Biomedicine & Pharmacotherapy 89 (2017) 1086–1091

Available online at

ScienceDirect
www.sciencedirect.com

Expression of VRK1 and the downstream gene BANF1 in esophageal

cancer
Jin Lia , Tingting Wanga , Lu Peia , Junpeng Jingc, Wentan Hua , Tiange Sunb ,
Hongchun Liua,*
a
Department of Medical Laboratory, First Affiliated Hospital, Zhengzhou University, Zhengzhou, Henan, 450052, China
b
Department of Geriatric Endocrinology, First Affiliated Hospital, Zhengzhou University, Zhengzhou, Henan, 450052, China
c
Department of Medical Laboratory, Maternal and Child Health Hospital of Guangxi Zhuang Autonomous Region, China

A R T I C L E I N F O A B S T R A C T

Article history:
Received 27 October 2016 Esophageal cancer is considered one of the most malignant tumors, being characterized by rapid
Received in revised form 20 February 2017 progression and poor outcomes. China has the highest incidence of esophageal cancer in the world.
Accepted 24 February 2017 Hence, it is necessary to clarify the mechanisms underlying esophageal cancer progression. In this study,
we examined the expression of vaccinia-related kinase 1 (VRK1) and barrier to autointegration factor 1
Keywords: (BANF1) in tumor tissues at the mRNA and protein levels via real-time PCR and immunohistochemical
Esophageal cancer analyses. The mRNA and protein expression levels of VRK1 and BANF1 were higher in tumor tissues than
Vaccinia-related kinase 1 (VRK1) in adjacent normal tissues. ROC curve analysis showed that VRK1 and BANF1 yielded AUCs of 0.790 and
Barrier to autointegration factor 1 (BANF1)
0.735, respectively, for the detection of esophageal squamous cell carcinoma(ESCC) patients. In
conclusion, our study indicates that VRK1 and BANF are promising novel therapeutic targets for
esophageal cancer.
© 2017 Published by Elsevier Masson SAS.

1. Introduction
Esophageal cancer, one of the most common types of malignant
tumors, accounts for 5% of all cancer deaths. Esophageal cancer
occurs more frequently in males than females and is prominent in
both western countries and eastern countries. In western
countries, most esophageal cancers are esophageal adenocarcino-
ma, while in eastern countries, squamous cell carcinomas are very
common [1,2]. According to population-based cancer registration
data from the National Central Cancer Registry (NCCR), the
incidence rate of esophageal cancer was 21.62/100,000 in 2011,
and it was the sixth most common type of malignant tumor in
China [1]. Recently, chemoradiotherapy has become one of the
treatment options for EC, but not all patients exhibit good clinical
responses. Therefore, it is important to clarify the mechanisms
underlying esophageal cancer progression.
We can obtain vast amounts of information for tumor
characterization from gene expression analysis [3]. Vaccinia-
related kinase (VRK) is a member of the Ser/Thr kinase family in
mammals. There are three subtypes of VRK in mammals: VRK1,
* Corresponding author.
E-mail address: xingyunerliu@163.com (H. Liu).
VRK2 and VRK3 [4]. VRK1 plays a role in cell cycle progression,
chromosome condensation, nuclear envelope breakdown and
reassembly and the DNA damage response [3,5]. Some studies
have suggested that VRK1 can phosphorylate histone H3 and play a
coordinating role in different signaling pathways in mammalian
DNA damage responses [6]. A large body of evidence suggests that
VRK1 plays an essential role in cancer progression [3,5–7]. VRK1
depletion or overexpression has an impact on the proliferation and
survival of cell lines from normal or malignant tissue [4]. VRK1 is
required for several processes in cell division. A study by Moura [8]
suggested that the expression of VRK1 can be regulated by Sox2
and that VRK1 acts as a tumor suppressor gene or tumor
predisposition gene.
VRK1 can mediate the phosphorylation of the barrier to
autointegration factor protein, which is encoded by the barrier
to autointegration factor 1 (BANF1) gene [9]. BANF1 is a small,
conserved and abundant DNA-binding protein. A study by Zheng
[10] concluded that BANF1 binds to double-stranded DNA with a
high affinity in sequence-independent manner. Some findings
have suggested that BANF1 is a high-affinity substrate for the VRK1
protein kinase [9]. BANF1 can affect gene expression either
positively or negatively. For example, when BANF1 was knocked
out in mice, the expression of SOX2, Oct4 and Nanog decreased in
embryonic stem cells [11]. BANF1 is known to repress a gene

