Struggling with the daunting task of writing a dissertation is a common plight among many students.

The journey from conceptualization to completion can be riddled with obstacles, making it one of the
most challenging academic endeavors one can undertake. For Sebastian Haesler, embarking on this
academic journey was no exception.

Crafting a dissertation demands not only a deep understanding of the subject matter but also an
immense amount of dedication, perseverance, and time. From conducting extensive research to
analyzing data and constructing coherent arguments, every step of the process requires meticulous
attention to detail and critical thinking.

For Sebastian Haesler, navigating through the complexities of his dissertation topic was a formidable
task. The pressure to produce original insights while adhering to academic standards can be
overwhelming, leaving many students feeling lost and overwhelmed.

In times of such academic turmoil, seeking professional assistance can be a wise decision. ⇒
HelpWriting.net ⇔ offers a lifeline for students like Sebastian Haesler, providing expert guidance
and support throughout the dissertation writing process. With a team of experienced writers and
researchers, ⇒ HelpWriting.net ⇔ ensures that each dissertation is meticulously crafted to meet
the unique needs and specifications of its clients.

By entrusting your dissertation to ⇒ HelpWriting.net ⇔, you can alleviate the stress and anxiety
that often accompanies this academic milestone. With their proven track record of delivering high-
quality, original content, you can rest assured that your dissertation is in capable hands.

Don't let the challenges of dissertation writing hold you back. Take the first step towards academic
success by reaching out to ⇒ HelpWriting.net ⇔ today.
He did his PhD at the Max Planck Institute for Molecular Genetics in Berlin, Germany and
postdoctoral work at the Center for Brain Science at Harvard University, with support from the
Human Frontiers Science Program. Pupils did not reverse the sequential order of syllables in the tutor
motifs, except for one control (unpublished data) and one FoxP2 knockdown pupil ( Figure 3 A). To
study the function of FoxP2 during song learning of zebra finches, we reduced the levels of FoxP2
expression bilaterally in Area X in vivo, using lentivirus-mediated RNAi. On PHD50, we punched
out Area X of injected birds and measured FoxP2 mRNA levels by real-time PCR. During a song
bout, a variable number of motifs are sung in short succession. Most participants were willing to
adopt passwordless authentication during our in-person user study, but closer analysis shows that
participants prioritize usability, security, and availability differently depending on the account type.
Three months after the event, we present an exemplifying analysis of the topics, used technologies
and remaining activity of these projects. For average syllable duration and mean entropy measures,
the difference was significant ( Figure 3 D). Harald Gall is probably best known for his work on
software evolution analysis and mining software archives which he has worked on since 1997. Taken
together, these data strongly suggest that insufficient levels of FoxP2 in Area X spiny neurons lead
to incomplete and inaccurate vocal imitation, implicating FoxP2 in postnatal brain function. FoxP1
protein levels were unaffected by overexpression of either shRNA. He graduated with M.Sc. at
EPFL and Bachelor at Huazhong University of Science and Technology. Typical features of FoxP2
knockdown pupils included syllable omissions ( Figure 2 B, syllables C, D, F, and G; Figure 2 C,
syllable B), imprecise copying of syllable duration ( Figure 2 B, syllable E longer; Figure 2 C, syllable
D shortened), and inaccurate imitation of spectral characteristics ( Figure 2 B, syllable E; Figure 2 C,
syllable D). Neither the similarity score nor the accuracy score correlated with the volume of Area X
targeted in the pupil. Boxes indicate the interquartile range (IQR) of the distribution; circles and
asterisks specify individual values lying beyond the inner (1.5 ? IQR) and outer fences (3. As
expected, this nontargeting shRNA did not affect expression of either FoxP2 or FoxP1 in vitro (
Figure 1 F). FoxP2 expression was quantified by real-time PCR using SybrGreen (Applied
Biosystems). In this paper, we analyzed these events in Germany in recent years and found out how
they can be detected, and what impact they have on citizens, especially in crisis situations. At the
same time, it may be understood as an impulse for crisis informatics to consider new forms of
volunteering in the course of crisis management. After the last song recording, brains were
histologically analyzed for correct targeting of virus to Area X. We found that due to the amount of
data and the inherent imprecision of the methods used, it is difficult to detect outages through
algorithmic examination. The aim of our lab is to gain a mechanistic understanding of the brain by
studying fundamental information processing problems, that are evolutionarily conserved and can be
readily studied in mice, the genetically most tractable mammal. Bailenson, Gerd Bruder, Greg Welch
