Received: 27 July 2018 | Revised: 29 September 2018 | Accepted: 11 October 2018

DOI: 10.1111/jfbc.12715

FULL ARTICLE

Study on the ability of partially hydrolyzed guar gum to

modulate the gut microbiota and relieve constipation

Xiaodan Fu1* | Rong Li2* | Tan Zhang1 | Meng Li1 | Haijin Mou1

1
College of Food Science and
Engineering, Ocean University of China, Abstract
Qingdao, China The aim of this study was to evaluate the effects of high‐ (HHGG, Mw 10,000–
2
Qingdao Women and Children Hospital,
30,000 Da) and medium‐molecular‐weight (MHGG, Mw 2,000–10,000 Da) partially
Qingdao, China
hydrolyzed guar gum (PHGG) on modulation of gut microbiota and relief of constipa‐
Correspondence
tion in mice. Mice were treated with galacto‐oligosaccharide (GOS) and xylo‐oligo‐
Haijin Mou, College of Food Science and
Engineering, Ocean University of China, saccharide (XOS) at a dose of 1 g/kg bw as positive controls. Low‐ and high‐dose
No. 5 Yushan Road, Qingdao 266003,
HHGG and MHGG groups received 250 mg or 1 g/kg bw, respectively. Treatment
Shandong, China.
Email: mousun@ouc.edu.cn was administered intragastrically for 15 days, and constipation model was induced by
loperamide lavage at d 16. PHGG could increase fecal moisture and small intestinal
Funding information
Key Research and Development Project transit and shortened the time to first black stool defecation after constipation. The
Foundation of Shandong Province, Grant/
highest short‐chain fatty acid production was observed in the high‐dose MHGG
Award Number: 2017YYSP003; Shandong
Natural Science Fund, Grant/Award group. Additionally, PHGG, GOS, and XOS predominantly promoted the accumula‐
Number: ZR2017MD006; Research and
tion of Bacteroidetes and inhibited the growth of Desulfovibrio. This study suggested
Development, Grant/Award Number:
2017YYSP003 and ZR2017MD006; that MHGG treatment could elicit constipation relief in mice.
Shandong Province
Practical applications
In this study, partially hydrolyzed guar gum (PHGG) produced by mannanase hydroly‐
sis was applied for the relieving constipation in mice. The medium‐molecular‐weight
product (Mw 2,000–10,000 Da) could elicit constipation relief and modulate the gut
microbiota in mice, which shows the potential to act as dietary fiber for constipation
treatment.

KEYWORDS
16S rRNA analysis, constipation relief, gut microbiota, partially hydrolyzed guar gum (PHGG),
short‐chain fatty acids

1 | I NTRO D U C TI O N commonly regarded as a metabolic “organ,” which affects the host’s

Abundant microbial communities inhabit the mammalian gastroin‐
testinal tract, especially the rumen and large intestine, where bacte‐
rial density can exceed 10 11
per gram (Flint, Bayer, Rincon, Lamed, &
White, 2008). Their symbiotic and mutualistic relationship with the
host establishes a complex and dynamic ecosystem, which plays a
central role in host health (Zhao et al., 2013). This vast community is
*
These authors contributed equally to this work
metabolism, physiology, nutrition, and immune function (Tropini,
Earle, Huang, & Sonnenburg, 2017). Indeed, the gut microbiota has
been reported to be closely related to pathological intestinal condi‐
tions such as malnutrition (Kau, Ahern, Griffin, Goodman, & Gordon,
2011), obesity (Zhang et al., 2009), and chronic inflammatory dis‐
eases such as inflammatory bowel disease (IBD) (Frank et al.., 2007).
Chronic constipation is a common functional gastrointestinal dis‐
order characterized by prolonged gastrointestinal emptying times,

J Food Biochem. 2018;e12715. wileyonlinelibrary.com/journal/jfbc © 2018 Wiley Periodicals, Inc. | 1 of 14