http://dx.doi.org/10.1016/j.biopha.2017.02.095
0753-3322/© 2017 Published by Elsevier Masson SAS.
 J. Li et al. / Biomedicine & Pharmacotherapy 89 (2017) 1086–1091 1087

involved in somatic cell fusion [12]. Additionally, BANF1 directly
bind to histones H1.1, H3 and H4, and this binding has many
implications, including potential roles in chromatin remodeling
during transcription [13,14]. Based on these data, we suspected
that VRK1 and BANF1 play an important role in the physiology of
cancer cells.
To address the role of VRK1 and BANF1 in esophageal cancer
cells, we enrolled 120 patients with esophageal cancer and
analyzed the expression of VRK1 and BANF1 in tumor tissues at
the mRNA and protein levels through real-time PCR and
immunohistochemical analysis, respectively.
2. Materials and methods
2.1. Ethics statement
A total of 120 human esophageal cancer tissues and 120
adjacent normal tissues were collected from the First Affiliated
Hospital of Zhengzhou University. All patients provided written
consent.
2.2. Patients and samples
A total of 120 esophageal cancer patients were enrolled in this
study. These patients were hospitalized during May to November
2016 for thoracic surgery at the First Affiliated Hospital of
Zhengzhou University. They were all newly diagnosed with
esophageal squamous cell carcinoma, which was histologically
confirmed using surgical specimens and biopsies. All of these
patients were previously untreated (including surgery, chemo-
therapy and radiotherapy). All clinicopathological characteristics
of the patients, including their age, gender, lymph node metastasis
and TNM stage, are presented in Table 1. Tumors were staged
according to the TNM staging system of the Union for International
Cancer Control (UICC).
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as
an internal control for the mRNA expression analysis. Relative gene
expression levels were determined using the delta Ct method and
expressed as the average of three independent experiments
the
standard deviation. The primers employed for these assays were as
follows: VRK1 (forward: CTACCAACGAGCTGCAAAACC, reverse:
TCACTCCCAAAGCGATCCATTA); BANF1 (forward: TGGCTGAAAGA-
CACTTGTGG, reverse: CACTCTCGAAGGCATCCGAAG); and GAPDH
(forward: GGAGCGAGATCCCTCCAAAAT, reverse: GGCTGTTGTCA-
TACTTCTCATGG).
2.4. Immunohistochemistry
IHC was used to assess VRK1 or BANF1 expression in tumor
sections. Paraffin-embedded esophageal tissue samples were cut
at a thickness of 5 mm and then mounted on coated microscope
slides. Briefly, antigen retrieval was conducted via immersion of
the slides in citrate-EDTA buffer, followed by heating in a
microwave oven for 2 min at high power and 20 min at low
power. Non-specific staining was blocked using 5% goat serum.
After blocking, 50 ml of the primary antibody (VRK1 or BANF1)
were applied to each section overnight at 4  C. A mouse IgG isotype
control antibody was used at the same concentration as the
primary antibodies. On the day after incubation with the secondary
antibody, sections were incubated with DAB until the desired
staining developed.
2.5. Statistical analysis
Student’s t-test was used to evaluate significant differences
between two groups of data from all appropriate experiments. The
receiver operating characteristic (ROC) curve and the area under
the ROC curve (AUC) were used to evaluate the diagnostic power of
tissue VRK1 and BANF1 for ESCC. A P value <0.05 was considered
significant.

