Journal of Surgical Oncology 2006;94:418–425

Accumulation of b-Catenin Protein, Mutations in Exon-3

of the b-Catenin Gene and a Loss of Heterozygosity of
5q22 in Solid Pseudopapillary Tumor of the Pancreas
SEONG MIN KIM, MD,1 CHUAN DONG SUN, MD,2,3 KI CHUNG PARK, BS,1,2 HO GUEN KIM, MD,4
WOO JUNG LEE, MD,1 AND SEUNG HOON CHOI, MD1,2*
1
Department of Surgery, Yonsei University College of Medicine, Seoul, Korea
2
Brain Korea 21 Project for Medical Science, Seoul, Korea
3
Department of Hepatobiliary and Vascular Surgery, Medical school hospital of Qingdao University,
Qingdao, P.R. China
4
Department of Pathology, Yonsei University College of Medicine, Seoul, Korea

Background: Solid pseudopapillary tumors (SPT) of the pancreas are neoplasms with
a low malignant potential. The molecular events contributing to the pathogenesis of
SPTs are still unknown.
Objectives: This study was intended to help better understand the early steps of
human SPT development.
Methods: We microdissected 20 SPTs and normal pancreatic tissue. In addition, we
examined the DNA from each SPT for mutations in exon-3 of b-catenin and loss of
heterozygosity (LOH) on 9 chromosome arms using 10 microsatellite markers.
Immunohistochemical staining for b-catenin was performed.
Results: Activating mutations between codons 32 and 37 of b-catenin exon-3 were
present in 16 cases (80%). Allelic loss on chromosome 5q22.1 was present in 10 cases
(55.5%), while no allelic loss was found on chromosomes 1p, 6q, 9p, 9q, 11p, 11q,
17p, or 22q. Nuclear accumulation of b-catenin was found in 20 cases (100%).
Conclusion: Mutations in exon-3 of the b-catenin gene, nuclear accumulation of b-
catenin, and LOH on chromosome 5q22.1 in SPT tissue suggest that these mutations
are involved in SPT tumorigenesis.
J. Surg. Oncol. 2006;94:418–425. ß 2006 Wiley-Liss, Inc.

KEY WORDS: solid pseudopapillary tumor; pancreas; mutation; immunohis-

tochemistry; loss of heterozygosity

INTRODUCTION staining for b-catenin. Occasionally, faint staining for

Solid pseudopapillary tumors (SPT) of the pancreas
are uncommon tumors, comprising less than 1% of all
pancreatic neoplasms [1]. SPTs are histologically,
clinically, and prognostically quite distinct from other
pancreatic neoplasms [2]. Ductal adenocarcinomas are
characterized by infiltrative growth and are almost
invariably lethal among older individuals. SPTs, on the
other hand, are neoplasms often found in young women,
and are frequently presented as well circumscribed, cystic
lesions [3]. Histologically, the uniform tumor cells
that form an SPT show diffuse yet strong staining
for vimentin, neuron-specific enolase (NSE), and the
progesterone receptor. In addition, they show nuclear
synaptophytin and cytokeratin (CK) 8 and 18 is seen.
They are negative for carcinoembryonic antigen (CEA)
and trypsin. Furthermore, only about 10% are malignant,
metastasizing to the peritoneum and/or liver [4,5].
Loss of heterozygosity (LOH) is one of the most
important mechanisms in the inactivation of tumor
Grant sponsor: Brain Korea 21 Project for Medical Science, Yonsei
University.
*Correspondence to: Seung Hoon Choi, MD, Department of Surgery,
Yonsei University College of Medicine, CPO Box 8044, Seoul 120-752,
Korea. Fax: þ82-2-313-8289. E-mail: shchoi@yumc.yonsei.ac.kr
Received 11 October 2005; Accepted 6 January 2006
DOI 10.1002/jso.20509
Published online in Wiley InterScience (www.interscience.wiley.com).

ß 2006 Wiley-Liss, Inc.

