Mycologia

ISSN: 0027-5514 (Print) 1557-2536 (Online) Journal homepage: http://www.tandfonline.com/loi/umyc20

Molecular systematics and phylogeography of the

Gibberella fujikuroi species complex

Kerry O'Donnell, Elizabeth Cigelnik & Helgard I. Nirenberg

To cite this article: Kerry O'Donnell, Elizabeth Cigelnik & Helgard I. Nirenberg (1998) Molecular
systematics and phylogeography of the Gibberella�fujikuroi species complex, Mycologia, 90:3,
465-493, DOI: 10.1080/00275514.1998.12026933

To link to this article: https://doi.org/10.1080/00275514.1998.12026933

Published online: 28 Aug 2018.

Submit your article to this journal

Article views: 2

Citing articles: 34 View citing articles

Full Terms & Conditions of access and use can be found at

http://www.tandfonline.com/action/journalInformation?journalCode=umyc20
MJCologia, 90(3), 199H, pp. 465-493.
© 1998 by The New York Botanical Garden, Bronx, :\'Y 104.'i8-.'il26
Molecular systematics and phytogeography of the
Gibberella Jujikuroi species complex
Kerry O'DonnelP
Microbial Properties Research, National Center for
Agricultural Utilization Research, Agricultural
Research Service, United States Department of
Agriculture, Peoria, Illinois 6I604-3999
Elizabeth Cigelnik
Microbial Properties Research, National Center for
Agricultural Utilization Research, Agricultural
Research Service, United States Department of
Agriculture, Peoria, Illinois 61604-3999
Helgard I. Nirenberg
Biologische Bundesanstalt fiir Land- und
Forstwirtschajt, Institut fiir Mikrobiologie, Konigin-
Luise-Stra}Je 19, D-14195 Berlin, German)'
Abstract: Phylogenetic relationships of the phyto-
pathogenic Gibberella Jujikuroi species complex were
investigated by maximum parsimony analysis of DNA
sequences from multiple loci. Gene trees inferred
from the [3-tubulin gene exons and introns, mito-
chondrial small subunit (mtSSU) rDNA, and 5' por-
tion of the nuclear 28S rDNA were largely concor-
dant, and in a combined analysis, provide strong sta-
tistical support for a phylogeny consistent with spe-
cies radiations in South America, Mrica, and Asia.
These analyses place the American clade as a mono-
phyletic sister-group of an Mrican-Asian clade. Mrica
is the most phylogenetically diverse area examined
with 16 species, followed by America (12 species) and
Asia (8 species). The biogeographic hypothesis pro-
posed from the phylogenetic evidence is based pri-
marily on the formation of natural barriers associated
with the fragmentation of the ancient super-conti-
nent Gondwana. Discordance of the nuclear riboso-
mal internal transcribed spacer (ITS) based tree with
gene trees from the other loci sequenced is due to
nonorthologous ITS2 sequences. The molecular evi-
dence suggests the divergent ITS2 types were com-
bined by an ancient interspecific hybridization (xen-
ologous origin) or gene duplication (paralogous or-
igin) that predates the evolutionary radiation of the
G. Jujikuroi complex. Two highly divergent nonor-
thologous ITS2 types designated type I and type II
were identified and characterized with conserved ITS
Accepted for publication October l.'i, 1997.
1 Email: kodonnell@sunca.ncaur.usda.go\'
465
Published online 28 Aug 2018
and ITS2 type-specific polymerase chain reaction
(PCR) primers and DNA sequence analysis. Only the
major ITS2 type is discernible when conserved ITS
primers are used; however, a minor ITS2 type was
amplified from every strain tested with type-specific
PCR primers. The evolutionary pattern exhibited by
the major ITS2 type is homoplastic when mapped
onto the species lineages inferred from the com-
bined nuclear 28S rDNA, mtSSU rDNA, and [3-tubu-
lin gene sequences. Remarkably, the data indicate the
major ITS2 type has switched between a type I and
type II sequence at least three times during the evo-
lution of the G. Jujikuroi complex, but neither type
has been fixed in any of the 45 species examined.
Twenty-six of the 45 species included in this study
represent either new species (23 species), new com-
binations (F. bulbi cola and F. phyllophilum), or a re-
discovered species (F. lactis). The results further in-
dicate that traditional sectional and species-level tax-
onomic schemes for this lineage are artificial and a
more natural classification is proposed.
Key Words: [3-tubulin, biogeography, evolution,
fungi, Hypocreales, ITS, mtSSU rDNA, phylogeny,
phytopathogens
1\:TRODL'CTIO~
Gibberella Jujikuroi (Sawada) Wollenw. is a polytypic
species complex with anamorphs in Fusarium. Fusar-
ia within this complex are best noted for many eco-
nomically-important plant diseases such as the gib-
berellin-induced "bakanae" or "foolish seedling"
disease of Oryza sativa (Sun and Snyder, 1981), pitch
canker of Pinus spp. (Correll et al., 1992), stalk rot
of Zea mays and Sorghum bicolor (Leslie, 1995), vas-
cular wilt of Cajanus cajan and Cicer arietinum
(Booth, 1971), Ficus carica endosepsis (Subbarao and
Michailides, 1993), and Ananas comosus fruit rot
(Bolkan et al., 1979); for secondary metabolites such
as the gibberellin plant hormones (Cerda-Olmedo et
al., 1994); and for the production of potent toxins
such as fumonisins, moniliformin, fusarin C, fusaric
acid (Marasas et al., 1984; Nelson et al., 1992; Leslie,
1995) and beauvericin (Moretti et al., 1996).
Fusaria have been variously sorted into infragener-
ic groupings called sections based on similar ana-
morphic features, but many sections are artificial
466 MYCOLOGIA

TABLE I. Species accepted within the Gibberella fujikuroi complex•

O'Donnell, Cigelnik, and Nirenberg Gerlach and Nirenberg (1982) Nelson eta!. (1983)
F. acutatum Nirenberg & O'Donnellh
F. annulatum Bugnicourt' annulatum insufficiently documented
F. anthvphilum (A. Braun) Wollenw. anthvphilum anthvphilum
F. bactridioides Wollenw. bactridioides (section Discolor) sambucinum (section Discolor)
F. begoniae Nirenberg & O'Donnell
F. brevicatenulatum Nirenberg et a!.
F. bulbicola Nirenberg & O'Donnell sacchari var. elongatum subglutinans
F. circinatum Nirenberg & O'Donnellci subglutinans
F. concentricum Nirenberg & O'Donnell
F. denticulatum Nirenberg & O'Donnell"
F. dlaminii Marasas et aJ.l
F. fujikuroi Nirenberg MP-C~ fujikuroi moniliforme
F. globosum Rheeder et a!.
F. guttiforme Nirenberg & O'Donnellh
F. lactis Pirotta & Riboni;
F. napiforme Marasas et a!. 1
F. nygamai Burgess & TrimboJil
F. phyllvphilum Nirenberg & O'Donnellg..i proliferatum var. minus moniliforme
F. proliferatum (Matsushima) Nirenberg MP-D proliferatum proliferatum
[see F. annulatum]'"
F. pseudoanthvphilum Nirenberg et a!.
F. pseudocircinatum O'Donnell & Nirenberg
F. pseudonygamai O'Donnell & Nirenbergk
F. ramigenum O'Donnell & Nirenberg1
F. sacchari (Butler) W. Gams MP-B sacchari var. sacchari subglutinans
[=F. neoceras Wollenw. & Reinking]"'
F. subglutinans (Wollenw. & Reinking) Nelson sacchari var. subglutinans subglutinans
eta!. MP-E"'
F. succisae (Schroter) Sacc. succisae insufficiently documented
F. thapsinum Klittich et a!. MP-Fg moniliforme
F. udum Butler udum (section Elegans) insufficiently documented
F. verticillioides (Sacc.) Nirenberg MP-Ag verticillioides moniliforme
African clade•
Fusarium sp. 25221
Asian clade"
Fusarium sp. 25226
Fusarium sp. 25303
Fusarium sp. 25309

(O'Donnell, 1993, 1997; O'Donnell and Gray, 1995,
Mule et al., 1997). The G. fujikuroi complex (TABLE
I) is highly controversial taxonomically, as reflected
in the widely divergent morphological species con-
cepts (MSC) adopted in traditional morphology-
based classification schemes for the genus. Booth
( 1971), for example, recognized one species and one
variety, Nirenberg (1976) and Gerlach and Niren-
berg ( 1982) six species and four varieties, and Nelson
et al. (1983) four species (TABLE I); however, in the
present synthesis 36 species are recognized within
this complex. In the four aforementioned morphol-
ogy-based taxonomic treatments, species within this
complex are classified in section Liseola (Wollenwe-
ber and Reinking, 1925) which by definition ex-
cludes species that produce chlamydospores. Section
Dlaminia was proposed by Kwasna et al. (1991) to
accommodate four Liseola-like species described
since 1985 that were not classified within section Lis-
eola because they produce chlamydospores. Section
Liseola, however, is paraphyletic because three chla-
mydospore-forming species classified in section
Dlaminia (i.e., F. dlaminii, F. nygamai, and F.
napiforme) are phylogenetically nested within section
Liseola (O'Donnell and Cigelnik, 1997). F. nisikadoi
(Nirenberg and Aoki, 1998) would be placed in Lis-
eola on morphological grounds, but this classification
would result in the polyphyly of Liseola. Results re-
 O'Do;o.;;-,;EI.L ET AI..: FuSARIUM MOLECCLAR PH\1.0GENY 467

TABLE I. Continued

O'Donnell, Cigelnik, and Nirenberg Gerlach and Nirenberg (1982) Nelson et al. (1983)
American clade•
Fusarium sp. 25195
Fusarium sp. 25204
Fusarium sp. 25346"
Fusarium sp. DAR 70287P
a The Gibberella fujikuroi complex roughly corresponds to section Liseola, but we avoid using this sectional name because
it is paraphyletic as currently defined. Furthermore, inclusion of Fusarium nisikadoi (Nirenberg and Aoki, 1998) in Liseola
is supported by the morphological e\idence but this classification would result in the polyphyly of this section.
h Received misidentified as F. udum FRC 0-1116 and 0-1117.

< Because F. proliferatum is a later synonym of F. annulatum, we are preparing a proposal to conserve the well-known species

F. proliferatum over F. annulatum which is known only from a single collection (Bugnicourt, 1952).
"The pine canker pathogen is currently called F. subglutinans f. sp. pini (Correll et al., 1992; Viljoen et al., 1995, 1997).
,. Incorrectly identified as F. lateritium from Ipomoea batatas (Nelson et al., 1995; Clark et al., 1995).
r Three chlamydospore-forming species described since 1985 were not classified in section Liseola but are members of the
Gibberella fujikuroi complex: F. dlaminii (as F. dlamini, Marasas et al., 1985), F. napiforme (Marasas et al., 1987), and F.
nygamai (Burgess and Trimboli, 1986).
~Note that Nelson et al. (1983) apply the name F. moniliforme Sheldon to four different species [F. fujikuroi MP-C, F.
phyllophilum, F. verticillioides MP-A, and Fusarium thapsinum MP-F]. F. verticillioides MP-A has priority over the later synonym
F. moniliforme.
11
This pathogen of Ananas comosus (pineapple) has been called F. moniliformevar. subglutinans (Bolkan et al., 1979; ATCC
38067 = NRRL 25037), F. subglutinans (Viljoen et al., 1995; MRC 6784 = NRRL 25624), and F. sacchari var. sacchari (CBS
184.29 = NRRL 22945).
i Received misidentified as F. moniliforme isolated from Ficus carica (Subbarao and Michailides, 1993); also misidentified as

F. proliferatum (Marasas et al., 1995).

i A distinct species in the African clade rather than a variety of F. proliferatum (Gerlach and Nirenberg, 1982); also received
misidentified as F. proliferatum FRC M-1219 = NRRL 13296.
k Misidentified as F. nygamai FRC M-1166 = NRRL 13592 (Nelson et al., 1992) and FRC M-1324 = NRRL 6022 (Marasas

et al., 1988b).
1 Received misidentified as F. moniliforme from Ficus carica (Subbarao and Michailides, 1993).

"' Note that the name F. subglutinans MP-E is incorrectly applied to F. sacchari MP-B by Nelson et al. (1983). F. sacchari
MP-B has priority over the later synonym F. neoceras.
"One species within the African clade, three in the Asian clade, and four in the American clade will be described separately.
u Received misidentified as F. lateritium from Ipomoea batatas (Nelson et al., 1995; Clark et al., 1995).

rThe holotype of F. babinda DAR 70287 (Summerell et al., 1995) is discordant with the protologue. Our molecular and
morphological data indicate the type is phylogenetically distinct from authentic cultures of F. babinda (NRRL 25539, 25540).

