Isolation, Identification, and Sequencing of a Goose-Derived Newcastle Disease

Virus and Determination of Its Pathogenicity

Author(s): Xiao-Qing Chen, Zi-Bing Li, Gui-Xue Hu, Song-Zhi Gu, Shuang Zhang, Ying Ying, and
Feng-Shan Gao
Source: Avian Diseases, 59(2):235-243.
Published By: American Association of Avian Pathologists
DOI: http://dx.doi.org/10.1637/10957-100914-Reg
URL: http://www.bioone.org/doi/full/10.1637/10957-100914-Reg

BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological, and
environmental sciences. BioOne provides a sustainable online platform for over 170 journals and books published
by nonprofit societies, associations, museums, institutions, and presses.
Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance of
BioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use.
Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial
inquiries or rights and permissions requests should be directed to the individual publisher as copyright holder.

BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, research
libraries, and research funders in the common goal of maximizing access to critical research.
AVIAN DISEASES 59:235–243, 2015

Isolation, Identification, and Sequencing of a Goose-Derived Newcastle Disease Virus

and Determination of Its Pathogenicity
Xiao-Qing Chen,AB Zi-Bing Li,AB Gui-Xue Hu,AD Song-Zhi Gu,A Shuang Zhang,A Ying Ying,A and Feng-Shan GaoACD
A
Department of Veterinary Medicine, College of Animal Science and Technology, Jilin Agricultural University, Changchun,
Jilin 130118, China
C
Department of Bioengineering, College of Life Science and Technology, Dalian University, Dalian, Liaoning 116622, China
Received 13 October 2014; Accepted 20 February 2015; Published ahead of print 23 February 2015

SUMMARY. In August 2010, geese in the Meihekou area of Jilin province in China were found to be infected by a pathogen
that caused a disease similar to Newcastle disease. To determine the causative agent of the infections, a virus was isolated from liver
tissues of infected geese, followed by a pathogenicity determination. The isolated virus was named NDV/White Goose/China/
Jilin(Meihekou)/MHK-1/2010. Specific primers were designed to amplify the whole genome of the MHK-1 virus, followed by
sequencing and splicing of the entire genome. Sequencing and phylogenetic analysis of MHK-1 showed that the isolate was a
virulent strain of Newcastle disease virus. The MHK-1 genome is 15,192 nucleotides long, and it belongs to the class II branch of
Newcastle disease viruses, as evidenced by the amino acid sequence (112R-R-Q-K-R-F117) of the F protein. The hemagglutinin titer
was 1:128 to 1:512. The chicken embryo mean death time, the intracerebral pathogenicity index, and the median lethal dose of
chicken embryos of MHK-1 were 43 hr, 1.63, and 109/ml, respectively, which revealed that the newly isolated MHK-1 strain is
strongly pathogenic to geese.
RESUMEN. Aislamiento, identificación y secuenciación de un virus de la enfermedad de Newcastle con origen en gansos y
determinación de su patogenicidad.
En agosto de 2010, se encontró que gansos en la zona de la provincia de Jilin Meihekou en China estaban infectados por un
agente patógeno que causaba una enfermedad similar a la enfermedad de Newcastle. Para determinar el agente causante de la
infección, un virus se aisló de los tejidos del hı́gado de gansos infectados, seguido por una determinación de la patogenicidad. El
virus aislado fue nombrado NDV/Ganso Blanco/China/Jilin (Meihekou)/MHK-1/2010. Se diseñaron iniciadores especı́ficos para
amplificar el genoma completo del virus MHK-1, seguido por secuenciación y ensamblaje de todo el genoma. La secuenciación y
análisis filogenético del virus MHK-1 mostraron que se trataba de una cepa virulenta del virus de la enfermedad de Newcastle. El
genoma del virus MHK-1 tiene una longitud de 15,192 nucleótidos y pertenece a la rama de clase II del virus de la enfermedad de
Newcastle, como lo demuestra la secuencia de aminoácidos (112R-R-Q-K-R-F117) de la proteı́na F. El tı́tulo por hemoaglutinación
fue de 1:128 a 1:512. El tiempo promedio de mortalidad embrionaria, ı́ndice de patogenicidad intracerebral, y la dosis letal media
de embriones de pollo del virus MHK-1 fueron 43 hr, 1,63, y 109/ml, respectivamente, lo que reveló que la cepa patógena MHK-1
es altamente patógena para los gansos.
Key words: Newcastle disease virus, geese, isolation, genome, pathogenicity
Abbreviations: CEFs 5 chicken embryo fibroblasts; ECEs 5 embryonated chicken eggs; ELD50 5 the median lethal dose of
chicken embryos; F 5 fusion protein; FITC 5 fluoroscein isothiocyanate; HA 5 hemagglutination; HE 5 hematoxylin-eosin;
HI 5 hemagglutination inhibition; HN 5 hemagglutinin-neuraminidase; ICPI 5 the intracerebral pathogenicity index; kb 5
kilobases (kb); L 5 RNA polymerase; M 5 matrix protein; MDT 5 mean death time; NDV 5 Newcastle disease virus;
NP 5 nucleoprotein; nt 5 nucleotides; ORFs 5 open reading frames; P 5 phosphoprotein; RT-PCR 5 reverse-transcription
PCR; SPF 5 specific-pathogen-free; TEM 5 transmission electron microscopy