2.3. RNA extraction and quantitative real-time PCR (qRT-PCR) 3. Results

Total RNA was extracted from tissues and cells using TRIzol
reagent (TAKARA, Dalian, China) and reverse transcribed using the
PrimeScript RT Reagent Kit (Takara, Dalian, China) according to the
manufacturer’s instructions. For VRK1 and BANF1 detection, the
obtained mRNA was reverse transcribed using Oligo dT Primers.
SYBR Premix Ex Taq (TAKARA, China) was employed to quantitate
mRNA expression using a real-time PCR system (Agilent, U.S.A.).
3.1. VRK1 and BANF1 are over-expressed in poorly differentiated
esophageal cancer
The relationship between the expression of VRK1 and BANF1
and tumor differentiation is shown in Fig. 1. In the 120 normal
esophageal tissues, positivity for VRK1 and BANF1 was observed
in 19 cases and 16 cases, respectively, and the corresponding rates

Table 1
Expression of VRK1 and BANF1 in 120 human esophageal cancer tissues.

Total VRK1 BNF1

Positive (n = 97) P Value Positive (n = 93) P Value

Gender; N (%) 0.555 1.000
Male 74 60 (81.1) 57 (77.0)
Female 46 37 (80.4) 36 (78.3)

Age; N (%) 0.348 0.386

<65 years 66 52 (78.8) 49 (74.2)
65 years 54 45 (83.3) 44 (81.5)

Tumor differentiation; N (%) 0.020* 0.002*

I–II 85 64 (75.3) 61 (71.8)
III–IV 35 33 (94.3) 32 (91.4)

Lymphatic invasion; N (%) 0.157 0.186

Yes 50 37 (74.0) 42 (84.0)
No 70 60 (85.7) 51 (72.9)
*
P < 0.05.
1088 J. Li et al. / Biomedicine & Pharmacotherapy 89 (2017) 1086–1091

Fig. 1. VRK1 and BANF1 expression in esophageal cancer tissues. VRK1 expression was higher in tumor tissues than in adjacent normal tissues (A–C) (P = 0.020, N = 120). (A)
Adjacent normal tissues, (B) para-carcinoma tissues, (C) esophageal cancer tissues. BANF1 expression was higher in tumor tissues than adjacent normal tissues (E–G)
(P = 0.002, N = 120). (E) Adjacent normal tissues, (F) para-carcinoma tissues, (G) esophageal cancer tissues. Cells in region no. 1 were judged as negative. Cells in region no. 2
were judged as positive.

of positivity were 15.8% and 13.3%. In the 85 cases of poorly differentiated esophageal cancer, the numbers of
well-differentiated esophageal cancer, 64 and 61 cases were VRK1- and BANF1-positive cases were 33 and 32, respectively,
positive for VRK1 and BANF1, respectively, and corresponding and the corresponding rates of positivity were 94.3% and
rates of positivity were 75.3% and 71.8%. In the 35 cases of 91.4%.

