Molecular Immunology xxx (xxxx) xxx

Contents lists available at ScienceDirect

Molecular Immunology
journal homepage: www.elsevier.com/locate/molimm

Mycobacterium tuberculosis EsxL induces TNF-α secretion through activation

of TLR2 dependent MAPK and NF-κB pathways
Kali Prasad Pattanaik a, Geetanjali Ganguli a, Sumanta Kumar Naik a, Avinash Sonawane b, *
a
School of Biotechnology, KIIT Deemed to be University, Bhubaneswar, Odisha, India
b
Discipline of Biosciences and Biomedical Engineering, IIT Indore, Madhya Pradesh, India

A R T I C L E I N F O A B S T R A C T

Keywords: Mycobacterium tuberculosis (Mtb) employs distinct strategies to circumvent host immune responses during the
Mycobacterium tuberculosis infection process. Various Mtb cell-wall associated and secretory proteins are known to play a critical role in the
Tumour necrosis factor α orchestration of host innate immune responses through modulation of signaling pathways. Mtb genome encodes
Toll-like receptor 2
for 23 (EsxA-EsxW) proteins belonging to the ESAT-6 like family; however, most of them are functionally un-
Mitogen-activated protein kinase
Nuclear factor-κB
known. Here, we show that Mtb EsxL induces tumor necrosis factor-alpha (TNF-α) production by activating
nuclear translocation of nuclear factor-κB (NF-κB) via interaction with Toll-like Receptor 2 (TLR2). Blocking or
silencing of TLR2 abrogated nuclear translocation of NF-kB and TNF-α production. Treatment with recombinant
purified EsxL (rEsxL) activated mitogen-activated protein kinase (MAPK) pathway by inducing the phosphory-
lation of extracellular signal-regulated kinase (ERK) and p38 kinase (p38) pathways. At the same time, inhibition
of ERK and p38 down-regulated the expression of TNF-α in rEsxL exposed murine macrophages. Besides TNF-α,
EsxL also induced the production of IL-6 proinflammatory cytokine. Taken together, these results suggest that
EsxL is able to induce TNF-α secretion via TLR2 through activation of NF-κB and MAPK signaling. This study will
help in deducing therapeutic strategies for better control of the disease.

1. Introduction deficient mice were found to be more susceptible to Mtb infection

Tuberculosis (TB), caused by Mycobacterium tuberculosis (Mtb), is still
considered as one of the deadliest infectious diseases worldwide. It has
been reported that approximately 10 million people are infected with
TB, out of which 1.5 million people die annually (Global Tuberculosis
Report, 2017). Mtb is an intracellular pathogen that primarily resides
inside the alveolar macrophages for a longer period by manipulating the
immune effector functions of macrophages (Satoh and Akira, 2016;
Lugo-Villarino et al., 2011). In the context of Mtb infection, various
Toll-like receptors such as TLR1, TLR2, TLR4, TLR6, and TLR9 play an
essential role in the recognition of a pathogen via interaction with
different mycobacterial ligands to initiate the downstream innate im-
mune responses (Mogensen, 2009). Previously, several mycobacterial
proteins such as lipomannan (Quesniaux et al., 2004), lip-
oarabinomannan (Jones et al., 2001), LpqH (19-kDa/Rv3763) (Noss
et al., 2001; Pai et al., 2003), LprG (Gehring et al., 2004), LprA (Pecora
et al., 2006), MPT83 (Chen et al., 2012), MPB83 (Chambers et al., 2010)
and LprE (Padhi et al., 2019) have been shown to modulate macrophage
functions through TLR2 dependent MAPK pathways and that TLR2
(Drennan et al., 2004). Upon infection, the activation of MAPKs such as
p38, ERK and JNK induce the cascades of phosphorylation reactions at
Th-XXX-Tyr motifs to control pro-inflammatory responses; direct or in-
direct cross-talk through nuclear translocation of NF-κB to regulate the
expression of different genes involved in cell differentiation, prolifera-
tion and death processes (Hayden and Ghosh, 2014).
It has been shown that various mycobacterial antigenic molecules
such as lipomannan, MPT83 and Rv1808 trigger the production of
proinflammatory cytokines such as TNF-α, IL-6, IL-12 and IL-1β through
activation of p38, ERK, and NF-kB pathways. Several studies have shown
that TNF-α is essential for the induction of pro-inflammatory responses
to activate macrophages during Mtb infection and also in the develop-
ment of granuloma during the progression of the disease. TNF-α proin-
flammatory cytokine was found to be increased in pulmonary TB cases
that helps in recruitment of immune cells such as macrophage and
lymphocytes to form granuloma and covers the infected foci (Wickre-
masinghe et al., 1999; Roach et al., 1993). Mice deficient in the TNF-α
receptor or neutralization of TNF-α showed high bacterial burden and
were more susceptible to Mtb infection (Flynn et al., 1995). TNF-α also

* Corresponding author at: Discipline of Biosciences and Biomedical Engineering, IIT Indore, Khandwa Road, Simrol, Madhya Pradesh, 453552, India.
E-mail address: asonawane@iiti.ac.in (A. Sonawane).

https://doi.org/10.1016/j.molimm.2020.11.020
Received 26 March 2020; Received in revised form 6 November 2020; Accepted 23 November 2020
0161-5890/© 2020 Published by Elsevier Ltd.

