1 Different profiles of gene expression in persister cells of Acinetobacter

2 baumannii under planktonic or biofilm cultures

4 Mariana Leyser 1,2, Kethlen Natiele de Almeida Pereira1, Rafaela Garcia da Rocha1,

5 Carlos Alexandre Sanchez Ferreira 1,2*, Sílvia Dias de Oliveira 1,2*

1
6 Laboratório de Imunologia e Microbiologia, Escola de Ciências da Saúde e da

7 Vida, Pontifícia Universidade Católica do Rio Grande do Sul, PUCRS, Av. Ipiranga,

8 6681, 90619-900, Porto Alegre, RS, Brazil

2
9 Programa de Pós-Graduação em Biologia Celular e Molecular, Escola de Ciências

10 da Saúde e da Vida, Pontifícia Universidade Católica do Rio Grande do Sul,

11 PUCRS.

12 *Corresponding authors:

13 E-mail addresses: silviadias@pucrs.br, silviadiasoliveira@gmail.com (S. D. Oliveira);

14 cferreira@pucrs.br, casanchezferreira@gmail.com (C. A. S. Ferreira)

15

1
16 Highlights

17  Heterogeneous gene expression of persister cells in planktonic culture.

18  Possibly, distinct pathways are involved in the regulation of persisters in both

19 planktonic and biofilm cultures.

20  Up-regulation of deaD, bamA, bamB, and bamE of persister cells in planktonic

21 culture.

22

23 ABSTRACT

24 Objectives: Acinetobacter baumannii is a significant cause of healthcare-associated

25 infections with considerable impact on public health and economic burden. While

26 carbapenems like meropenem are commonly used to treat A. baumannii infections,

27 therapeutic failures have increased due to the emergence of antimicrobial resistance

28 and the presence of persister cells. Persisters constitute a fraction of the bacterial

29 population that present a transient phenotype capable of tolerating supra-lethal

30 concentrations of antibiotics. Thus, we investigated the mRNA levels of the deaD,

31 bamA, bamB, bamD, bamE, ftsH, and ppiD in A. baumannii cells before and after

32 exposure to meropenem, both in planktonic and biofilm culture.

33 Methods: Transcriptional analysis was performed using reverse transcription

34 followed by real time PCR assay, using mRNA extracted from A. baumannii persister

35 cells. The data was analyzed by one-way ANOVA and Tukey test.

36 Results: We found different gene expression levels (p-value < 0.05) in most genes

37 tested in planktonic culture (deaD, bamA, bamB, bamE, and ftsH), while in biofilm

38 culture we found different levels of expression in bamD and ftsH. Therefore, we

2
39 suggest that these proteins could be part of the mechanism of A. baumannii

40 persisters to deal with the presence of high doses of meropenem.

41 Conclusion: This data contributes to the understanding of the molecular features of

42 A. baumannii persisters, their expression profile when subjected to antimicrobial

43 stress, and highlights six proteins as potential targets for drug development against

44 A. baumannii.

45 Keywords: Acinetobater baumannii, Persistence, β-Barrel Assembly Machinery,

46 Meropenem, Polymyxin

3
47 1. Introduction

48 Healthcare-associated infections (HAI) are among the leading causes of

49 morbidity and mortality in hospital patients, imposing a significant economic burden

50 and causing substantial human suffering [1]. Acinetobacter baumannii is an

51 opportunistic pathogen highly prevalent in HAI [2], particularly implicated in cases of

52 ventilator-associated pneumonia, sepsis, and wound and bloodstream infections [3–

53 6]. The current gold standard treatment for A. baumannii infections are

54 carbapenems, such as meropenem, but the emergence of resistant strains has

55 become increasingly prevalent [7–9]. Consequently, alternative therapeutics like

56 polymyxin B have been considered, although there have been reports of clinical

57 cases displaying resistance to this agent as well [10,11].

58 Therapeutic failure can also come from tolerance to antimicrobials due to the

59 presence of persister cells [12]. Persisters constitute a small fraction of phenotypic

60 variants capable of tolerating high-doses of antimicrobial drugs, despite being

61 genetically susceptible, returning to grow exponentially once the germicides have

62 been removed [12,13]. Currently, persisters are recognized as a highly

63 heterogeneous phenotype influenced by several environmental and experimental

64 factors. They can arise stochastically within the bacterial population and can be

65 induced by stressor agents, such as antimicrobials [12]. This phenomenon becomes

66 particularly important in the context of biofilm, given that this differential environment

67 can select, protect, and maintain persister cells [14–17].

68 The molecular pathways involved in the regulation and formation of persister cells

69 have not been completely elucidated. However, several molecular mechanisms have

70 been proposed and associated with this phenomenon. These mechanisms include

4
71 halting DNA replication and/or transcription, blocking translation, modulating energy

72 metabolism, decreasing intracellular antibiotic concentration, and controlling

73 ribosomal RNA activity [18–21]. Thus, proteins responsible for RNA activity could

74 play an import role in antimicrobial tolerance. DEAD/DEAH box helicases are an

75 ATP-dependent group of proteins involved in RNA basal metabolism, RNA

76 degradation and ribosome biogenesis and assembly [22,23]. These functions have a

77 role in environmental adaptation, host colonization, infectious processes and cold-

78 shock response [24].