Newcastle disease, caused by virulent strains of Newcastle disease
virus (NDV), is an acute and highly contagious disease responsible
for severe economic losses in domestic poultry, especially in chickens
(8,24), and it belongs to the Avulavirus genus within the
Paramyxoviridae family (10). The genome of NDV is a single-
stranded, negative-sense RNA of approximately 15.2 kilobases (kb)
that contains six open reading frames (ORFs) (23), including, from
39 to 59, nucleoprotein (NP), phosphoprotein (P), matrix (M)
protein, fusion (F) protein, hemagglutinin-neuraminidase (HN),
and RNA polymerase (L), that encode six structural proteins
(14,22). The molecular basis of NDV virulence relies on multiple
genes, and the amino acid sequence motif at the cleavage site of the
precursor F glycoprotein is the critical site for major changes in
virulence (11,28,31). Since NDV was first described in 1926, there
B
These authors contributed equally to this work.
D
Corresponding authors. E-mails: huguixue901103@163.com;
gfsh0626@126.com
There is no conflict of interest.
have been four NDV pandemics, with the fourth spreading genotype
VII NDV (1,19), although there is still only one serotype of NDV
presently. Based on genome sizes and the nucleotide sequences of the
F and L genes, NDV strains can be categorized as class I or class II
(21). Class I NDVs are usually 15,198 nucleotides (nt) in length and
consist of nine genotypes, all but one of which are avirulent in
chickens (16,17). Class II NDVs include 18 genotypes and are more
virulent than class I NDVs. Genotypes I–IV (15,186 nt) and IX
(15,192 nt) emerged before 1960, whereas genotypes V–VIII
(15,192 nt), X (uncertain), and XI (uncertain) were detected after
1960 (34,38). People generally thought that waterfowl had a greater
resistance to NDV. However, an increasing number of reports
showed an increasing pathogenicity of NVD toward waterfowl,
especially geese (35). Mortality from infections with virulent strains
of NDV can reach even 100% in goslings unprotected by
vaccination (33). Currently, among animal viruses, it is one of the
biggest contributors to economic losses to the world’s economy (9).
We successfully isolated an NDV strain, named NDV/White
Goose/China/Jilin(Meihekou)/MHK-1/2010, from the tissues of ill

235
236 Chen et al.

White Geese in the Meihekou area of Jilin province in China.

MHK-1 was detected with the use of the hemagglutination (HA)

Melting temperature (C)

and hemagglutination inhibition (HI) tests with the use of anti-
NDV antiserum and pathogenicity index tests. On this basis, we
proceeded with gene amplification and molecular cloning to obtain

56.1
54.8

57.5
59
59
59
59
59
57
59

61
59
61
61

55
the whole genome sequence of the virus. Then we studied the
molecular characteristics and pathogenicity of MHK-1.

MATERIALS AND METHODS

Samples and virus isolation. In August 2010, a goose farm with only

Expected size (bp)

800 2-yr-old White Geese in the Meihekou area of Jilin province in
China suffered an outbreak of disease. Nearly 100% of the geese were

1166
1031
911
1308
1021
892
1647
1015
1591
1439
921
1448
1042
1508
1662
infected, and 80% of the geese died after 5 days. We collected liver
tissues from five geese that were ill or near death. Physiological saline
was added in a proportion of 3:1 to the tissues, followed by cutting and
grinding the tissues into a homogenate. After centrifugation at 12,000 3
g for 10 min, antibiotics (final concentrations of 1000 IU/ml penicillin
and 1 mg/ml streptomycin) were added to the supernatant, and
incubated for 2 hr at 37 C. Thirty 9–11-day-old specific-pathogen-free

9598–11,036
10,815–11,735
11,527–13,019
12,890–13,932
13,685–15,192
1006–2036
1815–2725
2563–3871
3719–4739
5089–5980
5833–7479
7223–8237
8114–9704

4550–6211
1–1166
(SPF) embryonated chicken eggs (ECEs, a kind gift from the White

Position
Goose Research Center, Changchun, China) were inoculated with 0.1 ml
of supernatant via the chorioallantoic route, and then the control group
with same number of ECEs was inoculated with saline. The ECEs were
incubated at 37 C and were illuminated twice a day to detect the state of
the eggs. All the inoculated eggs, with the exception of those that were
dead after 24 hr, were discarded to avoid unspecific mortality. Allantoic
fluids from chick embryos that died between 24 and 120 hr
postinoculation were collected and stored at 280 C. Allantoic fluids

TTATGTTAATATTCAGCTTGACTCT
ATGCCTAAGTTAGCTTCCATGATC

TGACTATGATTGACCCTGTCTGAG

ACACCTCGACGAAGTCTATATCTG

GTCGACTCATGCTCTTGTAGTGGC
were negatively stained and then observed by transmission electron

TGACATCATGTGAGATCTCTGCT
ACTCCGAATCAAAGTATGTCTGC

ACCAAACAGAGATTTGGTGAATG
microscopy (TEM) (JME-100EA III, JEOL, Tokyo, Japan) (2). To
GGTACTTGCCAGTTCCCTTAT

TGCAGTTGGGATCCTGTAGAC

GGCATTGCTGATTGAATTGTT
CATCCGAATTTGGTAATCTTG

CTAGCGTCAGCGAGCACATAT

CTCCATAATGGGCAGAACTCC
confirm the presence of virus, allantoic fluids were tested by HA and HI
CTCAGAGCTTTGGTCTTGCC

tests with the use of the standard positive serum of NDV (Key Laboratory
of Animal Disease Control and Prevention of the Ministry of Agriculture)
Reverse (59–39)

and positive serum of the H5, H7, and H9 subtypes of avian influenza
virus (Harbin Veterinary Research Institute, Chinese Academy of
Agricultural Sciences) by the conventional microtiter method, as
previously described (26). The virus was plaque purified three times with
the use of ECEs and prepared for the tests to follow (36).
Ultrathin sectioning of infected cells. The virus was inoculated into
chicken embryo fibroblasts (CEFs), followed by culturing for 18, 24, or
30 hr. The cells were collected and centrifuged at 5200 3 g for 10 min
to remove the supernatant. The cell precipitate was fixed overnight with
2.5% glutaraldehyde. The cells were processed according to the
manufacturer’s instructions for ultrathin sectioning. Finally, the cells
were observed by TEM.
Pathogenicity index tests. The virulence of the isolated virus was
TAGAAGAGAGACATCCAGAGACCAG

