An official website of the United States government

Here's how you know

The .gov means it’s official.

Federal government websites often end in .gov or .mil. Before sharing sensitive information, make
sure you’re on a federal government site.
The site is secure.
The https:// ensures that you are connecting to the official website and that any information you
provide is encrypted and transmitted securely.

Skip to main page content

Access keys NCBI Log in
Homepage MyNCBI Homepage Main
Content Main Navigation

Primer-BLAST
» JOB ID:4-k9qjoeN7YQiDKNP-0Wv0X2B41o5RyQaQ
Primer-BLAST Results
 Help
Input PCR template
none

Specificity of primers
No target templates were found in selected database: Nucleotide collection (nt) (Organism limited
to Bacteria)

Other reports
Search Summary

Search parameters and other details

Search parameter name Search parameter value
Number of Blast hits analyzed 2845
Entrez query
Min total mismatches 2
Min 3' end mismatches 2
Defined 3' end region length 5
Mismatch threshold to ignore targets 6
Max target size 4000
Max number of Blast target sequences 50000
Blast E value 30000
Blast word size 7
Max candidate primer pairs 500
Min PCR product size 63
Max PCR product size 1000
Min Primer size 15
Opt Primer size 20
Max Primer size 25
Min Tm 57
Opt Tm 60
Max Tm 63
Max Tm difference 3
Repeat filter AUTO
Low complexity filter Yes
Detailed primer reports  
You can re-search for specific primers by accepting some of the unintended targets, check the
box(es) next to the ones you accept and try again to re-search for specific primers Submit
 Help
Primer pair 1
Self Self 3'
Sequence (5'->3') Length Tm GC%
complementarity complementarity
Forward
CTCCTCCTTTCATCTTCTTGGG 22 58.12 50.00 2.00 0.00
primer
Reverse
TTTAGGTTTCGGTCTGTGAGG 21 57.60 47.62 2.00 0.00
primer
Products on intended targets
Products on allowed targets

Products on allowed transcript variants

Products on potentially unintended templates

Products on target templates

If you want to allow any of the unintended targets, check the box(es) next to the ones you accept
and try again to re-search for specific primers Submit
 Help

FOLLOW NCBI

Connect with NLM

National Library of Medicine

8600 Rockville Pike
Bethesda, MD 20894

Web Policies
FOIA
HHS Vulnerability Disclosure

Help
Accessibility
Careers

NLM NIH HHS USA.gov