79 Proteins involved in membrane functions and structure, specifically β-barrel outer

80 membrane proteins (OMP), may also play an important role in persistence

81 regulation. OMPs are responsible for protein and solute translocation, signal

82 transduction, cellular adhesion, and virulence factors [25]. In our previous research,

83 we investigated the expression of ompW and ompA in persisters and found that

84 these genes were upregulated in the persister phenotype [26]. Therefore, the β-

85 Barrel Assembly Machinery (BAM) complex, which is responsible for the folding and

86 insertion of OMPs into the outer membrane, are also involved in these processes,

87 even if indirectly [27,28]. It is worth noting that FtsH is another protein involved in the

88 membrane environment, acting in quality control and degradation of membrane

89 proteins, heat shock response, and lipopolysaccharide biosynthesis [29,30], and its

90 activity may have implications for antibiotic tolerance. Additionally, the inner

91 membrane-anchored periplasmic folding factor PpiD may indirectly contribute to the

92 maturation of OMPs by aiding in the folding of newly translocated proteins and

93 participating in the network of periplasmic chaperone activities [31]. In this context,

94 we evaluated the mRNA levels of membrane proteins BamA, BamB, BamD, BamE,

95 FtsH and PppiD, as well as the expression of deaD in persister cells of A. baumannii

5
 96 after being exposed to meropenem in planktonic and biofilm culture. We also

97 assessed the persister levels after treatment with polymyxin B.

98

99 2. Materials and Methods

100 2.1. Acinetobacter baumannii strain

101 The A. baumannii Acb-1 strain used in this study was obtained from a tracheal

102 aspirate collected at the Department of Microbiology of the Clinical Pathology

103 Laboratory of São Lucas Hospital, Porto Alegre, RS, Brazil, following the protocol

104 approved by the Ethics Committee in Research (number 483469). Acb-1 has been

105 previously characterized as susceptible to meropenem and polymyxin B, with a

106 minimum inhibitory concentration (MIC) established as 1 μg/mL for both drugs.

107 Additionally, Acb-1 has demonstrated the ability to form biofilm in polystyrene

108 microplates [32,33]. The relative quantification of proteins associated with the

109 persister state, exposed to meropenem and polymyxin B separately, was determined

110 using nanoscale liquid chromatography coupled to tandem mass spectrometry (nano

111 LC-MS/MS) [34], which provided valuable data to support the selection of target

112 genes for current analysis.

113 2.2. Persister cell levels

114 Persister cell levels were determined in planktonic and biofilm cultures after

115 exposure to meropenem and polymyxin B, separately, according to the protocol

116 described by Drescher et al. [35], with some modifications. To evaluate persister

117 levels in planktonically growing cells, overnight cultures in Lysogeny broth (LB) were

118 diluted 1:50 in LB and incubated at 37°C until the mid-exponential growth phase

119 (approximately 108 colony-forming unit (CFU)/mL). Before antimicrobial exposure,

6
120 the initial cell density was determined by diluting a 100 µL-aliquot until 10 -8 in 0.85%

121 saline and spotting 10 µL of dilution in triplicate on nutrient agar, which was then

122 incubated at 37°C for 24h. A 1 mL aliquot was collected for RNA extraction.

123 Afterwards, the mid-exponential growth phase cultures were exposed to polymyxin B

124 or meropenem at 15-fold MIC for 96 h and 144 h, respectively. To determine the

125 surviving fractions at 6, 24 and 48 h of polymyxin B and 48, 96, 120, 144 h of

126 meropenem exposure, 1 mL-aliquots were removed at each time, centrifuged at

127 3,483 g for 7 min, and the supernatants discarded. The pellets were washed with 1

128 mL of 0.85% saline to remove antimicrobial residues. After washing, the pellets were

129 resuspended in 1 mL of 0.85% saline that was diluted until 10 -6, and 10 µL of each

130 dilution were spotted on nutrient agar. Also, for each aliquot removed to determine

131 persister cell levels, a 1 mL- aliquot was collected for RNA extraction.

132 To determine the persister levels in biofilm, Acb-1 was grown in LB for 24 h at

133 37°C using 6-well polystyrene plates. After this period, the culture medium containing

134 non-adherent cells was removed and the biofilm was washed twice with phosphate-

135 buffered saline (PBS). The initial biofilm population density was evaluated by adding

136 2 mL of 0.85% saline to each well with subsequent disruption by an ultrasonic water

137 bath (Ultrasonic Cleaner 1400 A, Unique, Indaiatuba, Brazil) for 10 min. For the

138 determination of persister levels, 2 mL of fresh LB containing 15-fold MIC of

139 meropenem were added to the 24 h-biofilms and incubated at room temperature until

140 96 h. At 48 and 96 h of exposure (evaluated in independent microplates), wells were

141 washed twice with PBS, and 2 mL of 0.85% saline was added. Biofilms were

142 disrupted by an ultrasonic water bath for 10 min. The supernatant containing

143 dissociate adherent cells was removed and their quantification was performed as

7
144 described for the planktonic cultures. A 1 mL-aliquot was also reserved at each time

145 point and subsequentially subjected to RNA extraction.

146 The surviving cell fractions were calculated by dividing the number of remaining

147 colonies counted by the number of colonies found before the antibiotic treatment.

148 After a 48-h or 144-h exposure to high concentrations of polymyxin B or meropenem,

149 respectively, the MIC of each antimicrobial was determined again by broth

150 microdilution [36] in the surviving cells to exclude the selection of a resistant mutant.

151 All assays were performed in biological and experimental triplicates, and the CFU

152 count data were the mean of three replicates.

153 2.3. RNA extraction

154 The RNA extraction was adapted from the protocol described by Han et al. [37].

155 A 1 mL-aliquot taken from the persister assay was centrifuged twice at 8,000 g for 5

156 min at 4°C. The supernatant was removed and, the pellet was resuspended in 0.85%

157 saline. Then, the cells were treated with 700 µL of TRIzol Reagent (ThermoFisher

158 Scientific, Waltham, MA) and incubated in room temperature for 10 min. Following

159 this, 400 µL of chloroform was added and mixed vigorously and incubated at room

160 temperature for 3 min. The sample was centrifuged at 12,000 g for 15 min at 4°C.