TCAAGGATGATAGAGTTTAAGAAGC

TGTGATTAAGATTGCACTGACTAGG

determined by three standard methods, chicken embryo mean death

CAGAAAGAAGAACTCAGGTGTGTG
ACAGCAAACGAATATTCAAAGATG

GAATTCATGGGCTCCAAACCTTCT
ATGGTTGTGGCAAATAGGTACTC

CCAGGGATCCTACTCTCCAATAT

time (MDT), the intracerebral pathogenicity index (ICPI), and the

ACCAAACAGAGAATCTGTGAGG
ACAGCTCATGCGTTTATATCGG

GAAGATGCAGCAGTTTGTCAAT
ATTAGACGGGATAACTCTGAGG

median lethal dose of chicken embryos (ELD50), as previously described

GTCTTTTATTGACGACCGTGT

AGGTGTGCAAGACATGGGAAC
CGCAGGCGATGATGTCTATG

(15). For the MDT, 40 NDV antibody-free chicken embryonated eggs,

obtained from the White Goose Research Center, were inoculated with a
Forward (59–39)

10-fold serial dilution of the NDV isolate (1024–10210) in saline. Five

Primers used in the study.

eggs were inoculated with 0.1 ml of each viral dilution, and five eggs
were inoculated with saline as a negative control. The infected eggs were
incubated at 37 C, and the deaths of the inoculated embryos were
recorded every 2 hr for 10 days. The highest dilution at which all the
embryos died was considered to be the minimum lethal dose. The MDT
was determined as the mean time, in hours, required for the highest
dilution (the least amount of virus) to kill all five embryos. The MDT
has been used to classify NDV strains into the following groups:
velogenic (highly virulent; MDT , 60 hr), mesogenic (moderately
virulent; 60 # MDT # 90 hr), and lentogenic (avirulent; MDT .
Table 1.