(2018): Does a Digital Assistant Need a Body. Thus, the increased syllable variability is apparently
not causally related to the observed tutor imitation deficit. At Haesler lab, we specifically focus on
improving our understanding of the brain by developing new tools that allow us to better interact
with the central nervous system. The motif accuracy score measures the extent to which the pupil's
sounds are closer to the tutor than expected by chance. We created a Raspberry Pi based prototype
with a speaker, a display, and a connected smart light bulb. Do these Subject Areas make sense for
this article. His lab combines systems neuroscience research and collaborative neuroengineering to
reveal mechanistic principles of brain function and to derive new technologies which will ultimately
find their use in research and clinical applications. In contrast to control pupils, knockdown pupils did
not improve in accuracy after PHD80, suggesting they had reached the end of the learning phase (
Figure 5 A).
Dort ist er insbesondere im LOEWE-Zentrum emergenCITY tatig. Sebastian Hiller he resolved the
mechanisms of chaperones interacting with folded client proteins. Einstein Day serves as a gateway
for students from top-tier Chinese universities to learn about the benefits of studying in Switzerland.
To use as controls, we subcloned fragments encoding a hairpin targeting GFP (shGFP, target
sequence GCAAGCTGACCCTGAAGTTCA) and a nontargeting hairpin (shControl, sequence
AATTCTCCGAACGTGTCACGT) into the modified pFUGW. The segments from each bird were
subsequently compared to their respective tutor motif in a pairwise fashion yielding one accuracy
score for each sound segment. Thus, FoxP2 is not a gene essential for short-term survival of
postmitotic neurons. He has received several awards for both his research and his teaching and has
published 4 monographs and more than 160 research papers. Acoustic structure is also stable across
syllable renditions. The similarity score was significantly lower in FoxP2 knockdown than in control
animals ( Figure 2 D). His research interests focus on the development, analysis, and application of
high-order accurate methods for the solution of complex time-dependent problems, often requiring
high-performance computing. Normalized Ct values from the same animal were calibrated to the
shControl-injected hemisphere. Here, we reduced FoxP2 levels in Area X before zebra finches
started to learn their song, using virus-mediated RNA interference for the first time in songbird
brains. In order to minimize potential cross-reactivity of the hairpins, we chose target sequences that
contained at least six dissimilar bases with FoxP1, the closest homolog of FoxP2. Specifically, we
focus on a simple computation, the ability to discriminate novel from familiar sensory stimuli. In
addition, in four out of seven knockdown pupils, the motif contained repetitions of individual
syllables or syllable pairs (e.g., see Figure 2 B and 2 C). The accuracy score is computed locally,
across short (9 ms) FFT windows and indicates how well the sound matched to the sound in the
tutor song. Moreover, we used immunohistological staining with antibody Hu (1:200; Chemicon) to
stain neurons and quantify the percentage of them infected by virus. This difference resulted from an
increase of variance with age in shFoxP2-injected birds ( Figure 5 B). Reflecting on the traditional
division of labor in crisis volunteering and counter-productive dynamics of care and empathy, we aim
for feminist ethics of care which allows for interactions on social media that foster generative
computer-supported collaboration. For the quantification of protein levels after FoxP2 knockdown,
we performed an immunohistological staining with the FoxP2 antibody on 50-?m sections 30 d after
virus injection. It will be interesting to test, whether “dyspraxic song” is also perceived as different
by other finches and interferes with communication, as DVD does in humans. To study the function
of FoxP2 during song learning of zebra finches, we reduced the levels of FoxP2 expression
bilaterally in Area X in vivo, using lentivirus-mediated RNAi. All sections were processed at the
same time with the same batch of antibody solution. Instead, the FFT windows are compared
sequentially from beginning to the end of the two sounds. Shedding light on this instance of citizen
science allows to highlight the potential of hackathons and startup culture regarding socio-
technological resilience. Alternatively, if FoxP2 restricts neuronal plasticity, knockdown pupils
should sing more variable song. Recent Publications Stay up-to-date with our latest research. CR
performed analysis of long-term changes in neuronal viability after knockdown. Shedding light on
this instance of citizen science allows to highlight the potential of hackathons and startup culture
regarding socio-technological resilience. The comparison of sonograms from shControl-injected (
Figure 2 A) and shFoxP2-injected pupils ( Figure 2 B and 2 C) with their respective tutors shows the
characteristic effects caused by reduction of FoxP2.