https://doi.org/10.1111/jfbc.12715
2 of 14 | FU et al.
difficult or low frequency defecation, and dry, hard feces (Zhao &
Yu, 2016). In recent years, with changes in diet structure and the
influence of psychological and social factors, a clear upward trend
has been observed for the incidence of constipation, which seri‐
ously affects patients of all ages and gender and affects their health
and quality of life (Bharucha, 2007; Khalif, Quigley, Konovitch, &
Maximova, 2005). The etiology and pathophysiology of chronic con‐
stipation is complicated and remains poorly understood, however, a
growing number of studies have revealed the potential constipation
relief effect of modulation of the intestinal microbiota (Li, Lu, & Yang,
2013).
Furthermore, the treatment of chronic constipation remains a
challenge, and possible microbiota‐based therapy has attracted con‐
siderable interest recently. Dietary fiber has been recommended as
a basic treatment for chronic constipation, which can promote the
excretion of intestinal mucin (Derrien et al., 2010), increase stool
bulk and promote colonic transit (López Román et al., 2008), stimu‐
late the growth of intestinal microbiota, and promote the accumula‐
tion of bacterial fermentation products (Jennings, Davies, Costarelli,
& Dettmar, 2009). Moreover, specific non‐digestible carbohydrates
are increasingly used as prebiotics to manipulate the gut microbiota
which may have beneficial effects on host health (Kruse, Kleessen, &
Blaut, 1999). Among them, galacto‐oligosaccharides (GOS) and xylo‐
oligosaccharide (XOS) have been reported to have potential benefi‐
cial effects on constipation and promote intestinal transit (Li et al.,
2013; Li, Zong, Qi, & Liu, 2011).
Guar gum is a seed galactomannan obtained from the endosperm
portion of the guar plant Cyamopsis tetragonolobus, a member of the
Leguminosae family. It mainly consists of high molecular weight ga‐
lactomannans with β‐D‐1,4‐linked mannose units as linear chains
and α‐D‐1,6‐linked galactose units as side chains (Mudgil, Barak, &
Khatkar, 2014). Guar gum is commonly used as food additive because
of its thickening and viscosity control properties (Morris, 2010).
However, an aqueous solution of guar gum is extremely viscous even
at low concentrations, which limits its incorporation at higher levels
into food products without affecting the food’s nutritional or tex‐
tural properties (Srivastava & Kapoor, 2005). Hence, partially hydro‐
lyzed guar gum (PHGG) that has a smaller molecular weight and lower
viscosity with resemblance to the basic chemical structure of native
guar gum, has potential applications in food nutrition as a fiber sup‐
plement (Mudgil et al., 2014; Slavin & Greenberg, 2003).
PHGG is generally recognized as safe and has been reported to
reduce symptoms of IBS (Niv et al., 2016), improve glycemic con‐
trol (Goulder, Alberti, & Jenkins, 1978), and relieve diarrhea (Spapen
et al., 2001). Moreover, PHGG has also been studied in constipated
subjects, and has been shown to reduce the fecal pH and increase
defecation frequency and fecal moisture (Hidehisa et al., 1994).
However, these studies focused on a PHGG mixture with an average
molecular weight of 20,000 Da. The beneficial effects of lower mo‐
lecular weight (Mw 2,000–10,000 Da) guar gum on the modulation
of constipation have not been reported.
Therefore, we prepared PHGG with different molecular weights
using ultrafiltration after enzymatic hydrolysis. The enhancement
of intestinal function as a result of PHGG treatment was assessed
based on SCFA production, fecal moisture, and variation of the fecal
microbiota after intragastric administration. Additionally, the effect
of PHGG on the promotion of gut transit was evaluated in mice after
inducing constipation by loperamide administration.
2 | M ATE R I A L S A N D M E TH O DS
2.1 | Materials
β‐mannanase (50,000 U/g) was provided by Genyuan
Biotechnology Co., Ltd. (Qingdao, Shandong. China). Food grade
guar gum (mannose/galactose (M/G) ratio = 1.68, galactomannan
≥90%, w/w) was provided by Q ingzhou Ronmer Biology Technology
Co., Ltd. (Qingzhou, Shandong, China). XOS, a commercial prod‐
uct, are mixtures of oligosaccharides formed by 2–7 xylose resi‐
dues linked through β‐(1→4)‐linkages (Mw 300–1,000 Da), with
a purity of over 95%, was purchased from Shandong Longlive
Bio‐Technology Corp. Ltd (Shandong, China). GOS, a commercial
preparation of lactose, comprised of DP 2–8 galactose units linked
through β‐(1→4)‐linkages (Mw 300–1,500 Da), with a purity over
95%, was provided by New Francisco Biotechnology Corp. Ltd
(Guangdong, China). The drug loperamide hydrochloride (2 mg per
capsule) was purchased from Xian Janssen Pharmaceutical Ltd.
(Xi’an, Shanxi, China). Gum acacia and charcoal were purchased
from Sigma (USA). High‐purity SCFA standards, including acetate,
propionate, butyrate, iso‐butyrate, valerate, iso‐valerate, and 4‐
methylvaleric acid were purchased from Sigma Aldrich Chemical.
All other chemicals and reagents used in this study were of ana‐
lytical grade.
2.2 | Preparation of PHGG
PHGG with different molecular weights were obtained using ul‐
trafiltration after enzymatic hydrolysis by commercial acidic β‐
mannanase (Genyuan Biotechnology Co., Ltd., Qingdao, China).
Briefly, a solution of guar gum (100 g/L) at pH = 2.5 was added
to acidic β‐mannanase (0.4 g/L) and incubated at 55°C for 12 hr.
The reaction was terminated by heating the solution at 90°C for
10 min. The hydrolysates were centrifuged at 10,000 × g for
15 min to separate out the non‐hydrolyzed parts. Spiral wound
PES membranes with MWCO 30,000 Da (PW8040F30, General
Electric Company, the USA) and PVDF hollow fiber membranes
with MWCO 10,000 Da (Zhongshan Lonkee Memerane Industry
Co. Ltd, Guangdong, China) were used to intercept the larger frag‐
ments with molecular weights between 10,000–30,000 Da from
the supernatants. Then, the filtrate passed through spiral wound
PES membranes with MWCO 2,000 Da (Microdyn‐Nadir GmbH,
Germany) to intercept the fragments with molecular weights be‐
tween 2,000–10,000 Da. Subsequently, the hydrolyzed guar gum
of medium‐molecular‐weight (MHGG, Mw 2,000–10,000 Da) and
high‐molecular‐weight (HHGG, Mw 10,000–30,000 Da) were ob‐
tained after freeze‐drying.
FU et al.
2.3 | Monosaccharide composition of PHGG
PHGG was hydrolyzed using 2 mol/L trifluoroacetic acid (TFA) at
110°C for 4 hr. The sample derivatization and further HPLC analy‐
sis procedures applied in this study were determined according to
method reported by Bai et al. (2015). The derived samples were ana‐
lyzed with an Agilent 1200 Infinity HPLC system equipped with an
Agilent Eclipse XDB‐C18 column (5 µm, 250 mm × 4.6 mm i.d.). The
mobile phase consisted of 83% A and 17% B. Eluent A was a phos‐
phate buffer containing 0.05 mol/L KH2PO 4 (pH = 6.9), and eluent B
was an acetonitrile of chromatographic grade. The temperature of
the column was 25°C and the flow rate was 0.8 ml/min. Calibration
was obtained with a series of standard sugar solutions, including
D‐mannose, D‐glucose, D‐xylose (Sinopharm Chemical Reagent
Co., Ltd, Shanghai, China), and L‐arabinose and D‐galactose (Beijing
Solarbio Science & Technology Co., Ltd., China).
2.4 | Animals and experimental diets
Four‐week‐old male Kunming mice (SPF strain) were purchased from
Jinan Peng Yue experimental animal breeding Co., Ltd. (Jinan, China,
SCXK: 20140007). They were housed in a standard polycarbonate
cages in an air‐conditioned room (temperature 21°C–22°C, relative
humidity 55%–65%) under a 12 hr (06:00–18:00) light cycle with
free access to food and water. All the mice were fed normal chow
which was purchased from Sebiona Biological Technology Co. Ltd.
(Guangzhou, China). According to the manufacturer, the main nutri‐
tional composition of the feed was recorded as the following: crude
protein (14.5%), crude lipid (4.00%), crude fiber (4.5%), crude ash
(4.7%), calcium (0.72%), and phosphorous (0.60%).
2.5 | Experimental design
After the acclimatization for 7 d, 96 mice were weighed and divided
into 8 groups of 12 with approximately equal total body weight
(300.14–308.01 g). The normal and constipation control groups
were treated only with saline via gavage once per day for 15 con‐
secutive days. The test groups were divided into four groups, in‐
cluding HHGG and MHGG, each of sample covering two doses. The
high‐ and low‐dose HHGG (HHGG‐H/‐L) and MHGG (MHGG‐H/‐L)
groups received 250 mg/kg body weight (bw) or 1 g/kg bw once per
day for 15 consecutive days, respectively. An additional two positive
control groups were treated with 1 g/kg bw XOS and GOS via gav‐
age once per day for 15 consecutive days. All materials were freshly
prepared in physiologic saline solution to such concentrations that
requisite doses were administered in a volume of 10 ml/kg of the
murine body weight. Feces samples were collected at 0, 5, 10, and
15 d, and the fecal water content was measured immediately after
excretion. Partial fresh fecal samples, collected at 15 d, were sub‐
sequently submerged in liquid nitrogen, then immediately froze at
−80°C until further SCFA and gut microbiota analysis. All of the
animals were fasted overnight for approximately 18 hr before induc‐
ing constipation (water was not restricted). All groups, except the
| 3 of 14
normal control, were treated with loperamide via gavage at day 16 to
induce constipation, and subsequently, the GI transit (the rate of car‐
bon powder propulsion through the small intestine), and the time to
the first black stool defecation were measured. The protocol of ani‐
mal use was reviewed and approved by of the ethical committee of
experimental animal care at Ocean University of China (Certificate
No. SYXK20120014) according to the guidelines.
2.6 | Induction of constipation in mice and
measurement of gut transit
Loperamide was dissolved in saline, and constipation was induced in
the mice by oral administration at a dose of 5 mg/kg bw, using a vol‐
ume of 10 ml/kg of mouse body weight (Moezi, Pirsalami, & Inaloo,
2015). Mice were fasted 18 hr before experiments in order to make
the intestines free of stool, freely drinking in cages with a floor made
of metal grids. On the test day, 30 min after the administration of
loperamide, all the mice received 0.25 ml of an intragastric suspen‐
sion of 10% vegetable charcoal in 5% gum acacia (Sigma Chemical
Co., St. Louis, MO) which contains requisite doses of dissolved test
samples. Intestinal transit was measured with the charcoal meal
method described by Puig and Pol (Pol, Planas, & Puig, 1995; Puig,
Pol, & Warner, 1996). Half of the mice in each group (n = 6) were
sacrificed 25 min later by cervical dislocation, and the stomach and
small intestines were totally removed. The mesentery was com‐
pletely separated to allow the intestine be fully straightened while
avoiding stretching. Subsequently, the total length of the small in‐
testine (INTS) from the pyloric sphincter to the ileocecal junction
and the distance advanced by the charcoal (CHARC) from the begin‐
ning of the pyloric sphincter to the forefront of the charcoal bulk
were measured, and the intestinal transit (% intestinal transit) was
calculated as the percentage of the length of the CHARC relative to
the INTS.
( )
% transit = CHARC∕INTS × 100%
The time to the first black stool defecation was measured follow‐
ing the methods of Nagakura, Naitoh, Kamato, Yamano, and Miyata
(1996). After the administration of vegetable charcoal, mice were re‐
turned to their cages. A white sheet was placed under the cages to
allow the researchers to distinguish black stools from normal ones.
The observation was performed for 6 hr after the administration of
the marker.
2.7 | Fecal and colonic SCFA measurements
For fecal SCFA analysis, 0.2–0.5 g of frozen samples was thawed
and homogenized in 1 ml water and kept under ice for 20–30 min
with occasional mixing with a vortex. After that, the clear superna‐
tant was obtained after a centrifugation (2000 × g, 10 min at 4°C).
Acetate, propionate, iso‐butyrate, butyrate, iso‐valerate, valer‐
ate, and 4‐methylvaleric acid were used as standards and 2‐eth‐
ylbutyric acid was used as an internal standard. The analysis was
4 of 14 | FU et al.
carried out using an Agilent 6890 N gas chromatograph equipped
with a flame ionization detector (Agilent Technologies, USA) and a
polar HP‐FFAP capillary column (0.25 µm × 320 µm × 30 m). The
initial oven temperature was 80°C, maintained for 0.5 min, and
then raised to 150°C at 8°C/min and held for 1.0 min, then in‐
creased to 200°C at 20°C/min, and finally held at this temperature
for 4 min. The temperature of the FID and the injection port was
250 and 200°C, respectively. Nitrogen was used as the carrier gas
at a flow of 10 ml/min, and the flow rates of hydrogen and air were
30 and 300 ml/min, respectively. A supernatant sample of 1 µl was
inserted in the glass liner of the splitless injection for GC analysis.
Data handling was carried out with a HP Chem Station Plus soft‐
ware (A.09.xx, Agilent).
2.8 | DNA extraction, MiSeq sequencing, and
data processing
Total genome DNA from fecal samples (d 15) was extracted using
the CTAB method (Rouhibakhsh, Priya, Periasamy, Haq, & Malathi,
2008). DNA concentration and purity were monitored on 1% aga‐
rose gels. The amplification sequencing of the V4–V5 region of
the bacterial 16 S rRNA genes was performed using universal
primers (515F 5′ GTGCCAGCMGCCGCGGTAA‐3′ and 907R 5′‐
CCGTCAATTCCTTTGAGTTT‐3′). PCR reactions were carried out
with Phusion® High‐Fidelity PCR Master Mix (New England Biolabs).
PCR products were mixed with same volume of 1X loading buffer
(contained SYB green), and then electrophoresed on a 2% agarose
gel. The main bright strip between 400–450 bp was chosen for fur‐
ther experiments. The PCR amplification products were purified
using the Qiagen Gel Extraction Kit (Qiagen, Germany) and quan‐
tified using QuantiFluor™‐ST (Promega, the USA) according to the
manufacturer’s protocol. Sequencing libraries were conducted by/
Nevogene Technology Co., Ltd. (Beijing, China) using TruSeq® DNA
PCR‐Free Sample Preparation Kit (Illumina, USA) and sequenced
on an Illumina HiSeq 2,500 platform. Operational taxonomic units
(OTUs) were clustered with minimum identity threshold of 97% using
UPARSE software (version7.0.100, https://drive5.com/uparse/)
(Edgar, 2013). The taxonomy of each 16S rRNA gene sequence was
analyzed using RDP Classifier (Version 2.2, https://sourceforge.
net/projects/rdp-classifier/) against GreenGene Database (https://
greengenes.lbl.gov/cgi-bin/nph-index.cgi) (DeSantis et al., 2006;
Wang, Garrity, Tiedje, & Cole, 2007). Follow‐up analyses were per‐
formed after OTU abundance information was normalized using a
Sample Mannose (w/w%) Galactose (w/w%)
Guar gum 51.7 35.2
Precipitates after 36.1 32.5
enzymolysis
HHGGb 43.0 43.5
c
MHGG 55.5 30.0
a
Man (Mannose), Gal (Galactose); bHHGG (high‐molecular‐weight partially hydrolyzed guar gum);
c
MHGG (medium‐molecular‐weight partially hydrolyzed guar gum).
standard of sequence number corresponding to the sample with the
least sequences. The changes in the relative abundance of the bac‐
terial phyla and genera were displayed using heat map, which was
constructed using the gplot package of R software. Cluster tree was
generated with the ape package of R using the average method to
show the differences among samples. A Spearman correlation analy‐
sis of intestinal transit and fecal indices was constructed using SPSS
17.0 software. The Spearman correlation coefficient of the top 40
abundant bacterial genera and the environmental factors including
the intestinal transit rate, the fecal water content, and the total con‐
tent of SCFAs was also calculated using the pheatmap package of R,
which was displayed by heat map.
2.9 | Statistical analysis
The results are presented as the mean ± the standard deviation
(X ± SD). Data from the control and other experimental groups were
analyzed with the SPSS 17.0 program using the Student’s t test.
Differences among groups were evaluated for significance by the
one‐way ANOVA (Tukey post hoc test). Correlations were consid‐
ered significant when p < 0.05.
3 | R E S U LT S A N D D I S CU S S I O N
3.1 | Monosaccharide composition of guar gum and
PHGG
During preparation of PHGG, four fragments were obtained by
centrifugation and ultrafiltration, and the Man/GOS (M/G) ratio
was analyzed (Table 1). Lower M/G ratios were observed in HHGG
and precipitates compared to that of the guar gum, and the HHGG
was the lowest. However, higher M/G ratios were observed in the
fragments (MHGG) with lower molecular weights. The distribution
of galactose substituents in guar gum can be classified into three
types: ordered, random, and blockwise (Daas, Schols, & de Jongh,
2000). Galactoses are usually observed to assemble compactly and
regularly at the ordered area of guar gum, which hinders enzymoly‐
sis (Srivastava & Kapoor, 2014), resulting the unhydrolyzed fractions
with high Mw value and low M/G ratio (HHGG). The random‐ and
non‐substituted mannan backbone area contain abundant enzyme‐
binding sites (Daas et al., 2000; Kurakake, Sumida, Masuda, Oonishi,
& Komaki, 2006), and mainly contributed to MHGG with a higher
M/G ratio and lower Mw value.
TA B L E 1 Content of mannose and
Man‐Gala ratio
galactose in guar gum and its hydrolysate
1.47
1.11
0.99
1.85
FU et al. | 5 of 14