90 hr). For the ICPI, 10 one-day-old chicks were injected intracerebrally

with 0.05 ml of a 10-fold dilution of fresh, infective allantoic fluid,
Primer

F10
F11
F12
F13
F14
F15

which was filtered before being inoculated and had an HA titer of at

F1
F2
F3
F4
F5
F6
F7
F8
F9

least 16. Ten chicks that were injected with 0.05 ml saline as a negative
 Isolation of a velogenic NDV strain from geese
Fig. 1. (A) Normal chicken embryo. (B) Hemorrhaging chicken embryo.
control were housed separately. Chickens were examined for clinical
symptoms and mortality every 12 hr for 8 days. On each day, chicks that
appeared normal or sick were scored as 0 and 1, respectively; dead chicks
were given a score of 2. The values for normal and sick chicks were
recorded, and the value for dead chicks was cumulative, such that a total
of 10 recordings were made each day for each group of 10 chicks. The
ICPI is expressed as the weighted mean divided by the number of
observations made. Velogenic viruses give values approaching 2, and
lentogenic viruses give values close to 0. Virulent NDVs give values that
are equal to or greater than 0.7. For the ELD50 determination, 30 NDV
antibody-free chicken embryonated eggs were inoculated with a 10-fold
serial dilution of the NDV isolate (1025–10210) in saline. Five eggs
were inoculated with 0.1 ml of each viral dilution, the infected eggs were
incubated at 37 C, and the deaths of the inoculated embryos were
recorded every 2 hr for 10 days. The Reed–Muench method was used to
calculate the ELD50 (29).
Primer design. Based on available NDV nucleotide sequences (NA-1,
with GenBank accession number DQ659677), 15 pairs of specific
primers were designed to amplify the complete genome of the NDV
isolate. All primers used for reverse-transcription PCR (RT-PCR) were
synthesized by Sangon Biotech (Shanghai, China), and their sequences
are displayed in Table 1. The amplified fragments overlapped each other
and covered the whole genome.
RNA extraction and RT-PCR. Viral genomic RNA was extracted
from allantoic fluid with the use of the Trizol Reagent (TransGen
Biotech, Beijing, China) according to the manufacturer’s instructions.
The extracted total RNA was reverse transcribed to cDNA with the use
of avian myeloblastosis virus reverse transcriptase (TaKaRa, Japan) and
oligo (dT) primers per the manufacturer’s recommendation with a
thermocycler (Bio-Rad, Hercules, CA). Then, 2 ml of the product was
used as a template to amplify the different regions of the genome in a
25-ml reaction volume containing 2 ml of 2.5 mmol/L dNTPs, 0.5 ml
237
(10 pmol/ml) of each primer, 2.5 ml of 103 Taq Buffer, 0.3 ml of ExTaq
Enzyme (TaKaRa), and 17.2 ml of double-distilled H2O. The PCR
reactions were performed according to the following protocol: 95 C for
5 min, followed by 30 cycles (95 C for 30 sec, 57.5 C for 30 sec, 72 C
for 1 min) and a final elongation step of 10 min at 72 C.
Gel extraction of PCR products. A 5-ml aliquot of PCR product was
loaded onto a 1% agarose gel and electrophoresed for 40 min in TAE
buffer containing 0.5 mg/L ethidium bromide. The PCR products were
purified with the use of the Solarbio Gel Extraction Kit (Solarbio,
Beijing, China) according to the manufacturer’s instructions.
Cloning and sequencing of PCR products. The PCR products
obtained with the F1 and F15 primers were inserted into the pEASY-
Blunt vector, and then transformed into Escherichia coli Trans 1-T1
competent cells according to the manufacturer’s instructions. The
recombinant plasmids were extracted from positive clones with the use
of the TaKaRa Plasmid Miniprep kit (TaKaRa, Dalin, China) and
identified by PCR. Plasmids containing inserts were sequenced by
Sangon Biotech (Shanghai, China). The whole-genome nucleotide
sequences of the MHK-1 isolates were selected and submitted to the
DNA Databank of Japan (DDBJ)/GenBank database through the
SAKURA system.
Analysis of the whole-genome nucleotide sequence. The whole-
genome nucleotide sequences of the MHK-1 isolates were aligned and
compared with 34 representative NDV strains, which were obtained
from GenBank (data not shown). Phylogenetic trees were built and
analyzed with the use of the MEGA 5.0 program. The variance of the
difference was computed with the use of the bootstrap method (1000
replicates).
Animal pathogenicity tests. Clinical symptoms observation. Eight 14-
day-old SPF goslings (White Goose breed) from the Changchun
Academy of Agricultural Sciences were inoculated subcutaneously with
0.2 ml of the third passage of the virus (ELD50 5 107.3); two goslings
238
Fig. 2. Negative staining electron microscopy observation of NDV.
were inoculated with saline as a control group. Clinical symptoms (state
of health, weight change, breathing characteristics, defecation) of the
goslings were observed for 5 days.
Pathological anatomy observation. The goslings were euthanized
according to the animal protocols approved by the local Animal Welfare
and Research Ethics Committee when they showed obvious signs of
illness. Then, pathologies of the brain, liver, spleen, lungs, and intestines
were observed for both the infected and control groups.
Immunohistochemical tests. Paraffin section hematoxylin-eosin
staining. Sample tissues were fixed with 10% neutral buffered formalin
for approximately 52 hr. All sampled tissues were routinely processed
into paraffin blocks, and 3–5-mm sections were cut for hematoxylin-
eosin (HE) staining. All tissues were examined histologically, and the
severity of the lesions was recorded.
Frozen-section immunofluorescence staining. Frozen-section im-
munofluorescence staining was processed as previously described (4). In
brief, frozen sections (5 mm) of the brain, liver, and duodenum of the
infected and control geese were made and fixed with 4% formaldehyde
for 5 min. Newcastle-positive blood serum was used as the primary
antibody, and fluoroscein isothiocyanate (FITC)–conjugated affinity
purified rabbit anti-chicken IgG was used as the secondary antibody. All
sections were observed by confocal laser scanning microscopy.
RESULTS
Chick embryo inoculation. ECEs that were 9–11 days old were
inoculated with the infected tissue solution, and a control group was
inoculated with physiological saline. The results showed that the
Chen et al.
Fig. 3. Chicken embryo fibroblasts infected with MHK-1 virus
(40,0003). The black arrow with a dashed tail indicates the released
virions, and the black arrow indicates a viral budding phenomenon in
the membrane; the white arrow indicates dense particles in
the cytoplasm.
chick embryos of the control group were normal (Fig. 1A), and the
infected group died at 36–48 hr. The surfaces of the dead chick
embryos showed evidence of hyperemia, and substantial hemor-
rhaging at the head (Fig. 1B).
Negative staining electron microscopy. Fresh allantoic fluids
were negatively stained and observed under an electron microscope.