161 The supernatant was transferred to a separate microtube containing 500 µL of

162 isopropanol. The mixture was gently pipetted 20 times and then incubated at room

163 temperature for 10 min. The samples were centrifuged at 12,000 g for 20 min at 4°C,

164 the supernatant was discarded, and the pellet was washed with 1 mL of 75%

165 ethanol. Then the sample was centrifuged again at 12,000 g for 10 min at 4°C, the

166 ethanol was carefully removed, and the pellet was dried at 65°C in a thermal block

167 for 5 min. Finally, the pellet was resuspended in 20 µL of UltraPure™ DNase/RNase-

8
168 Free Distilled Water (ThermoFisher Scientific, Waltham, MA) and incubated at room

169 temperature for 10 min to increase solubility.

170 RNA concentration and purity were evaluated by spectrophotometry at 260/280

171 nm at a NanoDropTM One spectrophotometer (ThermoFisher Scientific, Waltham,

172 MA). The samples were stored at -80°C until PCR analysis. For execution of the

173 persister assay three biological replicates were used for RNA extraction at each time

174 point.

175 2.4. Evaluation of gene expression

176 The genes were selected from proteomic data of persister cells obtained

177 previously from our research group [34]. Transcriptional analysis was performed

178 using reverse transcription followed by real time PCR. Firstly, 1 μg of purified total

179 RNA was used as a template for reverse transcriptase utilizing the High-Capacity

180 cDNA Reverse Transcription Kit (ThermoFisher Scientific, Waltham, MA). The target

181 genes selected for analysis were deaD, bamA, bamB, bamD, bamE, ftsH, and ppiD.

182 Gene-specific primers were designed based on the Acb1 strain genome, available in

183 Genbank under the accession number RDOH00000000.1, using the primer-Blast

184 algorithm. The levels of gene expression were normalized using the single copy

185 housekeeping gene rpoB as reference [38]. The qPCR assay was performed using

186 the PowerUp™ SYBR™ Green Master Mix (ThermoFisher Scientific, Waltham, MA)

187 in the StepOne™ Real-Time PCR System (ThermoFisher Scientific, Waltham, MA).

188 Gene expression was evaluated at 0, 96, and 144 h for planktonic persister cells and

189 at 0, 48, and 96 h for biofilm assays. Only the samples exposed to meropenem were

190 analyzed. For each of the three time points analyzed, all RNA replicates were

191 subjected to qPCR.

9
192

10
193 Table 1. Primers used in this study.

Target
Primer Sequence Product length (bp) Reference
gene

bamA- F TTAGCGGTCGGTTATTCGCA
393 This study
bamA- R TGCCTTACCACCATTTGCCA

bamB- F ACCATCGCCAGTGAGTCTTG
284 This study
bamB- R CTTCTGGACGCTTGGTGCTA

bamD- F TGGTGCTTCAACAGGTGTGT
512 This study
bamD- R TTCGTCGCTTCCCAAGTAGC

bamE- F ACTCGTGCTGACGTTATTCGT
254 This study
bamE- R CTGCGGGGATTTTCGCTTTT

deaD- F GCGTTTCATCAGCCAACCAG
273 This study
deaD- R TGGACGAAGCTGACCGTATG

ftsH- F AGCAAGTCACGATTGACGGT
557 This study
ftsH- R ACCCACACCCACGAACATTT

ppiD- F ACACCAGCCGCATGATAGTC
365 This study
ppiD- R ATTGAAGCGGAGACTCAGGC

rpoB- F GAGTCTAATGGCGGTGGTTC
[39]
rpoB- R ATTGCTTCATCTGCTGGTTG

194

195 2.5. Statistical analysis

196 The data obtained were statistically analyzed using GraphPad Prism 9.0

197 software. Descriptive statistics were performed, and the data were subjected to

198 analysis of variance (one-way ANOVA), after which the Tukey test was employed to

11
199 confirm the differences in each variable. A p-value of <0.05 was considered

200 statistically significant for all tests.

201

202 3. Results

203 3.1. Acb-1 persister levels after exposure to meropenem and polymyxin B

204 Persister cells were detected in all persister assays performed, following

205 exposure to meropenem or polymyxin B, in both planktonic and biofilm cultures. To

206 ensure the presence of persister cells and rule out the possibility of selecting

207 antibiotic-resistant mutants, cells were subjected to a new susceptibility test

208 afterwards, and no differences were observed comparing with the previous MIC,

209 confirming the presence of persister cells.

210 When exposed to meropenem, the planktonic cultures displayed a fraction of

211 persister cells that reached 0.0204% of the initial population after 144 h (Table 2).

212 The killing curves depicting this phenomenon can be observed in Fig. 1. The

213 exposure to polymyxin B resulted in a fraction of persister cells reaching 0.0077% in

214 6 h of exposure. Subsequently, the fraction increased to 0.16% in 48 h (Table 2), as

215 depicted in Fig 1.

216 When cultured in biofilm, the fraction of persister cells after exposure to

217 meropenem were higher compared to the planktonic culture, reaching 1.69% in 96 h

218 (Table 2). This observation is consistent with previous studies, which have also

219 reported that biofilm cultures retain a larger fraction of persister cells [32].

220

12
 221 Table 2. Persister cells fractions obtained after exposure to different antibiotics in

222 biofilm and planktonic cultures.