ported in the present study further indicate that sec-
tion Dlaminia is polyphyletic because F. beomiforme is
not a member of this clade. Although genetically dis-
tinct biological species called mating populations
(MPs) A through G have been identified within the
G. Jujikuroi complex (Leslie, 1995), a biological spe-
cies classification (BSC) has had little impact on the
taxonomy of Fusarium. Fusarium binomials are used
throughout this paper because Gibberella teleo-
morphs are known for only nine of the 45 species
included in the present study and because binomials
have not been proposed for most of the Gibberella
teleomorphs. The phylogenetic species concept
(PSC; Nixon and Wheeler, 1990) advocated in
O'Donnell and Cigelnik (1997) demonstrated a one-
to-one correlation between the PSC and BSC which
indicates that both concepts represent fundamental
taxonomic units. However, resu,lts obtained by
O'Donnell and Cigelnik (1997), extended to 45 spe-
cies in the present study, provide strong support for
the view that the PSC offers the best means for de-
scribing the phyletic diversity and evolutionary rela-
tionships within Fusarium.
In prior molecular systematic studies, partial nucle-
ar 28S rDNA (Guadet et al., 1989; Peterson and La-
grieco, 1991) and ribosomal internal transcribed
spacer (ITS) restriction length fragment length poly-
morphism (RFLP) and sequence data (Waalwijk et
al., 1996a, b) were used to infer phylogenetic rela-
tionships within Fusarium; however, the extent of
RFLP and sequence variation was insufficient to dis-
tinguish biological species within the G. Jujikuroi
complex. Randomly amplified polymorphic data
(RAPD; Voigt et al., 1995; Amoah et al., 1996) and
isozyme variation (Huss et al., 1996) distinguishes bi-
ological species within this complex, but these data
468 MYCOLOGIA
are too homoplastic (i.e., similarities due to conver-
gence, parallelism, and reversal rather than from evo-
lution by common descent) to infer phylogenetic re-
lationships (O'Donnell and Cigelnik, 1997).
Published molecular phylogenies have demonstrat-
ed the utility of sequences from the nuclear gene for
~-tubulin (Tsai et al., 1994; Schardl et al., 1994), and
the mitochondrial small subunit (mtSSU) rDNA
(LoBuglio et al., 1993; Hibbett and Donoghue, 1995)
at the interspecific level in fungi. A highly resolved
phylogeny was recently inferred for 17 species within
the G. Jujikuroi complex and its putative sister-group,
F. oxysporum Schlecht., from DNA sequence data
from multiple unlinked loci, including the mtSSU
rDNA, 5' portion of the nuclear 28S rDNA, and ~­
tubulin gene exons and introns (O'Donnell and Cig-
elnik, 1997). Surprisingly, O'Donnell and Cigelnik
( 1997) demonstrated that every strain of the Fusar-
ium species tested possesses two highly divergent
ITS2 sequences that exhibit a homoplastic pattern of
evolution when mapped onto the species lineages in-
ferred from the combined nuclear 28S rDNA, mtSSU
rDNA and ~-tubulin gene sequence data. The avail-
able data suggest that the ITS2 types were combined
either by an ancient interspecific hybridization (xen-
ologous origin) or gene duplication (paralogous or-
igin) that predates the evolutionary radiation of the
G. Jujikuroi complex. In that study, two divergent
nonorthologous (i.e., homologs that did not arise via
speciation), intragenomic ITS2 types were shown to
exhibit a long persistence time, having escaped from
concerted evolution across many speciation events.
Although rDNA multigene families are best known
for the high degree of intraspecific homogeneity as
a result of evolving together by concerted evolution
(Zimmer et al., 1980), the remarkable and unex-
pected discovery of highly divergent nonorthologous
ITS2 types appears to counter the concerted evolu-
tion dogma. In addition, polymorphisms within the
intergenic spacer (IGS) rDNA of F. oxysporum also
indicate that this region of the nuclear rDNA has es-
caped concerted evolution (Appel and Gordon,
1996).
The goal of the present research is to use DNA
sequence data from multiple loci on a much-expand-
ed dataset (Appendix I), including more taxa and
characters, to further assess the phylogenetic rela-
tionship of the Gibberella fujikuroi and Fusarium ox-
ysporum complexes (O'Donnell and Cigelnik, 1995,
1997), to infer phylogenetic relationships within the
G. Jujikuroi complex in order to critically evaluate
species-level systematics within this agronomically-im-
portant monophyletic lineage, to formulate a biogeo-
graphic hypothesis to investigate the patterns of spe-
ciation and evolutionary origins of these plant patho-
gens, and to investigate the evolution of ITS2
polymorphisms further in the context of a robust mo-
lecular phylogeny. The "gene tree/species tree"
problem illustrated by the ITS2 polymorphisms is
particularly significant because the ITS region has
been used extensively in species-level molecular sys-
tematic studies on a wide range of fungi, plants, and
animals (Tsai et al., 1994; Waalwijk et al., 1996b; Bald-
win et al., 1995; Wendel et al., 1995a; Vogler and
DeSalle, 1994).
MATERIALS AND METHODS
Material studied.-All strains listed in Appendix I are
stored cryogenically at -175 C or by lyophilization
in the ARS Culture Collection (NRRL), NCAUR, Pe-
oria, Illinois. The ingroup taxa were chosen to rep-
resent the complete range of taxonomic and phylo-
genetic variation within the G. Jujikuroi complex. All
mating experiments were conducted as described in
Klittich and Leslie ( 1992).
DNA extraction.-Mycelium for DNA extraction was
grown in yeast-malt broth (0.3% yeast extract, 0.3%
malt extract, 0.5% peptone, 2% dextrose), harvested
and lyophilized (O'Donnell, 1992). DNA was extract-
ed using a modification of the SDS mini prep method
of Raeder and Broda ( 1985) described in O'Donnell
( 1993). This phenol-based protocol was subsequently
replaced with a CTAB (hexadecyltrimethylammon-
ium bromide; Sigma Chemical Co., St. Louis) mini-
prep (Gardes and Bruns, 1993) modified slightly. Ly-
ophilized mycelium (-50 mg) was pulverized in a
1.5-ml microfuge tube with a pipet tip, resuspended
in 600-800 JJ.L of a CTAB extraction buffer ( 100 mM
Tris-Cl pH 8.4, 1.4 M NaCl, 25 mM EDTA pH 8.0,
2% CTAB) and incubated at 65 C for 30-60 min.
Mter the extraction step, an equal volume of chlo-
roform was added to each tube, vortexed briefly, and
then spun for 10 min at 12 300 g in a microfuge
(Savant, Holbrook, New York). The upper phase was
transferred to a 1.5-ml microfuge tube where the
DNA was precipitated by the addition of 600 JJ.L of
-20 C isopropanol. Mter the DNA was pelleted at 12
300 g for 5 min, the supernatant was discarded and
the DNA pellet was gently washed with 70% ethanol
and resuspended in 100 JJ.L TE buffer ( 10 mM Tris-
Cl pH 8.0, 1 mM EDTA pH 8.0) by heating in a 65
C block for about 30 min. Once the DNA pellet was
completely dissolved, 4 JJ.L of genomic DNA was add-
ed to 1 mL of either double-distilled H~O or TE/10
(10 mM Tris-Cl pH 8.0, 0.1 mM EDTA pH 8.0) and
used as a template for amplification by the polymer-
ase chain reaction (PCR).
 O'Do:-.:XELL ET AL.: F'USARIL'M MOLECCL\R PH'rLOGE;"\\'
PCR and DNA sequencing.-Conditions for PCR have
been described (O'Donnell and Cigelnik, 1997). To
obtain readable sequence data of the minor ITS2 and
[3-tubulin gene from a few species, PCR products
were cloned with the Prime PCR Cloner Kit (5' ~
3', Inc.; Boulder, Colorado). A quick PCR mini prep
(J. W. Taylor, pers. comm.) was used to amplify the
cloned insert out of the vector with the external PCR
primer pair. A pipet tip was touched to a recombi-
nant bacterial colony and the tip was immersed brief-
ly in a PCR tube containing the complete PCR mix-
ture prior to amplification via PCR. PCR fragments
were sequenced as described below.
Locations of the nuclear ribosomal DNA PCR and
sequencing primers are indicated in FIG. 2; maps
showing locations of the [3-tubulin gene and mtSSU
rDNA primers are presented in O'Donnell and Cig-
elnik (1997). The nuclear ribosomal DNA internal
transcribed spacer (ITS) region and 5' end of the
28S rDNA gene spanning domains D1 and D2 were
amplified with the ITS5 and NL4 primer pair (White
et al., 1990; O'Donnell, 1993), [3-tubulin gene with
Tl and T22 (O'Donnell and Cigelnik, 1997), and
mtSSU rDNA with MS1 and MS2 (White et al., 1990)
in a Perkin Elmer 9600 thermal cycler using the fas-
test ramp times as follows: 35 to 40 cycles of 30 s at
94 C, 30 s at 52 C, and 90 s at 72 C, followed by a 4
C soak. The ITS5 X NL4 primer pair amplify the
major ITS2 type from each species. Multiple strains
of every species tested contain a second, minor ITS2
type recovered with ITS2 type I (IF) or type II-specific
(IIF) PCR primers paired with NL4 (FIGS. 3, 4). Type-
specific reverse primers nested in the ITS2 (IR 5'-
GCCAGTCCCAACACCAAGCTG; and IIR 5'-CGA-
TCCCCAACACCAAACCCG) were paired with the
forward primer ITS5 in separate PCR experiments to
determine whether polymorphisms were present
within the ITS1 region contiguous with the minor
type I and type II ITS2 (O'Donnell and Cigelnik,
1997). PCR cycling conditions with the type-specific
primers were the same as above except that the an-
nealing temperature was elevated to 64 C. Following
PCR, amplified DNA was purified with GeneClean II
and both strands were sequenced with the Perkin-
Elmer Applied Biosystems (Foster City, California)
Taq DyeDeoxy Terminator cycle sequencing kit with
AmpliTaq DNA polymerase FS in a Perkin Elmer
9600 thermal cycler programmed with the fastest
ramp times as follows: 25 cycles of 15 s at 96 C and
4 min at 55 C, followed by a 4 C soak. Twelve se-
quencing primers were used to sequence the nuclear
rDNA (White et al., 1990; O'Donnell, 1996), ten for
the [3-tubulin gene (O'Donnell and Cigelnik, 1997),
and four for the mtSSU rDNA (O'Donnell, 1996).
Sequencing reaction mixtures were purified by gel
469
filtration through 2 ml spin columns (5' ~ 3', Inc.;
Boulder, Colorado) containing super-fine Sephadex
G-50 (Pharmacia; Piscataway, New Jersey) equilibrat-
ed in double-distilled H~O. Sequencing reactions
were run on an Applied Biosystems 373A DNA se-
quencer in a 6% gel mix (BioRad; Richmond, Cali-
fornia) in 1 X TBE buffer (22 mM Na2 EDTA, 0.89 M
tris base, and 0.89 M boric acid).
Phylogenetic analysis.-DNA sequences were aligned
visually with the QEdit Version 2.15 DOS text editor
software program (SemWare; Marietta, Georgia). Se-
quences of the 45 exemplars have been deposited in
GenBank under the following accession numbers:
U34413-U34421, U34423-U34428, U34430-U34435,
U34438-U34447, U34449-U34454, U34456-U34461,
U34468-U344 76, U344 78-034483, U34485-U34490,
U34497-U34505, U34507-U34512, U34514-U34519,
U34526-U34534, U34536-U34541, U34543-U34548,
U34555-U34563, U34565-U34570, U34572-U34577,
and U61540-U61695. Sequence alignments are avail-
able upon request from the senior author. Phyloge-
netic relationships were inferred from the aligned se-
quences for each dataset with PAUP version 3.1.1
(Swofford, 1993) and MacClade Version 3.01 (Mad-
dison and Maddison, 1992). Alignment gaps were
treated as missing because few were phylogenetically
informative. The heuristic search option with 1000
random addition sequences was used to infer maxi-
mum parsimony trees. Clade stability was assessed by
1000 bootstrap replications (Hillis and Bull, 1993)
and by decay indices (Bremer, 1988; Donoghue et al.,
1992) calculated from PAUP tree files containing
32 000 trees up to 10 steps longer than the most par-
simonious trees (MPT). Other measures, including
maximum sequence divergence, tree length, and
consistency and retention indices (CI and Rl), were
calculated with PAUP 3.1.1 (Swofford, 1993). The
Kishino and Hasegawa ( 1989) test was used to com-
pare alternative constrained and unconstrained to-
pologies using the DNAML program in PHYLIP
3.55c (Felsenstein, 1993). Base composition and ap-
proximate transition/transversion ratios were derived
with Mac Clade from PAUP tree files consisting of the
equally most-parsimonious trees. MacClade (Maddi-
son and Maddison, 1992) was used to map biogeo-
graphic origin onto a strict consensus cladogram of
the 78 most-parsimonious trees for the G. Jujikuroi
complex as in Hibbett et al. (1995). For this analysis,
species origin was coded as Mrican (AF), Asian (AS),
American (AM), Australian (AU), or equivocal (?).
Geographic origins of 12 species, including several
that are widespread, were coded as equivocal follow-
ing the recommendation of Kluge (1988). Origins of
nine of the 12 species coded as equivocal were re-
470 MYCOLOGIA
solved by MacClade. To examine evolution of the ma-
jor ITS2 type, we used MacClade to optimize this
character on the consensus cladogram of the 84
most-parsimonious trees obtained for the entire da-
taset.
A modification of Nixon and Wheeler's (1990)
phylogenetic species concept (PSC) was adopted in
order to extend the PSC to all terminal taxa within
the study. Species are defined as exclusive popula-
tions or lineages which are diagnosable by a unique
combination of fixed apomorphies. This definition
attempts to represent a synthesis of available infor-
mation from molecular phylogenetics, morphology,
and mating behavior.
RESULTS
Alignment.-The 13-tubulin gene accounts for the
greatest number of substitutions within the com-
bined dataset (FIG. 1A; 72.5%), followed by the mi-
tochondrial small subunit (mtSSU) rDNA (19.5%),
and 5' portion of the nuclear 28S rDNA (8%). A
similar pattern was observed among these loci when
the analysis was restricted to the G. fujikuroi complex
(FIG. 1C, TABLE 1): 13-tubulin gene (75.8%), mtSSU
rDNA (19.3%), and the 5' portion of the nuclear 28S
rDNA (4.9%). The 13-tubulin gene copy we se-
quenced from Fusarium is orthologous with tub2 of
F. verticillioides (synonym = F. moniliforme Sheldon;
Yan and Dickman, 1996) and Epichloii typhina (Pers.)
Tul. (Byrd et al., 1990), and benA of Aspergillus ni-
dulans (Eidam) Wint. (May et al., 1987). [3-tubulin
gene introns were over twice as informative as exons,
and substitutions within exons were strongly biased
towards transitions in the third codon position (FIG.
1C). Of the 203 variable sites within exons, 11 (5.4%)
were in the first position, 1 (0.5%) in the second,
and 191 (94.1 %) in the third position. Intron posi-
tions within the open reading frame are conserved
in Fusarium and Epichloii (Byrd et al., 1990): 5.0, 13.0,
54.0, and 317.2 (FIG. 1A). Virtually all PCR-amplified
DNA fragments were sequenced directly. Heteroge-
nous PCR pools of [3-tubulin gene amplified from F.
redolensWollenw. (Wollenweber, 1913) and the minor
ITS2 from F. annulatum were cloned to obtain read-
able sequence data.
Boundaries of the ITS1, 5.8S rDNA gene, and ITS2
were determined by comparison with published se-
quences of the ITS region (O'Donnell, 1992). The
ITS region varies in length from 455 bp to 474 bp,
including 158 bp of the 5.8S rDNA gene. The length
of the ITS1 ranges from 146 bp to 149 bp. The major
type II ITS2 is longer (161-167 bp) and has a higher
GC% (57%) compared with the major type I ITS2
(151-153 bp; GC% =52%). Sequence alignment re-
mtSSU rONA
A
B so
40
~
Q) 30
Ci5
20
10
c 25
20
~ 15
~
(J) 10
5
250 500 750 1000 1250 1500 1750 2000 2250 2500
Site
FIG. 1. A. Map of the three unlinked loci sequenced that
comprise the combined dataset (mtSSU rDNA = 770 bp,
nuclear 28S rDNA = 535 bp, ~-tubulin gene = 1300 bp).
Introns numbered 1-4 interrupt the coding region in the
~-tubulin gene. Distribution of the average number of steps
B. for the entire dataset (45 species) and C. for the G. Ju-
jikuroi complex (36 species) were calculated with MacClade
from files composed of the equally most-parsimonious trees
obtained with PAUP, using a 25 bp interval.
quired five independent single base pair insertion/
deletion mutations in the ITS1 and all but one of
these occurred in outgroups to the G. fujikuroi com-
plex. Alignment of the major type I and type II ITS2
sequences required 10 independent insertion/ dele-
tion mutations ( =indels) and 8 of these involved spe-
cies within the G. fujikuroi complex. Most indels were
1 or 3 bp but the longest was 6 bp in the type I ITS2.
The ITS2 sequences were analyzed without a contig-
uous stretch of 19 ambiguously aligned nucleotides.
The ambiguous region includes 12 nucleotides at the
5' end of the type I ITS2-specific primer IF (FIG. 3)
and 7 bp 5' to this primer not shown in FIG. 3 (see
O'Donnell and Cigelnik, 1997).
 O'DON:\ELL ET AL.: FuSARIUM MOLECLTLAR PHYLOGENY
Parsimony analysis.-Gene trees inferred from se-
quences of the ITS1/5.8S rDNA and 5' portion of
the nuclear 28S rDNA are largely unresolved (FIG.
2A, C) except for a clade in the 28S rDNA tree con-
sisting of F. oxysporum and related species (93% boot-
strap). The most striking feature of the ITS2 gene
tree is that the sequences form two unresolved clus-
ters designated type I and type II (Waalwijk et al.,
1996b) that show maximum sequence divergences of
19.4%, excluding the 19 bp ambiguous segment (FIG.
2B). The heuristic search option with 1000 random
addition sequences found 442 trees 58 steps in length
(CI = 0.76, RI = 0.96), excluding the ambiguously
aligned 19 bp region. Type I and type II ITS2-specific
forward PCR primers paired with the reverse primer
NL4 (FIGS. 3, 4A) reported in O'Donnell and Cigel-
nik ( 1997) were used to amplify a second, minor
ITS2 type from one or more strain of all 45 species
comprising the complete dataset (FIG. 4B). As was
previously demonstrated for a subset of these taxa
(O'Donnell and Cigelnik, 1997), results obtained on
multiple isolates indicate that the major and minor
ITS2 type is fixed within a species. All species includ-
ed in this study that were tested possess both type I
and type II sequences either as a major or minor
ITS2 type (FIGS. 3, 4). Type I and type II ITS2 se-
quences represent two orthologous sets that appear
to be xenologous or paralogous in origin. Distribu-
tion of the major ITS2 type among species is slightly
biased towards a type I sequence: 27 of 45 species for
the entire dataset (60%), 20 of 36 species for the G.
Jujikuroi complex (55.6%). Gene tree consensus of
the type I and type II ITS2 data are unresolved and
uninformative for parsimony. The type II ITS2 from
F. neoceras Wollenw. & Reinking is the most divergent
sequence of the minor ITS2 types observed (FIG. 3).
It exhibits microheterogeneity that appears to in-
clude type I ITS2 point mutations, suggesting recom-
bination between the two ITS2 types (Wendel et al.,
1995b), but it also includes substitutions that cannot
be unequivocally assigned to either a type I or type
II sequence (FIG. 3). PCR and sequence analysis, us-
ing the ITS2 type-specific reverse PCR primers paired
with the forward primer ITS5, indicated that poly-
morphisms were absent within the ITS1 region con-
tiguous with the minor ITS2 types.
Two additional loci were analyzed, the ~-tubulin
gene exons and introns (FIG. 5) and the mitochon-
drial small subunit (mtSSU) rDNA (FIG. 6). Gene
trees from both loci found by a heuristic search are
topologically concordant, especially with respect to
the G. Jujikuroi complex. Parsimony analysis of the ~­
tubulin sequences produced 1604 most-parsimonious
trees (744 steps, CI = 0.68, RI = 0.78) compared with
471
1370 trees (226 steps, CI = 0.70, RI = 0.80) for the
mtSSU rDNA data.
Sequences of the ~-tubulin gene are well-suited for
recently diverged groups such as the G. Jujikuroi com-
plex. Homoplasy within exons (CI = 0.75) and in-
trans (CI = 0.81) is comparable, but the introns are
under more relaxed functional constraints as evi-
denced by a much higher AT base composition (54%
compared with 44% for exons) and the presence of
indels. The transition/transversion ratio was very
high for exons (7.34 for the G. Jujikuroi complex).
Parsimony trees inferred from ~-tubulin gene exons
and introns, however, were concordant (data not
shown). ~-tubulin gene sequences possess 3.5 times
more phylogenetic signal than the mtSSU rDNA and
this is reflected in a ~-tubulin gene tree with more
nodes with higher bootstrap intervals and decay in-
dices (=d) (FIGS. 5, 6). Monophyly of a lineage com-
prising the G. Jujikuroi and F. oxysporum complexes,
for example, is strongly supported in the ~-tubulin
tree (99% bootstrap, d = 10) (FIG. 5) but this clade
received less than 50% support in the mtSSU rDNA
tree (FIG. 6). Similarly, monophyly of the G. Jujikuroi
complex (87% bootstrap, d = 4), an Mrican-Asian
clade (83%, d = 3), and the Mrican (81% bootstrap,
d = 2), Asian ( 100% bootstrap, d = 10), and Amer-
ican (100% bootstrap, d 2: 10) clades were supported
by bootstrap analyses of the ~-tubulin gene dataset;
however, decay indices for the Mrican-Asian clade
and Mrican clade were weak. These analyses place
the American clade as a sister-group of the Mrican-
Asian clade. Within the Mrican clade of the ~-tubulin
gene tree, F. dlaminii occupies a basal position to the
remaining 15 species which form a strongly support-
ed monophyletic lineage (97% bootstrap, d = 5).
The American clade was the only strongly supported
lineage in the mtSSU gene tree (FIG. 6; 89% boot-
strap, d = 7).
Parsimony analysis of the combined nuclear 28S
rDNA, mtSSU rDNA, and ~-tubulin gene datasets for
the total study (heuristic search option with 1000 ran-
dom addition sequences) yielded 84 most-parsimo-
nious trees (FIG. 7; length = 1067 steps, CI = 0.66,
RI = 0. 77). The tree shown in FIG. 7 is concordant
in most details with the other 83 equally most-parsi-
monious trees. A neighbor-joining (Nj) tree gener-
ated with the Jukes-Cantor distance method for the
combined dataset (data not shown) is topologically
concordant with the maximum parsimony phylogeny
shown in FH:. 7.
Nine species basal to the G. Jujikuroi complex con-
tribute over half of the tree length (602 steps). When
the analysis was restricted to the G. Jujikuroi complex,
78 most-parsimonious trees (length = 465 steps, CI
= 0. 74, RI = 0.88) were found. Bootstrap intervals
 ~
-...)
Nl

15 13 NLl NL3

}
- I- ~ 'IITSl ~::..' IITS2 I- '~
- -~ f
NL4
--
,_L ;; ~,__ ~ \ F. vel1icillioides MP-A
F. pseudonygamai F. pseudonygamai F. pseudonygamai
F. pseudoanthophl/um F. pseudoantnophilum - F. napiforme
F. brevicatenulatum F. napiforme F. denticulatum
F. begoniae F. ramigenum F.lactis
IT51 +5.85 rONA F. den#culatum IT52 F. den(iculatum 285 rONA
8 ss I ~ f,",:~':er;:";;:fa~";'
337bp ~ "P.·c~;J~rum 148 bp F.~'1:;;:' F. ramlgenum 535 bp
40steps F. sp. 25346 58 steps F. neoceras - F. pseudocirc/natum 59 steps
F.udum
Cl =0.90 F. ~k'=genum Cl =0.76 F/.'/::Jl},~7X:..MP-E Type F. phyllophl/um C~=0.78
Rl =0.89 F. laclis Rl = 0 96 F. succisae F.sp. 25221
F. udum • F. snlhophilum I F. nygamai MP-G Rl =0.86
- F. sacchari MP-B F. begoroae F. acutatum
F. neoceras F. buTbicola F. dlaminii
F. sp. 25221 F. circinatum F. sacchari MP-B
F. thapsinum MP-F 5 F. sp. 25346 F. neoceras
F. pseudocircinatum ~ F. pseudocircinatum F. fujikuroi MP-C 4
~ - Wi!.n amai MP-G F. sp. 25195 F. proliferatum MP-0 I steps I
F. ph lophilum F. sp. 25204 F. annulatum
F. lruroiMP-C F.~- 25184 • F. globosum a:::
F. proliferatum MP-0 F. oxysporum • F.sp. 25226
F. snnulatum F. inflexum • F. concentricum l4
- F. globosum F. nisikadoi • F.sp. 25303
F.sp.25309 2
~ ~~Jum F. sp.
2sao'f concolor • F. subglu#nans MP-E 0
F. sp. 25309 F. brevicatenulatum F. bactridioides ~
F. subglutinans F. sacchari MP-B F. succisae
F. anthophilum >
F. s.:C/;:,;tridioides F.~~M:~~u~
F. anlllophilum F. lhapsinum MP-F ~~~~'1.:
90 F. bulbicola F. nygemai MP-G F. circinatum
F. gutfiforme F. tidum F. gulliforme
F. sp. 25195
F. sp. 25195 F. lujikuroiMP-C F.sp. 25204
F. sp. 25204 F. proliferatum MP-0
F. sp. 25807 F. globosum F.sp. 22903 •
F. acutatum F. sp. 25226 Type - F. redo/ens •
F. dlaminii F. acutatum F. nisikadoi •
n F. concolor •
F. "P,"~~~~ ~ • F./~:::.~/~tum F. beomiforme •
F. nisikadoi • F. concentricum F. oxysporum •
F. inflexum •
: 'r.1r:::.: F. tp·~s~~o3 F.sp. 25184 •
F. redo/enS • F. sp. 22903 • F. sp. 25807
F. beomiforme • F. redolens • F.sp. 25346
F. concolor • F. beomiforme. F. thapsinum MP-F
sp. 25483 •
1-------- F.(oU1group) F. sp. 25483 • F.sp. 25483.
(oU1group) (outgroup)

A B c
FIG. 2. Map of the nuclear ITS rDNA region and 5' portion of the 28S rONA together with maximum parsimony gene trees inferred by heuristic searches on these sequences. Labeled
arrows indicate primers used for PCR and sequencing. I = ITS, NL = 28S rONA. Taxa followed by a solid dot are outgroups to the G. Jujikuroi complex. A. One of 40 most-parsimonious
trees for the nuclear ITS1/5.8S rONA sequences. The 5.8S rONA gene is highly conserved and contributes only two of the 40 steps. B. One of 442 most-parsimonious trees for the rDNA
ITS2 sequences (58 steps, CI = 0.76, RI = 0.96), excluding an ambiguously aligned 19 bp region. Species form two divergent clusters that correspond to the major type I and type II ITS2
sequences. The distance hetween the clusters in the ITS2 tree accounts for a tree that is much longer than the ITSI/5.8S tree (18 steps longer, excluding the ambiguously aligned region).
C. One of 59 most-parsimonious trees for the 28S rONA sequences. Bootstrap intervals above 50% are indicated. MP = mating population or biological species of the G. jujikuroi complex.
Teleomorphs are known for J•: udum and /•: rircinatum but they have not been added to the alphabetic MP series.
 O'DONNELL ET AI..: FuSARIUM MOLECUlAR PHYLOGENY 473

u
F. fujikurol (Major)
F. verllcl/1/o/de$ (minor)
[ F. sacchart (minor)
F. neoceras (minor)
F. fuillc!"'!'! (!"inor)
GGtAA • • GCC
. . .. . - - .. .
..... - - .. .
TC • .
-
GGCCCCGAAA TCT~GTGGCG GTCTCGCTGC
..........

r·.;g..g p · ·. · :·J!I.rG: r::::: :: :i::::: r ::: :c: rc::

.....--... .. .. .. . .. .
.. ...... ..
TT. . . • .. . .. .A .. TC. •
AGCTTCCATT GCGTAGTAGT AAAACCCTCG CAACTGGTAC GCGGCGCGGC

......... A
::::::::A: CT:::::::: TT:::::: :G:: AAA:::::::
....... A T.. T.... ..
I F. vertiCillioldes (Major) I A· ~ T. .. .. .. . A.. TC. • ......... A TT ....... AT .. T ..... .
[ F. sacchart (Major) A· .. .. T .... • .. . . . T .... . .. . A.. TC. • ......... A TT ....... A T .. T .... ..