 Accumulation of b-Catenin Protein Mutations in Exon-3 419

suppressor genes and is involved in almost all carcino-
genesis [6–9]. Currently, a broad spectrum of distinct
gene mutations and chromosomal alterations has been
defined in pancreatic neoplasms [10–12]. The known
genetic anomalies in ductal, intraductal, and papilla of
Vater neoplasm have been described in previous studies.
Owing to a low incidence and a small number of cases
seen in single institutions, there are limited data regarding
the molecular abnormalities of acinar cell, serous cystic,
mucinous cystic neoplasms, and SPTs. In recent years,
the significance of alterations in the APC/b-catenin
pathway in SPT tumorigenesis has been studied. Muta-
tions at exon-3 of the b-catenin gene have been found
in some patients, however, neither chromosomal altera-
tion nor allele loss has been observed in any patient
[13,14].
MATERIALS AND METHODS
Case and Tissue Selections
Table I shows the demographics of the 20 patients
(16 females, 4 males; mean age, 26.7 years; range, 11–
59 years) with SPT tumors that were analyzed in
this study. All tumors were completely resected and had
no metastases. Tumor samples were fixed in 10%
buffered formalin, processed routinely, and embedded
in paraffin. Four-micrometer thick sections were stained
with hematoxylin and eosin (H&E). Pathologists con-
firmed the histopathological diagnosis.
Immunohistochemical Analysis of b-Catenin
Each tumor section was deparaffinized and subjected
to antigen retrieval by microwaving in citrate buffer
(0.1 M sodium citrate, pH 6.0) for 15–30 min. Sections
were incubated with anti-b-catenin monoclonal antibody
(Transduction Laboratories, Lexington, KY) at a dilution
of 1:500, overnight at 48C, and stained using an avidin-
biotin staining kit (Histofine Kit; Nichirei, Tokyo,
Japan). The b-catenin immunostaining results for both
cytoplasm and nucleus were evaluated by comparing
the staining intensities of tumor cells and adjacent
non-tumor epithelial cells. Sections incubated with
PBS instead of primary antibody served as a negative
control. The sections were counterstained with Mayer
hematoxylin.
According to the criteria used by Abraham et al. [13],
when present, immunostaining was classified as
nuclear, cytoplasmic, and membranous b-catenin accu-
mulation in both the SPT tissue and surrounding non-
neoplastic pancreatic tissue. Nuclear and cytoplasmic
accumulation of b-catenin in SPT tissue was graded
according to the percentage of neoplastic cells with
strong immunolabeling.

TABLE I. Clinical Parameters and Mutations in the b-Catenin Gene in the SPTs
b-catenin gene mutation

Cases Age/sex Location Nuclear b-catenin (%) 5qLOH Mutated codon Base change Amino acid substitution

1 20/M Body, tail >90 þ 33 TCT ! CCT Ser ! Pro

2 13/F Body, tail >80
— —
3 21/M Body >90 þ 33 TCT ! TGT Ser ! Cys
4 40/F Head >90
37 TCT ! TTT Ser ! Phe
5 19/F Body >80
33 TCT ! TGT Ser ! Cys
6 43/F Head >90 þ 32 GAC ! GGC Asp ! Gly
7 28/F Head >70 N/D — —
8 39/M Tail >80
33 TCT ! CCT Ser ! Pro
9 32/F Tail >90 þ 32 GAC ! GGC Asp ! Gly
10 28/F Head >90 þ 37 TCT ! TGT Ser ! Cys
11 17/F Body >90 þ 32 GAC ! GGC Asp ! Gly
12 19/F Tail >70
33 TCT ! CCT Ser ! Pro
13 26/F Head >90 þ 33 TCT ! TTT Ser ! Phe
14 38/F Tail >90 þ 37 TCT ! TGT Ser ! Cys
15 23/F Head >50
— —
16 34/F Tail >80
32 GAC ! GGC Asp ! Gly
17 59/F Body >90 þ 37 TCT ! CCT Ser ! Pro
18 11/M Body >90 N/D 33 TCT ! TGT Ser ! Cys
19 19/F Tail >30
— —
20 25/F Tail >90 þ 32 GAC ! GGC Asp ! Gly
Locations of mutations in exon-3 of b-catenin are shown by codon. Nuclear accumulation was evaluated based on the percentage tumor cell
showing strong staining in the nuclei.
N/D, not performed due to lack of normal tissue for LOH comparison.
Ser, serine; Pro, proline; Cys, cysteine; Phe, phenylalanine; Asp, aspartic acid; Gly, glycine.

