Q: 1 Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine,

Thymine, Guanosine, Uracil and Cytosine, Guanine

Q: 2 What is the difference between DNAs and DNase ?
Q: 3 What are characteristics of prokaryotic chromosome/nucleoid ?
Q: 4 What is the role of NHC (Non-Histone chromsomal) other than histones proteins?
Q: 5 Give examples of nitrogenous bases.
Q: 6 What is the major compositional difference in DNA or RNA?
Q: 7 Who first identified DNA? Q: 8 What are histones?
Q: 9 . How many base pairs are present in a nucleosome ?
Q: 10 Name amino acid residues of histone proteins.
Q: 11 Who proposed central dogma of molecular biology?
Q: 12 . What is the linkage between nitrogenous base and pentose sugar called?
Q.13. It is sequence of the sequence of mRNA.
5–ATGCATGCAIGCATGCATGCATGIANG 3 .Write down the sequence of mRNA.
Q: 14 Mention the carbon positions to which the nitrogenous base and phosphate
molecule are respectively linked in the nucleotide.
Q: 15 Who proposed the famous double stranded helical structure of DNA?
Q: 16 How does the flow of genetic information in HIV deviate from the 'Central
dogma' proposed by Francis Crick? [C.B.S.E. 2011)
Q: 17 Draw double helix structures OR Draw only DNA Double Helix.
OR Describe Watson and Crick model with the help of suitable diagram
OR Draw the well labelled diagrams of B- DNA .
Q: 18 Differentiate between prokaryotic DNA and eukaryotic DNA.
Q: 19 What are Chargaff's rules?
Q: 20 How does a prokaryotic chromosome differ from an eukaryotic chromosome?
Q: 21 Define mention what enable histone to acquire a positive charge.
Q: 22 In the eukaryotes the DNA molecules are organised within the nucleus. How is
the DNA molecule organised in a bacterial of in absence of a nucleus ?
Q: 23 Explain the structure of nucleoside and nucleotide.
Q: 24 What is the role of RNA? How many bp's are present in bacteriophage ?
Q: 25 Which property of DNA double helix led Watson and Crick to hypothesise semi-
conservative mode of DNA replication? Explain.
OR
What background information did Watson and Crick had available with them for
developing a model of DNA? What was their own contribution? [N.C.E.R.T. Exemplar]
Q: 26 Why flowers are important for human beings?
Q: 27 Define flower and its floral parts with the help of diagram.
Q: 28 List the functions of a flower.
Q: 26 Explain the two factros responsible for conferring stability to double helix
structure of DNA.
Q: 27 Retrovirus do not follows central dogma. Comment.
Q: 28 The base sequence on one of the strands of DNA is ATGTCTATA.
(i) Give the base sequence of its complementary strand.
(ii) If an RNA strand is transcribed by this strand, what would be the base sequence of
RNA ? (iii) In what other respect, an RNA molecule differs from a DNA molecule ?
Q: 29 Draw a schematic representation of dinucleotide. Label the following: (i) The
components of a nucelotide (ii) 5' end (ii) N-glycosidic linkage (iv) Phosphodiester
linkage.
Q: 30 Why does RNA express the characters easily?
Q: 31 Why RNA viruses have high evolution rate?
Q:32 Why RNA is more reactive than DNA?
Q: 33 What suggested the copying mechanism of genetic material to Watson and
Crick?
Q:34 Which property of RNA helps it to work as catalyst?
Q: 35 Though RNA can directly code for proteins still DNA is preferred as storage
genetic material. Why ?
Q: 36 What are NHC proteins ? Q: 37 What are bacteriophages ?
Q: 38 What do you understand by transformation?
Q: 39 Who discovered the phenomenon of transformation?
Q: 40 Recall the experiment done by Frederick Griffith. If RNA, instead of DNA was the
genetic material, would the heat killed strain of Streptococcus have transformed the
R-strain into virulent strain? Explain your answer.
Q: 41 What is the nature of genetic material?
Q: 42 Differentiate between euchromatin and heterochromatin ?
Q: 43 How did Hershey and Chase differentiate between DNA and protein in their
experiment while proving that DNA is the genetic material?(C.B.S.E. 2016; N.C.E.R.T.)
