STUDENT SUPPORT MATERIAL

[ BIOLOGY ]

CLASS—XII
SESSION : 2023-24
 KENDRIYA VIDYALAYA SANGATHAN
SILCHAR REGION

CHIEF PATRON PATRON

SH. PIT RAJA SH. SATYAVEER SINGH

DEPUTY COMMISSIONER ASSISTANT COMMISSIONER

ACADEMIC CO-ORDINATOR

SH. SANJAY MALIK

PRINCIPAL, KV NIT AGARTALA

SUBJECT EXPERTS
1. Sh. Ram Singh Mahawar, PGT (Biology), KV No.1 Kunjaban
2. Dr. Shailendra Singh Kushwah, PGT (Biology), KV (NEPA) Barapani
3. Smt. Minal Verma, PGT (Biology), KV Happy Valley Shillong
4. Sh. Satyendra Kumar Alha, PGT (Biology), KV EAC Upper Shillong
5. Smt. Sieuli Baidya, PGT (Biology), KV Silchar
 CONTENTS
UNIT VI
REPRODUCTION
Chapter 1 : Sexual Reproduction in Flowering Plants
Chapter 2 : Human Reproduction
Chapter 3 : Reproductive Health

UNIT VII
GENETICS AND EVOLUTION
Chapter 4 : Principles of Inheritance and Variation
Chapter 5 : Molecular Basis of Inheritance
Chapter 6 : Evolution

UNIT VIII
BIOLOGY IN HUMAN WELFARE
Chapter 7 : Human Health and Disease
Chapter 8 : Microbes in Human Welfare

UNIT IX
BIOTECHNOLOGY
Chapter 9 : Biotechnology : Principles and Processes
Chapter 10 : Biotechnology and its Applications

UNIT X
ECOLOGY
Chapter 11 : Organisms and Populations
Chapter 12 : Ecosystem
Chapter 13 : Biodiversity and Conservation

PAPERS
1. Sample Papers 1, 2 and 3 with Blue Print and Marking Scheme
2. Link to Previous years CBSE sample papers
 UNIT-WISE MARKS DISTRIBUTION
CLASS 12 BIOLOGY (2023-24)
(As per CBSE curriculumn)

TIME : 3 HOURS M.MARKS:70

UNIT TITLE MARKS

VI REPRODUCTION 16

VII GENETICS AND EVOLUTION 20

VIII BIOLOGY AND HUMAN WELFARE 12

IX BIOTECNOLOGY AND ITS APPLICATIONS 12

X ECOLOGY AND ENVIRONMENT 10

TOTAL MARKS 70
 CHAPTER 1
SEXUAL REPRODUCTION IN
FLOWERING PLANTS
PRE-FERTILISATION: STRUCTURES AND EVENTS--
FLOWER – A FASCINATING ORGAN OFANGIOSPERMS

V.S. of a flower

--Stamen, Microsporangium and Pollen Grain

Structure of microsporangium &Microsporogenesis :

Figure 1.3 (a) Transverse section of a young anther; (b) Enlarged view of one microsporangium
showing wall layers; (c) A mature dehisced anther
--The process of formation of microspores from a pollen mother cell (PMC) through meiosis is called
microsporogenesis.
-----The microspores, as they are formed, are arranged in a cluster of four cells–the microspore tetrad.
---As the anthers mature and dehydrate, the microspores dissociate from each other and develop into pollen grains
.
--- Inside each microsporangium several thousands of microspores or pollen grains are formed that are released
with the dehiscence of anther.
--Pollen grain:. It has a prominent two-layered wall.
---The hard outer layer called the exineis made up of sporopollenin which is one of the most resistant organic
material known. It can withstand high temperatures and strong acids and alkali. No enzyme that degrades
sporopollenin is so far known. Pollen grain exine has prominent apertures called germpores where sporopollenin
is absent. Pollen grains are wellpreserved as fossils because of the presence of sporopollenin.
--The inner wall of the pollen grain is called the intine. It is a thin and continuous layer made up of cellulose and
pectin
--. When the pollen grain is mature it contains two cells, the vegetative cell and generativecell (Figure 1.5b). The
vegetative cell is bigger, has abundant food reserve and a large irregularly shaped nucleus.
The Pistil, Megasporangium (ovule) and Embryo sac

The Megasporangium (Ovule) : Let us familiarise ourselves with the structure of a typical angiosperm ovule
(Figure 1.7d). The ovule is a small structure attached to the placenta by means of a stalk called funicle. The body
of the ovule fuses with funicle in the region called hilum. Thus, hilum represents the junction between ovule and
funicle. Each ovule has one or two protective envelopes called integuments. Integuments encircle nucellus
except at the tip where a small opening called the micropyle is organised. Opposite the micropylar end, is the
chalaza, representing the basal part of the ovule.
Megasporogenesis : The process of formation of megaspores from the megaspore mother cell is called megasporogenesis.
Ovules generally differentiate a single megaspore mother cell (MMC) in the micropylar region of the nucellus. It is a large cell
containing dense cytoplasm and prominent nucleus. The MMC undergoes meiotic division. Meiosis results in the production of
four megaspores .
v

DOUBLE FERTILISATION
After entering one of the synergids, the pollen tube releases the two male gametes into the cytoplasm of the
synergid. One of the male gametes moves towards the egg cell and fuses with its nucleus thus completing the
syngamy. This results in the formation of a diploid cell, the zygote. The other male gamete moves towards the
two polar nuclei located in the central cell and fuses with them to produce a triploid primary endosperm nucleus
(PEN) (Figure 1.13a). As this involves the fusion of three haploid nuclei it is termed triple fusion. Since two types
of fusions, syngamy and triple fusion take place in an embryo sac the phenomenon is termed double fertilisation,
an event unique to flowering plants. The central cell after triple fusion becomes the primary endosperm cell
(PEC) and develops into the endosperm while the zygote develops into an embryo.
POST-FERTILISATION : STRUCTURES AND EVENTS
Following double fertilisation, events of endosperm and embryo development, maturation of ovule(s) into
seed(s) and ovary into fruit, are\ collectively termed post-fertilisation events.
Seed-In angiosperms, the seed is the final product of sexual reproduction. It is often described as a fertilised
ovule. Seeds are formed inside fruits. A seed typically consists of seed coat(s), cotyledon(s) and an embryo axis.
The cotyledons of the embryo are simple structures, generally thick and swollen due to storage of food reserves
(as in legumes.
CHAPTER -4 REPRODUCTIVE HEALTH
 UNIT-GENETICS AND EVOLUTION
CHAPTER -4
PRINCIPLES OF INHERITANCE AND VARIATION
Genetics
Genetics is a branch of biology dealing with inheritance and variation of characters from parents of offspring.
Inheritance
Process by which characters are passed on from parent to progeny
Variation
Degree by which the progeny differs from its parents
Mendel’s Experiments
● Gregor Johann Mendel known as the father of genetics proposed the laws of inheritance.
● He used garden pea as his sample.
● Large sampling size gave credibility to his collected data.
● Garden pea plant posses certain completely opposite traits.
Example - tall and dwarf plants
● He worked on the following seven traits of garden pea:
S. No. Character Dominant Recessive
1 Stem height Tall Dwarf
2 Flower colour Violet White
3 Flower position Axial Terminal
4 Pod shape Inflated Constricted
5 Pod colour Green Yellow
6 Seed shape Round Wrinkled
7 Seed colour Yellow Green
● True breeding pea lines were obtained by continuous self pollination for several generations.
● Fourteen true breeding pea lines were selected as pairs, which were similar except for one character with
contrasting traits.
● Artificial cross pollination (hybridisation) was performed on such varieties to obtain first hybrid generation known
as the first filial progeny or F 1 .
Inheritance of One Gene
● After hybridisation, the F1 generation so obtained resembled only one of its parents (say, all tall; no dwarf).
● When 2 plants from F 1generation were self pollinated, the second filial progeny or F2 generation was obtained.
● Revival of unexpressed trait (dwarf) was observed in some F 2progeny. Both traits, tall and dwarf, were expressed
in F2 in ratio 3:1.
● Mendel proposed that something is being passed unchanged from generation to generation. He called these things
as ‘factors’ (presently called genes).
● Factors contain and carry hereditary information.
● Alleles - Slightly different form of same factor Two alleles code for a pair of two contrasting traits. (e.g., tall and
dwarf)
Monohybrid Cross
● Cross that considers only a single character (e.g., height of the part)
● Studying the cross:
○ TT, tt, and Tt are genotypes while the traits, tall and dwarf, are phenotypes.
○ T stands for tall trait while t stands for dwarf trait.
○ Even if a single ‘T’ is present in the genotype, phenotype is ‘tall’.When ‘T’ and ‘t’ are present together, ‘T’
dominates andsuppresses the expression of ‘t’. Therefore, T (for tallness) is dominant trait while t (for dwarfness) is
recessive trait.
○ TT and tt are homozygous while Tt is heterozygous.
○ From the cross, it can be found that alleles of parental pair separate or segregate from each other and only one
allele is transmitted to the gamete.
○ Gametes of TT will have only T alleles; gametes of tt will have only t alleles, but gametes of Tt will have both T
and t alleles.
genotypic ratio in F2 generation can be found. TT: Tt: tt is 1:2:1.
○ The ratio 1:2:1 or of TT: Tt: tt
○ Gametebearing genes are in equal frequency of .
○ Hence, the expression can be expanded as

Mendel’s Laws of Inheritance

● Based on his experiments, Mendel proposed three laws or principles of inheritance:
○ Law of Dominance
○ Law of Segregation
○ Law of Independent Assortment
● Law of dominance and law of segregation are based on monohybrid cross while law of independent assortment is
based on dihybrid cross.
Law of Dominance
● According to this law, characters are controlled by discrete units called factors, which occur in pairs with one
member of the pair dominating over the other in a dissimilar pair.
Test Cross
● Cross between F2progeny and its homozygous recessive parent
● This cross determines whether the dominant character is coming from homozygous dominant genotype or
heterozygous genotype. (e.g., tallness coming from TT or Tt)

Law of Segregation
● This law states that the two alleles of a pair segregate or separate during gamete formation such that a gamete
receives only one of the two factors.

Incomplete Dominance
● In incomplete dominance, F 1generation has a phenotype that does not resemble either of the two parents, but is a
mixture of the two.
● Example - Flower colour in dog flower (snapdragon), where:
○ RR - Red flowers
○ rr - White flowers
○ Rr - Pink flowers
● Here, genotypic ratio remains same as in Mendelian crosses, but phenotypic ratio changes since complete
dominance is not shown by R (hence, incomplete dominance).
● Phenotypic Ratio - 1:2:1 that denotes Red: Pink: White
● Genotypic Ratio - 1:2:1 that denotes RR: Rr: rr

Codominance
● In codominance, the F 1progeny resembles both the parents.
● Example: ABO blood groups in human beings
● ABO blood groups are controlled by gene I . Gene Ihas three alleles, I
Allele Allele Genotype of Blood type of
fromParent 1 fromParent 2 offspring offspring
I A I A I AI A A
I A I B I AI B AB
I A i I Ai A
I B I A I AI B AB
I B I B I BI B B
I B i I Bi B
i i ii O
● Multiple alleles: When more than two alleles control a character, as in human blood groups

Inheritance of Two Genes (Dihybrid Cross)

● In dihybrid cross, we consider two characters. (e.g., seed colour and seed shape)
● Yellow colour and round shape is dominant over green colour and wrinkled shape.
● Phenotypic ratio - 9:3:3:1 Round yellow - 9 Round green - 3 Wrinkled yellow - 3 Wrinkled green -1
 Chromosomal Theory of Inheritance
○ In 1990, three scientists Hugo deVries, Correns and Von Tschermak independently rediscovered Mendel’s work.
Chromosomal Theory of Inheritance
● Chromosomes and genes both occur in pairs—two alleles of a gene pair are located on homologous sites of
homologous chromosomes .
Linkage and Recombination
● Morgan’s experiment
○ Dihybrid cross was carried out on fruit flies. Yellow bodied, white eyed females were crossed with brown bodied,
red eyed males.
○ F1progeny was obtained, which were intercrossed.
○ F2progeny was obtained and F 2ratio was observed.
○ F2ratio was observed to be significantly different from 9:3:3:1 as observed in Mendelian dihybrid cross.
● Explanation of deviation from Mendelian ratio:
○ Genes involved are located on X chromosome.
○ When two genes are located on the same chromosome, the proportions of parental gene combinations were much
higher than those of nonparental.
○ Linkage - Physical association of genes on a chromosome
○ Recombination - Nonparental gene combination

Sex Determination
● Chromosomes involved in sex determination are called sex chromosomes, while the other chromosomes are called
autosomes.
● XO type of sex determination
○ Other than autosomes, at least one X chromosome is present in all insects.
Females have XX chromosomes.
Males have XO chromosome.
○ Example -Insects
● XY type of sex determination
males are XY.
females are XX.
○ Example -Humans and Drosophila
● Male heterogamety - XO and XY types of sex determination are
examples of male heterogamety.
○ In XO type,
○ In XY type,
● Female heterogamety -
○ In ZW type,
Mutation
● Alteration of DNA sequence resulting in changes in genotype and phenotype of organisms
● DNA helix runs in a chromatid, hence any change (insertion or deletion) in the DNA sequence affects the
chromosome.
● Point Mutation - Mutation arising due to change in single base pair of DNA as in sickle cell anaemia
● Frameshift Mutation - Mutations arising due to deletion or insertion in DNA sequence
● Mutagens - Chemical or physical agents that lead to mutations Example - UV radiations
Pedigree Analysis
● Pedigree analysis is the analysis of inheritance of traits in several generations of a family.
● A particular trait under study is represented in a family tree.
● By using pedigree analysis, inheritance of a specific trait, abnormality or disease, can be traced.
● DNA is believed to be the carrier of genetic information, which passes unaltered from generation to generation.
Mutations occasionally alter the genetic material and genetic diseases are believed to be associated with these
alterations only.
Genetic Disorders
● Include Mendelian disorders and chromosomal disorders
Mendelian Disorders
○ autosomal dominant (muscular dystrophy)
○ autosomal recessive (sickle cell anaemia)
○ sex linked (haemophilia)
● Haemophilia
○ Sexlinked recessive disease
○ Transmission - From unaffected female (carrier) to maleprogeny
○ Females act as carriers of disease, but rarely suffer from haemophilia since for a female to become haemophilic,
the mother should be carrier and father should be haemophilic.
○ In this disease, protein involved in blood clotting is affected.Therefore, even a simple cut results in uncontrolled
bleeding.
● Sickle cell anaemia
○ Autosomal recessive disease
○ Cause of the disease - Change in gene causes the replacement of GAG by GUG leading to the substitution of Glu
by Val at sixthposition of beta globin chain of haemoglobin.
○ The mutant haemoglobin so formed polymerises at low oxygen tension, resulting in change in shape of RBC to
sicklelike.
● Phenylketonuria
○ Autosomal recessive disease
○ Phenylalanine Tyrosine,The enzyme responsible for this conversion gets mutated.
○ Phenylalanine accumulates. Then,Phenylalanine →Phenylpyruvic acid →Accumulates in brain → Mental
retardation
○ Phenylpyruvic acid also gets excreted through urine since kidneys poorly reabsorb it.
Chromosomal Disorders
● Down’s Syndrome
○ Cause: Presence of an additional copy of chromosome 21(Trisomy of 21)
○ Affected individual has short stature, small, round head,furrowed tongue, partially opened mouth, palm
crease,congenital heart disease and mental retardation.
● Klinefelter Syndrome
○ Cause: Additional copy of X chromosome, i.e., 47 chromosomes(XXY)
○ Affected individual has an overall masculine development with gynaecomastia; individual is sterile
● Turner’s Syndrome
○ Cause: Absence of one X chromosome, i.e., 45 chromosomes (XO).
○ Affected females are sterile; have rudimentary ovaries;secondary sexual characters are absent

CHAPTER -5

MOLECULAR BASIS OF INHERITANCE

● DNA - Polymer of deoxy ribonucleotides
● Nucleoside = Nitrogenous base + Pentose sugar (linked throughN -glycosidic bond )
Example - adenosine, deoxyadenosine, cytidine, etc.
● Nucleotide = Nucleoside + Phosphate group (linked throughphosphodiester bond )
● Many nucleotides link together through 3′ - 5′ phosphodiester bond to form polynucleotide chain (as in DNA
and RNA).
● In course of formation of polynucleotide chain, a phosphate moiety remains free at 5′ end of ribose sugar (5′ end of
polymer chain) and one OH group remains free at 3′ end of ribose (3′ end of polymer chain).
Double Helix Model for the Structure of DNA ●
○ Watson and Crick- Proposed double helix structure model for DNA based on Xray diffraction data
○ Erwin Chargaff- Proposed that in ds DNA, ratios A:T and C:G remain same and are equal to one
Features of double helix structure of DNA:
● In a DNA, two polynucleotide chains are coiled to form a helix. Sugarphosphate forms backbone of this helix
while bases project in wards to each other.
● Complementary bases pair with each other through hydrogen bond. Purines always pair with their corresponding
pyrimidines. Adenine pairs with thymine through two hydrogen bonds while guanine pairs with cytosine through
three hydrogen bonds.
○ The helix is right handed. Pitch - 3.4 nm 10 bp in each turn
○ The plane of one base pair stacks over the other in a double helix. This provides stability to the helix along with
hydrogen bonding.
● Organisation of DNA in prokaryotes:
○ They do not have nucleus. DNA is scattered.In certain regions called nucleoids, DNA (negatively charged) is
organised in large loops and is held by some proteins (positively charged).
● Organisation of DNA in eukaryotes:
○ They have positively charged basic proteins called histones(positive and basic due to presence of positive and
basic amino acid residues, lysine and arginine).
○ Histone octamer - Unit of eight molecules of histone ,DNA (negatively charged) winds around histone octamer
(positively charged) to form nucleosome. 1 nucleosome has approx. 200 bp of DNA.
○ Nonhistone chromosomal proteins - Additional set of proteins required for packaging of chromatin at higher level

Discovery of DNA as a Genetic Material

Transforming Principle
● Griffith performed experiments with the bacteria Streptococcus pneumoniae . This bacterium has two strains - S
strain and R strain.
S strain Bacteria R strain Bacteria
○ Produce smooth colonies on culture plate ○ Produce rough colonies on culture plate
○ Have a polysaccharide coat ○ Do not have a polysaccharide coat
○ Virulent (causes pneumonia) ○ Non virulent (does not cause pneumonia)

● Griffith’s experiment
● Live R strain in the presence of heat killed S strain produce virulence because somehow R strain bacteria is
transformed by heat killed S strain bacteria. Hence, it was concluded that there must be transfer of genetic material.

. Hershey and Chase Experiment to Confirm DNA as the Genetic Material

● Hershey and Chase worked on bacteriophages (viruses that infect bacteria). When a bacteriophage infects a
bacterium, the viral genetic material gets attached with the bacterial genetic material and bacteria then treats the viral
genetic material as its own to synthesise more viral particles. Hershey and Chase worked to discover whether it was
a protein or DNA that entered the bacteria from virus.They labelled some phages with radioactive sulphur and the
others with radioactive phosphorus.These radioactive phages were used to infect E. coli .
● E.coli was then blended and centrifuged to remove viral particles. It was observed that bacteria with radioactive
DNA were radioactive while those with radioactive proteins lost their radioactivity.
● This showed that it is the DNA that enters the bacteria from viruses and not proteins. Hence, it was concluded that
DNA is the genetic material.

Properties of the Genetic Material

● It should be able to replicate (duplicate to produce its identical copy).
● It should be chemically and structurally stable.
● It should have scope for changes that are essential for evolution.
● It should follow the Mendelian principles of inheritance.
 ● Difference between DNA and RNA:
DNA RNA
○ Has deoxy ribosesugar ○ Has ribose sugar
○ 5methyl uracil (thymine) is
○ Uracil is present in place of thymine.
present.
○ Mostly DNA acts as the genetic ○ RNA acts as a messenger and adaptor. It acts as a
material. genetic material in some viruses.
○ Presence of 2′ OH group at every nucleotide
○ DNA is stable.
makes RNA labile and easily biodegradable.
○ Chemically less reactive, mutates
○ Mutation in RNA is faster.
slowly
○ DNA requires RNA for protein
○ RNA directly codes for proteins.
synthesis. DNA →RNA →Protein
Why DNA is more stable than RNA?
● In RNA, a 2′ OH group is present at every nucleotide. This makes RNA unstable and degradable.
● Presence of thymine in place of uracil confers additional stability to DNA.
● RNA being a biocatalyst is more reactive.
● DNA is double stranded having complementary strand, which resists the changes by repair mechanism.
DNA Replication with Experimental Proof Machinery and Enzymes Involved
What is DNA Replication?
● DNA replication is the phenomenon in which a duplicate copy of DNA is synthesised.
● In replication, two strands of the DNA helix separate and each strand acts as a template for synthesing new
complementary strands.

● After completion of replication, the two copies so produced will have one parental and one newly synthesised
strand. This scheme of replication is called semiconservative replication.
Experiment to Prove That DNA Replicates Semi Conservatively
● Performed by - Messelson and Stahl
● E.coliwas grown in a medium containing heavy isotope 15N as the nitrogen source.
● 15 N was incorporated into newly synthesised DNA as well and the DNA became heavy DNA.
● Heavy DNA molecule can be differentiated from normal DNA by density gradient centrifugation using cesium
chloride as the gradient.
● Then, cells were again transferred into a medium with 14N as nitrogen source. Samples were taken from this
media and their DNA was extracted.
● E .colidivides every 20 minutes. Therefore, the DNA extracted after 20minutes had a hybrid density.
● DNA extracted after 40 minutes had equal amount of hybrid and light intensities.
● This implies that the newly synthesised DNA obtained one of its strands from the parent. Thus, replication is semi-
conservative.
Mechanism of DNA Replication ● Replication occurs in S phase of cell cycle.
● Enzyme involved DNA polymerase (DNA dependent DNA polymerase)
● Replication requires energy.Source of energy – Deoxy ribonucleoside triphosphates (DNTPs) DNTPs have dual
purpose - Act as substrates and provide energy also
● Replication initiates at specific regions in DNA called origin of replication.
● DNA polymerase polymerises a large number of nucleotides in a very short time.
● During the course of replication, two parent strands do not completely open, but a small opening forms in which
replication occurs. This small opening forms a replication fork.
● DNA polymerase can polymerise only in one direction that is 3' .
● Therefore, replication occurs smoothly at to end of DNA.(continuous replication, but occurs discontinuously at to
end)
● The discontinuous fragments so formed are joined by DNA ligase.
Transcription
● Transcription is the process of formation of RNA molecules from the DNA.
● During transcription, only a segment of DNA from only one of the strands participates.
● Both strands are not copied during transcription because:
○ If both strands get transcribed at the same time since the sequences of amino acid would be different in both (due
to complementarity), then two RNA molecules with different sequences will be formed, which in turn give rise to
two different proteins. Therefore, one DNA would end up giving rise to two different proteins.
○ Two RNA molecules so formed will be complementary to each other, hence would end up forming a double
stranded RNA leaving the entire process of transcription futile.
Transcriptional Unit
● A transcriptional unit has primarily three regions:
○ Promoter - Marks the beginning of transcription; RNApolymerase binds here
○ Structural gene - Part of the DNA that is actually transcribed
○ Terminator - Marks the end of transcription Template Strand and Coding Strand
● Enzyme involved in transcription, RNA polymerase (DNA dependent RNA polymerase), catalyses in only one
direction i.e., 5′ to 3′.
● Therefore, the strand with polarity 3′ →5′ acts as a template(Template Strand).
● The strand with polarity 5′ →3′ acts as coding strand (which is a monomer since it does not code for anything).
Coding strand has sequence similar to RNA formed after transcription except for the change that thymine is present
instead of uracil.
Gene
● The DNA sequence which codes for tRNA or rRNA molecule defines a gene.
● Cistron - Segment of DNA that contains the genetic code for a single polypeptide
● The structural genes could be of two types:
○ Monocistronic (mostly in eukaryotes)
○ Polycistronic (mostly in prokaryotes)
● Monocistronic genes have two parts:
○ Exon - Sequences that code for a particular character and is expressed in a matured and processed mRNA
○ Intron - Interrupting sequences that do not appear in a mature and processed mRNA
● Regulatory genes - Sequences that do not code for anything, but have regulatory functions
Types of RNA
● mRNA (messenger RNA) - It serves as a template for protein synthesis. DNA is transcribed to form an mRNA,
which in turn is translated to form protein. [Central dogma of molecular biology]
● tRNA (transfer RNA) - It brings amino acids during translation and reads the genetic code.
● rRNA (ribosomal RNA) - These are the work benches of translation.They play a structural and catalytic role
during translation. Transcription Process
● Transcription has three steps - initiation, elongation, and termination.
● Initiation:
○ RNA polymerase binds with the promoter to initiate the process of transcription.
○ Association with initiation factor (σ) alters the specificity of RNA polymerase to initiate the transcription.
● Elongation :
○ RNA polymerase uses nucleotide triphosphate as substrate, and polymerisation occurs according to
complementarity.
● Termination:
○ Termination occurs when termination factor (P) alters the specificity of RNA polymerase to terminate the
transcription.
● As the RNA polymerase proceeds to perform elongation, a short stretch of RNA remains bound to the enzyme. As
the enzyme reaches the termination region, this nascent RNA falls off and transcription is
terminated.

Complexities Associated with Transcription ● In prokaryotes:

○ There is no clear demarcation between cytosol and nucleus.Therefore, translation can begin even before
transcription is completed. Thus, in prokaryotes, transcription and translation are coupled.
● In eukaryotes:
○ Three different kinds of RNA polymerases are present.
RNA polymerase I transcribes rRNA.RNA polymerase II transcribes hnRNA (mRNA precursor). RNA polymerase
III transcribes tRNA, snRNA, and srRNA.
○ The precursor of mRNA, i.e. hnRNA, contains both introns and exons. Introns are removed and exons are joined
by a processcalled splicing.
○ Capping - In this, methyl guanosine triphosphate is added to the 5′ end of hnRNA.
○ Tailing - In this, adenylate residues are added to the 3′ end of hnRNA.
○ When hnRNA is fully processed, it is known as mRNA, which is transported out of the nucleus to get translated.

Genetic Code
● Genetic code directs the sequence of amino acids during the synthesis of proteins.
● George Gamow proposed that if 20 amino acids are to be coded by 4 bases, then the code should be made up of
three nucleotides. 4 3= 64 (4 2= 16), which is less than 20; so, the codon was proposed to be triplet.
● Har Gobind Khorana developed a chemical method to synthesise RNA molecules with defined combination of
bases.
● Nirenberg developed cell free systems for protein synthesis, which helped the code to be deciphered.
● The enzyme known as Severo Ochoa enzyme (polynucleotide phosphorylase) helped to polymerise RNA with
defined sequences in a template independent manner.
● It finally gave rise to the checkerboard for genetic code.
● Salient features of genetic code:
○ Codon is triplet. 4 3= 64 (61 codons code for amino acids while 3 are stop codons)
○ One codon codes for a single specific amino acid. Codons are unambiguous.
○ Codons are degenerate since some amino acids are coded by more than one codon.
○ Genetic code is universal. 1 codon codes for same amino acid in all species.
○ Codons are read continuous. They lack punctuations.
○ AUG has dual functions - Codes for Methionine and acts as a start codon
Effects of Mutations on Genetic Code
● Mutations include insertions, deletions, and rearrangements.
● Mutation results in changed phenotype and diseases such as sickle cell anaemia. (Change Glu →Val in gene
coding for beta globin chain of haemoglobin) Such mutations are called joint mutations .
● Insertion or deletion of a single base pair disturbs the entire reading frame in mRNA. Such mutations are called
frameshift mutations .
● Frameshift mutations hold the proof of the fact that codon is triplet because if we insert three or multiple of three
bases followed by the deletion of same number of bases, then the reading frame will remain unaltered.
tRNA
● tRNA is an adapter molecule. On one hand, it reads the genetic code and on the other hand, it binds to specific
amino acids.
● tRNA has an anticodon loopthat has bases complementary to the mRNA code and an amino acid acceptor end
where it binds to the corresponding amino acid.
● Initiation tRNA - This tRNA is essential for initiation of translation and has AUG in anticodon loop and Met in
amino acid acceptor end.
● There are no tRNAs for stop codons.