Please cite this article as: Kali Prasad Pattanaik, Molecular Immunology, https://doi.org/10.1016/j.molimm.2020.11.020
K.P. Pattanaik et al.
serves as a chemotactic factor to draw inflammatory cells such as
T-lymphocyte into the lower respiratory tract and leads to macrophage
activation and mycobacterial growth inhibition by working synergisti-
cally with IFN-γ (Sharma and Bose, 2001).TNF-α is known to inhibit
mycobacterial intracellular replication by activating both inducible ni-
tric oxide synthase (iNOS) dependent and independent pathways (Bek-
ker et al., 2001), facilitate phago-lysosome fusion and enhance the
apoptosis of Mtb infected cells. However, Mtb is known to
down-regulate TNF-α production in order to evade the host
anti-tuberculosis immune mechanisms (Olsen et al., 2016).
In addition to the cytokines, chemokines were also found to be
essential to attract immune cells to Mtb infected regions. Several che-
mokines such as CCL2 (MCP1), CCL3 (MIP-1 α), CCL4 (MIP1β) and CLL5
(RANTEs) play a vital role during Mtb infection (Domingo-Gonzalez
et al., 2016; Qiu et al., 2008; Sadek et al., 1998). MIP-1α, MIP-1β, and
RANTES induce activation and proliferation of T cells and macrophages
to suppress the growth of Mtb within macrophages (Taub et al., 1996;
Chensue et al., 1999). MIP-1α induces production of TNF-α and IL-6 in
macrophages, while MIP-1β can modulate MIP-1α synthesis to induce
TNF-α production. Other studies demonstrated that MIP-1α, MIP-1β, and
RANTES could increase phagocytosis and killing of Trypanosoma cruzi by
inducing nitric oxide production (Chensue et al., 1999; Villalta et al.,
1998).
Mtb EsxL (Rv1198) belongs to the mycobacterial early secreted
antigenic targets of 6-kDa (ESAT6) family proteins. The type VII secre-
tion system (T7SS) of Mtb contains five ESX secretion system (ESX1-
ESX5) (Målen et al., 2007). ESAT6 is an extraordinary Mtb virulence as
well as antigenic determinant abundantly secreted through ESX secre-
tion system (Lewis et al., 2003). ESAT-6 family proteins are known to
induce apoptosis and pro-inflammatory cytokine response via TLR
mediated signaling pathways (Shi et al., 2014; Lin et al., 2019). In this
study, we elucidated the role of Mtb EsxL (Rv1198) in the modulation of
macrophage innate immune responses. We have shown that Mtb EsxL is
responsible for the activation of macrophage pro-inflammatory response
by inducing the secretion of TNF-α through activation of TLR2 depen-
dent MAPK and NF-κB signaling pathways.
2. Material and methods
2.1. Purification of recombinant EsxL protein
Full-length Rv1198 gene was amplified from Mtb H37Rv genome.
Then the amplified product was digested with Nde1 and HindIII and
cloned into pET21b vector. The recombinant plasmid was transformed
into E. coli DH5α. The positive clones were confirmed by colony PCR and
sequencing using gene-specific primers (Table 1). Finally, the recombi-
nant EsxL protein (rEsxL) was expressed in E. coli BL21 (DE3). Protein
expression was induced with 0.5 mM IPTG (isopropyl-b-D-thio-
galactopyranoside, Sigma) for overnight at 16 ◦ C. Bacterial cells were
harvested and stored at −80 ◦ C. Next day cells were lysed using lysis
buffer (20 mM Tris/HCl, pH 8.0, 5 % glycerol, 300 mM NaCl, 10 mM
imidazole and lysozyme 1 mg/mL) containing protease inhibitor cock-
tail (Roche). The harvested cells were then sonicated, centrifuged at
13,000 r.p.m. for 40 min. rEsxL His-tagged protein was purified by af-
finity chromatography using Ni-NTA resin (Qiagen).
Table 1
Primers used in this study.
Gene name Forward primer
18 srRNA GTAACCCGTTGAACCCCATT
GAPDH GAGAGGCCCTATCCCAACTC
TNF-α CACACACACCCTCCTGATTG
IL-12 CACACTGGACCAAAGGGACT
IL-6 GCCTTCTTGGGACTGATGCT
EsxL AAGGATCCATATGACCATCAACTATCAATTCGG
2
Molecular Immunology xxx (xxxx) xxx
2.2. siRNA transfection
RAW264.7 murine macrophages (2.5 × 105 cells/well) in DMEM
media without antibiotic were seeded in 6-well plates. Cells were then
incubated at 37 ◦ C and 5% CO2 till confluency reached to 60 %. Cells
were transfected with 40 pmols of TLR2 siRNA (Santa Cruz Biotech, sc-
40257) as per manufacturer’s instructions. Scrambled siRNA was used
as a control. Cells were harvested 24 h post-treatment, and the silencing
efficiency was determined by quantitative real-time PCR (qRT-PCR)
using gene-specific primers (Table 1).
2.3. Western blot analysis
RAW264.7 cells were treated with different concentrations of rEsxL
for different time points and lysed with cell lysis buffer (5 mM EDTA, 5
mM EGTA, 1 mM PMSF, protease inhibitor cocktail, 10 mM Sodium
fluoride, 1 mM DTT and 1 mM sodium orthovanadate). The cells were
centrifuged at 13,000 r.p.m. for 30 min at 4 ◦ C. Protein concentration
was measured by Bradford assay. To study NF-kβ expression, a nuclear
protein extraction kit (ab113474, Abcam) was used for nuclear protein
extraction. Nuclear and cytoplasmic fractions were separated as per the
manufactures instructions. Proteins were electrophoresed in 12 % SDS-
PAGE gels and transferred to a polyvinylidenedifluoride (PVDF) mem-
brane (GE Healthcare, USA). The membranes were blocked with 5%
nonfat milk for 2 h at room temperature (RT) followed by wash with PBS
containing 0.05 % tween-20 (v/v) (PBST, pH 7.4) and incubated over-
night at 4 ◦ C with primary antibodies such as rabbit anti-ERK2, rabbit
anti-p38 (Santa Cruz Biotechnology), mouse anti–phospho-ERK1/2,
rabbit anti–phospho-p38, MHCII and MyD88. After a wash with PBST,
the membranes were incubated for 1–2 h at 37 ◦ C with the appropriate
HRP-conjugated anti-mouse IgG or anti-rabbit IgG secondary antibodies
(1:5000) (Genei). The peroxidase-positive bands were detected using an
ECL reaction solution (Merck) and visualised by exposure to x-ray film
(XAR5; Kodak, Rochester, NY).
2.4. qRT-PCR analysis
To check the relative expression of different cytokines, RAW264.7
cells (3 × 105 cells/well) were seeded on 6-well plates followed by
treatment with different concentrations of rEsxL. Total RNA was isolated
using TRIzol reagent and cDNA was synthesized using cDNA synthesis
kit (Thermo Scientific, AB1453A) as per the manufacturer’s instructions.
qRT-PCR amplification was carried out using gene-specific primers and
the synthesized cDNA as a template. All reactions were performed in a
total reaction volume of 10 μl using SYBR® Green PCR master mix (Cat.
No. A25742, Applied Biosystems, USA), and carried out in InstaQ96
Real-time PCR (Himedia) with initial denaturation at 95 ◦ C for 2 min,
final denaturation at 95 ◦ C for 30 s, annealing at 55 ◦ C for 15 s and
extension at 72 ◦ C for 30 s. The primers used for the determination of
different gene expression are listed in Table 1. The mRNA levels were
normalized to the transcript levels of 18 s rRNA and GAPDH and the
relative fold changes were calculated.
Reverse Primer
GTAACCCGTTGAACCCCATT
TTCACCTCCCCATACACACC
CTCATTCAACCCTCGAAAA
CTTTGCTTCCCTAGCACCTG
TGCCATTGCACAACTCTTTTCT
ATTAAGCTTGGCCCAGCTGGAGCCGAC
K.P. Pattanaik et al.
2.5. Subcellular localization of NF-kB
RAW264.7 cells were seeded in 24-well culture plates with glass
coverslips; treated with rEsxL (5 mg/mL) for 0, 15, or 30 min; and
washed twice with PBS. Then cells were fixed for 20 min using pre-