II
F. neoceras (Major)

F. sacchart (minor)
F. neoceras (minor)
CA • .. TC .. G TT .... • .. . . ·.ill,. T.... . .. . A.. TC. •

[~ =~,minor) C~A~~~~ TT~ ~AC~CCCAAC

.. .. .. .. ..
.. I.. .. .. .
.. ...... ..
.. ...... ..
TTCTGAAT

.. .. .. . G ..
......... A

-
TT ....... A T .. T .... ..

TGACCTCGGA TCAGGTAGGA ATACCCGCTG AACTTA~CA TATCAATAAG CGGAGGAI

F. fuj/kurol (minor)
1 F. verllc/11/oldes (Major)
.. C .. .. .. .
. . C. . . . . . .
.. .... - .. .
......•...
::28S: :rONA::
[ F. sacchart (Major) .. c .. .. .. . .. .. .. . . .
F. neoceras (Major) .. C .. .. .. . .. .... - ...

FIG. 3. Design of ITS2 type-specific forward PCR primers from alignment of nonorthologous type I and type II ITS2
sequences. Type I and type II ITS2 sequences are labeled I and II, respectively. Closed boxes indicate type I and type II ITS2-
specific forward (right arrow) PCR primers and the reverse PCR primer ITS4 (left arrow, sequence shown is the reverse
complement of ITS4) near the 5' end of the nuclear 28S rDNA. Matches (.) and gaps (-) are shown below the major type
II ITS2 sequence of the reference strain, F. Jujikuroi. Closed, shaded boxes indicate two nucleotide positions with putative
type I point mutations in the minor type II ITS2 sequence of F. neoceras and a single putative type II mutation in the major
type I ITS2 of F. neoceras. Sixteen positions in the minor type II ITS2 sequence of F. neoceras cannot assigned to either a
type I or type II ITS2.

and decay indices were measured to explore relative
levels of character support in the combined dataset
(FIG. 7). In general, bootstrap intervals and decay
indices (also known as Bremer Support; Davis, 1995)
were concordant. Support for many terminal branch-
es was weak as measured by bootstrapping and the
decay index. Overall, these values are generally com-
parable to those observed in the ~-tubulin gene tree
(FIG. 5); however, several nodes within the African
clade received higher measures of clade stability in
the combined analysis as did support for an African-
Asian sister-group (95% bootstrap, d = 5). Of the
three major clades identified within the G. Jujikuroi
complex, the African clade is the most phylogeneti-
cally diverse and speciose ( 16 species), followed by
the American (12 species) and Asian (8 species)
clades. Results obtained on multiple isolates (Appen-
dix I) demonstrated that each of the nine biological
species grouped as a phylogenetically distinct termi-
nal cluster with little intraspecific variation (data not
shown).
The high level of topological concordance among
the 84 most-parsimonious trees is evident from the
relationships retained in the strict consensus dado-
gram inferred from the combined nuclear 28S rDNA,
mtSSU rDNA, and ~-tubulin sequence data (FIG. 8),
upon which are mapped the two major ITS2 types
and chlamydospore production. The evolutionary
pattern exhibited by the major ITS2 type is homo-
plastic when mapped onto the species lineages (FIG.
8). The most parsimonious interpretation of these
results is that the most recent common ancestor of
the G. fujikuroi complex possessed a type I sequence
as the major ITS2 type. The major ITS2 type has
switched between a type I and type II sequence at
least three times during the evolution of this complex
(FIG. 8), but neither type has been fixed within any
of the 45 species included in this study. The major
ITS2 types are nearly evenly divided between type I
(5 species) and type II (4 species) sequences in spe-
cies basal to the G. fujikuroi complex. Species in all
three clades of the G. fujikuroi complex possess a
type I sequence as the major ITS2, and within the
American clade, type I is the only major type ob-
served. Species with a type II sequence as the major
ITS2 are restricted to a subclade within the Asian
clade and the basal half of the African clade (FIG. 8).
Chlamydospore production is plesiomorphic for the
fusaria included in this study. The most parsimonious
interpretation of the phylogenetic evidence is that
chlamydospore production has been lost multiple
times within the G. Jujikuroi complex. Seven of the
eight chlamydospore-forming species within the com-
plex are members of the African clade. The only non-
African species reported to produce chlamydospores
is F. bactridioides within the American clade, but this
needs to be verified because the only strain of this
species in culture (NRRL 20476 = BBA 4748 EXHO-
LOTYPE; Wollenweber, 1934) does not produce
chlamydospores.
Biogeography.-Geographic origins of species within
the G. Jujikuroi complex were mapped onto the strict
consensus tree (FIG. 9) from which were pruned two
synonymous species, F. annulatum (synonym= F. pro-
liferatum MP-D) and F. neoceras (synonym = F. sac-
chari MP-B). The ancestral area of the G. fujikuroi
complex is unknown but the most parsimonious in-
terpretation of the phylogenetic and biogeographic
patterns are consistent with a vicariant hypothesis
474 MYCOLOGIA

IF--+
A

14

IIF--+
Type
I

97

Type
II

ITS2 Type I &II

121 bp
4 85 steps
steps Cl =0.76
Rl =0.97

FIG. 4. A. ITS2 type-specific forward primers (IF= type I, IIF = type II) and the reverse primer NL4 were used as a PCR
pair to amplify and sequence the minor ITS2 type from every species in the dataset. 14 = ITS4. B. ITS2 gene tree inferred
from both major and minor ITS2 type sequences from every species in the dataset. Shaded names indicate the major ITS2
type for each species. The most divergent sequence is the minor type II ITS2 of F. neoceras, a later synonym of F. sacchari
MP-B.

based on the formation of natural barriers associated ican and Mrican clades, and 2 in the Asian clade. The
with the fragmentation of the ancient super-conti- origins of 9 of these species were resolved by Mac-
nent Gondwana (FIG. 9). Geographic origins of 12 Clade but the origins of 3 species in the American
species were coded as equivocal, 5 each in the Amer- clade remained equivocal. The only species coded as
 O'Do:-.NELL ET AL.: FuSARIUM MOLECL1L\R PH\1.0GENY 475

F. verticillioides MP-A 0'·'"W'1 ,.,•.,.,.,.•.••««.•.,.,.,.,.,.,.,.,.,.,.,.,.,.,,,.,.,,,.,._,.,_"ll

F. pseudonygamai
F. pseudoanthophilum
F. brevicatenulatum
F. napiforme
~-Tubulin F. ramigenum
F. lactis African
1283 bp F. thapsinum MP-F
Clade
F. pseudocircinatum
744 steps F. nygamai MP-G
F. denticulatum G)
97
Cl 0.68 IsslL--- F. sp. 25221
F. phyllophilum
6=
0"'
Rl 0.78 F. udum CD
F. acutatum ~
F. dlaminii o,M,.,.,.,.•.,.,,.»>..·<.•'''''•''''"''"'"M<«m,·»-»»«~,.,.J ::::::
Q)
F. sacchari MP-8
F. neoceras ,,.,,.,...=···~······"
F. fujikuroi MP-C
2'
"':::·
99
o F. proliferatum MP-0 Asian ~
c:
2
F. annulatum Clade a
-·
2
F. g/obosum
F. sp. 25226 (')
84
F. concentricum 0
87 2 F. sp. 25303 3
1 F. sp. 25309 .,.,.,,.,.,~•.••,,. ,,,««.,,,,,,,.,.,.,
""0
F. subglutinans MP-E CD
F. bactridioides X
F. succisae
F. anthophi/um
1
F. bulbicola American
F. sp. 25807
F. circinatum
Clade
100 F. begoniae
>10
F. sp. 25346
20 F. guttiforme
steps F. sp. 25195
F. sp. 2290t.~.~.;,,,~.~:? 4 .,·:·"··;::::;,,:,::::;:;;;;;,:::::,;;:
11-.---- F. nisikadoi
F. oxysporum
F. oxysporum
F. inflexum complex
F. sp. 25184 ·····"'''"'' ..••..,.,...,.,.,.,.,.,.,,,,.,,,.,.,.,. ,.,.,,,.,.,"''""
100
>10 F. redo/ens
F. beomiforme
F. concolor
.___ _ _ _ _ _ _ _ _ _ _ F. sp. 25483
(outgroup)

FIG. 5. One of 1604 most-parsimonious trees inferred from ~-tubulin gene sequences. Monophyly of the G. fujikuroi
complex, its three clades, and an African-Asian sister-group relationship are strongly supported by bootstrapping. The Fu-
sarium oxysporum complex forms a putative sister-group to the G. jitjikuroi complex. Bootstrap replication frequencies above
50% are indicated above internodes, decay indices below internodes. Two subclades are discernible within the Asian clade.
MP = biological species in the G. fujikuroi complex.

Australian, Fusarium sp. DAR 70287 (NRRL 25807),
was mistakenly deposited as the holotype of F. babin-
da (Summerell et al., 1995) because it is discordant
with the protologue. Fusarium sp. DAR 70287, or its
most recent ancestor, is inferred to have evolved with-
in the American clade which suggests that this species
may have been dispersed to Australia from the Neo-
tropics. In separate analyses we used PAUP to con-
strain F. denticulatum and F. verticillioides, two old
world pathogens on neotropical hosts, to the Amer-
ican clade. The constrained trees (data not shown)
were 49 (514 steps) and 55 (520 steps) steps longer
than the 78 most-parsimonious trees (465 steps), re-
spectively, and both monophyly constraint trees were
significantly worse than the most-parsimonious tree
when tested in maximum likelihood (Felsenstein,
1993).
DISCL'SSI0:-.1
Evolution of ITS.- This study reports the results of a
molecular phylogenetic analysis of the Gibberella Ju-
jikuroi complex and related species of Fusarium in-
ferred from DNA sequence data obtained from mul-
476 MYCOLOGIA

F. verticillioides MP-A
F. pseudonygamai
61 F. pseudoanthophilum
r o 2 F. brevicatenulatum
mtSSU rONA " o F. napiforme
F. ramigenum
732 bp F. sp. 25221 African
F. denticulatum
226 steps F. phyllophilum Clade
F. udum
Cl = 0.70 0 F. nygamai MP-G
F. sp. MP-F
Rl = 0.80 F. pseudocircinatum
..I F. lactis
' F. acuforme
..-----,_ F. dlaminii
92 F. sacchari MP-B
3 F. neoceras
F. fujikuroi MP-C
54 F. sp. 25226
2
Asian
F. concentricum
F. proliferatum MP-0 Clade
F. annulatum
F. sp. 25190
F. sp. 25303
0 F. sp. 25309
F. subglutinans MP-E
4 F. bactridioides
F. begoniae
F. guttiforme
F. sp. 25204
10 F. sp. 25195 American
F. circinatum
steps
F. sp. 25346 Clade
F. succisae
F. anthophilum
F. bulbophilum
F. sp. DAR 70287
!-L-F._.sp. 22901
12 F. concolor
.___ _ F. sp. 25184
F. sp. 22903
68 F. oxysporum
8 2 F. inflexum
F. sp. 25179
'----- F. beomiforme
F.sp.25483
(outgroup)

Fie;. 6. One of 1370 most-parsimonious trees inferred from the mtSSU rONA data rooted with sequences from Fusarium
sp. NRRL 25483. The phylogram is topologically concordant with the [3-tubulin gene tree (FIG. 5). Bootstrap replication
frequencies above 50% and decay indices are indicated above and below internodes, respectively. Seven biological species in
the G. fujikuroi complex are indicated ( = MP A-G).

tiple loci. Discordance of the ITS2 gene phylogeny
inferred from the major ITS2 type amplified from
each species and the species phylogeny inferred from
three unlinked loci is due to nonorthologous ITS se-
quences. One of the most interesting results of this
study is the discovery that every species within this
lineage possesses two divergent, xenologous or par-
alogous nuclear rDNA ITS2 types (O'Donnell and
Cigelnik, 1997). The nonorthologous type I and type
II ITS2 sequences appear as a homogeneous PCR
pool using conserved (ITS5 X ITS4; White et al.,
1990) and type-specific PCR primers (O'Donnell and
Cigelnik, 1997). We have termed the ITS2 amplified
with the conserved ITS primers the major type and
assume that it is the most abundant ribosomal repeat
type. Through use of type-specific forward PCR prim-
ers, we were able to demonstrate that species with
type I and type II sequences as the major ITS2 type
 O'DONNELL ET AL.: FuSARIUM MOLECULAR PHYLOGENY 477

F. verticillioides MP-A
F. pseudonygamai
98 F. pseudoanthophilum
6 F. brevicatenulatum
28S + mtSSU + ~-Tubulin 98 F. napiforme
6 F. ramigenum
2550 bp F. denticulatum African
F. pseudocircinatum
1067 steps G)
F. lactis Clade
Cl = 0.66
Rl = 0.77
F. thapsinum MP-F
F. nygamai MP-G
F. sp. 25221
g
CD
F. phyllophilum
F. udum
F. acutatum
a
::::::::
Q)
F. dlaminii
100 F. sacchari MP-B
>10 F. neoceras 2'
.....;:_

~
F. fujikuroi MP-C
F. proliferatum MP-D
Asian
F. annulatum
F. globosum
F. sp. 25226 Clade a
--
F. concentricum 0
100 F. sp. 25303 0
>10 F. sp. 25309 3
F. subglutinans MP-E '0
F. bactridioides CD
F. begoniae
F. guttiforme
><
F. sp. 25204
F. sp. 25195
American
100
>10
F. succisae
F. anthophilum
Clade
25 F. bulbicola
1 steps 1
F. sp. 25807
F. circinatum
F. sp. 25346
.___ _ F. sp. 25184

7
F. oxysporum
F. inflexum
F. oxysporum
F. sp. 22903
....____ F. nisikadoi
complex

F. sp. 25483
(outgroup)

FIG. 7. One of 84 most-parsimonious trees rooted with sequences from Fusarium sp. NRRL 25483 inferred from the
combined 28S rDNA, mtSSU rDNA, and 13-tubulin gene datasets. Bootstrap intervals greater that 50% (above internodes)
and decay indices up to 10 steps (below internodes) are indicated. The F. oxysporum complex forms a putative sister-group
to the G. fujikuroi complex. MP = biological species in the G. fujikuroi complex.

also possess type II and type I sequences, respectively,
as the minor ITS2 type. Polymorphisms within the
ITS1 region adjacent to the major and minor ITS2
types were not detected with type-specific PCR prim-
ers and sequence analysis. The large intertype diver-
gence within the ITS2 region suggests that the types
may have been combined as the result of an ancient
interspecies hybridization or gene duplication that
occurred prior to the evolutionary radiation of the
fusaria included in this study. The evolutionary pat-
tern exhibited by the major ITS2 types within the
species lineages inferred from three unlinked loci is
homoplastic. Gene trees inferred from type I and
type II ITS2 sequences are unresolved as are trees
from the flanking sequences of the nuclear ITS1 and
28S rDNA. Assuming the ITS2 types were combined
by an interspecific hybridization, the xenologous
ITS2 could have become established by gene conver-
sion (Sweetser et al., 1994) followed by repeated cy-
cles of unequal sister chromatid exchange (]inks-
Robertson and Petes, 1993).
The evolutionary pattern exhibited by the major
and minor ITS2 types mimics bidirectional interlocus
concerted evolution in cotton (Wendel et al.,
1995a,b), but differs significantly in that neither type
has been fixed in any of the 45 species included in
this study. Phylogenetic reconstruction indicates the
major ITS2 type has switched between a type I and
type II sequence at least three times during the evo-
lutionary history of the G. fujikuroi complex. Ho-
mology assessment is complicated in groups where
minor potentially nonorthologous rDNA loci have
478 MYCOLOGIA

Major ITS2 Type F. verticil/ioides MP-A

F. pseudonygamai •
==Type I F. pseudoanthophilum •
F. brevicatenulatum
Type II F. napiforme •
F. ramigenum
Equivocal F. denticulatum African
F. thapsinum MP-F Clade
F. pseudocircinatum
F. lactis
F. nygamai MP-G •
F. sp. 25221
F. phyllophilum
F. udum •
F. acutatum •
F. dlaminii •
95 F. sacchari MP-8
F. neoceras
F. fujikuroi MP-C
100 F. proliferatum MP-D
F. annu/atum
Asian
F. globosum Clade
F. sp. 25226
72 F. concentricum (")
100 F. sp. 25303 0
F. sp. 25309 3
F. subglutinans MP-E "2.
F. bactridioides • CD
F. begoniae X
F. guttiforme
F. sp. 25195
78 American
F. sp. 25204
100 F. succisae Clade
F. anthophilum
F. bulbicola
F. sp. 25807
F. circinatum
~!::::::==== F. sp. 25346
F. sp. 25184 •
99
98 F. oxysporum • F. oxysporum
F. inflexum •
99 F. sp. 22903 • complex

~--~~-----------------------------
F. nisikadoi
F. redo/ens •
F. beomiforme •
F. concolor •
F. sp. 25483 •
(outgroup)

FIG. 8. Strict consensus cladogram of the 84 most-parsimonious trees inferred from the combined 28S rDNA, mtSSU
rDNA, and [3-tubulin gene dataset. The major ITS2 type of each species is mapped onto the tree with MacClade. Type I and
type II major ITS2 sequences are represented in species basal to the G. Jujikuroi complex and within the Mrican and Asian
clades. Species that produce chlamydospores are indicated by a solid circle [= •l after taxon names. Bootstrap frequencies
above 50% are indicated.

become magnified into major loci which can com-
pletely replace orthologous loci during speciation
(Dubcovsky and Dvoiak, 1995). The molecular evi-
dence suggests that the major ITS2 type may be un-
der some form of copy number control because it
appears to be fixed within a species. Furthermore,
selection of the minor ITS2 type is apparently strong
and it may provide a buffer against deleterious mu-
tations (Clark, 1994).
In addition to the results reported here, several
studies have shown that rDNA polymorphisms can be
missed by sequencing PCR products directly (Wendel
et al., 1995b; Baldwin et al., 1995). Ribosomal DNA
polymorphisms within the ITS region in the same in-
 O'DONNELL ET AL.: FuSARIUM MOLECUlAR PHYLOGENY 479