Translation
● The mRNA contains the genetic information, which is translated into the amino acid sequence with help of tRNA.
Amino acids are polymerised to form a polypeptide.
● Amino acids are joined by peptide bond.
● First of all, charging of tRNA (aminoacylation of tRNA) takes place. In this, amino acids are activated in the
presence of ATP and are linked to their corresponding tRNA.
● Ribosomes are the workbenches for translation. Ribosomes have 2 subunits: a large subunit and a small subunit.
● Smaller subunit comes in contact with mRNA to initiate the process of translation.
● Translational unit in an mRNA is the region flanked by start codon and stop codon.
● Untranslated regions (UTR) are the regions on mRNA that are not themselves translated, but are required for
efficient translation process. They may be present before start codon (5′ UTR) or after
stop codon (3′ UTR).
● Initiator tRNA recognises the start codon. (Initiation)
● Then tRNAamino acid complexes bind to their corresponding codon on the mRNA and base pairing occurs
between codon on mRNA and tRNA anticodon.
● tRNA moves from codon to codon on the mRNA and amino acids are added one by one. (Elongation)
● Release factor binds to stop codon to terminate the translation.(Termination)
Regulation of Gene Expression
● Regulation of gene expression could be exerted at following levels.
○ Transcriptional level (following of primary transcripts)
○ Processing level (splicing)
○ Transport of mRNA from nucleus to cytoplasm
○ Translational level
● In addition, metabolic, physiological, or environmental conditions regulate the expression of genes.
● Expression of genes coding for enzymes is required only when substrate for that enzyme is available. For example:
Lactose Glucose + Galactose
E.colisynthesises betagalactosidase, only when lactose is available.
● Regulation in prokaryotes
○ Gene expression is regulated by controlling the rate of transcriptional initiation.
○ The activity of RNA polymerase at a given promoter is regulated by accessory proteins. The accessory proteins
affect the ability of a promoter to recognise start sites.
○ A regulatory protein could be activator or repressor.
○ Accessibility of promoter is also affected by operators. Operator is the region located adjacent to promoter.
○ Each operon has a specific operator and a specific repressor.
○ Usually operator binds to a repressor protein.
Regulation of Lac Operon
LacOperon
● Operon - An arrangement where a polycistronic gene is regulated by a common promoter and regulatory genes
● Lacoperon, trpoperon, hisoperon, valoperon are the examples of such systems.
● The elucidation of lacoperon as a transcriptionally active system was first done by geneticist Jacob and
biochemist Monod.
● Genes constituting lac operon:
Gene Nature Function
igene Inhibitor It codes for repressor of lac operon.
zgene Structural It codes for βgalactosidase.Lactose Galactose + Glucose
It codes for permease, which increases the permeability of cell
ygene Structural
to βgalactosidase.

agene Structural It codes for transacetylase.

● All genes involved in lacoperon are required for metabolism of lactose.
● Inducer- Lactose acts as an inducer forlacoperon since it regulates the switching on and off of the operon.
● If lactose is provided to the growth media of bacteria in absence of any other carbon source, then it is transported
inside the cells by permease.
● For permease to be present and lactose to enter inside the cells, low level of expression of lacoperon must be
present all the time.
Regulation in Absence of Inducer
● In absence of inducer, igene transcribes to synthesise repressor mRNA, which translates to form repressor.
● This repressor binds with the operator region of operon and prevents RNA polymerase to transcribe genes - z , y ,
and a(negative regulation).
● Therefore, in absence of the products of these genes, metabolism of lactose ceases.

Regulation in Presence of Inducer

● Inducer binds with the protein product of gene i(repressor) and inactivates it.
● This inactivated repressor is unable to inactivate RNA polymerase enzyme and z , y , and a genes synthesise
their respective mRNA, which in turn gets translated to form βgalactosidase, permease, and
transacetylase.
● In presence of all these enzymes, the metabolism of lactose proceeds in a normal manner.

Human Genome Project (HGP)

● Joint venture of US department of energy and National Institute of Health (NIH); later joined by Welcome Trust
(UK)
● Launched in 1990, completed in 2003
● This project worked towards the determination of complete DNA sequence of humans.
● DNA is the storehouse of genetic information and determining its sequence of base pairs can solve many medical,
agricultural, environmental, and evolutionary mysteries.
Relationship of HGP with Bioinformatics
● Human genome (genome refers to the totality of genes that are present in a human being) contains 3 × 10 9base
pairs.
● Cost of sequencing 1 bp = US $ 3 Cost of sequencing 3 × 10 9bp = US $ 9 billion
● Enormous sequence data so generated would have required 3300 books containing 1000 pages each just for a
human genome.
● Hence, for storing, retrieving, and analysing this enormous data, a new branch of biology has been developed
known as bioinformatics.
● Genomes of many nonhuman models such as bacteria, yeast, Caenorhabditis elegans , Drosophila , plants (rice
and Arabidopsis ) have also been sequenced.
Preparation of Genetic and physical maps on Genome
● 2 methods are used - restriction polymorphism and microsatellites
● Restriction polymorphism - Specialized enzymes called restriction endonucleases are used to cut the genome at
specialized sites called restriction endonuclease recognition site and maps are prepared based
on it.
● Microsatellites - These are repetitive DNA sequences.
.
DNA Fingerprinting
Introduction
● DNA fingerprinting is a method for comparing the DNA sequences of any two individuals.
● 99.9% of the base sequences in all human beings are identical. It is the remaining 0.1% that makes every
individual unique.
● It is a really difficult and time consuming task to sequence and compare all 3 × 10 9bases in two individuals. So,
instead of considering the entire genome, certain specific regions called repetitive DNA sequences are used for
comparative study.
Methodology of DNA fingerprinting
● VNTR (variable number of tandem repeats) are satellite DNAs that show high degree of polymorphism.
● VNTRs are used as probes in DNA fingerprinting.
● First of all, DNA from an individual is isolated and cut with restriction endonucleases.
● Fragments are separated according to their size and molecular weight on gel electrophoresis.
● Fragments separated on electrophoresis gel are blotted (immobilised) on a synthetic membrane such as nylon or
nitrocellulose.
● Immobilised fragments are hybridised with a VNTR probe.
● Hybridised DNA fragments can be detected by autoradiography.
● VNTRs vary in size from 0.1 to 20 kb.
● Hence, in the autoradiogram, band of different sizes will be obtained.
● These bands are characteristic for an individual. They are different in each individual, except identical twins.
Applications of DNA Fingerprinting
● DNA fingerprinting is widely used in forensics since every DNA of every tissue from an individual has the same
degree of polymorphism.
● DNA fingerprinting forms the basis of paternity testing since a child inherits polymorphism from both its parents.
● It can be used for studying genetic diversity in a population and evolution.

Chapter -6
Evolution
Origin of Life
Year Scientist Theory/Experiment Conclusion
The universe
expanded from
1927 Lemaitre Big Bang theory explosion of a
primordial, hot
substance.
1924 Oparin and Chemical evolution preceded Simple organic
- Haldane organic evolution molecules originated
1929 from inorganic
precursors.
Amino acids were
Synthesis of biomolecules by
Stanley synthesised from
creation of similar conditions
1952 Miller and ammonia, oxygen, and
as primitive atmosphere on
Urey carbon dioxide inside
laboratory scale
specialised apparatus.
Urey and Miller experiment
● Primitive atmosphere had high temperature, volcanic storms, and reducing atmosphere,
containing CH 4, NH 3, H 2, etc.
● Urey and Miller took the same compounds in a closed flask along with water vapour at 800
º C and created an electric discharge.

● Formation of biomolecules such as amino acids, simple sugars, fats, etc. was observed in
the flask.

Theories of Evolution
● The theory of special creation or divine intervention was challenged by Charles Darwin.
● He made observations on his sea trip around the world aboard H.M.S. Beagle and
concluded that all existing living forms share similarities among themselves and also with
other life forms, which existed millions of years ago of which many are extinct.
● The evolution of life forms has been gradual and those life forms better fit in environments
that leave more progeny. This is called natural selection and is a mechanism of evolution.
● Alfred Wallace working in the Malay Archepelago also came to the same conclusion.

Evidences of Evolution
● Fossils- They represent plants and animals that lived millions of years ago and are now
extinct. Different aged rock sediments contain fossils of different life-forms, which probably
died during the formation of the particular sediment.
● Comparative anatomy and morphology- It shows evidences of the similarities and differences
between living forms of today and that of the prehistoric times. Some of the examples of
comparative anatomy and morphology are:
● Homologous organs- All mammals share the same pattern of forelimbs. Though they perform
different functions, they are anatomically similar. This is called divergent evolution and the
structures are called homologous structures (common ancestors).
● Analogous organs- The pair of organs is not anatomically similar, but performs the same
function (e.g., the wings of butterflies and birds). This is called convergent evolution .
● Adaptive melanism- In England, it was noted that before industrial revolution, the number of
white winged moths was more than that of dark melanised moth. However, after
industrialisation, there were more of dark melanised moths. The explanation was that after
industrialization, the tree trunks became darker with deposits of soot and smoke and hence,
the number of dark moths increased in order to protect themselves from predators while the
white winged ones were easily picked up by the predators.
● Similarly, the herbicide and pesticide resistant plants and animals and antibiotic resistant
bacteria are some of the evidences that point towards evolution.
Adaptive Radiation
● During his exploration of the Galapagos Islands, Darwin noticed that there were many
varieties of finches in the same island.
● They varied from normal seed eating varieties to those that ate insects.
● This process of evolution starting from a single point and radiating in different directions is
called adaptive radiation.
● The other example for this is the evolution of the Australian marsupials from a single
ancestor. Placental mammals also exhibit similarities to their corresponding marsupial.
Example: placental wolf and the Tasmanian wolf
● When more than one adaptive radiation occurs in an isolated geographical area, the
phenomenon is called convergent evolution.
Biological Evolution & Mechanism of Evolution
● According to Darwin, evolution took place by natural selection.
● The number of life forms depends upon their ability to multiply and their life span.
● Another aspect of natural selection is the survival of the fittest, where
nature selects the individuals, which are most fit, to adapt to their environment.
● Branching descentand natural selectionare the two important concepts of Darwin’s theory of
evolution.
● The French naturalist Lamarck observed that evolution occurs due to the use or disuse of
particular organs or body parts. For example, giraffe have developed long necks as a result
of attempts to eat leaves high up on trees.
● Darwin also observed that variations are inheritable and the species fit to survive the
most, leaves more offsprings. Hence, the population’s characteristics change, giving rise to
the evolution of new life forms.
Mechanism of Evolution
● Darwin did not quite explain how evolution gave rise to different species of the same
organism.
● Mendel mentioned about inheritable factors, which influenced the phenotype of an
organism.
● Hugo de Vries based on his work on evening primrose suggested that variations occurred
due to mutations.
● Mutations are random and directionless while the variations that Darwin talked about were
small and directional. Hugo de Vries gave the name saltation (single step large mutation) to
the mutations which brought about speciation.
Hardy Weinberg Principle
● The frequency of occurrence of alleles of a gene in a population remains constant through
generations unless disturbances such as mutations, nonrandom mating, etc. are introduced.
● Genetic equilibrium (gene pool remains constant) is a state which provides a baseline to
measure genetic change.
● Sum total of all allelic frequencies is 1.
● Individual frequencies are represented as p and q such as in a diploid, where p and q
represent the frequency of allele Aand a .
The frequency of AAis p 2 , that of aais q 2 , and that of Aais 2pq.
● Hence, p 2+ 2pq + q 2= 1, which is the expansion of (p + q) 2 .
● When the frequency measured is different from that expected, it is indicative of
evolutionary change.
● Hardy Weinberg equilibrium is affected by
● gene flow or gene migration
● genetic drift (changes occurring by chance)
● mutation
● genetic recombination
● natural selection
● Sometimes, the change in allele frequency is so prominent in the new sample of
population that they become a different species and the original drifted population becomes
the founder. This effect is called founder effect.
● The advantageous mutations that help in natural selection over the generations give rise
to new phenotypes and result in speciation.
Evolution of Plants and Animals
Evolution of Plants
● Cellular life forms occurred on earth about 2000 million years ago.
● Some of these cells had the ability to produce oxygen through reactions similar to
photosynthesis.
● Slowly, singlecelled organisms became multicellular.
● Seaweeds and some plants probably existed around 320 million years ago.
Evolution of Animals
● Animals evolved about 500 million years ago. The first of them to evolve were
invertebrates.
● Jawless fishes evolved around 350 million years ago.
● Some of the fishes could go on land, and then come back to water. These were the first
amphibians. In 1938, a fish Coelacanth, which was thought to be extinct, was caught in
South Africa. This variety of fish, called lobefins, is believed to have evolved into the first
amphibians.
● Amphibians evolved into reptiles. In the next 200 million years, reptiles of different sizes
dominated the earth. However, about 65million years ago, some of them such as dinosaurs
disappeared.
● The first among the mammals were small shrew like mammals.
● During continental drift when North America joined South America,primitive mammals
suffered, but pouched mammals of Australia survived the same drift because of lack of
competition from other mammals.

Origin and Evolution of Man

Year Evolution Characteristics
Dryopithecus (apelike) and Hairy and walked similar
15 mya
Ramapithecus(manlike) to chimpanzees
Not tall, but walked
3 - 4 mya Manlike primates
straight
Used stone weapons and
Australopithecines , also
ate fruits;human like with
2 mya called Homo habilis ,lived in
brain capacity of 650 -
EastAfrica
800 cc; not meat eaters
Brain capacity of about
1.5 mya Homo erectus
900 cc; were meat eaters
1,000 - Brain capacity of 1400
Neanderthal man
40, 000 ya cc; used hides
75, 000 - Homo sapiens
 10, 000
years ago
When we compare the skulls of an adult human being, baby chimpanzee, and adult
chimpanzee, we observe that skull of baby chimpanzee resembles human being more as
compared to adult chimpanzee.
 CHAPTER -7

HUMAN HEALTH AND DISEASE

Health as per WHO is defined as - “ A state of complete physical , mental and social well being of a person
and not merely absence of any disease or infirmity . ”
Importance of good health –
◾ Increases happiness at all levels – domestic , social , professional .
◾ Increases productivity .
◾ Brings economic prosperity .
◾ Increases longevity .
◾ Reduces mortality rate of society and country .
Factors that determine good health -
◾ Proper balanced diet
◾ Hygiene at all levels – personal , domestic and community
◾ Hygienic habits
◾ Exercise , yoga , relaxation
◾ Vaccination
◾ Proper disposal of waste
◾ Control of vectors
◾ No addiction
LEUCOCYTES –
 IMMUNITY
The overall ability of an organism to fight disease causing organisms is called immunity .

NATURAL
ACTIVE – BY INFECTION
PASSIVE – THROUGH MOTHER

ACQUIRED ARTIFICIAL
- ACTIVE – BY VACCINATION
- PASSIVE – BY INTRODUCING
IMMUNITY ANTIBODIES

PHYSICAL BARRIER
PHYSIOLOGICAL BARRIER
INNATE CELLULAR BARRIER
CYTOKINE BARRIER

INNATE IMMUNITY ACQUIRED IMMUNITY

1 It is present since birth , it is inherited . This is acquired by an organism during his life due to
encounter with pathogen .
2 It is not pathogen specific . It is highly pathogen specific and has memory too .
3 It includes physical and physiological barriers It involves action of antibodies .

INNATE IMMUNITY
It provides different types of barriers to the entry of foreign agents in our body .

◾ Physical barriers – Skin , mucus lining of respiratory , urino-genital and gastrointestinal tract .
◾ Physiological barriers – Acid in stomach , saliva in mouth , tears in eyes , cerumen in ear .
◾ Cellular barrier – Some cells of our body can destroy pathogen by Phagocytosis . Ex – Poly morpho nuclear
leucocytes (PMNL ), monocytes , killer – T cells , macrophages in tissues.
◾ Cytokine barriers – this refers to special proteins called interferons produced by virus infected cells . These
interferons can protect neighbouring cells from further viral infection .

ACQUIRED IMMUNITY –

This is acquired by an organism during his life due to encounter with pathogen .
◾ When our body encounters a pathogen for first time it produces a response which is called Primary response . It
is of low intensity .
◾ Subsequent encounters with the same pathogen produces a highly intensified Secondary or Anamnestic
response . This shows that our immune system has strong memory .
 ACTIVE IMMUNITY
1 Produced by active participation of host’s immune
system .
2 It occurs due to production of antibodies by the
host due to contact with pathogen .
3 Immunological memory is present .
4 Slow in action but effectiveness is high and
produces long term protection.
Ex – Due to natural infection , due to vaccination (
BCG , DPT etc.)
B CELLS
1 They are formed in bone marrow and mature in
bone marrow itself .
2 They provide humoral immunity - outside infected
cells through antibodies present in blood .
3 They have two components – plasma cells and
memory cells .
4 They constitute 20% of the lymphocytes .
5 They do not respond against cancer cells, tumor
and transplants .
6 They do not have inhibitory effect on immune
system .
PASSIVE IMMUNITY
This immunity is not produced by participation of host’s
immune system.
It is produced due to introduction of antibodies from
outside source .
Immunological memory is not present .
Fast in action and produces short term protection .
Ex- anti tetanus serum , rabies vaccine , anti venom
against snake bite ,antibodies received by baby through
colostrum or foetus through placenta .
T CELLS
They are formed in bone marrow but mature in thymus .
They provide cell mediated immunity – inside infected
cells . They reach sites of infection .
They have three components – helper cells ,
cytotoxic/killer cells , suppressor cells .
They constitute 80% of the lymphocytes .
They respond against cancer cells , tumour and
transplants ( Killer T cells)
Suppressor T cells reduce activity of immune system
when needed .
 ◾ Antibodies are special proteins produced by plasma B cells in response to antigens .
◾ Each Ig has four peptide chains held in position by disulphide bridges .
◾ The two small chains are called light chains and the longer ones are called heavy chains . Hence the structure is
said to be H2L2.
◾ There is an antigen binding site where the antigen binds and is rendered harmless .
◾ Types of immunoglobins – IgA , IgM ,IgE , IgG .
LYMPHOID ORGANS -
◾ Primary lymphoid organs- B and T cells differentiate and proliferate in these organs. Ex- bone marrow and
thymus. Thymus is quite large during birth but slowly it reduces in size. Both bone marrow and thymus provide
microenvironment for development and maturation of T-cells .
◾ Secondary lymphoid organs – These are the sites where B and T cells interact with antigens and become effector
cells . Ex- lymph nodes , spleen , Mucosa Associated lymphoid tissue (MALT) , adenoids etc .
◾ Spleen is a large bean shaped organ . It contains lymphocytes and phagocytes . It filters blood borne
microorganisms . It is also a reservoir of erythrocytes .
◾ Lymph nodes are solid structures located along the lymph vessels . They trap antigens present in lymph and
tissue fluid . The lymphocytes present in lymph nodes get activated and produce an immune response .
◾ Mucosa - The inner most wall of gastro-intestinal tract , respiratory tract and uro- genital tract also has patches
of lymphoid tissue collectively called MALT .
IMMUNISATION -

◾ The principle of immunisation is based on the property of antigen specificity and memory of the immune system
◾ In vaccination , vaccine ( inactivated /weak pathogen , antigen protein of pathogen) is introduced in the body .
◾ The antibodies produced in the body due to introduction of vaccine would neutralize the pathogenic effect
during actual infection .
◾ The vaccine also generates memory B and T cells
◾ Sometimes when a person is infected with deadly microbe , readymade antibodies are introduced . This type of
immunisation is called Passive immunity .

DISEASE ( DIS +EASE )

⦿ A condition when functioning of one or more organ or organ system is adversely affected .
⦿ The person is not at ease and has signs and symptoms of the disease.
⦿ For being disease free one has to be careful about his
➢ Food and food habits
➢ Hygiene and hygienic habits
➢ Immunization at proper time .
➢ Exercise and relaxation .
➢ Avoid any addiction .
TYPES OF DISEASE
A) Non – infectious diseases -
1. Genetic disorders – haemophilia , thalassemia , colour blindnes etc .
2. Congenital diseases-
3. Deficiency diseases – anaemia , night blindness , scurvy , rickets etc .
4. Occupational disorders – silicosis , asbestosis , pneumoconiosis etc.
5. Life style disorders – obesity , hypertension ,
6. Organic diseases – cancer , arthritis , heart problems etc
 B) Infectious diseases – measles , diphtheria , cholera , malaria , dengue etc .
INFECTIOUS vs NON- INFECTIOUS
⦿ Infectious diseases are those that are transmitted from infected to healthy person
⦿ Ex- influenza , tuberculosis , COVID-19 , AIDS , syphillis , typhoid , dysentry , ringworm , elephantiasis ,
pneumonia ,polio etc.
⦿ Non- infectious diseases are those that are not transmitted from sick to healthy person .
⦿ Ex- cancer , hypertension , arthritis , renal calculi , artherosclerosis , liver cirrhosis ,etc.
PATHOGENS
Disease causing microbes are called pathogens . The various categories of pathogens are –
a. Bacteria – cholera , tuberculosis , typhoid , pneumonia etc .
b. Virus – influenza , common cold , AIDS , COVID -19 , SARS , Ebola , measles , polio ,dengue etc
c. Fungi – ringworm , athletes foot , eczema, chlamydiasis etc
d. Protozoa – malaria , amoebiasis , sleeping sickness etc
e. Helminths (worms) – ascariasis , taeniasis , elephantiasis , trichomoniasis etc .
MODES OF INFECTION
⦿ Through air ( droplet infection)- tuberculosis , COVID -19 , influenza , chicken pox etc
⦿ Through contaminated food and water – polio dysentry , typhoid , hepatits –A , diarrhoea etc
⦿ Through direct/indirect contact with patient –AIDS , hepatitis –B, chicken pox , measles , COVID-19 ,
ringworm etc .
⦿ Through vectors – malaria , sleeping sickness , dengue , elephantiasis , plague etc .
PREVENTION IS BETTER THAN CURE
It is a very famous saying which we need to apply always . Whether infectious or non infectious diseases (
leaving genetic disorders ) it’s better we prevent ourselves than suffer from the disease .
If we prevent ourselves by taking care of factors that determine good health , we will be safe from diseases.
We will not have to bear the pain of the disease and also spend money on medicines .

DISEASE PATHOGEN MODE OF INFECTION TARGET ORGAN SYMPTOMS

TYPHOID Salmonella typhi contaminated food small intestine a)sustained high fever(39-40C)
and water b)weakness
bacteria c) stomach pain and constipation
d) loss of appetite .
PNEUMONIA Streptococcus through air ( droplet alveoli of lungs a)fever
pneumonia infection) b)cough
bacteria Haemophilus using articles of c) chills and headache
influenzae patient d) finger nails and lips may turn gray
to bluish .
COMMON Rhino virus through air ( droplet nasal chamber a) nasal congestion and discharge
COLD infection) respiratory tract b) sore throat with hoarseness
using articles of c)cough
virus patient d)headache
AIDS Human immuno i)sexual contact with macrophages a) Fever
deficiency virus patient. ii)transfusion and b) unexplained weight loss
(HIV) of infected blood . T lymphocytes c)diarrhea
virus iii)using infected d) swelling in lymph nodes
needles , razor etc e) patient becomes prone to simple
infections .
 iv)from infected f) loss of memory and speech .
mother to fetus/baby g) it may even cause death.
MALARIA Plasmodium vivaxP bite of female liver a) chills and high fever that repeat
falciparum Anopheles mosquito RBC after specific pattern .
protozoa P ovale b) lackof appetite , jaundice
P malariae c) anaemia , weakness .
AMOEBIASIS Entamoeba contaminated food large intestine a) constipation
histolytica and water houseflies b) abdominal pain and cramps .
protozoa behave ascarrier c)stool with mucus and blood clots

ASCARIASIS Ascaris unwashed fruits and intestine a) fever

lumbrocoides vegetables b) muscular pain in abdomen
helminth soil c) internal bleeding and anaemia
d) blockage of intestine .
ELEPHATIASIS Wuchereria bite of female Culex lymphatic a)chronic inflammation of lower
bancrofti W mosquito vessels of lower limbs and genitals leading to
helminth malayi limb deformity.
Ringworm Microsporum through soil skin a) scaly lesions on various parts of
Trichophyton using articles of scalp body .
fungus Epidermophyton infected person like nails b) intense itching in the lesions.
towel,comb.

• Test for typhoid – Widal test

• Test for AIDS – ELISA ( Enzyme linked Immuno Sorbent Assay )
• Plasmodium falciparum cause the most dangerous malaria .

LIFE CYCLE OF PLASMODIUM VIVAX –

• The infective stage in life cycle of Plasmodium is Sporozoite . Sporozoites are present in the salivary gland of
female Anopheles mosquito .
• The sporozoites enter blood through mosquito bite and then infect liver cells .
• In the liver cells it completes one phase of asexual cycle . The next stage of life cycle ( merozoites) infect the
RBC. In the RBC the parasite reproduces asexually .
• The parasite destroys haemoglobin and produces a toxin called haemozoin .
• When RBCs rupture , haemozoin is released . It causes chills and fever .
• The parasite continues it’s asexual cycle in RBC through different stages – cryptozoites , merocryptozoites .
• In RBC gametocytes are also produced which are sucked by mosquito when it bites an infected patient .
• The gametocytes then form gametes and fertilization takes place in the gut of mosquito . The ookinetes get
embedded in the stomach wall and then transform to sporozoite . They travel to the salivary glands and are
stored there .

Acquired Immuno Deficiency Syndrome (AIDS)

• Caused by Human Immuno Deficiency Virus which is a retro virus – has RNA as genetic material . It has two
strands of RNA which is surrounded by a protein coat called capsid which in turn is surrounded by a
glycoprotein coat . Each strand of RNA is associated with enzyme Reverse transcriptase .
 • The target organs are macrophages present in areolar connective tissue and the Helper T cells or T4
lymphocytes .

(This figure is very important from exam point of view .)