The results showed circular NDV particles, and the surface of the
NDV was characterized by an envelope and a spike. The diameter of
the virus was about 200 nm (Fig. 2).
Ultrathin sections of infected cells. Ultrathin sections of CEF
infected by the MHK-1 strain were observed by electron microscopy.
The results showed that dense particles were observed inside the cell
cytoplasm, there was a viral budding phenomenon in the membrane,
and virions were released extracellularly (Fig. 3).
HA and HI tests. The 20 NDV samples were analyzed with the
use of HA and HI tests. The results showed that the viral
hemagglutination titers ranged from 1:128 to 1:512, and they could
be inhibited by the standard NDV-positive serum, but not by serum
positive for the H5, H7, and H9 subtypes of avian influenza virus.
Pathogenicity index tests. The MDT of the MHK-1 strain was
43 hr, and the intracerebral pathogenicity index (ICPI) was 1.63.
The ELD50 was 109/ml. The results confirmed the isolate is a
velogenic strain, with a rapid onset of symptoms.
RT-PCR amplification results. Fifteen pairs of specific primers
were designed to amplify the whole genome of the NDV isolate. The
fragments overlapped with each other and the lengths of the
segments matched the expected values (Fig. 4A–C).
Cloning the PCR products and sequencing. The PCR products
obtained with the F1 and F15 primers were inserted into the
pEASY-Blunt vector, transformed into E. coli Trans 1-T1 competent
cells, and identified by PCR (data not shown). The results of the
RT-PCRs were in accordance with expectations. The positive clones
from every PCR product were sequenced with the use of an
automated gene sequencing facility at Takara Bio, Inc.
Splicing of the whole genome of the MHK-1 strains and
analysis of the genetic phylogenetic tree. The whole-genome
sequences were spliced from 15 segments of the MHK-1 strain with
the use of the DNAStar program. The whole-genome sequences
were submitted to the DDBJ/European Molecular Biology Labora-
tory (EMBL)/GenBank database and received accession numbers
KM408752. Compared with the LaSota strain of the NDV vaccine,
which is 15,186 nt long, an extra six nucleotides (ACACTC) were
 Isolation of a velogenic NDV strain from geese
Fig. 4. RT-PCR products of whole genes of the NDV MHK-1
strain. M, DL2000 marker: lanes 1–7: products of whole genes of the
NDV MHK-1 strain following RT-PCR with primers F1–F7; lanes 8–
14: products of whole genes of the NDV MHK-1 strain following RT-
PCR with primers F8–F14; lane 15: F-gene product of whole genes of
the NDV MHK-1 RT-PCR with primers F15.
inserted into the noncoding region between the NP and P genes
located in the 1652–1657 nt region in the MHK-1 strain. The
length of the MHK-1 genome was 15,192 nt, which is consistent
with the extra six nucleotides. The genome has six ORFs. The
genetic structure is 39-NP-P-M-F-HN-L-59. A phylogenetic analysis
of the whole-genome sequence and the whole-genome sequences of
34 other strains showed that the MHK-1 strain belonged to the class
II branch of NDV strains (Fig. 5).
239
Analysis of the sequence and identification of the genotype of
F protein. The ORF of the F gene is 1662 bp long and encodes 553
amino acids. The F-protein cleavage-site sequence is located at 112R-
R-Q-K-R-F117, which is typical for velogenic NDV strains. To
identify the genotype of MHK-1, we compared the sequence of the
1–389-bp region of its F gene with typical velogenic NDV. The
phylogenetic analysis showed that the MHK-1 strain belonged to
genotype VII, which is the class II branch of NDVs (Fig. 6).
Homology analysis of the MHK-1 genome and its structural
genes. The whole genome sequence of the MHK-1 strain was
compared with those of 34 other strains with the use of the
DNAStar program. It was shown that the MHK-1 strain is most
homologous (99.4%) with NA-1 strains, which belong to genotype
VII of the class II branch. In contrast, the homology of MHK-1 and
duck/China/NDV08-004/2010 strains, which belong to the class I
branch, was the lowest (71.9%). A comparison of the homologies of
the structural genes of MHK-1 strains and the corresponding genes
of the other 34 NDV strains yielded the following results. For the
NP gene, the MHK-1strain had the highest nucleotide sequence
homology (99.7%) with NA-1 strains, and the lowest with DE-R49/
99 strains (77.6%). For the P gene, the MHK-1 strain had the
highest nucleotide sequence homology (99.9%) with NA-1 strains
and the lowest with duck/China/NDV08-004/2010 strains (70.4%).
For the M gene, the MHK-1 strain had the highest nucleotide
sequence homology (99.9%) with NA-1 strains and the lowest with
DE-R49/99 strains (75.8%). For the F gene, the MHK-1 strain had
the highest nucleotide sequence homology (99.9%) with NA-1
strains and the lowest with duck/China/NDV08-004/2010 strains
(70.8%). For the HN gene, the MHK-1 strain had the highest
nucleotide sequence homology (99.7%) with NA-1 strains and the
lowest with duck/China/NDV08-004/2010 strains (71.7%). For the
L gene, the MHK-1 strain had the highest nucleotide sequence
homology (99.1%) with NA-1 strains and the lowest with duck/
China/NDV08-004/2010 strains (74.9%). Moreover, the homolo-
gies among the NP/M/L genes were higher than those of the P/F/
HN genes.
Clinical symptoms observation. Fourteen-day-old SPF goslings
were inoculated with the third passage of the virus, and a control
group of two goslings was inoculated with saline solution. The
results showed that the goslings of the control group survived and
were healthy. The inoculated goslings all had clinical symptoms,
including depression, anorexia, dyspnea, producing white liquid
feces, and neuronal symptoms, such as torticollis, ruffled feathers
and one-leg paralysis, within 5 days and the morbidity incidence rate
was 100%.
Pathological dissection observation. The goslings were eutha-
nized when they had obvious signs of illness. Then the goslings were
dissected and pathologies were observed. It was found that there was
much mucus in the larynxes and tracheas of the infected goslings.
The trachea was hemorrhaged annularly. The brain and duodenum
exhibited severe bleeding (see Fig. 1A,B of the supplemental online
material, which is available on the Avian Diseases website). The
jejunum was swollen, and the liver had focal hemorrhaging with
partial swelling. However, there were no pathological anomalies in
the control group.
Paraffin section and HE staining. Paraffin sections from the
brain, liver, and duodenum of infected goslings, as well as the
control group, were stained with HE. All sections were observed by
light microscopy. The control group had normal brain tissue (see
Fig. 2A in the supplemental online material), whereas the infected
group had pathological cephaledema. Some neurons showed signs of
degeneration and necrosis (see Fig. 2B in the supplemental online
240 Chen et al.