3.2 | Determination of fecal water content to that of the normal group after constipation was induced by lop‐
eramide administration. Compared with the constipation control
Constipation is a common gastrointestinal disorder characterized
group, the fecal water content increased significantly in all the pos‐
by symptoms such as hard stool, straining, and infrequent defeca‐
itive‐ and PHGG‐treated groups (Figure 1b, p < 0.05). Furthermore,
tion (Moezi et al., 2015), which can be assessed principally by a
the fecal water content of the high‐dose MHGG group was the
decrease in the water content of the fecal pellet. Hard stool is a
highest of all the treatment groups and the value was close to that
typical symptom, and stool softening is a physician’s first step in
of the normal group, followed by that of the high‐dose HHGG
the management of chronic constipation by increasing stool water
group. It was reported that gel‐forming dietary fibers, such as guar
content (Mcrorie et al., 1998). During 15 d of administration, fecal
gum and pectin, possess good water‐holding capacity and lead to
water content was increased in all groups with administration time,
an increase in fecal bulking action (Stephen & Cummings, 1979).
however, no significant difference was seen between the experi‐
PHGG can become a gelatinous and viscous substance after ab‐
mental groups (Figure 1a). As the result show in Figure 1b, fecal
sorbing water and thus may lead to an increase in fecal moisture.
water content decreased in all of the treatment groups compared

