Professional Documents
Culture Documents
D2 2 Chordata Aktivitas 3.4
D2 2 Chordata Aktivitas 3.4
D2 2 Chordata Aktivitas 3.4
Primer-BLAST
» JOB ID:190ICsbJy2HsX9Fa3Dr1aKYh5FqLMv9Hig
Primer-BLAST Results
Help
Input PCR template
none
Specificity of primers
Target templates were found in selected database: Nucleotide collection (nt) (Organism limited to
Chordata)
Other reports
Search Summary
>OQ387763.1 Glossogobius aureus voucher PI-0097 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>OQ387044.1 Glossogobius aureus voucher PI-0098 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>OQ386882.1 Glossogobius aureus voucher PIL-362 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>OQ386818.1 Glossogobius aureus voucher PI-0096 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>OM674615.1 Glossogobius aureus cytochrome c oxidase subunit I (COX1) gene, partial cds;
mitochondrial
>MW498632.1 Glossogobius aureus voucher SP-119-1 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW498630.1 Glossogobius aureus voucher SP-119-5 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW498629.1 Glossogobius aureus voucher SP-119-4 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW498628.1 Glossogobius aureus voucher SP-119-3 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW498627.1 Glossogobius aureus voucher SP-119-2 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021711.1 Glossogobius aureus voucher PGA-TG3 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021710.1 Glossogobius aureus voucher PGA-TG4 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021709.1 Glossogobius aureus voucher PGA-TG7 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021708.1 Glossogobius aureus voucher PGA-TG9 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021706.1 Glossogobius aureus voucher PGA-TG15 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021705.1 Glossogobius aureus voucher PGA-TG16 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021704.1 Glossogobius aureus voucher PGA-TG17 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021703.1 Glossogobius aureus voucher PGA-TG40 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021702.1 Glossogobius aureus voucher PGA-TG42 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021700.1 Glossogobius aureus voucher PGA-NG1 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
product length = 317
Forward primer 1 CTCCTCCTTTCATCTTCTTGGG 22
Template 249 ...................... 270
>MW021699.1 Glossogobius aureus voucher PGA-NG2 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021698.1 Glossogobius aureus voucher PGA-NG3 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021697.1 Glossogobius aureus voucher PGA-NG4 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021695.1 Glossogobius aureus voucher PGA-BTG2 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021694.1 Glossogobius aureus voucher PGA-BTG3 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021692.1 Glossogobius aureus voucher PGA-BTG5 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021691.1 Glossogobius aureus voucher PGA-BTG6 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021690.1 Glossogobius aureus voucher PGA-BTG7 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021689.1 Glossogobius aureus voucher PGA-BTG8 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021688.1 Glossogobius aureus voucher PGA-BTG9 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021674.1 Glossogobius aureus voucher PGA-LG8 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021671.1 Glossogobius aureus voucher PGA-LG25 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021666.1 Glossogobius aureus voucher PGA-LGsp5 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
product length = 317
Forward primer 1 CTCCTCCTTTCATCTTCTTGGG 22
Template 249 ...................... 270
>MW021662.1 Glossogobius aureus voucher PGA-NG6 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021661.1 Glossogobius aureus voucher PGA-NG18 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021659.1 Glossogobius aureus voucher PGA-NG30 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021658.1 Glossogobius aureus voucher PGA-NG31 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021657.1 Glossogobius aureus voucher PGA-NG32 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021656.1 Glossogobius aureus voucher PGA-NG40 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>OK043695.1 Glossogobius aureus isolate LPST1 cytochrome c oxidase subunit I (COX1) gene,
