Brain Research Bulletin 71 (2007) 619–627

Diethylstilbestrol alters the population dynamic of neural precursor

cells in the neonatal male rat dentate gyrus
Jorge G. Ramos ∗ , Jorgelina Varayoud, Lucas Monje, Guillermo Moreno-Piovano,
Mónica Muñoz-de-Toro, Enrique H. Luque
Laboratorio de Endocrinologı́a y Tumores Hormonodependientes, School of Biochemistry and Biological Sciences,
Universidad Nacional del Litoral, Casilla de Correo 242, 3000 Santa Fe, Argentina
Received 16 September 2006; received in revised form 21 November 2006; accepted 5 December 2006
Available online 4 January 2007

Abstract
Little is known about how estrogens influence neurogenesis in the newborn male rodent. Herein, we examined the effects of neonatal diethyl-
stilbestrol (DES) exposure on the proliferation and survival of type-1 and type-2 neural precursor cells (NPC) in the dentate gyrus of male rats.
This was achieved by exposing newborn male pups to DES on postnatal day (PND) 1, PND3, PND5, and PND7, sacrificed at PND8 or PND21,
followed by double immunohistochemistry and morphometric analysis of hippocampal dentate gyrus. Furthermore, vascular endothelial growth
factor (VEGF) and brain-derived neurotrophic factor (BDNF) mRNA expression was evaluated in hippocampal tissue blocks by real time RT-PCR.
At PND8, the density of total proliferating NPC decreased in DES-treated animals. This reduction was due to a significant decrease in the mitotic
rate of type-2 cells only, since type-1 NPCs did not show changes in the proliferation index. Type-2 NPCs expressed the cell-cycle inhibitor p27kip1
and its expression was clearly augmented in the DES-treated group. Furthermore, the number of apoptotic cells in the dentate gyrus of DES-treated
rats decreased. Surprisingly, DES treatment enhanced cell survival and increased NPCs proliferation when animals were examined 14 days after
treatment. VEGF mRNA expression showed a positive correlation with NPCs proliferation and BDNF mRNA levels were higher in DES-treated
animals at both time points examined. Collectively, these results indicate that hippocampal NPCs proliferation and survival is a critical target of
DES exposure during the early postnatal period. VEGF and BDNF are proposed as key mediators of DES-induced NPC mitotic response.
© 2006 Elsevier Inc. All rights reserved.

Keywords: Hippocampus; Neural precursors; DES; Proliferation; Apoptosis

1. Introduction
Neurogenesis occurs throughout life in mammals includ-
ing man [14,23]. Neural precursor cells (NPC), located in the
subgranular zone (SGZ) of the dentate gyrus, proliferate and
integrate in hippocampal circuits and may be involved in certain
forms of hippocampal-dependent learning [19,47]. Two NPC
subtypes (type-I and type-II NPCs) have been characterized
previously using transgenic mice expressing green fluorescent
protein (GFP) under the promoter for nestin, an intermediate fil-
ament present in progenitor cells [16]. The two cellular subtypes
express nestin and can be distinguished using morphological cri-
teria [13,16]. Nestin expressing type-I NPCs have long processes
that go through the granule cell layer (GCL) of the dentate gyrus
∗ Corresponding author. Tel.: +54 342 4575207; fax: +54 342 4575207.
E-mail address: gramos@fbcb.unl.edu.ar (J.G. Ramos).
and reach the inner most portion of the molecular zone while
type-II NPCs lack these long processes and are characterized
by short cytoplasmic extensions that are tangentially oriented
to the GCL [16]. Under resting conditions, type-II NPCs are
most actively dividing, and physiologic mitogenic stimuli seem
to affect primarily these early types of precursors. Type-I cells
rarely divide, and their proliferation is not induced by the exper-
imental manipulations studied so far [13,26].
Previous studies have identified endocrine, neural, and
experiential factors that regulate the production and survival
of late-generated neurons in the rat hippocampus [29,35].
These include negative modulators, such as glucocorticoids
and interleukin-6 [34,51], and positive modulators, such as
serotonin, N-methyl-aspartate receptor antagonists and dehy-
droepiandrosterone [1,24].
Estrogens have been shown as regulators of synaptic plas-
ticity, cognitive function, memory, mood and behavior [32];
however, their roles in the control of neuronal and glial prolif-

0361-9230/$ – see front matter © 2006 Elsevier Inc. All rights reserved.
doi:10.1016/j.brainresbull.2006.12.004
620 J.G. Ramos et al. / Brain Research Bulletin 71 (2007) 619–627
eration and differentiation are still not fully understood. Recent
reports have shown that estradiol is able to influence cell pro-
duction in the adult hippocampal formation [41,50]. A single
dose of estradiol (10 ␮g/rat) has been shown to be capable
of increasing NPC proliferation in the SGZ of ovariectomized
adult female rats [49]. In contrast, other studies have demon-
strated that the density of new cells is negatively correlated
with plasma estradiol levels in wild adult female meadow voles
and laboratory rats [37,38]. This apparent discrepancy could
be explained by a time- and dose-dependent action of estro-
gen on NPC proliferation [37,38,50]. Moreover, the positive or
negative action of estrogens on hippocampal cell proliferation
during adulthood could be mediated by adrenal steroids and their
receptors [38].
Some efforts have been taken to elucidate possible mecha-
nisms and molecular mediators underlying NPC proliferation
and differentiation. Vascular endothelial growth factor (VEGF)
has been proposed as a key molecule that could regulate neuro-
genesis, mediating the effects of environment on hippocampal
plasticity during adulthood [3]. Most research on the effects of
estrogens on neurogenesis has been performed on adult female
rodents, and thus, little is known about the consequences of
estrogen exposure on hippocampal NPCs proliferation in the
neonatal male brain. There is a great body of evidence prov-
ing that the perinatal period is critical on hippocampal circuitry
formation [27]. During development, estrogen treatment has
been shown to affect the volume of CA1 and CA3 hippocam-
pal regions, spatial navigation behavior [21], the strength of
hippocampal long-term potentiation [8,57], and hippocampal-
dependent learning [30]. The GCL of the hippocampal dentate
gyrus has been characterized as a region of continuous but age-
dependent proliferation of NPC in rodents and humans [14,56].
DNA labeling studies performed in rats have demonstrated that
NPCs proliferation is intense during the first postnatal week
in the SGZ of the dentate gyrus, declining from the second
postnatal week to adulthood [18,44].