F. subglutinans MP-E (Zea+)

F. bactridioides (Pinus)
F. begoniae (Begonia)
F. guttiforme (Ananas)
F. sp. 25195 (wood)
F. sp. 25204 (palm)
F. succisae ( Succisa)
F. anthophilum (Hippeastrum+)
F. sp. 25807 (forest soil+)
F. bulbicola (Nerine+)
F. circinatum (Pinus)
F. sp. 25346 (Ipomoea)
F. dlaminii (Zea soil)
F. acutatum (Triticum+)
F. phy/lophilum (Dracaena+)
F. udum (Cajanus+)
F. sp. 25221 (Zea)
F. nygamai MP-G (Sorghum)
F. thapsinum MP-F (Sorghum)
F. pseudocircinatum (Solanum+)
F. lactis (Ficus)
F. denticulatum (Ipomoea)
F. ramigenum (Ficus)
F. napiforme ( Pennisetum)
F. brevicatenulatum ( Striga)
F. pseudoanthophilum (Zea)
F. pseudonygamai (Pennisetum)
F. verticillioides MP-A (Zea+)
F. sacchari MP-B (Saccharum)
F. fujikuroi MP-C ( Oryza)
F. proliferatum MP-D (Oryza+)

..-
c:::J African F. globosum (Triticum)
Ea. Australian F. sp. 25226 (Mangifera)
Asian F. concentricum (Musa)
American F. sp. 25303 ( Oryza)
rzzm Equivocal F. sp. 25309 (Triticum)
FIG. 9. Biogeographic hypothesis for the G. fujikuroi complex. Geogeographic origins of 24 of the 36 species were coded
as African, Australian, Asian, or American (indicated by pattern-coded box to left of each species name). A box is absent to
the right of the 12 species coded as equivocal and their likely origins as resolved by MacClade are indicated on the branches.
Endemism of the American, African and Asian clades is strongly supported by bootstrapping. The area of endemism of R
sp. DAR 70287, the only species coded as Australian, appears to be America.
480 MYCOLOGIA
dividual have been reported in fungi (O'Donnell and
Cigelnik, 1997; Sanders et al., 1995) plants (reviewed
in Baldwin et al., 1995; Buckler and Holtsford, 1996;
Wendel et al., 1995a, b), beetles (Vogler and De Salle,
1994) and nematodes (Zijlstra et al., 1995). Nonor-
thologous ITS sequences that have been maintained
in plants typically span the entire ITS region (Suh et
al., 1993, Ritland et al., 1993), but in Bubbia (Win-
teraceae) they are restricted to the ITS1 rDNA (Suh
et al., 1993). Although it was possible to sequence
the minor type II ITS2 from F. neoceras directly, we
cloned it because its sequence was so divergent, con-
sisting of a mosaic of nucleotides that suggest that
type I and type II ITS2 sequences may have recom-
bined (see Wendel et al., 1995b) (FIG. 3). ITS2 se-
quences from 9 of the 10 clones were identical to the
one we obtained from sequencing the PCR product
directly but one clone represented an additional mi-
nor ITS2 type. It is unclear whether this minor ITS2
type is part of a rRNA pseudogene (Buckler and
Holtsford, 1996), but if it is, it may be necessary to
sequence clones from a range of species to deter-
mine whether such pseudogenes are wide-spread in
Fusarium. The divergent ITS2 types are unrelated to
the three divergent ITS types reported previously for
Fusarium sambucinum Fuckel sensu lato (O'Donnell,
1992) which correspond to the following morpholog-
ical species described recently by Nirenberg ( 1995):
type A= F. torulosum (Berk. & Curt.) Nirenberg, type
B = F. sambucinum sensu stricto, and type C = F. ve-
nenatum Nirenberg. Phylogenies inferred from four
molecular datasets indicate these species are also phy-
logenetically distinct (O'Donnell 1997; O'Donnell
and Cigelnik, unpubl.).
The molecular basis for concerted evolution of
rDNA genes is unclear as are the mechanisms re-
sponsible for long-term persistence or escape from
concerted evolution. Long-term persistence of rDNA
polymorphisms following hybridization or allopoly-
plodization has been explained by physical con-
straints within the genome such as divergence of se-
quences beyond the point where gene conversion
can occur (Li and Graur, 1991), and the lower effi-
ciency of concerted evolution between rDNA repeats
dispersed on nonhomologous chromosomes (Vogler
and DeSalle, 1994; Schotterer and Tautz, 1994; Co-
penhaver and Pikaard, 1996a, b), especially if their
chromosomal location is not telomeric. Several stud-
ies have demonstrated that dispersed rDNA loci
evolve in concert if they are telomeric (Wendel et al.,
1995a; Arnheim et al., 1980). If the ITS2 types are
not telomeric, they may flank essential single copy
genes whose deletion via unequal sister chromatid
exchange would be lethal (Metzenburg et al., 1985).
Appel and Gordon's (1996) suggestion that polymor-
phisms within the intergenic spacer (IGS) of the nu-
clear rDNA of F. oxysporum may be due to a much
slower rate of concerted evolution within a predom-
inately clonal species could also explain polymor-
phisms within the ITS. Incomplete homogenization
of rDNA repeats in more complex eukaryotes may
reflect their longer generation time and larger rDNA
loci (Copenhaver and Pikaard, 1996b), but neither
of these apply in Fusarium.
The differential fate of the ITS2 types may reflect
competition between nucleolar organizing regions
(= NORs; Vaughan et al., 1993; Gecheff et al., 1994)
in which one NOR locus is under the active or passive
influence of another (i.e., nucleolar dominance). Hy-
bridization experiments have shown that rDNA loci
are located on at least two chromosomes in some spe-
cies of Fusarium (Boehm et al., 1994; Fekete et al.,
1993). Experiments are being conducted to deter-
mine whether these correspond to type I and type II
ITS2 loci and to estimate their respective copy num-
ber. From these studies it should be possible to dis-
tinguish between copy number and a possible ampli-
fication bias due to PCR selection (Wagner et al.,
1994). Phylogenetic analyses are being extended to
all fusaria to determine how ancient and widespread
the nonorthologous ITS2 types are within this genus.
Pending results from these analyses, phylogenetic re-
lationships inferred from the ITS region as the sole
locus within Fusarium should be viewed with caution.
Species-level molecular systematic studies frequently
employ the rDNA ITS region as the sole locus, but
results from this study emphasize the importance of
gene-gene concordance and in-depth sampling be-
fore making taxonomic revisions (Doyle, 1992).
Evolution of the Gibberella fujikuroi and Fusarium
oxysporum complexes.-Phylogenetic analysis of the
combined 28S rDNA, mtSSU rDNA and ~-tubulin
gene data provided greater resolution and compara-
ble measures of clade stability, as assessed by boot-
strapping and decay indices, than reported previously
for a dataset that included 17 of the species in this
study (O'Donnell and Cigelnik, 1997). Major clades
that received bootstrap support comparable with
those reported in 0 'Donnell and Cigelnik ( 1997) in-
clude a lineage comprising the G. Jujikuroi and F.
oxysporum complexes, and the Mrican-Asian, Mrican,
Asian, and American clades within the G. Jujikuroi
complex. In addition, F. dlaminii was resolved as the
most basal species within the Mrican clade rather
than a sister to an Asian clade consisting of F. sac-
chan-F. Jujikuroi-F. proliferatum (O'Donnell and Cig-
elnik, 1997). By comparison, Bruns' et al. (1991)
bootstrap analysis of the nuclear 28S rDNA data of
Guadet et al. ( 1989) did not support the monophyly
 O'Dor-;NELL ET AL.: FuSARIUM MOLECUlAR PHYLOGENY
of either the G. Jujikuroi complex (section Liseola,
55% bootstrap) or the clade comprising the G. fuji-
kuroi and F. oxysporum complexes (i.e., sections Lis-
eola-Elegans, 37% bootstrap). Bruns' result could
have been predicted based on the poor resolution we
obtained in the 28S rDNA gene tree (FIG. 2C). Phy-
logenetic relations inferred for biological species
within the G. Jujikuroi complex from RAPD (Voigt et
al., 1995; Amoah et al., 1996) and isozyme data (Huss
et al., 1996) identified F. Jujikuroi MP-C and F. proli-
Jeratum MP-D as sister taxa, but relationships of the
other species are discordant with our molecular phy-
logeny. We attribute this disagreement to high ho-
moplasy and the low number of characters in the
RAPD and isozyme data.
Although a close phylogenetic relationship of sec-
tions Liseola and Elegans has been suggested in tra-
ditional morphological-based classification schemes
(Booth, 1971; Gerlach and Nirenberg, 1982; Nelson
et al., 1983), section Liseola is paraphyletic as cur-
rently defined because it artificially excludes at least
8 species that form chlamydospores. These have been
shown by our results to belong to the G. Jujikuroi
complex. Chlamydospore production, however, is
plesiomorphic for the fusaria included in this study;
eight of the nine species basal to the G. Jujikuroi com-
plex produce chlamydospores. Furthermore, the
only outgroup species that does not form chlamyd-
ospores, Fusarium nisikadoi (Nirenberg and Aoki,
1998), would be placed in the artificial section Liseola
based on morphology, but the molecular phylogeny
does not support this classification. Section Liseola
could be redefined to include species that produce
chlamydospores, or it could be submerged within sec-
tion Elegans which has nomenclatural priority over
Liseola as practiced by Bilai ( 1977), but these taxo-
nomic changes are inadvisable because many other
sections within Fusarium are artificial and should be
abandoned for a more natural classification (Mule et
al., 1997; O'Donnell, 1997). Other plesiomorphic
characters for the G. Jujikuroi complex include fu-
monisin, beauvericin and moniliformin mycotoxin
production (Leslie et al., 1992; Moretti et al., 1996;
O'Donnell, unpubl.), suggesting that toxin produc-
tion may have been a key factor in the evolutionary
success of this phytopathogenic lineage.
As reported in O'Donnell and Cigelnik (1997), we
observed complete concordance of phylogenetic and
biological species within the G. Jujikuroi complex
which indicates the PSC and BSC identify compara-
ble taxa. Similar concordance of these two species
concepts was observed within the Nectria haematococ-
ca Berk. & Br. species complex (O'Donnell and Gray,
1995). Genetic divergence of the biological species
within the mtSSU rDNA and 13-tubulin gene trees
481
strongly suggests that the biological species have
been reproductively isolated for a long time (Leslie,
1995). It should be noted, however, that F. Jujikuroi
(MP-C) and F. proliferatum (MP-D) exhibit an inter-
mediate level of DNA-DNA complementarity (Ellis,
1988), and the reproductive barrier may not be com-
plete (Xu et al., 1995). We are currently using the
PSC to extend the BSC within this complex but it is
doubtful whether the BSC will ever become widely
applicable within the G. Jujikuroi complex and relat-
ed species of Fusarium because teleomorphs are un-
known for many species within this lineage and be-
cause mating tests are time consuming and often fail
even with standard testers. Isozyme variation has
been used to identify the seven MPs even if a tester
fails, and they are quicker than mating tests (Huss et
al., 1996); however, it remains to be determined how
many of the 36 species within the G. Jujikuroi com-
plex can be resolved with the 8 polymorphic loci em-
ployed in the study by Huss et al. ( 1996). G. Jujikuroi
teleomorphs are known for only nine of the 45 spe-
cies (i.e., 20%) included in this study, including F.
udum (Rai and Upadhyay, 1982) and F. circinatum
(Nirenberg and O'Donnell, 1998), but we have not
added these two species to the alphabetic A through
G mating population series (Leslie, 1995).
The phylogenetic evidence indicates that many
morphological species included in this study are pol-
ytypic (TABLE I, Appendix I), a result we attribute to
their extreme morphological crypsis and divergent
taxonomic opinions (Booth, 1971; Gerlach and Ni-
renberg, 1982; Nelson et al., 1983). The net result is
that competing morphology-based taxonomies have
contributed to considerable confusion in the litera-
ture regarding host preference and mycotoxigenic
potential of species (Leslie, 1995). Twenty-six of the
45 species included in this study represent, respec-
tively, new species (23 species), new combinations (F.
phyllophilum and F. bulbi cola), and a rediscovered
species (F. lactis). Two phylogenetically distinct spe-
cies basal to the G. Jujikuroi complex (FJ(;. 7, Fusar-
ium sp. NRRL 22903 and Fusarium redolens) were
identified previously as F. oxysporum based on mor-
phology (Donaldson et al., 1995). Donaldson et al.
(1995) noted, however, that these isolates grouped
anomalously in a dendrogram based on RFLP anal-
ysis of the ITS region. The gene phylogeny reported
in this study demonstrates that the anomalous group-
ing is due to the application of a polytypic species
concept for F. oxysporum and to the homoplastic pat-
tern of evolution of the nonorthologous ITS2 types.
Our results and those of Waalwijk et al. ( 1996a, b)
show the major ITS2 type found in F. oxysporum is a
type I (FIG. 2B) while in the F. oxysporum-like species,
Fusarium sp. NRRL 22903 and Fusarium redolens, it
482 MYCOLOGIA
is a type II. Fusarium sp. NRRL 22903 fits the descrip-
tion of F. bulbigenum Cke. & Mass. var. blasticola
(Rostr.) Wollenw. (Wollenweber and Reinking, 1935)
but we are not using this name until its relationship
to F. bulbigenum is resolved. Including the results of
O'Donnell and Cigelnik (1997), four independent
studies have identified the same two species clusters
corresponding to the two divergent, m~or ITS2 types
(Donaldson et al., 1995; Waalwijk et al., 1996a, b; and
Anderson, 1994), thus providing strong support that
these results are not due to PCR contamination.
Studies such as those of Donaldson et al. ( 1995), Edel
et al. (1995), Appel and Gordon (1996), and Waal-
wijk et al. (1996a, b) also show great potential for
identifYing morphologically cryptic phylogenetically
distinct species within the F. oxysporum species com-
plex.
Molecular systematics of the Gibberella fujikuroi com-
plex.-The 36 species identified within the G. fuji-
kuroi complex formed three strongly supported bio-
geographically structured clades that have not been
identified previously. The African clade is the largest
with 16 phylogenetically distinct species but only four
of these have been identified as biological species [F.
verticillioides MP-A (synonym = F. moniliforme); Fu-
sarium thapsinum MP-F (Klittich et al., 1997); F. ny-
gamai MP-G (Klaasen and Nelson, 1996); and F.
udum (Rai and Upadhyay, 1982)]. The name F. mon-
iliforme is rejected primarily because it has always
been applied to a multitude of phylogenetically dis-
tinct species in the taxonomies of Booth (1971) and
Nelson et al. (1983), and secondarily, because it is a
later synonym of F. verticillioides (Nirenberg, 1976;
Greuter et al., 1994). Only two of the 16 African spe-
cies are currently classified within section Liseola, F.
verticillioides MP-A and Fusarium thapsinum MP-F
(Klittich et al., 1997). F. dlaminii (published as F.
dlamini, Marasas et al., 1985) and F. napiforme (Mar-
asas et al., 1987) were excluded from section Liseola
because they produce chlamydospores; F. phyllophil-
um was previously considered a variety of F. prolifer-
atum (F. proliferatum (Matsushima) var. minus Niren-
berg sensu Gerlach and Nirenberg, 1982) or a syn-
onym of F. moniliforme (Nelson et al., 1983); and F.
lactis, a distinctive fig pathogen with short-chained
microconidiophores, was recognized by Wollenweber
and Reinking (1935) but has been misidentified as F.
moniliforme (Subbarao and Michailides, 1993) and F.
proliferatum (Marasas et al., 1995). F. udum is the only
other validly published species within this clade but
it has never been classified within section Liseola be-
cause it produces chlamydospores. Descriptions for
seven of the eight undescribed species are given in
accompanying papers (Nirenberg and O'Donnell,
1998; Nirenberg et al., 1998). Five of the species be-
ing described were received misidentified as follows:
F. acutatum received as F. udum; F. denticulatum from
Ipomoea batatas as F. lateritium Nees:Fr. (Nelson et al.,
1995; Clark et al., 1995); F. ramigenum from Ficus