➢ The viral RNA enters macrophage .
➢ Reverse transciptase makes viral DNA from viral RNA by the process of reverse transcription .
➢ Viral DNA gets incorporated into host genome .
➢ Viral RNA is produced which in turn makes the viral protein and glycoprotein needed for it’s coat .
➢ They get assembled and form new viruses .
➢ The new viruses are released. They infect new macrophages and T4 lymphocytes and destroy T cells.
➢ Each macrophage behaves as factory for making virus .
➢ The number of T cells reduce hence decreasing the immunity of the body .
• Pathological Test – ELISA ( Enzyme linked Immuno Sorbent Assay )
• Cure – there is no cure but a combination of drugs can reduce the symptoms and prolong the life of patient.
 • Prevention –
I. Follow monogamy and avoid unsafe sexual practices .
II. Use of disposable syringe should be followed .
III. Blood should be screened before transfusion .
IV. Sharing of needles , razors should be avoided .
➢ Awareness towards AIDS –
I. National AIDS Control Organisation ( NACO ) is working towards creating awareness among people
about the seriousness of the disease and preventive measures to be followed .
II. 1 st Dcember is observed as World AIDS Day to create awareness .
III. Many NGOs have also joined hands to create awareness .
IV. Patients should not be considered as a stigma in the society but should be treated as a normal person .

ALLERGY

• An exaggerated response of the immune system to certain antigens present in the environment is called allergy .
• The substances to which such exaggerated response is produced are called allergens – chemicals , dust , pollen ,
animal fur , some components of food etc.
• Symptoms –
I. Sneezing
II. Watery eyes
III. Running nose
IV. Difficulty in breathing
V. Rashes on skin
• The Immunoglobin IgE is responsible for producing allergic response .
• Allergy is caused due to release of histamine and serotonin from mast cells .
• Drugs like anti-histamine , adrenalin and other steroids reduce allergic response .
• Modern day children are more prone to allergy due to the over protected environment they live in during early
stages of life .

AUTO IMMUNITY DISEASES

• Memory based immunity is based on the ability of our immune system to differentiate between foreign
substances and self cells .
• Sometimes due to genetic disorder or other reasons our immune system attacks self cells and starts destroying
it . This is called auto immune disorder .
• Examples – Rheumatoid arthritis ,Type 1 diabetes , Hashimoto disorder , Psoriosis etc.

CANCER

Cancer is one of the most dreadful disease that causes lot of deaths every year all over the globe .

In our body new cells are formed , they grow and differentiate . It takes place in a controlled manner . Cells do
not divide in an uncontrolled manner . This is due to a property called contact inhibition .

CONTACT INHIBITION – It is property shown by normal cells by the virtue of which they do not divide in an
uncontrolled manner due to contact with neighbouring cells .
Cancer – It is a disorder where cells start dividing in an controlled manner because they lose the property of
contact inhibition . That is they keep dividing without differentiating . This causes starvation of neighbouring cells
of nutrients .

NORMAL CELLS CANCEROUS CELLS

1 Normal cells divide in a controlled manner . cancerous cells divide in an uncontrolled manner .
2 They grow and differentiate They do not grow and differentiate but only divide .
3 Cells have definite shape and boundary . Cells do not have definite shape and boundary .
4 They show property of contact inhibition . They do not show property of contact inhibition .
5 They do not starve neighbouring cells off nutrients They starve neighbouring cells off nutrients .
6 They tend to stick together and do not show They do not form clusters and show metastasis .
metastasis
METASTASIS-When cancer cells break off from their primary tumor ( original location ) ,travel through blood
stream or lymphatic system and form a new tumor in other organ or tissue of the body , it is called metastasis .It
is at this stage that cancer becomes dangerous and difficult to cure .

Causes of Cancer - Normal cells of our body have genes called cellular oncogenes (c-onc) or proto oncogenes
which are inactive . When they get activated by certain factors , the cells lose contact inhibition and start
dividing in an uncontrolled manner causing cancer . Those substances that convert normal cells into cancerous
cells are called carcinogens . Few carcinogens arecas follows –

➢ Chemical agents – nicotine , aniline dyes , benzopyrene , aflatoxin , asbestos dust etc

➢ Physical agents – Ionising radiations like X-rays , gamma rays ; Non-ionising radiations like UV rays .

➢ Biological agents – oncogenic virus like Papiloma virus .

TUMOR – Due to uncontrolled division of cell undifferentiated mass of cells are formed called tumor . Tumor
can be of two types -

BENIGN TUMOUR MALIGNANT TUMOR

1 It is non cancerous .
2 It stops growing after reaching a certain size
3 It is enclosed in a sheath
4 Limited adherence occurs amongst cells.
5 It is not invasive and does not show metastasis .
It is cancerous .
It continues growing and growth is indefinite
It is not enclosed in a sheath
There is no adherence amongst cells .
It is invasive and shows metastasis .

6 It is not fatal . It is may be fatal

CANCER DETECTION – There are different ways by which cancer can be detected –

I. Histopathological test or biopsy – In biopsy , a piece of suspected tissue is cut into thin section , is stained and
observed under microscope .
II. Radiography – Using X ray for getting images of suspected tissues .
III. Computed tomography ( CT scan ) – Uses X-rays for generating 3-D images of suspected tissue .
IV. Magnetic resosnance imaging (MRI) – Uses strong magnetic field and non-ionising radiations for generating 3-D
images of suspected tissue . It gives better depth of the tissue .
V. Monoclonal antibodies – These antibodies respond to cancer specific antigens and are very helpful in detecting
cancer .
 TTREATMENT OF CANCER – The common approaches are –

I. Surgery – This is used for removing the tissue that has become cancerous .
II. Radiation therapy – Tumor cells are irradiated lethally taking care that healthy tissues are not damaged .
III. Chemo therapy – In this method chemotherapeutic drugs are used for killing canceros cells and also for
controlling their uncontrolled division . They have side effects like hair loss , anaemia .
In majority of cases combination of radiotherapy , chemotherapy and surgery is used .
IV. Immunotherapy – patients are given biological response modifiers like ά- interferons which activate the immune
system and help in destroying the tumor/cancer .

DRUGS , DRUG ABUSE , DRUG

ADDICTION

Class of drug Source Available as Taken as Organ affected Effects

Opioids latex of plant smack – obtained from injection or by Binds to receptors It is a depressant
Papaver acetylation of snorting present in central and slows down
somniferum morphine extracted nervous system body function .
(poppy) from latex . and gastro-
also available as intestinal tract
heroine .
Cannabinoids Leaves ,resin and Marijuana , hashish , orally or by Binds to receptors Effects cardio-
inflorescence of charas , ganja . inhalation present in brain vascular system .
Cannabis sativa
( bhang)
Cocaine Seeds of coke , crack by snorting It interferes with Stimiulates central
Coca alkaloid Erythroxylum coca transmission of nervous system ,
neurotransmitter produces a sense
dopamine of euphoria and
hallucinations .
Other drugs Datura --- ---- --- hallucinogenic
Atropa belladona
• Most of the drugs mentioned above are used for medical purposes like morphine is commonly used as a
sedative and pain killer . Drugs like barbiturates , Lysergic acid diethyl amides ( LSD) extracted from fungus
Claviceps , benzodiazepines are used for treating patient with mental illness , depression and insomnia .
• Tobacco- It is used as chewing tobacco or in cigarettes . It is obtained from leaves of Nicotiana tabaccum . The
feeling of happiness is due to alkaloid nicotine . It causes cancer and also causes cardiovascular ailments .
• Alcohol- Drinking alcohol like use of tobacco is a common form of addiction found in people . Drinking alcohol
effects cerebellum so the person loses control about body balance , speech . Prolonged use effects liver , heart
and kidney .

OPIOID CANNABINOID COCA ALKALOID

DRUG ABUSE - When drugs are taken for purposes other than medicinal or taken in amounts or frequencies that
impair physical , physiological and psychological functions it is called drug abuse .

DRUG ADDICTION - It is the psychological attachment to certain effects of well being associated with drugs
and alcohol intake .

ADOLESCENTS AND DRUG

ADDICTION

REASONS OF DRUG ADDICTION-

⚫ Curiosity , need for adventure excitement and experiment .
⚫ To escape from stress , depression and frustration .
⚫ To overcome hardships of life .
⚫ Unstable and unsupportive family structure .
⚫ Peer pressure .
⚫ Social pressure .
EFFECTS
⚫ Loss of judgement , will power , emotional and self control
⚫ Drop in academic performance .
⚫ Lack of interest in personal hygiene .
⚫ Isolation , deteriorating relationship with family and friends
⚫ Weight loss .
⚫ Aggressive and rebellious behaviour , mood swings .
⚫ Decreased sperm count in males , enlargement of mammary glands , reduction in size of testes .
⚫ Hoarsening of voice ,irregular menstrual cycles , reduction in size of mammary glands in females .
⚫ Addiction may even cause severe damages to organs like cancer , liver cirrhosis in case of alcohol addiction .
PREVENTION AND CONTROL
⚫ Avoid undue peer pressure .
⚫ Seek help from family and friends .
⚫ Identifying danger signs in adolescents addicted with drug or alcohol .
⚫ Education and counseling .
⚫ Seeking professional and medical help

Withdrawal syndrome- The unpleasant manner in which body reacts if regular dose of drugs or alcohol is
abruptly discontinued is called withdrawal syndrome .
 CHAPTER – 8

MICROBES IN

HUMAN WELFARE
Microbes are found almost everywhere , even in very harsh conditions . Many of them pose serious threat to
life by causing diseases .But since ages they have been used for beneficial purposes by humans too . Use of
fermented food and drinks has been a part of ancient human civilizations . Used of curd also dates long back .
So let us know more about benefits of microbes in different fields .

IN THE FIELD OF FOOD INDUSTRY –

NAME OF MICROBE USE
1 Lactic Acid Bacteria (LAB) Used for making curd from milk . Lactobacillus acts on lactose present in milkand
Lactobacillus forms lactic acid that causes coagulation of milk proteins . Thus curd is formed .

2 Saccharomyces cerevisiae 1. Extensively used in bakery items for making it soft and fluffy .
Baker’s yeast or Brewer’s 2. Extensively used in making wine and other beverages from plant juices .
yeast 3. Also used for making dishes like dhokla , bhatura
3 Propionibacterium sharmanii Used for making Swiss cheese which has large holes due to production of large
amount of CO2 .
4 Penicillium roqueforti Used for ripening a special Roquefort cheese that has specific flavour .
1. Benefits of using curd –
• When curd is made from milk , the bacteria partially digest protein . hence digesting curd is easier than milk .
• Curd has an extra supplement of vitamin B 12.
• They reduce growth of harmful bacteria in gut . Thus curd is used as probiotics also .
2. The bakery items become soft and fluffy due to holes created in the dough . When yeast is added to dough , it
acts on the carbohydrate and produces CO2 . Production of CO2 causes holes .
3. Fermentors are large vessels in which fermentation is carried using Yeast ant plant juices . The anaerobic action
of yeast on plant juices produces ethanol .
4. Some traditional food and beverages made by fermentation are – idli , dosa , pickle of bamboo shoot ,
fermentation of soyabean , toddy prepared from sap of palm , fermented rice etc .

IN THE FIELD OF MEDICINE AND OTHER BIOMOLECULES –

NAME OF THE MICROBE
1 Penicillium notatum
2 Monascus purpureus
3 Trichoderma polysporum
4 Streptococcus
5 Aspergillus niger
6 Acetobacter aceti
SOURCE OF USE
antibiotic Penicillin Used for curing bacterial infection .
Statins Used for lowering blood cholesterol . Statin
inhibits action of enzyme that synthesizes
cholesterol thus lowers cholesterol level .
Cyclosporin -A Used as immuno-suppressant in patients with
organ transplant . This prevents rejection of
organ by body .
Streptokinase Used as a clot buster for removing clots from
blood vessels of patients who are suffering
from myocardial infarction .
Citric acid Used for large scale production of citric acid
Acetic acid Used for large scale production of vinegar .
7 Lactobacillus lactic acid Used for large scale production of lactic acid
8 Clostridium butyricum Butyric acid Used for large scale production of butyric acid
 DISCOVERY OF PENICILLIN –

• Alexander Fleming while working with Staphylococcus bacteria observed that in some of his unwashed culture
plates the bacteria could not grow well . On close observation , he found that it was due to a chemical penicillin
produced by fungus Penicillium notatum . His discovery of antibiotic property of Penicillium in 1928 was just
accidental .
• The antibiotic property of Penicillin was established by Ernest Chain and Howard Florey in 1945 .
• Penicillin proved to be a wonder drug . It very effectively cured many bacterial diseases like tuberculosis ,
diphtheria , leprosy . It was also used for curing soldiers in second world war .

Q . Why are bottled fruit juices clearer than home made juices ?

A. Bottled fruit juices are treated with enzymes cellulose ,pectinase and protease that digest all the suspended
fibres . So bottled fruit juices are clearer than home made juices .

Q. Name the enzyme present in detergents and also state is role .

A. Detergents have enzyme lipase . This enzyme digests oily stains on cloth and helps in better cleaning .

IN THE FIELD OF AGRICULTURE –

Microbes gave always played a major role in agriculture . They naturally help to maintain soil fertility by
process of decomposition . By doing so they return the nutrients to soil . But with the onset of cultivation of
hybrid plants , the use of fertilizers and pesticides increased . This damaged the chemical nature of soil and
reduced it’s water holding capacity . It also caused water pollution of nearby water bodies . So , the use of
microbes as fertilizer and biopesticide is increasing in order to maintain the soil quality .

S NAME OF THE MOICROBE NATURE ROLE

NO
1 Rhizobium symbiotic bacteria lives in root nodules of leguminous plants
and fixes nitrogen thus enriching soil .
2 Nostoc , Anabena , Oscillatoria blue green algae / cyanobacteria fixes nitrogen and grows well in water
logged soil like paddy field .
3. Azotobacter , freeliving , nitrogen fixing bacteria fixes nitrogen . spores are mixed with
Azospirillum,Clostridium water and sprayed .
4 Glomus fungus that forms mycorrhizal This association improves the resistance
association with roots of higher towards salinity , drought and root borne
plants pathogens . It also increases the
absorption of phosphorus by plants .
5 Bacillus thuringiensis bacteria with insecticidal property spores of bacteria are mixed with soil and
sprayed on leaves of crops . On eating
such leaves , the insect larvae die .
6 Baculovirus they belong to the genus they are excellent candidates for species
Nucleopolyhedrovirus specific , narrow spectrum insecticidal
application .
7 Trichoderma Free living fungi They are effective biocontrol agents of
root borne pathogens .

Q1. What is organic farming ? What practices does it include ?

 Ans – Organic farming refers to no or minimal use of chemicals like fertilizers , weedicides and pesticides and
more dependence on green manure , biofertilizers and biopesticides .In green manuring ,legumes which are not
of commercial importance like guar , clover etc are grown and then before they start flowering , they are
mulched in soil – mixed with soil by ploughing .

Q2. Name few insects that are use as pest control agents .

Ans – Ladybird and dragon flies are used for controlling Aphids and mosquitoes . Cochineal insect is used for
controlling weed Opuntia .

Q3. How does spraying of spores of Bacillus thuringiensis control pest ?

Ans – The spores are sprayed on the leaves . When the insect larvae eat such leaves , the spores reach their gut
and perforate the inner walls of gut . Thus the insect larvae get killed . The adult flies remain unaffected .

Q4. What is integrated pest management ? How are Baculovirus useful in this management ?

Ans –Integrated Pest Management (IPM) aims at destroying only the pest and conserving the useful insects of
the ecosystem . Baculovirus used as biological control agents fall in the genus Nucleopolyhedrovirus . These
viruses are excellent candidates for species specific , narrow spectrum insecticidal application . They are very
specific about which species they have to target . They do not cause any damage to non targeted insects , plants
, mammals , fishes and bird.

BIOGAS PLANT –
• Developed in India mainly due to efforts of Khadi and Village Industries commission (KVIC)
• So it is set up in rural background .
• CONSTRUCTION –
➢ It consists of a concrete tank which is underground .
➢ The tank has an inlet for feeding slurry .
➢ It has an outlet for taking out sludge .
➢ The chamber has a dome shaped floating roof .
➢ The chamber has an outlet for collecting biogas .
• WORKING –
➢ Cattle excreta and farm waste is collected and mixed with water and made into a slurry .
➢ They are fed in the concrete chamber .
➢ Methanogens , the anaerobic bacteria present in the dung of cattles act on cellulose and produces biogas .
➢ Biogas is rich in methane , hydrogen and CO2 . Biogas is very efficient and clean fuel .
➢ As the biogas is produced the floating roof rises . The gas is collected through pies and sent for generating
electricity or as domestic fuel .
➢ The spent slurry or sludge is removed and used as manure in fields .
SEWAGE TREATMENT PLANT ( STP)–
Sewage refers to municipal waste water – water generated from houses , schools , hotels etc containing
organic matter like human excreta , vegetable waste etc .

The organic matter present in sewage harbours several pathogenic microbes . If it is diposed in water
bodies without treatment it will cause these harms –

• Spread of water borne diseases

• Decrease in level of dissolved oxygen present in water as lot of oxygen is used for decomposing organic
matter .

BIOCHEMICAL OXYGEN DEMAND (BOD)–

• It is defined as the amount of oxygen that would be consumed if all the organic matter in one liter of
waterwere oxidized by bacteria .
• More the organic matter , higher is the BOD .
• Hence BOD is an indicator of water

pollution .STEPS OF SEWAGE TREATMENT –

1. PRIMARY TREATMENT – this involves physical removal of large and small particles by filtration
and sedimentation . All the solid that settles down is called primary sludge that is converted to
manure . thesupernatant water sent for secondary treatment is called effluent .
2. SECONDARY TREATMENT / BOLOGICAL TREATMENT – Effluent is passed on to aeration tank where the
followingsteps are taken –
a. Effluent is constantly agitated by bubbling air into it .
b. A small innoculum of floc is added to the tank . Floc refers to masses of bacteria and fungal
filament thatform a mesh .
c. Bubbling of air causes vigorous growth of floc . While the floc is growing , the suspended organic
matterof water is consumed thus reducing the level of pollution .
d. This reduces the BOD of effluent . Intermittently BOD is checked to see level of pollution .
3. TERTIARY TREATMENT –
a. The effluent is then sent to settling tank .
b. Bacterial and fungal floc settle down .
c. The sediment is called activated sludge .
d. A small amount of floc is pumped into aeration chamber as innoculum .
e. Major part of activated sludge is sent to anaerobic sludge digester where it is digested by
anaerobicbacteria . Biogas is produced and the solid waste left over is used as manure in
fields .

NOTE – Ministry of Environment and Forest (MoEF) has initiated Ganga Action Plan(GAP) and
Yamuna Action Plan(YAP) to protect our major rivers . STPs have been set up for treating water before
being discharged into water bodies .
 Ch.9-Bio technology: Principles and Processes
Genetic engineering allows us to isolate and introduce only one or a set of desirable genes without introducing
undesirable genes into the target organism.

GENETIC ENGINEERING INVOLVES-

• Creation of recombinant DNA

• Use of gene cloning
• Gene transfer
The likely fate of a piece of DNA, which is somehow transferred into an alien organism :
➢ Most likely, this piece of DNA would not be able to multiply itself in the progeny cells of the organism
➢ But, when it gets integrated into the genome of the recipient, it may multiply and be inherited along with
the host DNA. This is because the alien piece of DNA has become part of a chromosome, which has the ability
to replicate. In a chromosome there is a specific DNA sequence called the origin of replication, which is
responsible for initiating replication. Thus, an alien DNA is linked with the origin of replication, so that, this
alien piece of DNA can replicate and multiply itself in the host organism. This can also be called as cloning or
making multiple identical copies of any template DNA.

CONSTRUCTION OF THE FIRST ARTIFICIAL RECOMBINANT DNA MOLECULE

The construction of the first recombinant DNA was accomplished by Stanley Cohen and Herbert Boyer in
1972. They adopted the following procedure.
• They isolated antibiotic resistance gene by cutting out a piece of DNA from the plasmid.
• The cutting of DNA at specific locations was done with the help of restriction enzymes popularly called as
‘molecular scissors.
• The cut piece of DNA with antibiotic resistance gene was then linked with the plasmid DNA of Salmonella
typhimurium acting as vector with the help of the enzyme DNA ligase.
• This new autonomously replicating DNA created in vitro with linked fragment of antibiotic resistant gene is
called recombinant DNA
• Recombinant DNA was then transferred into Escherichia coli, where it could replicate using the new host’s
DNA polymerase enzyme. The ability to multiply copies of antibiotic resistance gene in E. coli was called
cloning of antibiotic resistance gene in E. coli.

3 BASIC STEPS IN GENETICALLYMODIFYING ORGANISM

1. Identification of Genes with Desirable Genes

2. Introduction of desirable gene into the host
3. Maintenance of introduced DNA in the host and its transfer to progeny

TOOLS OF RECOMBINANT DNA TECHNOLOGY:

The key tools are
• Restriction enzymes
• Polymerase enzymes
• Ligases
• Vectors
• The host organism

Restriction Enzymes:

• Restriction enzymes belong to a larger class of enzymes called nucleases.

• These are of two kinds; exonucleases and endonucleases.
Exonucleases remove nucleotides from the ends of the DNA whereas, endonucleases make cuts at specific
positions within the DNA so that single stranded free ends called ‘sticky ends’ project from each fragment of
DNA duplex.
• In 1963 two restriction enzymes responsible for restricting the growth of bacteriophage in Escherichia coli
were isolated. One of these added methyl groups to DNA, while the other cut DNA. The later was called
restriction endonuclease.
The first restriction endonuclease–Hind II was isolated and characterized in1968. It cuts DNA molecules at a
particular point by recognizing a specific sequence of six base pairs. This specific base sequence is known as
the recognition sequence for Hind II.

FUNCTIONING OF RESTRICTION ENDONUCLEASE

• Each restriction endonuclease functions by ‘inspecting’ the length of a DNA sequence.

• Once it finds its specific recognition sequence, it will bind to the DNA and cut each of the two strands of the
double helix at specific points in their sugar-phosphate backbone.
• The recognition sequence of each restriction endonuclease consists of a definite number of specific base pairs
in DNA double helix called palindromic nucleotide sequence. Palindromes are groups of letters that form the
same words when read both forward and backward.
Steps in the formation of recombinant DNA by the action of restriction endonuclease enzyme –EcoR1.

SUMMARY OF RECOMBINANT DNA TECHNOLOGY (rDNA technology)

• -The restriction enzyme cuts both the vector DNA and the foreign DNA at the same site. It cuts each of the
two strands of the DNA double helix at specific points in their sugar-phosphate backbone.
• This leaves overhanging sticky ends in foreign DNA and vector DNA.
• Sticky ends form hydrogen bonds with their complementary cut counterparts. This stickiness of the
end facilitates the action of enzyme DNA ligase.
• -Thus Recombinant DNA is formed.
• The recombinant DNA is now shifted to the suitable host to get expressed and yield choice product.

Separation and isolation of DNA fragments: [GEL ELECTROPHORESIS]

-Gel electrophoresis is the technique used for separating DNA fragments.

PRINCIPLE OF GEL ELECTROPHORESIS:
DNA fragments are negatively charged. When an electric field is applied in a medium containing DNA, the
DNA tend to move towards the positive electrode anode.

PROCEDURE:
-The medium used in gel electrophoresis is agarose gel which is a natural polymer extracted from seaweeds.
-The DNA fragments are transferred to the agarose gel matrix and an electric field is applied.
-Under the electric field, the DNA fragments move according to their size through the seaving effect of
agarose gel
-Smaller the size of the DNA fragment, the faster is the rate of movement of it and farther is the distance
covered by it.
-The separated DNA fragments can be visualized by staining with ETHIDIUM BROMIDE followed by its
exposure to UV radiations.
-The DNA appear in bright orange coloured bands in the gel
-The separated DNA bands can be cutout from the agarose gel and extracted from the gel. This step is known

as ELUTION.
Cloning vectors
Cloning vectors are the DNA molecules that can carry a foreign DNA segment into the host cell. (i) The
vectors used in recombinant DNA technology can be: (a) Plasmids Autonomously replicating circular extra-
chromosomal DNA. (b) Bacteriophages Viruses infecting bacteria. (c) Cosmids Hybrid vectors derived from
plasmids which contain cos site of X phage. (ii) Copy number can be defined as the number of copies of
vectors present in a cell. (iii) Bacteriophages have high number per cell, so their copy number is also high in
genome. (iv) Plasmids have only one or two copies per cell.
(v) Copy number can vary from 1-100 or more than 100 copies per cell. (vi) If an alien piece of DNA is linked
with bacteriophage or plasmid DNA, its number can be multiplied equal to the copy number of the plasmid or
bacteriophage.
Features Required to Facilitate Cloning into Vector
(a) Origin of replication (Ori)
(b) Selectable marker
(c) Cloning sites
(d) Vectors for cloning genes in plants and animals.
Origin of replication
Origin of replication(Ori) is a sequence from where replication starts. • Any piece of DNA when linked to this
sequence can be made to replicate within the host cells. The sequence is also responsible for controlling the
copy number of the linked DNA. (ii) Selectable marker helps in identifying and eliminating non-transformants
and selectively permitting the growth of the transformants. • Transformation is a process through which a
piece of DNA is introduced in a host bacterium.
Selectable marker • The genes encoding resistance to antibiotics such as ampicillin, chloramphenicol,
tetracycline or kanamycin, etc, are some useful selectable markers for E. coli. • Ligation of alien DNA is
carried out at a restriction site present in one of the two antibiotic resistance genes. Example is ligating a
foreign DNA at the Bam HI site of tetracycline resistance gene in the vector pBR322. -» The recombinant
plasmids will lose tetracycline resistance due to insertion of foreign DNA. But, it still can be selected out from
non-recombinant ones by plating the transformants on ampicillin containing medium.
-» The transformants growing on ampicillin containing medium are then transferred on a medium containing
tetracycline.
-» The recombinants will grow in ampicillin containing medium but not on that containing tetracycline.
The non-recombinants will grow on the medium containing both the antibiotics. In this example, one antibiotic
resistance gene helps in selecting the transformants whereas, the other
antibiotic resistance gene gets ‘inactivated due to insertion’ of alien DNA and helps in selection of
recombinants.
* Selection of recombinants due to inactivation of antibiotics is a cumbersome procedure, so alternative
selectable markers are developed which differentiate recombinants from non-recombinants on the basis of their
ability to produce colour in the presence of a chromogenic substrate. -» In this method, a recombinant DNA is
inserted within the coding sequence of an enzyme J3-galactosidase.
-» This results into inactivation of the enzyme, B-galactosidase (insertional inactivation).
-> The bacterial colonies whose plasmids do not have an insert, produce blue colour, but others do not produce
any colour, when grown on a chromogenic substrate.
Cloning Site Cloning sites are required to link the alien DNA with the vector. • The vector requires very few
or single recognition sites for the commonly used restriction enzymes. • The presence of more than one
recognition sites within the vector will generate several fragments leading to complication in gene cloning.