In addition to the experimental work on novelty circuits, we engage in method development, with a
particular emphasis on novel brain interfaces. Two vertical lines mark the beginning and the end of
the longest rendition of each syllable to visualize variability of syllable duration (particularly evident
in syllables II and IV). The apoptotic cell (white arrow) contains fragmented DNA typical of
apoptosis. Based on this entropy measure, we generated a sequence consistency score (1. Inaccurate
vocal imitation was already evident early during song ontogeny and persisted into adulthood. In this
Zoom webinar, you can will hear from vice presidents, provosts, deans and accomplished alumni of
five top Swiss universities to get first-hand information about study programs and university choices
in the country in the heart of Europe. Songbirds are a useful model to address this because, like
human youngsters, they learn to vocalize by imitating the sounds of their elders. In 2017, Xueying
made several business trips to China together with the founders’ team to get a first-hand feeling
about the Chinese market and to find potential business opportunities. We define “syllable” as a
continuous sound element, surrounded by silent intervals. In this paper, we analyzed these events in
Germany in recent years and found out how they can be detected, and what impact they have on
citizens, especially in crisis situations. After the last song recording, brains were histologically
analyzed for correct targeting of virus to Area X. For manual counting of imitated syllable types, two
individuals who were blind to treatment counted all syllables that matched a tutor syllable by visual
inspection of sonograms. Their interobserver reliability was 80%. Albeit some misdirected offers and
regressive interruptions, people use the possibility to make their voices heard and, showing empathy,
help each other to cope with crisis. He also continues to write on lyrical poetry, especially on Rainer
Maria Rilke and Paul Celan. We focused on aims, activities, and technological mediation, with
Activity Theory astheoretical framework. That is, each syllable of a motif was given a unique
integer. By PHD20, fathers and older male siblings were removed from family cages to prevent
experimental zebra finches from instructive auditory experience prior to the onset of tutoring.
Together with a focus group, we developed a taxonomy for warning messages in smart home
environments, dividing them into five classes with different stimuli. Thus, similarity reflects how
many sound intervals were above p -value, and accuracy indicates the average (1 ? p -value). The
comparison of the distribution of these features across the repertoire of knockdown and control
pupils did not reveal any significant differences, indicating that knockdown pupils, control pupils,
and tutors sang syllables with similar acoustic features ( Figure S5 ). TUNEL-positive cells were
counted using a fluorescence microscope. FoxP2 might mediate adaptive structural and functional
changes of the spiny neurons while the song is learned. Recent Publications Stay up-to-date with our
latest research. Finally, we quantified fluorescence intensity levels in the images. At the same time, it
may be understood as an impulse for crisis informatics to consider new forms of volunteering in the
course of crisis management. Inaccurate imitation is particularly evident in the second element of
syllable A and the first element of syllable B. Similarity and accuracy scores did not differ
significantly between shGFP-injected and shControl-injected animals, ruling out that RISC
activation contributed to the effects of shFoxP2 on song imitation ( Figures 2 D and 3 B). In
addition, we also manually counted the number of user-defined syllables copied from the tutors,
confirming that knockdown animals imitated fewer syllables ( Figure S6 ). Whereas the variance was
similar between the two experimental groups at PHD65 and at PHD80, it was significantly higher in
knockdown pupils compared to controls at PHD90 ( Figure 5 B). The frequency distribution of
accuracy values also suggests that imprecise syllable imitation was not skewed towards particular
syllables or syllable types ( Figure S9 ).