carica as F. moniliforme (Subbaro and Michailides,
1993); F. pseudonygamai from Pennisetum typhoides as
F. nygamai (Marasas et al., 1988a, b; Nelson et al.,
1992); F. pseudocircinatum on Solanum sp. from Gha-
na as F. sacchari var. sacchari, on Heteropsylla incisa
(Homoptera: Psyllidae) from Papua New Guinea as
F. subglutinans, and on Pinus kesiya from the Philip-
pines as F. moniliforme var. subglutinans. Two phyla-
genetically distinct African species, F. brevicatenula-
tum on Striga asiatica from Madagascar and F. pseu-
doanthophilum on Zea mays from Zimbabwe, are de-
scribed in Nirenberg et al. (1998). Fusarium sp.
NRRL 25221 on Z. mays from Zimbabwe will be de-
scribed separately.
The Asian clade is the smallest with eight phyla-
genetically distinct species but this may be a sampling
artifact. Teleomorphs are known for only three spe-
cies: F. sacchari MP-B, F. fujikuroi MP-C, and F. proli-
feratum MP-D. The ex-type strain of F. neoceras cannot
be identified morphologically (Gerlach and Niren-
berg, 1982) but the molecular evidence indicates that
this species is a later synonym of F. sacchari, a result
corroborated by mating experiments with F. sacchari
tester strains with which it is highly fertile. Given the
long branch that supports F. sacchari, this species may
have evolved in New Guinea, the area of endemism
of its primary host Saccharum ojjicinarum (sugar-
cane; Simpson and Ogorzaly, 1995). Additional sam-
pling within this clade may help clarify its sister-group
relationships and biogeography. Because the molec-
ular phylogenetic evidence strongly indicates F. pro-
lijeratum is a later synonym of F. annulatum, we are
preparing a proposal to conserve F. proliferatum over
F. annulatum which is known from only one collec-
tion (Bugnicourt, 1952). Only one of the five phyla-
genetically distinct species identified within this clade
is being described (Nirenberg and O'Donnell, 1998),
F. concentricum from the Asian endemic host Musa
sp. (banana) and the brown plant hopper, Nilapar-
vata lugens [Homoptera: Delphacidae]. The other
three species [NRRL 25226 on Mangifera indica from
India (Kumar et al., 1993), NRRL 25303 on Oryza
sativa from japan, and NRRL 25309 on Triticum aes-
tivum from japan] will be described subsequently. Fu-
sarium globosum Rheeder et al. ( 1996) was recently
described from Z. mays in southern Africa; however,
this species is probably endemic to Asia because it
has been isolated on Triticum aestivum in Japan and
it is deeply nested within the Asian clade in our mo-
lecular phylogeny.
 O'DO!';l\El.l. ET AL: FuSARIUM MOLECUL\R PH\LOGENY
The American clade contains 12 phylogenetically
distinct species but only two of these have been re-
ported to produce a teleomorph, F. subglutinans MP-
E and F. circinatum (Nirenberg and O'Donnell, 1998;
Viljoen et al., 1997). Three new species within this
clade are being described and one new combination
is being made in Nirenberg and O'Donnell (1998):
F. guttiforme on Ananas comosus from collections in
Brazil, England, and Hawaii (Bolkan et al., 1979) re-
ceived as F. moniliforme Sheldon var. subglutinans
Wollenw. & Reinking ATCC 38067 = NRRL 25037, F.
subglutinans MRC 6784 = NRRL 25624, and F. sac-
chari var. sacchari CBS 184.29 = NRRL 22945); F. be-
goniae on Begonia elatior from Germany but at least
one parent of this hybrid is from South America; F.
bulbicola on Nerine bowdenii bulbs represents a new
combination for F. sacchari (Butler) W. Gams var.
elongatum Nirenberg to eliminate the polyphyly of F.
sacchari (Gerlach and Nirenberg, 1982); and F. circin-
atum from pitch canker of Pinus spp. received as F.
subglutinans (Wollenw. & Reinking) Nelson et al. f.
sp. pini (Correll et al., 1992; Viljoen et al., 1995,
1997) and F. subglutinans (Kuhlman et al., 1978).
The pine isolates were reported to be interfertile
with F. subglutinans (Kuhlman et al., 1978) but the
phylogenetic evidence reported here and by Viljoen
et al. ( 1997), coupled with the inability to reproduce
the mating experiments of Kuhlman et al. (1978) (T.
Gordon pers. comm.; O'Donnell, unpubl.), indicate
that F. circinatum and F. subglutinans MP-E are not
members of the same biological species. Of the spe-
cies we sampled, F. subglutinans MP-E is most closely
related to F. bactridioides, a species treated as a syn-
onym of F. sambucinum (Nelson et al., 1983) or as a
distinct species in section Discolor (Wollenweber,
1934; Gerlach and Nirenberg, 1982). Crosses be-
tween the ex-type strain of F. bactridioides and F. subgl-
utinans MP-E testers resulted in aberrant, immature
perithecia but no asci or ascospores (O'Donnell, un-
publ.). F. bactridioides' morphology and nutritional
mode as a putative pathogen of the rust Cronartium
conigenum is unlike any other member of the G. fu-
jikuroi complex but the molecular evidence indicates
that it may have evolved from a F. subglutinans-like
ancestor. The three remaining species (NRRL 25195
on wood from Venezuela, NRRL 25204 on palm from
Venezuela, and NRRL 25346 on Ipomoea batatas from
Peru) will be described later. F. denticulatum and Fu-
sarium sp. NRRL 25346 were received misidentified
as F. lateritium from Ipomoea batatas (Nelson et al.,
1995; Clark et al., 1995), but both species are phy-
logenetically distinct and the molecular evidence in-
dicates that they have evolved within separate clades:
F. denticulatum in the Mrican clade and Fusarium sp.
NRRL 25346 in the American clade. The taxonomic
483
status of F. anthophilum was recently challenged
(Chen, 1994), in part from the results of Ellis' (1988)
DNA-DNA hybridization experiments, but this chal-
lenge is in error because the strains employed in the
study of Ellis (1988) were misidentified through use
of polytypic species concepts (Nelson et al., 1983;
NRRL 13330 = FRC M-1262 received as F. anthophil-
um and NRRL 13571 = ATCC 38480 received as G.
fujikuroi var. subglutinans both are F. sacchari MP-B).
F. babinda was recently described from forest soils in
Australia but it was not classified within section Lis-
eo/a because it produces chlamydospores (Summerell
et al., 1995). We have examined authentic cultures
of this species (NRRL 25539 and 25540) and have
determined that the holotype of F. babinda, here re-
ferred to as Fusarium sp. DAR 70287, is an unrelated,
phylogenetically distinct species which does not fit
the protologue. Fusarium sp. DAR 70287, or its an-
cestor, appears to have evolved within the American
clade. One prediction of this hypothesis is that this
species might be extant in similar habitats in South
America.
Biogeography of the Gibberella fujikuroi complex.-
The biogeographic hypothesis proposed from the
phylogenetic evidence suggests that the biota area
cladogram reflects vicariant events associated with
the fragmentation of Gondwana in the upper Creta-
ceous through the Paleocene over the last 100 mil-
lion years (Raven and Axelrod, 1974; Weijermars,
1989; Smith et al., 1994). Concordant biological and
geological area cladograms fit the prediction of a
Gondwanic history and, as expected, exhibit the fol-
lowing sister relations: ((American) (African,
Asian)). Molecular clock estimates from calibration
of the nuclear small subunit 18S rDNA (Berbee and
Taylor, 1993) are consistent with the vicariant hy-
pothesis which suggests that Fusarium evolved ap-
proximately 110 Mya.; however, additional estimates
of divergence times are needed (Simon et al., 1993).
The ancestral area of the G. fujikuroi complex may
have been Mrica where it is the most speciose and
phylogenetically diverse. Biogeographical interpreta-
tion of the data has been complicated considerably
due to dispersal of the agronomically important host
plants by humans. In addition, at least one putative
long-distance trans-Pacific jump dispersal may not
have involved humans. The geographic origin of Fu-
sarium sp. DAR 70287 was coded as Australian, but
the most parsimonious interpretation of the data sug-
gests that either this species or its ancestor's area of
endemism is in the Neotropics. When the geographic
origin of Fusarium sp. DAR 70287 was coded as
American (data not shown), likely geographic origins
of all 12 equivocal species were resolved by MacClade
484 MYCOLOGIA
(Maddison and Maddison, 1992). Geographic origins
of seven of the nine species resolved by MacClade
could have been predicted from the area of endem-
ism of the host plant, but taxa dispersed by humans
on economically important plants were coded in a
neutral manner ( = equivocal) as recommended by
Kluge (1988). The geographic origin ofF acutatum
is problematical because four isolates came with in-
complete host data. However, a fifth isolate from In-
dia on the African endemic, Cajanus cajan, suggests
that this pathogen may have been introduced to Asia
on this host as also predicted for F udum. One pre-
diction of the biogeographic hypothesis (FIG. 9) is
that F acutatum should be present in Africa because
it is rooted in the African clade.
In all but two instances hosts and pathogens ap-
pear to have been moved simultaneously from one
biogeographic region to another. For example, the
African species F ramigenum and F lactis appear to
have been moved from northern Africa, the area of
endemism of their host Ficus carica, to California
where calimyrna and wild figs have been cultivated
for the past 100 years. The two exceptions involve
Neotropical hosts infected with Paleotropical patho-
gens. Zea mays and Ipomoea batatas may have been
moved from the Neotropics to Africa where F verti-
cillioides and F denticulatum, respectively, switched to
these Neotropical host species brought into contact
with them by humans. We further theorize that once
they became established as seed-borne pathogens, F
verticillioides and F denticulatum became widespread
as their respective hosts were cultivated panglobally.
Results from analyses of vegetative compatibility
groups within F denticulatum (Clark et al., 1995) are
consistent with an African origin because isolates
from this region exhibit the greatest genetic diversity.
In addition, maximum likelihood analyses of parsi-
mony trees constraining F denticulatum and F verti-
cillioides to the American clade were significantly
worse than the most-parsimonious tree (data not
shown). Based on the host's ancestral area, F verti-
cillioides MP-A "center of origin" has been theorized
to be Central America (Klittich and Leslie, 1992).
However, our phylogenetic hypothesis supports an
African origin for F verticillioides and contradicts the
suggestion that it has coevolved with Zea mays (Leslie,
1995). Rigorous tests of our vicariant biogeographic
hypothesis are needed to address this and other ques-
tions directed towards understanding the evolution-
ary history of the G. Jujikuroi complex. Towards this
end, area cladograms are being constructed for the
F oxysporum and Nectria haematococca species com-
plexes (Van Etten and Kistler, 1988; O'Donnell and
Gray, 1995) to determine whether similar patterns of
vicariance are present within these important plant
pathogenic lineages.
Fusarium's importance as a mycotoxigenic phyto-
pathogen provides a strong economic incentive for
the development of a phylogenetically based classifi-
cation because a natural system offers the greatest
predictive value for investigating all aspects of its bi-
ology. The G. Jujikuroi complex molecular phylogeny
inferred from three unlinked loci in this study pro-
vides a testable hypothesis for investigating evolution
of morphology, mycotoxins, biogeography, and spe-
cies boundaries. Future studies will include a cladistic
analysis of morphological data directed at under-
standing the evolution of phenotypic characters that
have been used in classifying the fusaria in an effort
to distinguish between phylogenetically informative
and homoplastic characters. In order for these sys-
tematic studies to effect stable taxonomic revision, it
will be necessary to provide users such as plant pa-
thologists and mycotoxicologists with the systematic
tools that are derived from a synthesis of genotypic
and phenotypic data. Towards this end, a dichoto-
mous key to species is provided in an accompanying
paper (Nirenberg and O'Donnell, 1998).
ACKNOV.'LEDGMENTS
Thanks are due Martin Dickman (University of Nebraska),
Louise Glass (University of British Columbia), DavidS. Hib-
bett (Harvard University), and Cees Waalwijk (Research In-
stitute for Plant Protection, Wageningen) for sharing un-
published data, Christopher L. Schardl (University of Ken-
tucky) for recommending the 13-tubulin gene for phyloge-
netics, Monique Gardes and Thomas D. Bruns (University
of California, Berkeley) for the CTAB DNA extraction pro-
tocol, John W. Taylor (University of California, Berkeley)
for the quick PCR bacterial miniprep protocol, Barbara
Thiers (New York Botanical Garden, Bronx), Amy Y. Ross-
man (National Fungus Collections, Beltsville), and Michael
Priest (New South Wales Agriculture Plant Pathology Her-
barium, DAR, Rydalmere) for loan of specimens, the indi-
viduals and culture collections cited in Appendix I for gen-
erously providing strains, Larry Tjarks for oligonucleotides,
Steve Prather for the illustrations, and Walter Gams (Cen-
traalbureau voor Schimmelcultures, Baarn),John W. Taylor,
Corby Kistler (University of Florida), and Christopher L.
Schardl for numerous constructive criticisms and sugges-
tions. Names are necessary to report factually on available
data; however, the USDA neither guarantees nor warrants
the standard of the product, and the use of the name by
USDA implies no approval of the product to the exclusion
of others that may also be suitable.
LITERATURE CITED
Amoah, B. K., M. V. Macdonald, N. Rezanoor, and P. Nich-
olson. 1996. The use of random amplified polymor-
 Q'DON:>JELL ET AL.: FuSARIUM MOLECUlAR PHYLOGE:>JY
phic DNA technique to identify mating groups in the
Fusarium section Liseola. Pl. Pathol. 45: 115-125.
Anderson, C. 1994. Restriction mapping of the internal
transcribed spacer of the ribosomal DNA of Fusarium
section Liseola. M.Sc. Thesis. Kansas State University,
Manhattan. 45 pp.
Appel, D. J., and T. R. Gordon. 1996. Relationships among
pathogenic and nonpathogenic isolates of Fusarium ox-
ysporum based on the partial sequence of the intergen-
ic spacer region of the ribosomal DNA. Malec. Pl.-Mi-
crobe Interact. 9: 125-138.
Arnheim, N., M. Krystal, R. Schmickel, G. Wilson, 0. Ryder,
and E. Zimmer. 1980. Molecular evidence for genetic
exchanges among ribosomal genes on nonhomologous
chromosomes in man and apes. Proc. Natl. Acad. Sci.
U.S.A. 77: 7323-7327.
Baldwin, B. G., M. J. Sanderson, J. M. Porter, M. F. Wojcie-
chowski, C. S. Campbell, and M. J. Donoghue. 1995.
The ITS region of nuclear ribosomal DNA: a valuable
source of evidence on angiosperm phylogeny. Ann.
Missouri Bot. Card. 82: 247-277.
Berbee, M. L., and J. W. Taylor. 1993. Dating the evolu-
tionary radiations of the true fungi. Can ad. ]. Bot. 71:
1114--1127.
Bilai, V. I. 1977. Fusarii. ed. 2. Naukova Dumka, Kiev. 443
pp.
Boehm, E. W. A., R. C. Ploetz, and H. C. Kistler. 1994. Sta-
tistical analysis of electrophoretic karyotype variation
among vegetative compatibility groups of Fusarium ox-
ysporum f. sp. cubense. Malec. Pl.-Microbe Interact. 7:
196-207.
Balkan, H. A., J. C. Dianese, and F. P. Cupertino. 1979.
Pineapple flowers as principal infection sites for Fusar-
ium moniliforme var. subglutinans. Pl. Dis. RRporler 63:
655-657.
Booth, C. 1971. The genus Fusarium. Commonwealth My-
cological Institute, Kew, United Kingdom. 237 pp.
Bremer, K. 1988. The limits of amino acid sequence data
in angiosperm phylogenetic reconstruction. Evolution
42: 795-803.
Bruns, T. D., T. J. White, and J. W. Taylor. 1991. Fungal
molecular systematics. Annual Rev. Ecol. S)·st. 22: 525-
564.
Buckler, E. S., and T. P. Holtsford. 1996. Zea systematics:
ribosomal ITS evidence. Malec. Bioi. Evol. 13: 612-622.