(d) Vectors for cloning genes in plants and animals are many which are used to clone genes in plants and
animals.
• In plants, the Tumour inducing (Ti) plasmid of Agrobacterium tumefaciens is used as a cloning vector. -»
Agrobacterium tumefaciens is a pathogen of several dicot plants. -» It delivers a piece of DNA known as T-
DNA in the Ti plasmid which 1 transforms normal plant cells into tumour cells to produce chemicals required
by pathogens. • Retrovirus, adenovirus, papillomavirus are also now used as cloning vectors in animals
because of their ability to transform normal cells into cancerous cells.
Competent host organism
Competent host for transformation with recombinant DNA is required because DNA being a hydrophilic
molecule, cannot pass through cell membranes, Hence, the bacteria should be made competent to accept the
DNA molecules or Competency is the ability of a cell to take up foreign DNA.
Methods to make a cell competent are as follows. (a) Chemical method in this method, the cell is treated
with a specific concentration of | a divalent cation such as calcium to increase pore size in cell wall. The cells
are then incubated with recombinant DNA on ice, followed by placing them briefly at 42°C and then putting it
back on ice. This is called heat shock treatment. • This enables the bacteria to take up the recombinant DNA.
(b) Physical methods In this method, a recombinant DNA is directly injected into the nucleus of an animal cell
by microinjection method. • In plants, cells are bombarded with high velocity microparticles of gold or
tungsten coated with DNA called as biolistics or gene gun method. (c) Disarmed pathogen vectors when
allowed to infect the cell, transfer the recombinantDNA into the host.
Genetic Material (DNA)
• RNA is removed by treatment with ribonuclease
• Proteins are removed by treatment with Protease
• The purified DNA is precipitated by adding chilled ethanol.
• The Bacterial/Plant /Animal cell is broken down by enzymes to release DNA, along with
RNA,proteins ,polysaccharides and lipids.
• Bacterial cell is treated with enzyme Lysozyme
• Plant cell is treated with enzyme Cellulase.
• Fungal cell is treated with Chitinase.
Cutting DNA at specific locations
Using the restriction enzymes to cut target DNA and the vector DNA so that the sticky ends can be
complimentary and linking can be done by ligase.

Amplification of Gene of Interest using PCR

Polymerase chain reaction (PCR) is the process in which the amplification of the gene of interest is carried out
with two sets of primers and a thermostable DNA polymerase enzyme Taq polymerase. It was developed by
Kary Mullis in 1985. The process involves the following steps:
Denaturation: The double-stranded DNA is heated up to 940 C which causes the hydrogen bonds to break and
the two strands get separated.
Annealing: The two sets of primers are added which bind to the appropriate complementary segment of the
DNA strand at 54oC.
Extension: The Taq polymerase enzyme polymerizes the nucleotide chain using the nucleotides provided in
the medium and by using the template strand at 720C.

Insertion of recombinant DNA into the host cell/organism.

There are several methods of introducing the ligated DNA into recipient cells.
Recipient cells after making them ‘competent’ to receive, take up DNA present in its surrounding.
If a recombinant DNA bearing gene for resistance to an antibiotic (e.g., ampicillin) is transferred into E. coli
cells, the host cells become transformed into ampicillin-resistant cells.
Selectable marker-An antibiotic resistance marker is a gene that produces a protein that provides cells
expressing this protein with resistance to an antibiotic.
Bacteria that have been subjected to a procedure to introduce foreign DNA are grown on a medium containing
an antibiotic, and those bacterial colonies that can grow have successfully taken up and expressed the
introduced genetic material.
Normally the genes encoding resistance to antibiotics such as ampicillin, chloramphenicol, tetracycline or
kanamycin, etc., are considered useful selectable markers.

MCQ (1 Mark)
SECTION–A
1 What is the function of Restriction endo nuclease:
a. Synthesizes DNA (b) Cuts the DNA molecules randomly
b. Cuts the DNA molecule at specific sites.
c. Restricts the synthesis of DNA inside the nuclease.
ANSWER. c
2 The linking of antibiotic resistance gene with plasmid vector become possible with:
a) DNA polymerase b) Exonuclease c) DNA ligase d) Endonuclease.
Ans. C
3. Stirred-tank bioreactors have been designed for:
a)Addition of preservative to the product
b)Purification of product
c)Ensuring anaerobic condition in the cultural vessel
d).availability of oxygen throughout the process.
ANSWER. d
4. Given below is as ample of a portion of DNA strand giving the base sequence on the opposite strands.
What is so special shownin it?
5’ GAATTC _3’
3’ CTTAAG 5’
a) Replication completed b) Deletion mutation
c) Startcodonat5’level d) Palindromic sequence of base pairs
ANSWER. d
5.There is restriction endonuclease called EcoRI.What does “co”in it stand for?
a) Colon b) Coelom c)Co enzyme d)Coli
ANSWER. d
6.Agarose extracted from seaweeds is used in:
a) Spectro photometry b) tissue culture b)PCRd)Gel electrophoresis
ANSWER.d
7.An enzyme catalysing the removal of nucleotides from ends of DNA is:
a) endonuclease b) exonuclease c) DNAligase d) Hind-II
ANSWER. b
8 The transfer of genetic material from one bacterium to another through mediation of a viral vector is
termed as:
a) Transduction b) Conjugation c) Transformation d) translation
ANSWER. a
9.Which of the given statements is correct in the context of observing DNA Separated by agarose gel
electrophoresis?
a) DNA can be seen in visible light
b) DNA can be seen without staining in visible light
c) Ethidium bromide stained DNA can be seen in visible light
d) Ethidium bromide stained DNA can be seen under exposure of UV lights.
ANSWER. d
10.Which of the following is not the characteristic of plasmid?
a) Extra nuclear b)single-stranded c)independent replication d)Circular DNA
ANSWER. b
11 Who among the following was awarded the Nobel Prize for the development of PCR technique?
(a) Herbert Boyer (b) Hargovind Khurana (c) Kary Mullis (d) Arthur Kornberg
ANSWER. c
12. In agarose gel electrophoresis, DNA molecules are separated on the basis of their
(a) charge only (b) size only (c) charge to size ratio (d) All of these
ANSWER. b
13 The most important feature in a plasmid to be used as a vector is
(a)Origin of replication (Ori) (b) presence of a selectable marker
(c) presence of sites for restriction endonuclease (d) its size
ANSWER. a
14. While isolating DNA from bacteria, which of the following enzymes is not used?
(a) Lysozyme (b) Ribonuclease
(c) Deoxyribonuclease(d) Protease
ANSWER. c
15. An antibiotic resistance gene in a vector usually helps in the selection of
(a) competent cells (b) transformed cells
(c) recombinant cells (d) None of these
ANSWER. b
16. The role of DNA ligase in the construction of a recombinant DNA molecule is
(a) formation of phosphodiester bond between two DNA fragments
(b) formation of hydrogen bonds between sticky ends of DNA fragments
(c)ligation of all purine and pyrimidine bases (d)None of the above
ANSWER. a
17. Which of the following steps are catalysed by Taq polymerase in a PCR reaction?
(a) Denaturation of template DNA (b) Annealing of primers to template DNA
(c)Extension of primer end on the template DNA (d) All of the above
ANSWER. c
18. Which of the following should be choosen for best yield if one were to produce a recombinant protein in
large amounts?
(a) Laboratory flask of largest capacity
(b) A stirred-tank bioreactor without in-lets and out-lets
(c)A continuous culture system (d)Any of the above
ANSWER. c
19 Significance of heat shock method in bacterial transformation is to facilitate.
(a)Binding of DNA to the cell wall (b)Uptake of DNA through membrane transport proteins
(c)Uptake of DNA through transient pores in the bacterial cell wall
(d)Expression of antibiotic resistance gene
ANSWER. c
20 Which of the following statements does not hold true for restriction enzyme?
(a) It recognises a palindromic nucleotide sequence (b) It is an endonuclease
(c) It is isolated from viruses
(d) It produces the same kind of sticky ends in different DNA molecules
ANSWER c

Assertion and reason type questions

A).Assertion and reason both are correct statements and reason is correct explain for assertion.
B).Assertion and reason both are correct statements but reason is incorrect explain for assertion.
C). Assertion is correct but reason is wrong
D). Assertion is wrong but reason is correct
1 .Assertion: Restriction enzymes recognize palindromic sequence.
Reason: Palindromic sequences read the same in both directions of the two strands. Answer: (b)
2.Assertion: Restriction digestion is a process of cutting DNA by restriction enzyme.
Reason: DNA ligase joins two DNAs. Answer: (b)
3 Assertion: Restriction endonucleases are also called ‘molecular scissors’.
Reason: When fragments generated by restriction endonucleases are mixed, they join together due to their
sticky ends. Answer: (b)
4 Assertion : Restriction enzymes cut the strand of DNA to produce sticky ends.
Reason : Stickiness of the ends facilitates the action of the enzyme DNA polymerase.
Answer: (c)
5 Assertion: The matrix used in gel electrophoresis should have controllable pore size.
Reason: Agarose concentration can be changed to change pore sizes. Answer: (b)
6 Assertion: Foreign DNA and vector DNA cut with the help of ligase.
Reason: Ligase actson the sugar phosphate backbone of DNA.
Answer: (d) In formation of rDNA, restriction endonucleases cut both foreign DNA and vector DNA and act on
the sugar phosphate backbone of DNA. 1
7. Assertion: In gel electrophoresis, DNA fragments are separated.
Reason: DNA is negatively charged, so it moves towards anode under an electric field.
Answer: (a)
8 Assertion : All endonucleases cut DNA at specific sites.
Reason : Endonucleases are found in viruses.
Answer: (d
9 Assertion: Genetic engineering requires both nucleases and ligases.
Reason: Ligases produce the nick in the recombinant DNA molecule.
Answer: (c)
10 Assertion : In recombinant DNA technology, human genes are often transferred into bacteria
(prokaryotes) or yeast (eukaryotes).
Reason : Both bacteria and yeast multiply very fast to form a huge population which express the desired
gene.
Answer: (a)
SECTIONC-B(2MARKS)
1.What does ‘competent’ refer to in competent cells used in transformation experiments?
Ans. DNA being a hydrophilic molecule can not pass through cell membranes. Therefore, the bacteria should
be made competent to accept the DNA molecules.
Competent means bacterial cells, on treatment with chemicals like CaCl2, are made capable of taking up
foreign DNA.
2 What is the significance of adding proteases at the time of isolation of genetic material (DNA)?
Ans. Proteases degrade the proteins present inside a cell (from which DNA is being isolated). If the proteins
are not removed from DNA preparation then they could interfere with any downstream treatment of DNA.

3. While doing a PCR, ‘denaturation’ step is missed. What will be its effect on the process?
Ans. If denaturation of double-stranded DNA does not take place then primers will not be able to anneal
(joining) to the template. Hence, no extension will take place and after that there will be no amplification.

4. What modification is done on the Ti-plasmid of Agrobacterium tumefaciens to convert it into a cloning
vector?
Ans. The plasmid is disarmed by deleting the tumour inducing genes in the plasmid. So, that it becomes an
effective cloning vector. The modified tumour inducing (Ti) plasmid of Agrobacterium tumefaciens will no
longer remain pathogenic to the plants but still deliver genes of interest into a variety of plants.
5. How does one visualise DNA on an agarose gel?
Ans. A compound called ethidium bromide stains DNA, which on exposure with ultra-violet, (uv) radiation
gives an orange light band of DNA. Hence, DNA fragments appear as orange band
in the presence of ethidium bromide and UV light.
6. Describe the role of CaCl2 in the preparation of competent cells?
Ans. CaCl2 is known to increase the efficiency of DNA uptake to produce transformed bacterial cells. The
divalent Ca+2 ions create transient pores on the bacterial cell wall by which the entry of foreign DNA is
facilitated into the bacterial cells.
7. What is meant by gene cloning?
Ans. Gene cloning refers to a process in which a gene of interest is ligated to a vector. The recombinant DNA
thus produced is introduced in a host cell by transformation.
8. Write any four ways used to introduce a desired DNA segment into a bacterial cell in recombinant
technology experiments.
Answer: Ways to introduce desired DNA into bacterial cell are
a. microinjection
b. disarmed pathogen vectors
c. treatment of host cell by bivalent cation such as calcium
d. biolistic or gene gun
9. Mention the uses of cloning vector in biotechnology.
Answer:
I Uses of Cloning Vector in Biotechnology
ii Helps in linking the foreign/alien DNA with the host’s DNA.
 Iii Helps in the selection of recombinants from the non-recombinants.
10.Write the role of ori and restriction site in a cloning vector pBR322.
Answer: Ori is a sequence of DNA from where replication starts. Any piece of DNA that needs to replicate in
the host cell has to be linked to it.
Restriction site is the recognition site made of palindromic sequence for restriction enzymes.
3 MARKS QUESTIONS
1.Why is making cells competent essential for biotechnology experiments? List any two ways by which this can be
achieved.
Or
Why and how bacteria can be made ‘competent’? 2. Study the diagram given below and answer the following
questions.
(i) Why have DNA fragments in band D moved farther away in comparison to those in band C?
(ii) Identify the anode end in the diagram.
(iii) How are these DNA fragments visualised?
3 (i) Mention the importance of gel-electrophoresis in biotechnology.
(ii) Explain the process of this technique. 4. How does β-galactosidase coding sequence act as a selectable
marker? Why is it a preferred selectable marker to antibiotic resistance genes? Explain
5. Give reason why
(i) DNA cannot pass into a host cell through the cell membrane.
(ii) Proteases are added during isolation of DNA for genetic engineering.
(iii) Single cloning site is preferred in a vector. 6.(i) Explain the significance of palindromic nucleotide
sequences in the formation of recombinant DNA.
(ii) Write the use of restriction endonuclease in the above process.
7. How is insertional inactivation of an enzyme used as a Selectable marker to differentiate recombinants from non-
recombinants8.(i) Explain the basis on which the gel electrophoresis technique works.
(ii) Write any two ways the products obtained through this technique can be utilised.
9. (i) Name the organism in which the vector shown is inserted to get the copies of the desired gene.
(ii) Mention the area labelled in the vector responsible for controlling the copy number of the inserted gene.
(iii) Name the selectable marker in the vector shown below.
10.Name the source of the DNA polymerase used in PCR technique. Mention why is it used?
LONG ANSWER QUESTIONS (5) MARKS
1 Explain the role(s) of the following in biotechnology
(i) Restriction endonuclease
(ii) Gel-electrophoresis (iii) Selectable markers in pBR322
2.Describe the various steps involved in Recombinant DNA technology with the help of a well labeled.
Diagram?
3.How can the following be made possible for biotechnology experiments?
(i) Isolation of DNA from bacterial cell.
(ii) Reintroduction of the recombinant DNA into a bacterial cell..
4.What are Restriction enzyme? Why do bacteria have these restriction enzymes. Show diagrammatically a
restriction enzyme its recognition & the product it produces?
5. Expand PCR? Describe the different Steps involved in this technique?
CASE STUDY QUESTIONS
CASE STUDY- 1
Biotechnology deals with techniques of using live organisms or enzymes from organisms to produce products
and processes useful to humans. In this sense, making curd, bread or wine, which are all microbe-mediated
processes, could also be thought as a form of biotechnology. However, it is used in a restricted sense today,
to refer to such of those processes which use genetically modified organisms to achieve the same on a larger
scale. Further, many other processes/techniques are also included under biotechnology. For example, in vitro
fertilisation leading to a ‘test-tube’ baby, synthesising a gene and using it, developing a DNA vaccine or
correcting a defective gene, are all part of biotechnology.
The European Federation of Biotechnology (EFB) has given a definition of biotechnology that encompasses
both traditional view and modern molecular biotechnology. The definition given by EFB is as follows: ‘The
integration of natural science and organisms, cells, parts thereof, and molecular analogues for products and
services’.
Que. 1) ……………………is a technique where live enzymes or organisms are used to make products or methods
which are useful to humans.
(a) Bio-technology (b) Info-technology (c) Medical technology (d) Business technology. Ans. (a)
Que. 2) In biotechnology, produced products and processes are useful to the ………
(a) Microbes (b) Reptiles (c) Humans (d) Cockroach Ans.(c)
Que. 3) The definition of Biotechnology is given by …………
(a) FFB (b) FBU (c) BFE (d) EFB Ans. (d)
Que. 4) Which are the microbe-mediated processes in biotechnology.
Answer : The process of making wine, bread and curd are microbe-mediated processes in Biotechnology.
CASE STUDY - 2
The techniques of genetic engineering which include creation of recombinant DNA, use of gene cloning and
gene transfer, overcome this limitation and allow us to isolate and introduce only one or a set of desirable
genes without introducing undesirable genes into the target organism.
Most likely, this piece of DNA would not be able to multiply itself in the progeny cells of the organism. But,
when it gets integrated into the genome of the recipient, it may multiply and be inherited along with the host
DNA. This is because the alien piece of DNA has become part of a chromosome, which has the ability to
replicate. In a chromosome there is a specific DNA sequence called the origin of replication, which is
responsible for initiating replication. Therefore, for the multiplication of any alien piece of DNA in an
organism it needs to be a part of a chromosome(s) which has a specific sequence known as ‘origin of
replication’. Thus, an alien DNA is linked with the origin of replication, so that this alien piece of DNA can
replicate and multiply itself in the host organism. This can also be called cloning or making multiple identical
copies of any template DNA. The cutting of DNA at specific locations became possible with the discovery of
the so- ‘molecular scissors’– restriction enzymes.
Que. 1) Which DNA sequence is responsible for initiating replication?
(a) Endonuclease (b) Restriction DNA
(c) Gene clone (d) Origin of replication
Ans. (d)
Que. 2) DNA sequence is mainly present in ……………………………
(a) Mitochondria (b) Chromosomes
(c) Chloroplast (d) Cytoplasm.
Ans. (b)
Que. 3) True or False
‘The piece of DNA don’thave the ability to multiply itself in the progeny cell of an organism.’
(a) True (b) False
Ans. (a)
Que. 4) Write name of molecular scissors which is useful in cutting DNA?
Answer: Restriction enzyme is a molecular scissor which is helpful in cutting DNA.
Case study -3
In the year 1963, the two enzymes responsible for restricting the growth of bacteriophage in Escherichia coli
were isolated. One of these added methyl groups to DNA, while the other cut DNA. The later was called
restriction endonuclease. The first restriction endonuclease–Hind II, whose functioning depended on a
specific DNA nucleotide sequence was isolated and characterised five years later. It was found that Hind II
always cut DNA molecules at a particular point by recognising a specific sequence of six base pairs. This
specific base sequence is known as the recognition sequence for Hind II. Besides Hind II, today we know more
than 900 restriction enzymes that have been isolated from over 230 strains of bacteria each of which
recognise different recognition sequences. The convention for naming these enzymes is the first letter of the
name comes from the genus and the second two letters come from the species of the prokaryotic cell from
which they were isolated, e.g., EcoRI comes from Escherichia coli RY 13. In EcoRI, the letter ‘R’ is derived from
the name of strain. Roman numbers following the names indicate the order in which the enzymes were
isolated from that strain of bacteria
Restriction enzymes belong to a larger class of enzymes called nucleases. These are of two kinds;
exonucleases and endonucleases. Exonucleases remove nucleotides from the ends of the DNA whereas,
endonucleases make cuts at specific positions within the DNA. Each restriction endonuclease functions by
‘inspecting’ the length of a DNA sequence. Once it finds its specific recognition sequence, it will bind to the
DNA and cut each of the two strands of the double helix at specific points in their sugar -phosphate
backbones. Each restriction endonuclease recognises a specific palindromic nucleotide sequences in the DNA.
Que. 1) How many enzymes are there which can restrict growth of bacteriophage in E.coli?
(a) One (b) Two (c) Three (d) Four
Ans.(b)
Que. 2) The letter ‘R’ in the EcoRI is a name of ……………
(a) Strain (b) Species (c) Genus (d) Kingdom
Ans.(a)
Que. 3) In the naming of enzyme, first letter of name belongs to ………………
(a) Species (b) Order (c) Strain (d) Genus
Ans.(d)
Que. 4) Which enzyme belongs to nucleases class of enzymes?
Answer: Restriction enzyme mainly belongs to nucleases class of enzymes.
Case study -4
When cut by the same restriction enzyme, the resultant DNA fragments have the same kind of ‘sticky-ends’
and, these can be joined together (end-to-end) using DNA ligases The cutting of DNA by restriction
endonucleases results in the fragments of DNA. These fragments can be separated by a technique known as
gel electrophoresis. Since DNA fragments are negatively charged molecules they can be separated by forcing
them to move towards the anode under an electric field through a medium/matrix. Nowadays the most
commonly used matrix is agarose which is a natural polymer extracted from sea weeds. The DNA fragments
separate (resolve) according to their size through sieving effect provided by the agarose gel. Hence, the
smaller the fragment size, the farther it moves. The separated DNA fragments can be visualised only after
staining the DNA with a compound known as ethidium bromide followed by exposure to UV radiation (you
cannot see pure DNA fragments in the visible light and without staining). You can see bright orange coloured
bands of DNA in an ethidium bromide stained gel exposed to UV light.
The separated bands of DNA are cut out from the agarose gel and extracted from the gel piece. This step is
known as elution. The DNA fragments purified in this way are used in constructing recombinant DNA by
joining them with cloning vectors.
Que. 1) …………………… is used to join sticky ends of DNA.
(a) DNA Ligase (b) DNA Host (c) DNA restriction (d) None of them
Ans.(a)
Que. 2) On the basis of ……..……., fragments of DNA gets separated in the Gel electrophoresis.
(a) Nucleotide (b) Colour (c) Shape (d) Size
Ans.(d)
Que. 3) After DNA fragment separation, DNA is stained by ………………… for the visualization.
(a) Toluidine (b) Ethidium bromide (c) Sulphuric acid (d) Phloroglucinol
Ans.(b)
Que. 4) Name the technique which useful in the separation of fragments of DNA.
Answer: Gel electrophoresis is the technique which useful in the separation of fragments of DNA.
Case Study- 5
Since DNA is a hydrophilic molecule, it cannot pass through cell membranes. Why? In order to force bacteria
to take up the plasmid, the bacterial cells must first be made ‘competent’ to take up DNA. This is done by
treating them with a specific concentration of a divalent cation, such as calcium, which increases the
efficiency with which DNA enters the bacterium through pores in its cell wall. Recombinant DNA can then be
forced into such cells by incubating the cells with recombinant DNA on ice, followed by placing them briefly
at 420C (heat shock), and then putting them back on ice. This enables the bacteria to take up the
recombinant DNA. This is not the only way to introduce alien DNA into host cells. In a method known as
micro-injection, recombinant DNA is directly injected into the nucleus of an animal cell.
In another method, suitable for plants, cells are bombarded with high velocity micro-particles of gold or
tungsten coated with DNA in a method known as biolistics or gene gun. And the last method uses ‘disarmed
pathogen’ vectors, which when allowed to infect the cell, transfer the recombinant DNA into the host. Now
that we have learnt about the tools for constructing recombinant DNA, let us discuss the processes
facilitating recombinant DNA technology.
Que. 1) In ……… method, recombinant DNA is transferred into the host to infect the cell.
(a) Restriction method (b) Gene Gun (c) Biolistics (d) Disarmed pathogen
Ans.(d)
Que. 2) Biolistics or Gene gum method is suitable for ……
(a) Reptiles (b) Plants (c) Birds (d) Insects
Ans.(b)
Que. 3) Calcium cation increases efficiency of …………. for the bacterium entry.
(a) Cell (b) DNA (c) RNA (d) Ribosome
Ans.(b)
Que. 4) Why the DNA cannot pass through cell membrane?
Answer: DNA is basically a hydrophilic molecule and cell membrane is hydrophobic in nature. Hence, the
DNA cannot pass through cell membrane.

Self Assessment Test

(MCQ- 1 Mark))

1 Restriction enzymes were discovered by

a. Smith and Nathans b. Alexander Fleming
c. Berg d. None
2. Bacteria protect themselves from viruses by fragmenting viral DNA with
a. Ligase b. Endonuclease c. Exonuclease d.. Gyrase
3 The DNA fragments have sticky ends due to
a. Endonuclease b. Unpaired bases c. Calcium ions d. Free methylation
4. Plasmids are used as cloning vectors for which of the following reasons?
a . Can be multiplied in culture b. Self-replication in bacterial cells
c. Can be multiplied in laboratories with the help of enzymes
d. Replicate freely outside bacterial cells
5 PCR technique was invented by
a. Karry Mullis b. Boyer c Sanger d. Cohn
6 Plasmid DNA acts as _____ to transfer the piece of DNA attached to it into the host organism.
a) protein b) carrier c) vector d) antibody
7.The two core techniques that enabled the birth of modern biotechnology are _____
a) red biotechnology and green biotechnology
b) classical and traditional biotechnology
c) genetics and mathematics
d) genetic engineering and maintenance of a sterile environment 1
Directions: In the following questions, a statement of assertion is followed by a statement of reason.
Mark the correct choice as: ( 1 -Mark)
(a) If both Assertion and Reason are true and Reason is the correct explanation of Assertion.
(b) If both Assertion and Reason are true but Reason is not the correct explanation of Assertion.
(c) If Assertion is true but Reason is false.
(d) If both Assertion and Reason are false.