Meropenem (15 µg/mL) Polymyxin B (15 µg/mL)

Time point
Planktonic (%) Biofilm (%) Planktonic (%)

6h - - 0.008

24 h - - 0.120

48 h 18.861 4.440 0.159

96 h 0.351 1.689 -

120 h 0.034 - -

144 h 0.020 - -

223

224

225 Fig. 1. Killing curves of Acinetobacter baumannii Acb-1 after exposure to: ()

226 meropenem (15 µg/mL) in planktonic culture for up to 144 h, (■) polymyxin B (15

227 µg/mL) in planktonic culture for up to 48 h, and (▲) meropenem (15 µg/mL) in biofilm

228 culture for up to 96 h. Each data point represents mean and standard deviation (error

229 bars) from three biological replicates. CFU: Colony-forming unit.

13
230 3.2. Differential gene expression in planktonic culture

231 Some of the genes evaluated showed differential regulation when exposed to

232 meropenem for up to 144 h. deaD exhibited an initial down-regulation (0.32-fold) at

233 96 h and subsequent up-regulation (2.41-fold) at 144 h (Fig. 2A). Conversely, bamA

234 and bamE displayed an initial up-regulation (3.27-fold and 1.97-fold, respectively)

235 and subsequent down-regulation (0.34-fold and 0.84 respectively) (Fig. 2B and 2E),

236 but at 144 h no significant difference was observed compared to pre-meropenem

237 exposure. Although not statistically significant, bamB showed a tendency to

238 downregulation at 96 h and a significant upregulation at 144 h (1.51-fold) when

239 compared to the 96-h time point, however no significant difference was observed

240 compared to pre-meropenem exposure (Fig. 2C). bamD and ppiD showed no

241 differential expression (Fig. 2D and 2G). ftsH displayed downregulation (0.12-fold) at

242 96 h (Fig. 2F).

14
243

15
244 Fig. 2. Differential gene expression of persister cells in the planktonic culture of

245 Acinetobacter baumannii Acb-1 after exposure to meropenem (15 µg/mL) for 0, 96,

246 and 144 h using quantitative real-time PCR. The gene rpoB was used as the

247 housekeeping control and six genes already evaluated by proteome analysis were

248 evaluated: (A) deaD, (B) bamA, (C) bamB, (D) bamD, (E) bamE, (F) ftsH, and (G)

249 ppiD. The y-axis represents the fold difference of each gene relative to the threshold

250 cycle (CT) values (2-(ΔΔCT)). The values represent the means of three experimental

251 replicates obtained from two biological replicates (n=6). A one-way ANOVA was

252 performed, and a p-value of <0.05 was considered significant. The significance level

253 is indicated as follows: *= p-value <0.05, **= p-value <0.01 and, and n.s.= not

254 significant.

255 3.3. Differential gene expression in biofilm culture

256 In the persister cells from biofilm exposed to meropenem for up to 96 h, most

257 of the evaluated genes did not show significant differential expression. Unlike what

258 was observed in planktonic culture, bamD exhibited a down-regulation (0.15-fold) at

259 96 h (Fig. 3D). ftsH displayed an up-regulation (10.6-fold) at 48 h (Fig. 3F), but it was

260 followed by a downregulation, returning to the initial levels before meropenem

261 exposure. No statistically significant differential gene expression was observed for

262 deaD, bamA, bamB, bamE, and ppiD in the analyzed samples.

16
263

264 Fig. 3. Differential gene expression of persister cells in biofilm of Acinetobacter

265 baumannii Acb-1 after exposure to meropenem (15 µg/mL) for 0, 96, and 144 h

266 using quantitative real-time PCR. The analyzed genes were as follows: (A) deaD, (B)

267 bamA, (C) bamB, (D) bamD, (E) bamE, (F) ftsH, and (G) ppiD. The gene rpoB was

17
268 used as control. The y-axis represents the fold difference of each gene relative to the

269 threshold cycle (CT) values (2-(ΔΔCT)). The values represent the means of three

270 experimental replicates obtained from two biological replicates (n=6). A one-way

271 ANOVA was performed, and a p-value of <0.05 was considered significant. The

272 significance level is indicated as follows: *= p-value <0.05, **= p-value <0.01 and,

273 and n.s.= not significant.

274

275 4. Discussion

276 The molecular mechanisms underlying persister cells are still not completely

277 understood, however, important progress has been made. Studies have showed that

278 proteins involved in translation and RNA metabolism may play a role in persister cell

279 formation [18,40]. Furthermore, the involvement of ribosomal RNA in persister cells

280 has been proposed [40]. Additionally, there is ongoing discussion about the potential

281 participation of membrane proteins in the persistence state, as they can contribute to

282 reducing intracellular antibiotic concentration and act in signal transduction pathways

283 [18,25]. Previous study conducted by our research group demonstrated an

284 upregulation of OMP genes in persister cells [26]. Given that proteins which are

285 involved in RNA metabolism and membrane-associated proteins have been

286 characterized as involved in the persistence phenotype, in this study, we aimed to

287 measure the expression of genes that might be involved in these processes. Using

288 the literature and the current advances in the area, along with a previous proteomic

289 analysis of the A. baumannii strain Acb-1 (data not shown), six genes were selected.

290 Comparing the killing curves (Fig. 1) of Acb-1 following meropenem and

291 polymyxin B treatment, it is possible to observe that when treating with polymyxin B

18
292 there is a population growth after 6 h, corroborating what has been observed

293 previously with different A. baumannii strains [34]. The surviving cells observed are

294 bona-fide persisters, as their susceptibility remained unchanged even after

295 treatment. Notably, when contrasting planktonic and biofilm cultures, the latter

296 showed a higher count of persister cells. These findings are likely attributed to the

297 distinct environment established by biofilm cultures, which promote, protect, and

298 select for persisters [14,16]. The biofilm, with its nutrient levels, aeration, and pH

299 gradients, potentially acts as a natural source of stressors and selectors, providing

300 an environment conducive for the formation and/or maintenance of persisters.