Journal of Surgical Oncology DOI 10.1002/jso

420 Min Kim et al.
Genomic DNA Preparation
Sufficient numbers of formalin-fixed, paraffin-
embedded sections for DNA isolation were available
from all 20 tumors. Tumorous tissue was microdissected
from four to eight 4-mm sections, which were depar-
affinized in xylene, rehydrated in ethanol, and air-dried.
Adjacent non-tumorous tissue was found in 18 cases
and was dissected separately. DNA was extracted with
SDS-proteinase K and phenol-chloroform and dissolved
in 20 ml of 10 mM Tris-HCL (pH 8.0).
Mutational Analysis
Genomic DNA from each SPT and normal tissue
sample was amplified by polymerase chain reaction
(PCR) using a forward primer (50 -ATGGAACCA
GACAGAAAAGC-30 ) and a reverse primer (50 -GCT
ACTTGTTCTTGAGT GAAG-30 ). These primers ampli-
fied a 200 base pair (bp) fragment of b-catenin gene exon-
3 encompassing the GSK-3b phosphorylation site. The
PCR reactions were performed in a 20 ml total reaction
volume containing: 2 ml of template DNA, 2 ml of 10
buffer, 4 ml of 5 Q-solution, 1 ml each of forward and
reverse primers (final concentration of 0.5 mM), 1.2 ml of
2.5 mM deoxynucleotide triphosphate mix and 0.2 U of
Tag DNA polymerase (QIAGEN, Inc., Valencia, CA).
The reaction mixture was pre-incubated for 3 min at
948C, carried through 35 cycles (948C for 1 min, 538C for
1 min, and 728C for 1 min), and a final extension at 728C
for 10 min. PCR products were purified using QIAquick
PCR purification kit (QIAGEN) before sequencing.
Automated sequencing of purified PCR products was
performed using an ABI prism 3100 DNA analyzer
(Applied Biosystems, Foster City, CA) and internal
primers (forward, 50 -AAAGCGGCTGTTAGTCACTG
G-30 ; reverse, 50 -CCTGTTCC CACTCATACAGG-30 ).
The resulting sequence data were analyzed using the
Sequencer analysis program (Gene Codes, Ann Arbor,
MI). All mutations were verified with both the sense and
anti-sense sequencing data.
TABLE II. Primers for LOH Analysis
Forward primer
D5S592 AGACAGACAGAGAGATTAGA
D17S1828 TGCACTCACAGATTTGCC
D17S1832 ACGCCTTGACATAGTTGC
D11S1984 GGGTGACAGAGCAAAATTCT
D11S898 AGCACCATTTGCTGAGACTG
D6S287 ATATTAGTGCCTTATGCTTCTG
D1S197 TCATGTCCCTCCTCCCAAAG
D9S285 TGCCAANAGAGTAGATCTGAAG
D9S319 GCCAGTGTTCTCCAGAGAAA
D22S1167 ACATGGCAAAACCCAGTCTC
Journal of Surgical Oncology DOI 10.1002/jso
Microsatellite Selection
Ten microsatellite markers, located on nine chromo-
somal arms, were selected for utility in SPT tissue based
on location at regions relevant to pancreas tumorigenesis.
These are regions of LOH in early-stage carcinomas or
sites of identified or putative tumor suppressor genes.
Markers at regions not believed to be relevant to pancreas
tumorigenesis were also included as controls. These
regions were selected to be highly polymorphic (ideally
>75% heterozygosity) and able to be multiplexed
together without adverse interaction. All primers were
synthesized commercially by Geno Tech. Corporation
(Seoul, Korea).
LOH Evaluation
Genomic DNA from each SPT and normal tissue
sample was amplified by PCR at 10 microsatellite loci to
evaluate the LOH (Table II). PCR reactions were carried
out in a 20 ml reaction volume consisting of 1.5 mM
MgCl2; 20 pmol of primer; 0.2 mM each of dATP, dGTP,
and dTTP, 5 mM dCTP; 1 mCi [a-32P]-dCTP (3,000 Ci/
mmol; DuPont New England Nuclear, Boston, MA);
50 ng sample DNA; 1 PCR buffer; and 1.25 U of Tag
polymerase (Life Technologies, Inc., Gaithersburg, MD).
After denaturation at 958C for 5 min, DNA amplification
was performed for 25–30 cycles (denaturation at 958C
for 30 sec, primer annealing at 55–608C for 30 sec, and
elongation at 728C for 15 sec). PCR products were
separated in 6% polyacrylamide gels containing 5.6 M
urea and visualized by autoradiography. LOH was
considered present when the intensity of a heterozygous
band disappeared or reduced by at least 50% as compared
with non-neoplastic control tissues for at least one
informative marker.
RESULTS
A summary of the clinicopathologic and molecular
findings in the 20 SPTs (designated 1–20) is presented in
Table I.
Reverse primer Product size
AGTAAAGTGAGTGGAGAGC 145–175 (bp)
TTAAGCCAGTTCGGATTTG 207–227 (bp)
TGTGTGACTGTTCAGCCTC 151–195 (bp)
ACACCTGGATCTTGGACTCA 170–202 (bp)
TGTATTTGTATCGATTAACCAACTT 140–156 (bp)
AAATTGGATATTCATGCTTG 143–171 (bp)
GAGCAAGCATCCAAAAACGA 115–129 (bp)
ACCGCAATCAAGCCAAT 107–129 (bp)
TGGGATATGTCAGCCAAAAT 173–190(bp)
GGGGCTTCAACAACATTCTTAAC 266–278 (bp)
 Accumulation of b-Catenin Protein Mutations in Exon-3 421