All viral constructs expressed GFP under control of the human ubiquitin C promoter. Figure 3 A
illustrates the inaccurate syllable imitation (syllables A and B) in a knockdown pupil that learned
from the same tutor as the shControl-injected pupil shown. These sounds were found to represent
cage noise, mostly. Moreover, we employ viral circuit tracing to delineate novelty circuits with cell
type specific resolution. FoxP2 knockdown also did not cause apoptotic cell death in Area X, and it
did not alter the density of neurons in this nucleus. Genetic aberrations of the human FoxP2 gene
impair speech production and comprehension, yet the relative contributions of FoxP2 to brain
development and function are unknown. An entropy score of 0 indicates random syllable order,
whereas a score of 1 reflects a fixed syllable order. Normalized Ct values from the same animal were
calibrated to the shControl-injected hemisphere. To quantify how well the syllables of a motif were
imitated on average, we obtained motif accuracy scores in SAP from pairwise motif comparisons
between pupil and tutor. In zebra finch Area X, a basal ganglia structure necessary for song learning,
FoxP2 expression increases during the time when song learning occurs. Two vertical lines mark the
beginning and the end of the longest rendition of each syllable to visualize variability of syllable
duration (particularly evident in syllables II and IV). Using lentivirus-mediated RNAi for the first
time in the songbird brain, we reduced FoxP2 mRNA and protein levels in Area X with either of two
different knockdown constructs. He returned to UNIGE in 2003 as Secretary General, a position he
held through October 2018 and then he has been named Vice-Rector as of 1 November 2018 Geneva
in charge of International and Inter-institutional Relations. Schweizerische Eidgenossenschaft
Confederation suisse Confederazione Svizzera Confederaziun svizra Swiss Confederation Federal
Department of Economic Affairs, Education and Research EAER State Secretariat for Education,
Research and Innovation SERI. Consistent with this, FoxP2 knockdown pupils showed different
song abnormalities than birds with electrolytic lesions in Area X. Besides, she is also a certified
auto-racing referee since 2017. After carrying out postdoctoral studies in the Plant Biochemistry
Institute in Halle (Germany), in the Earth Science Departments Memorial University Newfoundland
(Canada) and ETH Zurich, he became Assistant Professor at the Department of Chemistry at ETH
Zurich and became Full Professor in 2008 in the Department of Chemistry and Applied Sciences. We
found that knockdown pupils imitated their tutors less accurately than control pupils already at
PHD65 ( Figure 5 A). We provide a resilience conceptwith requirements derived from an
interdisciplinary view enablingcitizens to communicate and collaborate in everyday life and
duringcrisis events. Shedding light on this instance of citizen science allows to highlight the potential
of hackathons and startup culture regarding socio-technological resilience. After the last song
recording, brains were histologically analyzed for correct targeting of virus to Area X. The limited
imitation success of FoxP2 knockdown pupils could also result from an imprecise neural
representation of the tutor model. For this purpose, we take a look at two different approaches to
recording internet outages, namely the self-reporting of citizens and automatic reporting by
algorithmic examination of the availability of IP networks. Syllable omissions of FoxP2 knockdowns
are consistent with this notion, but more variable syllable production is clearly not. Recent
Publications Stay up-to-date with our latest research. But once an event is publicly known by self-
reporting, they have advantages to capture the temporal and spatial dimensions of the outage due to
its nature of objective measurements. Boxes indicate the interquartile range (IQR) of the distribution;
circles and asterisks specify individual values lying beyond the inner (1.5 ? IQR) and outer fences (3.