chilled methanol and acetone (1:1). To reduce the background stain-
ing, cells were incubated in PBS containing 5% BSA for 30 min and then
incubated with PhospoNF-kB(cellsignaling-3033) antibody. After incu-
bation for 12 h at 4 ◦ C, the cells were washed with phosphate buffer
saline (PBS) and incubated with FITC conjugated goat anti-rabbit IgG
Alexfluor 488(Thermo Scientific cat A32790) for 1 h at RT. Following,
cells were washed and mounted with DAPI-containing ProLong Gold
Antifade mounting solution (catalog number P-36,931; Invitrogen). NF-
kB localization was observed using a fluorescent microscope (Olympus).
2.6. Cytokine profiling
RAW 264.7 cells (2 × 105) in DMEM medium were seeded onto 24-
well tissue culture plate and treated with rEsxL (4 μg/mL) for 24 h. Then
supernatants were collected and cytokine levels were estimated using
Bioplex kit assay (Bio-Rad).
2.7. Pull-down assay
Whole-cell protein lysates were isolated from RAW 264.7 cells and
purified rEsxL-His proteins were added to Ni-NTA beads either alone or
in combination for 2 h on a rocker at 4 ◦ C. The flow-through (FT)
samples were first collected and the beads were then washed (W) with
ice-cold equilibration buffer (20 mM Tris, pH 8.0, 5 % glycerol 150 mM
NaCl) containing 20 mM imidazole. Finally bound proteins were eluted
(E1-E2) in buffer containing 300 mM imidazole. Fractions were elec-
trophoresed on 15 % SDS-PAGE. Western blotting was done with anti-
TLR2 and anti-rEsxL antibodies.
2.8. Statistical analysis
All experiments were performed at least three times. Statistically
significant differences between groups were determined using one-way,
two-way ANOVA (Sidak’s & Turkey’s multiple comparison test) and
Mann-Whitney U_test. Significance were referred as ‘ns’ for non-
significant, * for P < 0.05, ** for P < 0.01 and *** for P ≤ 0.001 ****
for P ≤ 0.0001.
3. Results
3.1. Purification of rEsxL and generation of polyclonal anti-EsxL
antibody
Mycobacterium tuberculosis EsxL (Rv1198), a 94 amino acid residue
protein, is present in the esxKL operon. EsxL belongs to ESX-5 system
and is reported to be present in the culture filtrates of Mtb H37Rv along
with EsxK (Rv1197) (Pandey et al., 2017). Previous study has shown
that ESX-5 plays a critical role in the modulation of macrophage immune
responses and also in cell to cell spread of mycobacteria (Abdallah et al.,
2008; Abdallah et al., 2011). EsxL was amplified from Mtb H37Rv
genomic DNA, cloned in pET21b vector and expressed in E.coli BL21DE3
(clone map; Supplementary Figure S1A). rEsxL was purified using
Ni-NTA and the protein purity was confirmed on SDS-PAGE followed by
silver staining (Supplementary Figure S1B). Anti-EsxL polyclonal anti-
body was generated in rabbit. As shown, the antibody can detect rEsxL
(Supplementary Figure S1C). Further confirmative analysis was per-
formed by identification of the purified EsxL protein by mass spec-
trometry analysis (Supplementary Figure S1D). To determine whether
rEsxL exhibit any cytotoxic effect on macrophages, murine macrophages
RAW264.7 were treated with different concentrations of rEsxL and cell
cytotoxicity was determined by MTT assay. rEsxL did not show any
3
Molecular Immunology xxx (xxxx) xxx
cytotoxicity on macrophages up to 50 μg/mL concentration (Supple-
mentary Figure S2).
3.2. rEsxL induces production of proinflammatory cytokines and
chemokines in murine macrophages
ESAT-6 family proteins and ESX secretory proteins are known to
modulate the cytokine production, and in particularly enhance IL-6 and
TNF-α secretion upon interaction with the macrophages (Yang et al.,
2015).To examine the role of EsxL in the modulation of host immune
responses, macrophages were treated with rEsxL and studied for the
production of a panel of cytokines and chemokines. We found that
treatment with the 2−4 μg concentration of rEsxL significantly induced
the production of TNF-α cytokine in macrophages compared to un-
treated and buffer control cells at 24 h post infection (Fig. 1A and B).
Treatment with proteinase K (PK) abrogated the rEsxL mediated in-
duction of TNF-α production at the transcriptional level (Fig. 1A). To
exclude the effect of endotoxin contamination, RAW264.7 cells were
incubated with LPS (100 ng/mL) or rEsxL (5 μg/mL) with or without
pretreatment with polymyxin B (PMB) and the TNF-α level was checked
after 24 h (Fig. 1C). As shown, no difference in TNF-α secretion was
observed in with and without PMB treated cells. Since maximum TNF-α
secretion was observed at 4 μg rEsxL concentration after 24 h, we
selected these two parameters for the analysis of different cytokines and
chemokines production in macrophages using Bioplex method. We
found that treatment with rEsxL significantly increased the production
of various cytokines and chemokines such as TNF-α, IL-6, MIP1α, MIP1β,
MCP1α and RANTES in macrophages after 24 h (Fig. 1 D–I). However,
no significant differences in the production of IL-10 and IL-12p40 cy-
tokines were observed in comparison to untreated cells (Figs. 1 J and K).
These results indicate that rEsxL elicits the production of some proin-
flammatory cytokines and chemokines in macrophages.
3.3. rEsxL induces nuclear translocation of NF-kBp65 in murine
macrophages
Previous studies have shown that MtbESAT-6 family proteins TB10.4
and TB9.8 induces TNF-α production through activation and nuclear
translocation of NF-kB (Liu et al., 2014; Liu et al., 2018). We speculated
that Mtb EsxL may also phosphorylate and induce nuclear translocation
of NF-kB to enhance proinflammatory cytokine production in macro-
phages. To enumerate this hypothesis, we treated the macrophages with
4 μg/mL of rEsxL and studied the NF-kB level in the cytoplasmic and
nuclear fractions. We observed a significant time-dependent increase in
nuclear translocation and a concomitant decrease in cytoplasmic
NF-kBp65 levels in rEsxL treated macrophages than the untreated cell
(Fig. 2A&B). Immunofluorescence analysis also showed more NF-kB
co-localization (cyan) with nuclei (blue), whereas treatment with pro-
teinase K showed significant reduction in NF-kB nuclear translocation
(Fig. 2C&D). These results demonstrate that rEsxL is indeed involved in
NF-kB nuclear translocation.
3.4. rEsxL triggers TNF-α expression through MAPK pathway
Both P38 and ERK MAPK pathways have been shown to enhance the
synthesis of pro-inflammatory cytokines such as TNF-α. Moreover,
MAPK and NF-kB cross-talk were also found to be necessary for the in-
duction of TNF-α expression. We also found that treatment with rEsxL
resulted in phosphorylation of MAPK proteins, p38 and ERK at early
time points (Fig. 3A&B), while no significant differences were observed
in pJNK levels (data not shown). To confirm the involvement of MAPK in
cytokine modulation, we next studied the expression of TNF-α after
chemical inhibition of p38 and ERK by SB203580 (10μM) and U0126
(10 μM), respectively in macrophages. We found that inhibition of p38
and ERK significantly reduced the induction of TNF-α transcripts by
rEsxL as compared to uninhibited cells (Fig. 3E). Similarly, inhibition of
K.P. Pattanaik et al. Molecular Immunology xxx (xxxx) xxx