Clinicopathologic Characteristics and

Conventional Histopathology
Tumors (30%) were located in the head area of the
pancreas, 35% in the body, and 35% in the tail. The SPT
histological diagnosis was confirmed by surgical resec-
tion in all cases. All tumors were well encapsulated
without adhesions or metastases to other organs. H&E
staining of each tumor sample showed the typical
histopathology of an SPT (uniform polygonal cells
arranged with minute fibrovascular stalks, exhibiting a
pseudopapillary pattern; Fig. 1). Some tumors also
showed a solid monomorphous pattern, sclerosis, and
cystic degeneration to varying degrees.

Immunohistochemistry
The cytoplasm and the nuclei stained intensely for b-
catenin in almost all tumor cells examined (Fig. 2B,C),
while membranous reactivity was weak or absent.
Meanwhile, acinic cells, duct cells, and some islet cells

Fig. 2. Immunostaining for b-catenin (A) shows b-catenin immu-

Fig. 1. Histopathology of SPT. (A) shows pseudopapillary pattern
with one to two layers of tumor cells lining elongated fibrovascular
stalks. Cells were stained with H&E and are magnified at 40. (B)
shows solid pattern of sheets of polyhedral tumor cells. The nuclei are
round or oval with dispersed chromatin and small nucleoli. Cells were
stained with H&E and are magnified at 100. [Color figure can be
viewed in the online issue, available at www.interscience.wiley.com.]
nostain in normal pancreatic tissue. Acinal cells, duct cells, and some
islet cells in the non-neoplastic pancreatic parenchyma showed only
weak or absent membranous staining. (B) shows b-catenin immunos-
tain in solid(right bottom) and pseudopapillary(middle upper) areas of
tumor. Almost all tumor cells show cytoplasmic and nuclear staining.
Membranous staining is weak and discontinuous. Cells were counter-
stained with hematoxylin and magnified at 100. (C) shows b-catenin
immunostain in areas of tumor. Cells are counterstained with
hematoxylin and magnified at 200. [Color figure can be viewed in
the online issue, available at www.interscience.wiley.com.]