To this end, we analyzed the behavioral consequence of an experimental reduction of FoxP2 during
song development. In 2018, he was appointed professor at the Wuhan Institute of Physics and
Mathematics of the Chinese Academy of Sciences. However, it is still possible that FoxP2
knockdown affected the motor control of singing.
Although many IoT sensors, such as smoke detectors or security cameras, are available and
governmental crisis warning systems are in place, little is known about how to warn appropriately in
smart home environments. That is, in each comparison, SAP identifies the best possible match to the
tutor motif for each segment. Unfortunately, these apps are not designed to beresilient and fail with
communication infrastructure outages whenservers are no longer available. Knockdown of FoxP2
resulted in an incomplete and inaccurate imitation of tutor song. Together with a focus group, we
developed a taxonomy for warning messages in smart home environments, dividing them into five
classes with different stimuli. Based on these data, we computed the Markov chain for each pupil,
i.e., all transition probabilities between syllables. To comprehensively capture the acoustic similarity
between syllables in a single measure we used the product of similarity and accuracy to obtain the
syllable identity score. We found that knockdown pupils could in principle imitate adjacent tutor
syllables in the same order (e.g., Figure 2 B, syllables A and B, and H and I; Figure 2 C, syllables C
and D). Syntax refers to the sequence of syllables in many successive motifs. Imprecisely copied
pupil syllables are designated with red italic letters. Establishing Lentivirus-Mediated Knockdown of
FoxP2 in Zebra Finch Area X (A) Phase contrast image of a sagittal 50-?m brain section from a male
zebra finch. The limited imitation success of FoxP2 knockdown pupils could also result from an
imprecise neural representation of the tutor model. DNA double-strand breaks characteristic of
apoptotic cells were detected using the TUNEL method, visualized with an Alexa568 secondary
antibody (red). The apoptotic cell (white arrow) contains fragmented DNA typical of apoptosis.
Normalized Ct values from the same animal were calibrated to the shControl-injected hemisphere.
The thresholds were adjusted for each pupil individually to obtain an optimal segmentation. The
accuracy score is computed locally, across short (9 ms) FFT windows and indicates how well the
sound matched to the sound in the tutor song. To increase signal intensity, we stained the sections by
fluorescent immunohistochemistry with an anti-FITC antibody, followed by incubation with an
Alexa568-conjugated secondary antibody. Since FoxP2 is a transcription factor, it could act by
positively or negatively regulating plasticity-related genes. As expected, shControl-injected pupils,
shGFP-injected pupils, and tutors performed their syllables with equal stability ( Figure 4 C). On
PHD50, we punched out Area X of injected birds and measured FoxP2 mRNA levels by real-time
PCR. While this has historically been an analog process,people now use collaboration or messenger
apps to support theirself-organization. Neither the similarity score nor the accuracy score correlated
with the volume of Area X targeted in the pupil. We recorded the song of pupils on PHD65, PHD80,
and between PHD90 and 93 using an automated recording system, in absence of the tutor. Besides,
she is also a certified auto-racing referee since 2017. Three months after the event, we present an
exemplifying analysis of the topics, used technologies and remaining activity of these projects. An
entropy score of 0 indicates random syllable order, whereas a score of 1 reflects a fixed syllable
order. The Influence of Visual Embodiment and Social Behavior on the Perception of Intelligent
Virtual Agents in AR, IEEE International Symposium on Mixed and Augmented Reality. This
difference resulted from an increase of variance with age in shFoxP2-injected birds ( Figure 5 B).