DES is a synthetic estrogen that is frequently used in neona-
tal estrogenization experiments because it is not bound by
alpha-fetoprotein and penetrate the blood brain barrier [12,46].
Previously, it has been shown that DES exposure during the
developmental stage resulted in a marked influence on synapto-
genesis and neuronal vulnerability [45]. Several reports have
indicated that neonatal xenoestrogen exposure inhibits sex-
ual differentiation of non-reproductive behaviors, including
hippocampal-dependent tasks, like maze learning and spatial
location [4,15]. However, very little is known about the effects
and mechanisms underlying DES exposure during the early
postnatal period on the male hippocampal NPC population
dynamic.
Taking into account the above-mentioned findings, the goal
of the present study was to determine the effects of DES expo-
sure on the proliferation, apoptosis and survival of hippocampal
NPC in vivo, during the first week of male rat postnatal life.
To evaluate the possible molecular mediators of these effects, a
real time RT-PCR approach was optimized to quantify VEGF
and BDNF mRNA expression levels in the dorsal dentate gyri
of neonatally estrogenized male rats.
2. Materials and methods
2.1. Animal treatments
Pups were obtained from timed-pregnant Wistar rats housed under a con-
trolled environment (22 ± 2 ◦ C; lights on from 06:00 to 20:00 h) with free access
to pellet laboratory chow (Cooperación, Buenos Aires, Argentina) and tap water
supplied from glass bottles. All rats were handled in accordance with the prin-
ciples and procedures outlined in the Guide for the Care and Use of Laboratory
Animals issued by the National Academy of Sciences (USA). All protocols
were approved by the Bioethical Commission of the School of Biochemistry
and Biological Science of the Universidad Nacional del Litoral.
Seven pregnant dams per treatment group were used to collect offspring for
each time point (see below). The day of birth was designated as postnatal day
0 (PND0). Pups were sexed according to ano-genital distance, and each litter
was culled randomly on PND1 to a maximum of 10 neonates, with up to 10
male pups per litter if possible. When fewer than 10 males were available, an
appropriate number of females were retained. All male pups were assigned to
one of two groups, and were given sc injections of either DES (0.2 ␮g/pup,
Sigma, St. Louis, MO) dissolved in corn oil or an equal volume (25 ␮l) of corn
oil alone on PND1, PND3, PND5, and PND7.
The DES dose used here did not produce signs of acute or chronic toxicity
and no significant differences in weight gain between DES-exposed and control
pups were recorded during the experiment (data not shown). On PND8, a set
of males of both groups was injected i.p. with the thymidine analog bromod-
eoxyuridine (BrdU, Sigma, 60 mg/kg of body weight). To determine the NPC
proliferation index on PND8, some animals (n = 12 for each group) were killed
by decapitation 4 h after BrdU injection. To evaluate the NPC survival index,
others were sacrificed 14 days (PND21) after BrdU treatment (n = 10 for each
group). To assess NPC proliferation 2 weeks after DES treatment, another set of
rats was injected with BrdU on PND21 and sacrificed 4 h later (n = 13 for each
group). For immunohistochemical procedures, brains from males sacrificed at
each time point were fixed by immersion in 4% paraformaldehyde in PBS for 24 h
at 4 ◦ C. Fixed tissue was dehydrated in an ascending series of ethanol, cleared in
xylene and embedded in paraffin. For real time RT-PCR analysis, a second set of
brains (n = 10 per treatment group in each time point) was quickly removed, and
the dorsal pole of the hippocampus (including the dentate gyrus) was microdis-
sected, using needles of adequate internal diameters [39]. Tissue blocks were
flash frozen in liquid nitrogen and stored at −80 ◦ C until RNA extraction.
2.2. Immunohistochemistry
Brain serial sections (5 ␮m in thickness) were mounted on 3-aminopropyl
triethoxysilane (Sigma) coated slides and dried for 24 h at 37 ◦ C. BrdU incor-
poration into cells in the S phase of the cell cycle was evaluated as previously
described [25]. All primary antibodies were incubated overnight at 4 ◦ C. For
BrdU labeling, a mouse monoclonal antibody against BrdU (clone 85-2C8,
Novocastra, Newcastle upon Tyne, UK) was used at a dilution of 1:100.
Immunostaining of estrogen receptor ␣ (ER␣) was performed using a mouse
monoclonal antibody raised to full-length recombinant human ER␣ (clone
6F11, Novocastra) at a dilution of 1:200, and for the detection of p27kip1 ,
a polyclonal antibody diluted 1:500 raised against a peptide mapping at the
carboxy terminus of p27 of human origin was evaluated (sc-528, Santa Cruz
Biotechnology Inc., CA). Reactions were developed using a streptavidin–biotin
peroxidase method and diaminobenzidine (DAB) (Sigma) as a chromogen sub-
strate. Samples were counterstained with Harris hematoxylin (Biopur, Rosario,
Argentina) and mounted with permanent mounting medium (PMyR, Buenos
Aires, Argentina). Each immunohistochemical run included positive and nega-
tive controls. For negative controls, the primary antibodies were replaced with
non-immune mouse or rabbit serum (Sigma), or immunohistochemistry (IHC)
was performed in samples from animals that did not receive BrdU.
2.3. Double IHC
To identify the immunophenotype of the proliferating or quiescent cells, a
second round of immunolabeling was performed after BrdU or p27kip1 detection
using anti-nestin (identifying type-1 and type-2 NPCs) [16], anti-calbindin (to
detect mature granule neurons), or anti-GFAP (to detect astrocytes) as a second
 J.G. Ramos et al. / Brain Research Bulletin 71 (2007) 619–627
primary antibody. The sections were incubated overnight at 4 ◦ C with anti-nestin
(clone rat 401, BD Pharmingen, San Jose, CA) 1:200, or anti-calbindin-D-
28-K (KD-15, Sigma) 1:200, or anti-GFAP (Sigma) 1:100. Reactions were
developed using a streptavidin–biotin peroxidase method. Visualization of this
second round of antigens was achieved by the DAB-nickel intensified technique.
The DAB-nickel solution (2.3 mg DAB, 4 ml 0.05 M Tris–HCl buffer [pH 7.5],
15 ␮l 30% H2 O2 , and 460 ␮l 1% nickel chloride) was added to the samples.
After 10 min at 20 ◦ C, the samples were rinsed in running water. Slides were
counterstained with Harris hematoxylin (Biopur) and mounted with permanent
mounting medium.