partial cds; mitochondrial
>MW574820.1 Glossogobius aureus voucher NTM21-07 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574793.1 Glossogobius aureus voucher NTM21-06 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574780.1 Glossogobius aureus voucher NTM21-29 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MK777324.1 Glossogobius aureus voucher DOS04901 cytochrome c oxidase subunit I (COI) gene,
partial cds; mitochondrial
>MH721180.1 Glossogobius aureus isolate VN_B2 cytochrome oxidase subunit I (COI) gene, partial
cds; mitochondrial
>MG407403.1 Glossogobius cf. aureus JPQ-2018 voucher BLF-Gsp2 cytochrome oxidase subunit 1
(COI) gene, partial cds; mitochondrial
>MG407394.1 Glossogobius aureus voucher BLF-Gsp5 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>KY849519.1 Glossogobius aureus voucher AP55 cytochrome oxidase subunit 1 (COI) gene, partial
cds; mitochondrial
>KY371556.1 Glossogobius aureus voucher SCS85 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>KX352738.1 Glossogobius aureus voucher COFRTN 0017 cytochrome oxidase subunit I (COI)
gene, partial cds; mitochondrial
>KT951787.1 Glossogobius aureus voucher GCY-JLS cytochrome oxidase subunit I (COI) gene,
partial cds; mitochondrial
>KJ013044.1 Glossogobius aureus voucher DB 12.1 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>KC789535.1 Glossogobius aureus voucher PNT-35 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>KC789534.1 Glossogobius aureus voucher PNT-34 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>KC789533.1 Glossogobius aureus voucher PNT-06 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MT981707.1 Glossogobius aureus voucher IFW11 cytochrome c oxidase subunit I (COX1) gene,
partial cds; mitochondrial
>HQ682689.1 Glossogobius aureus voucher Gaur2-LdB cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
product length = 317
Forward primer 1 CTCCTCCTTTCATCTTCTTGGG 22
Template 248 ...................... 269
>HQ654706.1 Glossogobius aureus voucher Gaur1 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>HQ654705.1 Glossogobius aureus voucher Gaur2 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>HQ654704.1 Glossogobius aureus voucher Gaur3 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>HQ654703.1 Glossogobius aureus voucher Gaur4 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>HQ654702.1 Glossogobius aureus voucher Gaur5 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>EF607394.1 Glossogobius aureus isolate FSCS082-06 cytochrome oxidase subunit I (COI) gene,
partial cds; mitochondrial
>OQ387122.1 Glossogobius aureus voucher PIL-363 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021707.1 Glossogobius aureus voucher PGA-TG10 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
product length = 317
Forward primer 1 CTCCTCCTTTCATCTTCTTGGG 22
Template 249 ........A............. 270
>MW021677.1 Glossogobius aureus voucher PGA-LG1 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021676.1 Glossogobius aureus voucher PGA-LG2 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021675.1 Glossogobius aureus voucher PGA-LG6 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021673.1 Glossogobius aureus voucher PGA-LG20 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021672.1 Glossogobius aureus voucher PGA-LG21 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021670.1 Glossogobius aureus voucher PGA-LG26 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021669.1 Glossogobius aureus voucher PGA-LG27 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
product length = 317
Forward primer 1 CTCCTCCTTTCATCTTCTTGGG 22
Template 249 ........A............. 270
>MW021668.1 Glossogobius aureus voucher PGA-LG34 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021652.1 Glossogobius sp. PGA-MKG1 cytochrome oxidase subunit 1 (COI) gene, partial cds;
mitochondrial
>MW021651.1 Glossogobius sp. PGA-MKG3 cytochrome oxidase subunit 1 (COI) gene, partial cds;
mitochondrial
>MW021649.1 Glossogobius sp. PGA-MKG7 cytochrome oxidase subunit 1 (COI) gene, partial cds;
mitochondrial
>MW021645.1 Glossogobius sp. PGA-LM5 cytochrome oxidase subunit 1 (COI) gene, partial cds;
mitochondrial
>MW021636.1 Glossogobius sp. PGA-LM6 cytochrome oxidase subunit 1 (COI) gene, partial cds;