Fig. 2. The difference in the tissue expression level of VRK1 between esophageal cancer tissues and adjacent normal tissues. The results are presented in box plots (A) and
scatter plots (B) (P = 0.044, N = 120). The difference in the tissue BANF1 expression level between ESCC patients and healthy controls. The results are presented in box plots (A)
and scatter plots (B) (P = 0.040, N = 120).
 J. Li et al. / Biomedicine & Pharmacotherapy 89 (2017) 1086–1091
3.2. VRK1 and BANF1 are over-expressed in esophageal cancer biopsies
compared with adjacent normal tissues
To verify our hypothesis, VRK1 and BANF1 protein levels were
assessed immunohistochemically in 120 esophageal cancer speci-
mens. The clinical characteristics of the esophageal cancer patients
were catalogued, and the intensity of VRK1 and BANF1 staining in
each sample was assigned a score of 0 (negative staining), 1 (<5%
staining), 2 (<25% staining) or 3 (25–50% staining). VRK1 and
BANF1 levels were markedly higher in tumors than in non-tumor
specimens. Representative immunohistochemical images of VRK1
and BANF1 in tumor and non-tumor samples are shown. A greater
number of VRK1- and BANF1-positive cells was observed in the
tumor region than the adjacent non-tumor region (Fig. 1).
3.3. Difference in the VRK1 and BANF1 mRNA expression levels
between tumor tissues and adjacent normal tissues
To identify the role of VRK1 and BANF1 in esophageal cancer
tissues, VRK1 and BANF1 mRNA levels were examined via real-
time PCR in several paired tumor tissues and adjacent normal
tissues. Without exception, VRK1 levels were higher in tumor
tissues than in adjacent normal tissues (Fig. 2A and B). VRK1 is
known to regulate the phosphorylation of BANF1 [9]. Therefore, we
examined the levels of BANF1. BANF1 expression was also higher in
these tumor tissues (Fig. 2C and D). The possibility that VRK1 and
BANF1 might be oncogenic in esophageal cancer led us to
hypothesize that VRK1 and BANF1 may be highly expressed in
esophageal cancer patients’ tissues and that their expression may
be predictive of a poor prognosis.
3.4. Diagnostic evaluation of the ROC curve
Finally, ROC curve analysis was performed to evaluate the
diagnostic power of tissue VRK1 and BANF1 expression for the
detection of ESCC. As shown in Fig. 3A, at the optimal cut-off value
for VRK1 of 0.542, the sensitivity was 89.3%; the specificity was
62.5%; Youden’s index was 51.8%; and the AUC was 0.790 (95% CI,
Fig. 3. ROC curve analysis of VRK1 for ESCC detection in patients (A), and the analysis of BANF1 for ESCC detection in patients (B).
1089
0.657–0.922) for the detection of ESCC. As shown in Fig. 3 B, at the
optimal cut-off value for BANF1 of 0.654, the sensitivity was 70.4%;
the specificity was 62.5%; Youden’s index was 32.9%; and the AUC
was 0.735 (95% CI, 0.592–0.877) for the detection of ESCC. In terms
of the authenticity and diagnostic evaluation of the screening test,
VRK1 performed better than BANF1.
4. Discussion
The present study was conducted to elucidate the role of VRK1
and BANF1 in esophageal cancer tissues and cell lines, and the
results highlighted the oncogenic role of VRK1 and BANF1 in
esophageal cancer. The expression levels of VRK1 and BANF1,
which were higher in tumor tissues than in adjacent normal
tissues, were associated with the clinical characteristics of
esophageal cancer patients. We assumed that VRK1 and BANF1
promote cell proliferation in esophageal cancer cell lines, and
depletion of VRK1 and BANF1 using siRNA significantly suppressed
the growth of EC109 and EC1 cells.
Unlimited proliferation is a major hallmark of cancer cells and is
closely related to an uncontrolled cell cycle. A large amount of
evidence suggests that there is an intimate connection between