Q: 44 Distinguish between transformation and transduction.
Q:45 You are repeating the Hershey-Chase experiment and are provided with two
isotopes: 32P and 15N (in place of 35S in the original experiment). How do you expect
your results to be different? [C.B.S.E. 2016]
Q: 46 It is established that RNA is the first genetic material. Explain giving three
reasons.[C.B.S.E. 2012/
Q: 47 Explain the role of 35S and 32P in the experiments conducted by Hershey and
Chase. [C.B.S.E. 2019; 2020]
Q: 48 Why is DNA considered a better materia than RNA l IC.B.S.E. 2016]
Q: 49 Discuss Griffith experiment to prove DNA is genetic material.
Q: 50 Explain Hershey and Chase experiment to prove that DNA is genetic material.
IC.B.S.E. 2018; 20201
Q: 51 List the three major functions of a DNA.
Q: 52 (a) Write the scientific name of the bacterium used by Fredrick Griffith in his
experiment.
(b) How did he prove that some "transforming principle' is responsible for
transformation of the non-violent strains of bacteria into the virulent form?
(c) State the biochemical nature of transforming principle'? (d) Name the scientists
who proved it.IC.B.S.E. 2016, 2011]
Q: 53 Describe Fredrick Griffith's experiment on Streptococcus pneumoniae. Discuss
the conclusion he arrive at[C.B.S.E. 2014]
Or
Describe the experiment with Streptococcus pneumoniae that demonstrated the
existence of some "transforming principle".
Q: 54 How did Griffith explain the trans- formation of R-strain (non-virulent) bacteria
into S-strain (virulent)?
(b) Explain how MacLeod, McCarty and Avery determined the biochemical nature of
the molecule responsible for transforming R-strain bacteria linto S-strain bacteria.
Q:55 How did Alfred Hershey and Martha Chase arrive at the conclusion that DNA is
the genetic material [C.B.S.E. 2009). OR. Write the conclusion they
arrive at after the experiment.
Q:56 Give an example where ribosome acts as catalyst.
Q: 57 Name two viruses that have RNA as genetic material
Q:58 Which of the following RNA acts as structural RNA as well as enzyme in bacteria
Q: 59 Which enzyme initiates transcription?
Q: 60 Differentiate between mRNA and RNA
Q: 61 Draw the structure of a RNA charged with methionine.[C.B.S.E. 2012)
Q:62 (a) Draw the structure of the initiator rRNA adaptor molecule.
(b) Draw a clover leaf structure of RNA showing the following:
(b) Why is RNA called an adaptor molecule ? [C.B.S.E. 2017)
Q: 63 State the functions of the following in a prokaryote :tRNA and rRNA (C.B.S.2012]
Q: 64 (a) Name the scientist who called RNA an adaptor molecule.
b) Draw a clover leaf structure of RNA showing the following:
1) Tyrosine attached to its amino acid site.
ii) Anticodon for this amino acid in its correct site (codon for tyrosine is UAC).
c) What does the actual structure of RNA look like ?[C.B.S.E. 2014]
Q:65 Enlist the role of following in protein synthesis:(1) mRNA (ii) RNA.(i) tRNA
Q:66 Q.84. (i) What are the three types of RNAs? (ii) Which one of these has the shape
of a clover-leaf in two dimensional structure? (iii) How is each RNA related in the
information flow during protein
Q:67 Describe the structure of a RNA polynucleotide chain having different types of
nucleotides.
Q: 68 To prove semi-conservative replication of DNA in chromosomes, Taylor and his
colleagues conducted experimentation:
Q:69 Define semi-conservative DNA Replication.
Q:70 What are two functions of DNA polymerase?
Q: 71 How does DNA polymerase functions within a replication fork of DNA during
replication?
Q:72 What is the direction of DNA/RNA replication by polymerases?
Q:73 Which of the two DNA strands is called coding strand?
Q:74 At which phase of cell division DNA replicates ?
Q: 75 Can DNA polymerase initiate DNA replication?