Fig. 1. RAW264.7 cells were incubated with (A) 2 and 4 (μg/mL) of rEsxL, buffer control (B.C.) and proteinase K (PK) (50 μg/mL) along with rEsxL for 24 h, and total
RNA was isolated from rEsxL treated and control cells, cDNA was synthesized and subsequently TNF-α expression was checked at the transcriptional levels. The fold
change was normalized against 18 s rRNA. (B) 4 μg/mL rEsxL and TNF-α cytokine level was measured in comparison to respective control at different time points. (C)
LPS (100 ng/mL) and rEsxL (4 μg/mL) with and without polymyxin-B (PMB) (10 μg/mL), Pam3CSK4; untreated (control) cells were used as control for rEsxL.The cell
supernatants were collected and TNF-α level was measured by using cytokine assay kit. (D-K) with and without rEsxL (4 μg/mL); Cell supernatant from untreated
(control) and rEsxL treated cells were collected after 24 h post treatment and the released cytokines and chemokines were studied by using bioplex assay. Data are
expressed as the mean + SD.**, P < 0.001;***, P < 0.0001; ns, non significant. The experiment was performed in duplicates.

4
K.P. Pattanaik et al. Molecular Immunology xxx (xxxx) xxx

Fig. 2. rEsxL induce nuclear translocation of NF-kBp65. (A) Western blot analysis of NF-kBp65 using cytoplasmic and nuclear fraction of the protein samples isolated
from rEsxL treated RAW264.7 macrophages at different time points. (B) Quantitative densitometry of western blot data was performed using ImageJ analysis
software. Graph represent densitometric ratio of cytoplasmic and nuclear NF-kBp65 ratio with respect to respective constitutive control at different time intervals. (C)
Nuclear localization of NF-kBp65 post rEsxL treatment in mouse macrophages was determined using fluorescence microscopy and compared with untreated and
protein kinase treated rEsxL. (D) Fluorescence intensity was quantified using Image J software. The graph represents nuclear NF-kBp65 fluorescence intensity of
control and rEsxL treated variants from three biological replicates; Mean ± SD; *** for P < 0.0001,** for P < 0.001 * for P < 0.05; ns, non-significant.

p38 and ERK also decreased nuclear translocation of NF-kB in rEsxL
treated macrophages in comparison to rEsxL treated cells (Fig. 3C&D).
These results demonstrate that rEsxL induces NF-kB nuclear trans-
location via p38 and ERK MAPK dependent pathways.
3.5. Induction of TNF-α production and NF-kB translocation by rEsxL is
dependent on TLR2
Toll-like receptors play an essential role in the activation of macro-
phage immune responses. ESAT-6 proteins such as TB10.4 and TB9.8 are
known to increase TNF-α production through TLR2 pathway (Liu et al.,
2014; Liu et al., 2018). As shown above, rEsxL treatment up-regulated
TNF-α synthesis (Fig. 1A-D). Next, we investigated the role of TLRs in
the induction of TNF-α by EsxL. For this, TLR2 and TLR4 were either
silenced or chemically inhibited using siRNA or treatment with TLR
blocker and then studied TNF-α expression in rEsxL treated macro-
phages. Interestingly, TLR2 silenced cells failed to induce TNF-α
expression by rEsxL when compared to non-silenced cells (Fig. 4A and
Supplementary Fig. 3A and B). We also studied the nuclear translocation
of NF-kB after blocking the TLR2 receptor by using anti-TLR2 antibody.
TLR-2 blocking significantly reduced NF-kB translocation to the nucleus
(Fig. 4B&C). On the other hand no significant differences in NF-kBp65
translocation and TNF-α expression were observed after treatment
with a TLR4 blocker(TAK242, Sigma) (Supplementary Fig. 4A).
Above results suggested that EsxL regulates TNF-α secretion through
TLR-2 dependent pathway. To further confirm that EsxL interacts with
TLR2, we performed immune pull-down assay with rEsxL. Immunoflu-
orescence study showed TLR2 and EsxL co-localization (Fig. 4D). For
pull-down assay, murine macrophage cell lysates were incubated with
rEsxL protein and passed through Ni-NTA column followed by elution
with an elution buffer. As shown, both rEsxL and TLR2 were eluted in
the same fraction indicating that TLR2-EsxL interacts with each other
(Fig. 4E).
4. Discussion
Various secretory as well as cell-wall associated virulence factors
have been regarded as the key mediators for the Mtb pathogenicity.

5
K.P. Pattanaik et al. Molecular Immunology xxx (xxxx) xxx

Fig. 3. MAPK activation by rEsxL triggers NF-kBp65 nuclear translocation and TNF-α induction. (A)Western blot analysis was performed to determine the phos-
phorylation of p38 and pERK in rEsxL treated RAW 264.7 macrophages at different time points. (B) Quantitative densitometry of western blots was performed using
Image J analysis. The expression was normalized to total p38 and total ERK as loading control. Experiments were performed in biological triplicates. (C) Fluorescence
microscopy analysis of NF-kBp65 nuclear translocation in rEsxL treated RAW264.7 cells in the presence of p38 inhibitor (SB203580,10μM) and ERK inhibitor
(U0126,10μM). (D) The bar graph shows non-significant nuclear translocation of NF-kBp65 at p38 and ERK inhibitor conditions with and without rEsxL of three
biological replicates. (E) Relative expression of TNF-α was studied by using P38 chemical inhibitor (SB203580, 10μM) and ERK inhibitor (U0126, 10μM).The fold
change was normalized against 18 s rRNA. Data are expressed as the mean + SD from).*** for P < 0.005;**** for P < 0.0001; ns, non-significant. The experiment was
performed in triplicates.

