local fair ones, continually give
me fresh food for admiration. Like every decent master-craftsman he
had all his tools with him, consisting of a pair of bellows, three
crucibles and a hammer—nothing more, apparently. He was quite
willing to show his skill, and in a twinkling had fixed his bellows on
the ground. They are simply two goat-skins, taken off whole, the four
legs being closed by knots, while the upper opening, intended to
admit the air, is kept stretched by two pieces of wood. At the lower
end of the skin a smaller opening is left into which a wooden tube is
stuck. The fundi has quickly borrowed a heap of wood-embers from
the nearest hut; he then fixes the free ends of the two tubes into an
earthen pipe, and clamps them to the ground by means of a bent
piece of wood. Now he fills one of his small clay crucibles, the dross
on which shows that they have been long in use, with the yellow
material, places it in the midst of the embers, which, at present are
only faintly glimmering, and begins his work. In quick alternation
the smith’s two hands move up and down with the open ends of the
bellows; as he raises his hand he holds the slit wide open, so as to let
the air enter the skin bag unhindered. In pressing it down he closes
the bag, and the air puffs through the bamboo tube and clay pipe into
the fire, which quickly burns up. The smith, however, does not keep
on with this work, but beckons to another man, who relieves him at
the bellows, while he takes some more tools out of a large skin pouch
carried on his back. I look on in wonder as, with a smooth round
stick about the thickness of a finger, he bores a few vertical holes into
the clean sand of the soil. This should not be difficult, yet the man
seems to be taking great pains over it. Then he fastens down to the
ground, with a couple of wooden clamps, a neat little trough made by
splitting a joint of bamboo in half, so that the ends are closed by the
two knots. At last the yellow metal has attained the right consistency,
and the fundi lifts the crucible from the fire by means of two sticks
split at the end to serve as tongs. A short swift turn to the left—a
tilting of the crucible—and the molten brass, hissing and giving forth
clouds of smoke, flows first into the bamboo mould and then into the
holes in the ground.
The technique of this backwoods craftsman may not be very far
advanced, but it cannot be denied that he knows how to obtain an
adequate result by the simplest means. The ladies of highest rank in
this country—that is to say, those who can afford it, wear two kinds
of these massive brass rings, one cylindrical, the other semicircular
in section. The latter are cast in the most ingenious way in the
bamboo mould, the former in the circular hole in the sand. It is quite
a simple matter for the fundi to fit these bars to the limbs of his fair
customers; with a few light strokes of his hammer he bends the
pliable brass round arm or ankle without further inconvenience to
the wearer.
SHAPING THE POT