2.4. In situ detection of apoptosis
Sections were analyzed for in situ detection of cells with DNA strand breaks
(apoptotic cells) using the TUNEL technique (ApopTag, Intergen Co., Pur-
chase, NY). In brief, after deparaffinization and rehydration, sections were
incubated with proteinase K (20 ␮g/ml) (Intergen) for 15 min at 37 ◦ C and then
treated with hydrogen peroxide in PBS for 10 min at RT to quench endogenous
peroxidase activity. Sections were then incubated with a mixture containing
digoxigenin-labeled deoxynucleotide triphosphate, unlabeled deoxynucleotide
triphosphate mix, and TdT enzyme in a humidified chamber at 37 ◦ C for 1 h.
Slides were subsequently rinsed with PBS and incubated with anti-digoxigenin-
peroxidase for 30 min at 20 ◦ C and substrate–chromogen mixture (DAB, Sigma)
for 6 min. Samples were counterstained with Mayer hematoxylin, dehydrated,
and mounted with a permanent mounting medium. Negative control slides were
ran using the same procedures, except that distilled water was added instead of
TdT enzyme. As a positive control, involuting rat prostate after the second day
of castration was processed in an identical manner to the experimental samples.
2.5. Morphometry
To avoid interference of possible neurogenetic gradients [9] in differences
depending on the treatment, the same hippocampal region was analyzed in all
groups for BrdU and neuronal markers immunohistochemistry and TUNEL
staining. The area of the hippocampus evaluated in this work was limited to
the dorsomedial pole of the hippocampus, where the dentate gyrus is horizon-
tally oriented beneath the corpus callosum and the external and internal blades
are joined at the crest (an approximate 0.8 mm block of tissue extending in the
caudal direction from the first appearance of the GCL) [6,27,40]. The SGZ was
defined as a 150 ␮m band immediately adjacent to the hilar surface of the GCL.
The cell counting procedures were performed in the GCL and the SGZ of the
dentate gyrus as was previously described [6,40]. To calculate the proportions
of each cell phenotype and the density of BrdU-positive cells in the dentate
gyrus, the total number of BrdU or p27kip1 -labeled cells and their respective
phenotypes were scored in six or more sections of a one-in-six series per ani-
mal. To evaluate the entire dorsomedial pole of the hippocampus the different
series of coronal sections were separated in the caudal direction by approxi-
mately 120 ␮m. The ER␣(+) cell population and the proportion of apoptotic
cells were evaluated using the same criteria. All data were represented as spatial
cell densities (number of cells/mm2 of evaluated area) or relative proportions.
All spatial measurements (SGZ and GCL area and volume) were performed
using an Olympus BH-2 microscope equipped with a Spot Insight color video
camera (Diagnostic Instruments, Sterling Heights, MI) and a digital image analy-
sis software (Image Pro-Plus 4.1.0.1® system, Media Cybernetics, Silver Spring,
Table 1
Primer pairs used in real-time RT-PCR
Gene Primer sequence (5 –3 )
BDNF Forward: AGCCTCCTCTG TCTTTCTGCTGGA
Reverse: CTTTTGTCTATGCCCCTGCAGCCTT
VEGF Forward: CTGCTCTCTTGGGTGCACTGG
Reverse: GGTTTGATCCGCATGATCTGCAT
L19 Forward: GAAATCGCCAATGCCAACTC
Reverse: ACCTTCAGGTACAGGCTGTG
621
MD). To calculate the total volumes of the portions of the GCL and SGZ ana-
lyzed, two consecutive sections every 120 ␮m were selected and the outlines of
the GCL and the SGZ were drawn with a low-power objective lens (10×). The
estimation of GCL and SGZ volumes were made according to the principle of
Cavalieri [53]. The areas were calculated by means of Image Pro-Plus software
and the total volume for each hemisphere was estimated as the sum of the areas
multiplied by the distance between the analyzed sections.
2.6. Real-time PCR analysis
An optimized RT-PCR protocol was employed to analyze the relative expres-
sion levels of VEGF and BDNF mRNAs in the dentate gyrus of male rats on
PND8 and PND21. Individual samples of hippocampal dentate gyri of each
experimental group were homogenized in TRIzol (Invitrogen, Carlsbad, CA),
and RNA was prepared according to the manufacturer’s protocol. Equal quan-
tities (4 ␮g) of total RNA were reverse-transcribed into cDNA with AMV
reverse transcriptase (12.5 U; Promega, Madison, WI) using 200 pmol of random
primers (Promega). Twenty units of ribonuclease inhibitor (RNAout) (Invitro-
gen Argentina, Buenos Aires, Argentina) and 100 nmol of a deoxynucleotide
triphosphate mixture were added to each reaction tube in a final volume of 30 ␮l
of 1× AMV-RT buffer. Reverse transcription was performed at 42 ◦ C for 90 min.
Reactions were stopped by heating at 97 ◦ C for 5 min and cooling on ice, fol-
lowed by dilution of the reverse-transcribed cDNA with RNAse free water to a
final volume of 60 ␮l. Samples were analyzed in duplicate or triplicate, and a
sample without reverse transcriptase was included in each plate to detect contam-
ination by genomic DNA. Primer pairs used for amplification of VEGF, BDNF
and the ribosomal protein L19 cDNAs are shown in Table 1. cDNA levels were
detected using real-time PCR with the DNA Engine Opticon System (Bio-Rad
Laboratories Inc. Waltham, MA) and SYBR Green I dye (Cambrex Corp., East
Rutherford, NJ). For cDNA amplification, 5 ␮l of cDNA were combined with
a mixture containing 2.5 U Taq-DNA polymerase (Invitrogen), 2.5 mM MgCl2
(Invitrogen), 0.2 mM of each of the four dNTPs (Promega), and 10 pmol of each
primer (Invitrogen) in a final volume of 25 ␮l of 1× SYBR Green I PCR Taq
buffer. After initial denaturation at 97 ◦ C for 5 min, the reaction mixture was sub-
jected to successive cycles of denaturation at 96 ◦ C for 45 s, annealing at 60 ◦ C
for VEGF and BDNF genes for 30 s, and extension at 72 ◦ C for 1 min. The
annealing temperature for the amplification of the L19 housekeeping gene was
56 ◦ C. Product purity was confirmed by dissociation curves and random agarose
gel electrophoresis. No DNA template controls were included in any of the
assays, yielding no consistent amplification. Calculation of relative expression
levels of each target was conducted based on the cycle threshold (CT ) method
[20]. The CT for each sample was calculated using the Opticon Monitor Anal-
ysis Software (Bio-Rad Laboratories) with an automatic fluorescence threshold
setting. Efficiency of PCR reactions was assessed for each target by amplifica-
tion of serial dilutions (over five orders of magnitude) of cDNA fragments of the
transcripts under analysis. Depending on specific PCR conditions, efficiencies
ranged from 90% to 120%. Accordingly, fold expression over control values was
calculated for each target by the equation 2−CT , where CT is determined by
subtracting the corresponding L19 CT value (internal control) from the specific
CT of each target and experimental condition. CT is obtained by subtracting
the CT of each experimental sample from that of the control sample (taken
as reference value 100). Note that no significant differences in CT values were
observed for L19 between the treatment groups. All PCR products were cloned
using the TA cloning kit (Invitrogen, Argentina) and specificity was confirmed
by DNA sequencing (data not shown).