8 Assertion: When cut by the same restriction enzyme, the resultant DNA fragments have the same kind of
‘sticky-ends
Reason: These can be joined together (end-to-end) using DNA ligases
9 Assertion: bioreactors can be thought of as vessels in which raw materials are biologically converted into
specific products, individual enzymes, etc. using microbial plant, animal or human cells.
Reason: A bioreactor provides the optimal conditions for achieving the desired product by providing
optimum growth conditions (temperature, pH, substrate, salts, vitamins, oxygen
10.Assertion: Cloning is making multiple unidentical copies of any template DNA.
Reason: No Ori site are required for cloning
11.Assertion: A bacterial cell with no restriction enzymes will be easily infected and lysed by bacteriophages.
Reason: Restriction enzymes catalyze synthesis of protective coat around bacterial cell that prevents
bacteriophage attack.
(2- MARKS QUESTIONS)
12. Why do DNA fragments move towards the anode during gel electrophoresis? 2
13. Why is it not possible for an alien DNA to become part of a chromosome anywhere along its length and
replicate normally? 2
14. How can retroviruses be used efficiently in biotechnology experiments in spite of them being disease
causing? 2
SECTION-C (3- MARKS QUESTIONS)
15.How is insertional inactivation of an enzyme used as a Selectable marker to differentiate recombinants
from non-recombinants? 3
16.Explain the work carried out by Cohen and Boyer that contributed immensely in biotechnology. 3
17.How are the DNA fragments separated by gel electrophoresis visualized and separated for use in
constructing recombinant DNA? 3
CASE STUDY QUESTION
18.CASE STUDY
The techniques of genetic engineering which include creation of recombinant DNA, use of gene cloning and
gene transfer, overcome this limitation and allows us to isolate and introduce only one or a set of desirable
genes without introducing undesirable genes into the target organism.
Most likely, this piece of DNA would not be able to multiply itself in the progeny cells of the organism. But,
when it gets integrated into the genome of the recipient, it may multiply and be inherited along with the host
DNA. This is because the alien piece of DNA has become part of a chromosome, which has the ability to
replicate. In a chromosome there is a specific DNA sequence called the origin of replication, which is
responsible for initiating replication. Therefore, for the multiplication of any alien piece of DNA in an
organism it needs to be a part of a chromosome(s) which has a specific sequence known as ‘origin of
replication’. Thus, an alien DNA is linked with the origin of replication, so that, this alien piece of DNA can
replicate and multiply itself in the host organism. This can also be called as cloning or making multiple
identical copies of any template DNA. The cutting of DNA at specific locations became possible with the
discovery of the so- ‘molecular scissors’– restriction enzymes.
Que. 1) Which DNA sequence is responsible for initiating replication?
(a) Endonuclease (b) Restriction DNA (c) Gene clone (d) Origin of replication
Que. 2) DNA sequence is mainly present in …………………………
(a) Mitochondria (b) Chromosomes (c) Chloroplast (d) Cytoplasm.
Que. 3) True or False
‘The piece of DNA don’t have ability to multiply itself in the progeny cell of an organism.’
(a) True (b) False
Que. 4) Write name of molecular scissors which is useful in cutting DNA?
(5-MARKS QUESTIONS)
19.Give reason why
(i) DNA cannot pass into a host cell through the cell membrane.
(ii) Proteases are added during isolation of DNA for genetic engineering.
(iii) Single cloning site is preferred in a vector
20.(i) Name the selectable markers in the cloning vector pBR322. Mention the role they play.
(ii) Why is the coding sequence of an enzyme p-galactosidase a preferred selectable marker in comparison to
the ones named above?
 Ch.10:Biotechnology and its applications
Applications of Biotechnology in Agriculture and medicine----
1. In Agriculture -
Genetically modified organisms- The plants, bacteria, fungi and animals whose genes have been altered by
manipulation are called Genetically Modified Organisms. Its advantages to crops are-
a) Crops are more tolerant to abiotic stresses like cold, drought, etc.
b) Reduced dependence of crops on chemical pesticides.
c) Reduced post-harvest losses.
d) Increased efficiency of mineral usage by plants
e) Enhanced nutritional value of food.
RNA interference-This is the method of silencing of a specific mRNA due to a complementary double stranded
RNA molecule that binds to and prevents the translation of the mRNA. This technique is used to make tobacco
plants resistant to a nematode, Meloidegyneincognitia.
Bt cotton- Insecticidal protein produced by bacterium Bacillus thuringienesis kill certain insects like
lepidopterans(budworm, armyworm),coleopterans(beetles) and dipterans(flies, mosquitoes). The gene
encoding this protein is called cry gene which is isolated from bacterium and introduced into crop plants like
cotton. Such plants become resistant to insect pests.
This toxin protein doesn’t kill the bacterium itself because it exist as inactive protoxin but once an insect ingest
the inactive toxin, it is converted into an active form due to alkaline pH of the insect gut. The activated toxin binds
to the surface of midgut epithelial cells and create pores that cause swelling and lysis and ultimately death of the
insect.
2. Applications of biotechnology in medicine-
a) Genetically Engineered Insulin- In 1983, an American company Eli Lily prepared two DNA sequences
corresponding to A and B chains of human insulin and introduced them in plasmids of E. coli to produce
insulin chains A and B separately. These A and B chains are extracted and combined by creating
disulphide bonds to form human insulin.

b) Gene therapy- It is a collection of methods that allows correction of a gene defect that has been
diagnosed in a child/embryo. It involves delivery of the normal gene into the embryo. This gene will then
take over the function of the non-functional gene.
The first clinical gene therapy was given in 1990 to a 4-year old girl with adenosine deaminase deficiency (ADA
deficiency). This enzyme is important for the functioning of immune system. This disorder is caused due to the deletion
of the gene for adenosine deaminase. If the gene isolate from the marrow cells producing ADA is introduced into the
cells at early embryonic stages, it could be a permanent cure.
c) Molecular diagnosis of diseases-using PCR technique, probe and ELISA
d) Stemcelltechnology-
Stem cells are undifferentiated biological cell. These can differentiate into
specialized cells and can divide to produce more stem cells.
These cells are found in multicellular organisms.
Adult stem cells are used in medical therapies, for example, in bone
marrowtransplantation.
Stem cells can be taken from umbilical cord blood just after birth.
 e) Recombinantvaccineproduction-
Secondgenerationvaccinesorrecombinantvaccine-Thevaccineproducedthroughgenetic engineering
methods are called recombinant vaccines or second-generation vaccines.
Recombinant vaccines are produced from the insertion of viral DNA or RNA genetic code into
yeastcellsorviruses,resultingintheproductionofspecificcomponentoftheoriginalpathogen. Examples -
Recombinant hepatitis -B vaccine and polio vaccine.
3. Biopiracy-It is the use of bioresources by multinational companies and other organizations without proper
authorization from the countries and people concerned. Ex-In 1997,an American company got patent rights on
Basmati rice. This new variety of Basmati had actually been derived from Indian farmer’s varieties.
4. Transgenicanimals-
AnimalswhoseDNAismanipulatedtopossessandexpressanextragene,areknownas transgenic animals-
Transgenic rat, pigs, cows.

Reasonfordevelopingtransgenicanimals-
a. Study of normal physiology and development
b. Study of disease
c. Biological products- many useful biological products can be produced by transgenic animals… (a) alpha
-1-antitrypsin (human protein) is used to treat emphysema. (b) 1997-transgenic cow (Rosie) - produced human
protein enriched milk (2.4 g/L)
d. Vaccine safety
e. Chemical safety testing

5. Patents – It is a set of exclusive rights granted by a government to the inventors or their assignee to prevent
others from commercial /illegal use of their invention.
6. GEAC -Genetic Engineering Approval Committee makes all decisions regarding the validity of GM research and
the safety of introducing GMOs for public services.

MCQ (1 Mark)
1) ADA is an enzyme which is deficient in a genetic disorder SCID. What is the full form of ADA
(a) Adenosine deoxyaminase (b) Adenosine deaminase
(c) Aspartate deaminase (d) Arginine deaminase
Ans. (b)
2) Silencing of a gene could be achieved through the use
(a) RNAi only (b) antisense RNA only (c) both RNAi and antisense RNA (d) none of the above
Ans. (c)
3) Biopiracy means
(a) use of bio patents (b) thefts of plants and animals
(c) stealing of bioresources (d) exploitation of bioresources without authentic permission
Ans. (d)
4) Crystals of Bt toxin produced by some bacteria do not kill the bacteria themselves because:
(a) bacteria are resistant to the toxin (b) toxin is immature
(c) toxin is inactive (d) bacteria encloses toxin in a special sac.
Ans. (c)
5) A probe which is a molecule used to locate homologous sequences in a mixture of DNA or RNA molecules could be:
(a) a ssRNA (b) a ssDNA (c) either RNA (d) can be ssDNA but not ssRNA
Ans. (c)
6) Choose the correct option regarding retrovirus.
(a) An RNA virus that synthesises DNA during infection
(b) A DNA virus that synthesises RNA during infection
(c) A ssDNA virus
(d) A dsRNA virus
Ans. (c)
7) The trigger for activation of toxin of Bacillus thuringiensis is
(a) acidic pH of stomach (b) high temperature
(c) alkaline pH of gut (d) mechanical action in the insect gut
Ans. (c)
8. Bt corn has been made resistant from corn borer disease by introduction of the gene
(a) cryIAb (b) ampR (c) cryIIAb (d) trp
Ans. (a)
9. Which of the following statements is/are correct ?
I. The proinsulin has an extra peptide called C-peptide.
II. The functional insulin has A and B chains linked together by hydrogen bonds.
III. Genetically engineered insulin is produced in E. coli.
IV. In man, insulin is synthesised as a proinsulin.
(a) I and II (b) I and III (c) III and IV (d) I, III and IV
Ans. (d)
10. Which of the following statements about biopatents is/are correct?
I. Biopatents protect intellectual property right of an inventor.
II. Biopatents of all products are subjected to commercialisation.
III. Biopatents should be granted carefully and impartially.
IV. Biopatenting requires examination of legal, ethical, and social issues.
Choose the correct option.
(a) Only II (b) I, III and IV (c) II and IV (d) I, II, III and IV
Ans. (a)
11. Transgenic animals are produced
I. To study the normal physiology and development. II. To study diseases.
III. To obtain useful biological products. IV. To test the vaccine safety.
V. To test the chemical safety.
Which of the above statements are correct?
(a) I, II and III (b) II, III and IV (c) I, II, III and V (d) I, II, III, IV and V
Ans. (d)
12.Which property of transgenic animals is used in chemical safety testing?
(a) Insensitivity to toxic substances (b) Sensitivity to toxic substances
(c) Resistance to toxic substances (d) Both (a) and (c)
Ans. (b)
13. Match the following columns:
Column-I Column-II
Bt Tobacco 1.Vitamin-A
Lepidopterans 2. High yield and pest resistant
Bt cotton 3. Manduca sexta
Golden rice 4.Tobacco budworm
Choose the correct option:
(a) A–3, B–4, C–2, D-1 (a) A–3, B–1, C–2, D-4 (a) A–1, B–4, C–2, D-3 (a) A–3, B–1, C–2, D-4
Ans. (a)
14. Which bacterium was the first to be used as biopesticide on the commercial scale in the world?
(a) Bacillus thuringiensis (b) E. coli (c) Pseudomonas aeruginosa (d) Agrobacterium tumefaciens
Ans. (a)
15. Which Indian plants have either been patented or attempts have been made to patent them by Western nations for
their use?
(a) Basmati rice (b) Turmeric (c) Neem (d) All of the above
Ans. (d)
16. .Which gene was introduced in the first transgenic cow?
(a) Human a -lactalbumin (b) b -1-antitrypsin (c) a -1-antitrypsin (d) cry l Ac
Ans. (a)
17. Biotechnology mainly deals with
(a) industrial scale production of pharmaceutical
(b) biological use of genetically modified microbes, fungi, plants and animals
(c) Both (a) and (b)
(d) None of the above
Ans. (c)
18. Plants, bacteria, fungi and animals whose genes have been altered by manipulation are called
(a) genetically modified organisms (b) hybrid organisms
(c) pest resistant organisms (d) insect resistant organisms
Ans. (a)
19. Bt toxin is
(a) intracellular crystalline protein (b) extracellular crystalline protein
(c) intracellular monosaccharide (d) extracellular polysaccharide
Ans. (a)
20. Insect resistant transgenic cotton has been produced by inserting a piece of DNA from
(a) an insect (b) a bacterium (c) a wild relative of cotton (d) a virus
Ans. (b)

ASSERTION-REASON QUESTIONS (1 MARK)

In the following questions (I to X) a statement of Assertion is followed by statement of Reason. Choose the correct
option.
(A) If both Assertion and Reason are true and the Reason is the correct explanation of the Assertion.
(B) If both Assertion and Reason are true but the Reason is not the correct explanation of the Assertion.
(C) If Assertion is true but Reason is false.
(D) If both Assertion and Reason are false.
I) Assertion : ‘Cry’ proteins are named so because they are crystal proteins.
Reason : ‘Cry’ proteins solubilize in alkaline pH of the insect’s gut and activate Bt toxin. Ans (B)
II). Assertion : Patents are granted by government to an inventor.
Reason : Patent prevents other from commercial use of an invention. Ans (A)
III). Assertion : Stem cells are undifferentiated biological cells found in multicellular organisms.
Reason : They are obtained from only umbilical cord blood just after birth. Ans (c)
IV). Assertion : Indian Patents Bill takes cases of biopiracy in consideration.
Reason : Biopiracy is the use of bioresources by multinational companies without proper authorization from concerned
persons and countries occurring in all eukaryotic organisms. Ans (B)
V) Assertion : Organizations like Genetic Engineering Approval Committee (GAEC) monitor GM research. Ans (A)
Reason : Some ethical standards are required to evaluate the morality of all human activities. Ans (A)
VI) . Assertion : Human insulin is produced in E. coli.
Reason : In mammals, insulin is synthesized as a pro-hormone which contains an extra stretch of protein. Ans (B)
VII) .Assertion : The RNAi can be introduced in an organism only by inserting the gene encoding complementary RNA.
Reason : The complement of the mRNA sense strand usually contains the sequence of codons for producing functional
protein. Ans (D)
VIII) Assertion: Many crops are incorporated with foreign genes to make them tolerant to abiotic stresses.
Reason: Genomes of many plants are manipulated or altered by combining them with other genes to get desired
traits. Ans (A)
IX) Assertion: Agrobacterium tumefaciens is popular in genetic engineering because this bacterium is associated with the
stems of all cereal and pulse crops.
Reason: Using Agrobacterium as a vector, the genes can be transferred in biotechnological techniques.
Ans (D))
X) Assertion: Humulin is better than conventional insulin.
Reason : Conventional insulin produces many side effects. Ans (A)
SHORT ANSWER QUESTIONS (2MARKS)

1. Name a molecular diagnostic technique to detect the presence of a pathogen in its early stage of infection. What are
transgenic plants? Give some example.
Ans.: Polymerase chain reaction (PCR) is a technique used in molecular biology to amplify a single copy or a few copies
of a segment of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA
sequence.
2. What are transgenic plants? Give some example.
Ans.: Transgenic plants are plants that have been genetically engineered, a breeding approach that uses
recombinant DNA techniques to create plants with new characteristics. They are identified as a class of genetically
modified organism (GMO). Examples – Bt Cotton, Golden Rice, FlavrSavr tomato.
3. What is GEAC? What are its main objectives?
Ans. GEAC is Genetic Energy Approval Committee. It is an Indian government organization. Its main objectives are
as follows:
● To examine the validity of genetic modification research.
● To inspect whether the use of genetically modified crops is safe for public use or not
4. Explain the principle involved in ELISA.
Ans. In ELISA, the antigen-antibody interactions always use an enzyme labelled antigen or antibody. The enzyme activity
is measured with the help of a calorimeter using a substrate that changes colour when modified by the enzyme. After
the substrate addition, the light is absorbed by the product formed and is represented in the numeric values.
5.Who was given the first gene therapy? Why does this treatment reoccur in nature?
Ans. The first gene therapy was given to a four-year-old girl, on 14th September 1990, at the NIH Clinical Centre.
She was suffering from a genetic disorder Adenosine Deaminase deficiency. The treatment is recurrent in nature
because the genetically engineered lymphocytes used in the therapy are mortal and need to be administered
periodically in the patient.
7. What is Golden Rice?
Ans. Golden rice is a transgenic variety of rice (Oryza sativa) containing good quantities of β- carotene (provitamin A)
which is principle source of vitamin A. Since the grains of the rice are yellow in colour due to β-carotene, the rice is
commonly called golden rice.
8. Tobacco Plants are damaged severally when infested with Meloidegyneincognitia. Name and explain the
strategy that is adopted to stop this infestation.
Ans. Gene expression can be controlled by using RNA molecule and this technology is called RNAi or gene Silencing.
During this process Nematode specific gene is introduced into host plant which produces dsRNA. This silence specific
mRNA of the Nematode.
9. How is the matured, functional insulin hormone different from its Prohormone form?
Ans. Mature functional insulin is obtained by processing of prohormone which contains extra peptide called C-
peptide. This C-peptide is removed during maturation of proinsulin to insulin.
9.Biopiracy should be prevented. State why and how?
Ans. Biopiracy is unauthorised exploitation of bioresources of developing or under developed
countries. hence, it should be prevented. it can be prevented by developing Laws to
obtained proper authorisation and by paying compensatory benefits.
10. Name a genus of Baculovirus. Why are they considered good biocontrol agents?
Ans. Nucleopolyhedrovirus is a of baculovirus. They are species-species , have narrow
spectrum insecticidal application and no negative impact on non-target organism, hence they are considered good
biocontrol agents.

SHORT ANSWER QUESTIONS (3 MARKS)

1. cryIAb is introduced in a plant to control infestation by corn borer.
(a) Name the resultant plant after successful insertion of the gene desired.
(b) Summarize the action of the gene introduced.
Ans.(a) Bt corn
(b) CryIAb/Bt toxin gene codes for crystal protein; the Bt toxin protein exists as an inactive
protein, but once an insect ingests it, it gets converted into an active form due to the alkaline
pH of the gut which solubilises the crystal. The activated toxin binds to the surface of mid gut
and creates pores that cause swelling, lysis and eventually death of the insect.
2. A corn farmer has perennial problem of corn-borer infestation in his crop. Being
environmentally conscious he does not want to spray insecticides. Suggest solution based on your
knowledge of biotechnology. Write the steps to be carried out to achieve it.
Ans. The following steps should be followed:
(i) Isolation of Bt toxin genes from Bacillus thuringiensis.
(ii) Incorporation of gene into corn.
(iii) Toxin coded by gene cryIAb in corn, kills the pests and the pest dies.
3. (a) State the role of DNA ligase in biotechnology.
(b) What happens when Meloidegyneincognitia consumes cells with RNAi gene.
Ans.(a) DNA ligase joins the DNA fragments with same sticky ends. It also links Okazaki fragments
or discontinuously synthesised fragments. DNA ligase is used to link desired gene with
plasmid to form recombinant DNA. (Any one)
(b) The specific mRNA of the nematode is silenced and the parasite dies
4. What are the drawbacks of the insulin obtained from the slaughtered cows and pigs?
Ans. The drawbacks of insulin obtained from slaughtered animals are as follows:
• Since insulin is produced in very small amounts in the body, therefore, a large number of animals are slaughtered
which is unethical.
• If the slaughtered animals are infected, the insulin will also be contaminated which in turn will infect the acceptor.
• The humans might have a potential immune response against the administered insulin derived from animals.
5.Explain five areas where biotechnology has influenced human lives.
Ans. Biotechnology has influenced human lives as follows:
• Genetically modified crops with high nutritive value are provided by biotechnology.
• It has helped in the production of recombinant vaccines.
• It has devised techniques such as gene therapy for the treatment of genetic diseases.
• Genetically engineered microbes are produced to control environmental pollution.
• Transgenic animals are developed that can produce human proteins.
6. What are transgenic animals? Enlist any three areas where they can be used.
Ans. Transgenic animal are those whose genetic material has been altered by a gene of interest using genetic
engineering techniques. Four areas where they can be used are:
● Transgenic animals are served as experimental models for the study of various human diseases.
● They are used to test vaccines such as polio vaccines.
● The gene expressions help scientists to understand the normal expression of genes at various stages of
growth and development.
● To produce medicine, protein required for treatment of disease, human milk protein etc.
7.How did the process of RNA interference help to control the nematode from infecting roots of tobacco plants?
Explain.
Ans. Using Agrobacterium vectors, nematode specific genes are introduced into host plant. The introduction of DNA
produced both sense and anti-sense RNA in host cells. This two RNA’s being complementary formed a double stranded
RNA (dsRNA) that initiated RNAi and silenced the specific mRNA of the nematode. As a result, the parasite could not
survive in the transgenic host expressing specific interfering RNA.
8.Plasmid is a boon to biotechnology. Justify this statement quoting the production of human insulin as an
example.
Ans. Plasmids are extra-chromosomal, self-replicating, usually circular, double-stranded DNA molecules found
naturally in many bacteria. In 1983, Eli Lilly an American company, first prepared two DNA sequences
corresponding to A and B chains of human insulin and introduced them in plasmids of E. coli to produce insulin
chains. These chains A and B were produced separately, extracted, and combined by creating disulfide bonds to
form functional human insulin (Humulin).
10. Write the difference between the proinsulin and mature insulin.
Ans. Insulin is a hormone secreted by pancreas. It consists of two short polypeptide chains, i.e., chains A and B, linked
together by disulphide bridges. Chain-A contains 21 amino acids, while chain-B contains 30 amino acids. In mammals,
insulin is synthesised as a prohormone, i.e., it needs to be processed before it becomes fully mature and functional
hormone. This prohormone contains an extra stretch called the C-peptide of 33 amino acids. This is known as
proinsulin. The insulin that lacks C-peptide is called mature insulin.
11. Explain process of gene therapy to treat adenosine deaminase deficiency. Mention two disadvantages of this
procedure.
Ans. (i) Lymphocytes from the blood of the patient are grown on culture outside the body.
(ii) A functional ADA cDNA is then introduced into these lymphocytes using a retroviral vector.
(iii) The genetically engineered lymphocyte is returned to the blood of patient.
Disadvantages:
Therapy is not completely curative as cells do not remain alive and periodic infusion of lymphocyte is required.
CASE BASE QUESTION (4 MARKS EACH)
Refer to the diagram of maturation of proinsulin into insulin to answer the any four questions from 1(i) to (IV) given
below:

(i) How are two short polypeptide chains of insulin linked together?
Ans.: Two short polypeptide chains of insulin are linked together by disulphide bridges.
(ii) State the role of C-peptide in human insulin.
Ans.: C-peptide (extra stretch of polypeptide) makes the insulin inactive.
(iii) Mention the chemical change that proinsulin undergoes, to be able to act as mature insulin.
Ans: An extra stretch called C-peptide is removed from pro-insulin during maturation.
(iv) What do you mean by term proinsulin?
Ans. The prohormone contains an extra stretch called the C-peptide of 33 amino acids. This
is known as proinsulin.
OR
(iv) Which of the following companies started selling Humulin in the year 1983 ?
Ans.: Eli Lilly
Case -2. Read the following and answer any four questions from 2(i) to 2 (v) given below:
Nematodes like Meloidegyneincognitiainfects the roots of tobacco plants and
causes reduction in yield. The infestation of these nematodes can be prevented by the process of RNA interference
(RNAi). RNAi is present in all eukaryotic organisms as cellular defence by silencing of specific mRNA due to
complementary dsRNA molecules that bind to and prevents translation of the mRNA. The source of complementary
dsRNA may be from an infection by viruses having RNA genomes or mobile genetic elements that replicate through RNA
intermediate. Nematode specific genes were introduced into host plant using Agrobacterium vectors. The parasite could
not survive in a transgenic host expressing specific interfering RNA.
(i) In RNAi, genes are silenced using
(a) ss DNA (b) ds DNA (c) dsRNA (d) ssRNA
Ans.(c)
(ii) Silencing of a gene could be achieved through the use of
(a) (RNAi) only (b) Antisense RNA only (c) both (d) None of the above
Ans.©
(iii) Name the vector use in RNAi :
(a) Agrobacterium tumefaciens (b) Bacillus thruingiensis (c) Aspergillus (d) Drosophila
Ans. (a)
(iv) . Which among the following is not allowed to take place in the case of RNA interference employed in making tobacco
plants resistant to the nematode, Meloidegyneincognitia?
(a) Transcription of mRNA (b) Translation of mRNA
(c) Replication of DNA (d) Maturation of hn RNA.
Ans.(b)
2. (V) A probe which is a molecule used to locate specific sequences in a mixture of, DNA or RNA molecules could be
(a) A single stranded RNA (b) A single stranded DNA
(c) Either RNA or DNA (d) Can be ssDNA but not ssRNA
Ana. (c)
Case-3. GM crops especially Bt crops are known to have higher resistance to pest attacks. To substantiate this an
experimental study was conducted in 4 different farmlands growing Bt and non Bt-Cotton crops. The farm lands had the
same dimensions, fertility and were under similar climatic conditions. The histogram below shows the usage of pesticides
on Bt crops and non-Bt crops in these farm lands.

1.Which of the above 4 farm lands has successfully applied the concepts of Biotechnology to show better management
practices and use of agrochemicals?
Ans. Farm Land II. (1 mark)
2. If you had to cultivate, which crop would you prefer (Bt or Non- Bt) and why?
Ans. Bt crop. Because the use of pesticides is highly reduced for Btcrop Decrease of pesticide used is also more significant
for Bt crop. (1 mark)
3.Cotton Bollworms were introduced in another experimental study on the above farm lands wherein no
pesticide was used. Explain what effect would a Bt and Non Bt crop have on the pest.
Ans: In Bt cotton a cry gene has been introduced from bacterium Bacillus thuringiensis (Bt) which causes synthesis of a
toxic protein. This protein becomes active in the alkaline gut of bollworm feeding on cotton, punching holes in the lining
causing death of the insect. However; a Non Bt crop will have no
effect on the cotton bollworm/ the yield of cotton will decrease / non Bt will succumb to pest attack.

Case -4. Read the following and answer any four questions from 4(i) to 4(v) given below :
The Indian Government has set up organizations such as GEAC , which will make decisions regarding the validity of GM
research and the safety of introducing GM-organisms for public services. Biopatent: A patent is the right granted by a
government to an inventor to prevent others from making commercial use of his invention. Now, patents are granted
for biological entities and for products derived from biological resources. Biopiracy: It is the term used to refer to the
use of bio-resources by multinational companies and other organizations without proper authorization from the
countries and people concerned without compensatory payment. In 1997, an American company got patent rights on
Basmati rice through the US Patent and Trademark Office. This allowed the company to sell a ‘new variety of Basmati, in
the US and abroad. This ‘new’ variety of Basmati had actually been derived from Indian farmer’s varieties. Indian Basmati
was crossed with semi-dwarf varieties and claimed as an invention or a novelty.
(i) GEAC stands for:
(a) Genome Engineering Action Committee
(b) Ground Environment Action Committee
(c) Genetic Engineering Approval Committee
(d) Genetic and Environment Approval Committee Golden rice
Ans. ©
(ii Golden rice is yellow in colour due to the presence of :
(a) riboflavin (b) β – carotene (c) vitamin B1 (d) complex genetic material.
Ans. (b)
(iii) Rules of conduct that may be used to regulate our activities in relation to the biological world is called:
(a) bioethics (b) bio war (c) biopatent (d) biopiracy
Ans. (a)
(iv) Biopiracy means
(a) use of biopatent (b) Thefts of plants and animal
(c) Stealing of bioresources (d) exploitation of bioresources without authentic permission
Ans.(d)
(v) Night blindness can be prevented by use of:
(a) golden rice (b) transgenic tomato (c) transgenic maize (d) Bt Brinjal
Ans.(a)
Case 5 . Read the following and answer questions given below:
Insects in the Lepidopteran group lay eggs on maize crops. The larvae on hatching feed on maize leaf and tender cob. In
order to arrest the spread of three such Lepidopteran pests, Bt maize crops were introduced in an experimental field. A
study was carried out to see which of the three species of lepidopteran pests

Insect gut pH was recorded as 10, 8 and 6 respectively for Species I, II and III respectively.
(a) Evaluate the efficacy of the Bt crop on the feeding habits of the three species of stem borer and suggest which species
is least susceptible to Bt toxin. (1)
Ans. (a) Species III is least susceptible
(b) Which species is most susceptible to Bt-maize, (1)
Ans. (b) Species I is most susceptible.
(c) Using the given information, suggest why similar effect was not seen in the three insect species? (2)
Ans: c) Insect species I and II have alkaline gut pH which solubilises the insecticidal protein crystals of protoxin and makes
it active. Species III has an acidic and the protoxin continues to remain in an inactive form doing no harm to insect species
III.
LONG ANSWER QUESTION ( 5 MARKS)
1. How is a transgenic tobacco plants protected against Meloidegyneincognitia? Explain the procedure.
2.a) What is gene therapy? (1)
b) Describe the procedure of such a therapy that could be a permanent cure for a disease. Name the disease.
3. An application of biotechnology in agriculture involves production of pest resistant plants using Cry gene from a
bacterium. Name the bacterium. Explain why the Cry gene kills the pest but not the bacterium itself.
4.i) GM crops are designed to develop natural resistance from insects and pests. Which crops are modified using
Bacillus thuringiensis?(1mark)
ii) List four advantages of GMOs to a farmer.(2marks)
iii) State that foods derived from genetically modified crops should be tested for possible reaction in the people.
Explain.

5. a) Name the source from which insulin was extracted earlier. Why is this insulin no more in use by diabetic patients?
b) Explain the process of synthesis of insulin by Eli Lilly company. Name the technique used by the company.
c) How is the insulin produced by the human body different from the insulin produced by the above-mentioned
company?
SELF ASSESSMENT TEST (40 MARKS)
MCQ(1 mark)

1.Biopiracy is related to which of the following?