F I G U R E 1 Fecal water content

change in all groups (a); Post‐induction
of constipation by loperamide (b). Mice
were treated with GOS and XOS at a
dose of 1 g/kg bw. The low‐ and high‐
dose HHGG (HHGG‐L/‐H) and MHGG
(MHGG‐L/‐H) groups received 250 mg/
kg bw or 1 g/kg bw, respectively. Water
content of defecation was calculated as
the difference between the wet and dry
weights of collected pellets. Values are
mean ± SD, n = 6. **p < 0.01 compared
to control group (Student’s t test).
*
p < 0.05 compared to control group
(Student’s t test). Abbreviation: XOS
(xylo‐oligosaccharide), GOS (galacto‐
oligosaccharide), HHGG (high‐molecular‐
weight partially hydrolyzed guar gum),
MHGG (medium‐molecular‐weight
partially hydrolyzed guar gum)
6 of 14 | FU et al.
3.3 | Intestinal transition after loperamide‐induced
constipation
Difficult or infrequent passage of stool is one of the symptoms of
chronic constipation (Bharucha, 2007). Recently, some research has
investigated the effects of possible microbiota‐based therapy on
chronic constipation, such as dietary fiber, prebiotics, and probiotics
(Zhao & Yu, 2016). Dietary fiber can be fermented by intestinal mi‐
crobiota to produce hydrogen, methane, and carbon dioxide, which
can increase stool bulk and promote colonic transit (López Román et
al., 2008). Additionally, prebiotics such as GOS have been reported
to have potential effects on the promotion of intestinal peristalsis
and relief of constipation (Li et al., 2013). In this study, we evalu‐
ated the constipation relieving effects of two fragments of PHGG
with different molecular weights compared to that of XOS and
GOS in mice. As the results show in Figure 2, the intestinal tran‐
sit rate was significantly (p < 0.01) reduced in the loperamide‐only
group (35.40% ± 3.07%) compared to that of the normal group
(78.94% ± 5.40%), indicating the establishment of an acceptable
model of constipation. Higher intestinal transit rates were observed
for all of the PHGG‐treated groups, though there was no statisti‐
cal difference between the low‐dose PHGG groups and the control
group. However, great enhancement was observed for the high‐dose
PHGG groups compared to that of the control (p < 0.01). Importantly,
high‐dose MHGG showed the highest effects on promoting intesti‐
nal function with the highest intestinal transit rate (73.79% ± 5.17%),
followed by the high‐dose HHGG group (60.73% ± 8.34%). GOS
significantly improved intestinal peristalsis with a higher intestinal
transit rate (43.40% ± 5.58%), but there was no significant differ‐
ence between the XOS and control groups.
The time to first black stool defecation of mice in all treated
groups after inducing constipation is shown in Figure 3. The shortest
F I G U R E 2 Small intestinal transit rate
of mice after inducing constipation with
loperamide. Values are mean ± SD, n = 6.
**
p < 0.01 compared to control group
(Student’s t test). *p < 0.05 compared
to control group (Student’s t test).
Abbreviation: XOS (xylo‐oligosaccharide),
GOS (galacto‐oligosaccharide), HHGG
(high‐molecular‐weight partially
hydrolyzed guar gum), MHGG (medium‐
molecular‐weight partially hydrolyzed
guar gum)
time to the first black stool defecation was observed in the normal
group with a significant difference (p < 0.01) compared to that of the
control. High‐dose MHGG and HHGG showed significant improve‐
ment (p < 0.01) in the time to first black defecation compared to that
of the control, and the best time was observed for the high‐dose
MHGG group, which was the closest to that of the normal group.
However, no significant difference between the normal, low‐dose
MHGG, and HHGG groups was observed. Furthermore, a significant
improvement (p < 0.05) was observed in the GOS and XOS groups.
These results indicated that PHGG could shorten the time to defeca‐
tion and this effect was concentration‐dependent. The water‐hold‐
ing capacity is one of the important mechanisms by which dietary
fibers increase fecal bulk and modulate gastrointestinal transit time
(Stephen & Cummings, 1980). Thus, the increase in fecal moisture
by PHGG may result in the formation of softer feces, leading to an
increase in the frequency of defecation.
3.4 | Changes of SCFAs in feces of mice
Undigested carbohydrates can be fermented by gut microbiota
under anaerobic conditions in the large intestine, mainly in the form
of SCFA production (Flint, Scott, Louis, & Duncan, 2012). SCFAs have
a complex effect on the host, and can be used as energy sources
and important signaling molecules in physiological metabolism of
the host (Pomare, Branch, & Cummings, 1985). SCFAs have been re‐
ported to stimulate ileal propulsive contractions and colonic smooth
muscle contractility, which may help promote the bowel movement
(Zhao & Yu, 2016). The concentration of SCFAs in feces of all the
experimental groups at day 15 is shown in Figure 4. Compared with
that of the control and normal groups, higher concentrations of
total SCFAs were observed in all the treated groups. Moreover, a
significant increase (p < 0.05) was observed in the high‐dose MHGG
FU et al. | 7 of 14

F I G U R E 3 Time to first black stool defecation of mice after establishing constipation model using loperamide. Values are mean ± SD,
n = 6. **p < 0.01 compared to control group (Student’s t test). *p < 0.05 compared to control group (Student’s t test). Abbreviation: XOS (xylo‐
oligosaccharide), GOS (galacto‐oligosaccharide), HHGG (high‐molecular‐weight partially hydrolyzed guar gum), MHGG (medium‐molecular‐
weight partially hydrolyzed guar gum)

F I G U R E 4 SCFA production in feces

from all experimental groups. Values are
mean ± SD, n = 6. Differences among
groups were evaluated for significance
by the one‐way ANOVA (Tukey post
hoc test), and the variations of the total
SCFA production were signed outside
the column, and different letters indicate
a significant difference (p < 0.05).
Abbreviation: XOS (xylo‐oligosaccharide),
GOS (galacto‐oligosaccharide), HHGG
(high‐molecular‐weight partially
hydrolyzed guar gum), MHGG (medium‐
molecular‐weight partially hydrolyzed
guar gum)