tumor development and cell cycle dysregulation [15]. Several
studies have suggested the CDK family and other mitotic kinases as
potent pharmacological targets for anti-cancer therapy; these
kinases play pivotal roles not only in tumorigenic cells but also in
normal cells [16–18]. For example, a study by Martin [19] found
that VRK1 gene expression could be used as a significant
prognostic indicator in the development of estrogen receptor-
positive breast cancers. However, cell cycle progression is also a
critical process in normal cells, and these kinases are unsuitable
drug targets for clinical trials. VRK1 belongs to the mitotic kinase
family and is expressed in normal cells, similar to other mitotic
kinases. However, VRK1 plays an important role in the growth of
some tumors, such as lung cancer and head and neck squamous
cancer [20,21]. In studies by Kim [21] and So [22], VRK1 was
identified as a critical mitotic protein kinase in the proliferation of
lung cancer cells. They found that VRK1, which is specific for the
1090 J. Li et al. / Biomedicine & Pharmacotherapy 89 (2017) 1086–1091
cancer cell cycle network and correlates with cell cycle markers, is
a potential druggable target in the lung cancer-specific mitotic
network. In addition, VRK1 is down-regulated, causes G1 cell cycle
arrest and reduces the proliferation of cancer cells. These results
are similar to our observations obtained through tissue analysis.
There are several lines of evidence supporting the important role of
VRK1 in tumor biology. Another early study suggested that VRK1 is
an upstream kinase for 53BP1 focus formation in response to DNA
damage leading to tumor-specific cell death [23]. In addition,
several studies have demonstrated that VRK1 depletion impairs
tumor proliferation and metastasis, and suppressing VRK1-
mediated BAF phosphorylation induces abnormal nuclear enve-
lope dynamics and tumor cell death [4,24]. However, the molecular
mechanism of the VRK1 inhibition-mediated anti-proliferative
effects on tumor cells still requires further detailed research.
Inhibition of VRK1 could target several hallmarks of the cancer
phenotype [25]. For this reason, VRK1 might be a suitable target for
cancer therapy and may facilitate the development of kinase-
specific inhibitors, though this will require further exploration
[26,27]. An increased understanding of the biology VRKs and their
mode of action would allow the development of targeted therapies
interfering with their function in cancer cells, without the
potential physiological consequences of manipulating a central
signaling mediator.
In the present study, we found that not only VRK1 but also
BANF1 was more highly expressed in tumor tissues than in
adjacent tissues. A study by Margalit et al. [28] showed that
genomic DNA is attached to the nuclear envelope during
interphase via the interaction of the core nuclear envelope
constituents lamin and BAF. The interaction between DNA and
the nuclear envelope is important for nuclear integrity and must
therefore be tightly regulated throughout the cell cycle. In
addition, disruption of the link between DNA and the nuclear
envelope, achieved via VRK1-mediated BAF phosphorylation, leads
to progression of the cell cycle [29]. This process is important for
various cell functions. Our results from the present study suggest
that BANF1 is important for cancer cell proliferation. We also
demonstrated that BANF1 is expressed at higher levels in tumor
tissues than in adjacent tissues. BAF, which is encoded by the
BANF1 gene, is a soluble protein that localizes to both the
cytoplasm and nucleus, where it interacts with LEM-domain
proteins (LAP2, emerin, MAN1 and NET25) and affects chromatin