Fig. 5. Phylogenetic tree of 35 NDV strains based on the complete genomic sequences.

materials). The control group had a normal liver (see Fig. 2C in the
supplemental online material). However, the natural hepatic
structure of the infected geese disappeared, and the hepatic cords
were disorganized and their boundary was blurry. Most of the liver
cells displayed degeneration and necrosis, and some of the liver cell
nuclei disappeared (see Fig. 2D in the supplemental online
material). The duodenums of the control group were normal (see
Fig. 2E in the supplemental online material), whereas the
duodenum villi of infected geese were sloughed and necrotic (see
Fig. 2F in the supplemental online material).
Observation of frozen tissue sections by indirect immunoflu-
orescence microscopy. The frozen sections of brain, liver, and
duodenum tissues from infected and control goslings were incubated
with Newcastle-positive blood serum and a FITC-conjugated
secondary antibody. The frozen sections were observed by the
indirect immunofluorescence method. A green fluorescence signal,
which denoted the presence of NDV, occurred and was detected in
the liver, but not in the brain or duodenum (see Fig. 3A,B in the
supplemental online material).
DISCUSSION
NDV occurs worldwide, and it has a considerable impact on the
poultry industry, as it causes significant economic loses (27).
However, NDV infection is not restricted to chickens, as it has been
demonstrated that there are at least 250 species of birds that are
susceptible to this virus (26). There is a large variety of fowls in
China, especially waterfowls and terrestrial birds in the southern
region. The circulation of different strains of NDV in this
environment was promoted by the mixing of species, which
established a natural cycling pool of NDV. The virulence of the
virus gradually increased during its circulation because of the
selective pressure of the hosts (5). Meanwhile, the virus continued to
 Isolation of a velogenic NDV strain from geese
Fig. 6. Phylogenetic tree constructed with 35 NDV strains based on the 1–389-bp region of the F gene.
spread to different hosts, which further enhanced its virulence,
eventually leading to outbreaks in poultry (30). Previous studies
found that geese are strongly resistant to disease, as the infected geese
did not show any illness and were merely vectors for the virus (3). In
1997, there was an outbreak of NDV in geese flocks in most parts of
southern China, and the morbidity and mortality can reach 100% in
goslings, although this varies with the route of infection (13). All
isolates from waterfowl (geese and ducks) from 1997 to 2005 were
virulent strains (18). This overturned the traditional view that geese
could only be infected, but not killed, by the virus. The
pathogenicity of this strain of NDV toward geese has grown
stronger as the virus evolves.
Presently, we isolated a NDV strain, named MHK-1, from geese
in the Meihekou area of Jilin province in China. In a previous
study, it was shown that NDV can replicate in chicken embryos
and chicken embryo fibroblasts (20). In this study, we used MHK-
1 to inoculate 9–11-day-old ECEs, and it was shown that MHK-1
could cause obvious pathological changes in chicken embryos. HA
241
and HI tests were performed with allantoic fluids from infected
chicken embryos, and the results demonstrated that the virus was an
NDV. Electron microscopic analysis of infected allantoic fluids
showed that the virion was circular, with a diameter of about
200 nm, and the surface of the virus exhibited an envelope and
spikes. All of these characteristics proved that MHK-1 is a typical
paramyxovirus. In addition, it was found that there were dense
particles scattered in the cytoplasm of the infected cells. The virions
produced a gemmiform protuberance that could be released from
the cell when mature virions formed near the cytoplasmic
membrane. The mature virions were circular or elliptic, and the
surface of the virus exhibited an envelope and spikes. It was shown
that the MHK-1 strain can proliferate in chicken embryo
fibroblasts and that the budding of virions occurred in the
membranes. All of these characteristics are consistent with those of
paramyxoviruses.
The pathogenicity index tests showed that the MDT of the
MHK-1 strain was 43 hr, the ICPI was 1.63, and the ELD50 was
242 Chen et al.
109/ml. The results showed that the isolate is a velogenic strain that
exhibits a rapid onset of symptoms.
To study the molecular characteristics of the MHK-1, we
designed 15 pairs of specific primers to amplify the whole genome
of the MHK-1 strain. After splicing the whole genomic sequence, it
was shown that the whole genomic sequence of MHK-1 is about
15,192 nt. A phylogenetic analysis of the whole-genome sequence of
MHK-1 and those of 34 other strains showed that the MHK-1 strain
belongs to the class II branch of NDVs. The results showed that the
homology among the whole genome sequence of the MHK-1 strain
and class II strains ranged from 83.4% to 99.4%, which was much
greater than for class I genes (71.9%–72.3%). It was shown that the
genes of class I and class II viruses had obvious differences, and all
genes of the MHK-1 and class I strains exhibited different degrees of
homology. From this perspective, the P/F/HN genes have
undergone more mutations during NDV evolution, whereas the
NP/M/L genes are relatively more conserved.
F-protein cleavage is an essential step for the entry of NDV into
the host cell (6). It mediates the fusion of the virion envelope with
the cellular plasma membrane (7); therefore, it is a major
determinant of virulence. The composition of amino acids in the
112–117 cleavage site determines the cleavage ability and affects the
virulence of the virus (32,37). Generally, a velogenic NDV has the
cleavage motif 112R/K-R-Q-R/K-R-F117, and lentogenic or asymp-
tomatic NDVs have the cleavage motif 112G-R/K-Q-C-R-L117 (25),
whereas the amino acid sequence of the MHK-1 strain is 112R-R-Q-