SMOOTHING WITH MAIZE-COB

CUTTING THE EDGE

 FINISHING THE BOTTOM

LAST SMOOTHING BEFORE

BURNING

FIRING THE BRUSH-PILE

 LIGHTING THE FARTHER SIDE OF
THE PILE

TURNING THE RED-HOT VESSEL

NYASA WOMAN MAKING POTS AT MASASI

Pottery is an art which must always and everywhere excite the
interest of the student, just because it is so intimately connected with
the development of human culture, and because its relics are one of
the principal factors in the reconstruction of our own condition in
prehistoric times. I shall always remember with pleasure the two or
three afternoons at Masasi when Salim Matola’s mother, a slightly-
built, graceful, pleasant-looking woman, explained to me with
touching patience, by means of concrete illustrations, the ceramic art
of her people. The only implements for this primitive process were a
lump of clay in her left hand, and in the right a calabash containing
the following valuables: the fragment of a maize-cob stripped of all
its grains, a smooth, oval pebble, about the size of a pigeon’s egg, a
few chips of gourd-shell, a bamboo splinter about the length of one’s
hand, a small shell, and a bunch of some herb resembling spinach.
 Nothing more. The woman scraped with the
shell a round, shallow hole in the soft, fine
sand of the soil, and, when an active young
girl had filled the calabash with water for her,
she began to knead the clay. As if by magic it
gradually assumed the shape of a rough but
already well-shaped vessel, which only wanted
a little touching up with the instruments
before mentioned. I looked out with the
MAKUA WOMAN closest attention for any indication of the use
MAKING A POT. of the potter’s wheel, in however rudimentary
SHOWS THE a form, but no—hapana (there is none). The
BEGINNINGS OF THE embryo pot stood firmly in its little
POTTER’S WHEEL
depression, and the woman walked round it in
a stooping posture, whether she was removing
small stones or similar foreign bodies with the maize-cob, smoothing
the inner or outer surface with the splinter of bamboo, or later, after
letting it dry for a day, pricking in the ornamentation with a pointed
bit of gourd-shell, or working out the bottom, or cutting the edge
with a sharp bamboo knife, or giving the last touches to the finished
vessel. This occupation of the women is infinitely toilsome, but it is
without doubt an accurate reproduction of the process in use among
our ancestors of the Neolithic and Bronze ages.
There is no doubt that the invention of pottery, an item in human
progress whose importance cannot be over-estimated, is due to
women. Rough, coarse and unfeeling, the men of the horde range
over the countryside. When the united cunning of the hunters has
succeeded in killing the game; not one of them thinks of carrying
home the spoil. A bright fire, kindled by a vigorous wielding of the
drill, is crackling beside them; the animal has been cleaned and cut
up secundum artem, and, after a slight singeing, will soon disappear
under their sharp teeth; no one all this time giving a single thought
to wife or child.
To what shifts, on the other hand, the primitive wife, and still more
the primitive mother, was put! Not even prehistoric stomachs could
endure an unvarying diet of raw food. Something or other suggested
the beneficial effect of hot water on the majority of approved but
indigestible dishes. Perhaps a neighbour had tried holding the hard
roots or tubers over the fire in a calabash filled with water—or maybe
an ostrich-egg-shell, or a hastily improvised vessel of bark. They
became much softer and more palatable than they had previously
been; but, unfortunately, the vessel could not stand the fire and got
charred on the outside. That can be remedied, thought our
ancestress, and plastered a layer of wet clay round a similar vessel.
This is an improvement; the cooking utensil remains uninjured, but
the heat of the fire has shrunk it, so that it is loose in its shell. The
next step is to detach it, so, with a firm grip and a jerk, shell and
kernel are separated, and pottery is invented. Perhaps, however, the
discovery which led to an intelligent use of the burnt-clay shell, was
made in a slightly different way. Ostrich-eggs and calabashes are not
to be found in every part of the world, but everywhere mankind has
arrived at the art of making baskets out of pliant materials, such as
bark, bast, strips of palm-leaf, supple twigs, etc. Our inventor has no
water-tight vessel provided by nature. “Never mind, let us line the
basket with clay.” This answers the purpose, but alas! the basket gets
burnt over the blazing fire, the woman watches the process of
cooking with increasing uneasiness, fearing a leak, but no leak
appears. The food, done to a turn, is eaten with peculiar relish; and
the cooking-vessel is examined, half in curiosity, half in satisfaction
at the result. The plastic clay is now hard as stone, and at the same
time looks exceedingly well, for the neat plaiting of the burnt basket
is traced all over it in a pretty pattern. Thus, simultaneously with
pottery, its ornamentation was invented.
Primitive woman has another claim to respect. It was the man,
roving abroad, who invented the art of producing fire at will, but the
woman, unable to imitate him in this, has been a Vestal from the
earliest times. Nothing gives so much trouble as the keeping alight of
the smouldering brand, and, above all, when all the men are absent
from the camp. Heavy rain-clouds gather, already the first large
drops are falling, the first gusts of the storm rage over the plain. The
little flame, a greater anxiety to the woman than her own children,
flickers unsteadily in the blast. What is to be done? A sudden thought
occurs to her, and in an instant she has constructed a primitive hut
out of strips of bark, to protect the flame against rain and wind.
This, or something very like it, was the way in which the principle
of the house was discovered; and even the most hardened misogynist
cannot fairly refuse a woman the credit of it. The protection of the
hearth-fire from the weather is the germ from which the human
dwelling was evolved. Men had little, if any share, in this forward
step, and that only at a late stage. Even at the present day, the
plastering of the housewall with clay and the manufacture of pottery
are exclusively the women’s business. These are two very significant
survivals. Our European kitchen-garden, too, is originally a woman’s
invention, and the hoe, the primitive instrument of agriculture, is,
characteristically enough, still used in this department. But the
noblest achievement which we owe to the other sex is unquestionably
the art of cookery. Roasting alone—the oldest process—is one for
which men took the hint (a very obvious one) from nature. It must
have been suggested by the scorched carcase of some animal
overtaken by the destructive forest-fires. But boiling—the process of
improving organic substances by the help of water heated to boiling-
point—is a much later discovery. It is so recent that it has not even
yet penetrated to all parts of the world. The Polynesians understand
how to steam food, that is, to cook it, neatly wrapped in leaves, in a
hole in the earth between hot stones, the air being excluded, and
(sometimes) a few drops of water sprinkled on the stones; but they
do not understand boiling.
To come back from this digression, we find that the slender Nyasa
woman has, after once more carefully examining the finished pot,
put it aside in the shade to dry. On the following day she sends me
word by her son, Salim Matola, who is always on hand, that she is
going to do the burning, and, on coming out of my house, I find her
already hard at work. She has spread on the ground a layer of very
dry sticks, about as thick as one’s thumb, has laid the pot (now of a
yellowish-grey colour) on them, and is piling brushwood round it.
My faithful Pesa mbili, the mnyampara, who has been standing by,
most obligingly, with a lighted stick, now hands it to her. Both of
them, blowing steadily, light the pile on the lee side, and, when the
flame begins to catch, on the weather side also. Soon the whole is in a
blaze, but the dry fuel is quickly consumed and the fire dies down, so
that we see the red-hot vessel rising from the ashes. The woman
turns it continually with a long stick, sometimes one way and
sometimes another, so that it may be evenly heated all over. In
twenty minutes she rolls it out of the ash-heap, takes up the bundle
of spinach, which has been lying for two days in a jar of water, and
sprinkles the red-hot clay with it. The places where the drops fall are
marked by black spots on the uniform reddish-brown surface. With a
sigh of relief, and with visible satisfaction, the woman rises to an
erect position; she is standing just in a line between me and the fire,
from which a cloud of smoke is just rising: I press the ball of my
camera, the shutter clicks—the apotheosis is achieved! Like a
priestess, representative of her inventive sex, the graceful woman
stands: at her feet the hearth-fire she has given us beside her the
invention she has devised for us, in the background the home she has
built for us.
At Newala, also, I have had the manufacture of pottery carried on
in my presence. Technically the process is better than that already
described, for here we find the beginnings of the potter’s wheel,
which does not seem to exist in the plains; at least I have seen
nothing of the sort. The artist, a frightfully stupid Makua woman, did
not make a depression in the ground to receive the pot she was about
to shape, but used instead a large potsherd. Otherwise, she went to
work in much the same way as Salim’s mother, except that she saved
herself the trouble of walking round and round her work by squatting
at her ease and letting the pot and potsherd rotate round her; this is
surely the first step towards a machine. But it does not follow that
the pot was improved by the process. It is true that it was beautifully
rounded and presented a very creditable appearance when finished,
but the numerous large and small vessels which I have seen, and, in
part, collected, in the “less advanced” districts, are no less so. We
moderns imagine that instruments of precision are necessary to
produce excellent results. Go to the prehistoric collections of our
museums and look at the pots, urns and bowls of our ancestors in the
dim ages of the past, and you will at once perceive your error.
MAKING LONGITUDINAL CUT IN
BARK