Therefore, the integration of pallial and dopaminergic signals provides a candidate mechanism for
tuning the motor output to the tutor model during learning.
In this Zoom webinar, you can will hear from vice presidents, provosts, deans and accomplished
alumni of five top Swiss universities to get first-hand information about study programs and
university choices in the country in the heart of Europe. The fact that FoxP2 knockdown pupils
produced syllables more variably than controls at PHD90 would be consistent with this. We provide
a resilience conceptwith requirements derived from an interdisciplinary view enablingcitizens to
communicate and collaborate in everyday life and duringcrisis events. Furthermore, he is professor
of Software Engineering in the Department of Informatics at UZH. Area X is outlined by white
arrows (scale bar indicates 1 mm). We quantified the acoustic similarity between different syllables
using symmetric comparisons to obtain syllable identity scores. Most participants were willing to
adopt passwordless authentication during our in-person user study, but closer analysis shows that
participants prioritize usability, security, and availability differently depending on the account type.
All sections were processed at the same time with the same batch of antibody solution. Both
scenarios would result in low sequence stereotypy, which we did not find ( Figure S8 ). Instead, the
FFT windows are compared sequentially from beginning to the end of the two sounds. All antibody
incubations were performed simultaneously, and pictures were taken with identical camera settings.
For this purpose, we take a look at two different approaches to recording internet outages, namely
the self-reporting of citizens and automatic reporting by algorithmic examination of the availability
of IP networks. In addition to the experimental work on novelty circuits, we engage in method
development, with a particular emphasis on novel brain interfaces. During the seasonal phase of
vocal plasticity in canaries, increased FoxP2 expression in the fall months might similarly be
involved in seasonal song modifications. The outcome of song learning was affected by virus
infection in approximately 20% of the volume of Area X. But once an event is publicly known by
self-reporting, they have advantages to capture the temporal and spatial dimensions of the outage
due to its nature of objective measurements. We then summed the values from all sections for both
areas separately and calculated the ratio of GFP-positive area to total Area X, which is equivalent to
the ratio of GFP-positive volume to total Area X volume. DNA double-strand breaks characteristic
of apoptotic cells were detected using the TUNEL method, visualized with an Alexa568 secondary
antibody (red). Since knockdown pupils sing as variable as control pupils early during song
development and even more variable as adults ( Figures 4 and 5 B), we favor the hypothesis that
knockdown pupils were impaired in adjusting their motor output according to the memorized tutor
model in the course of song learning. This difference resulted from an increase of variance with age
in shFoxP2-injected birds ( Figure 5 B). The filled white arrow points to a TUNEL-labeled cell not
infected by shFoxP2-f. Reflecting on the traditional division of labor in crisis volunteering and
counter-productive dynamics of care and empathy, we aim for feminist ethics of care which allows
for interactions on social media that foster generative computer-supported collaboration. How did
literature and science imagine and construct this elusive phenomenon. Differences in Song
Development of FoxP2 Knockdown and Control Pupils (A) We measured the accuracy of syllable
imitation in song recordings of the same pupils made at three different ages (PHD65, PHD80, and
PHD90), using the automated batch procedure in Sound Analysis Pro. Our findings provide the first
example of a functional gene analysis in songbirds and suggest that normal auditory-guided vocal
motor learning requires FoxP2. Social media like Facebook mediate societal structures, including
relationships of care, offering a space for continuous, cumulatively resilient conduct of care work.
This effect was already evident during vocal practice in young birds. Specifically, we focus on a
simple computation, the ability to discriminate novel from familiar sensory stimuli. FoxP2 mRNA
was reduced on average by approximately 70% in the shFoxP2-infected region of Area X compared
to the shControl-infected region of Area X ( Figure 1 I). In view of this model, FoxP2 knockdown
pupils might have either experienced a limitation in generating enough sound variability or
difficulties with reinforcing the “right” motor patterns, a possibility that includes both difficulties in
detecting similarity to the target or adjusting song appropriately.