301 Additionally, the biofilm matrix incorporates several mechanisms that can limit the

302 antimicrobial action, including extracellular enzymes, efflux pumps, eDNA, facilitated

303 horizontal gene-transfer, among others [14,15,17].

304 The observed differential expression of the deaD gene (Fig. 2A) can be due to

305 several reasons. DEAD-box helicases, especially DeaD, are known to have diverse

306 functions, including involvement in ribosome assembly and mRNA degradation [22].

307 DeaD has also been implicated in cold-shock response and growth at low

308 temperatures [22], as well as in response to oxidative stress in bacteria [41,42]. In

309 this sense, the Acb-1 proteomic data presented a considerable overproduction of

310 DeaD at 96 h (unpublished data). Therefore, the downregulation of deaD at 96 h

311 followed by an upregulation at 144 h (Fig. 2A), may be explained by several

312 scenarios. In the initial 96 h, with bacteria experiencing antibiotic stress, A.

313 baumannii may tightly control the expression of deaD due to its ATP-dependent

314 nature and short mRNA half-life [24]. This could result in a depletion of mRNA levels,

315 while the active protein remains relatively abundant. Additionally, DeaD plays a role

316 in late-stage ribosomal assembly and constitutes part of the degradosome, which is

19
317 essential for the bacterial metabolism and response to environmental changes [24].

318 Therefore, the subsequent upregulation of deaD at 144 h may be necessary to

319 maintain enough levels of the DeaD protein in persister cells, which exhibit distinct

320 gene expression patterns associated with their phenotype.

321 The BAM complex, composed of four lipoproteins (BamBCDE) and one OMP

322 (BamA), plays a crucial role in the folding and insertion of OMPs [43,44]. The current

323 model suggests that BamD may regulate the engagement of OMP with the complex,

324 while BamA is primarily responsible for the folding process [43]. The functions of the

325 other three proteins in the complex, BamB, BamC, and BamE, are still under debate,

326 with possibly redundant activities, as single deletions of these proteins only lead to

327 minor folding errors in OMPs [43,44]. In this study, we observed an increase in

328 mRNA expression for most of the Bam genes evaluated (Fig 2B, C, E). The up-

329 regulation of bamAE was observed at 96 h (Fig. 2B and E), while bamB was

330 overexpressed at 144 h (Fig. 2C). On the other hand, bamD showed a down-

331 regulation in biofilm culture (Fig. 3D), but did not show significant changes in the

332 planktonic culture (Fig 2D). These findings suggest that the Bam complex may play a

333 role in the persister phenotype. These results also corroborate Schmitt et al. findings,

334 who reported an up-regulation of ompA and ompW genes, which are closely

335 associated with the Bam complex, after 96 h of exposure to meropenem [26].

336 However, further investigation is needed to understand the delayed response

337 observed in bamB, with its up-regulation occurring only at 144 h (Fig. 2C).

338 Additionally, the reason for the lack of differential expression of bamD in the

339 planktonic culture (Fig. 2D) and its down-regulation in biofilm (Fig. 3D) needs to be

340 explored, considering its role as a quality checkpoint regulator and an essential

341 component of the Bam complex [43].

20
342 FtsH is a member of the ATPases family (AAA + proteases), which utilize ATP to

343 degrade several proteins [45]. It is considered a universal protease with several

344 known targets, including LpxC, RpoH, and YfgM [46]. These substrates play roles in

345 stress response, interacting with (p)ppGpp, an important alarmone involved in the

346 stringent response, and YfgM, which acts in intra and extra cytoplasmic stress

347 response [46]. Given the known function of FtsH and our observations in this study,

348 we propose that FtsH may play an important role in the stress response associated

349 with the persister phenotype. In planktonic culture, we observed a down-regulation of

350 FtsH mRNA at 96 h (Fig. 2F), suggesting that maintaining the activity of proteins and

351 substrates involved in initiating and sustaining a stress response is crucial within the

352 cell. On the other hand, in the biofilm, where cells, persisters or not, have

353 mechanisms that provide protection [17], the stress response may not be as severe

354 as in planktonic state. This is supported by the up-regulation of FtsH mRNA at 48 h

355 in biofilm (Fig. 3F). However, further analysis is required to fully understand the

356 implications of these findings. Taken together, our data suggest that FtsH may play a

357 significant role in the stress response observed in the persister phenotype. The

358 dynamic regulation of FtsH expression in different growth conditions highlights its

359 potential involvement in cellular adaptation and survival strategies.

360 PpiD works in cooperation with SecYEG proteins as a chaperone for the

361 translocation of proteins by the SecYEG complex. It also forms a complex with YfgM

362 [47,48], which serves as a substrate for FtsH and is involved in the stress response

363 [46]. Additionally, PpiD plays a role in the proper folding of certain OMPs [47].

364 However, both in planktonic and biofilm cultures, we observed no significant changes

365 in ppiD expression in any of the samples analyzed (Fig 2G and 3G). This indicates

366 that the expression of ppiD remains relatively stable under the conditions tested and

21
367 may not be directly involved in the mechanisms underlying persister formation and

368 maintenance.

369 Planktonic cultures (Fig. 2) presented a more heterogeneous profile of differential

370 gene expression compared to biofilms (Fig. 3). This difference can be due to several

371 reasons. In biofilm state, cells are protected by the extracellular environment, which

372 can shield them from several stressful conditions [16]. The presence of extracellular

373 polymeric substances in the biofilm hinders the penetration of antibiotics, in addition

374 to the potential interference caused by its components [14,16,17]. Due to the

375 protective nature of the biofilm environment, cells may have a reduced need for an

376 extensive stress response compared to planktonic cultures, or at least, when faced

377 with the presence of an antibiotic there is no change in gene expression of the

378 evaluated genes in this study. However, it should be noted that some studies have

379 shown up-regulation of specific genes in biofilm cultures, particularly those related to

380 bacterial adhesion, invasion, and virulence in microorganisms such as

381 Porphyromonas gingivalis [49]. In Staphylococcus aureus, genes related to

382 fermentation and glycolysis were found to be up-regulated in biofilms [50].