mitochondrial
>MW021635.1 Glossogobius sp. PGA-LM1 cytochrome oxidase subunit 1 (COI) gene, partial cds;
mitochondrial
>MW574838.1 Glossogobius aureus voucher NTM21-46 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574836.1 Glossogobius aureus voucher NTM21-26 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574835.1 Glossogobius aureus voucher NTM21-24 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574834.1 Glossogobius aureus voucher NTM21-67 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574795.1 Glossogobius aureus voucher NTM21-18 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574784.1 Glossogobius aureus voucher NTM21-09 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574777.1 Glossogobius aureus voucher NTM21-68 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574769.1 Glossogobius aureus voucher NTM21-11 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574765.1 Glossogobius aureus voucher NTM21-20 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574723.1 Glossogobius aureus voucher NTM21-63 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574713.1 Glossogobius aureus voucher NTM21-16 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574710.1 Glossogobius aureus voucher NTM21-10 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574708.1 Glossogobius aureus voucher NTM21-27 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574703.1 Glossogobius aureus voucher NTM21-60 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574696.1 Glossogobius aureus voucher NTM21-08 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574684.1 Glossogobius aureus voucher NTM21-61 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>HQ682690.1 Glossogobius aureus voucher Gaur1-LdB cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>HQ682688.1 Glossogobius aureus voucher Gaur3-LdB cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
product length = 317
Forward primer 1 CTCCTCCTTTCATCTTCTTGGG 22
Template 248 ........A............. 269
>HQ682687.1 Glossogobius aureus voucher Gaur4-LdB cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021743.1 Glossogobius cf. aureus PGA-LGsp19 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021742.1 Glossogobius cf. aureus PGA-LGsp16 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021741.1 Glossogobius cf. aureus PGA-LGsp15 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021740.1 Glossogobius cf. aureus PGA-LGsp13 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021739.1 Glossogobius cf. aureus PGA-LGsp7 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021738.1 Glossogobius cf. aureus PGA-LGsp25 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021737.1 Glossogobius cf. aureus PGA-LGsp50 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021736.1 Glossogobius cf. aureus PGA-LGsp32 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021735.1 Glossogobius cf. aureus PGA-LGsp33 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021734.1 Glossogobius cf. aureus PGA-LGsp37 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021733.1 Glossogobius cf. aureus PGA-LGsp43 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
product length = 317
Forward primer 1 CTCCTCCTTTCATCTTCTTGGG 22
Template 249 .....T...........C.... 270
>MW021732.1 Glossogobius cf. aureus PGA-LGsp24 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021731.1 Glossogobius cf. aureus PGA-LGsp23 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW021730.1 Glossogobius cf. aureus PGA-LGsp20 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>KU944939.1 Glossogobius giuris isolate ASIZP0916711 cytochrome oxidase subunit I (COI) gene,
partial cds; mitochondrial
>MG407404.1 Glossogobius cf. aureus JPQ-2018 voucher BLF-Gsp3 cytochrome oxidase subunit 1
(COI) gene, partial cds; mitochondrial
>MG407400.1 Glossogobius cf. aureus JPQ-2018 voucher BLF-LGsp8 cytochrome oxidase subunit
1 (COI) gene, partial cds; mitochondrial
>MG407399.1 Glossogobius cf. aureus JPQ-2018 voucher BLF-LGsp3 cytochrome oxidase subunit
1 (COI) gene, partial cds; mitochondrial
>MG407398.1 Glossogobius cf. aureus JPQ-2018 voucher BLF-Gsp7 cytochrome oxidase subunit 1
(COI) gene, partial cds; mitochondrial
>MG407397.1 Glossogobius cf. aureus JPQ-2018 voucher BLF-Gsp6 cytochrome oxidase subunit 1
(COI) gene, partial cds; mitochondrial