group, followed by that of the XOS, GOS, and low‐dose MHGG
groups. Besides, both the low‐ and high‐dose HHGG groups showed
low SCFA production capacity which indicates that lower molecu‐
lar weight carbohydrates may be more easily fermented by the gut
microbiota.
Acetate, comprising around 62.31%–73.59% of the total SCFA
production, was the major SCFA in all the experimental groups,
which was followed by propionate (18.25%–22.81%). Acetate and
propionate have been reported to act as agonists of GPR43 and
GPR41, affecting intestinal transit and protecting against the de‐
velopment of inflammatory diseases (Brown et al., 2003; Maslowski
et al., 2009). In this study, MHGG promoted the accumulation of
acetate compared to that observed for the untreated groups, and
the production was dependent on the concentration of MHGG. A
significant increase in acetate (p < 0.05) was observed for the high‐
dose MHGG and GOS groups, followed by the low‐dose MHGG
group. Additionally, an increasing trend of acetate was also observed
in the XOS and HHGG groups. Compared to that of the untreated
8 of 14 | FU et al.
groups, XOS significantly promoted the accumulation of propio‐
nate (p < 0.05) and increased the relative ratio of propionate in total
SCFAs. Moreover, a significant increase in propionate was observed
for the high‐dose MHGG and GOS groups, followed by the low‐dose
MHGG group (p < 0.05). Additionally, the HHGG had no obvious ef‐
fect on promoting the production of propionate.
Butyrate is considered a main energy substrate and factor
for the stimulation and differentiation of colonocytes (Rowe &
Bayless, 1992). Some studies have reported that butyrate can
elicit potential therapeutic effects on constipation, such as re‐
lieving the pain during defecation (Vanhoutvin et al., 2009).
Additionally, the anti‐inflammatory properties of butyrate could
potentially promote bowel movement by reducing intestinal in‐
flammation (Kristjánsson, Venge, Wanders, Lööf, & Hällgren,
2004). In this study, XOS and GOS showed good butyrogenic ef‐
fect compared to that of the untreated groups, followed by MHGG
treatment groups. However, no butyrogenic effect was observed
in the HHGG groups.
3.5 | Structural changes in the fecal
microbiota of mice
Chronic constipation is a prevalent gastrointestinal disorder, how‐
ever it’s etiology is most likely multifactorial and is not well studied
(Zhao & Yu, 2016). The gut microbiome plays important roles in gas‐
trointestinal functions such as modulating immune responses and
promoting gastrointestinal motility (Maurice, Haiser, & Turnbaugh,
2013; Mazmanian, Liu, Tzianabos, & Kasper, 2005), and increasing
data show that regulation of intestinal microbiota may have benefi‐
cial effects on relieving constipation. However, the potential effect
of gut microbiota in constipation remains poorly understood. To as‐
sess the influence of PHGG on the gut microbiome, feces of all eight
experimental groups were collected at d 15. High‐quality 16S rRNA
gene sequences were generated through HiSeq sequencing analysis.
The average sequence read was 57,241 per sample and follow‐up
analyses were performed after subsampling of all samples accord‐
ing to the minimum number of sequences. OTUs were generated at
≥97% sequence identity and the number of OTUs per sample ranged
between 229 and 300.
The heat map showed that at phyla level, the fecal micro‐
biome in all the samples was dominated by Bacteroidetes, fol‐
lowed by the Firmicutes, Actinobacteria, Tenericutes, and
Proteobacteria (Figure 5). Compared with that of the untreated
groups, Bacteroidetes showed a higher relative abundance in the
XOS, GOS, and all PHGG‐treated groups, of which the highest was
observed in the high‐dose MHGG group. Bacteroidetes are among
the major members of the gut microbiota of animals, they are in‐
creasingly regarded as degraders of high molecular weight organic
matter, such as proteins and carbohydrates (Thomas, Hehemann,
Rebuffet, Czjzek, & Michel, 2011), and the presence of numerous
carbohydrate‐active enzymes were found through sequencing of
the Bacteroidetes genomes (Davies, Gloster, & Henrissat, 2005).
Therefore, the increase in Bacteroidetes in all the treated groups
may be attributed to the additional oligosaccharides and polysac‐
charides. Moreover, three phyla decreased in all the treated groups,
including Firmicutes, Proteobacteria, and Tenericutes. Furthermore,
a decreased Firmicutes/Bacteroidetes ratio was observed in the
XOS, GOS, and PHGG‐treated groups compared to that of the
untreated groups, and the lowest Firmicutes/Bacteroidetes ratio
was observed in the high‐dose MHGG group, followed by the low‐
dose HHGG, XOS, and GOS groups. The decreased Firmicutes/
Bacteroidetes ratio was reported to be associated with weight loss
(Ley, Turnbaugh, Klein, & Gordon, 2006), however, its relationship
with constipation remains poorly understood. Differences in the
composition of the intestinal microbiota between constipated pa‐
tients and healthy controls have been demonstrated by Zhu et al.
(2014), and the data showed a significant increase in Bacteroidetes
and a decreased tendency of Firmicutes in the control group com‐
pared with that of the constipated patients. Therefore, the variation
of microflora of Bacteroidetes and Firmicutes may contribute to
modulating constipation with PHGG.
The top 40 dominant genera in all the experimental groups were
selected to construct a heat map (Figure 6). The fecal microbiota
in all the samples was dominated by Bacteroides and Alloprevotella,
followed by Lactobacillus, Prevotellaceae_UCG‐001, Alistipes, and
Odoribacter. Compared to that of the normal group, increases in
Bacteroides were observed in all the treated groups except GOS.
The increased abundance of Bacteroides may be associated with
the fermentation of carbohydrates, which may contribute to the
production of organic acids (Zhao & Yu, 2016). Lactobacilli are the
generally recognized beneficial species for regulating intestinal
function and previous studies have reported that an abundance of
Lactobacillus was either lower or higher in constipated models than
in that of normal groups (Chassard et al., 2012; Kashyap et al., 2013;
Monteagudo‐Mera et al., 2016). In this study, low‐dose MHGG
promoted the accumulation of Lactobacillus in all treated groups.
Husebye, Hellström, Sundler, Chen, and Midtvedt (2001) trans‐
planted conventional intestinal microbiota into germ‐free rats to
reveal that Lactobacillus acidophilus could accelerate small intestinal
transit. The potential effect of gut microbiota in constipation is not
well understood, but production of H2S by fermentation of sulphate‐
reducing bacteria (SRB) could modulate peripheral pain‐related sig‐
nals and may influence gut sensory motor functions (Kawabata et
al., 2007). Moreover, Chassard et al. (2012) reported that a high
number of H2‐utilizing sulphate‐reducing bacteria were observed
in their constipation predominant‐irritable bowel syndrome (IBS‐C)
group compared to that of healthy controls, which could in turn in‐
fluence colonic motility and generate IBS symptoms. Desulfovibrio is
the dominant SRB in the flora of the human colon with a capacity for
intestinal colonization through the mucus layer, and its metabolites
are potential pathogenic factors of chronic gastrointestinal diseases
(Devereux, Delaney, Widdel, & Stahl, 1989; Gibson, Macfarlane, &
Cummings, 1993). In this study, an obvious decrease in Desulfovibrio
was observed in all the PHGG‐treated groups and positive groups.
The lowest abundance was observed in the XOS group, followed by
the high‐dose MHGG group.
FU et al. | 9 of 14

F I G U R E 5 Heat map of the bacterial abundance in phyla level at day 15 in all experimental groups. The numbers of reads of each phylum
were assigned to each color block. The abundance of each phylum is plotted in red–blue color scale. The red and blue color indicates
high and low abundance, respectively. Abbreviation: XOS (xylo‐oligosaccharide), GOS (galacto‐oligosaccharide), HHGG (high‐molecular‐
weight partially hydrolyzed guar gum), MHGG (medium‐molecular‐weight partially hydrolyzed guar gum)

In addition to modulate the gut microbiota associated

with constipation as we discussed above, dietary fiber can
also be utilized by specific bacteria to produce SCFAs, which
may be beneficial to normalize defecation (Brown et al., 2003;
Maslowski et al., 2009). Alloprevotella, which has been rec‐
ognized previously to produce moderate amounts of acetate
during fermentation (Downes, Dewhirst, Tanner, & Wade,
2013), was enriched in high‐dose MHGG group. Bacteroides,
which has been reported to produce acetate and propionate
(Louis, Hold, & Flint, 2014), was stimulated by the treatment
of PHGG and XOS. Moreover, MHGG, XOS, and GOS promoted
the proliferation of Odoribacter and Alistipes, which are known
for their butyrate‐producing capabilities in intestinal tract
(Vital, Karch, & Pieper, 2017).
3.6 | Factors influencing intestinal transit and
structuring bacterial community in feces
The Spearman correlation analysis showed that the intestinal ­transit
rate was significantly positively correlated with fecal water content
(p < 0.01), but was not related to the content of SCFAs (Table2).
These results are in accordance with the conclusion mentioned above,
pointing that the water‐holding capacity of PHGG is one of the
major mechanisms for constipation relief. A Spearman correlation
coefficient of the top 40 abundant bacterial genera and environmen‐
tal factors was displayed by the heat map (Figure 7). Among them,
Odoribacter, a butyrate‐producing bacterium (Vital et al., 2017) and
Rikenella, an acetate and propionate‐producing bacterium (Kaneuchi
& Mitsuoka, 1978), showed significantly positive correlation with
10 of 14 | FU et al.