(a) Traditional knowledge
(b) Biomolecules and regarding bioresources
(c) Bioresources
(d) All of the above
2. In 1997, the first transgenic cow, Rosie produced
(a) human protein enriched milk (2.4 g/L)
(b) human protein enriched milk (2.8 g/L)
(c) human calcium enriched milk (2.4 g/L)
(d) human calcium enriched milk (2.8 g/L)
3. Consider the following statements.
I. Bt toxin gene has been cloned from the bacteria.
II. Genetic engineering works only on animals and has
not yet been successfully used on plants.
III. Strains of Bacillus thuringiensis are used in producing bio insecticidal plants.
4. Peptide A and Peptide B are linked by how many disulfide linkages are between their proinsulin.
a) 1 b) 2 c) 4 d)5
5. CryIIAb endotoxin obtained from Bacillus thuringiensis are effective against
a) flies b) mosquitoes c) bollworms c) nematodes
6. Meloidegyneincognitia infects
a) stem of tobacco b)root of tobacco c) leaf of tobacco d) all of these
7. The site of production of ADA in the body is
(a) erythrocytes (b) lymphocytes (c) blood plasma (d) osteocytes
Assertion-Reason( 1mark)
Direction (Q. Nos. 1-2) Each of these questions contains two statements, Assertion (A) and Reason (R). Each of these
questions also has four alternative choices, any one of which is the correct answer. You have to select one of the codes
(a), (b), (c) and (d) given below.
(a) Both A and R are true and R is the correct explanation of A
(b) Both A and R are true, but R is not the correct explanation of A
(c) A is true, but R is false
(d) A is false, but R is true
1. Assertion (A) Transgenic plant production can be achieved via recombinant DNA technology.
Reason(R) An organism that contains and expresses a transgene is called a transgenic organism.
2. Assertion (A) A crop expressing a cry gene is usually resistant to a group of insects.
Reason(R) Cry proteins produced from Bacillus thuringiensis are toxic to larvae of certain insects
3.Assertion: ADA gene therapy was done at first to treat immune disorder due to ADA deficiency.
Reason: The gene ADA cDNA was delivered into the patient's cells using a retroviral vector.
4. Assertion: Organizations like GEAC are necessary to monitor GM researches and to test the safety of introducing
GM organisms for public services.
Reason: GM researches can have unpredictableresults which even can be disastrous when genetically modified
organisms are introduced into the ecosystem.
SA-1(2MARKS)
1. List the advantages of recombinant insulin.
2. What is ADA deficiency and how can it be cured?
3.How is Rosie considered different from a normal cow? Explain.
SA-II( 3 MARKS EACH)
1. (i) Which insects are killed by Bacillus thuringiensis?
(ii) The Bt toxin binds to which cells?
(iii) In which plants, Bt toxin is used?
2. Plasmid is boon to biotechnology. Justify this statement quoting the production of human insulin as an example.
3. What is Agrobacterium mediated genetic transformation described as natural genetic engineering in plants?
CASE BASE QUESTION
GM crops contributed to an increase in the number of functional foods or nutraceutical foods with added benefits.
Nutraceutical foods are applied to isolated nutrients, dietary supplements and herbal products, specific diets, processed
foods. Scientist have developed Golden rice that contains more Vitamin-A. Capacity of Golden rice lines with varying
carotene content to supply the recommended nutrient intake of vitamin-A. The graph below shows the shaded part as
dietary intake of vitamin-A from the other source and the unshaded part as dietary intake of vitamin-A from Golden Rice.
 1. Evaluate the efficacy of golden rice to meet the daily intake of vitamin-A on people.(1 Mark)
2. GM crops are the best solution to overcome issues developed due to conventional breeding. Discuss. (2)
3. Which disease is cause by deficiency of Vitamin-A
LONG ANSWER QUESTION
1.Sunil”s father is suffering from high blood sugar. Doctors had advised regular insulin injections, which were declined
by the family due to objections on the process used in insulin production. The doctor explained the process now used in
insulin production and its advantages.
(i) Why did the family decline the use of insulin injection despite its necessity? (1)
(ii) Name the process by which insulin is produced now-a-days. Explain the process in detail.(3)
(iii) What values are shown by the doctor? (1)
2. Explain the different uses of biotechnology in the medical field.
 CHAPTER-13: BIODIVERSITY AND ITS CONSERVATION
INTRODUCTION
o In our biosphere immense diversity (or heterogeneity) exists not only at the species level but at
all levels of biological organization ranging from macromolecules within cells to biomes.
o Biodiversity can be defined as the combined diversity at all the levels of biological organization.
o Various types of biodiversity are-
o Genetic diversity- A single species might show high diversity at the genetic level over its
distributional range. Example- The genetic variation of the medicinal plant Rauwolfiavomitoria in
potency and concentration of the active chemical reserpine that the plant produces.

Fig.Rauwolfia

o Species diversity: The diversity at the species level. For example, the Western Ghats have a
greater amphibian species diversity than the Eastern Ghats.

Fig. western ghats

o Ecological diversity: diversity at the ecosystem level. For example- deserts, rain forests,
mangroves, coral reefs, wetlands, estuaries, and alpine meadows of India has a greater
ecosystem diversity than a Scandinavian country like Norway.

Fig. coral reefs

NUMBER OF SPECIES ON EARTH AND IN INDIA
o The total number of plant and animal species described so far is slightly more than 1.5 million.
 o Robert May places the global species diversity at about 7 million.
o More than 70 per cent of all the species recorded are animals, while plants including algae, fungi,
bryophytes, gymnosperms and angiosperms comprise no more than 22 per cent of the total.
o Among animals, insects are the most species-rich taxonomic group, making up more than 70 per
cent of the total.
o India has only 2.4 per cent of the world’s land area, its share of the global species diversity is an
impressive 8.1 per cent and that is how makes India is one of the 12 mega diversity countries of
the world.
o Nearly 45,000 species of plants and twice as many of animals have been recorded from India.

Fig. algae, fungi, bryophytes

PATTERN OF BIODIVERSITY

o Latitudinal gradients-
o Species diversity decreases as we move away from the equator towards the poles.
o Tropics harbor more species than temperate or polar areas.
o Colombia located near the equator has nearly 1,400 species of birds while New York at 41° N
has 105 species and Greenland at 71° N only 56 species. India, with much of its land area in the
tropical latitudes, has more than 1,200 species of birds.
o The largely tropical Amazonian rain forest in South America has the greatest biodiversity on
earth- it is home to more than 40,000 species of plants, 3,000 of fishes, 1,300 of birds, 427 of
mammals, 427 of amphibians, 378 of reptiles and of more than 1,25,000 invertebrates.
o Tropics have greatest biodiversity because
1. a) Unlike temperate regions subjected to frequent glaciations in the past, tropical latitudes have
remained relatively undisturbed for millions of years.
2. b) Tropical environments are less seasonal and more constant and predictable which promote niche
specialization and lead to a greater species diversity.
3. c) There is more solar energy available in the tropics, which contributes to higher productivity
thus contributing indirectly to greater diversity.
4. Fig. amazon rain forest
o Species-Area relationships
o Alexander von Humboldtobserved that within a region species richness increased with
increasing explored area, but only up to a limit.
o The relation between species richness and area for a wide variety of taxa such as angiosperm
plants, birds, bats, freshwater fishes turns out to be a rectangular hyperbola.
o On a logarithmic scale, the relationship is a straight line described by the equation
o log S = log C + Z log A where,
S= Species richness A= Area Z = slope of the line (regression coefficient) C = Y-intercept.

o The species-area relationships among very large areas like the entire continents, the slope of the
line is much steeper (Z values in the range of 0.6 to 1.2).
For example, for frugivorous (fruit-eating) birds and mammals in the tropical forests of different
continents, the slope is found to be 1.15.

THE IMPORTANCE OF SPECIES DIVERSITY TO THE ECOSYSTEM

o Communities with more species, generally, tend to be more stable than those with less species.
o A stable community should not show too much variation in productivity from year to year.
o David Tilmanfound that plots with more species showed less year-to-year variation in total
biomass and increased diversity contributed to higher productivity.
o According to the rivet popper hypothesis, in an airplane (ecosystem) all parts are joined
together using thousands of rivets (species).
o If every passenger travelling in airplane starts popping a rivet to take home (causing a species to
become extinct), it may not affect flight safety (proper functioning of the ecosystem) initially, but
as more and more rivets are removed, the plane becomes dangerously weak over a period of
time.
o Loss of rivets on the wings is more serious threat to flight safety than loss of a few rivets on the
seats or windows inside the plane.
Fig. a stable community

LOSS OF BIODIVERSITY
o The colonization of tropical Pacific Islands by humans is said to have led to the extinction of
more than 2,000 species of native bird.
o The IUCN Red List (2004) documents the extinction of 784 species.
o Some examples of recent extinctions include the dodo (Mauritius), quagga (Africa),
thylacine (Australia), Steller’s Sea Cow (Russia) and three subspecies (Bali, Javan,
Caspian) of tiger.
o Loss of biodiversity in a region may lead to
o Decline in plant production
o Lowered resistance to environmental perturbations such as drought
o Increased variability in certain ecosystem processes such as plant productivity, water use, and
pest and disease cycles.

Fig. dodo, thylacine, javan

CAUSE OF BIODIVERSITY LOSS

o Habitat loss and fragmentation
o Tropical rain forests covering more than 14 per cent of the earth’s land surface, these rain forests
now cover no more than 6 per cent.
o The Amazon rain forest called as the ‘lungs of the planet’ harboring probably millions of species
is being cut and cleared for cultivating soya beans or for conversion to grasslands for raising
beef cattle.
o Breaking of large areas into small fragments cause biodiversity loss.
 Fig. tropical rain forest

o Over exploitation
o Many species extinctions in the last 500 years were due to overexploitation by humans. For
example- Steller’s sea cow, passenger pigeon.

Fig. passenger pigeon

o Alien species invasions

o When alien species are introduced these cause decline or extinction of indigenous species.
Example- the Nile perch introduced into Lake Victoria in east Africa led eventually to the extinction of
an ecologically unique assemblage of more than 200 species of cichlid fish in the lake.

o Introduction of the African catfish Clariasgariepinus for aquaculture purposes is posing a threat to
the indigenous catfishes in our rivers.

Fig. African cat fish

o Co-extinctions
o When a species becomes extinct, the plant and animal species associated with it in an obligatory
way also become extinct.
Example-

o When a host fish species becomes extinct, its unique assemblage of parasites also meets the
same fate.
o In plant-pollinator mutualism extinction of one invariably leads to the extinction of the other.
 BIODIVERSITY CONSERVATION
o Reasons of conserving biodiversity is grouped into three categories
 narrowly utilitarian
 broadly utilitarian
 Ethical.

o Narrowly utilitarian- humans derive countless direct economic benefits from nature such as
cereals, pulses, fruits, firewood, fiber, construction material, industrial products like tannins,
lubricants, dyes, resins, and perfumes.

Fig. human beings derive pulses, firewood, dyes from nature

o broadly utilitarian-
o Biodiversity plays a major role in many ecosystem services that nature provides.
o Amazon forest is estimated to produce, through photosynthesis, 20 per cent of the total oxygen
in the earth’s atmosphere
o Bees, bumblebees, birds and bats pollinate the flowers without which plants cannot give us fruits
or seeds.

Fig. pollination

o The ethical argument for conserving biodiversity relates to what we owe to millions of plant,
animal and microbe species with whom we share this planet.
WAYS TO CONSERVE BIODIVERSITY
o Biodiversity can be conserved by In Situ and Ex Situ conservation.
o The process of protecting biodiversity at all levels by conserving and protecting the whole
ecosystem is called in situ conservation.
o The process in which endangered and threatened animals are saved by taking urgent measures
is called ex situ conservation.
o Biodiversity hotspots are the regions with very high levels of species richness and high degree of
endemism.
o Three hotspots – Western Ghats and Sri Lanka, Indo-Burma and Himalaya – cover high
biodiversity regions.

Fig. western Ghats and Himalaya

o Biodiversity-rich regions are legally protected as biosphere reserves, national parks and
sanctuaries.
o India now has 14 biosphere reserves, 90 national parks and 448 wildlife sanctuaries.
o Sacred groves are the forests in which tracts of forest were set aside, and all the trees and
wildlife within were venerated and given total protection. Examples- Khasi and Jaintia Hills in
Meghalaya, Aravalli Hills of Rajasthan.

Fig. khasi hills

o In ex-situ conservation, threatened animals and plants are taken out from their natural habitat
and placed in special setting where they can be protected and given special care. Examples-
Zoological parks, botanical gardens and wildlife safari park.
o Gametes of threatened species can be preserved in viable and fertile condition for long periods
using cryopreservation techniques, eggs can be fertilized in vitro, and plants can be propagated
using tissue culture methods.

Red Data Book-is a state document established for documenting rare and endangered species of
animals, plants, and fungi, as well as some local subspecies that exist within the territory. The Red
Data Book contains the complete list of threatened species.

Brief History of the Red Data Book

The name of this book has its origins in Russia, it was originally known as the Red Data Book of the
Russian Federation or the RDBRF. The book was based on research conducted between 1961 and
1964 by biologists in Russia. Hence, it is also called the Russian Red Data Book.
Currently, the International Union for Conservation of Nature maintains the Red Data Book. IUCN is
the world’s most detailed inventory centre of the global conservation status of biological species.
The International Union for Conservation of Nature (IUCN) was founded in 1948 with an aim to
maintain a complete record of every species that ever lived.

the Red Data Book indexes species as:

• Threatened
• Not threatened
• Unknown

Advantages of the Red Data Book

• It helps in identifying all animals, birds and other species about their conservation status.
• It is used to evaluate the population of a particular species.
• The data available in this book can be used to evaluate the taxa at the global level.
• With the help of this book, we can estimate the risk of taxa becoming globally extinct.
• Provides a framework or guidelines for implementing protective measures for endangered
species.

Disadvantages of the Red Data Book

• The information available in the Red Data Book is incomplete. Many species, both extinct and
extant are not updated in this book.
• The source of the book’s data has been speculated and has been mired in controversy.
• This book maintains the complete record of all animals, plants, other species but it has no
information about the microbes.

Red Data Book of India

Red Data Book of India includes the conservation status of animals and plants which are endemic
to the Indian subcontinent. The data for this book is provided through surveys which are conducted
by the Zoological Survey of India and the Botanical Survey of India under the guidance of the
Ministry of Environment, Forest and Climate Change.

Critically endangered mammals as per the Red Data List of India include:

• Kondana Rat
• Malabar Civet
• Kashmir Stag
• River Dolphins
Critically endangered arthropods include:

• Rameshwaram Parachute spider

• Peacock Tarantula
Critically endangered fish include:

• Pookode Lake barb

• Ganges River shark
• Pondicherry shark
Critically endangered amphibians and reptiles include:

• Gharial
• White-spotted bush frog
• Toad-skinned frog

1. Ramsar sites are defined as wetland sites that are of convention importance and are
developed under Ramsar convention. Ramsar convention is defined as an international
treaty, where it originates this name after the city of Ramsar in Iran, which was signed in the
year 1971 and the negotiation for the Ramsar convention was started in the year 1960 by
different countries and NGO, 37 Ramsar sites in India are named under the Ramsar
Convention.

In July 2022, five new sites from India were added to the List of Ramsar Sites. The new sites
are:
1. Karikili Bird Sanctuary – Tamil Nadu
2. Pallikaranai Marsh Reserve Forest – Tamil Nadu
3. Pichavaram Mangrove – Tamil Nadu
4. SakhyaSagar – Madhya Pradesh
5. Pala Wetlands – Mizoram
2. Khijadia Wildlife Sanctuary in Gujarat and Bakhira Wildlife Sanctuary in Uttar Pradesh were
announced as Ramsar sites (Wetlands of International Importance) on the occasion of World
Wetland day 2022 (2nd February 2022) held at Sultanpur National Park, a Ramsar site in
Haryana.
3. Haiderpur Wetland in Uttar Pradesh has been added as the 47th Ramsar Site in December
2021. It is a human-made wetland formed in 1984 and is located within the boundaries of
Hastinapur Wildlife Sanctuary.
4. Four new sites have been added to the list of Ramsar Sites in India in August 2021. These
are:
• Sultanpur National Park – Gurugram, Haryana
• Bhindawas Wildlife Sanctuary – Jhajjar, Haryana
• Thol Lake Wildlife Sanctuary – Near Ahmedabad, Gujarat
• Wadhvana Wetland – Vadodara, Gujarat
In 2020, the following sites were added to the Ramsar Sites of India List:
• December 2020 – The Tso Kar Wetland Complex was added to the list of Ramsar sites
in India. This includes the high-altitude wetland complex of two connected lakes,
Startsapuk Tso and Tso Kar, in Ladakh.
• November 2020 – Maharashtra – Lonar Lake
• November 2020 – Agra (Uttar Pradesh) – Sur Sarovar also called, Keetham Lake
• November 2020 – Uttarakhand – Asan Barrage
• July 2020 – Bihar – Kanwar Lake or KabalTaal
 • February 2020 – Kolkata – Sunderban Reserve Forest (Sunderban Wetlands)
2nd February 2021 marked the 50th anniversary of the Ramsar Convention, the day which is also
celebrated as World Wetlands Day. India on this occasion established the Centre for Wetland
Conservation & Management which is the first in the country. It is set up under the Ministry of
Environment, Forest and Climate Change (MoEF&CC), at the National Centre for Sustainable
Coastal Management (NCSCM) in Chennai.
Sambhar Lake had been in the news for its deterioration over salt mining. Sambhar Lake is a
Ramsar Site in India.
 CHAPTER- 12:ECOSYSTEM

Introduction

An ecosystem can be defined as a functional unit of nature, where living organisms

interact among themselves and also with the surrounding physical environment.

An ecosystem is divided into two basic categories

• Terrestrial ecosystem. Example- forest, desert.

• Aquatic ecosystem. Example- pond, lake, wetland.

Fig. Terrestrial and forest ecosystem

Ecosystem- structure and functions

The various components of the environment are abiotic and biotic.

Interactions of biotic and abiotic components result in a physical structure that is

characteristic for each type of ecosystem.

Biotic components are the living beings and abiotic components are the nonliving things
of the ecosystem.

Vertical distribution of different species occupying different levels is

called stratification.

The functional components of ecosystem are-

• Productivity
• Decomposition
• Energy flow
• Nutrient cycling
Fig. stratification- trees occupy the top level of the forest, shrubs the second and herbs
and grasses the bottom layer.

• Example of functional components’ of ecosystem is a pond ecosystem

• The abiotic component is the water with all the dissolved inorganic and organic
substances and the rich soil deposit at the bottom of the pond.
• The solar input, the cycle of temperature, day-length and other climatic conditions
regulate the rate of function of the entire pond.
• The autotrophic components include the phytoplankton, some algae and the
floating, submerged and marginal plants found at the edges.
• The consumers are represented by the zooplankton, the free swimming and bottom
dwelling forms.
• The decomposers are the fungi, bacteria and flagellates especially abundant in the
bottom of the pond.

Fig. a pond ecosystem

Productivity

The rate of biomass production is called productivity.

Productivity is of two types-

• Primary productivity
• Secondary productivity.

Primary productivity is defined as the amount of biomass or organic matter produced per
unit area over a time period by plants during photosynthesis.
Primary productivity is expressed in terms of weight (g–2) or energy (kcal m–2 ).

Primary productivity can be divided into

• gross primary productivity (GPP)

• net primary productivity (NPP).

Gross primary productivity of an ecosystem is the rate of production of organic matter

during photosynthesis.

Gross primary productivity minus respiration losses (R), is the net primary productivity
(NPP).

GPP – R = NPP

Secondary productivity is defined as the rate of formation of new organic matter by

consumers.

The annual net primary productivity of the whole biosphere is approximately 170 billion
tons (dry weight) of organic matter.

Fig. productivity

Decomposition

Decomposers break down complex organic matter into inorganic substances like carbon
dioxide, water and nutrients and the process is called decomposition.

Dead plant remains such as leaves, bark, flowers and dead remains of animals, including
fecal matter is called detritus.

Detritus is the raw material for decomposition.

Detritivores are the organisms break down detritus into smaller particles. Example-
millipedes, dung flies, woodlice, burying beetles.

The important steps in the process of decomposition are fragmentation, leaching,

catabolism, humification and

Fragmentation is through breaking down of detritus into smaller particles.

The process by which watersoluble inorganic nutrients go down into the soil horizon and
get precipitated as unavailable salts is called as leaching.

The process by which bacterial and fungal enzymes degrade detritus into simpler
inorganic substances called as catabolism.

Humification is the accumulation of a dark coloured amorphous substance called humus.

The humus is further degraded by some microbes and release of inorganic nutrients
occur by the process known as mineralisation.

Factors affecting the rate of decomposition

Large amount of oxygen is required for decomposition as it is an energy requiring

process.

chitin and lignin present in detritus slower the rate of decomposition.

Nitrogen and water-soluble substances like sugars in detritus increases the rate of
decomposition.

Warm and moist environment favour decomposition whereas low temperature, dryness
and anaerobiosis inhibit decomposition.

Fig. millipedes, dung fly

Energy flow

Sun is the only source of energy for all ecosystems on Earth and except for the deep sea
hydro-thermal ecosystem.

Less than 50 per of incident solar radiation is photosynthetically active radiation

(PAR).

Plants capture only 2-10 per cent of the PAR.

All organisms are dependent for their food on producers.

Flow of energy in the ecosystem is unidirectional.

The green plant in the ecosystem are called producers. Example-In a terrestrial
ecosystem, major producers are herbaceous and woody plants and in aquatic ecosystem
phytoplankton, algae and higher plants are producers.

All animals depend on plants for their food needs are called consumers.

Consumers which feed on the producers, they are called primary consumers or
herbivores. Example- grass

The animals eat herbivores, they are called secondary consumers or primary carnivores.
Example- goat.

The animals which eat the primary carnivores are called tertiary consumers or secondary
carnivores. Example- man.

Based on the source of their nutrition or food, organisms occupy a specific place in the
food chain that is known as their trophic level.

Producers belong to the first trophic level, herbivores (primary consumer) to the second
and carnivores (secondary consumer) to the third trophic level.

Food chain is the flow of energy from one trophic level to another trophic level by eating
and being eaten.

Food chain if is two types-

• Grazing food chain

• Detritus food chain

Food chain which starts from producers and ends on carnivores through herbivores is
called grazing food chain.

Grass --> goat --> man.

Fig. grass is eaten by goat and goat is eaten by men

Food chain which starts from dead organic matter and passes through detrivores to
organisms feeding on detrivores is called detritus food chain.
Detrivores are decomposers which meet their energy and nutrient requirements by
degrading dead organic matter or detritus, these are also known as saprotrophs.

Decomposers secrete digestive enzymes that breakdown dead and waste materials into
simple, inorganic materials.

The interconnected matrix of food chain is called food web. For example- specific
herbivore of one food chain may serve as food of carnivores in another food chain.

Each trophic level has a certain mass of living material at a particular time called as the
standing crop.

The standing crop is measured as the mass of living organisms (biomass) or the number
in a unit area.

Fig. A food chain, where grass is eaten by insects and frogs eat the insects which in turn is
eaten by the snakes and eagles eat the snakes
Ecological pyramid

Ecological pyramid is the graphical representation of various trophic levels of food chain
designed to show their number, biomass and energy.

The base of a pyramid is broad and it narrows down at the apex.

The base of each pyramid represents the producers or the first trophic level while the
apex represents tertiary or top level consumer.

The three ecological pyramids that are usually studied are

• pyramid of number
• pyramid of biomass
• pyramid of energy.
A given species may occupy more than one trophic level in the same ecosystem at the
same time. For example, a sparrow is a primary consumer when it eats seeds, fruits, peas,
and a secondary consumer when it eats insects and worms.

Producers are more in number and biomass than the herbivores, and herbivores are
more in number and biomass than the carnivores so all the pyramids, of number, of
energy and biomass are upright.

The pyramid of biomass in sea is also generally inverted because the biomass of fishes far
exceeds that of phytoplankton.

Pyramid of energy is always upright because when energy flows from a particular trophic
level to the next trophic level, some energy is always lost as heat at each step.

Limitations of ecological pyramids

• It does not take into account the same species belonging to two or more trophic
levels.
• It assumes a simple food chain, something that almost never exists in nature
• It does not accommodate a food web.

•
• Saprophytes are not given any place in ecological pyramids.

Fig. ecological pyramids

Ecosystem services

The products of ecosystem processes are named as ecosystem services.

For example, healthy forest ecosystems

• purify air and water

• mitigate droughts and floods
• cycle nutrients
• generate fertile soils
• provide wildlife habitat
• maintain biodiversity
• pollinate crops
• provide storage site for carbon and also provide aesthetic
• cultural and spiritual values

Fig. pollination
 Chapter 11: Organism and Populations

Introduction

Ecology is the study of the interactions among organisms and between the organism
and its physical (abiotic) environment.

Ecology deals with four levels of biological organization –

o Organism- a living entity which can function on its own.

o Populations- sum of all living organisms of the same species living in a particular
geographical area.
o Communities- a group of people living together in one place.
o Biomes- a large geographical area of various plants and animals.

Fig. deer, an organism

Fig. population of deer

Fig. deer, elephant and tiger form a community

Fig. a biome with different plants and animals

Fig. desert, rain forest, tundra

Population
A group of individuals living in a geographical area who can interbreed and share or
compete for similar resources is called a population.

A population has certain attributes such as birth rates and death rates and in a
population these rates refer to per capita births and deaths, respectively.
The rates are expressed as increase or decrease in number of the members of
the population. For example-
o If in a pond there are 20 lotus plants last year and through reproduction 8 new plants
are added, taking the current population to 28, the birth rate is calculated as 8/20 =
0.4 offspring per lotus per year.
o If 4 individuals in a laboratory population of 40 fruitflies died in a week, the death rate
in the population during that period is 4/40 = 0.1 individuals per fruitfly per week.
Another attribute characteristic of a population is sex ratio.

An individual is either a male or a female but a population has a sex ratio.

A population at any given time is composed of individuals of different ages.
If the age distribution is plotted for the population, the resulting structure is called an
age pyramid.
The shape of the pyramids reflects the growth status of the population whether it is
growing or stable or declining.
Population size is more technically called population density, designated as N.

Population density can be measured by

o Counting the number.

o Percent cover.
o Pug marks and fecal pellets for tiger census.

Population growth
The size of a population keeps changing in time, depending on various factors
including food availability, predation pressure and reduce weather.
The density of a population in a given habitat during a given period, fluctuates due to
changes in four basic processeswhich are-

o Natality refers to the number of births during a given period in the population that
are added to the initial density.
o Mortality is the number of deaths in the population during a given period.
o Immigration is the number of individuals of the same species that have come into
the habitat from elsewhere during the time period under consideration.
o Emigration is the number of individuals of the population who left the habitat and
gone elsewhere during the time period under consideration.
If N is the population density at time t, then its density at time t +1 is Nt+1 = Nt+ [(B + I)
– (D + E)], where
B= number of births

I= number of immigrants

D= number of deaths

E= number of emigrants

N= population density

t= time period.
Fig. four basic processes which fluctuates population density

Growth models : Exponential growth

When resources in the habitat are unlimited, each species grow in number and reach
enormous population density in a short time.
If in a population of size N, the per capita birth rates and per capita death rates are
represented as b and d respectively, then the increase or decrease in N during a unit
time period t (dN/dt) will be dN/dt = (b – d) × N

Let (b–d) = r, then

dN/dt = rN
The r in this equation is called the ‘intrinsic rate of natural increase’.
The integral form of the exponential growth equation as Nt = N0ert, where
Nt= Population density after time t
N0 = Population density at time zero
r = intrinsic rate of natural increase

e = the base of natural logarithms (2.71828).