K-R-F117 at cleavage site. Thus, the results showed that the MHK-1
strain had typical molecular characteristics of velogenic NDVs.
The MHK-1 strain belongs to genotype VII, as shown by
comparing and analyzing the hypervariable region (1–389 bp) of the
F gene. The strain had high nucleotide sequence homology with
other NDVs from isolated from geese and ducks; the homology of
MHK-1 and the NDV NA-1 strain isolated from geese was as high
as 99.4%. The homology of MHK-1 and NDV ZJ-1 from goose was
as high as at 97.2%, and the homology of MHK-1 and the NDV
duck/China(Fujian)/FP1/02 strain isolated from ducks was as high
as 97.5%. Therefore, MHK-1 belongs to genotype VII. The results
showed that the NDVs of geese and ducks have a close genetic
relationship during the same epidemic period in parts of China. The
MHK-1 strain had the lowest homology with the duck/China/
Guangxi21/2010 strain (genotype II), 83.4%, and showed 83.5%
homology with the B1 strain (genotype II), which shows that the
sequences of the whole gene of NDVs were significantly different
between different genotypes. The homology of MHK-1 and the
LaSota strain, the specific vaccine strain used in China, was only
83.5%, and homology to the V4 strain (genotype I) was 85.4%,
which implies that there is a significant difference in the antigenicity
of the NDVs from geese and that of the LaSota strain. Previously, it
had been reported that some people used the LaSota vaccine strain
and a type I strain of NDV to prevent and control NDVs from
geese; however, the results showed that these vaccines did not
produce an ideal immune response in geese (12). Therefore, we
should choose a more strongly virulent strain that has excellent
immunogenicity as a candidate for engineering a vaccine to prevent
and control NDV effectively.
The pathogenicity of the MHK-1 strain was studied by artificially
infecting the young SPF goslings. To confirm that the MHK-1
strain isolated from geese had a pathogenic effect on goslings, the
assay was performed at the organ, tissue, and cellular level. At the
organ level, the infected goslings showed depression, anorexia, and
dyspnea; produced white liquid feces; and exhibited neuronal
symptoms, such as torticollis, ruffled feathers, and one-leg paralysis.
The pathological anatomic showed that the larynx and trachea of the
gosling had a great deal of mucus, along with an annular hemorrhage
in the trachea ring. The brain and duodenum also exhibited severe
hemorrhaging, the jejunum was swollen, and the liver had focal
hemorrhaging with local swelling. At the tissue level, the brain, liver,
and duodenum tissue exhibited histopathological changes in paraffin
sections. At the cellular level, the tissues from the infected goslings
showed that the MHK-1 strain was only detected in the liver, not in
the brain or duodenum. Because the goslings were infected rapidly,
they suffered a high mortality rate when infected with the MHK-1
strain. In conclusion, the MHK-1 strain had a pathogenic effect on
goslings, suggesting that the virus can multiply rapidly. The study
provides useful information regarding the prevention and control of
NDVs in waterfowl.
REFERENCES
1. Alexander, D. J. Newcastle disease and other avian paramyxoviruses.
Rev. Sci. Tech. 19:443–462. 2000.
2. Bhella, D., A. Ralph, and R. P. Yeo. Conformational flexibility in
recombinant measles virus nucleocapsids visualised by cryo-negative stain
electron microscopy and real-space helical reconstruction. J. Mol. Biol.
340:319–331. 2004.
3. Bolte, A. L., M. Voss, E. Vielitz, and E. F. Kaleta. Response of
domestic geese to lentogenic and velogenic strains of Newcastle disease virus.
Dtsch. Tierarztl. Wochenschr. 108:155–159. 2001.
4. Brandon, D. M., S. K. Nayak, and P. S. Binder. Lectin binding
patterns of the human cornea. Comparison of frozen and paraffin sections.
Cornea 7:257–266. 1988.
5. Cai, S., J. Li, M. T. Wong, P. Jiao, H. Fan, D. Liu, M. Liao, J. Jiang,
M. Shi, T. T. Lam, T. Ren, and F. C. Leung. Genetic characterization and
evolutionary analysis of 4 Newcastle disease virus isolate full genomes from
waterbirds in South China during 2003–2007. Vet. Microbiol. 152:46–54.
2011.
6. Chen, L., P. M. Colman, L. J. Cosgrove, M. C. Lawrence, L. J.
Lawrence, P. A. Tulloch, and J. J. Gorman. Cloning, expression, and
crystallization of the fusion protein of Newcastle disease virus. Virology
290:290–299. 2001.
7. Chen, L., J. J. Gorman, J. McKimm-Breschkin, L. J. Lawrence, P. A.
Tulloch, B. J. Smith, P. M. Colman, and M. C. Lawrence. The structure of
the fusion glycoprotein of Newcastle disease virus suggests a novel paradigm
for the molecular mechanism of membrane fusion. Structure 9:255–266.
2001.
8. Collins, M. S., S. Franklin, I. Strong, G. Meulemans, and D. J.
Alexander. Antigenic and phylogenetic studies on a variant Newcastle disease
virus using anti-fusion protein monoclonal antibodies and partial sequencing
of the fusion protein gene. Avian Pathol. 27:90–96. 1998.
9. Dai, Y., M. Liu, and W. Li. Protective efficacy of commercial
Newcastle disease vaccines against challenge of goose origin virulent
Newcastle disease virus in geese. Avian Dis. 52:467–471. 2008.
10. Fauquet, C. M., and D. Fargette. International Committee on
Taxonomy of Viruses and the 3,142 unassigned species. Virol. J. 2:64. 2005.
11. Glickman, R. L., R. J. Syddall, R. M. Iorio, J. P. Sheehan, and M. A.
Bratt. Quantitative basic residue requirements in the cleavage-activation site
of the fusion glycoprotein as a determinant of virulence for Newcastle disease
virus. J. Virol. 62:354–356. 1988.
12. Hu, S., H. Ma, Y. Wu, W. Liu, X. Wang, Y. Liu, and X. Liu. A
vaccine candidate of attenuated genotype VII Newcastle disease virus
generated by reverse genetics. Vaccine 27:904–910. 2009.
13. Jinding, C., L. Ming, R. Tao, and X. Chaoan. A goose-sourced
paramyxovirus isolated from southern China. Avian Dis. 49:170–173. 2005.
14. Kattenbelt, J. A., M. P. Stevens, and A. R. Gould. Sequence variation