>MG407396.1 Glossogobius cf. aureus JPQ-2018 voucher BLF-Gsp4 cytochrome oxidase subunit 1
(COI) gene, partial cds; mitochondrial
>KF714950.1 Glossogobius giuris voucher PGN158 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574833.1 Glossogobius giuris voucher NTM21-149 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574829.1 Glossogobius giuris voucher NTM21-179 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574799.1 Glossogobius giuris voucher NTM21-151 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574790.1 Glossogobius giuris voucher NTM21-183 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
product length = 317
Forward primer 1 CTCCTCCTTTCATCTTCTTGGG 22
Template 281 ........C.....C....... 302
>MW574789.1 Glossogobius giuris voucher NTM21-180 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574783.1 Glossogobius giuris voucher NTM21-184 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574782.1 Glossogobius giuris voucher NTM21-52 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574751.1 Glossogobius giuris voucher NTM21-178 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574748.1 Glossogobius giuris voucher NTM21-181 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574714.1 Glossogobius giuris voucher NTM21-53 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574693.1 Glossogobius giuris voucher NTM21-175 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574672.1 Glossogobius giuris voucher NTM21-176 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574667.1 Glossogobius giuris voucher NTM21-185 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574660.1 Glossogobius giuris voucher NTM21-150 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>JF493543.1 Glossogobius giuris voucher Smith 240.44 #4_05 cytochrome oxidase subunit 1 (COI)
gene, partial cds; mitochondrial
>MN223563.1 Peristedion liorhynchus clone XS-51 cytochrome c oxidase subunit I gene, partial
cds; mitochondrial
>JF494135.1 Peristedion weberi voucher Smith 158.1 #1_05 cytochrome oxidase subunit 1 (COI)
gene, partial cds; mitochondrial
>ON166082.1 Glossogobius giuris voucher ZSICF116 cytochrome c oxidase subunit I (COX1) gene,
partial cds; mitochondrial
>ON166069.1 Glossogobius giuris voucher ZSICF103 cytochrome c oxidase subunit I (COX1) gene,
partial cds; mitochondrial
>ON166048.1 Glossogobius giuris voucher ZSICF82 cytochrome c oxidase subunit I (COX1) gene,
partial cds; mitochondrial
>MK572223.1 Glossogobius giuris from Bangladesh cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>KX239491.1 Glossogobius giuris voucher PUMNH 43/2013 cytochrome oxidase subunit I (COI)
gene, partial cds; mitochondrial
>KT364543.1 Glossogobius giuris voucher M189 cytochrome oxidase subunit I (COI) gene, partial
cds; mitochondrial
>OR345341.1 Glossogobius giuris isolate 3530 cytochrome c oxidase subunit I (COX1) gene,
partial cds; mitochondrial
>OR345340.1 Glossogobius giuris isolate 3529 cytochrome c oxidase subunit I (COX1) gene,
partial cds; mitochondrial
>OR345338.1 Glossogobius giuris isolate Ex85F9 cytochrome c oxidase subunit I (COX1) gene,
partial cds; mitochondrial
>OR345335.1 Glossogobius giuris isolate 871 cytochrome c oxidase subunit I (COX1) gene, partial
cds; mitochondrial
>ON604209.1 Glossogobius giuris voucher RDR0952 cytochrome c oxidase subunit I (COX1) gene,
partial cds; mitochondrial
>ON604208.1 Glossogobius giuris voucher RDR0631 cytochrome c oxidase subunit I (COX1) gene,
partial cds; mitochondrial
>ON604202.1 Glossogobius giuris voucher RDR1101 cytochrome c oxidase subunit I (COX1) gene,
partial cds; mitochondrial
product length = 317
Forward primer 1 CTCCTCCTTTCATCTTCTTGGG 22
Template 169 .....T..C.....C....... 190
>ON604198.1 Glossogobius giuris voucher RDR0589 cytochrome c oxidase subunit I (COX1) gene,
partial cds; mitochondrial
>ON604196.1 Glossogobius giuris voucher RDR0980 cytochrome c oxidase subunit I (COX1) gene,
partial cds; mitochondrial