Studies showed that mycobacteria have evolved with different secretion
mechanisms to transport extracellular proteins across their hydrophobic
and extremely impermeable cell walls (Stanley et al., 2003; Brodin et al.,
2005). It has been reported that pathogenic mycobacteria strains consist
up to five T7S secretory systems designated as ESX-1,2,3,4 and 5.
Phylogenetic and comparative genomic analyses have shown that these
ESX systems are likely to be evolved by gene duplication in the order
ESX-4, ESX-1, ESX-3, ESX-2, and ESX-5 (Gey Van Pittius et al., 2001). A
T7S system that has attracted considerable attention in recent times is
ESX-5, which is limited to pathogenic mycobacterial species like M.
tubercule, M. leprae and, M. marinum (Gey van Pittius et al., 2006). This
ESX-5 system was found to be essential for the formation of granulomas,
cell to cell spread of mycobacteria, and its substrates were shown to
actively modulate the immune responses of human macrophages
(Abdallah et al., 2008; Abdallah et al., 2011). Mtb EsxL, encoded by
Rv1198, is a putative interacting ESAT-6 family protein that belongs to
the ESX-5 group and is encoded by the esxKL operon. EsxL is stated to be
present in the culture filtrates of Mtb H37Rv (Målen et al., 2007). The
patterns of the RNA expression in sputum from diagnosed TB patients
also displayed a prominent presence of Rv1198 transcripts, and that EsxL
is highly expressed during active human lung TB infection (Bukka et al.,
2012; Pandey et al., 2017). Mtb genome encodes numerous putative
protein and non-protein antigenic molecules, some of which are enco-
ded by ESX-5 system, are capable of eliciting potent innate and adaptive
immune responses. Therefore, functional characterization of these
mycobacterial ESAT-6 family proteins is essential for better under-
standing of the host-pathogen interactions and the design of prospective
vaccine candidates.

6
K.P. Pattanaik et al. Molecular Immunology xxx (xxxx) xxx

Fig. 4. rEsxL interacts with TLR2 and triggers TNF-α expression. (A) RAW264.7 mouse macrophages were treated with rEsxL, TLR2 siRNA, scrambled siRNA, and
TLR2 siRNA along with rEsxL for 24 h. Relative fold-expression of TNF-α was studied by normalizing data against 18 s rRNA. (B) NF-kBp65 nuclear translocation was
studied with fluorescence microscopy by blocking TLR2 using anti-TLR2 antibody prior to rEsxL treatment (blue-Nucleus, green-NF-kB). (C) Fluorescence intensity of
nuclear p-65NFkB of RAW264.7 cells blocked with TLR2 antibody and with or without rEsxL treatment were quantified using imageJ analysis software. (D)
Interaction between TLR2 and rEsxL was studied by using immune staining method (blue-nucleus, Red- TLR2 and green rEsxL). (E) Pull down assay was performed to
confirm rEsxL interaction with TLR2. Data are expressed as the mean + SD from).**, P < 0.001;***, P < 0.0001; ns, not significant. The experiment was performed in
triplicates (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article).

Cross-talks between TLRs and mycobacterial ESAT-6 family antigens
have been extensively studied over the decades. Among different toll-
like receptors, TLR2 is considered as an essential link between innate
and adaptive immune responses against invasive mycobacteria and
other microbial pathogens (Hmama et al., 2015; Pasare and Medzhitov,
2005; Takeda and Akira, 2005). However, despite comprehensive
studies carried out over the years, the precise molecular mechanism(s)
by which mycobacterial ESAT-6 like proteins help in exerting patho-
genesis remains poorly understood. Here, we successfully purified
His-tagged recombinant protein (rEsxL) and also generated anti-EsxL
antibody. From the pull-down assay, we confirmed that Mtb EsxL
interacts with the TLR2 receptor to trigger TNF-α secretion in macro-
phages. Previous studies also demonstrated that several mycobacterial
proteins such as MPT83 and Mtb9.8 interacted with TLR2 (Chen et al.,
2012; Liu et al., 2018). The same report also suggested that interaction
of mycobacterial MPT83 and Mtb9.8 with TLR2 resulted in subsequent
activation of the pro-inflammatory TNF-α cytokine. We also found that
exposure to Mtb EsxL induced TNF-α secretion, along with a panel of
other cytokines and chemokines; while TLR silencing abrogated EsxL
induced TNF-α secretion. TNF-α act as a critical regulator of host im-
mune responses to Mtb infection, macrophage activation to kill engulfed
bacteria efficiently, and induction of chemokines, cytokines and