Product size (bp) Genbank accession number
298 NM 012513
320 NM 031836.1
290 NM 031103
622 J.G. Ramos et al. / Brain Research Bulletin 71 (2007) 619–627

2.7. Statistics
Values are expressed as mean ± S.E.M.; and comparisons were made using
the Mann–Whitney non-parametric test and the threshold of significance was
fixed at P < 0.05.
3. Results
3.1. Neonatal xenoestrogen exposure alters the NPC
population dynamic
3.1.1. NPC proliferation and apoptosis on PND8
Proliferating cells were detected in the molecular layer,
hilus, SGZ and in the GCL innermost portion of the den-
tate gyrus in controls and DES-treated rats. They were often
organized in clusters, with irregularly shaped nuclei. In the
dentate gyrus of control PND8 rats, there were more BrdU-
positive cells than in age-matched DES-treated rats (Fig. 1,
A versus B). Morphometric analysis demonstrated that treat-
ment with DES decreased cell proliferation (P < 0.01, Fig. 2A).
As described previously [16], NPCs are characterized by mor-
phological features and by the expression of the filamentous
protein nestin. Nestin-expressing precursor cells fall into two
large categories: type-1 and type-2 NPCs. Type-1 NPC is gener-
ally located in the SGZ and characterized by a long process
(Fig. 1C, inset C1) reaching through the GCL and into the
molecular layer of the dentate gyrus. Type-2 NPC lacks long

Fig. 1. Effects of neonatal DES exposure on the NPC population dynamic in male pups at PND8. Male pups were injected from PND1 to PND7 with either vehicle
(A, C, E and G) or 0.2 ␮g of DES (B, D, F and H). BrdU(+) cells were diminished in the dentate gyrus of PND8 DES-treated male rats (A vs. B). The two main
categories of nestin-expressing cells were morphologically characterized in the SGZ: type-1 (C1 inset arrows) and type-2 (C2, inset arrows) NPCs; only type-2 NPC
proliferation index was decreased in DES-treated animals (C vs. D, arrowheads). However, the number of apoptotic cells (E, arrows) was decreased in DES-treated
animals (E vs. F). Expression of p27kip1 was only detected in type-2 NPC (G and H, arrows) and was increased in DES-treated group (G vs. H). GCL, granular cell
layer; SGZ, subgranular zone. Scale bar 100 ␮m.
 J.G. Ramos et al. / Brain Research Bulletin 71 (2007) 619–627 623

Fig. 2. Quantification of the results obtained by TUNEL technique and by regular and double immunohistochemistry in the dentate gyrus on PND8. Data are
expressed as spatial cell densities and each column represents the mean ± S.E.M. of atleast four semi-serial sections per animal (n = 12 animals per group). (A) Total
proliferating cells in the SGZ; (B) total NPC proliferation density; (C) NPC types-I and -II proliferation indexes; (D) apoptotic cells; (E) total NPC p27kip1 (+) cells;
(F) NPC type-I and type-II p27kip1 (+) density. Scale bar 100 ␮m.

processes having a round or ovoid nucleus and a soma with
scant cytoplasm (Fig. 1C, inset C2). The short cytoplasmic
extensions of these cells tended to be oriented tangentially
to the GCL. Using double IHC, we detected that type-1 and
type-2 cells had incorporated BrdU 4 h after i.p. administra-
tion, indicating that both cell types had undergone proliferation
in controls and in DES-treated males. On PND8, the density
of total BrdU(+)/nestin(+) NPC decreased in DES-treated ani-
mals (P < 0.01, Fig. 1, C versus D and Fig. 2B) however, when
BrdU(+)/nestin(+) cells were evaluated identifying each NPC
type, the decrease in proliferative activity was due to type-
2 cells only (P < 0.01, Fig. 2C). On the same postnatal day,
the number of pyknotic and TUNEL(+) cells in the SGZ of
DES-treated rats clearly decreased (P < 0.01, Fig. 1, E ver-
sus F, and Fig. 2D), suggesting an anti-apoptotic effect of the
xenoestrogen exposure during the early postnatal period. In
accordance with the above-mentioned findings, an increased
expression of p27kip1 was found in the SGZ of DES pups
(Fig. 2E). By double IHC, we could classify which type of
NPC express p27kip1 , showing that only type-2 NPC expresses
this cell-cycle inhibitor and its expression was clearly aug-
mented in DES-treated group (P < 0.01, Fig. 1, G versus H and
Fig. 2F).
3.1.2. NPC survival on PND21
To determine if DES treatment affects cell survival, we exam-
ined the number of BrdU(+) cells that remains in the SGZ and
GCL 14 days after the BrdU injection. At this point, the majority
of the BrdU-labeled cells in both groups was fully incorporated
into the GCL and they were morphologically similar to the sur-
rounding mature granule neurons. Surprisingly, the number of
BrdU(+) cells was higher in the DES-treated rats compared with
controls (P < 0.05, Fig. 3A). Regarding the immunophenotype
of the surviving BrdU(+) cells, results showed that DES did
not alter the proportion of calbindin (mature neuron type) or
GFAP (mature glial type) positive cells compared with controls
(Fig. 3B).
3.1.3. NPC proliferation on PND21
In contrast with the results observed on PND8, DES-treated
rats that were injected with BrdU on PND21 showed a sig-
nificantly higher number of double labeled BrdU(+)/nestin(+)
cells compared with control rats (P < 0.01, Fig. 4A). In addi-
tion, the NPC of DES-treated group showed a clearly decreased
expression of p27kip1 (P < 0.01, Fig. 4B). At this time point, no
differences in the number of apoptotic figures were observed
between the controls and DES-treated males (Fig. 4C).