DRAWING THE BARK OFF THE LOG

REMOVING THE OUTER BARK

 BEATING THE BARK

WORKING THE BARK-CLOTH AFTER BEATING, TO MAKE IT

SOFT

MANUFACTURE OF BARK-CLOTH AT NEWALA

To-day, nearly the whole population of German East Africa is
clothed in imported calico. This was not always the case; even now in
some parts of the north dressed skins are still the prevailing wear,
and in the north-western districts—east and north of Lake
Tanganyika—lies a zone where bark-cloth has not yet been
superseded. Probably not many generations have passed since such
bark fabrics and kilts of skins were the only clothing even in the
south. Even to-day, large quantities of this bright-red or drab
material are still to be found; but if we wish to see it, we must look in
the granaries and on the drying stages inside the native huts, where
it serves less ambitious uses as wrappings for those seeds and fruits
which require to be packed with special care. The salt produced at
Masasi, too, is packed for transport to a distance in large sheets of
bark-cloth. Wherever I found it in any degree possible, I studied the
process of making this cloth. The native requisitioned for the
purpose arrived, carrying a log between two and three yards long and
as thick as his thigh, and nothing else except a curiously-shaped
mallet and the usual long, sharp and pointed knife which all men and
boys wear in a belt at their backs without a sheath—horribile dictu!
[51]
Silently he squats down before me, and with two rapid cuts has
drawn a couple of circles round the log some two yards apart, and
slits the bark lengthwise between them with the point of his knife.
With evident care, he then scrapes off the outer rind all round the
log, so that in a quarter of an hour the inner red layer of the bark
shows up brightly-coloured between the two untouched ends. With
some trouble and much caution, he now loosens the bark at one end,
and opens the cylinder. He then stands up, takes hold of the free
edge with both hands, and turning it inside out, slowly but steadily
pulls it off in one piece. Now comes the troublesome work of
scraping all superfluous particles of outer bark from the outside of
the long, narrow piece of material, while the inner side is carefully
scrutinised for defective spots. At last it is ready for beating. Having
signalled to a friend, who immediately places a bowl of water beside
him, the artificer damps his sheet of bark all over, seizes his mallet,
lays one end of the stuff on the smoothest spot of the log, and
hammers away slowly but continuously. “Very simple!” I think to
myself. “Why, I could do that, too!”—but I am forced to change my
opinions a little later on; for the beating is quite an art, if the fabric is
not to be beaten to pieces. To prevent the breaking of the fibres, the
stuff is several times folded across, so as to interpose several
thicknesses between the mallet and the block. At last the required
state is reached, and the fundi seizes the sheet, still folded, by both
ends, and wrings it out, or calls an assistant to take one end while he
holds the other. The cloth produced in this way is not nearly so fine
and uniform in texture as the famous Uganda bark-cloth, but it is
quite soft, and, above all, cheap.
Now, too, I examine the mallet. My craftsman has been using the
simpler but better form of this implement, a conical block of some
hard wood, its base—the striking surface—being scored across and
across with more or less deeply-cut grooves, and the handle stuck
into a hole in the middle. The other and earlier form of mallet is
shaped in the same way, but the head is fastened by an ingenious
network of bark strips into the split bamboo serving as a handle. The
observation so often made, that ancient customs persist longest in
connection with religious ceremonies and in the life of children, here
finds confirmation. As we shall soon see, bark-cloth is still worn
during the unyago,[52] having been prepared with special solemn
ceremonies; and many a mother, if she has no other garment handy,
will still put her little one into a kilt of bark-cloth, which, after all,
looks better, besides being more in keeping with its African
surroundings, than the ridiculous bit of print from Ulaya.
MAKUA WOMEN