7
K.P. Pattanaik et al.
apoptosis. These NF-κB dependent signaling pathway activities have
made TNF-α as a key factor for inhibiting mycobacterial growth in
granulomas(Gutierrez et al., 2008; Harris et al., 2008).
Earlier reports demonstrated that Mtb proteins such as PPE26 and
MPT83 interact with TLR2 to induce secretion of pro-inflammatory cy-
tokines through nuclear translocation of NF-kB (Chen et al., 2012; Su
et al., 2015). Reports suggest that NF-κB mediated responses signifi-
cantly control mycobacterial load in TB granulomas, inflammation level
in lung tissue, and granuloma size (Fallahi-Sichani et al., 2012). Further
upon stimulation, NF-kB also induces the transcription of the TNF family
of cytokines. Indeed we also found that treatment with rEsxL induced
NF-kB activation and subsequently TNF-α secretion in macrophages.
TNF-α binds to the TNF-receptor (Tnfr)to activate the MAPK
pathway as a primary response. Then secondary response generated
from MAPK molecules is known to augment the TNF-α expression. The
secondary response is a result of cross-talk between MAPkinases (p38
and ERK) and NF-kB, thereby inducing the production of TNF-α (Sabio
and Davis, 2014). In the context of Mtb infection, MAPKs play crucial
roles in the activation of innate immunity, T-cell activation, prolifera-
tion and differentiation into T-helper cells (Dong et al., 2002; Adler
et al., 2007). We also found that rEsxL significantly upregulated the
phosphorylation of MAPK molecules namely p38 and ERK. Previous
studies also demonstrated that Mtb protein such as Rv3402C and MPT83
trigger TNF-α production through activation of p38 and ERK MAPK
signaling pathways (Li et al., 2014; Chen et al., 2012). On the contrary,
chemical inhibition of p38 and ERK, but not JNK, significantly reduced
NF-kB nuclear translocation and subsequent reduction in the production
of TNF-α cytokine. These results suggested that p38 and ERK MAPK
pathways are essential for the production of TNF-α by Mtb EsxL.
5. Conclusions
In summary, MtbEsxL interacts with TLR2 to activate the production
of pro-inflammatory cytokines (specifically TNF-α) through MAPK
phosphorylation and nuclear translocation of NF-kB.
Author’s contribution
KP designed, performed, analyzed the experiments and wrote the
manuscript; GG performed the experiments and analyzed the data and
contributed to writing up the manuscript; SKN analyzed the data and
contributed to writing up the manuscript; AS designed experiments,
analyzed the data, obtained funding and wrote the manuscript.
Declaration of Competing Interest
The authors have no conflict of interest.
Acknowledgement
This work was supported by grant (BT/PR23317/MED/29/1186/
2017) from Department of Biotechnology, Government of India and
Alexander von-Humboldt Stiftung, Germany (Ref 3.3-IND-1152176-
HFST-E) to AS. KP would like to acknowledge the Council of Science and
Industrial Research, Government of India, for the research scholarship.
Appendix A. Supplementary data
Supplementary material related to this article can be found, in the
online version, at doi:https://doi.org/10.1016/j.molimm.2020.11.020.
References
Abdallah, A.M., Savage, N.D.L., van Zon, M., Wilson, L., Vandenbroucke-Grauls, C.M.J.
E., van der Wel, N.N., Ottenhoff, T.H.M., Bitter, W., 2008. The ESX-5 secretion
system of Mycobacterium marinum modulates the macrophage response.
J. Immunol. 181, 7166–7175.
8
Molecular Immunology xxx (xxxx) xxx
Abdallah, A.M., Bestebroer, J., Savage, N.D.L., De Punder, K., Van Zon, M., Wilson, L.,
Korbee, C.J., Van Der Sar, A.M., Ottenhoff, T.H.M., Van Der Wel, N.N., 2011.
Mycobacterial secretion systems ESX-1 and ESX-5 play distinct roles in host cell
death and inflammasome activation. J. Immunol. 187, 4744–4753.
Adler, H.S., Kubsch, S., Graulich, E., Ludwig, S., Knop, J., Steinbrink, K., 2007. Activation
of MAP kinase p38 is critical for the cell-cycle-controlled suppressor function of
regulatory T cells. Blood 109, 4351–4359. https://doi.org/10.1182/blood-2006-09-
047563.
Bekker, L.G., Freeman, S., Murray, P.J., Ryffel, B., Kaplan, G., 2001. TNF-alpha controls
intracellular mycobacterial growth by both inducible nitric oxide synthase-
dependent and inducible nitric oxide synthase-independent pathways. J. Immunol.
166, 6728–6734. https://doi.org/10.4049/jimmunol.166.11.6728.
Brodin, P., de Jonge, M.I., Majlessi, L., Leclerc, C., Nilges, M., Cole, S.T., Brosch, R., 2005.
Functional analysis of early secreted antigenic target-6, the dominant T-cell antigen
of Mycobacterium tuberculosis, reveals key residues involved in secretion, complex
formation, virulence, and immunogenicity. J. Biol. Chem. 280, 33953–33959.
https://doi.org/10.1074/jbc.M503515200.
Bukka, A., Price, C.T.D., Kernodle, D.S., Graham, J.E., 2012. Mycobacterium tuberculosis
RNA expression patterns in sputum Bacteria Indicate secreted esx factors
contributing to growth are highly expressed in active disease. Front. Microbiol. 2,
266. https://doi.org/10.3389/fmicb.2011.00266.
Chambers, M.A., Whelan, A.O., Spallek, R., Singh, M., Coddeville, B., Guerardel, Y.,
Elass, E., 2010. Non-acylated Mycobacterium bovis glycoprotein MPB83 binds to
TLR1/2 and stimulates production of matrix metalloproteinase 9. Biochem. Biophys.
Res. Commun. 400, 403–408. https://doi.org/10.1016/j.bbrc.2010.08.085.
Chen, S.-T., Li, J.-Y., Zhang, Y., Gao, X., Cai, H., 2012. Recombinant MPT83 derived from
Mycobacterium tuberculosis induces cytokine production and upregulates the
function of mouse macrophages through TLR2. J. Immunol. 188, 668–677. https://
doi.org/10.4049/jimmunol.1102177.
Chensue, S.W., Warmington, K.S., Allenspach, E.J., Lu, B., Gerard, C., Kunkel, S.L.,
Lukacs, N.W., 1999. Differential expression and cross-regulatory function of RANTES