Journal of Surgical Oncology DOI 10.1002/jso

422 Min Kim et al.

in the non-neoplastic pancreatic parenchyma showed however, was found in any of the other microsatellite
only weak or absent membranous staining (Fig. 2A). loci (Fig. 4).

Mutational Analysis of b-Catenin DISCUSSION

Sixteen of the 20 tumors (80%) showed a 1 bp
missense mutation on codons 32, 33, and 37 on exon-3 of
the b-catenin gene. No mutations were found in any
corresponding non-tumorous tissue (Fig. 3).
LOH
Allelic loss assays on chromosome 5q 22.1 revealed
LOH in 10 of 18 (55.5%) patients. No allelic loss,
Studies of SPTs to date have not shown the abundance
of genetic alterations characteristic of ductal adenocarci-
nomas, such as mutations in the K-ras oncogene, p53, and
DPC4 tumor suppressor genes [15–22]. The specific
molecular alterations that do characterize SPTs have
remained obscure [10–14,23,24].
The histopathological and immunohistochemical fea-
tures of SPTs are similar to those of pancreatoblastoma
and acinar cell carcinomas, two other distinctive

Fig. 3. Direct sequencing showing point mutation of b-catenin exon-3. The electropherogram indicates a mutation between codons 32 and 37 in
the tumor samples. Representative DNA sequencing chromatograms demonstrated the following mutations in the forward sequence: (A) TCT
(serine) !CCT (proline) in codon 33 (case 1), (B) TCT (serine) !TTT (phenylalanine) in codon 37 (case 4), (C) TCT (serine) !TGT (cysteine)
in codon 33 (case 3), and (D) GAC (aspartic acid) !GGC (glycine) in codon 32 (case 9). In the reverse sequence, the following mutations were
seen: (E) TCT (serine) !TGT (cysteine) in codon 37 (case 10), (F) TCT (serine) !CCT (proline) in codon 32 (case 17), and (G) GAC (aspartic
acid) !GGC (glycine) in codon 32 (case 20). [Color figure can be viewed in the online issue, available at www.interscience.wiley.com.]