F I G U R E 6 Heat map of the relative abundance of the top 40 genera at day 15 in all experimental groups. The abundance of each
genus is plotted in red–blue color scale. The red and blue color indicates high and low abundance, respectively. Abbreviation: XOS (xylo‐
oligosaccharide), GOS (galacto‐oligosaccharide), HHGG (high‐molecular‐weight partially hydrolyzed guar gum), MHGG (medium‐molecular‐
weight partially hydrolyzed guar gum)

TA B L E 2 Correlation analysis of intestinal transit rate and fecal indices

Index Fecal water content Acetate Propionate Iso‐butyrate Butyrate Total SCFAs
**
Intestinal transit 0.952 0.143 0.071 −0.214 0.024 0.024
rate

Note. The correlation coefficient and significance were obtained using Spearman correlation analysis. Significant values are shown as:
*
p < 0.05; **p < 0.01.

the total content of SCFAs (0.01 < p ≤ 0.05). The abundances of
Lachnospiraceae_NK4A136_group (p ≤ 0.001), Ruminiclostridium_6
(p ≤ 0.001), and Desulfovibrio (0.001 < p ≤ 0.01) decreased in all the
fiber‐treated groups, showing significantly negative correlation with
the total content of SCFAs. However, intestinal transit rate showed no
correlation with any bacterial genus, proving that the change of intestinal
microbiota contributed little to the transit rate. Fecal water con‐
tent in the modeling mice also showed no correlation with the in‐
testinal microbiota except for Ruminococcaceae_NK4A214_group
(0.01 < p ≤ 0.05).
FU et al. | 11 of 14

F I G U R E 7 Correlation heat map of the top 40 genera and environmental factors, including the intestinal transit rate, the fecal water
content, and the total content of SCFAs. The Spearman correlation coefficient was calculated using the pheatmap package of R. X and Y axis
are environmental factors and genera, respectively. R was marked in different colors, and the legend in the right side is the color range of
different R values. ***p ≤ 0.001, **0.001 < p ≤ 0.01, *0.01 < p ≤ 0.05

4 | CO N C LU S I O N S This in vivo test suggests that MHGG perform a constipation reliev‐