during mycobacterial (type 1) and schistosomal (type 2) antigen-elicited
granulomatous inflammation. J. Immunol. 163, 165–173.
Domingo-Gonzalez, R., Prince, O., Cooper, A., Khader, S.A., 2016. Cytokines and
chemokines in Mycobacterium tuberculosis infection. Microbiol. Spectr. 4 (10)
https://doi.org/10.1128/microbiolspec.TBTB2-0018-2016, 1128/microbiolspec.
TBTB2-0018–2016.
Dong, C., Davis, R.J., Flavell, R.A., 2002. MAP kinases in the immune response. Annu.
Rev. Immunol. 20, 55–72. https://doi.org/10.1146/annurev.
immunol.20.091301.131133.
Drennan, M.B., Nicolle, D., Quesniaux, V.J.F., Jacobs, M., Allie, N., Mpagi, J.,
Frémond, C., Wagner, H., Kirschning, C., Ryffel, B., 2004. Toll-like receptor 2-defi-
cient mice succumb to Mycobacterium tuberculosis infection. Am. J. Pathol. 164,
49–57. https://doi.org/10.1016/S0002-9440(10)63095-7.
Fallahi-Sichani, M., Kirschner, D.E., Linderman, J.J., 2012. NF-κB signaling dynamics
play a key role in infection control in tuberculosis. Front. Physiol. 3, 170. https://
doi.org/10.3389/fphys.2012.00170.
Flynn, J.L., Goldstein, M.M., Chan, J., Triebold, K.J., Pfeffer, K., Lowenstein, C.J.,
Schreiber, R., Mak, T.W., Bloom, B.R., 1995. Tumor necrosis factor-alpha is required
in the protective immune response against Mycobacterium tuberculosis in mice.
Immunity 2, 561–572. https://doi.org/10.1016/1074-7613(95)90001-2.
Gehring, A.J., Dobos, K.M., Belisle, J.T., Harding, C.V., Boom, W.H., 2004.
Mycobacterium tuberculosis LprG (Rv1411c): a novel TLR-2 ligand that inhibits
human macrophage class II MHC antigen processing. J. Immunol. 173, 2660–2668.
https://doi.org/10.4049/jimmunol.173.4.2660.
Gey van Pittius, N.C., Sampson, S.L., Lee, H., Kim, Y., van Helden, P.D., Warren, R.M.,
2006. Evolution and expansion of the Mycobacterium tuberculosis PE and PPE
multigene families and their association with the duplication of the ESAT-6 (esx)
gene cluster regions. BMC Evol. Biol. 6, 95. https://doi.org/10.1186/1471-2148-6-
95.
Gey Van Pittius, N.C., Gamieldien, J., Hide, W., Brown, G.D., Siezen, R.J., Beyers, A.D.,
2001. The ESAT-6 gene cluster of Mycobacterium tuberculosis and other high G+C
Gram-positive bacteria. Genome Biol. 2 https://doi.org/10.1186/gb-2001-2-10-
research0044. RESEARCH0044.
World Health Organization. Global tuberculosis report 2017. Geneva; 2017. Report No.
WHO/HTM/TB/2017.23 Contract No.: WHO/HTM/TB; 2017. https://apps.who.int/
iris/handle/10665/259366.
Gutierrez, M.G., Mishra, B.B., Jordao, L., Elliott, E., Anes, E., Griffiths, G., 2008. NF-
kappa B activation controls phagolysosome fusion-mediated killing of mycobacteria
by macrophages. J. Immunol. 181, 2651–2663. https://doi.org/10.4049/
jimmunol.181.4.2651.
Harris, J., Hope, J.C., Keane, J., 2008. Tumor necrosis factor blockers influence
macrophage responses to Mycobacterium tuberculosis. J. Infect. Dis. 198,
1842–1850. https://doi.org/10.1086/593174.
Hayden, M.S., Ghosh, S., 2014. Regulation of NF-κB by TNF family cytokines. Seminars
in Immunology. Elsevier, pp. 253–266.
Hmama, Z., Peña-Díaz, S., Joseph, S., Av-Gay, Y., 2015. Immunoevasion and
immunosuppression of the macrophage by Mycobacterium tuberculosis. Immunol.
Rev. 264, 220–232. https://doi.org/10.1111/imr.12268.
Jones, B.W., Means, T.K., Heldwein, K.A., Keen, M.A., Hill, P.J., Belisle, J.T., Fenton, M.
J., 2001. Different Toll-like receptor agonists induce distinct macrophage responses.
J. Leukoc. Biol. 69, 1036–1044.
Lewis, K.N., Liao, R., Guinn, K.M., Hickey, M.J., Smith, S., Behr, M.A., Sherman, D.R.,
2003. Deletion of RD1 from Mycobacterium tuberculosis mimics bacille Calmette-
Guérin attenuation. J. Infect. Dis. 187, 117–123. https://doi.org/10.1086/345862.
K.P. Pattanaik et al.
Li, W., Zhao, Q., Deng, W., Chen, T., Liu, M., Xie, J., 2014. Mycobacterium tuberculosis
Rv3402c enhances mycobacterial survival within macrophages and modulates the
host pro-inflammatory cytokines production via NF-kappa B/ERK/p38 signaling.
PLoS One 9. https://doi.org/10.1371/journal.pone.0094418 e94418–e94418.
Lin, J., Chang, Q., Dai, X., Liu, D., Jiang, Y., Dai, Y., 2019. Early secreted antigenic target
of 6-kDa of Mycobacterium tuberculosis promotes caspase-9/caspase-3-mediated
apoptosis in macrophages. Mol. Cell. Biochem. 457, 179–189. https://doi.org/
10.1007/s11010-019-03522-x.
Liu, S., Jia, H., Hou, S., Zhang, G., Xin, T., Li, H., Yuan, W., Guo, X., Gao, X., Li, M., 2014.
Recombinant TB10. 4 of Mycobacterium bovis induces cytokine production in
RAW264. 7 macrophages through activation of the MAPK and NF-κB pathways via
TLR2. Mol. Immunol. 62, 227–234.
Liu, S., Jia, H., Hou, S., Xin, T., Guo, X., Zhang, G., Gao, X., Li, M., Zhu, W., Zhu, H.,
2018. Recombinant Mtb9.8 of Mycobacterium bovis stimulates TNF-α and IL-1β
secretion by RAW264. 7 macrophages through activation of NF-κB pathway via
TLR2. Sci. Rep. 8, 1–11.
Lugo-Villarino, G., Hudrisier, D., Tanne, A., Neyrolles, O., 2011. C-type lectins with a
sweet spot for Mycobacterium tuberculosis. Eur. J. Microbiol. Immunol. (Bp). 1,
25–40. https://doi.org/10.1556/EuJMI.1.2011.1.6.
Målen, H., Berven, F.S., Fladmark, K.E., Wiker, H.G., 2007. Comprehensive analysis of
exported proteins from Mycobacterium tuberculosis H37Rv. Proteomics 7,
1702–1718. https://doi.org/10.1002/pmic.200600853.
Mogensen, T.H., 2009. Pathogen recognition and inflammatory signaling in innate
immune defenses. Clin. Microbiol. Rev. 22, 240–273. https://doi.org/10.1128/
CMR.00046-08.
Noss, E.H., Pai, R.K., Sellati, T.J., Radolf, J.D., Belisle, J., Golenbock, D.T., Boom, W.H.,
Harding, C.V., 2001. Toll-like receptor 2-dependent inhibition of macrophage class II
MHC expression and antigen processing by 19-kDa lipoprotein of Mycobacterium
tuberculosis. J. Immunol. 167, 910–918. https://doi.org/10.4049/