383 Furthermore, in the persister phenotype, the biofilm state may employ distinct

384 pathways to maintain the viability of cells in the presence of antibiotics. This aspect

385 requires further investigation to fully understand the mechanisms involved.

386

387 5. Conclusion

388 Our study revealed that deaD, the bam complex, and ftsH may contribute to the

389 persister phenotype in A. baumannii. Moreover, we observed that genes differentially

390 expressed in planktonic state did not necessarily show the same pattern in biofilm,

22
391 suggesting the existence of different pathways involved in persister formation and/or

392 maintenance in each environment. Therefore, more studies are needed to elucidate

393 the mechanisms underlying persister formation, which could pave the way for the

394 development of novel treatments for A. baumannii infections.

395

396 Funding

397 This study was supported by the State of Rio Grande do Sul, through

398 Fundação de Amparo à Pesquisa do Rio Grande do Sul (FAPERGS) (Programa

399 Pesquisador Gaúcho - 19/2551-0001976-9), and in part by the Coordenação de

400 Aperfeiçoamento de Pessoal de Nível Superior – Brasil (CAPES) – [Finance Code

401 001]. SDO is Research Career Awarded of the CNPq (grant number 309933/2020-

402 0).

403 Ethical approval

404 Not required.

405 Declaration of competing interest

406 The authors declare that they have no known competing financial interests or

407 personal relationships that could have appeared to influence the study reported in

408 this paper.

409 Acknowledgments

410 We thankfully acknowledge to Julia Huppes Majolo for assistance in statistical

411 analysis, Brenda Landvoigt Schmitt, Vanessa Fey, and Maila Pacheco Dias for

412 assistance in all technical work.

23
413 Data availability statement

414 The original contributions presented in the study are included in the article;

415 further inquiries may be directed to the corresponding author.

416

24
417 References

418 [1] Stone PW. Economic burden of healthcare-associated infections: an American perspective.
419 Expert Rev Pharmacoecon Outcomes Res 2009;9:417–22. https://doi.org/10.1586/erp.09.53.
420 [2] European Centre for Disease Prevention and Control. Point prevalence survey of healthcare-
421 associated infections and antimicrobial use in European acute care hospitals :2011 2012. LU:
422 Publications Office; 2013.
423 [3] Peleg AY, Seifert H, Paterson DL. Acinetobacter baumannii: emergence of a successful pathogen.
424 Clin Microbiol Rev 2008;21:538–82. https://doi.org/10.1128/CMR.00058-07.
425 [4] Quartin AA, Scerpella EG, Puttagunta S, Kett DH. A comparison of microbiology and
426 demographics among patients with healthcare-associated, hospital-acquired, and ventilator-
427 associated pneumonia: a retrospective analysis of 1184 patients from a large, international
428 study. BMC Infect Dis 2013;13:561. https://doi.org/10.1186/1471-2334-13-561.
429 [5] Simonetti A, Ottaiano E, Diana MV, Onza C, Triassi M. Epidemiology of hospital-acquired
430 infections in an adult intensive care unit: results of a prospective cohort study. Ann Ig Med Prev
431 E Comunita 2013;25:281–9. https://doi.org/10.7416/ai.2013.1930.
432 [6] Nguyen M, Joshi S g. Carbapenem resistance in Acinetobacter baumannii, and their importance
433 in hospital-acquired infections: a scientific review. J Appl Microbiol 2021;131:2715–38.
434 https://doi.org/10.1111/jam.15130.
435 [7] Higgins PG, Dammhayn C, Hackel M, Seifert H. Global spread of carbapenem-resistant
436 Acinetobacter baumannii. J Antimicrob Chemother 2010;65:233–8.
437 https://doi.org/10.1093/jac/dkp428.
438 [8] Karakonstantis S, Kritsotakis EI, Gikas A. Treatment options for K. pneumoniae, P. aeruginosa
439 and A. baumannii co-resistant to carbapenems, aminoglycosides, polymyxins and tigecycline: an
440 approach based on the mechanisms of resistance to carbapenems. Infection 2020:1–17.
441 https://doi.org/10.1007/s15010-020-01520-6.
442 [9] Kempf M, Rolain J-M. Emergence of resistance to carbapenems in Acinetobacter baumannii in
443 Europe: clinical impact and therapeutic options. Int J Antimicrob Agents 2012;39:105–14.
444 https://doi.org/10.1016/j.ijantimicag.2011.10.004.
445 [10] Hagihara M, Housman ST, Nicolau DP, Kuti JL. In vitro pharmacodynamics of polymyxin B and
446 tigecycline alone and in combination against carbapenem-resistant Acinetobacter baumannii.
447 Antimicrob Agents Chemother 2014;58:874–9. https://doi.org/10.1128/AAC.01624-13.
448 [11] Lima WG, Brito JCM, Cardoso BG, Cardoso VN, de Paiva MC, de Lima ME, et al. Rate of polymyxin
449 resistance among Acinetobacter baumannii recovered from hospitalized patients: a systematic
450 review and meta-analysis. Eur J Clin Microbiol Infect Dis 2020;39:1427–38.
451 https://doi.org/10.1007/s10096-020-03876-x.
452 [12] Van den Bergh B, Fauvart M, Michiels J. Formation, physiology, ecology, evolution and clinical
453 importance of bacterial persisters. FEMS Microbiol Rev 2017;41:219–51.
454 https://doi.org/10.1093/femsre/fux001.
455 [13] Fauvart M, De Groote VN, Michiels J. Role of persister cells in chronic infections: clinical
456 relevance and perspectives on anti-persister therapies. J Med Microbiol 2011;60:699–709.
457 https://doi.org/10.1099/jmm.0.030932-0.
458 [14] Flemming H-C, Wingender J, Szewzyk U, Steinberg P, Rice SA, Kjelleberg S. Biofilms: an emergent
459 form of bacterial life. Nat Rev Microbiol 2016;14:563–75.
460 https://doi.org/10.1038/nrmicro.2016.94.
461 [15] Lewis K. Multidrug Tolerance of Biofilms and Persister Cells. In: Romeo T, editor. Bact. Biofilms,
462 Berlin, Heidelberg: Springer; 2008, p. 107–31. https://doi.org/10.1007/978-3-540-75418-3_6.
463 [16] Dincer S, Uslu FM, Delik A, Dincer S, Uslu FM, Delik A. Antibiotic Resistance in Biofilm. Bact.
464 Biofilms, IntechOpen; 2020. https://doi.org/10.5772/intechopen.92388.
465 [17] Flemming H-C, Wingender J. The biofilm matrix. Nat Rev Microbiol 2010;8:623–33.
466 https://doi.org/10.1038/nrmicro2415.