>MW574843.1 Glossogobius giuris voucher NTM21-188 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574842.1 Glossogobius giuris voucher NTM21-86 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574830.1 Glossogobius giuris voucher NTM21-15 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574825.1 Glossogobius giuris voucher NTM21-59 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574824.1 Glossogobius giuris voucher NTM21-123 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574816.1 Glossogobius giuris voucher NTM21-82 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574810.1 Glossogobius giuris voucher NTM21-98 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574807.1 Glossogobius giuris voucher NTM21-97 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574806.1 Glossogobius giuris voucher NTM21-92 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574803.1 Glossogobius giuris voucher NTM21-95 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574797.1 Glossogobius giuris voucher NTM21-13 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574796.1 Glossogobius giuris voucher NTM21-56 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574794.1 Glossogobius giuris voucher NTM21-36 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
product length = 317
Forward primer 1 CTCCTCCTTTCATCTTCTTGGG 22
Template 221 .....T..C.....C....... 242
>MW574792.1 Glossogobius giuris voucher NTM21-129 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574791.1 Glossogobius giuris voucher NTM21-159 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574787.1 Glossogobius giuris voucher NTM21-89 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574786.1 Glossogobius giuris voucher NTM21-79 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574781.1 Glossogobius giuris voucher NTM21-182 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574773.1 Glossogobius giuris voucher NTM21-125 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574767.1 Glossogobius giuris voucher NTM21-110 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574761.1 Glossogobius giuris voucher NTM21-124 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574759.1 Glossogobius giuris voucher NTM21-109 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574754.1 Glossogobius giuris voucher NTM21-166 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574747.1 Glossogobius giuris voucher NTM21-163 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574744.1 Glossogobius giuris voucher NTM21-83 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574743.1 Glossogobius giuris voucher NTM21-164 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574742.1 Glossogobius giuris voucher NTM21-96 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574740.1 Glossogobius giuris voucher NTM21-70 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574739.1 Glossogobius giuris voucher NTM21-127 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
product length = 317
Forward primer 1 CTCCTCCTTTCATCTTCTTGGG 22
Template 221 .....T..A.....C....... 242
>MW574737.1 Glossogobius giuris voucher NTM21-80 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574736.1 Glossogobius giuris voucher NTM21-94 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574729.1 Glossogobius giuris voucher NTM21-87 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574727.1 Glossogobius giuris voucher NTM21-88 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574725.1 Glossogobius giuris voucher NTM21-101 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574715.1 Glossogobius giuris voucher NTM21-160 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574700.1 Glossogobius giuris voucher NTM21-57 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574699.1 Glossogobius giuris voucher NTM21-85 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574698.1 Glossogobius giuris voucher NTM21-23 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574697.1 Glossogobius giuris voucher NTM21-58 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574695.1 Glossogobius giuris voucher NTM21-91 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574694.1 Glossogobius giuris voucher NTM21-84 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574692.1 Glossogobius giuris voucher NTM21-165 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574690.1 Glossogobius giuris voucher NTM21-128 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574686.1 Glossogobius giuris voucher NTM21-35 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574682.1 Glossogobius giuris voucher NTM21-126 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
product length = 317
Forward primer 1 CTCCTCCTTTCATCTTCTTGGG 22
Template 221 .....T..A.....C....... 242