Bugnicourt, F. 1952. Une espece fusarienne nouvelle, par-
asite du riz. Rev. Gen. Bot. 59: 13-18.
Burgess, L. W., and D. Trimboli. 1986. Characterization
and distribution of Fusarium nygamai, sp. nov. Myco-
logia 78: 223-229.
Byrd, A. D., C. L. Schardl, P. J. Songlin, K. L. Mogen, and
M. R. Siegel. 1990. The 13-tubulin gene of t-pichloi ty-
phina from perennial ryegrass (Lolium perenne). Curr.
Genet. 18: 347-354.
Cerda-Olmedo, E., R. Fernandez-Martin, and J. Avalos.
1994. Genetics and gibberellin production in Cibberella
fujikuroi. Antonie van Leeuwenhoek Int. ]. Gen. Malec.
Microbial. 65: 217-225.
Chen, F.:J. 1994. Genetic analysis of pyriform microconid-
485
ium production in mating population B of Cibberella
Jujikuroi. Canad.]. Bot. 72: 1209-1210.
Clark, A. J. 1994. Invasion and maintenance of a gene du-
plication. Proc. Natl. Acad. Sci. U.S.A. 91: 2950-2954.
Clark, C. A., M. W. Hoy, and P. E. Nelson. 1995. Variation
among isolates of Fusarium lateritium from sweetpotato
for pathogenicity and vegetative compatibility. Phyto-
pathology 85: 624--629.
Copenhaver, G. P., and C. S. Pikaard. 1996a. RFLP and
physical mapping with an rONA-specific endonuclease
reveals that nucleolus organizer regions of Arabidopsis
thaliana adjoin the telomeres on chromosomes 2 and
4. Pl.]. 9: 259-272.
- - - , and - - - . 1996b. Two-dimensional RFLP analy-
ses reveal megabase-sized clusters of rRNA gene vari-
ants in Arabidopsis thaliana, suggesting local spreading
of variants as the mode for gene homogenization dur-
ing concerted evolution. Pl.]. 9: 273-282.
Correll, J. C., T. R. Gordon, and A. H. McCain. 1992. Ge-
netic diversity in California and Florida populations of
the pitch canker fungus Fusarium subglutinans f. sp.
pini. Phytopathology 82: 415-420.
Davis, J. I. 1995. A phylogenetic structure for the mono-
cotyledons as inferred from chloroplast DNA restric-
tion site variation, and a comparison of measures of
clade support. Syst. Bot. 20: 503-527.
Donaldson, G. C., L.A. Ball, P. E. Axelrood, and N. L. Glass.
1995. Primer sets developed to amplify conserved
genes from filamentous ascomycetes are useful in dif-
ferentiating Fusarium species associated with conifers.
Appl. Environm. Microbial. 61: 1331-1340.
Donoghue, M.J, R. G. Olmstead,]. F. Smith, andJ. D. Palm-
er. 1992. Phylogenetic relationships of Dipsacales
based on rbcL sequences. Ann. Missouri Bot. Card. 79:
333-345.
Doyle, J. J. 1992. Gene trees and species trees: molecular
systematics as one-character taxonomy. Syst. Bot. 17:
144--163.
Dubcovsky, J., and J. Dvoiak. 1995. Ribosomal RNA multi-
gene loci: nomads of the Triticeae genomes. Genetics
140: 1367-1377.
Edel, V., C. Steinberg, I. Avelange, G. Laguerre, and C. Al-
abouvette. 1995. Comparison of three molecular
methods for the characterization of Fusarium oxyspo-
rum strains. Phytopathology 85: 579-585.
Ellis, J. J. 1988. Lesser known species in section Liseola of
Fusarium and near relatives in the Fusarium oxysporum
group. Myologia 80: 734--738.
Fekete, C., R. Nagy, A. J. M. De bets, and L. Hornak. 1993.
Electrophoretic karyotypes and gene mapping in eight
species of the Fusarium sections Arthosporiella and
Sporotrichiella. Curr. Genet. 24: 500-504.
Felsenstein, J. 1993. PHYUP (Phylogeny inference package)
version 3.55c. Department of Genetics, University of
Washington, Seattle.
Gardes, M., and T. D. Bruns. 1993. ITS primers with en-
hanced specificity for basidiomycetes-application to
the identification of mycorrhizae and rusts. Malec. Ecol.
2: 113-118.
Gecheff, K., T. Hvarleva, S. Georgiev, T. Wilkes, and A.
486 MYCOLOGIA
Karp. 1994. Cytological and molecular evidence of de-
letion of ribosomal RNA genes in chromosome 6 of
barley (Hordeum vulgare). Genome 37: 419-425.
Gerlach, W., and H. Nirenberg. 1982. The genus Fusarium-
A pictorial atlas. Mitt. Biol. Bundesanst. Land-Forstw.
Bertin-Dahlem 209: 1-406.
Greuter, W., F. R. Barrie, H. M. Burdet, W. G. Chaloner, V.
Demoulin, D. L. Hawksworth, P. M. ]0rgensen, D. H.
Nicolson, P. C. Silva, P. Trehane, and J. McNeill. 1994.
International Code of Botanical Nomenclature (Tokyo
Code). Regnum Veg. 31: 1-389 +xviii.
Guadet, J., J. Julien, J. F. Lafay, andY. Brygoo. 1989. Phy-
logeny of some Fusarium species, as determined by
large-subunit rRNA sequence comparison. Malec. Biol.
Evol. 6: 227-242.
Hibbett, D. S., and M.J. Donoghue. 1995. Progress toward
a phylogenetic classification of the Polyporaceae
through parsimony analysis of mitochondrial ribosomal
DNA sequences. Canad. J Bot. 73: S853-S861.
- - - , Y. Fukumasa-Nakai, A. Tsuneda, and M. J. Dono-
ghue. 1995. Phylogenetic diversity in shiitake inferred
from nuclear ribosomal DNA sequences. Mycologia 87:
618-638.
Hillis, D. M., andJ.J. Bull. 1993. An empirical testofboot-
strapping as a method for assessing confidence in phy-
logenetic analysis. Syst. Biol. 42: 182-192.
Huss, M.J., C. L. Campbell, D. B. Jennings, and]. F. Leslie.
1996. Isozyme variation among biological species in
the Gibberella fujikuroi species complex (Fusarium sec-
tion Liseola). Appl. Environm. Microbial. 62: 3750-
3756.
]inks-Robertson, S., and T. D. Petes. 1993. Experimental
determination of rates of concerted evolution. Meth.
Enz. 224: 631-646.
Kishino, H., and M. Hasegawa. 1989. Evaluation of the
maximum likelihood estimate of the evolutionary tree
topologies from DNA sequence data, and the branch-
ing order in ominoidea. J Malec. Evol. 29: 170-179.
Klaasen, J. A., and P. E. Nelson. 1996. Identification of a
mating population, Gibberella nygamai sp. nov., within
the Fusarium nygamai anamorph. Mycologia 88: 965-
969.
Klittich, C. J. R., and J. F. Leslie. 1992. Identification of a
second mating population within the Fusarium moni-
liforme anamorph of Gibberella fujikuroi. Mycologia 84:
541-547.
- - - , - - - , P. E. Nelson, and W. F. 0. Marasas. 1997.
Fusarium thapsinum ( Gibberella thapsina): A new spe-
cies in section Liseola from sorghum. Mycologia 89:
643-652.
Kluge, A. G. 1988. Parsimony in vicariance biogeography:
a quantitative method and a greater antillean example.
Syst. Zool. 37: 315-328.
Kuhlman, E. G., L. D. Dwinell, P. E. Nelson, and C. Booth.
1978. Characterization of the Fusarium causing pitch
canker of southern pines. Mycologia 70: 1131-1143.
Kumar, J., U. S. Singh, and S. P. S. Beniwal. 1993. Mango
malformation: one hundred years of research. Annual
Rev. Phytopathology 31: 217-232.
Kwasna, H., J. Chelkowski, and P. Zajkowski. 1991. Grzylfy
(Mycota), tom XXII. Sierpik (Fusarium). Polska Aka-
demia Nauk, Flora Polska, Warzawa-Krak6w, Poland.
137 pp.
Leslie, J. F. 1995. Gibberella fujikuroi: available populations
and variable traits. Canad. J Bot. 73: S282-S291.
- - - , R. D. Plattner, A. E. Desjardins, and C.J. R. Klittich.
1992. Fumonisin B1 production by strains from differ-
ent mating populations of Gibberella fujikuroi (Fusar-
ium section Liseola). Phytopathology 82: 341-345.
Li, W.-H., and D. Graur. 1991. Fundamentals of molecular
evolution. Sinauer Associates, Sunderland, Massachu-
setts. 284 pp.
LoBuglio, K. F., J. I. Pitt, and J. W. Taylor. 1993. Phyloge-
netic analysis of two ribosomal DNA regions indicates
multiple independent losses of a sexual Talaromyces
state among asexual Penicillium species in subgenus
Biverticillium. Mycologia 85: 592-604.
Maddison, W. P., and D. R. Maddison. 1992. MacClade:
analysis of phylogeny and character evolution. Version 3.
Sinauer Associates, Sunderland. 398 pp.
Marasas, W. F. 0. , P. E. Nelson, and T. A. Toussoun. 1984.
Toxigenic Fusarium species: Identity and mycotoxicology.
Pennsylvania State Univ., University Park, Pennsylvania
328 pp.
- - - , - - - , and---. 1985. Fusarium dlamini, a new
species from southern Africa. Mycologia 77: 971-975.
- - - , - - - , and - - - . 1988b. Reclassification of two
important moniliformin-producing strains of Fusarium,
NRRL 6022 and NRRL 6322. Mycologia 80: 407-410.
- - - , C.J. Rabie, A. Lubben, P. E. Nelson, T. A. Toussoun,
and P. S. van Wyk. 1987. Fusarium napiforme, a new
species from millet and sorghum in southern Africa.
Mycologia 79: 910-914.
- - - , - - - , - - - , - - - , - - - , a n d - - - . 1988a.
Fusarium nygamai from millet in southern Africa. My-
cologia 80: 263-266.
- - - , J. P. Rheeder, M. Schlechter, S. Stockenstrom, L. V.
D. Westhuizen, and T. J. Michailides. 1995. Fusarium
isolates causing endosepsis of figs in California: identity
and mycotoxicology. Int. Seminar Fusarium Mycotoxins,
Taxonomy and Pathogenicity, Martina Franca, Italy. p.
160.
May, G. S., M. L.-S. Tsang, H. Smith, S. Fidel, and N. R.
Morris. 1987. Aspergillus nidulans ~-tubulin genes are
unusually divergent. Gene 55: 231-243.
Metzenberg, R. L., J. N. Stevens, E. U. Selker, and E. Mor-
zycka-Wroblewska. 1985. Identification and chromo-
somal distribution of 5S rRNA genes in Neurospora eras-
sa. Proc. Natl. Acad. Sci. U.S.A. 82: 2067-2071.
Moretti, A., A. Logrieco, A. Bottalico, A. Ritieni, V. Fogliano,
and G. Randazzo. 1996. Diversity in beauvericin and
fusaproliferin production by different populations of
Gibberella fujikuroi (Fusarium section Liseola). Sydowia
48: 44-56.
Mule, G., A. Logrieco, G. Stea, and A. Bottalico. 1997. Clus-
tering of trichothecene-producing Fusarium strains de-
termined from 28S ribosomal DNA sequences. Appl.
Environm. Microbial. 63: 1843-1846.
Nelson, P. E.,J. H.Juba, and C. A. Clark. 1995. An unusual
 O'DoNNELL ET AL.: FuSARIUM MOLECULAR PHYLOGENY
strain of Fusarium lateritium affecting sweetpotato. My-
cologia 87: 507-509.
- - - , R. D. Plattner, D. D. Shackelford, and A. E. Desjar-
dins. 1992. Fumonisin B1 production by Fusarium spe-
cies other than F. moniliforme in Section Liseola and by
some related species. Appl. Environm. Microbial. 58:
984-989.
- - - , T. A. Toussoun, and W. F. 0. Marasas. 1983. Fu-
sarium species: An illustrated manual for identification.
Pennsylvania State Univ., University Park, Pennsylvania.
183 pp.
Nirenberg, H. 1976. Untersuchungen iiber die morphol-
ogische und biologische Differenzierung in der Fusar-
ium-Sektion Liseola. Mitt. Bioi. Bundesanst. Land-
Forstw. Bertin-Dahlem 169: 1-117.
- - - . 1995. Morphological differentiation of Fusarium
sambucinum Fucke1 sensu stricto, F. torulosum (Berk. &
Curt.) Nirenberg comb. nov. and F. venenatum Niren-
berg sp. nov. Mycopathologia 129: 131-141.
- - - , and T. Aok.i. 1998. Fusarium nisikadoi, a new spe-
cies from Japan. Mycoscience 38: 329-333.
- - - , and K. O'Donnell. 1998. New Fusarium species
and combinations within the Gibberella fujikuroi species
complex. Mycologia 90: 434-458.
- - - , ---,]. Kroschel, A. P. Andrianaivo,]. M. Frank,
and W. Mubatanhema. 1998. Two new species of Fu-
sarium: Fusarium brevicatenulatum from the noxious
weed Striga asiatica in Madagascar and Fusarium pseu-
doanthophilum from Zea mays in Zimbabwe. Mycologia
90: 459-464.
Nixon, K. C., and Q. D. Wheeler. 1990. An amplification
of the phylogenetic species concept. Cladistics 6: 211-
223.
O'Donnell, K. 1992. Ribosomal DNA internal transcribed
spacers are highly divergent in the phytopathogenic as-
comycete Fusarium sambucinum ( Gibberella pulicaris).
Curr. Genet. 2: 213-220.
- - - . 1993. Fusarium and its near relatives. Pp. 225-233.
In: The fungal holomorph: mitotic, meiotic and pleomor-
phic speciation in fungal systematics. Eds., D. R. Reyn-
olds and]. W. Taylor. CAB International, Wallingford.
- - - . 1996. Progress towards a phylogenetic classification
of Fusarium. Sydowia 48: 57-70.
- - - . 1997. Phylogenetic evidence indicates the impor-
tant mycotoxigenic strains Fn-2, Fn-3, Fn-2B and Fn-M
represent a new species of Fusarium. Mycotoxins 45: 1-
10.
- - - , and E. Cigelnik. 1995. Multiple gene phylogenies
reveal ITS2 polymorphisms predate speciation within
the "Gibberella fujikuroi complex" of Fusarium. Inocu-
lum 46: 32.
- - - , and - - - . 1997. Two divergent intragenomic
rDNA ITS'! types within a monophyletic lineage of the
fungus Fusarium are nonorthologous. Malec. Phyloge-
netics Evol. 7: 103-116.
- - - , and L. E. Gray. 1995. Phylogenetic relationships of
the soybean sudden death syndrome pathogen Fusar-
ium solani f. sp. phaseoli inferred from rDNA sequence
data and PCR primers for its identification. Malec. Pl.-
Microbe Interact. 8: 709-716.
487
Peterson, S. W., and A. Logrieco. 1991. Ribosomal RNA
sequence variation among interfertile strains of some
Gibberella species. Mycologia 83: 397-402.
Raeder, V., and P. Broda. 1985. Rapid preparation of DNA
from filamentous fungi. Lett. Appl. Microbiology 1: 17-
20.
Rai, B., and R. S. Upadhyay. 1982. Gibberella indica: the
perfect state of Fusarium udum. Mycologia 74: 343-346.
Raven, P. H., and D. L. Axelrod. 1974. Angiosperm bio-
geography and past continental movements. Ann. Mis-
souri Bot. Card. 61: 539-673.
Rheeder, J. P., W. F. 0. Marasas, and P. E. Nelson. 1996.
Fusarium globosum, a new species from corn in south-
ern Africa. Mycologia 88: 509-513.
Ritland, C. E., K. Ritland, and N. A. Straus. 1993. Variation
in the ribosomal internal transcribed spacers (ITS1
and ITS2) among eight taxa of the Mimulus guttatus
species complex. Malec. Bioi. Evol. 10: 1273-1288.
Sanders, I. R., M. Alt, K. Groppe, T. Boller, and A. Wi-
emken. 1995. Identification of ribosomal DNA poly-
morphisms among and within spores of the Glomales:
application to studies on the genetic diversity of arbus-
cular mycorrhizal fungal communities. New Phytol. 130:
419-427.
Schardl, C. L., A. Leuchtmann, H.-F. Tsai, M. A. Collett, D.
M. Watt, and D. B. Scott. 1994. Origin of a fungal
symbiont of perennial ryegrass by interspecific hybrid-
ization of a mutualist with the ryegrass choke patho-
gen, Epichloe typhina. Genetics 136: 1307-1317.
Schlotterer, C., and D. Tautz. 1994. Chromosomal homo-
geneity of Drosophila ribosomal DNA arrays suggests in-
trachromosomal exchanges drive concerted evolution.
Curr. Bioi. 4: 777-783.
Simon, L.,]. Bousquet, R. C. Levesque, and M. Lalonde.
1993. Origin and diversification of endomycorrhizal
fungi and coincidence with vascular land plants. Nature
363: 67-69.
Simpson, B. B., and M. C. Ogorzaly. 1995. Economic botany:
Plants in our world. McGraw-Hill, New York. 742 pp.
Smith, A. G., D. G. Smith, and B. M. Funnell. 1994. Atlas
of mesozoic and cenozoic coastlines. Cambridge Univer-
sity Press, Cambridge. 99 pp.
Subbarao, K. V., and T. ]. Michailides. 1993. Virulence of
Fusarium species causing fig endosepsis in cultivated
and wild caprifigs. Phytopathology 83: 527-533.
Suh, Y, L. B. Thien, H. E. Reeve, and E. A. Zimmer. 1993.
Molecular evolution and phylogenetic implications of
internal transcribed spacer sequences of ribosomal
DNA in Winteraceae. A mer.]. Bot. 80: 1042-1055.
Summerell, B. A., C. A. Rugg, and L. W. Burgess. 1995.
Characterization of Fusarium babinda sp. nov. Mycol.
Res. 99: 1345-1348.
Sun, S.-K., and W. C. Snyder. 1981. The bakanae disease of
the rice plant. Pp. 104-113. In Fusarium: Diseases, bi-
ology, and taxonomy. Eds., P. E. Nelson, T. A. Toussoun,
and R. ]. Cook. Pennsylvania State Univ., University
Park, Pennsylvania.
Sweetser, D. B., H. Hough,]. F. Whelden, M. Arbuckle, and
]. A. Nickoloff. 1994. Fine-resolution mapping of spon-
taneous and double-strand break-induced gene conver-
488 MYCOIDGIA
sion tracts in Saccharomyces cerevisiae reveals reversible
mitotic conversion polarity. MoiRe. Cell. Bioi. 14: 3863-
3875.
Swofford, D. L. 1993. PA UP: Phylogenetic analysis using par-
simony, version 3.1.1. Computer program distributed by
the Illinois Natural History Survey, Champaign, Illi-
nois.
Tsai, H.-F., J.-S. Liu, C. Staben, M. J. Christensen, G. C. M.
Latch, M. R. Siegel, and C. L. Schardl. 1994. Evolu-
tionary diversification of fungal endophytes of tall fes-
cue grass by hybridization with t-pichloe species. Proc.
Natl. Acad. Sci. U.S.A. 91: 2542-2546.
Van Etten, H. D., and H. C. Kistler. 1988. Nectria haema-
tococca, mating populations I and Vl. Advances Pl. Path-
oZ. 6: 189-206.
Vaughan, H. E., M. Jamilena, C. R. Rej6n, J. S. Parker, and