624 J.G. Ramos et al. / Brain Research Bulletin 71 (2007) 619–627
Table 2
Quantitative analysis of GCL and SGZ volumes
Control
GCL SGZ
PND8 0.351 ± 0.081 0.151 ± 0.009
PND21 0.732 ± 0.021 0.387 ± 0.012
Results are expressed in mm3 as means ± S.E.M.
3.1.4. ERα expression in NPCs
Cells that were immunoreactive for ER␣ were observed in the
hilus and the SGZ, and none of them were co-labeled with nestin.
Finally, no differences were found in the number or distribution
of total ER␣(+) cells in both experimental groups at any time
point analyzed (data not shown).
3.1.5. GCL and SGZ volumes
The estimated volumes of the GCL and SGZ analyzed in this
work are shown in Table 2. No differences were obtained in the
volumetric analysis between DES treated and control animals.
3.2. Hippocampal VEGF and BDNF gene expressions are
affected by neonatal DES treatment
Using quantitative real time RT-PCR we examined the
expression of VEGF and BDNF mRNA in the microdis-
Fig. 3. Two weeks after DES exposure, animals showed a higher number of
surviving BrdU(+) cells in the dentate gyrus. (A) Spatial density of BrdU(+)
cells and morphological detail of surviving cells in each experimental group
(arrows) and (B) proportion of BrdU(+) surviving cells that show neuron or
glial phenotype at PND21. (* P < 0.05 vs. control).
DES
GCL SGZ
0.339 ± 0.015 0.148 ± 0.008
0.799 ± 0.056 0.401 ± 0.022
sected dentate gyrus of experimental males on PND8 and
PND21. Results demonstrated that DES treatment significantly
decreased the VEGF mRNA expression in the hippocampus of
PND8 rats (P < 0.01, Fig. 5A). In contrast, 14 days after the
end of the xenoestrogen regime (PND21), VEGF mRNA lev-
els were clearly augmented in DES-treated animals (P < 0.01,
Fig. 5A). Additionally, BDNF mRNA levels were higher in
DES-treated animals at both times points when compared with
control animals (P < 0.01, Fig. 5B).
Fig. 4. Effects of neonatal DES exposure on NPC proliferation and apoptosis on
PND21. BrdU was injected 4 h before sacrifice on PND21. Data are expressed
as spatial cell densities and each column represents the mean ± S.E.M. of five
semi-serial sections per animal (n = 13 animals per group). (A) PND21 NPC
proliferation; (B) PND21 NPC p27kip1 (+) density; (C) PND21 apoptotic cells
density. (* P < 0.05 vs. control).
 J.G. Ramos et al. / Brain Research Bulletin 71 (2007) 619–627
Fig. 5. Effect of neonatal DES exposure on (A) VEGF mRNA and (B) BDNF
mRNA levels in the rat dentate gyrus on PND8 and PND21. Relative mRNA
levels were measured by real-time RT-PCR and fold expression from control
values were calculated for each target by the equation 2−CT . Control values
were assigned to a reference level of 100 and values are given as mean ± S.E.M.
of atleast three independent determinations. (* P < 0.05 vs. control).
4. Discussion
To our knowledge, this is the first study showing that DES
exposure of newborn male rats significantly affects the prolifera-
tion and survival of NPCs in the hippocampal SGZ. An important
reduction in the proliferative activity of hippocampal NPCs was
observed the day after the end of DES treatment while a signifi-
cant increase in NPC proliferation was detected in rats sacrificed
2 weeks after the last DES injection. This biphasic NPC prolif-
eration response positively correlated with hippocampal VEGF
mRNA levels, suggests that VEGF could be a key mediator in
this estrogen-induced event. Taking into account that the prolif-
eration of type-1 NPCs was not affected by the xenoestrogen, it is
tempting to propose that the observed changes in the hippocam-
pal cell proliferation were due to DES-induced modifications in
type-2 NPCs. Moreover, p27kip1 was only expressed in type-2
cells and was negatively correlated with BrdU immunodetec-
tion on PND8 and PND21. Collectively, these results show that
type-2 NPC population constitutes a target of DES action.
Many studies have described that estrogen could affect cell
proliferation in the dentate gyrus of adult rats. Recently, Tanapat
et al. [50] have shown that an acute treatment with a moderate
(10 ␮g/rat), but not with a low (1 ␮g/rat) or a high (50 ␮g/rat),
dose of 17␤-estradiol rapidly increased cell proliferation in
ovariectomized adult animals. Moreover, no differences were
observed when the steroid was given during prolonged peri-
ods of time (3 weeks). These results clearly showed that the
effects of estrogens in the control of cell proliferation on the
dentate gyrus of adult female rats depended on the selected
625
times and doses. However, little is known about the estrogen
effects on dentate gyrus cell proliferation during the early post-
natal period. Our results show that the DES treatment used was
enough to alter the NPCs population dynamic. At PND8, a clear
down-regulation of type-2 NPC proliferation was observed in
the DES-treated males, suggesting that the early postnatal time
could be a sensitive period of xenoestrogen action on the control
of NPC population dynamic. Moreover, the differences observed
between PND8 versus PND21 and those obtained by others in
adult rats [49,50] suggest that the estrogenic responsiveness of
the NPCs vary at different life-time points. This observation is
important since a growing body of evidence shows that man and
wildlife are exposed to estrogenic active compounds during the
perinatal period [42]. The behavioral and physiological conse-
quences of an estrogenic perturbation on NPC proliferation and
differentiation during early postnatal times are still unknown.
Many reports have shown that perinatal exposure to estrogen-
like compounds alters exploratory and socio-sexual behavior
[17,43]. Future studies could address whether these estrogen-
induced behavioral disorders are related with perturbations in
the proliferation and survival of hippocampal NPCs.
Several reports have been demonstrated the importance of
a functional septohippocampal pathway for the regulation of
hippocampal neurogenesis [7,33,52]. There is a growing body
of evidence proving that the cholinergic basal forebrain sys-
tem plays a survival-promoting role for neuronal progenitors
and immature neurons within regions of adult neurogenesis
like the SGZ of the dentate gyrus [7]. It has been clearly
shown that presynaptic acetylcholine (Ach) receptors play a cen-
tral role in the modulation of hippocampal Ach release [55].