silencing [13]. In addition, a previous study suggested that BAF can
condense DNA in vitro [30]. BAF is phosphorylated by the
conserved VRK family of Ser/Thr kinases and the closely related
vaccinia virus kinase B1 [29,31–33]. Our study led to a similar
conclusion, that VRK1 depletion may suppress BANF1 expression.
In addition, BAF is specifically phosphorylated on the Ser-4 (the
major VRK phosphorylation site), Thr-2 and Thr-3 residues [34].
This phosphorylation inhibits its binding to DNA and reduces its
ability to homodimerize or bind LEM-domain proteins. BAF
phosphorylation also favors its localization to the cytoplasm,
which is consistent with disrupted binding to DNA and LEM-
domain proteins [31,34,35]. In addition,DRAM (Damage-Regulated
Autophagy Modulator,a novel damage-regulated autophagy mod-
ulator), whose expression is induced by p53, might be implicated
in the autophagic degradation of VRK1 protein.According to this
significant study, it can be speculated that the regulatory pathway
related to VRK1 and BANF1 might be involved in the p53 signal
pathway [36].
In summary, we found that VRK1 and BANF1 are up-regulated
in esophageal cancer and that their increased expression is
associated with a poor prognosis. VRK1 and BANF1 expression
might play an important role in the progression of esophageal
cancer. In addition, VRK1 depletion may suppress BANF1
expression. Taken together, these findings suggest that high
VRK1 and BANF1 expression could potentially serve as an
indicator of a poor prognosis and/or a therapeutic target in
esophageal cancer.
Conflict of interest
The authors declare no conflict of interest.
Acknowledgements
This work was supported by a grant from the science and
technology development plan of Education Department of Henan
Province (No. 2013020036, No. 14A320026) and Henan Provincial
Healthbureau (No. 201304015). It was also supported by scientific
and technological project of Science and Technology Department
of Henan Province (No. 172102310028) and Science and Technolo-
gy Department of Zhengzhou (No. 141PPTGG437).
References
[1] Q.Y. Gao, J.Y. Fang, Early esophageal cancer screening in China, Best Pract. Res.
Clin. Gastroenterol. 29 (2015) 885–893, doi:http://dx.doi.org/10.1016/j.
bpg.2015.09.018.
[2] C.S. Chung, Y.C. Lee, M.S. Wu, Prevention strategies for esophageal cancer:
perspectives of the east vs. west, Best Pract. Res. Clin. Gastroenterol. 29 (2015)
869–883, doi:http://dx.doi.org/10.1016/j.bpg.2015.09.010.
[3] N. Lee, J.H. Kwon, Y.B. Kim, S.H. Kim, S.J. Park, W. Xu, H.Y. Jung, K.T. Kim, H.J.
Wang, K.Y. Choi, Vaccinia-related kinase 1 promotes hepatocellular carcinoma
by controlling the levels of cell cycle regulators associated with G1/S
transition, Oncotarget 6 (2015) 30130–30148, doi:http://dx.doi.org/10.18632/
oncotarget.4967.
[4] T.P. Molitor, P. Traktman, Molecular genetic analysis of VRK1 in mammary
epithelial cells: depletion slows proliferation in vitro and tumor growth and
metastasis in vivo, Oncogenesis 2 (2013) e48, doi:http://dx.doi.org/10.1038/
oncsis.2013.11.
[5] M. Salzano, M. Vazquez-Cedeira, M. Sanz-Garcia, A. Valbuena, S. Blanco, I.F.
Fernandez, P.A. Lazo, Vaccinia-related kinase 1 (VRK1) confers resistance to
DNA-damaging agents in human breast cancer by affecting DNA damage
response, Oncotarget 5 (2014) 1770–1778, doi:http://dx.doi.org/10.18632/
oncotarget.1678.
[6] M. Salzano, M. Sanz-Garcia, D.M. Monsalve, D.S. Moura, P.A. Lazo, VRK1
chromatin kinase phosphorylates H2AX and is required for foci formation
induced by DNA damage, Epigenetics 10 (2015) 373–383, doi:http://dx.doi.
org/10.1080/15592294.2015.1028708.
[7] A. Dobrzynska, P. Askjaer, Vaccinia-related kinase 1 is required for early