jimmunol.167.2.910.
Olsen, A., Chen, Y., Ji, Q., Zhu, G., De Silva, A.D., Vilchèze, C., Weisbrod, T., Li, W.,
Xu, J., Larsen, M., Zhang, J., Porcelli, S.A., Jacobs, W.R.C., 2016. Tumor necrosis
factor alpha-downregulating genes for the development of antituberculous vaccines.
MBio 7, e01023–15. https://doi.org/10.1128/mBio.01023-15.
Padhi, A., Pattnaik, K., Biswas, M., Jagadeb, M., Behera, A., Sonawane, A., 2019.
Mycobacterium tuberculosis LprE suppresses TLR2-Dependent cathelicidin and
autophagy expression to enhance bacterial survival in macrophages. J. Immunol.
203, 2665–2678. https://doi.org/10.4049/jimmunol.1801301.
Pai, R.K., Convery, M., Hamilton, T.A., Boom, W.H., Harding, C.V., 2003. Inhibition of
IFN-γ-Induced class II transactivator expression by a 19-kDa lipoprotein from
Mycobacterium tuberculosis : a potential mechanism for immune evasion.
J. Immunol. 171, 175–184. https://doi.org/10.4049/jimmunol.171.1.175.
Pandey, H., Tripathi, S., Srivastava, K., Tripathi, D.K., Srivastava, M., Kant, S.,
Srivastava, K.K., Arora, A., 2017. Characterization of culture filtrate proteins Rv1197
and Rv1198 of ESAT-6 family from Mycobacterium tuberculosis H37Rv. Biochim.
Biophys. Acta - Gen. Subj. 1861, 396–408. https://doi.org/10.1016/j.
bbagen.2016.10.013.
Pasare, C., Medzhitov, R., 2005. Toll-like receptors: linking innate and adaptive
immunity. Adv. Exp. Med. Biol. 560, 11–18. https://doi.org/10.1007/0-387-24180-
9_2.
Pecora, N.D., Gehring, A.J., Canaday, D.H., Boom, W.H., Harding, C.V., 2006.
Mycobacterium tuberculosis LprA is a lipoprotein agonist of TLR2 that regulates
innate immunity and APC function. J. Immunol. 177, 422–429. https://doi.org/
10.4049/jimmunol.177.1.422.
Molecular Immunology xxx (xxxx) xxx
Qiu, L., Huang, D., Chen, C.Y., Wang, R., Shen, L., Shen, Y., Hunt, R., Estep, J., Haynes, B.
F., Jacobs Jr, W.R., Letvin, N., Du, G., Chen, Z.W., 2008. Severe tuberculosis induces
unbalanced up-regulation of gene networks and overexpression of IL-22, MIP-
1alpha, CCL27, IP-10, CCR4, CCR5, CXCR3, PD1, PDL2, IL-3, IFN-beta, TIM1, and
TLR2 but low antigen-specific cellular responses. J. Infect. Dis. 198, 1514–1519.
https://doi.org/10.1086/592448.
Quesniaux, V.J., Nicolle, D.M., Torres, D., Kremer, L., Guérardel, Y., Nigou, J., Puzo, G.,
Erard, F., Ryffel, B., 2004. Toll-like receptor 2 (TLR2)-dependent-positive and TLR2-
independent-negative regulation of proinflammatory cytokines by mycobacterial
lipomannans. J. Immunol. 172, 4425–4434. https://doi.org/10.4049/
jimmunol.172.7.4425.
Roach, T.I., Barton, C.H., Chatterjee, D., Blackwell, J.M., 1993. Macrophage activation:
lipoarabinomannan from avirulent and virulent strains of Mycobacterium
tuberculosis differentially induces the early genes c-fos, KC, JE, and tumor necrosis
factor-alpha. J. Immunol. 150, 1886–1896.
Sabio, G., Davis, R.J., 2014. TNF and MAP kinase signalling pathways. Semin. Immunol.
26, 237–245. https://doi.org/10.1016/j.smim.2014.02.009.
Sadek, M.I., Sada, E., Toossi, Z., Schwander, S.K., Rich, E.A., 1998. Chemokines induced
by infection of mononuclear phagocytes with mycobacteria and present in lung
alveoli during active pulmonary tuberculosis. Am. J. Respir. Cell Mol. Biol. 19,
513–521. https://doi.org/10.1165/ajrcmb.19.3.2815.
Satoh, T., Akira, S., 2016. Toll-like receptor signaling and its inducible proteins.
Microbiol. Spectr. 4 https://doi.org/10.1128/microbiolspec.MCHD-0040-2016,
10.1128/microbiolspec.MCHD-0040–2016.
Sharma, S., Bose, M., 2001. Role of cytokines in immune response to pulmonary
tuberculosis. Asian Pacific J. allergy Immunol. 19, 213–219.
Shi, J., Zhang, H., Fang, L., Xi, Y., Zhou, Y., Luo, R., Wang, D., Xiao, S., Chen, H., 2014.
Biochemical and Biophysical Research Communications A novel firefly luciferase
biosensor enhances the detection of apoptosis induced by ESAT-6 family proteins of
Mycobacterium tuberculosis. Biochem. Biophys. Res. Commun. 452, 1046–1053.
https://doi.org/10.1016/j.bbrc.2014.09.047.
Stanley, S.A., Raghavan, S., Hwang, W.W., Cox, J.S., 2003. Acute infection and
macrophage subversion by Mycobacterium tuberculosis require a specialized
secretion system. Proc. Natl. Acad. Sci. U. S. A. 100, 13001–13006. https://doi.org/
10.1073/pnas.2235593100.
Su, H., Kong, C., Zhu, L., Huang, Q., Luo, L., Wang, H., Xu, Y., 2015. PPE26 induces
TLR2-dependent activation of macrophages and drives Th1-type T-cell immunity by
triggering the cross-talk of multiple pathways involved in the host response.
Oncotarget 6, 38517–38537. https://doi.org/10.18632/oncotarget.5956.
Takeda, K., Akira, S., 2005. Toll-like receptors in innate immunity. Int. Immunol. 17,
1–14. https://doi.org/10.1093/intimm/dxh186.
Taub, D.D., Turcovski-Corrales, S.M., Key, M.L., Longo, D.L., Murphy, W.J., 1996.
Chemokines and T lymphocyte activation: I. Beta chemokines costimulate human T
lymphocyte activation in vitro. J. Immunol. 156, 2095–2103.
Villalta, F., Zhang, Y., Bibb, K.E., Kappes, J.C., Lima, M.F., 1998. The cysteine-Cysteine
family of chemokines RANTES, MIP-1α, and MIP-1β induce trypanocidal activity in
human macrophages via nitric oxide. Infect. Immun. 66, 4690. LP – 4695.
Wickremasinghe, M.I., Thomas, L.H., Friedland, J.S., 1999. Pulmonary epithelial cells
are a source of IL-8 in the response to Mycobacterium tuberculosis: essential role of
IL-1 from infected monocytes in a NF-kappa B-dependent network. J. Immunol. 163,
3936–3947.
Yang, S., Li, F., Jia, S., Zhang, K., Jiang, W., Shang, Y., Chang, K., Deng, S., Chen, M.,
2015. Early secreted antigen ESAT-6 of mycobacterium tuberculosis promotes
apoptosis of macrophages via targeting the microrna155-SOCS1 interaction. Cell.
Physiol. Biochem. 35, 1276–1288. https://doi.org/10.1159/000373950.