M. A. Garrido-Ramos. 1993. Loss of nucleolar-organiz-
er regions during polyploid evolution in Scilla autum-
naZis. Heredity 71: 574-580.
Viljoen, A., W. F. 0. Marasas, M. J. Wingfield and C. D.
Viljoen. 1997. Characterization of Fusarium subglutin-
ans f. sp. pini causing root disease of Pinus patula seed-
lings in South Africa. Mycol. Res. 101: 437-445.
- - - , M. J. Wingfield, W. F. 0. Marasas, and T. A. Coutin-
ho. 1995. Characterization of Fusarium isolates from
gladiolus corms pathogenic to pines. Pl. Dis. 79: 1240-
1244.
Vogler, A. P., and R. DeSalle. 1994. Evolution and phylo-
genetic information content of the ITS-I region in the
tiger beetle Cicindela dorsalis. MoiRe. Bioi. Evol. 11:
393--405.
Voigt, K., S. Schleier, and B. Bruckner. 1995. Genetic vari-
ability in Gibberella fujikuroi and some related species
of the genus Fusarium based on random amplification
of polymorpic DNA (RAPD). Curr. Genet. 27: 528-535.
Waalwijk, C., R. P. Baayen,J. R. A. De Koning, and W. Gams.
1996a. Ribosomal DNA challanges the status of Fusar-
ium sections Liseola and Elegans. Sydowia 48: 90-104.
---, J. R. A. de Koning, R. P. Baayen, and W. Gams.
1996b. Discordant groupings of Fusarium spp. from
sections Elegans, Liseola and Dlaminia based on ribo-
somal ITS 1 and ITS2 sequences. Mycologia 88: 316--328.
Wagner, A., N. Blackstone, P. Cartwright, M. Dick, B. Misof,
P. Snow, G. P. Wagner, J. Bartels, M. Murtha, and J.
Pendleton. 1994. Surveys of gene families using poly-
merase chain reaction: PCR selection and PCR drift.
Syst. Bot. 43: 250-261.
Weijermars, R. 1989. Global tectonics since the breakup of
Pangea 180 million years ago: evolution maps and
lithospheric budget. Earth-Sci. Rev. 26: 113-162.
Wendel, J. F., A. Schnabel, and T. Seelanan. 1995a. Bidi-
rectional interlocus concerted evolution following al-
lopolyploid speciation in cotton ( Goss)pium). Proc.
Natl. Acad. Sci. U.S.A. 92: 280-284.
- - - , - - - , a n d - - - . 1995b. An unusual ribosomal
DNA sequence from Gossypium gossypioides reveals an-
cient, cryptic, intergenomic introgression. MoiRe. Phy-
logenetics Evol. 4: 298-313.
White, T. J., T. Bruns, S. Lee, and J. Taylor. 1990. Ampli-
fication and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. Pp. 315-322. In: PCR
protocols: A guide to methods and application. Eds., M.
A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White.
Academic Press, New York.
Wollenweber, H. W. 1913. Studies on the Fusarium prob-
lem. Phytopathology 3: 24-50.
- - - . 1934. Fusarium bactridioides sp. nov., associated
with Cronartium. Science 79: 572.
- - - , and 0. A. Reinking. 1925. Aliquot fusaria tropicalla
nova vel revisa.J. Agric. Res. 30: 155-169.
- - - , a n d - - - . 1935. Die Fusarien, ihre Beschreibung,
Schadwirkung und Bekiimpfung. Paul Parey, Berlin. 355
pp.
Xu, J.-R, K. Yan, M. B. Dickman, and J. F. Leslie. 1995.
Electrophoretic karyotypes distinguish the biological
species of Gibberella fujikuroi (Fusarium section Liseo-
la). MoiRe. Pl.-Microbe Interact. 8: 74-84.
Yan, K., and M. B. Dickman. 1996. Isolation of a 13-tubulin
gene from Fusarium moniliforme that confers cold-sen-
sitive benomyl resistance. Appl. Environm. Microbial.
62: 3053-3056.
Zijlstra, C., A. E. M. Lever, B. J. Uenk, and C. H. Van Si-
lfhout. 1995. Differences between ITS regions of iso-
lates of root-knot nematodes Meloidogyne hapla and M.
chitwoodi. Phytopathology 85: 1231-1237.
Zimmer, E. A., S. L. Martin, S. M. Beverley, Y. W. Kan, and
A. C. Wilson. 1980. Rapid duplication and loss of
genes coding for the a chains of hemoglobin. Proc.
Natl. Acad. Sci. U.S.A. 77: 2158-2162.
Appendix I.-Description of representative strains of each
species sequenced and analyzed phylogenetically. Strain
data include culture collection number(s), geographic ori-
gin, and host/substrate where available. Coding for loci se-
quenced (in parentheses) together with the acronym of the
culture collection/individual who supplied the strains are
presented at the end of Appendix 1. MP A-G indicate bio-
logical species of the Gibberella fujikuroi complex (Leslie,
1995); however, only members of MP-C are named G. Juji-
kuroi sensu stricto.
Fusarium acutatum NRRL 13308 = CBS 739.97 = BBA
69553 = IMI 375327 = FRC 0-1116 = DAOM 225121,
India, unknown (n,m,i,t5,t3); NRRL 13309 =CBS 402.97
= BBA 69580 = FRC 0-1117 = IMI 376ll0 (ex holotype),
India, unknown (n,m,i,t5,t3); NRRL 25118 = ARSEF
3704 = BBA 69718, Pakistan, [Homoptera: Aphididae]
on Triticum sp. (m,i,t5); NRRL 25119 = ARSEF 3707 =
BBA 69719, Pakistan, [Homoptera: Aphididae] on Triti-
cumsp. (m,t5); NRRL 25731 = BBA63520 =CBS 401.97,
India, Cajanus cajan (m, t5).
Fusarium annulatum NRRL 13614 = NRRL 13619 = CBS
258.54 = BBA 63629 = IMI 202878 = IMI 375326 = FRC
M-1636 = DAOM 225139 (ex holotype), Vietnam, Oryza
sativa (n,m,i,t5,t3).
Fusarium anthophilum NRRL 13293 = FRC M-1211, KY,
USA, Lotus corniculatus (n,m,i,t5); NRRL 13602 = CBS
737.97 = IMI 375325 = FRC M-1355 = DAOM 225119,
Germany, Hippeastrum sp. (n,m,i,t5,t3); NRRL 13292 =
NRRL 13828 = FRC M-ll90, NC, USA, Plantago sp.
(n,m,i,t5,t3); NRRL 25062 = CBS 108.92, Netherlands,
 O'DON:\ELL ET .-\1 .. : FUSARIUM MOLECL'L\R PHYLOGENY
Hippeastrum sp. (t5); NRRL 25214 = BBA 8998 = BBA
62266, Germany, Hippeastrum sp. (t5); NRRL 22943 =
NRRL 25216 =CBS 222.76 = BBA 63270 = IMI 202880,
Germany, Euphorbia pulcherrima (n,m,i,t5); NRRL 25217
= BBA 64252, New Zealand, Hippeastrum sp. (t5).
Fusarium babinda NRRL 25539 = DB F11165 = CBS 396.96
= BBA 69788, Queensland, Australia, rain forest soil
(n,m,i,t5,t3); NRRL 25540 = DB F11170 = CBS 397.96
= BBA 69789 = IMI 375324 = DAOM 225118, Victoria,
Australia, Nothojagus forest soil (n,m,i,t5,t3).
Fusarium bactridioides NRRL 204 76 = CBS 177.35 = CBS
100057 = BBA 4748 = BBA 63602 = IMI 375323 =
DAOM 225115 (ex holotype), AZ, USA, Cronartium con-
igenum on Pinus leiophylla (n,m,i,t5,t3); NRRL 22201 =
BBA 63602 = IMI 376116, AZ, USA, C. on P. leiophylla
(t5,m).
Fusarium begoniaeNRRL 25300 =CBS 403.97 = BBA 67781
= IMI 375315 = DAOM 225116 (exholotype), Germany,
Begonia elatior hybrid (n,m,i,t5,t3); NRRL 25315 = BBA
69131 = CBS 452.97 = IMI 376114, Germany, Begonia
elatior hybrid (n,m,i,t5,t3).
Fusarium beomiforme NRRL 13606 = FRC M-1425 = IMI
376117 (ex holotype), Australia, soil (n,m,i,t3); NRRL
25174 = BBA 65829 = CBS 740.97 = IMI 375328 =
DAOM 225123, New Caledonia, soil (n,m,i,t5,t3); NRRL
25185 = BBA 69439 = FRC M-1089, Papua New Guinea,
soil (n,m,t5,t3).
Fusarium brevicatenulatum NRRL 25446 = BBA 69197 =
CBS 404.97 = IMI 375329 = DAOM 225122 (ex bolo-
type), Madagascar, Striga asiatica (n,m,i,t5,t3); NRRL
25447 = BBA 69198 =CBS 100196, Madagascar, S. asia-
tica (m).
Fusarium bulbicola NRRL 13600 = FRC M-1354 = BBA
63620, Germany, Haemanthussp. (n,m,i,t5); NRRL 13618
=CBS 220.76 = BBA 12293 = BBA 63628 = IMI 202877
= IMI 375322 = DAOM 225114 (ex holotype), Nether-
lands, Nerine bowdenii (n,m,i,t5,t3); NRRL 22947 = CBS
245.59 = BBA 8549 = BBA 63620, Germany, Haemanthus
sp. (n,m,i,t5); NRRL 25176 = BBA 10670 = BBA 63622,
Germany, Nerine bowdenii (t5).
Fusarium circinatum NRRL 25331 = TRG SL-1 = BBA
69720 =CBS 405.97 = IMI 375321 = DAOM 225113 (ex
holotype), CA, USA, Pinus radiata (n,m,i,t5,t3); NRRL
25332 = TRG FK867 = CBS 100197 = BBA 69721, GA,
USA, P. taeda (m,t5); NRRL 25333 = TRG SA-0024 =
BBA 69722, South Africa, P. patula (m,t5); NRRL 25621
= MRC 6209 = BBA 69854, South Africa, P. patula (t5);
NRRL 25707 = IMI 211032, NC, USA, P. caribaea (m, t5);
NRRL 25708 = IMI 211031, NC, USA, P. taeda (m, t5).
Fusarium concentricum NRRL 25181 = BBA 64354 = CBS
450.97 = IMI 375352 = DAOM 225146 (ex holotype),
Costa Rica, Musa sapientum (n,m,i,t5,t3); NRRL 25202 =
BBA 68483 = ARSEF 2053, Korea, Nilaparvata lugens
[Homoptera: Delphacidae] (t5); NRRL 25666 = BBA
69855 = ITEM 807, Guatemala, M. sapientum (m, t5);
NRRL 25667 = BBA 69856 = ITEM 817, Guatemala, M.
sapientum (m, t5); NRRL 25668 = BBA 69857 = ITEM
818 = CBS 453.97, Guatemala, M. sapientum (m, t5);
NRRL 25669 = BBA 69858 = ITEM 819, Guatemala, M.
sapientum (m, t5).
489
Fusarium concolorNRRL 13994 =CBS 183.34 =CBS 450.97
= BBA 2607 = BBA 63601 = IMI 375337 = DAOM
225131 (ex holotype), Uruguay, Hordeum sp. (n,m,i,t5,t3).
Fusarium denticulatum NRRL 25189 = BBA 65244 = CBS
406.97, Cuba, Ipomoea batatas (n,m,i,t5,t3); NRRL 25302
= BBA 67769 = CBS 735.97 = IMI 375320 = CC 4785-
1 = DAOM 225112, NC, USA, I. batatas (n,m,i,t5,t3);
NRRL 25311 = BBA 67772 = CBS 407.97 = CC F89-22
= IMI 376115 (ex holotype), LA, USA, I. batatas
(n,m,i,t5,t3); NRRL 25314 = BBA 67771 = CC 91-25-1,
Brazil, I. batatas (t5); NRRL 25316 = BBA 67770 = CC
F89-31, LA, USA, I. batatas (n,m,i,t5,t3); NRRL 25345 =
CC 91-82-1, Zambia, I. batatas (t5); NRRL 25350 = CC
91-29-1, Philippines, I. batatas (n,m,i,t5,t3); NRRL 25351
= CC 93-151-1, Indonesia, I. batatas (t5); NRRL 25352 =
CC 4785-3, NC, USA, I. batatas (t5); NRRL 25465 = CC
91-02-1, Peru, I. batatas (t5).
Fusarium dlaminii NRRL 13164 = FRC M-1637= ATCC
58097 = CBS 175.88 = BBA 69859 = IMI 375348 =
DAOM 225120 (ex holotype), South Africa, Zea mays field
soil (n,m,i,t5,t3); NRRL 25354 = TRG MC4-1S, MD, USA,
soil (m,t5); NRRL 25355 = TRG MC9-8S =CBS 408.97=
BBA 69727, MD, USA, soil (m,t5); NRRL 25442 = MRC
3023 = BBA 69046, South Africa, soil (m,t5); NRRL
25443 = MRC 3024 = BBA 69047, South Africa, soil (m,
t5).
Fusarium fujikuroi MP-C NRRL 13566 = IMI 300793 = IMI
375349 = ATCC 38941 = DAOM 225143, Taiwan, Oryza
sativa (n,m,i,t5,t3); NRRL 13620 = NRRL 13998 = NRRL
22174 = IMI 196086 =CBS 221.76 = BBA 12428 = BBA
63630 = IMI 202879 (ex holotype), Taiwan, 0. sativa
(n,m,i,t5,t3); NRRL 22010 = JFL 1993, Taiwan, 0. sativa
(m,t5); NRRL 22012 = JFL 1995, Taiwan, 0. sativa
(m,t5); NRRL 22013 = JFL 1996, Taiwan, 0. sativa
(m,t5); NRRL 22059 = JFL 4921 (n,i,t5,t3); NRRL 22060
= JFL 4922 (t5).
Fusarium globosum NRRL 25190 = BBA 69018 = CBS
741.97 = IMI 375331 = MAFF 237513 = DAOM 225125,
Japan, Triticum aestivum (n,m,i,t5,t3); NRRL 25193 =
BBA 69017 = MAFF 237512, Japan, T. aestivum (t5);
NRRL 25198 = BBA 69019 = MAFF 237511, Japan, T.
aestivum (t5); NRRL 26131 =CBS 428.97 = IMI 375330
= MRC 6647 = DAOM 225124 (ex ho1otype), South Af-
rica, Zea mays (n,m,i,t5,t3); NRRL 26132 = CBS 429.97
= MRC 6648, South Africa, Z. mays (m,t5); NRRL 26133
=CBS 430.97 = MRC 6657, South Africa, Z. mays (m,t5);
NRRL 26134 = CBS 431.97 = MRC 6660, South Africa,
Z. ma)'S (m,t5).
Fusarium guttiforme NRRL 22945 = CBS 184.29 = IMI
375350 = DAOM 225144, England, Ananas comosus
(n,m,i,t5,t3); NRRL 25037 = ATCC 38067 = BBA 69665,
Brazil, A. comosus (t5); NRRL 25038 = ATCC 42089, Bra-
zil, A. comosus (t5); NRRL 25295 = JAV E248 = BBA
69661 = CBS 409.97 = IMI 376113 (ex holotype), Brazil,
A. comosus (n,m,i,t5,t3); NRRL 25296 = JAV E/RG 3381,
Brazil, A. comosus (t5); NRRL 25297 = JAV E/RG 3383
= BBA 69663, Brazil, A. comosus (t5); NRRL 25298 = JAV
E/RG 3384 = BBA 69664 = CBS 410.97, Brazil, A. com-
osus (t5); NRRL 25384 = ATCC 52602, Hawaii, A. como-
490 MYCOLOGIA
sus (t5); NRRL 25624 = MRC 6784 = BBA 69860, Brazil,
A. comosus (t5).
Fusarium inflexum NRRL 20433 = CBS 716.74 = BBA
63203 = IMI 375336 = DAOM 225130 (ex holotype),
Germany, Vicia Jaba (n,m,i,t5,t3).
Fusarium lactis NRRL 25200 = BBA 68590 = TM F41 =
CBS 411.97 = IMI 375351 = DAOM 225145 (ex neotype),
CA, USA, Ficus carica (n,m,i,t5,t3); NRRL 25334 = TM
Fl = BBA 69865, CA, USA, F. carica (t5); NRRL 25338
= TM Fl3 = BBA 68591 = CBS 420.97, CA, USA, F.
carica (t5); NRRL 25339 = TM Fl5 = BBA 69866, CA,
USA, F. carica (t5); NRRL 25340 = TM FIB, CA, USA, F.
carica (t5); NRRL 25344 = TM F64, CA, USA, F. carica
(t5).
Fusarium napiforme NRRL 13604 = FRC M-3563 = CBS
748.97 = BBA 69861 = DAOM 225147 = IMI 375353 (ex
holotype), South Mrica, Pennisetum typhoides
(n,m,i,t5,t3); NRRL 25196 = FRC M-3560 = BBA 67629,
South Mrica, P. typhoides (t5); NRRL 25201 = FRC M-
3566 = BBA 67630, South Mrica, P. typhoides (t5).
Fusarium neoceras See Fusarium sacchari
Fusarium nisikadoi NRRL 25179 = BBA 69009 = CBS
742.97 = IMI 375333 = MAFF 237509 = DAOM 225127,
Japan, Phyllostachys nigra var. henonis (n,m,i,t5,t3); NRRL
25183 = BBA 69010 = MAFF 237510,Japan, P. nigravar.
henonis (t5); NRRL 25191 = BBA 69016 =CBS 412.97
= MAFF 237508,Japan, P. nigravar. henonis (t5); NRRL
25203 = BBA 69014 = MAFF 237507,Japan, P. nigravar.
henonis (t5); NRRL 25308 = BBA 69015 = CBS 456.97
= MAFF 237506 = IMI 376111 (exholotype),Japan, Trit-
icum aestivum (t5); NRRL 25327 = CBS 209.76 = BBA
69597, isolated at CBS, The Netherlands, nut (t5).
Fusarium nygamai MP-G NRRL 13448 = ATCC 58555 =
FRC M-1375 = CBS 749.97 = BBA 69862 = IMI 375354
= DAOM 225148 (ex holotype), Australia, Sorghum bicolor
(n,m,i,t5,t3); NRRL 22106 = CBS 834.85, India, Cajanus
sp. (n,m,i,t5,t3); NRRL 25312 = BBA 64375 = CBS
572.94, India, Cajanus sp. (t5); NRRL 25449 = BBA
63175, Morocco, Oryza sativa (m,t5); NRRL 25450 =
BBA 65861, Sudan, Striga hermonthica (m,t5); NRRL
25596 = ATCC 15645, Greece, Nicotiana tabacum (t5).
Fusarium oxysporum NRRL 13307 = FRC 0-1080, FL, USA,
Lycopersicon esculentum (n,m,i,t5,t3); NRRL 22518 =
ATCC 32669, MI, USA, [f. sp. melonis] Cucumis melo var.
cantalupensis (cantalope) (n,m,i,t5); NRRL 22519 =
ATCC 28856, France, [f. sp. melonis] Cucumis melo var.
reticulatus (muskmelon) (n,m,i,t5); NRRL 22520 = ATCC
62166, MD, USA, [f. sp. melonis] Cucumis melo var. can-
talupensis (cantaloupe) (n,m,i,t5); NRRL 22521 = ATCC
32780, Belgium, [f. sp. melonis] Cucumis melo var. reticu-
latus (muskmelon) (n,m,i,t5); NRRL 22533 = CBS
244.61 = BBA 8388, Germany, [f. sp. aechmeae] Aechmea
Jascicata (n,m,i,t5); NRRL 22534 = CBS 175.35 = BBA
5709, Germany, [f. sp. apii] (n); NRRL 22535 = CBS
172.30, Germany, [f. sp. batatas] Ipomoea batatas
(n,m,t5); NRRL 22536 = CBS 182.35 = BBA 5629, Ger-
many, [f. sp. callistephi] (n,m,i,t5); NRRL 22537 = CBS
742.79 = BBA 62302, Germany, [f. sp. cattlryae] Phalaen-
opsis sp.(n,m,i,t5); NRRL 22538 = CBS 192.35 = BBA
2906, Germany, [f. sp. cepae] (n,m,t5); NRRL 22539 =
CBS 129.81 = BBA 63926, FL, USA, [f. sp. chrysanthemi]
Chrysanthemum sp. (n,m,i,t5); NRRL 22541 = CBS
149.25, unknown, [f. sp. cubense] Musa sp. (n,m,i,t5);
NRRL 22542 = CBS 159.57 = BBA 7022 [f. sp. cyclam-
inis] Cyclamen persicum (n,m,i,t5); NRRL 22543 = CBS
783.83, Surinam, [f. sp. elaeidis] Elaeis guineenis
(n,m,i,t5); NRRL 22544 = CBS 167.30, unknown, [f. sp.
lycopersici] Lycopersicon esculentum (n,m,i,t5); NRRL
22545 = CBS 247.61 = BBA 8398, Germany, [f. sp. mat-
thiolae] Matthiola incana (n,m,i,t5); NRRL 22547 = CBS
196.65 = BBA 8713, Germany, [f. sp. narcissi] Narcissus
sp. (n,m,t5); NRRL 22548 = CBS 744.79 = BBA 62349,
Germany, [f. sp. opuntiarum] Zygocactus truncatus
(m,i,t5); NRRL 22549 =CBS 744.79 = BBA 62355, Brazil,
[f. sp. passijlorae] Passijlora edulis (n,m,i,t5); NRRL
22550 = CBS 794.70 = BBA 11103, Iran, [f. sp. pernicios-
um] Albizia jublibrissin (n,m,i,t5); NRRL 22551 = CBS
171.31, Germany, [f. sp. pini] Pinus sp. (n,m,i,t5); NRRL
22552 =CBS 180.29, Germany, [f. sp. pisi] Pisum sativum
(n,m,i,t5); NRRL 22553 = CBS 488.76, Germany, [f. sp.
raphani] Raphanus sativus (n,m,i,t5); NRRL 22554 =
CBS 130.81 = BBA 63927, Nigeria, [f. sp. tracheiphilum]
Chrysanthemum sp.(n,m,i,t5); NRRL 22555 =CBS 797.70
= BBA II 096, Iran, [f. sp. tuberosi] Solanum tuberosum
(n,m,i,t5); NRRL 22556 =CBS 242.59 = BBA 8248, Ger-
many, [f. sp. tulipae] Tulipa sp.(n,m,i,t5); NRRL 22557 =
CBS 173.28, unknown, [f. sp. vasinfectum] Gossypium sp.
(n,m,i,t5); NRRL 22902 = BCRI 9065I = DAOM 225129
= IMI 375335, ID, USA, Pseudotsuga menziesii
(n,m,i,t5,t3); NRRL 25039 =AD I, Canada, Pinus strobus
(m,i,t5); NRRL 25040 = AD 2, Canada, P. strobus (m,i);
NRRL 25041 = AD 3, Canada, P. strobus (m,i); NRRL
25042 =AD 7, Canada, P. strobus (m,i); NRRL 25044 =
AD 11, Canada, P. strobus (m,i); NRRL 25045 =AD 12,
Canada, P. strobus (m,i); NRRL 25047 =AD 15, Canada,
P. strobus (m,i); NRRL 25050 = AD 28, Canada, P. strobus
(m,i); NRRL 25051 = AD 29, Canada, P. strobus (m,i);