Journal of Surgical Oncology DOI 10.1002/jso

 Accumulation of b-Catenin Protein Mutations in Exon-3
Fig. 4. Allelic loss assay on 5q in SPT. LOH at 5q22.1 is present in
cases 1, 3, 6, 9, 10, 11, 13, 14, 17, and 20. N denotes normal tissues,
and T denotes tumor tissues.
pancreatic malignancies [24–28]. SPTs, pancreatoblas-
tomas, and acinar cell carcinomas occur most frequently
in young women, the pediatric population, and in
adults, respectively. Occasionally, cases of SPTs have
been seen in males and old adults, pancreatoblastomas
occur infrequently in adults, and acinar cell carcinomas
do appear in children. Previous studies of these three
tumors have found mutations in the APC/b-catenin
pathway, a molecular genotype that is distinct from that
of pancreatic ductal adenocarcinoma [13,14,23,29–34].
The histological and clinicopathological similarities
among SPTs, pancreatoblastoma, and acinar cell carci-
nomas suggest that these neoplasms may also share
similar genetic alterations.
Similar to two previous studies, we found the most
common molecular alteration in SPTs (16 of 20) to be a
mutation in exon-3 of b-catenin [13,14]. b-catenin
functions both as an intracellular component of cad-
herin-mediated cell adhesion and as a downstream
transcriptional activator in the Wnt signaling pathway
[23,31]. Normal b-catenin degradation is promoted by
the APC tumor suppressor protein, which in conjunction
with glycogen synthase kinase-3b (GSK-3b) and Axin,
promotes phosphorylation of b-catenin on serine/threo-
nine residues that are encoded in exon-3 of the b-catenin
gene. Phosphorylation targets b-catenin for subsequent
ubiquitin-mediated degradation, a process necessary for
maintaining normal levels of b-catenin. Abnormal
accumulation of b-catenin and loss of b-catenin regula-
tion can result from mutations that stabilize b-catenin or
Journal of Surgical Oncology DOI 10.1002/jso
423
block Axin function. For example, most gastric adeno-
carcinomas have been shown to contain b-catenin
mutations [32,33]. Our results are similar to those of
Abraham et al. [13] in that we found mutations only on
codons between 32 and 37. Tanaka et al. [14], on the other
hand, found mutations in a larger range, between codons
32 and 41. All of the b-catenin mutations detected in this
study were 1 bp missense mutations affecting either
serine phosphorylation sites (codons 33 and 37) or
residues immediately surrounding a phosphorylation site
(codons 32 and 34). These mutations would, therefore, be
predicted to interfere with normal b-catenin phosphor-
ylation and degradation.
As has been seen previously, we observed abnormal
nuclear and cytoplasmic b-catenin accumulation in all
SPTs, including the four SPTs that did not contain
identifiable b-catenin mutations [13,14,34]. Table I in our
study showed some distinctive pattern of mutations
previously not reported. First, b-catenin gene mutation
itself is essential for strong nuclear b-catenin immunor-
eactivity (e.g., >90%). Second, there was no evidence
that isolated 5q22 LOH without b-catenin gene muta-
tion(that case was not found in our study) can cause b-
catenin accumulation(APC maps to 5q21–22 and is
known as the promotor of b-catenin phosphorylation in
conjunction with glycogen synthase kinase-3b (GSK-3b)
and Axin). From these two results, we can postulate that
another genetic mutation such as Axin 1 also can cause b-
catenin accumulation and SPT although its effect on
accumulation of b-catenin is less than that of b-catenin
gene mutation itself. Third, our data showed a striking
association of codon 33 mutations with male gender
(P < 0.019), although the cause and significance are
not clear. But in the study of Abraham et al. [13],
three male patients showed mutation of codons 34, 37,
37, respectively. Accumulation of cytosolic b-catenin is
due to its interaction with T-cell transcription factor
(Tcf)/lymphoid enhancer-binding factor (Lef), and trans-
location of the b-catenin-Tcf/Lef complex to the nucleus
[17–22,35,36].
Recently, researchers studying pancreatic neoplasms
have reported a LOH at chromosomal-specific poly-