uterine development in Caenorhabditis elegans, Dev. Biol. 411 (2016) 246–256,
doi:http://dx.doi.org/10.1016/j.ydbio.2016.01.010.
[8] D.S. Moura, I.F. Fernandez, G. Marin-Royo, I. Lopez-Sanchez, E. Martin-Doncel,
F.M. Vega, P.A. Lazo, Oncogenic Sox2 regulates and cooperates with VRK1 in
cell cycle progression and differentiation, Sci. Rep. 6 (2016) 28532, doi:http://
dx.doi.org/10.1038/srep28532.
[9] T.P. Molitor, P. Traktman, Depletion of the protein kinase VRK1 disrupts nuclear
envelope morphology and leads to BAF retention on mitotic chromosomes,
Mol. Biol. Cell 25 (2014) 891–903, doi:http://dx.doi.org/10.1091/mbc.E13-10-
0603.
[10] R. Zheng, R. Ghirlando, M.S. Lee, K. Mizuuchi, M. Krause, R. Craigie, Barrier-to-
autointegration factor (BAF) bridges DNA in a discrete, higher-order
nucleoprotein complex, Proc. Natl. Acad. Sci. U. S. A. 97 (2000) 8997–9002, doi:
http://dx.doi.org/10.1073/pnas.150240197.
[11] J.L. Cox, S.K. Mallanna, B.D. Ormsbee, M. Desler, M.S. Wiebe, A. Rizzino, Banf1 is
required to maintain the self-renewal of both mouse and human embryonic
stem cells, J. Cell. Sci. 124 (2011) 2654–2665, doi:http://dx.doi.org/10.1242/
jcs.083238.
[12] A. Margalit, E. Neufeld, N. Feinstein, K.L. Wilson, B. Podbilewicz, Y. Gruenbaum,
Barrier to autointegration factor blocks premature cell fusion and maintains
adult muscle integrity in C. elegans, J. Cell. Biol. 178 (2007) 661–673, doi:
http://dx.doi.org/10.1083/jcb.200704049.
[13] R. Montes de Oca, P.R. Andreassen, K.L. Wilson, Barrier-to-autointegration
factor influences specific histone modifications, Nucleus 2 (2011) 580–590,
doi:http://dx.doi.org/10.4161/nucl.2.6.17960.
[14] R. Montes de Oca, K.K. Lee, K.L. Wilson, Binding of barrier to autointegration
factor (BAF) to histone H3 and selected linker histones including H1.1, J. Biol.
Chem. 280 (2005) 42252–42262, doi:http://dx.doi.org/10.1074/jbc.
M509917200.
[15] G.H. Williams, K. Stoeber, The cell cycle and cancer, J. Pathol. 226 (2012) 352–
364, doi:http://dx.doi.org/10.1002/path.3022.
[16] J. Bartek, J. Lukas, Chk1 and Chk2 kinases in checkpoint control and cancer,
Cancer Cell 3 (2003) 421–429.
 J. Li et al. / Biomedicine & Pharmacotherapy 89 (2017) 1086–1091
[17] B. Zhang, X. Gu, U. Uppalapati, M.A. Ashwell, D.S. Leggett, C.J. Li, High-content
fluorescent-based assay for screening activators of DNA damage checkpoint
pathways, J. Biomol. Screen. 13 (2008) 538–543, doi:http://dx.doi.org/10.1177/
1087057108318509.
[18] S. Ashwell, S. Zabludoff, DNA damage detection and repair pathways—recent
advances with inhibitors of checkpoint kinases in cancer therapy, Clin. Cancer
Res. 14 (2008) 4032–4037, doi:http://dx.doi.org/10.1158/1078-0432.ccr-07-
5138.
[19] K.J. Martin, D.R. Patrick, M.J. Bissell, M.V. Fournier, Prognostic breast cancer
signature identified from 3D culture model accurately predicts clinical
outcome across independent datasets, PLoS One 3 (2008) e2994, doi:http://dx.
doi.org/10.1371/journal.pone.0002994.
[20] A. Valbuena, M. Sanz-García, I.L. ópez-Sánchez, F.M. Vega, P.A. Lazo, Roles of
VRK1 as a new player in the control of biological processes required for cell
division, J. Cell. Signal. 23 (8) (2011 Aug) 1267–1272.
[21] C.R. Santos, M. Rodriguez-Pinilla, F.M. Vega, J.L. Rodriguez-Peralto, S. Blanco, A.
Sevilla, A. Valbuena, T. Hernandez, A.J. van Wijnen, F. Li, E. de Alava, M.
Sanchez-Cespedes, P.A. Lazo, VRK1 signaling pathway in the context of the
proliferation phenotype in head and neck squamous cell carcinoma, Mol.
Cancer Res. 4 (2006) 177–185, doi:http://dx.doi.org/10.1158/1541-7786.mcr-
05-0212.
[22] I.J. Kim, D. Quigley, M.D. To, P. Pham, K. Lin, B. Jo, K.Y. Jen, D. Raz, J. Kim, J.H. Mao,
D. Jablons, A. Balmain, Rewiring of human lung cell lineage and mitotic