in the Newcastle disease virus genome. Virus Res. 116:168–184. 2006.
15. Khalafalla, A. I., M. A. Fadol, O. A. Hameid, Y. A. Hussein, and M.
el Nur. Pathogenic properties of Newcastle disease virus isolates in the
Sudan. Acta Vet. Hung. 40:329–333. 1992.
 Isolation of a velogenic NDV strain from geese
16. Kim, S. H., S. Nayak, A. Paldurai, B. Nayak, A. Samuel, G. L.
Aplogan, K. A. Awoume, R. J. Webby, M. F. Ducatez, P. L. Collins, and S.
K. Samal. Complete genome sequence of a novel Newcastle disease virus
strain isolated from a chicken in West Africa. J. Virol. 86:11394–11395.
2012.
17. Lindh, E., C. Ek-Kommonen, V. M. Vaananen, J. Alasaari, A.
Vaheri, O. Vapalahti, and A. Huovilainen. Molecular epidemiology of
outbreak-associated and wild-waterfowl-derived newcastle disease virus
strains in Finland, including a novel class I genotype. J. Clin. Microbiol.
50:3664–3673. 2012.
18. Liu, H., Z. Wang, Y. Wu, Y. Wu, C. Sun, D. Zheng, T. Xu, and J.
Li. Molecular characterization and phylogenetic analysis of new Newcastle
disease virus isolates from the mainland of China. Res. Vet. Sci. 85:612–616.
2008.
19. Lomniczi, B., E. Wehmann, J. Herczeg, A. Ballagi-Pordany, E. F.
Kaleta, O. Werner, G. Meulemans, P. H. Jorgensen, A. P. Mante, A. L.
Gielkens, I. Capua, and J. Damoser. Newcastle disease outbreaks in recent
years in western Europe were caused by an old (VI) and a novel genotype
(VII). Arch. Virol. 143:49–64. 1998.
20. Losio, M. N., E. Lodetti, L. Alborali, G. Tosi, and C. Buonavoglia. A
study on the long-term immunity induced by La Sota strain of Newcastle
disease virus grown in a BS/BEK cell line of bovine embryo kidney origin.
Avian Pathol. 27:28–32. 1998.
21. Maminiaina, O. F., P. Gil, F. X. Briand, E. Albina, D. Keita, H. R.
Andriamanivo, V. Chevalier, R. Lancelot, D. Martinez, R. Rakotondravao,
J. J. Rajaonarison, M. Koko, A. A. Andriantsimahavandy, V. Jestin, and R.
Servan de Almeida. Newcastle disease virus in Madagascar: identification of
an original genotype possibly deriving from a died out ancestor of genotype
IV. PLoS One 5:e13987. 2010.
22. Mayo, M. A. A summary of taxonomic changes recently approved by
ICTV. Arch. Virol. 147:1655–1663. 2002.
23. Millar, N. S., P. Chambers, and P. T. Emmerson. Nucleotide
sequence of the fusion and haemagglutinin-neuraminidase glycoprotein
genes of Newcastle disease virus, strain Ulster: molecular basis for variations
in pathogenicity between strains. J. Gen. Virol. 69(Pt 3):613–620. 1988.
24. Miller, P. J., E. L. Decanini, and C. L. Afonso. Newcastle disease:
evolution of genotypes and the related diagnostic challenges. Infect. Genet.
Evol. 10:26–35. 2010.
25. Miller, P. J., L. M. Kim, H. S. Ip, and C. L. Afonso. Evolutionary
dynamics of Newcastle disease virus. Virology 391:64–72. 2009.
26. Miller, P. J., and M. K. Torchetti. Newcastle disease virus detection
and differentiation from avian influenza. Methods Mol. Biol. 1161:235–
239. 2014.
27. Moro de Sousa, R. L., H. J. Montassier, and A. A. Pinto. Detection
and quantification of antibodies to Newcastle disease virus in ostrich and
rhea sera using a liquid phase blocking enzyme-linked immunosorbent assay.
Clin. Diagn. Lab. Immunol. 7:940–944. 2000.
243
28. Peeters, B. P., O. S. de Leeuw, G. Koch, and A. L. Gielkens. Rescue
of Newcastle disease virus from cloned cDNA: evidence that cleavability
of the fusion protein is a major determinant for virulence. J Virol 73:
5001–5009. 1999.
29. Pizzi, M. Sampling variation of the fifty percent end-point,
determined by the Reed-Muench (Behrens) method. Hum. Biol.
22:151–190. 1950.
30. Qin, Z. M., L. T. Tan, H. Y. Xu, B. C. Ma, Y. L. Wang, X. Y. Yuan,
and W. J. Liu. Pathotypical characterization and molecular epidemiology of
Newcastle disease virus isolates from different hosts in China from 1996 to
2005. J. Clin. Microbiol. 46:601–611. 2008.
31. Romer-Oberdorfer, A., O. Werner, J. Veits, T. Mebatsion, and T. C.
Mettenleiter. Contribution of the length of the HN protein and the
sequence of the F protein cleavage site to Newcastle disease virus
pathogenicity. J. Gen. Virol. 84:3121–3129. 2003.
32. San Roman, K., E. Villar, and I. Munoz-Barroso. Mode of action of
two inhibitory peptides from heptad repeat domains of the fusion protein of
Newcastle disease virus. Int. J. Biochem. Cell. Biol. 34:1207–1220. 2002.
33. Smietanka, K., Z. Minta, M. Reichert, M. Olszewska, K. Wyrostek,
M. Jozwiak, and T. van den Berg. Experimental infection of juvenile
domestic and Canada geese with two different clades of H5N1 high
pathogenicity avian influenza virus. Vet. Microbiol. 163:235–241. 2013.
34. Snoeck, C. J., A. A. Owoade, E. Couacy-Hymann, B. R. Alkali, M. P.
Okwen, A. T. Adeyanju, G. F. Komoyo, E. Nakoune, A. Le Faou, and C. P.
Muller. High genetic diversity of Newcastle disease virus in poultry in West
and Central Africa: cocirculation of genotype XIV and newly defined
genotypes XVII and XVIII. J. Clin. Microbiol. 51:2250–2260. 2013.
35. Wan, H., L. Chen, L. Wu, and X. Liu. Newcastle disease in geese:
natural occurrence and experimental infection. Avian Pathol 33:216–221.
2004.
36. Wang, L., D. L. Suarez, M. Pantin-Jackwood, M. Mibayashi, A.
Garcia-Sastre, Y. M. Saif, and C. W. Lee. Characterization of influenza virus
variants with different sizes of the nonstructural (NS) genes and their
potential as a live influenza vaccine in poultry. Vaccine 26:3580–3586.
2008.
37. Yu, M., E. Wang, Y. Liu, D. Cao, N. Jin, C. W. Zhang, M. Bartlam,
Z. Rao, P. Tien, and G. F. Gao. Six-helix bundle assembly and
characterization of heptad repeat regions from the F protein of Newcastle
disease virus. J. Gen. Virol. 83:623–629. 2002.
38. Zou, J., S. Shan, N. Yao, and Z. Gong. Complete genome sequence
and biological characterizations of a novel goose paramyxovirus-SF02
isolated in China. Virus Genes 30:13–21. 2005.
ACKNOWLEDGMENT
This study was financially supported by the National Natural Science
Foundation of China (grant 31372413).