25
467 [18] Wilmaerts D, Windels EM, Verstraeten N, Michiels J. General Mechanisms Leading to Persister
468 Formation and Awakening. Trends Genet 2019;35:401–11.
469 https://doi.org/10.1016/j.tig.2019.03.007.
470 [19] Pinel-Marie M-L, Brielle R, Riffaud C, Germain-Amiot N, Polacek N, Felden B. RNA antitoxin SprF1
471 binds ribosomes to attenuate translation and promote persister cell formation in Staphylococcus
472 aureus. Nat Microbiol 2021;6:209–20. https://doi.org/10.1038/s41564-020-00819-2.
473 [20] Wang Y, Bojer MS, George SE, Wang Z, Jensen PR, Wolz C, et al. Inactivation of TCA cycle
474 enhances Staphylococcus aureus persister cell formation in stationary phase. Sci Rep
475 2018;8:10849. https://doi.org/10.1038/s41598-018-29123-0.
476 [21] Pandey S, Sahukhal GS, Elasri MO. The msaABCR Operon Regulates Persister Formation by
477 Modulating Energy Metabolism in Staphylococcus aureus. Front Microbiol 2021;12:657753.
478 https://doi.org/10.3389/fmicb.2021.657753.
479 [22] Iost I, Bizebard T, Dreyfus M. Functions of DEAD-box proteins in bacteria: Current knowledge
480 and pending questions. Biochim Biophys Acta BBA - Gene Regul Mech 2013;1829:866–77.
481 https://doi.org/10.1016/j.bbagrm.2013.01.012.
482 [23] Hausmann S, Gonzalez D, Geiser J, Valentini M. The DEAD-box RNA helicase RhlE2 is a global
483 regulator of Pseudomonas aeruginosa lifestyle and pathogenesis. Nucleic Acids Res
484 2021;49:6925–40. https://doi.org/10.1093/nar/gkab503.
485 [24] Redder P, Hausmann S, Khemici V, Yasrebi H, Linder P. Bacterial versatility requires DEAD-box
486 RNA helicases. FEMS Microbiol Rev 2015;39:392–412. https://doi.org/10.1093/femsre/fuv011.
487 [25] Rollauer SE, Sooreshjani MA, Noinaj N, Buchanan SK. Outer membrane protein biogenesis in
488 Gram-negative bacteria. Philos Trans R Soc Lond B Biol Sci 2015;370:20150023.
489 https://doi.org/10.1098/rstb.2015.0023.
490 [26] Schmitt BL, Leal BF, Leyser M, de Barros MP, Trentin DS, Ferreira CAS, et al. Increased ompW and
491 ompA expression and higher virulence of Acinetobacter baumannii persister cells. BMC
492 Microbiol 2023;23:157. https://doi.org/10.1186/s12866-023-02904-y.
493 [27] Hagan CL, Silhavy TJ, Kahne D. β-Barrel membrane protein assembly by the Bam complex. Annu
494 Rev Biochem 2011;80:189–210. https://doi.org/10.1146/annurev-biochem-061408-144611.
495 [28] Selkrig J, Leyton DL, Webb CT, Lithgow T. Assembly of β-barrel proteins into bacterial outer
496 membranes. Biochim Biophys Acta 2014;1843:1542–50.
497 https://doi.org/10.1016/j.bbamcr.2013.10.009.
498 [29] Langklotz S, Baumann U, Narberhaus F. Structure and function of the bacterial AAA protease
499 FtsH. Biochim Biophys Acta BBA - Mol Cell Res 2012;1823:40–8.
500 https://doi.org/10.1016/j.bbamcr.2011.08.015.
501 [30] Akiyama Y, Kihara A, Tokuda H, Ito K. FtsH (HflB) Is an ATP-dependent Protease Selectively
502 Acting on SecY and Some Other Membrane Proteins *. J Biol Chem 1996;271:31196–201.
503 https://doi.org/10.1074/jbc.271.49.31196.
504 [31] Matern Y, Barion B, Behrens-Kneip S. PpiD is a player in the network of periplasmic chaperones
505 in Escherichia coli. BMC Microbiol 2010;10:251. https://doi.org/10.1186/1471-2180-10-251.
506 [32] Gallo SW, Donamore BK, Pagnussatti VE, Ferreira CAS, de Oliveira SD. Effects of meropenem
507 exposure in persister cells of Acinetobacter calcoaceticus-baumannii. Future Microbiol
508 2017;12:131–40. https://doi.org/10.2217/fmb-2016-0118.
509 [33] Gallo SW, Ferreira CAS, de Oliveira SD. Combination of polymyxin B and meropenem eradicates
510 persister cells from Acinetobacter baumannii strains in exponential growth. J Med Microbiol
511 2017;66:1257–60. https://doi.org/10.1099/jmm.0.000542.
512 [34] Gallo SW. Avaliação do fenótipo de persistência em isolados nosocomiais de Acinetobacter
513 calcoaceticus-baumannii 2017.
514 [35] Drescher SPM, Gallo SW, Ferreira PMA, Ferreira CAS, Oliveira SD de. Salmonella enterica
515 persister cells form unstable small colony variants after in vitro exposure to ciprofloxacin. Sci
516 Rep 2019;9:7232. https://doi.org/10.1038/s41598-019-43631-7.