>MW574680.1 Glossogobius giuris voucher NTM21-93 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574675.1 Glossogobius giuris voucher NTM21-81 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574674.1 Glossogobius giuris voucher NTM21-172 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574668.1 Glossogobius giuris voucher NTM21-12 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574664.1 Glossogobius giuris voucher NTM21-71 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>MW574662.1 Glossogobius giuris voucher NTM21-177 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>JF493542.1 Glossogobius giuris voucher Smith 240.44 #5_05 cytochrome oxidase subunit 1 (COI)
gene, partial cds; mitochondrial
>JF493541.1 Glossogobius giuris voucher Smith 240.44 #1 cytochrome oxidase subunit 1 (COI)
gene, partial cds; mitochondrial
>JF493539.1 Glossogobius giuris voucher Smith 240.44 #3_05 cytochrome oxidase subunit 1 (COI)
gene, partial cds; mitochondrial
>MK440700.1 Glossogobius giuris voucher BNHS FWF 925 cytochrome oxidase subunit I (COI)
gene, partial cds; mitochondrial
>ON166112.1 Glossogobius sp. ZSICF146 cytochrome c oxidase subunit I (COX1) gene, partial cds;
mitochondrial
>LR596623.1 Gambusia punctata mitochondrial COI gene for cytochrome oxidase subunit 1
>LR596617.1 Gambusia rhizophorae mitochondrial COI gene for cytochrome oxidase subunit 1
>FN545621.1 Gambusia punctata mitochondrial partial COI gene for cytochrome oxidase subunit I,
haplotype BC-31
>LC715997.1 Etelis carbunculus KAUM:I:66954 mitochondrial COX1 gene for cytochrome c oxidase
subunit 1, partial cds
>LC715996.1 Etelis carbunculus KAUM:I:66636 mitochondrial COX1 gene for cytochrome c oxidase
subunit 1, partial cds
>LC484226.1 Etelis carbunculus okinawa-69 mitochondrial COI gene for cytochrome oxidase
subunit I, partial cds
>LC484225.1 Etelis carbunculus okinawa-12 mitochondrial COI gene for cytochrome oxidase
subunit I, partial cds
product length = 317
Forward primer 1 CTCCTCCTTTCATCTTCTTGGG 22
Template 184 .........G.C......G... 205
>LR596625.1 Gambusia punctata mitochondrial COI gene for cytochrome oxidase subunit 1
>LR596624.1 Gambusia punctata mitochondrial COI gene for cytochrome oxidase subunit 1
>LR596622.1 Gambusia punctata mitochondrial COI gene for cytochrome oxidase subunit 1
>LR596621.1 Gambusia punctata mitochondrial COI gene for cytochrome oxidase subunit 1
>LR596620.1 Gambusia punctata mitochondrial COI gene for cytochrome oxidase subunit 1
>LR596619.1 Gambusia rhizophorae mitochondrial COI gene for cytochrome oxidase subunit 1
>LR596618.1 Gambusia rhizophorae mitochondrial COI gene for cytochrome oxidase subunit 1
>KU954233.1 Etelis carbunculus isolate EMAGA0491 cytochrome oxidase subunit I (COI) gene,
partial cds; mitochondrial
>KU954232.1 Etelis carbunculus isolate EMAEA1215 cytochrome oxidase subunit I (COI) gene,
partial cds; mitochondrial
>KU954231.1 Etelis carbunculus isolate EMACH1118 cytochrome oxidase subunit I (COI) gene,
partial cds; mitochondrial
>KP267665.1 Poecilopsetta praelonga isolate 74_CTWD cytochrome oxidase subunit I (COI) gene,
partial cds; mitochondrial
product length = 317
Forward primer 1 CTCCTCCTTTCATCTTCTTGGG 22
Template 281 .........G.C......G... 302
>JQ935865.1 Gambusia panuco voucher PTR200 cytochrome oxidase subunit 1 (COI) gene, partial
cds; mitochondrial
>JQ935864.1 Gambusia panuco voucher PTR198 cytochrome oxidase subunit 1 (COI) gene, partial
cds; mitochondrial
>JQ935863.1 Gambusia aurata voucher PTR131 cytochrome oxidase subunit 1 (COI) gene, partial
cds; mitochondrial
>JQ431727.1 Etelis carbunculus voucher MBIO1864.4 cytochrome oxidase subunit 1 (COI) gene,
partial cds; mitochondrial
>FN545628.1 Gambusia punctata mitochondrial partial COI gene for cytochrome oxidase subunit I,
haplotype BC-103
>FN545625.1 Gambusia punctata mitochondrial partial COI gene for cytochrome oxidase subunit I,
haplotype BC-73
>FN545624.1 Gambusia punctata mitochondrial partial COI gene for cytochrome oxidase subunit I,
haplotype BC-61
>FN545622.1 Gambusia punctata mitochondrial partial COI gene for cytochrome oxidase subunit I,
haplotype BC-40
>FN545620.1 Gambusia punctata mitochondrial partial COI gene for cytochrome oxidase subunit I,
haplotype BC-22
If you want to allow any of the unintended targets, check the box(es) next to the ones you accept
and try again to re-search for specific primers Submit
Help
FOLLOW NCBI
Web Policies
FOIA
HHS Vulnerability Disclosure
Help
Accessibility
Careers