morphic sites in DNA extracted from a tumor as
compared to DNA from matched normal tissues. LOH
has been identified at 5q, 17p, 9p, 13q, and 18q in ductal
cancer of the pancreas; at 5q, 17p, 9p, and 18q in papilla
of Vater cancer, and at 5q, 17p, 9p, 6q, and 18q in
intraductal tumors [24,27,28]. Due to the rarity of SPTs,
little or no data about allelic loss on chromosomes have
been available. We observed, for the first time, a high
frequency of 5q22.1 LOH (10/18, 55.5%) with the
microsatellite marker D5S592. No allelic loss was found
at 1p, 5q, 6q, 9p, 9q, 11p, 11q, 17p, or 22q. The sites of
common LOH in other pancreatic neoplasms (6q, 9p, and
424 Min Kim et al.
17p) did not show allelic loss in our data [15,16,37].
The LOH rate in this study and that in papilla of Vater
cancer is similar for 5q22.1 (55.5% vs. 75%), but ductal
cancer shows a much lower rate at the same site (20%).
In summary, the presence of mutations in b-catenin
exon-3 and nuclear accumulation in SPTs suggests that
these mutations and accumulations arise in tumorigen-
esis. Frequency of allelic loss on chromosome 5q22.1
suggests that the locus might be involved in the molecular
pathogenesis of SPTs. Further study should focus on
more intensive screening of the microsites on chromo-
some 5q.
ACKNOWLEDGMENTS
This work was supported by the Brain Korea 21 project
for medical science in 2004-2005, Yonsei University.
REFERENCES
1. Ky A, Shilyansky J, Gerstle J, et al.: Experience with papillary
and solid epithelial neoplasms of the pancreas in children.
J Pediatr Surg 1998;33:42–44.
2. Washington K: Solid-pseudopapillary tumor of the pancreas:
Challenges presented by an unusual pancreatic neoplasm. Ann
Surg Oncol 2002;9:3–4.
3. Horisawa M, Niinomi N, Sato T, et al.: Frantz’s tumor (solid and
cystic tumor of the pancreas) with liver metastasis: Successful
treatment and long-term follow-up. J Pediatr Surg 1995 30:724–
726.
4. Pettinato G, Manivel JC, Ravetto C, et al.: Papillary cystic tumor
of the pancreas. A clinicopathologic study of 20 cases with
cytologic, immunohist-ochemical, ultrastructural, and flow cyto-
metric observations, and a review of the literature. Am J Clin
Pathol 1992 98:478–488.
5. Kosmahl M, Seada LS, Janig U, et al.: Solid-pseudopapillary
tumor of the pancreas: Its origin revisited. Virchows Arch 2000;
436:473–480.
6. Zhou CZ, Qiu GQ, Zhang F, et al.: Loss of heterozygosity on
chromosome 1 in sporadic colorectal carcinoma. World
J Gastroenterol 2004;10:1431–1435.
7. Bozzetti C, Bortesi B, Merisio C, et al.: Loss of heterozygosity
(LOH) in ovarian cancer. Int J Gynaecol Obstet 2004;85:294–
295.
8. Takeuchi S, de Vos S, Takeuchi N, et al.: Allelic loss during
progression of follicular lymphoma. Leuk Res 2004;28:567–
569.
9. Kubo H, Miki C, Kusunoki M, et al.: Evaluation of genetic
mutations of tumor suppresser genes in colorectal cancer patients.
Hepatogastroenterology 2004;51:114–117.
10. Nakata B, Yashiro M, Nishioka N, et al.: Genetic alterations in
adenoma-carcinoma sequencing of intraductal papillary-muci-
nous neoplasm of the pancreas. Int J Oncol 2002;21:1067–
1072.
11. Wild A, Langer P, Celik I, et al.: Chromosome 22q in pancreatic
endocrine tumors: Identification of a homozygous deletion
and potential prognostic associations of allelic deletions. Eur
J Endocrinol 2002;147:507–513.
12. Wada K: p16 and p53 gene alterations and accumulations in
the malignant evolution of intraductal papillary-mucinous
tumors of the pancreas. J Hepatobiliary Pancreat Surg 2002;9:
76–85.
13. Abraham SC, Klimstra DS, Wilentz RE, et al.: Solid-pseudopa-
pillary tumors of the pancreas are genetically distinct
from pancreatic ductal adenocarcinomas and almost always
Journal of Surgical Oncology DOI 10.1002/jso
harbor beta-catenin mutations. Am J Pathol 2002;160:1361–
1369.
14. Tanaka Y, Kato K, Notohara K, et al.: Frequent beta-catenin
mutation and cytoplasmic/nuclear accumulation in pancreatic
solid-pseudopapillary neoplasm. Cancer Res 2001;61:8401–
8404.
15. Fujii H, Inagaki M, Kasai S: Genetic progression and hetero-
geneity in intraductal papillary-mucinous neoplasms of the