Bailenson, Gerd Bruder, Greg Welch (2018): Does a Digital Assistant Need a Body. The apoptotic
cell (white arrow) contains fragmented DNA typical of apoptosis. Proteins are in roman type, genes
and RNA in italics. Through the State Secretariat for Education, Research and Innovation, he was
responsible for representing Switzerland at numerous international research institutions such as the
European Space Agency (ESA), the European Southern Observatory (ESO), and Euratom. Together
with a focus group, we developed a taxonomy for warning messages in smart home environments,
dividing them into five classes with different stimuli. By PHD20, fathers and older male siblings
were removed from family cages to prevent experimental zebra finches from instructive auditory
experience prior to the onset of tutoring. The identification of the downstream target genes of FoxP2
and the electrophysiological characterization of spiny neurons with reduced FoxP2 levels will shed
light on the mechanisms by which FoxP2 affects the outcome of vocal learning. Instead, the FFT
windows are compared sequentially from beginning to the end of the two sounds. The outcome of
song learning was affected by virus infection in approximately 20% of the volume of Area X. There
was no difference between knockdown and control animals in the total number of TUNEL-positive
cells. Here, in particular, in the usability and resilience (e.g., independence from ICT infrastructure)
of solutions to improve crisis resilience before a crisis, but also the management of a crisis. Acoustic
structure is also stable across syllable renditions. This is an open-access article distributed under the
terms of the Creative Commons Attribution License, which permits unrestricted use, distribution,
and reproduction in any medium, provided the original author and source are credited. The identity
of pupil syllables was determined by similarity comparison to tutor syllables using SAP software.
Harris, Albert K. Lee, Edvard I. Moser, John O\textquoterightKeefe, Alfonso Renart, Karel Svoboda,
Michael Hausser, Sebastian Haesler, Matteo Carandini, Timothy D. Harris. Thus, similarity reflects
how many sound intervals were above p -value, and accuracy indicates the average (1 ? p -value). Of
note, both shFoxP2 hairpins (shFoxP2-f and shFoxP2-h) affected motif similarity and motif accuracy
scores to a similar degree ( Figure S7 ), which is consistent with their comparable efficiency in
reducing FoxP2 mRNA in vitro ( Figure 1 F). For this purpose, we take a look at two different
approaches to recording internet outages, namely the self-reporting of citizens and automatic
reporting by algorithmic examination of the availability of IP networks. In this paper, we analyzed
these events in Germany in recent years and found out how they can be detected, and what impact
they have on citizens, especially in crisis situations. We validated the segmentation for each pupil by
visual inspection of the segments and confirmed that segments correspond to syllables. The results
show that taxonomy-based warning stimuli are perceived to be appropriate and participants could
imagine using such a warning system. Since syllables are not yet rendered in a stereotyped motif
structure at PHD65, we quantified song imitation success and vocal variability on the level of the
syllables only. He was also volunteering in refugee aid in Wurzburg. DNA double-strand breaks
characteristic of apoptotic cells were detected using the TUNEL method, visualized with an
Alexa568 secondary antibody (red). The frequency distribution of accuracy values also suggests that
imprecise syllable imitation was not skewed towards particular syllables or syllable types ( Figure S9
). Because motif duration differed between birds, these entropy values were rescaled by the maximal
possible entropy for each given motif duration. An entropy score of 0 indicates random syllable
order, whereas a score of 1 reflects a fixed syllable order. Social media like Facebook mediate
societal structures, including relationships of care, offering a space for continuous, cumulatively
resilient conduct of care work. As a result, we propose that users’ crowdsourcing can enhance the
detection of outages and should be seen as an important starting point to even begin an analysis with
algorithm-based techniques, but it is to ISPs and regulatory authorities to support that. Importantly
though, this increased variability of syllable rendition in FoxP2 knockdown pupils was not yet
evident at PHD65, when tutor imitation was already less proficient ( Figure 5 B).