Since the cholinergic forebrain neurons activity is regulated by
estrogens through ER␣ [2] an indirect cholinergic pathway in
DES-mediated control of hippocampal neurogenesis could not
be ruled out.
The length of the cell-cycle during neurogenesis depends pri-
marily on the duration of the G1 transition and is modulated by
the enzymatic activity of cyclin-dependent kinases (CDKs) [5].
It has been shown that CDK regulators, like the kip1 protein
family, may have a critical role in cell-cycle control of transit
amplifying neural progenitors in the subventricular zone of adult
mice brain [11]. During embryonic development, it has been
shown that p27kip1 is implicated in the maintenance of differen-
tiated neurons in a quiescent state; however, little is known about
the possible roles of this CDK inhibitor during postnatal neu-
rogenesis [5]. Using double IHC together with morphological
criteria, we demonstrated that type-2 NPCs express p27kip1 pro-
tein and this expression were enhanced with DES treatment. An
inverse correlation between proliferation and p27kip1 expression
was observed, suggesting a critical role of this CDK inhibitor in
xenoestrogen-induced quiescent state of type-2 NPCs. Not only
a great number of type-2 NPCs remained quiescent in DES-
treated males on PND8 but a significant decrease in the number
of apoptotic cells was also detected at this time point. Both events
could contribute to the great proportion of remaining BrdU(+)
cells observed on PND21 in the DES group, strongly suggest-
ing that xenoestrogen exposure enhances the survival of cell
progeny in the male dentate gyrus, while no effects on NPC
626 J.G. Ramos et al. / Brain Research Bulletin 71 (2007) 619–627
differentiation was detected. Moreover, when BrdU incorpora-
tion was evaluated on PND21, a great number of NPCs were
positive in the DES-treated group, suggesting the existence of
an internal regulatory mechanism triggered to compensate the
initial xenoestrogen-induced declination in NPCs proliferation.
There is a growing body of evidence that suggest that extrin-
sic agents, such as alcohol or xenoestrogens can alter intrinsic
cellular mechanisms of stem cell fate choices contributing to
altered neurogenesis and/or gliogenesis during central nervous
system maturation [54]. The compensatory mechanism above-
mentioned could help to restore the number of required granule
cells, diminishing the possible neurological adverse effects of an
early estrogenic exposure. Whether this mechanism is inducible
only at early postnatal times or remains active during adulthood,
is under study in our laboratory.
VEGF is a hypoxia-inducible protein that promotes angio-
genesis through receptor tyrosine kinases on endothelial cells.
Recent evidence indicates that VEGF can act as a neurotrophic
factor [31,36] and produces neurogenic effects on NPCs [22].
A significant reduction in hippocampal VEGF transcripts was
observed on PND8 in DES-treated rats in parallel with a reduc-
tion in NPCs proliferation. On the other hand, on PND21, when
the NPCs proliferation was higher in the estrogenized-rats the
VEGF mRNA levels were significantly increased. We propose
here that hippocampal VEGF could be a xenoestrogen target
gene and a positive molecular mediator in type-2 NPC prolifer-
ation.
Regarding the role of BDNF, it has been shown that estrogen
could up-regulate the BDNF mRNA and protein levels in the rat
hippocampus [48]. Our results agree with this study, since we
observed a significant increase in BDNF mRNA expression in
DES-treated animals. BDNF is emerging as an important media-
tor of activity-dependent modifications in synaptic strength [28]
and plays an important role in the survival and growth of neu-
rons [10]. However, the possible relationships between BDNF
and NPCs proliferation remain unknown. Taking into account
that we observed a decrease in apoptotic levels and an increase
in new granule neurons survival in DES-treated rats, the hypoth-
esis that BDNF could be a critical mediator of these events could
not be ruled out. We also suggest that VEGF is a key factor in
type-2 NPC regulation of proliferation, and that BDNF could
be responsible for extended survival times of the neuronal cell
progeny. More studies are necessary to confirm this hypothesis.
Conflict of interest
The authors declare that there is no conflict of interest that
would prejudice the impartiality of this scientific work.
Acknowledgements
The authors thank Mr. Juan C. Villarreal and Mr. Juan Grant
for their technical assistance and animal care. This study was
supported by grants from the Argentine National Council for
Science and Technology (CONICET, CIC Grant 652/04), the
Argentine National Agency for the Promotion of Science and
Technology (ANPCyT) (PICT 2003, No. 13-4737) and the Uni-
versidad Nacional del Litoral (CAI + D 2005 019/118). L.M.
and G.M.P. are fellows of the CONICET and the Universidad
Nacional del Litoral, respectively. J.V., J.G.R., and E.H.L. are
career investigators of the CONICET.
References
[1] M. Banasr, M. Hery, J.M. Brezun, A. Daszuta, Serotonin mediates oestro-
gen stimulation of cell proliferation in the adult dentate gyrus, Eur. J.
Neurosci. 14 (2001) 1417–1424.
[2] S.H. Bora, Z. Liu, A. Kecojevic, I. Merchenthaler, V.E. Koliatsos, Direct,
complex effects of estrogens on basal forebrain cholinergic neurons, Exp.
Neurol. 194 (2005) 506–522.
[3] L. Cao, X. Jiao, D.S. Zuzga, Y. Liu, D.M. Fong, D. Young, M.J. During,
VEGF links hippocampal activity with neurogenesis, learning and memory,
Nat. Genet. 36 (2004) 827–835.
[4] R. Carr, F. Bertasi, A. Betancourt, S. Bowers, B.S. Gandy, P. Ryan, S.
Willard, Effect of neonatal rat bisphenol a exposure on performance in the
Morris water maze, J. Toxicol. Environ. Health A 66 (2003) 2077–2088.
[5] V.S. Caviness Jr., T. Takahashi, R.S. Nowakowski, The G1 restriction point
as critical regulator of neocortical neuronogenesis, Neurochem. Res. 24
(1999) 497–506.
[6] S. Ciaroni, R. Cuppini, T. Cecchini, P. Ferri, P. Ambrogini, C. Cuppini, P.
Del Grande, Neurogenesis in the adult rat dentate gyrus is enhanced by
vitamin E deficiency, J. Comp. Neurol. 411 (1999) 495–502.
[7] C.M. Cooper-Kuhn, J. Winkler, H.G. Kuhn, Decreased neurogenesis after
cholinergic forebrain lesion in the adult rat, J. Neurosci. Res. 77 (2004)
155–165.