networks in lung adenocarcinomas, Nat. Commun. 4 (2013) 1701, doi:http://
dx.doi.org/10.1038/ncomms2660.
[23] M. Sanz-Garcia, D.M. Monsalve, A. Sevilla, P.A. Lazo, Vaccinia-related kinase 1
(VRK1) is an upstream nucleosomal kinase required for the assembly of 53BP1
foci in response to ionizing radiation-induced DNA damage, J. Biol. Chem. 287
(2012) 23757–23768, doi:http://dx.doi.org/10.1074/jbc.M112.353102.
[24] W. Kim, H.N. Lyu, H.S. Kwon, Y.S. Kim, K.H. Lee, D.Y. Kim, G. Chakraborty, K.Y.
Choi, H.S. Yoon, K.T. Kim, Obtusilactone B from Machilus Thunbergii targets
barrier-to-autointegration factor to treat cancer, Mol. Pharmacol. 83 (2013)
367–376, doi:http://dx.doi.org/10.1124/mol.112.082578.
[25] D. Hanahan, R.A. Weinberg, Hallmarks of cancer: the next generation, Cell 144
(2011) 646–674, doi:http://dx.doi.org/10.1016/j.cell.2011.02.013.
[26] M.W. Karaman, S. Herrgard, D.K. Treiber, P. Gallant, C.E. Atteridge, B.T.
Campbell, K.W. Chan, P. Ciceri, M.I. Davis, P.T. Edeen, R. Faraoni, M. Floyd, J.P.
Hunt, D.J. Lockhart, Z.V. Milanov, M.J. Morrison, G. Pallares, H.K. Patel, S.
Pritchard, L.M. Wodicka, P.P. Zarrinkar, A quantitative analysis of kinase
1091
inhibitor selectivity, Nat. Biotechnol. 26 (2008) 127–132, doi:http://dx.doi.org/
10.1038/nbt1358.
[27] J. Zhang, P.L. Yang, N.S. Gray, Targeting cancer with small molecule kinase
inhibitors, Nat. Rev. Cancer 9 (2009) 28–39, doi:http://dx.doi.org/10.1038/
nrc2559.
[28] A. Margalit, A. Brachner, J. Gotzmann, R. Foisner, Y. Gruenbaum, Barrier-to-
autointegration factor—a BAFfling little protein, Trends Cell. Biol. 17 (2007)
202–208, doi:http://dx.doi.org/10.1016/j.tcb.2007.02.004.
[29] R.J. Nichols, M.S. Wiebe, P. Traktman, The vaccinia-related kinases
phosphorylate the N0 terminus of BAF, regulating its interaction with DNA
and its retention in the nucleus, Mol. Biol. Cell 17 (2006) 2451–2464, doi:
http://dx.doi.org/10.1091/mbc.E05-12-1179.
[30] D. Skoko, M. Li, Y. Huang, M. Mizuuchi, M. Cai, C.M. Bradley, P.J. Pease, B. Xiao, J.
F. Marko, R. Craigie, K. Mizuuchi, Barrier-to-autointegration factor (BAF)
condenses DNA by looping, Proc. Natl. Acad. Sci. U. S. A. 106 (2009) 16610–
16615, doi:http://dx.doi.org/10.1073/pnas.0909077106.
[31] M. Gorjanacz, E.P. Klerkx, V. Galy, R. Santarella, C. Lopez-Iglesias, P. Askjaer, I.W.
Mattaj, Caenorhabditis elegans BAF-1 and its kinase VRK-1 participate directly
in post-mitotic nuclear envelope assembly, EMBO J. 26 (2007) 132–143, doi:
http://dx.doi.org/10.1038/sj.emboj.7601470.
[32] R.J. Nichols, P. Traktman, Characterization of three paralogous members of the
mammalian vaccinia related kinase family, J. Biol. Chem. 279 (2004) 7934–
7946, doi:http://dx.doi.org/10.1074/jbc.M310813200.
[33] J. Nezu, A. Oku, M.H. Jones, M. Shimane, Identification of two novel human
putative serine/threonine kinases VRK1 and VRK2, with structural similarity
to vaccinia virus B1R kinase, Genomics 45 (1997) 327–331.
[34] L. Bengtsson, K.L. Wilson, Barrier-to-autointegration factor phosphorylation
on Ser-4 regulates emerin binding to lamin A in vitro and emerin localization
in vivo, Mol. Biol. Cell 17 (2006) 1154–1163, doi:http://dx.doi.org/10.1091/mbc.
E05-04-0356.
[35] A. Jamin, A. Wicklund, M.S. Wiebe, Cell-and virus-mediated regulation of the
barrier-to-autointegration factor's phosphorylation state controls its DNA
binding, dimerization, subcellular localization, and antipoxviral activity, J.
Virol. 88 (2014) 5342–5355, doi:http://dx.doi.org/10.1128/jvi.00427-14.
[36] A. Valbuena, S. Castro-Obregón, P.A. Lazo, Downregulation of VRK1 by p53 in
response to DNA damage is mediated by the autophagic pathway, PLoS One 6
(February (2)) (2011) e17320, doi:http://dx.doi.org/10.1371/journal.
pone.0017320.