In conclusion, PHGG significantly increased the water content of
feces after constipation modeling, and MHGG at a high‐dose ex‐
hibited the best effect for constipation relief. MHGG could sig‐
nificantly promote small intestinal transit, followed by HHGG and
GOS, and this effect was concentration‐dependent. The same ten‐
dency was observed for the time to the first black stool defecation.
Furthermore, MHGG possessed better fermentability in the intes‐
tine of mice than HHGG, showing the highest SCFA production of
all the test groups. Moreover, PHGG promoted the accumulation of
Bacteroidetes and inhibited harmful species, such as Desulfovibrio.
ing effect by promoting small intestinal transit and increasing the
fecal water content. Furthermore, since the preparation of MHGG
by enzymatic hydrolysis is low‐cost and eco‐friendly, it may provide
an option for the development of novel dietary fiber.
AC K N OW L E D G M E N T S
The authors are grateful for the financial support by the Key
Research and Development Project Foundation of Shandong
Province (2017YYSP003) and Shandong Natural Science Fund
(ZR2017MD006).
12 of 14 | FU et al.
C O N FL I C T O F I N T E R E S T S
The authors declare no conflict of interest.
ORCID
Xiaodan Fu http://orcid.org/0000-0001-6969-7369
REFERENCES
Bai, W., Fang, X., Zhao, W., Huang, S., Zhang, H., & Qian, M. (2015).
Determination of oligosaccharides and monosaccharides in Hakka
rice wine by precolumn derivation high‐performance liquid chroma‐
tography. Journal of Food and Drug Analysis, 23(4), 645–651. https://
doi.org/10.1016/j.jfda.2015.04.011
Bharucha, A. E. (2007). Constipation. Best Practice & Research Clinical
Gastroenterology, 21(4), 709–731. https://doi.org/10.1016/j.bpg.2007.
07.001
Brown, A. J., Goldsworthy, S. M., Barnes, A. A., Eilert, M. M., Tcheang,
L., Daniels, D., … Dowell, S. J. (2003). The orphan G protein‐coupled
receptors GPR41 and GPR43 are activated by propionate and other
short chain carboxylic acids. Journal of Biological Chemistry, 278(13),
11312–11319. https://doi.org/10.1074/jbc.M211609200
Chassard, C., Dapoigny, M., Scott, K. P., Crouzet, L., Del’homme, C.,
Marquet, P., … Bernalier‐Donadille, A. (2012). Functional dysbio‐
sis within the gut microbiota of patients with constipated‐irritable
bowel syndrome. Alimentary Pharmacology & Therapeutics, 35(7),
828–838. https://doi.org/10.1111/j.1365-2036.2012.05007.x
Daas, P., Schols, H. A., & de Jongh, H. H. J. (2000). On the galactosyl
distribution of commercial galactomannans. Carbohydrate Research,
329(3), 609–619. https://doi.org/10.1016/S0008-6215(00)00209-3
Davies, G. J., Gloster, T. M., & Henrissat, B. (2005). Recent structural
insights into the expanding world of carbohydrate‐active enzymes.
Current Opinion in Structural Biology, 15(6), 637–645. https://doi.
org/10.1016/j.sbi.2005.10.008
Derrien, M., van Passel, M. W. J., van de Bovenkamp, J. H. B., Schipper,
R. G., de Vos, W. M., & Dekker, J. (2010). Mucin‐bacterial interac‐
tions in the human oral cavity and digestive tract. Gut Microbes, 1(4),
254–268. https://doi.org/10.4161/gmic.1.4.12778
DeSantis, T. Z., Hugenholtz, P., Larsen, N., Rojas, M., Brodie, E. L., Keller,
K., … Andersen, G. L. (2006). Greengenes, a chimera‐checked 16S
rRNA gene database and workbench compatible with ARB. Applied
and Environmental Microbiology, 72(7), 5069–5072. https://doi.
org/10.1128/AEM.03006-05
Devereux, R., Delaney, M., Widdel, F., & Stahl, D. A. (1989). Natural relation‐
ships among sulfate‐reducing eubacteria. Journal of Bacteriology, 171(12),
6689–6695. https://doi.org/10.1128/jb.171.12.6689-6695.1989
Downes, J., Dewhirst, F. E., Tanner, A. C. R., & Wade, W. G. (2013).
Description of alloprevotella rava gen. nov., sp. nov., isolated from
the human oral cavity, and reclassification of Prevotella tannerae
Moore et al. 1994 as alloprevotella tannerae gen. nov., comb. nov.
International Journal of Systematic and Evolutionary Microbiology,
63(Pt 4), 1214–1218. https://doi.org/10.1099/ijs.0.041376-0
Edgar, R. C. (2013). UPARSE: Highly accurate OTU sequences from
microbial amplicon reads. Nature Methods, 10, 996. https://doi.
org/10.1038/nmeth.2604
Flint, H. J., Bayer, E. A., Rincon, M. T., Lamed, R., & White, B. A. (2008).
Polysaccharide utilization by gut bacteria: Potential for new insights
from genomic analysis. Nature Reviews Microbiology, 6, 121. https://
doi.org/10.1038/nrmicro1817
Flint, H. J., Scott, K. P., Louis, P., & Duncan, S. H. (2012). The role of the gut
microbiota in nutrition and health. Nature Reviews Gastroenterology &
Hepatology, 9, 577–589. https://doi.org/10.1038/nrgastro.2012.156
Frank, D. N., St. Amand, A. l., Feldman, R. A., Boedeker, E. C., Harpaz,
N., & Pace, N. R. (2007). Molecular‐phylogenetic characterization of
microbial community imbalances in human inflammatory bowel dis‐
eases. Proceedings of the National Academy of Sciences of the United
States of America, 104(34), 13780–13785. https://doi.org/10.1073/
pnas.0706625104
Gibson, G. R., Macfarlane, G. T., & Cummings, J. H. (1993). Sulphate re‐
ducing bacteria and hydrogen metabolism in the human large intes‐
tine. Gut, 34(4), 437–439. https://doi.org/10.1136/gut.34.4.437
Goulder, T. J., Alberti, K. G. M. M., & Jenkins, D. A. (1978). Effect of
added fiber on the glucose and metabolic response to a mixed meal
in normal and diabetic subjects. Diabetes Care, 1(6), 351. https://doi.
org/10.2337/diacare.1.6.351
Hidehisa, T., Nobuhisa, W., Tsutomu, O., Noriyuki, I., Junzo, Y., & Takehiko,
Y. (1994). Influence of partially hydrolyzed guar gum on constipation
in women. Journal of Nutritional Science and Vitaminology, 40(3), 251–
259. https://doi.org/10.3177/jnsv.40.251
Husebye, E. E., Hellström, P. M., Sundler, F., Chen, J., & Midtvedt, T.
(2001). Influence of microbial species on small intestinal myoelectric
activity and transit in germ‐free rats. American Journal of Physiology.
Gastrointestinal and Liver Physiology, 280(3), G368–G380. https://doi.
org/10.1152/ajpgi.2001.280.3.G368
Jennings, A., Davies, G. J., Costarelli, V., & Dettmar, P. W. (2009). Dietary
fibre, fluids and physical activity in relation to constipation symp‐
toms in pre‐adolescent children. Journal of Child Health Care, 13(2),
116–127. https://doi.org/10.1177/1367493509102469
Kaneuchi, C., & Mitsuoka, T. (1978). Bacteroides microfusus, a new spe‐
cies from the intestines of calves, chickens, and Japanese quails.
International Journal of Systematic and Evolutionary Microbiology,
28(4), 478–481. https://doi.org/10.1099/00207713-28-4-478
Kashyap, P. C., Marcobal, A., Ursell, L. K., Larauche, M., Duboc, H.,
Earle, K. A., … Sonnenburg, J. L. (2013). Complex interactions among
diet, gastrointestinal transit, and gut microbiota in humanized
mice. Gastroenterology, 144(5), 967–977. https://doi.org/10.1053/j.
gastro.2013.01.047
Kau, A. L., Ahern, P. P., Griffin, N. W., Goodman, A. L., & Gordon, J. I.
(2011). Human nutrition, the gut microbiome, and immune system:
Envisioning the future. Nature, 474(7351), 327–336. https://doi.
org/10.1038/nature10213
Kawabata, A., Ishiki, T., Nagasawa, K., Yoshida, S., Maeda, Y., Takahashi,
T., … Nishikawa, H. (2007). Hydrogen sulfide as a novel nocicep‐
tive messenger. Pain, 132(1–2), 74–81. https://doi.org/10.1016/j.
pain.2007.01.026
Khalif, I. L., Quigley, E. M. M., Konovitch, E. A., & Maximova, I. D. (2005).
Alterations in the colonic flora and intestinal permeability and ev‐
idence of immune activation in chronic constipation. Digestive
and Liver Disease, 37(11), 838–849. https://doi.org/10.1016/j.
dld.2005.06.008
Kristjánsson, G., Venge, P., Wanders, A., Lööf, L., & Hällgren, R. (2004).
Clinical and subclinical intestinal inflammation assessed by the
mucosal patch technique: Studies of mucosal neutrophil and eo‐
sinophil activation in inflammatory bowel diseases and irritable
bowel syndrome. Gut, 53(12), 1806–1812. https://doi.org/10.1136/
gut.2003.036418
Kruse, H. P., Kleessen, B., & Blaut, M. (1999). Effects of inulin on faecal
bifidobacteria in human subjects. British Journal of Nutrition, 82(5),
375–382. https://doi.org/10.1017/S0007114599001622
Kurakake, M., Sumida, T., Masuda, D., Oonishi, S., & Komaki, T. (2006).
Production of galacto‐manno‐oligosaccharides from guar gum by
β‐mannanase from penicillium oxalicum SO. Journal of Agricultural
and Food Chemistry, 54(20), 7885–7889. https://doi.org/10.1021/
jf061502k
Ley, R. E., Turnbaugh, P. J., Klein, S., & Gordon, J. I. (2006). Human gut