NRRL 25250 = HK F41, Poland, P. sylvestris, nursery soil
(m,t5); NRRL 25353 = TRG RA-4E, CA, USA, muskmel-
on root (n,m,i,t5,t3); NRRL 25356 = CA 92015, France,
soil (m,i,t5,t3); NRRL 25357 = CA 91142, France, soil
(m,i,t5,t3); NRRL 25358 = CA 92B42, France, soil (m,t5);
NRRL 25359 = CA 91294, France, soil (m,i,t5,t3); NRRL
25360 = CA 92L83, France, soil (m,t5); NRRL 25361 =
CA 92018, France, soil (m,i,t5,t3); NRRL 25362 = CA
91238, France, soil (m,i,t5,t3); NRRL 25363 = CA 92M45,
France, soil (m,t5); NRRL 25366 = CK 22410, Queens-
land, Australia, Musa sp. (m,i,t5,t3); NRRL 25367 = CK
MV44, Malawi, Musa sp. (m,i,t5,t3); NRRL 25387 =
ATCC 26225, New Zealand, Homo sapiens (n,m,i,t5,t3);
NRRL 25594 = ATCC 16415, SC, USA, [f. sp. batatas]
Ipomoea batatas (m,t5); NRRL 25595 = ATCC 11938, MD,
USA, [f. sp. batatas] Ipomoea batatas (m,t5); NRRL 25598
= ATCC 18774, unknown, [f. sp. glycines] Glycine max
(m,t5); NRRL 25603 = CKA2, Australia, Musasp. (m,t5);
NRRL 25604 = CK 22615, NSW, Australia, Musa sp.
(m,t5); NRRL 25605 = CK FOOOI, Natal, South Mrica,
Musa sp. (m,t5); NRRL 25606 = CK STPA2, Tanzania,
Musa sp. (m,t5); NRRL 25607 = CK B2-l, FL, USA, Musa
sp. (m,t5); NRRL 25608 = CKJLTH20, Ban Nok, Thai-
 O'D0:-1!\:ELL ET AL.: FuSARIUM MOLECUL\R PH\LOGENY
land, Musa sp. (m,t5); NRRL 25609 = CK MW2, Misuku,
Karonga, Malawi, Musa sp. (m,t5).
Fusarium phyllophilum NRRL 13296 = FRC M-1219, Ger-
many, Sanseviera dooneri (n,m,i,t5,t3); NRRL 13617 =
CBS 216.76 = BBA 11730 = BBA 63625 = IMI 20287 4
= IMI 375338 = DAOM 225132, Italy, Dracaena deremen-
sis (n,m,i,t5,t3); NRRL 25053 =CBS 246.61 = BBA 7983,
Germany, Sanseviera dooneri (t5) ; NRRL 251 78 = NRRL
25218 = BBA 63625, Italy, Dracaena deremensis (t5);
NRRL 25219 = BBA 63618, Germany, Sanseviera dooneri
(t5); NRRL 25305 = BBA 11833 = BBA 63639, Germany,
Gastera excarvata (n,m,i,t5,t3).
Fusarium proliferatum MP-D NRRL 13569 = IMI 300795 =
ATCC 42112, CA, USA, Zea mays (n); NRRL 13583 =
FRC M-1300, Finland, poultry feed (m,t5); NRRL 13584
= FRC M-1327, Japan, river sediment (m,t5); NRRL
13585 = FRC M-1293, India, Triticum sp. (m,t5); NRRL
20983 = JFL 996 = FRC M-3701, IN, USA, Sorghum hi-
color (m,t5); NRRL 22003 = JFL 1591 = FRC M-5360,
China, Zea mays (m,i,t5); NRRL 22025 = JFL 2930 = FRC
M-3777, AL, USA, Sorghum bicolor (m,t5); NRRL 22032 =
JFL 2959 = FRC M-3813, SC, USA, Nicotiana tabacum
(m,t5); NRRL 22057 = JFL 4853 (n,i,t3); NRRL 22058 =
JFL 4854 (t5); NRRL 22944 =CBS 217.76 = BBA 11341
= BBA 63624 = IMI 375339 = DAOM 225133, Germany,
Cattleya hybrid (n,m,i,t5,t3); NRRL 22948 =CBS 267.93,
Indonesia, unknown (n,m,i,t5); NRRL 25006 = FRC M-
5991 (n,m,i,t5); NRRL 25054 = CBS 620.80, England, Si-
tobion avenae (t5); NRRL 25060 = CBS 182.32, CA, USA,
Ficus carica (t5); NRRL 25082 = ARSEF 1310, Morocco,
Sitona discoideus [Coleoptera: Curculionidae] (m,i,t5);
NRRL 25089 = ARSEF 2337, ID, USA, Rhopalosiphum
padi [Homoptera: Aphididae] on Zea mays (m,i,t5);
NRRL 25091 = ARSEF 2568, GA, USA, Chalcodermus ae-
neus [Coleoptera: Curculionidae] (m,i,t5); NRRL 25175
= BBA 69071 = MAFF 236459, Japan, Triticum aestivum
(t5); NRRL 25177 = BBA 69013 = MAFF 237651,Japan,
T. aestivum (t5); NRRL 25182 = BBA 69070 = MAFF
236458, Japan, T. aestivum (t5); NRRL 25207 = BBA
65640, Uzbekistan, Morus alba (t5); NRRL 25222 = BBA
69540, Argentina, soil (t5); NRRL 25223 = BBA 69541,
Argentina, soil (i,t5); NRRL 25225 = IMI 316829, Paki-
stan, Trigonella foecum (t5); NRRL 25227 = IMI 305089,
unknown, Caryota mitis (t5); NRRL 25306 = BBA 69011
= MAFF 236463, Japan, Triticum aestivum (n,m,i,t5,t3);
NRRL 25307 = BBA 11345 = BBA 63634, Germany, Cat-
tleya sp. (t5); NRRL 25320 = BBA 69589, Russia, Gossyp-
iumsp. (t5); NRRL 25335 = TM F4, CA, USA, Ficus carica
(t5); NRRL 25336 = TM F5, CA, USA, F. carica (t5);
NRRL 25337 = TM F6, CA, USA, F. carica (t5); NRRL
25376 = IMI 183478, Australia, bovine liver.
Fusarium pseudoanthophilum NRRL 25206 = BBA 69030 =
CBS 745.97 = IMI 375340 = Frank GW23 = DAOM
225134, Gweru, Zimbabwe, Zea mays (n,m,i,t5,t3); NRRL
25209 = BBA 69003 =CBS 415.97 =Frank KA18, Karoi,
Zimbabwe, Z. mays (t5); NRRL 25210 = BBA 69004 =
IMI 360543 = Frank GW24, Gweru, Zimbabwe, Z. mays
(t5); NRRL 25211 = BBA 69002 = CBS 414.97 = Frank
12-KW20 = IMI 376112 (ex holotype), Gambiza, Zimba-
bwe, Z. mays (n,m,i,t5,t3).
491
Fusarium pseudocircinatum NRRL 22946 = CBS 126.73 =
CBS 449.97 = IMI 375316 = BBA 69636 = DAOM
225117 (ex holotype), Ghana, Solanum sp. (n,m,i,t5,t3);
NRRL 25034 = ARSEF 2301 =CBS 455.97 = BBA 69598,
Papua New Guinea, Heteropsylla incisa [Homoptera: Psyl-
lidae] (n,m,i,t5,t3); NRRL 25372 = IMI 294599 = BBA
69723, Philippines, Pinus kesiya (m,t5); NRRL 25737 =
QM 553, Barro Colorado Island, Panama, textile (m, t5);
NRRL 25738 = QM 612 = BBA 70134, Barro Colorado
Island, Panama, dead leaves (m, t5).
Fusarium pseudonygamai NRRL 6022 = BBA 69551 = CBS
416.97 = MRC 1412, Nigeria, Pennisetum typhoides
(n,m,i,t5,t3); NRRL 13592 = FRC M-1166 = BBA 69552
= CBS 417.97 = IMI 375342 = DAOM 225136 (ex ho-
lotype), Nigeria, P. typhoides (n,m,i,t5,t3).
Fusarium ramigenum NRRL 25208 = BBA 68592 = TM F50
= CBS 418.97 = IMI 375343 = DAOM 225137 (ex ho-
lotype), CA, USA, Ficus carica (n,m,i,t5,t3); NRRL 25212
= BBA 68593 = TM F62 = CBS 526.97, CA, USA, F.
carica (t5); NRRL 25341 = TM F21, CA, USA, F. carica
(t5); NRRL 25685 = BBA 69864 = TM F61, CA, USA, F.
carica (m, t5).
Fusarium redo/ens NRRL 22901 = BCRI F30 = CBS 743.97
= IMI 375334 = DAOM 225128, B.C., Canada, Pseudo-
tsuga menz.iesii (n,m,i,t5,t3); NRRL 25123 = ARSEF 4011,
Denmark, Lilioceris lilii [Coleoptera: Chrysomelidae]
(i,t5); NRRL 25600 = CBS 248.61 = CBS 360.87 = BBA
9526 = DSM 62390 = ATCC 16067, Dianthus caryophyl-
lus, Germany (ex holotype) (m, t5); NRRL 25602 = DSM
62386, Germany, Fritillaria sp. (m,t5).
Fusarium sacchari MP-B NRRL 13295 = FRC M-1217, Ger-
many, Cattleya sp. (n,m,i,t5); NRRL 13999 = CBS 223.76
= BBA 63340 = IMI 375344 = DAOM 225138, India,
Saccharum officinarum (n,m,i,t5,t3); NRRL 20471 =CBS
147.25 = BBA 69863 = IMI 375345 = DAOM 225140 (ex
holotype of F. neoceras), Honduras, Musa sapientum
(n,m,i,t5,t3); NRRL 20957 = JFL 0278, Taiwan, S. offici-
narum (m,t5); NRRL 22006 = JFL 1728, Philippines, Sor-
ghum bicolor (m,t5); NRRL 22038 = JFL 3820 = BBA
63342 = FRC M-942, India, S. of.ficinarum (m,t5); NRRL
22042 = JFL 3828 = FRC M-1217 = BBA 62260, Ger-
many, Cattleya sp. (m,t5); NRRL 22043 = JFL 3852
(n,i,t5,t3); NRRL 22044 = JFL 3853 (t5); NRRL 25031 =
ARSEF 2141, India, Scirpophaga excerptalis [Lepidoptera:
Pyralidae] (t5); NRRL 25032 = ARSEF 2143, India, Pyr-
illa perpusilla [Hemiptera: Lophopidae] (t5); NRRL
25033 = ARSEF 2145, India, Pulvinaria elongata [Ho-
moptera: Coccidae] (t5); NRRL 25061 = CBS 134.73,
Guyana, S. of.ficinarum (t5); NRRL 25090 = ARSEF 2418,
India, Emmalocera depressella [Lepidoptera: Phycitinae]
(m,i,t5); NRRL 25139 = ARSEF 2142, India, Chilo sac-
chariphagus indicus [Lepidoptera: Pyralidae] (m,i,t5);
NRRL 25140 = ARSEF 2144, India, Pyrilla perpusilla [He-
miptera: Lophopidae] (m,i,t5); NRRL 25310 = BBA
63320, India, S. of.ficinarum (n,m,i,t5,t3); NRRL 25664 =
ITEM 805, Guatemala, M. sapientum (m, t5); NRRL
25665 = ITEM 806, Guatemala, M. sapientum (m, t5).
Fusarium subglutinans MP-E NRRL 13588 = FRC M-1294,
lA, USA, Zea mays (n,m,i,t5); NRRL 13599 = FRC M-
1351, Zambia, Z. mays (n,m,i,t5); NRRL 20844 = CBS
492 MYCOLOGIA
215.76 = BBA 10351 = BBA 62621, Germany, Z. mays
(n,m,i,t5); NRRL 20981 = JFL 990 = FRC M-3696 = BBA
65921, IL, USA, Z. mays (t5); NRRL 22002 = JFL 1583
= FRC M-5352, China, Z. mays (m,i,t5); NRRL 22016 =
JFL 2192 = CBS 747.97 = IMI 375346 = DAOM 225141
= FRC M-3693, IL, USA, Z. mays (n,m,i,t5,t3); NRRL
22034 = JFL 3809 = BBA 11157 =BBA 62275 = FRC M-
845, Iran, Z. mays (m,t5).
Fusarium succisae NRRL 13298 = FRC M-1221, Germany,
Succisa pratensis (n,m,i,t5); NRRL 13613 = CBS 219.76
= BBA 12287 = BBA 63627 = IMI 375347 = DAOM
225142, Germany, S. pratensis (n,m,i,t5,t3); NRRL 25215
= BBA 63162, Germany, S. pratensis (t5).
Fusarium thapsinum MP-F NRRL 22007 = JFL 1733 = BBA
69581 = FRC M-5487, Philippines, Sorghum bicolor
(m,i,t5); NRRL 22028 = JFL 2942 = BBA 69584 = FRC
M-3790, MS, USA, S. bicolor (m,t5); NRRL 22045 = JFL
3869 = CBS 733.97 = IMI 375317 = DAOM 225109 =
MRC 6002, South Africa, S. bicolor (n,m,i,t5,t3); NRRL
22048 = JFL 4092 = BBA 69582 = FRC M-6562
(n,i,t5,t3); NRRL 22049 = JFL 4093 = BBA 69583 =CBS
776.96 = FRC M-6563 = ATCC 200521 (ex holotype)
(t5); NRRL 22054 = JFL 4440 = FRC M-6519, Thailand,
Musa sp. (m,t5); NRRL 25229 = IMI 240460, Italy, Homo
sapiens ( t5) .
Fusarium udum NRRL 22114 = NRRL 25194 = CBS 747.79
=CBS 451.97 = BBA 10725 = BBA 62451, India, Cajanus
cajan (n,m,i,t5); NRRL 22540 =CBS 211.58 (exholotype
of F. oxysporum f. sp. crotalariae), Brazil, Crotalaria sp.
(n,m,i,t5,t3); NRRL 22949 =CBS 178.32 = IMI 375319 =
DAOM 225111, Germany, unknown (n,m,i,t5,t3); NRRL
25192 = BBA 65056 =CBS 419.97, India, Crotolariajuncea
(t5); NRRL 25199 = BBA 65058, India, Cajanus cajan (t5);
NRRL 25313 = BBA 64843, India, Crotolaria juncea (t5);
NRRL 25610 = IMI 193652, India, Cajanus cajan
(n,m,i,t5); NRRL 25611 = IMI 170431, India, Crotolaria
verrucosa (n,m,i,t5); NRRL 25612 = IMI 241426, India,
Cicer arietinum (n,m,i,t5); NRRL 25613 = IMI 271070, Ma-
lawi, Cajanus cajan (n,m,i,t5); NRRL 25614 = IMI 275452,
Malawi, Cajanus cajan (n,m,i,t5).
Fusarium verticillioides MP-A NRRL 6396 = ATCC 24088,
AK, USA, chicken feed (n,m,i,t5); NRRL 6397 = ATCC
24089, AK, USA, chicken feed (n,m,i,t5); NRRL 6442 =
ATCC 46035, Egypt, corn (n,m,i,t5); NRRL 13563 =
ATCC 52131, NC, USA, Pinus taeda (n); NRRL 20956 =
JFL 149 = FRC M-3125, CA, USA, Zea mays (t5); NRRL
20960 = JFL 488 = FRC M-1325 = MRC 0826, South
Africa, Z. mays (m,t5); NRRL 20984 = JFL 999 = FRC
M-3703 = BBA 65898, IN, USA, Z. mays (n,i,t3); NRRL
22001 = JFL 1562 = FRC M-5331, China, Ory-za sativa
(m,t5); NRRL 22050 = JFL 4362, Egypt, Sorghum bicolor
(m,t5); NRRL 22052 = JFL 4424 = FRC M-6536, Thai-
land, Musa sp. (m,t5); NRRL 22055 = JFL 4516 = FRC
M-5500, Nepal, Z. mays (m,t5); NRRL 22172 = BBA
11778 = BBA 62264 = CBS 734.97 = IMI 375318 =
DAOM 225110, Germany, Z. mays (n,m,i,t5,t3); NRRL
25029 = ARSEF 3223, India, Nilaparvata lugens [Ho-
moptera: Delphacidae] (n,m,i,t5,t3); NRRL 25035 =
ATCC 46493, Equador, Elaeis guineensis (t5); NRRL
25055 =CBS 579.78, MD, USA, Homo sapiens (t5); NRRL
25056 = CBS 139.40, Italy, Phyllocactus hybridus (t5);
NRRL 25057 = CBS 125.73, India, Trichosanthes dioica
(t5); NRRL 25058 = CBS 167.87, USA, Pinus sp. (t5);
NRRL 25059 = CBS 624.87, Honduras, Musa sapientum
(t5); NRRL 25087 = ARSEF 2252, France, [Diptera: Bi-
bionidae] on Solidago sp. (m,i,t5); NRRL 25102 = ARSEF
3300, Mexico, Spodoptera frugiperda [Lepidoptera: Noc-
tuidae] on Zea mays (m,i,t5); NRRL 25111 = ARSEF
3673, CA, USA, Bemisia tabaci [Homoptera: Aleyrodidae]
on Citrus limon (lemon tree) (m,i,t5); NRRL 25113 =
ARSEF 3675, CA, USA, B. tabaci [Homoptera: Aleyrodi-
dae] on Bauhinia variegata (orchid tree) (m,i,t5); NRRL
25114 = ARSEF 3676, Mexico, B. tabaci [Homoptera: A 1-
eyrodidae] (m,i,t5); NRRL 25115 = ARSEF 3677, Mexico,
USA, B. tabaci [Homoptera: Aleyrodidae] on Brassica
oleracea var. botrytis (cauliflower) (m,i,t5); NRRL 25116 =
ARSEF 3678, CA, USA, B. tabaci [Homoptera: Aleyrodi-
dae] on Brassica oleracea var. botrytis (broccoli) (m,i,t5);
NRRL 25117 = ARSEF 3679, Mexico, B. tabaci [Homop-
tera: Aleyrodidae] on Brassica oleracean (kale) (m,i,t5);
NRRL 25228 = IMI 244440, NC, USA, Homo sapiens (t5);
NRRL 25368 = IMI 316823, India, Trigonellafeonum-grae-
cum (m,t5); NRRL 25370 = IMI 312010, Ghana, Triplo-
chiton scleroxylon (m,t5); NRRL 25383 = ATCC 60858,
Canada, Alligator mississipiensis (n,m,t5); NRRL 25616 =
BBA 63172, India, Ory-za sativa ( t5).
Fusarium sp. 22903 NRRL 22900 = BCRI P4C2Pl7A, B.C.,
Canada, Pseudotsuga men-ziesii (n,m,i,t5,t3); NRRL 22903
= BCRI 3139 = IMI 375363 = DAOM 225157, OR, USA,
P. men-ziesii (n,m,i,t5,t3); NRRL 25043 =AD 31, Ontario,
Canada, Pinus strobus (i); NRRL 25049 = AD 27, Ontario,
Canada, P. strobus (n,m,i); NRRL 25052 =AD 30, Ontar-
io, Canada, P. strobus (i).
Fusarium sp. 25184 NRRL 25184 = BBA 65467 = CBS
573.94 = IMI 375332 = DAOM 225126, Germany, peat
soil (n,m,i,t5,t3); NRRL 20702 = NRRL 25186 = CBS
841.85 = BBA 64572, Germany, Vitis vinifera (t5); NRRL
25187 = BBA 64573, Germany, V. vinifera (t5); NRRL
25317 = BBA 64596, Germany, V. vinifera (t5).
Fusarium sp. 25195 NRRL 25195 = BBA 65676 = GJS 90-
248 = IMI 375357 = DAOM 225151, Venezuela, wood
(n,m,i,t5,t3).
Fusarium sp. 25204 NRRL 25204 = BBA 65668 = GJS 90-
215 = IMI 375356 = DAOM 225150, Venezuela, palm
(n,m,i,t5,t3).
Fusarium sp. 25221 NRRL 25221 = BBA 69031 = IMI
375355 =Frank 5bCn8 = DAOM 225149, Chinhoyi, Zim-
babwe, Zea mays (n,m,i,t5,t3).
Fusarium sp. 25226 NRRL 25226 = IMI 304063 = IMI
375361 = BBA 69662 = DAOM 225155, India, Mangifera
indica (n,m,i,t5,t3).
Fusarium sp. 25303 NRRL 25303 = BBA 69021 = IMI
375360 = MAFF 237649 = DAOM 225154,Japan, Ory-za
sativa (n,m,i,t5,t3).
Fusarium sp. 25309 NRRL 25309 = BBA 69012 = IMI
375359 = MAFF 237650 = DAOM 225153, Japan, Triti-
cum aestivum (n,m,i,t5,t3).
Fusarium sp. 25346 NRRL 25346 = CC 91-8-1 = FRC L-286
= BBA 69725 = IMI 375358 = DAOM 225152, Peru,
Ipomoea batatas (n,m,i,t5,t3).
 Q'DOK:-JELL ET AI..: FuSARIUM MOLECULAR PHYLOGENY
Fusarium sp. 25483 NRRL 25483 = CBS 217.78 = BBA
63778 = IMI 375362 = DAOM 225156, Namibia, Penni-
setum typhoideum (n,m,i,t5,t3).
Fusarium sp. 25807 NRRL 25807 = DAR 70287 = BBA
69872 (ex holotype) and holotype not authentic for F.
babinda, Australia, forest soil (n,m,i,t5,t3).
Coding of loci sequenced: n = nuclear large subunit 28S
rONA; m = mitochondrial small subunit rONA; i = nuclear
rONA internal transcribed spacer; t5 = [3-tubulin gene,
exon #I to exon #4; t3 = [3-tubulin gene, exon #4 and exon
#5.
Strain Source: AD = A. Duggal, Department of Forestry,
University of Toronto, Toronto, Canada; ATCC =American
Type Culture Collection, Rockville, MD; ARSEF = ARS Col-
lection of Entomopathogenic Fungi, Ithaca, NY; BBA =
Biologische Bundesanstalt fiir Land- und Forstwirtschaft,
Berlin, Germany; BCRI = British Columbia Research Inc.,
Vancouver, Canada; CA = C. Alabouvette, Institut National
de Ia Recherche Agronomique, Dijon, France; CBS = Cen-
traalbureau voor Schimmelcultures, Baarn, The Nether-
lands; CC = C. Clark, Department of Plant Pathology &
Crop Physiology, Louisiana State University, Baton Rouge,
LA; CK = C. Kistler, Plant Pathology Department, Univer-
493
sity of Florida, Gainesville, FL; DAOM = Department of
Agriculture (Mycology), Agriculture and Agri-Food Canada,
Ottawa, Canada; DAR = New South Wales Department of
Agriculture, Plant Pathology Herbarium, Rydalmore, N. S.
W., Australia; DB = D. Backhouse, Department of Crop Sci-
ences, University of Sydney, New South Wales, Australia;
DSM = Deutsche Sammlung von Mikroorganismen und
Zellkulturen, Braunschweig, Germany; Frank = J. M. Frank,
University of Surrey, Guildford, England; FRC = Fusarium
Research Center, Pennsylvania State University, University
Park, PA; GJS = G. J. Samuels, USDA-ARS, BARC-West,
Beltsville, MD; HK = H. Kwasna, Akademia Rolnicza, Ka-
tedra Fitopatologii Lefmej, Poznan, Poland; IMI = Inter-
national Mycological Institute, Egham, England;JAV = J. A.
Ventura, Empresa Capixaba de Pesquisa Agropecudria, Vi-
t6ria-ES, Brazil; JFL = J. F. Leslie, Department of Plant Pa-
thology, Kansas State University, Manhattan, KS; MAFF =
Ministry of Agriculture, Forestry and Fisheries, NIAR, Tsu-
kuba, Japan; MRC = Medical Research Council, Tygerberg,
South Mrica; NRRL = Northern Regional Research Labo-
ratory = NCAUR, Peoria, IL; QM = Quartermaster Culture
Collection housed at NCAUR, Peoria, IL; TM = T. J. Mi-
chailides, Kearney Agricultural Center, University of Cali-
fornia, Parlier, CA; TRG = T. R. Gordon, Department of
Plant Pathology, University of California, Davis, CA.