26
517 [36] M07: Dilution AST for Aerobically Grown Bacteria - CLSI. Clin Lab Stand Inst n.d.
518 https://clsi.org/standards/products/microbiology/documents/m07/ (accessed April 5, 2023).
519 [37] Han P, Go MK, Chow JY, Xue B, Lim YP, Crone MA, et al. A high-throughput pipeline for scalable
520 kit-free RNA extraction. Sci Rep 2021;11:23260. https://doi.org/10.1038/s41598-021-02742-w.
521 [38] Krizova L, Poirel L, Nordmann P, Nemec A. TEM-1 β-lactamase as a source of resistance to
522 sulbactam in clinical strains of Acinetobacter baumannii. J Antimicrob Chemother
523 2013;68:2786–91. https://doi.org/10.1093/jac/dkt275.
524 [39] Hornsey M, Ellington MJ, Doumith M, Thomas CP, Gordon NC, Wareham DW, et al. AdeABC-
525 mediated efflux and tigecycline MICs for epidemic clones of Acinetobacter baumannii. J
526 Antimicrob Chemother 2010;65:1589–93. https://doi.org/10.1093/jac/dkq218.
527 [40] Pinel-Marie M-L, Brielle R, Riffaud C, Germain-Amiot N, Polacek N, Felden B. RNA antitoxin SprF1
528 binds ribosomes to attenuate translation and promote persister cell formation in Staphylococcus
529 aureus. Nat Microbiol 2021;6:209–20. https://doi.org/10.1038/s41564-020-00819-2.
530 [41] da Silva RAG, Wong JJ, Antypas H, Choo PY, Goh K, Jolly S, et al. Mitoxantrone targets both host
531 and bacteria to overcome vancomycin resistance in Enterococcus faecalis. Sci Adv
532 2023;9:eadd9280. https://doi.org/10.1126/sciadv.add9280.
533 [42] Hoshino K, Hamauzu R, Nakagawa H, Kodani S, Hosaka T. Unique Physiological and Genetic
534 Features of Ofloxacin-Resistant Streptomyces Mutants. Appl Environ Microbiol 2022;88:e02327-
535 21. https://doi.org/10.1128/aem.02327-21.
536 [43] Hart EM, Silhavy TJ. Functions of the BamBCDE Lipoproteins Revealed by Bypass Mutations in
537 BamA. J Bacteriol 2020;202:e00401-20. https://doi.org/10.1128/JB.00401-20.
538 [44] Knowles TJ, Scott-Tucker A, Overduin M, Henderson IR. Membrane protein architects: the role of
539 the BAM complex in outer membrane protein assembly. Nat Rev Microbiol 2009;7:206–14.
540 https://doi.org/10.1038/nrmicro2069.
541 [45] Ito K, Akiyama Y. Cellular Functions, Mechanism of Action, and Regulation of Ftsh Protease.
542 Annu Rev Microbiol 2005;59:211–31.
543 https://doi.org/10.1146/annurev.micro.59.030804.121316.
544 [46] Bittner L-M, Arends J, Narberhaus F. When, how and why? Regulated proteolysis by the essential
545 FtsH protease in Escherichia coli. Biol Chem 2017;398:625–35. https://doi.org/10.1515/hsz-
546 2016-0302.
547 [47] Miyazaki R, Ai M, Tanaka N, Suzuki T, Dhomae N, Tsukazaki T, et al. Inner membrane YfgM–PpiD
548 heterodimer acts as a functional unit that associates with the SecY/E/G translocon and
549 promotes protein translocation. J Biol Chem 2022;298.
550 https://doi.org/10.1016/j.jbc.2022.102572.
551 [48] Fürst M, Zhou Y, Merfort J, Müller M. Involvement of PpiD in Sec-dependent protein
552 translocation. Biochim Biophys Acta BBA - Mol Cell Res 2018;1865:273–80.
553 https://doi.org/10.1016/j.bbamcr.2017.10.012.
554 [49] Sánchez MC, Romero-Lastra P, Ribeiro-Vidal H, Llama-Palacios A, Figuero E, Herrera D, et al.
555 Comparative gene expression analysis of planktonic Porphyromonas gingivalis ATCC 33277 in
556 the presence of a growing biofilm versus planktonic cells. BMC Microbiol 2019;19:58.
557 https://doi.org/10.1186/s12866-019-1423-9.
558 [50] Becker P, Hufnagle W, Peters G, Herrmann M. Detection of Differential Gene Expression in
559 Biofilm-Forming versus Planktonic Populations of Staphylococcus aureus Using Micro-
560 Representational-Difference Analysis. Appl Environ Microbiol 2001;67:2958–65.
561 https://doi.org/10.1128/AEM.67.7.2958-2965.2001.
562

27