microbes associated with obesity. Nature, 444, 1022. https://doi.
org/10.1038/4441022a
FU et al.
Li, T., Lu, X., & Yang, X. (2013). Stachyose‐enriched α‐galacto‐oligosac‐
charides regulate gut microbiota and relieve constipation in mice.
Journal of Agricultural and Food Chemistry, 61(48), 11825–11831.
https://doi.org/10.1021/jf404160e
Li, Y., Zong, Y., Qi, J., & Liu, K. (2011). Prebiotics and oxidative stress in
constipated rats. Journal of Pediatric Gastroenterology and Nutrition,
53(4), 447–452. https://doi.org/10.1097/MPG.0b013e31821eed83
López Román, J., Martínez Gonzálvez, A. B., Luque, A., Pons Miñano, J.
A., Vargas Acosta, A., Iglesias, J. R., & Hernández, M. (2008). Efecto
de la ingesta de un preparado lácteo con fibra dietética sobre el es‐
treñimiento crónico primario idiopático. Nutrición Hospitalaria, 23,
12–19.
Louis, P., Hold, G. L., & Flint, H. J. (2014). The gut microbiota, bacterial
metabolites and colorectal cancer. Nature Reviews Microbiology, 12,
661–672. https://doi.org/10.1038/nrmicro3344
Maslowski, K. M., Vieira, A. T., Ng, A., Kranich, J., Sierro, F., Di, Y., …
Mackay, C. R. (2009). Regulation of inflammatory responses by gut
microbiota and chemoattractant receptor GPR43. Nature, 461, 1282.
https://doi.org/10.1038/nature08530
Maurice, C. F., Haiser, H. J., & Turnbaugh, P. J. (2013). Xenobiotics
shape the physiology and gene expression of the active human
gut microbiome. Cell, 152(1), 39–50. https://doi.org/10.1016/j.
cell.2012.10.052
Mazmanian, S. K., Liu, C. H., Tzianabos, A. O., & Kasper, D. L. (2005). An
immunomodulatory molecule of symbiotic bacteria directs matura‐
tion of the host immune system. Cell, 122(1), 107–118. https://doi.
org/10.1016/j.cell.2005.05.007
Mcrorie, J. W., Daggy, B. P., Morel, J. G., Diersing, P. S., Miner,
P. B., & Robinson, M. (1998). Psyllium is superior to docu‐
sate sodium for treatment of chronic constipation. Alimentary
Pharmacology & Therapeutics, 12(5), 491–497. https://doi.
org/10.1046/j.1365-2036.1998.00336.x
Moezi, L., Pirsalami, F., & Inaloo, S. (2015). Constipation enhances the
propensity to seizure in pentylenetetrazole‐induced seizure models
of mice. Epilepsy & Behavior, 44, 200–206. https://doi.org/10.1016/j.
yebeh.2015.01.013
Monteagudo‐Mera, A., Arthur, J. C., Jobin, C., Keku, T., Bruno‐Barcena,
J. M., & Azcarate‐Peril, M. A. (2016). High purity galacto‐oligosac‐
charides (GOS) enhance specific bifidobacterium species and their
metabolic activity in the mouse gut microbiome. Beneficial Microbes,
7(2), 247–264. https://doi.org/10.3920/BM2015.0114
Morris, J. B. (2010). Morphological and reproductive characterization
of guar (Cyamopsis tetragonoloba) genetic resources regenerated in
Georgia. USA. Genetic Resources and Crop Evolution, 57(7), 985–993.
https://doi.org/10.1007/s10722-010-9538-8
Mudgil, D., Barak, S., & Khatkar, B. S. (2014). Guar gum: Processing,
properties and food applications—A review. Journal of Food
Science and Technology, 51(3), 409–418. https://doi.org/10.1007/
s13197-011-0522-x
Nagakura, Y., Naitoh, Y., Kamato, T., Yamano, M., & Miyata, K. (1996).
Compounds possessing 5‐HT3 receptor antagonistic activity in‐
hibit intestinal propulsion in mice. European Journal of Pharmacology,
311(1), 67–72. https://doi.org/10.1016/0014-2999(96)00403-7
Niv, E., Halak, A., Tiommny, E., Yanai, H., Strul, H., Naftali, T., & Vaisman,
N. (2016). Randomized clinical study: Partially hydrolyzed guar
gum (PHGG) versus placebo in the treatment of patients with irri‐
table bowel syndrome. Nutrition & Metabolism, 13, 10. https://doi.
org/10.1186/s12986-016-0070-5
Pol, O., Planas, E., & Puig, M. M. (1995). Peripheral effects of naloxone
in mice with acute diarrhea associated with intestinal inflamma‐
tion. Journal of Pharmacology and Experimental Therapeutics, 272(3),
1271–1276.
Pomare, E. W., Branch, W. J., & Cummings, J. H. (1985). Carbohydrate
fermentation in the human colon and its relation to acetate
| 13 of 14
concentrations in venous blood. Journal of Clinical Investigation, 75(5),
1448–1454. https://doi.org/10.1172/JCI111847
Puig, M. M., Pol, O., & Warner, W. (1996). Interaction of morphine and
clonidine on gastrointestinal transit in mice. Anesthesiology, 85(6),
1403–1412. https://doi.org/10.1097/00000542-199612000-00022
Rouhibakhsh, A., Priya, J. J., Periasamy, M., Haq, Q. M., & Malathi, V.
G. (2008). An improved DNA isolation method and PCR protocol
for efficient detection of multicomponents of begomovirus in le‐
gumes. Journal of Virological Methods, 147(1), 37–42. https://doi.
org/10.1016/j.jviromet.2007.08.004
Rowe, W. A., & Bayless, T. M. (1992). Colonic short‐chain fatty acids:
Fuel from the lumen? Gastroenterology, 103(1), 336–338. https://doi.
org/10.1016/0016-5085(92)91133-O
Slavin, J. L., & Greenberg, N. A. (2003). Partially hydrolyzed guar
gum: Clinical nutrition uses. Nutrition, 19(6), 549–552. https://doi.
org/10.1016/S0899-9007(02)01032-8
Spapen, H., Diltoer, M., Van Malderen, C., Opdenacker, G., Suys, E., &
Huyghens, L. (2001). Soluble fiber reduces the incidence of diarrhea
in septic patients receiving total enteral nutrition: A prospective,
double‐blind, randomized, and controlled trial. Clinical Nutrition,
20(4), 301–305. https://doi.org/10.1054/clnu.2001.0399
Srivastava, M., & Kapoor, V. P. (2005). Seed galactomannans: An overview.
Chemistry & Biodiversity, 2(3), 295–317. https://doi.org/10.1002/
cbdv.200590013
Srivastava, P. K., & Kapoor, M. (2014). Cost‐effective endo‐mannanase
from bacillus sp. CFR1601 and its application in generation of oli‐
gosaccharides from guar gum and as detergent additive. Preparative
Biochemistry & Biotechnology, 44(4), 392–417. https://doi.org/10.108
0/10826068.2013.833108
Stephen, A. M., & Cummings, J. H. (1979). Water‐holding by dietary fibre
in vitro and its relationship to faecal output in man. Gut, 20(8), 722–
729. https://doi.org/10.1136/gut.20.8.722
Stephen, A. M., & Cummings, J. H. (1980). Mechanism of action of di‐
etary fibre in the human colon. Nature, 284, 283–284. https://doi.
org/10.1038/284283a0
Thomas, F., Hehemann, J.‐H., Rebuffet, E., Czjzek, M., & Michel, G.
(2011). Environmental and gut bacteroidetes: The food connec‐
tion. Frontiers in Microbiology, 2, 93. https://doi.org/10.3389/
fmicb.2011.00093
Tropini, C., Earle, K. A., Huang, K. C., & Sonnenburg, J. L. (2017). The
gut microbiome: Connecting spatial organization to function.
Cell Host & Microbe, 21(4), 433–442. https://doi.org/10.1016/j.
chom.2017.03.010
Vanhoutvin, S. A. L. W., Troost, F. J., Kilkens, T. O. C., Lindsey, P. J.,
Hamer, H. M., Jonkers, D. M. A. E., … Brummer, R. J. M. (2009). The
effects of butyrate enemas on visceral perception in healthy volun‐
teers. Neurogastroenterology & Motility, 21(9), 952–e976. https://doi.
org/10.1111/j.1365-2982.2009.01324.x
Vital, M., Karch, A., & Pieper, D. H. (2017). Colonic butyrate‐producing
communities in humans: An overview using omics data. mSystems,
2(6). https://doi.org/10.1128/mSystems.00130-17
Wang, Q., Garrity, G. M., Tiedje, J. M., & Cole, J. R. (2007). Naïve bayes‐
ian classifier for rapid assignment of rRNA sequences into the new
bacterial taxonomy. Applied and Environmental Microbiology, 73(16),
5261–5267.
Zhang, H., DiBaise, J. K., Zuccolo, A., Kudrna, D., Braidotti, M., Yu, Y., …
Krajmalnik‐Brown, R. (2009). Human gut microbiota in obesity and
after gastric bypass. Proceedings of the National Academy of Sciences
of the United States of America, 106(7), 2365–2370. https://doi.
org/10.1073/pnas.0812600106
Zhao, Y., Wu, J. F., Li, J. V., Zhou, N.‐Y., Tang, H., & Wang, Y. L. (2013).
Gut microbiota composition modifies fecal metabolic profiles in
mice. Journal of Proteome Research, 12(6), 2987–2999. https://doi.
org/10.1021/pr400263n
14 of 14 | FU et al.

Zhao, Y. M., & Yu, Y.‐B. (2016). Intestinal microbiota and chronic
constipation. SpringerPlus, 5(1). 1130. https://doi.org/10.1186/ How to cite this article: Fu X, Li R, Zhang T, Li M, Mou H.
s40064-016-2821-1 Study on the ability of partially hydrolyzed guar gum to
Zhu, L., Liu, W., Alkhouri, R., Baker, R. D., Bard, J. E., Quigley, E. M., &
modulate the gut microbiota and relieve constipation. J Food
Baker, S. S. (2014). Structural changes in the gut microbiome of con‐
stipated patients. Physiological Genomics, 46(18), 679–686. https:// Biochem. 2018;e12715. https://doi.org/10.1111/jfbc.12715
doi.org/10.1152/physiolgenomics.00082.2014