Growth models :
i. EXPONENTIAL GROWTH:-When the resources in the habitat are unlimited,
each species has the ability to realise fully its innate potential to grow in
number, as Darwin observed while developing his theory of natural selection.
then the population grows in an exponential or geometric fashion.
if ,populationof size N

birth rates as “b” and death rate as “d”, then the increase or decrease in N
 during a unit time period t (dN/ dt) will be

dN/dt = (b-d) X N

let (b-d)=r , then

dN/dt= rN

the r is called the intrinsic rate of natural increase

LOGISTIC GROWTH:-

A population growing in a habitat with limited resources show initially a lag

phase, followed by phases of acceleration and deceleration and finally an
asymptote, when the population density reaches the carrying capacity.

This type of population growth is called Verhulst-Pearl Logistic Growthand is

described by the following equation:
dN/dt = rN (K-N/N), where
N = Population density at time t

r = Intrinsic rate of natural increase

K = Carrying capacity

Population interaction
Interspecific interactions arise from the interaction of populations of two different
species.
Interspecific interactions could be beneficial, detrimental or neutral to one of the
species or both.
Both the species benefit in mutualism and both lose in competition in their interactions
with each other.
In both parasitism and Predation only one species benefits

The interaction where one species is benefitted and the other is neither benefitted nor
harmed is called commensalism.

In amensalism on the other hand one species is harmed whereas the other is
unaffected. Predation, parasitism and commensalisms share a common
characteristic– the interacting species live closely together.

Predation
It is an interspecific interaction where organisms of higher trophic levels feed on
organisms of lower trophic level.

Herbivores are predators as they feed on grass.

Exotic species have no predators hence they grow very rapidly. Example- The prickly
pear cactus introduced into Australiaand the invasive cactus was brought under
control only after a cactus-feeding moth was introduced in the country.

Fig. cactus
Importance of predation in an ecosystem are–
o Predator keeps prey populations under control.
o Predator acts as a passage for transfer of energy across trophic levels.
o Predators help in maintaining species diversity in a community by reducing the
intensity of competition among competing prey species.
Some species of insects and frogs are cryptically-colored (camouflaged) to avoid
being detected easily by the predator.

Fig. colored frogs

Some are poisonous and therefore avoided by the predators.

The Monarch butterfly is highly distasteful to its predator (bird) because of a special
chemical present in its body which is acquired by feeding a poisonous weed during
caterpillar stage.

All insects are known to be phytophagous as these feed on plant sap and other parts
of plants.
Thorns in Acacia, cactus are morphological means of defense against insects.

Many plants produce and store some chemical which make the herbivores sick if
eaten and even kill the predators.

Calotropisproduce poisonous cardiac glycosides against herbivores.

Fig. calotropis

Nicotine, caffeine, quinine, opium are produced by plant as defenses against the
grazers and browsers.
Competition
Competition is struggling by the organisms for the same resources like food, shelter
and sex.
The competition is between two organisms belonging to same species, this is called
intraspecific competition.

The competition between organisms belonging to different species is called

interspecific competition. For example- in some shallow South American lakes visiting
flamingoes and resident fishes compete for their common food, the zooplankton in the
lake.
Fig. flamingoes

Resources need not be limiting for competition to occur. For example- Abingdon
tortoise in Galapagos Islands became extinct within a decade after goats were
introduced on the island, apparently due to the greater browsing efficiency of the
goats.

Fig. Abingdon tortoise

The occurrence of competition in nature comes from competitive release.

Competitive release is the process in which a species whose distribution is restricted

to a small geographical area because of the presence of a competitively superior
species, is found to expand its distributional range dramatically when the competing
species is experimentally removed.
Connell’s elegant field experiments showed that on the rocky sea coasts of Scotland,
the larger and competitively superior barnacle Balanus dominates the intertidal area,
and excludes the smaller barnacle Chathamalus from that zone.

Gause’s ‘Competitive Exclusion Principle’states that two closely related species

competing for the same resources cannot co-exist indefinitely and the competitively
inferior one will be eliminated eventually
Species facing competition might evolve mechanisms like resource partitioning that
promote co-existence rather than exclusion.

If two species compete for the same resource, they could avoid competition by
choosing different times for feeding or different foraging patterns, this is called
resource partitioning.

MacArthur showed that five closely related species of warblers living on the same tree
were able to avoid competition and co-exist due to behavioural differences in their
foraging activities.
Parasitism
Parasitism is the association between two organisms in which one organism is
benefitted and another organism is harmed.

Some of the parasitic adaptations are-

o Loss of unnecessary sense organs
o Presence of adhesive organs or suckers to cling on to the host.

o Loss of digestive system.

o High reproductive capacity.

o The life cycles of parasites are often complex, involving one or two intermediate
hosts or vectors to facilitate parasitisation of its primary host.
o The human liver fluke depends on two intermediate hosts, a snail and a fish to
complete its life cycle.
Effects of parasites on the host-

o Majority of the parasites harm the host.

o They may reduce the survival, growth and reproduction of the host and reduce its
population density.
o They might render the host more vulnerable to predation by making it physically
weak.
Parasites that feed on the external surface of the host organism are called
ectoparasites. Examples-
o The lice on humans and ticks on dogs
o Many marine fish are infested with ectoparasiticcopepods.

o Cuscuta, a parasitic plant that is commonly found growing on hedge plants, has
lost its chlorophyll and leaves in the course of evolution and derives its nutrition
from the host plant which it parasitizes.
Endoparasites are those that live inside the host body at different sites. Example- tape
worm, liver fluke.

Brood parasitism is the process in which the parasitic bird lays its eggs in the nest of
its host and lets the host incubate them.

The eggs of the host is similar with the egg of the host. For example- cuckoo lays
eggs in the nest of the crow.

Fig. lice on human

Commensalism
The type of interaction in which one species benefits and the other is neither harmed
nor benefited is called commensalism. Example-

o An orchid growing as an epiphyte on a mango branch.

o Barnacles growing on the back of a whale.
o Clown fishes living among stinging tentacles of sea anemone.

Fig. Barnacles growing on the back of a whale

Mutualism
Mutualism is the interaction between two living organisms where both the organisms
are equally benefitted and no one is harmed. Examples-

o Lichens represent an intimate mutualistic relationship between a fungus and

photosynthetic algae or cyanobacteria.

Fig. lichens
o Mycorrhizae are associations between fungi and the roots of higher plants, where
the fungi help the plant in the absorption of essential nutrients from the soil while
the plant in turn provides the fungi with energy-yielding carbohydrates.
o Plants provide nectar and pollen for pollinating agents and the pollinating agents in
turn pollinate the flowers of plants.
o Animals disperse the seeds of plants and plants provide juicy fruits for seed
dispersers.
o Fig tree is pollinated by a species of wasp only where the wasp pollinates the fig
inflorescence while searching for suitable egg-laying sites and in return for the
favor of pollination the fig offers the wasp some of its developing seeds, as food for
the developing wasp larvae.
Fig. fig tree

Amensalism
The interaction in which one species is harmed while the other is neither benefitted
nor harmed is called amensalism.

Example- Penicilium inhibits the growth of various bacteria by secreting penicillin.

Fig. penicilium

Sexual deceit
Sexual deceit is the process in which petal of its flower bears an uncanny
resemblance to the female of the bee in size, colour and markings. Example- the
Mediterranean orchid Ophrys.

The male bee is attracted to what it perceives as a female, ‘pseudocopulates’ with the
flower, and during that process is dusted with pollen from the flower.

When this same bee ‘pseudocopulates’ with another flower, it transfers pollen to it
and thus, pollinates the flower.

Fig. the Mediterranean orchid Ophrys

SAMPLE
PAPERS
 SAMPLE PAPER-1
BLUE PRINT

SUBJECT : BIOLOGY (THEORY) CLASS : XII

Time : 3 Hours Max. Marks: 70

The weightage of the distribution of marks over different dimensions of the question paper shall be
as follows :
1. Weightage of Content/Subject Units
Unit Content Marks
1 Reproduction 16
2 Genetics and Evolution 20
3 Biology and Human Welfare 12
4 Biotechnology and its application 12
5 Ecology and Environment 10
Total 70

2. Weightage of Different Form of Questions

S.No. Form of Questions Marks for each No. Of questions Total Marks
1 Very short answer (VSA) 1 16 16
2 Short answer (SA I) 2 5 10
3 Short answer (SA II) 3 7 21
4 Case based question 4 2 8
5 Long Answer 5 3 15
Total 33 70

3. Scheme of Option
1. There will be no overall option.
2. Internal choice (either/or type) on a very selective basis has been provided. The choice
has been given in one question of 4 marks and all the three questions of 5 marks weightage.

4. Weightage to difficulty level of questions

S.No. Estimated Difficulty Level Percentage
1 Easy 20
2 Average 60
3 Difficult 20

S Unit VSA - I SA - I SA - II CBQ LA Marks

No. 1 mark 2 marks 3 marks 4 marks 5 marks allotted
1 Reproduction 3[3] 2[1] 6[2] - 5[1] 16
2 Genetics and Evolution 3[3] 2[1] 6[2] 4[1] 5[1] 20
3 Biology and human welfare 3[3] 2[1] 3[1] 4[1] 12
4 Biotechnology and its application 2[2] 2[1] 3[1] - 5[1] 12
5 Ecology and environment 5[5] 2[1] 3[1] - - 10
Total (Qus. 26) 16(16) 10(5) 21(07) 8(2) 15(3) 70
 SAMPLE QUESTION PAPER-1
CLASS XII SUBJECT-BIOLOGY (044)
Maximum Marks: 70 Time: 3 hours
General Instructions:
(i) All questions are compulsory.
(ii) The question paper has five sections and 33 questions. All questions are compulsory.
(iii) Section–A has 16 questions of 1 mark each; Section–B has 5 questions of 2 marks each; Section– C has 7
questions of 3 marks each; Section– D has 2 case-based questions of 4marks each; and Section–E has 3
questions of 5 marks each.
(iv) There is no overall choice. However, internal choices have been provided in somequestions. A
student has to attempt only one of the alternatives in such questions.
Wherever necessary, neat and properly labeled diagrams should be drawn.
SECTION - A
Q.NO. Question Mark
s
The prenatal technique to determine the genetic disorders in a foetus is called 1
1.
(a) Laproscopy (b) Amniocentesis
(c) Abstinence (d) Coitus interrupts
Both chasmogamous and cleistogamous flowers are present in 1
2
(a) Helianthus (b) Commelina
(c) Rosa (d) Gossypium
In XO type of sex determination 1
3.
(a) females produce two different types of gametes
(b) males produce two different type of gametes
(c) females produce gametes with Y chromosomes
(d) males produce gametes with Y chromosomes .
Who proposed that the first form of life could have come from pre-existing non-living organic 1
4.
molecules ?
(a) S.L. Miller (b) Oparin and Haldane
(c) Charles Darwin (d) Alfred Wallace
5. A protein or polysaccharide molecule that stimulates antibody formation. 1
(a) antigen (b) antibiotics
(c) exotoxin (d) endotoxins
6. The primary treatment of wastewater involves the removal of 1
(a) dissolved impurities (b) stable particles
(c) toxic substances (d) harmful bacteria
7. Which of the following water samples in the table given below, will have a higher concentration 1
of organic matter?
Water Sample Level of pollution Value of BOD
High High
Low Low
Low High
(d) High Low
8. In an experiment, recombinant DNA bearing ampicillin-resistance gene is transferred into E.coli 1
cells. The host cells are then cultured on a medium containing ampicillin. The result will be
(a) both transformants and non-transformants cannot survive.
(b) both transformants and non-transformants can survive.
(c) transformants only survive and the non-transformants cannot survive.
(d) transformants cannot survive, but non-transformants can survive.

9. The maximum growth rate occurs in : 1

(a) Lag phase (b) Exponential, phase
(c) Stationary phase (d) Senescent phase
10. Which types of the following pyramid are never inverted? 1
(a) Pyramid of energy (b) Pyramid of biomass
(c) Pyramid of number (d) Pyramid of dry biomass
The main difference between "Sixth Extinction" and the previous five extinctions is that ,the sixth 1
11. extinction:
a) is mainly occurring on islands b) is mainly affecting plants
c) is occurring at a faster rate d) does not involve human activities
12. Which of the following is an example of ex-situ conservation? 1
(a) Sacred Grooves (b) National Park
(c ) Biosphere Reserve (d) Seed Bank
Question No. 13 to 16 consist of two statements – Assertion (A) and Reason (R). Answer
thesequestions selecting the appropriate option given below:
A. Both A and R are true and R is the correct explanation of A.
B. Both A and R are true and R is not the correct explanation of A.
C. A is true but R is false.
D. A is False but R is true.
13 Assertion: A typical microsporangium of angiosperms is generally surrounded by four wall layers 1
– epidermis , endothecium , middle layers and tapetum .
Reason: The outer three wall layers perform the function of protection and helps in dehiscence
of anther to release the pollen .
14 Assertion: Sickle cell anaemia is an autosome – linked recessive disorder that can be
transmitted if both parents are heterozygous for the gene .
Reason: In sickle cell anaemia , Haemoglobin molecule undergoes polymerization under
1
low oxygen tension causing the change in shape of RBC
15 Assertion: Human insulin can be produced into bacterial cells using biotechnology. 1
Reason: To produce human insulin the A , B and C polypeptides of the human insulin are
produced separately in the bacterial cells , extracted and combined by creating
disulphide bonds.
16 Assertion: Amount of organic matter synthesized by producers per unit time and per unit area
during the process of photosynthesis is referred as net primary productivity . 1
Reason: Primary productivity is usually high and sustained throughout the year in temperate
are as due to abundance of sunlight .
SECTION B 2
 Name the muscular and glandular layers of human uterus. Which one of these layers undergoes 2
cyclic changes during menstrual cycle? Name the hormone essential for maintenance of this
17 layer.
18 Why are F2 phenotypic and genotypic ratios same in a cross between red flowered snapdragon 2
and white flowered snapdragon plants? Explain with the help of cross.
19 Name the interactions in the following organisms: 2
a. Fig and Wasp b. Cuscuta and shoe flower c. Clown fish and sea anemone d. Cuckoo and crow

20 Study the diagram given below and answer the following questions 2

(i) “ DNA fragments in band D moved farther away in comparison to those in band C.”why?
(ii) Identify the anode end in diagram.
(iii) How are these DNA fragments visualized?

21 Explain the difference between an upright pyramid of biomass and an inverted pyramid of 2
biomass, with the help of labelled diagrams.

SECTION C 3
The below diagram shows human male reproductive system (one side only).
22

(i) Identify ‘X’ and write its location in the body.

(ii) Name the accessory gland ‘Y’ and its secretion.
(iii) Name and state the function of ‘Z

In the T.S. of a mature anther given below, identify ‘a’ and ‘b’ and mention their functions. 3
23

A. If the base adenine constitutes 31% of an isolated DNA fragment, then what is the expected 3
24
percentage of the base cytosine in it?
 B. A template strand is given below. Write down the corresponding coding strand and the mRNA
strand that can be formed, along with their polarity.
3′- ATGCATGCATGCATGCA TGCATGC-5’
Given below is a diagrammatic representation of the experimental setup used by SL Miller for his 3
25
experiment.

(i) Write the names of different gases contained and the conditions set for the reaction in the
flask A.
(ii) State the type of organic molecule he collected in the water at B.
(iii) Write the conclusion he arrived at.
A. A patient showed symptoms of sustained high fever, stomach pain and constipation, but no 3
26
blood clot in stools. Name the disease and its pathogen. Write the diagnostic test for the disease.
How does the disease get transmitted?
OR
Identify A, D, E and F in the diagram of an antibody molecule given below. Why is antibody
molecule called H2L2 molecule.

27 (i) Name the organism in which the vector shown is inserted to get the copies of the desired
3
gene.
(ii) Mention the area labelled in the vector responsible for controlling the copy number of the
inserted gene.
(iii) Name and explain the role of a selectable marker in the vector shown.
28 A. Identify A and B in the figure given below representing proportionate number of major
1
vertebrate taxa.

B. List four causes of biodiversity loss.

SECTION D
Q.no 29 and 30 are case based questions. Each question has subparts.
Read the following question and answer the following question
29
In a court of law , a woman with blood group ‘AB’ claims a child of blood group ‘O’ to be hers as
her husband is of blood group O’ another couple of blood group ’A’ and ‘B’ also claims the child
as theirs . The judge took the help of Geneticists and the child was handed over to the second
couple , with Blood groups ‘A’ and ‘B’ .
4

1. The possible Blood groups of the children of the first couple are
a. A and B
b. AB and A
c. AB and B
d. A,B and AB
2. The possible Genotypes of second couple are
a. IA IA X IB IB
b. IA i X IB IB
c. IA IA X IB i
d. IA i X IB i
3. The possible Blood groups of the children of the second couple are
a. A , B and O
b. A, AB and O
c. B , AB and O
d. A, B, AB and O
4. A person with Blood group AB shows
a. Both Antigen A and Antigen B but no antibodies.
b. Both Anti - A and Anti - B antibodies
c. Antigen A and Anti- B antibodies
d. Antigen B and Anti- A antibodies
 Read the following question and answer the following question : 4
30
Immunity in our body is of two types : 1. Innate immunity and 2. Acquired immunity . Innate
immunity is a non specific defence mechanism whereas acquired immunity is pathogen specific it
is called specific immunity too. Acquired immunity is characterized by memory .Antibodies are
specific to antigens and their four types of antibodies produced in our body they are IgA, IgE , IgG
and IgM. It shows primary response when it encounters the pathogen for the first time and
secondary response during the subsequent and counters with the same antigen / pathogen.

1. The primary and secondary responses are carried out with specialised types of cells namely
a. Macrophages and T- lymphocytes
b. Natural killer cells and B-lymphocytes
c. neutrophils and macrophages
d. B- lymphocytes and T- lymphocytes
2. The type of antibody produced during allergic reaction is
a. IgA b. IgE c. IgG d. IgM
3. Colostrum contains antibodies
a. IgA b. IgE c. IgG d. IgM
4. The organ transplants( grafts ) are often rejected if not taken from a compatible person it is
a. Due to cell mediated immunity
b. mediated by T-lymphocytes
c. because body distinguishes self and non-self cells
d. all of these
SECTION E
5
31 Given below is the diagram of a human ovum surrounded by a few sperms. Study the diagram
and answer the following questions.

(i) Which one of the sperms would reach the ovum earlier?
(ii) Identify ‘D and ‘E. Mention the role of ‘E.
(iii) Mention what helps the entry of sperm into the ovum and write the changes occurring
in the ovum during the process.
(iv) Name the specific region in the female reproductive system where the event
represented in the diagram takes place
OR
A. Draw a diagram of a section of a megasporangium (anatropous ovule) of an angiosperm and
label funiculus, micropyle, embryo sac and nucellus.
B. Explain polyembryony and apomixis .
32 Answer the following questions based on Meselson and Stahl’s experiment on E.coli.
5
(i) Write the name of the chemical substance used as the only source of nitrogen in the
experiment.
(ii) Why did they allow the synthesis of the light and the heavy DNA molecules in the organism?
 (iii) How did they distinguish the heavy DNA molecules from the light DNA molecules?
(iv) Write the conclusion the scientists arrived at, at the end of the experiment.
OR
A. The following is the flow chart highlighting the steps in DNA fingerprinting technique.
Identify a, b, c, d, e and f.

B. Study the schematic representation of the genes involved in the lac operon given below and
answer the questions that follows

(i) Identify and name the regulatory gene in this operon.

(ii) Name the inducer molecule and the products of the genes z and y of the operon.
33 A. Why is making cells competent essential for biotechnology experiments? List any two ways by 5
which this can be achieved
B. Explain the roles of the following with the help of an example each in recombinant DNA
technology.
(i) Restriction enzymes
(ii) Plasmids
OR
A Explain how Eli Lilly, an American company, produced insulin by recombinant DNA technology
B. Why is proinsulin so called? How is proinsulin different from functional insulin in humans?

*******************************
 SAMPLE PAPER -1
MARKING SCHEME
CLASS XII BIOLOGY (044)
Q.No. ANSWER Marks
SECTION - A
1 (b) Amniocentesis 1

2 (b) Commelina 1

3 (b) males produce two different types of gamete 1

4 (b) Oparin and Haldane 1

5 (a) antigen 1

6 (b) stable particles 1

7 (a) High , High 1

8 (c) transformants only survive and not the non-transformants can survive. 1

9 (b) Exponential phase 1

10 (a) Pyramid of energy 1

11 c) is occurring at a faster rate 1

12 (d) Seed Bank 1

Question No. 13 to 16 consist of two statements – Assertion (A) and Reason (R). Answer
these questions selecting the appropriate option given below:
A. Both A and R are true and R is the correct explanation of A
B. Both A and R are true and R is not the correct explanation of A
C. A is true but R is false
D. A is False but R is true

13 b 1

14 b 1

15 c 1

16 d 1
SECTION – B

17 Myometrium , endometrium , endometrium goes under cyclical changes. 2

progesterone hormone maintains it
18 It can be explained with the help of a cross given below 2

19 a. Mutualism b. Parasitism c. Commensalism d. Brood Parasitism 2

20 (i) In band D, DNA fragments are smaller than those on band C. The fragments separate according 1
to their size through the sieving effect provided by the gel. So, the smaller fragments move farther
away than the larger ones. ½
(ii) B is anode end in the diagram as DNA fragments are moving towards this end. ½
(iii) Gel containing DNA fragments are stained with ethidium bromide and exposed to UV radiation.
Orange colour bands of DNA become visible.
21 a. b. 2

22 (i) X-Testis. It is located outside the abdominal cavity within a pouch called scortum. 1*3
(ii) Y-Seminal vesicle. It produces an alkaline secretion rich in fructose and constitutes 60% of the
volume of the semen.
(iii) Z-Epididymis. It stores the sperms and transports the sperm from the testis to outside the
testis.
23 In the given figure a is sporogenous tissue and b is tapetum. 1
Sporogenous tissue has cell which are potential Pollen Mother Cell (PMC) or microspore mother
cell and give rise to microspore tetrad after meiotic cell division. 2

Tapetum nourishes the developing microspores or pollen grains.

24 A. According to Chargaff’s rule A + G = C+ T = 50% 1½
∴ if A = 31% then T = 31%;
C + T = 50%
∴ C = 50% – 31% = 19%

B. For the given template strand 3- ATGCATGCAT GCATGCATGCATGC- 5′ 1½

Coding strand is 5′- TACGTACGTACGTACGTACG TACG – 3′
and mRNA strand is 5′- UACGUACGUACGUACGU ACGUACG – 3′

25 (i) Gases were methane, ammonia, hydrogen and water vapour. In ‘A’ flask electric discharge was 3
created using electrodes.
(ii) The organic molecules collected in water at ‘B’ were amino acids.
(iii) He concluded that life could have come from pre-existing non-living organic molecules and their
formation was preceded by chemical evolution.

26 The symptoms, such as constant high fever, stomach pain and constipation, weakness and 3
headache are shown in typhoid.
Its causative’agent is a bacterium called Salmonella typhi. Widal test is used for its diagnosis.
Typhoid is transmitted through contaminated food and water.
OR
A-Antigen binding region,
D-Light chain 2
E-Heavy chain
F-Disulphide bond/bridge
2 heavy chain and 2 light chain 1

27 i) Escherichia coli(E.coli) ½
(ii) Ori in the vector is responsible for controlling the copy number of inserted gene. ½
(iii) The genes encoding resistance to antibiotics like tetR resistant to tetracycline and ampR resistant
to ampicillin are used as selectable markers. If a foreign DN A is ligated at the Bam HI site of 2
tetracycline resistance gene, the recombinant plasmids will lose the tetracycline resistance due to
insertional inactivation but transformants can be selected by growing them on ampicillin containing
medium. The selectable markers help in identifying and eliminating non-transformants and
selectively permitting the growth of transformants

28 A In the mentioned diagram, among the major vertebrate taxa 1

A-represents mammals.
B-represents ambhibians
B The four causes of biodiversity loss are as follows

• Habitat loss and fragmentation

• Overexploitation 2
• Alien species invasions
• Coextinctions.
29 1. A 1*4
2. D
3. D
4. A
30 1. D 1*4
2. B
3. A
4. D
31 (i) The sperm ‘A’ would reach the ovum earlier. 1
(ii) D-Cororia radiata, E-Zona pellucida-During fertilisation, a sperm comes in contact with zona 2
pellucida layer of the ovum and induces changes in the membrane that block the entry of additional
sperms. Hence, E helps to prevent polyspermy. 1
(iii) The hydrolytic secretions of the acrosome help the sperm to enter into the cytoplasm of the
ovum through the zona pellucida and the plasma membrane. This induces the completion of the
meiotic division of the secondary oocyte. 1
(iv) These events take place in the ampullary-isthmic junction of the Fallopian tube of uterus.

OR
A.

B. Occurrence of more than one embryo in a seed is called polyembryony .

Development of seed without fertilization is called apomixis . 2

32 (i) NH4Cl (Ammonium chloride). 1

(ii) It is to show that after one generation E. coli with 15N -DNA in a medium of 14N, has DNA of 2
intermediate density between the light and heavy DNAs.
It shows that of the two strands, only one strand is synthesised newly, using the 14N-nitrogen source
in the medium. 1
(iii) The heavy and light DNA molecules can be differentiated by centrifugation in a cesium chloride
(CsCl) density gradient.
The 15N -DNA was heavier than 14N -DNA and the hybrid 15N – 14N -DNA was intermediate between
the two newly form DNA strands. 1
(iv) Scientists concluded that the DNA replication is semi-conservative, i.e. of the two strands of
DNA, one is the parental strand, while the other is newly synthesised.

OR
3
a – Restriction endonuclease
b – Agarose gel
c – Nitrocellulose or Nylon
d – VNTR
e – Hybridisation
f- Autoradiography
B. (i) i gene-regulatory gene : It codes for the repressor protein of the operon ½
(ii) Lactose is an inducer molecule.
Gene ‘Z’ codes for p-galactosidase ‘y’ gene codes for permease. 1½
33 Since, DNA molecules are hydrophilic, they cannot pass through cell membranes. For recombinant
DNA to be integrated into vector or host genome, it is necessary for the DNA to be inserted in the
cell. Therefore, making the host cells competent is necessary in biotechnology experiments. 3
The two ways by which cells can be made competent to take up DNA are (any two ways)
• Chemical action The host cell is treated with a specific concentration of divalent cation, i.e. calcium
increases the pore size in the cell membrane. DNA is then incubated with treated bacterial cell at
42°C, thereby increasing the efficiency of DNA to enter it through pores in cell wall.
• Heat shock treatment Incubating the cells with recombinant DNA on ice, followed by brief
treatment of heat at 42°C and again putting them back on ice.
B. (i) The restriction enzymes are known as molecular scissors. These enzymes belong to a larger
group of enzymes called nucleases, which are of following two types
• Exonucleases Those, who remove nucleotides from the ends of the DNA (either 5′ or 3′) in one
strand of duplex.
• Endonucleases Those, who make cuts at specific position within the DNA. Each restriction
endonuclease functions by ‘inspecting’ the length of a DNA sequence. 2
Role of Restriction Enzyme in Recombinant DNA Technology The restriction endonucleases are used
to cut plasmid DNA as well as foreign DNA at desired sites. The foreign DNA is then inserted into
plasmid DNA and the plasmid takes the foreign DNA into the desired host organism.
Example The first discovered restriction enzyme is Hind II. It was isolated from Haemophilus
influenzae. It always cuts DNA at 5 GT (Pyrimidine T Or C (Purine A or G) AC3′ and 3’CA (Purine A or
G) (Pyrimidine T or C) TG5′.
It produces DNA segments with blunt ends.
(ii) Plasmids These are extrachromosomal, self-replicating, double-stranded, closed and circular DNA
molecules. It is found only in bacteria and few yeast cells.
Role of Plasmid in DNA Recombinant Technology These are used as vectors to carry the desired
gene (foreign genes) into the desired host organisms.
For example, pBR322 is widely used plasmid vector. In its name P signifies plasmid, B is from Boliver
and R is from Rodriguez. Boliver and Rodriguez were two scientists who developed pBR322 in 1977.
This plasmid has genes for resistance against ampicillin and tatracycline. They have restriction sites
for enzymes like PvuI, Pst I, Sal I, Bam HI.
OR
A. Steps involved in insulin production by Eli Lilly company are as follows 3
• DNA sequences corresponding to the two polypeptide, A and B-chains of insulin were
synthesised in vitro.
• They were introduced into plasmid DNA of E. coli.
• This bacterium was cloned under suitable conditions.
• The transgene was expressed in the form of polypeptides A and B, secreted into the medium.
• They were extracted and combined by creating disulphide bridge to form human insulin.