[8] D.A. Cordoba Montoya, H.F. Carrer, Estrogen facilitates induction of long
term potentiation in the hippocampus of awake rats., Brain Res. 778 (1997)
430–438.
[9] D. Crespo, B.B. Stanfield, W.M. Cowan, Evidence that late-generated gran-
ule cells do not simply replace earlier formed neurons in the rat dentate
gyrus, Exp. Brain Res. 62 (1986) 541–548.
[10] A.M. Davies, The role of neurotrophins in the developing nervous system,
J. Neurobiol. 25 (1994) 1334–1348.
[11] F. Doetsch, J.M. Verdugo, I. Caille, A. Alvarez-Buylla, M.V. Chao, P.
Casaccia-Bonnefil, Lack of the cell-cycle inhibitor p27Kip1 results in selec-
tive increase of transit-amplifying cells for adult neurogenesis, J. Neurosci.
22 (2002) 2255–2264.
[12] L.L. DonCarlos, M. McAbee, D.S. Ramer-Quinn, D.M. Stancik, Estrogen
receptor mRNA levels in the preoptic area of neonatal rats are responsive
to hormone manipulation, Brain Res. Dev. Brain Res. 84 (1995) 253–260.
[13] J.G. Emsley, B.D. Mitchell, G. Kempermann, J.D. Macklis, Adult neuro-
genesis and repair of the adult CNS with neural progenitors, precursors,
and stem cells, Prog. Neurobiol. 75 (2005) 321–341.
[14] P.S. Eriksson, E. Perfilieva, T. Bjork-Eriksson, A.M. Alborn, C. Nordborg,
D.A. Peterson, F.H. Gage, Neurogenesis in the adult human hippocampus,
Nat. Med. 4 (1998) 1313–1317.
[15] F. Farabollini, S. Porrini, S.D. Della, F. Bianchi, F. Dessi-Fulgheri, Effects
of perinatal exposure to bisphenol A on sociosexual behavior of female and
male rats, Environ. Health Perspect. 3 (Suppl. 110) (2002) 409–414.
[16] V. Filippov, G. Kronenberg, T. Pivneva, K. Reuter, B. Steiner, L.P.
Wang, M. Yamaguchi, H. Kettenmann, G. Kempermann, Subpopulation of
nestin-expressing progenitor cells in the adult murine hippocampus shows
electrophysiological and morphological characteristics of astrocytes, Mol.
Cell. Neurosci. 23 (2003) 373–382.
[17] T. Fujimoto, K. Kubo, S. Aou, Prenatal exposure to bisphenol A impairs
sexual differentiation of exploratory behavior and increases depression-like
behavior in rats., Brain Res. 1068 (2006) 49–55.
[18] E. Gould, P. Tanapat, Stress and hippocampal neurogenesis, Biol. Psychi-
atry 46 (1999) 1472–1479.
[19] N.B. Hastings, E. Gould, Rapid extension of axons into the CA3 region by
adult-generated granule cells, J. Comp. Neurol. 413 (1999) 146–154.
[20] R. Higuchi, C. Fockler, G. Dollinger, R. Watson, Kinetic PCR analysis:
real-time monitoring of DNA amplification reactions, Biotechnology (NY)
11 (1993) 1026–1030.
 J.G. Ramos et al. / Brain Research Bulletin 71 (2007) 619–627
[21] C. Isgor, D.R. Sengelaub, Prenatal gonadal steroids affect adult spatial
behavior CA1 and CA3 pyramidal cell morphology in rats, Horm. Behav.
34 (1998) 183–198.
[22] K. Jin, Y. Zhu, Y. Sun, X.O. Mao, L. Xie, D.A. Greenberg, Vascular
endothelial growth factor (VEGF) stimulates neurogenesis in vitro and
in vivo, Proc. Natl. Acad. Sci. U.S.A. 99 (2002) 11946–11950.
[23] M.S. Kaplan, J.W. Hinds, Neurogenesis in the adult rat: electron micro-
scopic analysis of light radioautographs, Science 197 (1977) 1092–1094.
[24] K.K. Karishma, J. Herbert, Dehydroepiandrosterone (DHEA) stimulates
neurogenesis in the hippocampus of the rat, promotes survival of newly
formed neurons and prevents corticosterone-induced suppression, Eur. J.
Neurosci. 16 (2002) 445–453.
[25] L. Kass, J. Varayoud, H. Ortega, d.T. Munoz, E.H. Luque, Detection of
bromodeoxyuridine in formalin-fixed tissue DNA denaturation following
microwave or enzymatic digestion pretreatment is required, Eur. J. His-
tochem. 44 (2000) 185–191.
[26] G. Kronenberg, K. Reuter, B. Steiner, M.D. Brandt, S. Jessberger, M.
Yamaguchi, G. Kempermann, Subpopulations of proliferating cells of the
adult hippocampus respond differently to physiologic neurogenic stimuli,
J. Comp. Neurol. 467 (2003) 455–463.
[27] H.G. Kuhn, H. Dickinson-Anson, F.H. Gage, Neurogenesis in the den-
tate gyrus of the adult rat: age-related decrease of neuronal progenitor
proliferation, J. Neurosci. 16 (1996) 2027–2033.
[28] E.S. Levine, C.F. Dreyfus, I.B. Black, M.R. Plummer, Brain-derived neu-
rotrophic factor rapidly enhances synaptic transmission in hippocampal
neurons via postsynaptic tyrosine kinase receptors, Proc. Natl. Acad. Sci.
U.S.A. 92 (1995) 8074–8077.
[29] D.C. Lie, H. Song, S.A. Colamarino, G.L. Ming, F.H. Gage, Neurogenesis
in the adult brain: new strategies for central nervous system diseases, Annu.
Pharmacol. Rev. Toxicol. 44 (2004) 399–421.
[30] V.N. Luine, S.T. Richards, V.Y. Wu, K.D. Beck, Estradiol enhances learning
and memory in a spatial memory task and effects levels of monoaminergic
neurotransmitters, Horm. Behav. 34 (1998) 149–162.
[31] H. Matsuzaki, M. Tamatani, A. Yamaguchi, K. Namikawa, H. Kiyama, M.P.
Vitek, N. Mitsuda, M. Tohyama, Vascular endothelial growth factor rescues
hippocampal neurons from glutamate-induced toxicity: signal transduction
cascades, FASEB J. 15 (2001) 1218–1220.