Q: 76 If the sequence of one strand of DNA is written as follows:
5-AIGCATGCATGCATGCATGCATGCATGE-31 [C.B.S.E. 2020; N.C.E.R.T.]
Write down the sequence of complementary strand in 5'-3' direction.
Q:77 Name the types of synthesis 'a' and 'b' occuring in the replication fork of DNA as
shown below
Q: 78 What are exons ? Q: 79 Name the enzyme involved in the continuous
replication of DNA srand. Mention the polarity lof the template strand. [C.B.S.E. 2010]
Q:80 Name the enzyme and state its property that is responsible for continuous and
discontinuous replication of the two strandsof a DNA molecule.[C.B.S.E. 2013]
Q:81 Mention the function of DNA ligase ? Q:82 What is origin of replication or ori?
Q:83 What is replication fork?
Q:84 In a nucleus, the number of RNA nucleoside triphosphates is 10 times more than
the number of DNA nucleoside triphosphates, still only DNA nucleotides are added
during the DNA replication and not the RNA nucleotides. Why?
Q:85 Differentiate Leading and Lagging strand.
Q:86 Why only one strand of DNA acts as template for transcription?
Q:87 Differentiate between Replication and Transcription.
Q:88 Depending upon the chemical nature of the template (DNA or RNA) and the
nature of nucleic acids synthesised from it (DNA or RNA), list the types of nucleic acid
polymerases. IN.C.E.R.T.J
Q:89 Name indicating their functions, a few additional enzymes, other than DNA
polymerase and ligase, that are involved in the replication of DNA with high degree of
processivity and accuracy.IN.C.E.R.T. Exemplar]
Q:90 During in vitro synthesis of DNA, a researcher used 2',3'-deoxycytidine
triphosphate as raw nucleotide in place of 2'-deoxy cytidine triphosphate, other
conditions remaining as standard. Will further polymerisation of DNA continue up to
end or not? Explain.IN.C.E.R.T. Exemplar]
Q:91 Why do you see two differfent types of replicating strands in the given DNA
replication fork? Explain. Name these strands.(C.B.S.E. 2011
Q:92 (a) Explain the process of DNA replication with the help of a schematic diagram.
(b) In which phase of the cell cycle does replication occur in Eucaryotes? What would
happen if cell division is not followed after DNA replication?(C.B.S.E. 2014]
Q:93 Answer the following questions based on Meselon and Stahl's experiment:
(a) Write the name of the chemical substance used as a source of nitrogen in the
experiment by them. (b) Why did the scientists synthesise the light and the heavy
DNA molecules in the organism used in the experiment? (c) How did the scientists
make it possible to distinguish the heavy DNA molecule from the light DNA molecule
? Explain. (d) Write the conclusion the scientists arrived at after completing the
experiment. [C.B.S.E. 2016]
Q:94 State the dual role of deoxyribonucleoside triphosphates during DNA replication.
[C.B.S.E. 2018]
Q:95 In a nucleus, the number of RNA nuceoside triphosphates is 10 times more than
the number of DNA nucleoside triphosphates, still only DNA nucleotides are added
during the DNA replication, and not the RNA nucleotides. Why? IN.C.E.R.T. Exemplar
Q:96 Describe the discontinuous synthesis of DNA.
Q:97 Describe the process of DNA Replication. [C.B.S.E. 2020]
Q:98 Draw a labelled schematic sketch of replication fork of DNA. Explain the role of
the enzymes involved in DNA replication.[C.B.S.E. 2019]
Q:99 Describe semi conservative nature of DNA replication.[C.B.S.E. 20201
Or
Write note that mode of DNA replication is semiconservative.
Or
State the aim and describe Meselson and Stahl's experiment.
Q:100 a) Why did the scientists use 15NH4Cl and 14NH,Cl as source of nitrogen in the
© Write the conclusion drawn by them at the end of their experiment.culture medium
for growing E. coli?
(b) Name the molecule(s) that 15N got incorporated into.
D Write the observations made by them from the samples taken at the end of 20
minutes and 40 minutes respectively
E How did they distinguish between 15N To labelled molecules from 14N ones?
F Mention the significance of taking the E. coli samples at definite time intervals for
this observations