pancreas. Am J Pathol 1997;151:1447–1454.
16. Yatsuoka T, Sunamura M, Furukawa T: Association of poor
prognosis with loss of 12q, 17p, and 18q, and concordant loss of
6q/17p and 12q/18q in human pancreatic ductal adenocarcinoma.
Am J Gastroenterol 2000;95:2080–2085.
17. Abraham SC, Wu TT, Klimstra DS, et al.: Distinctive molecular
genetic alterations in sporadic and familial adenomatous poly-
posis-associated pancreatoblastomas: Frequent alterations in the
APC/beta-catenin pathway and chromosome 11p. Am J Pathol
2001;159:1619–1627.
18. Rubinfeld B, Albert I, Porfiri E, et al.: Binding of GSK3 beta to
the APC-beta-catenin complex and regulation of complex
assembly. Science 1996;272:1023–1026.
19. Munemitsu S, Albert I, Souza B, et al.: Regulation of intracellular
beta-catenin levels by the adenomatous polyposis coli (APC)
tumor-suppressor protein. Proc Natl Acad Sci USA 1995;
92:3046–3050.
20. Stommer P, Kraus J, Stolte M, et al.: Solid and cystic pancreatic
tumors. Clinical, histochemical, and electron microscopic fea-
tures in ten cases. Cancer 1991;67:1635–1641.
21. Hessman O, Skogseid B, Westin G, et al.: Multiple allelic
deletions and intratumoral genetic heterogeneity in men1
pancreatic tumors. J Clin Endocrinol Metab 2001;86:1355–
1361.
22. Ohori NP, Fowler MH, Swalsky PA, et al.: Comparative molecular
analysis of loss of heterozygosity in adenocarcinoma in bile duct
brushings and corresponding surgical pathology specimens.
Cancer 2003;99:379–384.
23. Barth AI, Nathke IS, Nelson WJ: Cadherins, catenins and APC
protein: Interplay between cytoskeletal complexes and signaling
pathways. Curr Opin Cell Biol 1997;9:683–690.
24. Heinmoller E, Dietmaier W, Zirngibl H, et al.: Molecular
analysis of microdissected tumors and preneoplastic intraductal
lesions in pancreatic carcinoma. Am J Pathol 2000;157:83–
92.
25. Shorter NA, Glick RD, Klimstra DS: Malignant pancreatic
tumors in childhood and adolescence: The Memorial Sloan-
Kettering experience, 1967 to present. J Pediatr Surg 2002;37:
887–892.
26. Kamisawa T, Tu Y, Egawa N, et al.: Ductal and acinar
differentiation in pancreatic endocrine tumors. Dig Dis Sci
2002;47:2254–2261.
27. Park S, Kim SW, Kim SH, et al.: Loss of heterozygosity in
ampulla of Vater neoplasms during adenoma-carcinoma
sequence. Anticancer Res 2003;23:2955–2959.
28. Nagai M, Kawarada Y, Watanabe M, et al.: Analysis of
microsatellite instability, TGF-beta type II receptor gene muta-
tions and hMSH2 and hMLH1 allele losses in pancreaticobiliary
maljunction-associated biliary tract tumors. Anticancer Res 1999;
19:1765–1768.
29. Abraham SC, Wu TT, Hruban RH: Genetic and immunohisto-
chemical analysis of pancreatic acinar cell carcinoma:
Frequent allelic loss on chromosome 11p and alterations in
the APC/beta-catenin pathway. Am J Pathol 2002;160:953–
962.
30. Tanaka Y, Kato K, Notohara K: Significance of aberrant
(cytoplasmic/nuclear) expression of beta-catenin in pancreato-
blastoma. J Pathol 2003;199:185–190.
31. Behrens J, von Kries JP, Kuhl M, et al.: Functional interaction of
beta-catenin with the transcription factor LEF-1. Nature 1996;
382:638–642.
32. Behrens J, Lustig B: The Wnt connection to tumorigenesis. Int
J Dev Biol 2004;48:477–487.
 Accumulation of b-Catenin Protein Mutations in Exon-3
33. Ha NC, Tonozuka T, Stamos JL: Mechanism of phosphorylation-
dependent binding of APC to beta-catenin and its role in beta-
catenin degradation. Mol Cell 2004;27:511–521.
34. Chen C, Jing W, Gulati P: Melanocytic differentiation in a solid
pseudopapillary tumor of the pancreas. J Gastroenterol 2004;39:
579–583.
35. Tetsu O, McCormick F: Beta-catenin regulates expression of
cyclin D1 in colon carcinoma cells. Nature 1999;398:422–426.
Journal of Surgical Oncology DOI 10.1002/jso
425
36. Sellin JH, Umar S, Xiao J, et al.: Increased beta-
catenin expression and nuclear translocation accompany
cellular hyperproliferation in vivo. Cancer Res 2001;61:2899–
2906.
37. Barghorn A, Speel EJ, Farspour B: Putative tumor suppressor loci
at 6q22 and 6q23–q24 are involved in the malignant progression
of sporadic endocrine pancreatic tumors. Am J Pathol 2001;158:
1903–1911.