[32] B.S. McEwen, S.E. Alves, Estrogen actions in the central nervous system,
Endocr. Rev. 20 (1999) 279–307.
[33] P. Mohapel, G. Leanza, M. Kokaia, O. Lindvall, Forebrain acetylcholine
regulates adult hippocampal neurogenesis and learning, Neurobiol. Aging
26 (2005) 939–946.
[34] M.F. Montaron, K.G. Petry, J.J. Rodriguez, M. Marinelli, C. Aurousseau, G.
Rougon, M. Le Moal, D.N. Abrous, Adrenalectomy increases neurogenesis
but not PSA-NCAM expression in aged dentate gyrus, Eur. J. Neurosci. 11
(1999) 1479–1485.
[35] M. Naylor, K.K. Bowen, K.A. Sailor, R.J. Dempsey, R. Vemuganti,
Preconditioning-induced ischemic tolerance stimulates growth factor
expression and neurogenesis in adult rat hippocampus, Neurochem. Int.
47 (2005) 565–572.
[36] O.O. Ogunshola, A. Antic, M.J. Donoghue, S.Y. Fan, H. Kim, W.B. Stew-
art, J.A. Madri, L.R. Ment, Paracrine and autocrine functions of neuronal
vascular endothelial growth factor (VEGF) in the central nervous system,
J. Biol. Chem. 277 (2002) 11410–11415.
[37] B.K. Ormerod, L.A. Galea, Reproductive status influences cell proliferation
and cell survival in the dentate gyrus of adult female meadow voles: a
possible regulatory role for estradiol, Neuroscience 102 (2001) 369–379.
627
[38] B.K. Ormerod, T.T. Lee, L.A. Galea, Estradiol initially enhances but sub-
sequently suppresses (via adrenal steroids) granule cell proliferation in the
dentate gyrus of adult female rats, J. Neurobiol. 55 (2003) 247–260.
[39] M. Palkovits, M.J. Brownstein, Microdissection of brain areas by the punch
technique, in: A.C. Cuello (Ed.), Brain Microdissection Techniques Chich-
ester, John Wiley and Sons, 1983, pp. 1–36.
[40] T.D. Palmer, A.R. Willhoite, F.H. Gage, Vascular niche for adult hippocam-
pal neurogenesis, J. Comp. Neurol. 425 (2000) 479–494.
[41] M. Perez-Martin, V. Salazar, C. Castillo, C. Ariznavarreta, I. Azcoitia, L.M.
Garcia-Segura, J.A. Tresguerres, Estradiol and soy extract increase the pro-
duction of new cells in the dentate gyrus of old rats, Exp. Gerontol. 40
(2005) 450–453.
[42] M. Pombo, L. Castro-Feijoo, Endocrine disruptors, J. Pediatr. Endocrinol.
Metab. 18 (Suppl. 1) (2005) 1145–1155.
[43] S. Porrini, V. Belloni, S.D. Della, F. Farabollini, G. Giannelli, F. Dessi-
Fulgheri, Early exposure to a low dose of bisphenol A affects socio-sexual
behavior of juvenile female rats, Brain Res. Bull. 65 (2005) 261–266.
[44] R.M. Sapolsky, M.J. Meaney, Maturation of the adrenocortical stress
response: neuroendocrine control mechanisms and the stress hyporespon-
sive period, Brain Res. 396 (1986) 64–76.
[45] K. Sato, N. Matsuki, Y. Ohno, K. Nakazawa, Effects of 17beta-estradiol
and xenoestrogens on the neuronal survival in an organotypic hippocampal
culture, Neuroendocrinology 76 (2002) 223–234.
[46] L. Savu, C. Benassayag, G. Vallette, E.A. Nunez, Ligand properties of
diethylstilbestrol: studies with purified native and fatty acid-free rat alpha
1-fetoprotein and albumin, Steroids 34 (1979) 737–748.
[47] T.J. Shors, D.A. Townsend, M. Zhao, Y. Kozorovitskiy, E. Gould, Neu-
rogenesis may relate to some but not all types of hippocampal-dependent
learning, Hippocampus 12 (2002) 578–584.
[48] D.T. Solum, R.J. Handa, Estrogen regulates the development of brain-
derived neurotrophic factor mRNA and protein in the rat hippocampus,
J. Neurosci. 22 (2002) 2650–2659.
[49] P. Tanapat, N.B. Hastings, A.J. Reeves, E. Gould, Estrogen stimulates a
transient increase in the number of new neurons in the dentate gyrus of the
adult female rat, J. Neurosci. 19 (1999) 5792–5801.
[50] P. Tanapat, N.B. Hastings, E. Gould, Ovarian steroids influence cell pro-
liferation in the dentate gyrus of the adult female rat in a dose- and
time-dependent manner, J. Comp. Neurol. 481 (2005) 252–265.
[51] L. Vallieres, I.L. Campbell, F.H. Gage, P.E. Sawchenko, Reduced hip-
pocampal neurogenesis in adult transgenic mice with chronic astrocytic
production of interleukin-6, J. Neurosci. 22 (2002) 486–492.
[52] B.K. Van der, J. Mulder, J.N. Keijser, B.J. Eggen, P.G. Luiten, E.A. Van
der Zee, Input from the medial septum regulates adult hippocampal neuro-
genesis, Brain Res. Bull. 67 (2005) 117–125.
[53] H. van Praag, B.R. Christie, T.J. Sejnowski, F.H. Gage, Running enhances
neurogenesis, learning, and long-term potentiation in mice, Proc. Natl.
Acad. Sci. U.S.A. 96 (1999) 13427–13431.
[54] M.C. Vemuri, C.S. Chetty, Alcohol impairs astrogliogenesis by stem cells
in rodent neurospheres, Neurochem. Int. 47 (2005) 129–135.
[55] E.S. Vizi, J.P. Kiss, Neurochemistry and pharmacology of the major hip-
pocampal transmitter systems: synaptic and non-synaptic interactions,
Hippocampus 8 (1998) 566–607.
[56] C.G. Wasterlain, F. Plum, Vulnerability of developing rat brain to electro-
convulsive seizures, Arch. Neurol. 29 (1973) 38–45.
[57] C.S. Woolley, B.S. McEwen, Estradiol mediates fluctuation in hippocampal
synapse density during the estrous cycle in the adult rat, J. Neurosci. 12
(1992) 2549–2554.