B. Human insulin when initially synthesised in human body consists of three peptide chains-A, B
and C. The C-peptide is an extra stretch of amino acids joining the A and B-chains. This is called
proinsulin or prohormone. It undergoes processing or splicing to release the functional mature 2
insulin that can carry out its normal functions.
During processing, the C-peptide is removed. Only A and B-chains contribute to form the functional
insulin
 SAMPLE PAPER-2
BLUE PRINT

SUBJECT : BIOLOGY (THEORY) CLASS : XII

Time : 3 Hours Max. Marks: 70

The weightage of the distribution of marks over different dimensions of the question paper shall be
as follows :
1. Weightage of Content/Subject Units
Unit Content Marks
1 Reproduction 16
2 Genetics and Evolution 20
3 Biology and Human Welfare 12
4 Biotechnology and its application 12
5 Ecology and Environment 10
Total 70

2. Weightage of Different Form of Questions

S.No. Form of Questions Marks for each No. Of questions Total Marks
1 Very short answer (VSA) 1 16 16
2 Short answer (SA I) 2 5 10
3 Short answer (SA II) 3 7 21
4 Case based question 4 2 8
5 Long Answer 5 3 15
Total 33 70

3. Scheme of Option
1. There will be no overall option.
2. Internal choice (either/or type) on a very selective basis has been provided. The choice
has been given in one question of 4 marks and all the three questions of 5 marks weightage.
S Unit VSA - I SA - I SA - II CBQ LA
2 3 Marks
No. 1 mark marks marks 4 marks 5 marks allotted
1 Reproduction 3[3] 2[1] 6[2] - 5[1] 16
2 Genetics and Evolution 3[3] 2[1] 6[2] 4[1] 5[1] 20
3 Biology and human welfare 3[3] 2[1] 3[1] 4[1] 12
4 Biotechnology and its application 2[2] 2[1] 3[1] - 5[1] 12
5 Ecology and environment 5[5] 2[1] 3[1] - - 10
Total (Qus. 26) 16(16) 10(5) 21(07) 8(2) 15(3) 70

4. Weightage to difficulty level of questions

S.No. Estimated Difficulty Level Percentage
1 Easy 20
2 Average 60
3 Difficult 20
 SAMPLE QUESTION PAPER-2
CLASS XII SUBJECT-BIOLOGY (044)
Maximum Marks: 70 Time: 3 hours
General Instructions:
(i) All questions are compulsory.
(ii) The question paper has five sections and 33 questions. All questions are compulsory.
(iii) Section–A has 16 questions of 1 mark each; Section–B has 5 questions of 2 marks each; Section– C has 7
questions of 3 marks each; Section– D has 2 case-based questions of 4 marks each; and Section–E has 3
questions of 5 marks each.
(iv) There is no overall choice. However, internal choices have been provided in some questions. A student has
to attempt only one of the alternatives in such questions.
Wherever necessary, neat and properly labeled diagrams should be drawn.
SECTION - A
1 Consider the statements regarding contraception and answer as directed - 1
(a) Medical termination of pregnancy during first trimester is generally safe.
(b) Chances of contraception are nil until mother females breast feeds the infant upto two years.
(c) Intrauterine devices like copper-T are effective contraceptives.
(d) Contraceptive pills may be taken upto one week after coitus to prevent contraception.
Which two of the above statements are correct:-
(a) a, c (b) a,b (c ) b,c (d) c,d
2 Match the items of column I with suitable items of column II. 1
Column I Column II
A. Barrier method (i) Condoms
B. IUD (ii) Multiload 375
C. Surgical technique (iii) Tubectomy
D. Hormone administration (iv) Implants
Choose the correct option.
(a) A-(i), B-(ii), C-(iv), D-(iii)
(b) A-(i), B-(ii), C-(iii). D-(iv)
(c) A-(i), B-(iv), C-(i), D-(iii)
(d) None of these
3 Which of the following are the functions of RNA? 1
(a) It is a carrier of genetic information from DNA to ribosomes synthesising
polypeptides.
(b) It carries amino acids to ribosomes.
(c) It is a constituent component of ribosomes.
(d) All of the above.
4 The process by which organisms with different evolution history evolve similar phenotypic 1
adaptations in response to a common environmental challenge is called
(a) Adaptive radiation (b) Natural selection
(c) Convergent evolution (d) Non-random evolution.
5 Use of antihistamines and steroids give a quick relief from 1
(a) Nausea (b) Headache (c) Cough (d) Allergy.
6 Barrier created by saliva and tears is related to 1
(a) Physiological barriers (b) Cellular barriers (c) Cytokine barriers (d) Physical barriers.
7 Mycorrhiza does not help the host plant in 1
(a) Enhancing its phosphorus uptake capacity (b) Increasing its tolerance to drought
 (c) Enhancing its resistance to root pathogens (d) Increasing its resistance to insects.
8 DNA fragments generated by restriction endonucleases in a chemical reaction can be separated 1
by
(a) Restriction mapping (b) Centrifugation (c) Polymerase chain reaction (d) Gel Electrophoresis.
9 The birth and death rates of four countries are given below. Which one will have the least 1
population growth rate?
Country Birth rate/1000 Death rate/1000
M 15 5
N 25 10
O 35 18
P 48 41

(a) M (b) N (c ) O (d) P

10 The logistic population growth is expressed by 1
(a) dN/dt = rN (b) dN/dt =rN (N-K/N) (c) dt/dN = Nr (K-N/K) (d) dN/dt = rN (K-N/K)
11 Highest value in g/m²/yr in grassland ecosystem is found in 1
(a) Gross primary production (b) Net primary production
(c) Secondary production (d) Tertiary production.
12 Which of the following is not an invasive alien species in the Indian context? 1
(a) Lantana (b) Cynodon (c) Parthenium (d) Eichhornia
Question No. 13 to 16 consist of two statements – Assertion (A) and Reason (R). Answer these 1
questions selecting the appropriate option given below:
E. Both A and R are true and R is the correct explanation of A.
F. Both A and R are true and R is not the correct explanation of A.
G. A is true but R is false.
H. A is False but R is true.
13 Assertion: A structure of a typical microsporangium in angiosperms consists of four wall layers- 1
epidermis, endothecium, middle layers and tapetum.
Reason:The function of outer three wall layers is protection and also help in dehiscence of anther
to release pollen.
14 Assertion: Down's syndrome is caused due to absence of either X or Y sex chromosome. 1
Reason: Such individuals show mental retardation and broad head with characteristic features.
15 Assertion: Orgnisations like Genetic Engineering Approval Committee (GEAC) monitor GM4 1
researches.
Reason: Some ethical standards are required to evaluate the morality of all human activities.
16 Assertion : The decomposers feed on detritus or decaying organic matter, derived from all levels. 1
Reason : At each level of energy flow in the food web, energy is lost to respiration.
SECTION - B
17 Write the function of each of the following: (a) Seminal vesicle (b) Acrosome of human sperm. 2
18 In peas, tallness is dominant over dwarfness, and red colour of flowers is dominant over the white 2
colour. When a tall plant bearing red flowers was pollinated by a dwarf plant bearing white flowers,
the different phenotypic groups were obtained in the progeny in numbers mentioned against them
-
Tall, Red = 138 Tall, White = 132
Dwarf, Red = 136 Dwarf, White= 128
Mention the genotypes of the two parents and of the types of four offsprings.
19 Your classmate complains of headache and cough. The doctor confirms that he is suffering from 2
Pneumonia and not common cold, on the basis of certain symptoms. List these symptoms.
20 With an example explain how biotechnology has been applied in each of the following: 2
 (i) In raising pest resistant plants.
(ii) In producing more nutritionally balanced milk.
21 Co-evolution is a spectacular example of mutualism between an animal and a plant. Describe co- 2
evolution with the help of an example.
OR
Construct an ideal pyramid of energy if 1,000,000 joules of sunlight is available.
SECTION - C
22 Schematically represent sequential events of oogenesis. 3
23 Draw a labelled schematic representation of a mature embryo sac of an organism. 3
24 In the following diagram the two DNA strands represented are ready for transcription. 3

(2) (4)

3’ 5’

5’ 3’
(3) (1)

(i) Label the parts marked 1 to 4 and state their functions in transcription.
(ii) Which one of the two strands of DNA has nucleotide sequence similar to mRNA that will be
transcribed and why?
25 Given here is a diagrammatic representation of the experimental set up used by S. L. Miller for his 3
experiment

(a) Write the name of different gases contained and the conditions for the reaction in flask
(b) State the type of organic molecule he collected in the water at 'B'.
(c ) Write the conclusions he arrived at.
26 (a) How is activated sludge produced during sewage treatment? 3
(b) Explain how this sludge is used in biogas production.
OR
Given below is a list of six microorganisms. State their usefulness to humans.
(a) Nucleopolyhedrovirus (b) Saccharomyces cerevisiae (c) Monascus purpureus
(d) Trichoderma polysporum (e) Penicillium notatum (f) Propionibacterium sharmanii
27 (a) Explain how recombinants and non-recombinants are differentiated on the basis of colour 3
production in the presence of a chromogenic substrate. Name that procedure.
(b) Describe the temperature treatment that enhances the bacteria to take up the rDNA.
28 Give three hypotheses for explaining why tropics show greatest levels of species richness. 3
SECTION - D
29 In the case of co-dominance, the F1 generation resembles both parents. A good example is different
types of red blood cells that determine ABO blood grouping in human being. ABO blood groups are
controlled by the gene I. The plasma membrane of the red blood cells has sugar polymers that
 protrude from its surface and the kind of sugar is controlled by the gene.The gene I has three alleles
IA, IB and i. The alleles IA and IB produce a slightly different form of the sugar while allele i does not
produce any sugar. Because humans are diploid organisms, each person possesses any two of the
three I gene alleles. IA and IB are completely dominant over i, in other words when IA and i are
present, IA expresses. (because it does not produce any sugar), and when IB and i are present IB
expresses. But when IA and IB are present together they both express their own types of sugars.
This is because of co-dominance. Hence red blood cells have both A and B types of sugars. Since
there are three different alleles, there are six different combinations of these three alleles that are
possible, and therefore, a total of six different genotypes of the human ABO blood types. 1*4
1. The ploidy level of human being is :-
a. Haploidy b. Diploidy c. Triploidy d. Not certain
2. Which of the following gene is not produce sugar :-
a. IA . b. IB c. IAIB d. i
3. How many types of sugars are found in red blood cells :-
a. A type sugar b. B type sugar
b. Both A & B type sugar d. A is rarely found and B is commonly found
Or
How many alleles are responsible to determine blood group in humans :-
a. 2 b. 3 c. 4 d. 5
4. How many types of genotypes are found to make the human blood group :-
a. 4 b. 5 c. 6 d. 7
30 This graph clearly show how vaccination has gone in India.

1. Why vaccination is important?

2. How vaccination work? 1
or 2
How large-scale production of vaccines can be achieved? 1
3. Name the vaccine that is produced from yeast.
SECTION - E
31 Give reason why: 5
(i) Most zygotes in angiosperms divide only after certain amount of endosperm is formed.
(ii) Groundnut seeds are exalbuminous and castor seeds are albuminous.
(iii) Micropyle remains as a small pore in the seed coat of a seed
(iv) Integuments of an ovule harden and the water content is highly reduced, as the seed
matures.
(v) Apple and cashew are not called true fruits.
 OR
The graph given below shows the variation in the levels of ovarian hormones phases of menstrual
cycle:

(a) Identify 'X' and 'Y'.

(b) Specify the source of the hormone marked in the diagram.
(c) Reason out why X peaks before Y.
(d) Compare the role of X and Y.
(e) Under which condition will the level of Y continue to remain high on the 28th day?
32 Observe the representation of gens involved in the lac operon given below: 5

(a) Identify the region where the repressor protein will attach in absence of inducer.
(b) Under certain conditions repressor is unable to attach at this site. Explain.
(c) If repressor fails to attach to the said site what products will be formed by z, y and a?
(d) Analyse why this kind of regulation is called negative regulation.
OR
Answer the following questions based on Hershey and Chase experiment:
(a) Name the kind of virus they worked with and why.
(b) Why did they use two types of culture media to grow viruses in? Explain.
(c) What was the need for using a blender and later a centrifuge during their experiment?
(d) State the conclusion drawn by them after the experiments.
33 (i) Many copies of a specific gene of interest are required to study the detailed sequencing 5
of bases in it. Name the process.
(ii) How can a bioreactor be made to function at optimal state in order to obtain a desired
foreign gene product? Explain.
(iii) Describe the roles of heat, primers and the bacterium Thermus aquaticus in the process
of PCR.
OR
(a) Describe the various stages involved in gene transfer for the commercial production of
human insulin by Eli Lilly.
(b) Explain how a hereditary disease can be corrected. Give an example of first successful
attempt made towards correction of such diseases.
 SAMPLE PAPER-2
MARKING SCHEME
1 (a) a, c 1
2 (b) A-(i), B-(ii), C-(iii). D-(iv) 1
3 (d) All of the above. 1
4 (c ) Convergent evolution 1
5 (d) Allergy 1
6 (a) Physiological barriers 1
7 (d) Increasing its resistance to insects. 1
8 (d) Electrophoresis. 1
9 (d) P 1
10 (d) dN/dt = rN (K-N/K) 1
11 (a) Gross primary production 1
12 (b) Cynodon 1
Question No. 13 to 16 consist of two statements – Assertion (A) and Reason (R). Answer
thesequestions selecting the appropriate option given below:
I. Both A and R are true and R is the correct explanation of A.
J. Both A and R are true and R is not the correct explanation of A.
K. A is true but R is false.
L. A is False but R is true.
13 b 1
14 d 1
15 a 1
16 b 1
17 (a) It is responsible for storage and transport of sperms. It provides secretions for 1
motility and nourishment of sperms.
(b) It helps the sperm to enter into the cytoplasm of the ovum through the zona pellucida 1
and provides enzymes for fertilisation.
18 The result shows that the four types of offspring are in a ratio of 1:1:1:1. Such a result is
observed in a test cross progeny of a dihybrid cross.The cross can be represented as: 1/2+1/
Parents: Tall and red (TtRr) x Dwarf and white (ttrr) 2
Offsprings:
TR Tr Tr tr 1
tr TtRr Ttrr ttRr Ttrr
Tall and red Tall and white Dwarf and red Dwarf and
White
19 Doctor confirms pneumonia on the basis of the following symptoms-fever/chills/grey-blue 1
lips and finger nails (any two).
It is not common cold as the following symptoms are not observed - Nasal congestion/sore 1
throat/hoarseness (any two).
20 (i) By mRNA silencing through the technique of RNA interference which produces 1
both same sense and antisense RNAs.
(ii) transgenic cow, Rosie, produced human protein-enriched milk (2.4 grams per 1
litre). The milk contained the human alpha-lactalbumin and was
nutritionally a more balanced product for human babies than natural cow-
milk.
21 Co-evolution can be observed in Fig (plant) and wasp (animal). The female wasp uses the fruit 2
for oviposition or egg laying. It also uses developing seeds within the fruit for nourishing its
larvae. The wasp in turn pollinates the fig inflorescence. The given Fig species can be
 pollinated by its 'partner' wasp species and no other species.
OR 1/2 FOR
Refer NCERT fig no.14.4 page no. 249 EACH
CORREC
T STEP
22 Refer NCERT fig no.3.8 b page no. 49 3
23 Refer NCERT fig no.2.8 b page no.26 3
24 (i) 1. Terminator - Stoppage of transcription. 2. Promoter - Binding site for 1/2*4=
RNA polymerase 3. Coding Strand - The strand which has the polarity 2
(5'→3') and the sequence same as RNA (except thymine at the place of
uracil), is displaced during transcription. This strand (which does not code
for anything) is referred to as coding strand. 4. Template strand - The 1
strand that has the polarity 3'→5' acts as a template
(ii) Coding strand is similar to mRNA in nucleotide sequence as both have nucleotides
complementary to template strand of DNA.
25 Ans. (a) Gases. CH4, NH3, H2O, H₂ Conditions. Temperature 800°C, high voltage discharges 1+1+1
(c) Amino acids, organic acids, ribose sugar, purine adenine.
(c) There was abiogenic formation of organic substances.
26 (a) Once the BOD of sewage or waste water is reduced significantly, the effluent is 1
passed into a settling tank where the bacterial flocs undergo sedimentation and the
sediment is thus called activated sludge.
(b) A small part of the activated sludge is pumped back into the aeration tank to serve 2
as the inoculum. The remaining major part of the activated sludge is pumped into
large tanks called anaerobic sludge digesters. The anaerobic bacteria digest the
bacteria and fungi in the sludge and produce mixture of gases like methane,
hydrogen sulphide and CO2, which constitute biogas.
OR
(a) Nucleopolyhedrovirus: Used as bio-control agents. 1/2
(b) Saccharomyces cerevisiae: Used in bread making and in brewing industry. FOR
(c) Monascus purpureus: Cholesterol lowering agent. EACH
(d) Trichoderma polyporum: Produces Cyclosporin-A, used as immunosuppressive agent.
(e) Penicillium notatum: Produces antibiotic penicillin.
(f) Propionibacterium sharmanii: Produces large amount of CO2, in Swiss cheese.
27 (a) The procedure is called insertional inactivation. In this method recombinants and non- 2
recombinants are differentiated on the basis of the ability to produce colour in the
presence of a chromogenic substrate. In this method, a rDNA is inserted in an enzyme -
Beta-galactosidase which leads to inactivation of the enzyme which does not produce
colour due to insertion.
(b) (i) Host cells are incubated with rDNA on ice.(ii) Followed by placing them briefly at 1
42°C.(iii) Then transfer them back on ice. This enables the host cells (bacteria) to take up the
rDNA.
28 The three hypotheses to explain species richness in tropics are
(a) Speciation is generally a function of time, unlike temperate regions subjected to 1
frequent glaciations in the past, tropical latitudes have remained relatively undisturbed
for millions of years and thus, had a long evolutionary time for species diversification,
(b) Tropical environments, unlike temperate ones, are less seasonal, relatively more 1
constant and predictable. Such constant environments promote niche specialisation and
lead to a greater species diversity and
(c) There is more solar energy available in the tropics, which contributes to higher 1
productivity; this in turn might contribute indirectly to greater diversity. .
29 1. (b). Diploidy 2. (d). i 3. (c). Both A & B type sugar or (b) 3 4. ( c) 6 1+1+1+
 1
30 1. To provide passive immunization by activating immune system of the body using heat 1
killed pathogen or antigenic proteins of pathogen.
2. In vaccination, a preparation of antigenic proteins of pathogen or inactivated/weakened 2
pathogen(vaccine) are introduced into the body. The antibodies produced in the body
against these antigens would neutralise the pathogenic agents during actual infection. The
vaccines also generate memory-B and T-cells that recognize the pathogen quickly on
subsequent exposure and overwhelm the invaders with a massive production of
antibodies.
or 1
Recombinant DNA technology has allowed the production of antigenic polypeptides of
pathogen in bacteria or yeast. Vaccines produced using this approach allow large scale
production and hence greater availability for immunization.
3. Hepatitis B vaccine produced from yeast.
31 (i) To obtain nutrition from the endosperm for the developing embryo, zygotes, divide after
its formation 1
(ii) The groundnut seeds are exalbuminous because the endosperm is completely consumed 1
during embryo development. Whereas, castor seeds are albuminous because the endosperm
persists and is used up during seed germination.
(iii) Micropyle remain as a small pore in the seed coat of a seed for the entry of water and 1
oxygen required for germination.
(iv) To protect the embryo and keep the seed viable, until favourable conditions return for 1
germination. 1
(v) In apple and cashew, apart from ovary, thalamus also contributes to fruit formation so
they are not true fruits.
OR 1
(a) X-Estrogen Y-Progesterone 1
(b) X-Maturing ovarian follicle/Graafian follicle Y-Corpus luteum(Blastocyst)
(c) Formation of Graaffian follicle (releases estrogen) is followed by the formation of corpus 1
luteum (releases progesterone) 1
Role of X (Estrogen): leads to changes in the ovary and uterus/regeneration of endometrium
through proliferation 1
Role of Y (Progesterone): Maintenance of endometrium for implantation of the fertilad
ovum/maintenance of other events of pregnancy
(e) In case of pregnancy.
32 (a) The repressor protein will attach to operator region, o. 1
(b) In presence of an inducer, lactose, repressor is unable to attach. 1
(c) z-Beta galactosidase. y-Permease a-Transacetylase 1
(d) It is called negative regulation as it involves constitutive (all the time) repressor. The 2
operon is always in off position due to presence of repressor and is switched on only in
presence of an inducer. Inducer Lactose or allolactose interacts with repressor making it
inactive.
OR
(a) They worked with bacteriophage because when it attacks a bacteria it only inserts its ½
genetic material in its body.
(b) They grew some viruses on a medium that contained radioactive phosphorus and some
others on medium that contained radioactive sulphur. Viruses grown in the presence of 2
radioactive phosphorus contained radioactive DNA but not radioactive protein because DNA
contains phosphorus but protein does not. Similarly, viruses grown on radioactive sulphur
contained radioactive protein but not radioactive DNA because DNA does not contain
 sulphur.
(c) Blender was used to agitate the bacteria to remove the viral coats from them. Centrifuge ½
was used to separate virus particle from the bacteria.
(d) Bacteria which was infected with viruses that had radioactive DNA were radioactive. tom 2
indicating that DNA was the material that passed from the virus to the bacteria. Bacteria that
were infected with viruses that had radioactive proteins were not radioactive. This indicates
that proteins did not enter the bacteria from the viruses. DNA is therefore the genetic
material that is passed from virus to bacteria.
33 (i) Polymerase chain reaction (PCR). ½
(ii) A stirred-tank bioreactor is the most commonly used bioreactor. It comes with a curved 2
base to facilitate the mixing of the reactor contents. The stirrer facilitates even mixing and
oxygen availability throughout the bioreactor. The bioreactor has an agitator system, an
oxygen delivery system and a foam control system, a temperature control system, pH control
system and sampling port so that volumes of the cultures can be withdrawn periodically.
(iii) Heat denatures or helps in separation of DNA into two strands.
Primer-Enzyme DNA Polymerase extend the primers using the nucleotides provided in the ½
reaction and the genomic DNA as template. 1
Thermus aquaticus: It is the source of thermostable DNA polymerase or Taq polymerase.
OR 1
(a) (i) In 1983, Eli Lilly an American company prepared two DNA sequences corresponding
to A and B chains of human insulin and 3
(iii) Introduced them in plasmids of E. coli to produce insulin chains.
(iv) Chains A and B were produced separately, extracted and combined by creating disulfide
bonds to form human insulin.
(b) A hereditary disease can be corrected by gene therapy. In this method, normal genes are
inserted into a person's cells and tissues to treat a disease. The first successful attempt for 2
gene therapy was done for adenosine deaminase (ADA) deficiency.
 SAMPLE PAPER-3
BLUE PRINT

SUBJECT : BIOLOGY (THEORY) CLASS : XII

Time : 3 Hours Max. Marks: 70

Types of

(NO OF Q)
MCQ/A&R

Questions
questions

questions
Questions)

BASED Q
Questions

STUDY
SAQ II
(No of

SAQ I

CASE

LAQ
(No. of

(No. of

(No. of
→ Weightage

))

)
Units↓

I
Reproduct 16 2Q 1Q 1Q 5(1)
ion
1Q

II
Genetics
20 6Q 1Q 1Q 1Q 5(1)
and
evolution
III
Biology
and 12 2Q 1Q 1Q 5(1)
human
-
Welfare
IV
Biotechnol
ogy and
12 4Q 1Q 2Q -
its -
applicatio
n
V
Ecology
and 10 2Q 1Q 2Q -
environme
-
nt

1(16)=
Total 70(33) 2(5)=10 3(7)=27 5(3)=15
16 4 (2)=8
 SAMPLE QUESTION PAPER-3
CLASS XII SUBJECT-BIOLOGY (044)
Maximum Marks: 70 Time: 3 hours
General Instructions:
(i) All questions are compulsory.
(ii) The question paper has five sections and 33 questions. All questions are compulsory.
(iii) Section–A has 16 questions of 1 mark each; Section–B has 5 questions of 2 marks each;
Section– C has 7 questions of 3 marks each; Section– D has 2 case-based questions of 4
marks each; and Section–E has 3 questions of 5 marks each.
(iv) There is no overall choice. However, internal choices have been provided in some
questions. A student has to attempt only one of the alternatives in such questions.
(v) Wherever necessary, neat and properly labeled diagrams should be drawn.
SECTION: A
1. Lactational amenorrhea ,as a means of contraception, best refers to:
(a) Reduced deficiency of pregnancy hormone
(b) Absence of menstruation since ovulation does not occur during breastfeeding
(c) Unsuitable uterus
(d) Suppressed sperm motility
2. Given below are some chromosomal abnormalities and the chromosomal complement. Select
the correct match:
Chromosomal abnormality Chromosome complement

1 Down’s Syndrome A 44+XXY

2 Klinefelter’s Syndrome B TRISOMY OF 21

3 Colour Blindness C 44+ OX

4 Turner’s Syndrome D sex-linked recessive disorder

A B C D
(a) 1 2 3 4
(b) 3 4 1 2
(c) 2 1 4 3
(d) 4 3 2 1
3. Mendel Crossed tall and dwarf plants. In F2 generation the observed the ratio was 3:1 for tall
and short plants. From this result, he deduced
(a) law of dominance
(b) law of independent assortment
(c) law of segregation
(d) law of incomplete dominance

4. The presence of both a leading and lagging strand is observed during DNA replication. This is
because:
(a) RNA primers are not sufficient to facilitate replication of both strands
(b) Only one DNA template is available for reading at a time
 (c) DNA polymerase can catalyse synthesis of one strand at a time
(d) DNA polymerase read only in 5 '-->3' direction

5. Which one of the following pair of microbes and their function is correctly matched?
Microbes Functions
(a) Rhizobium Symbiotic organisms in roots of leguminous plants
(b) Mycorrhiza Sulphurdioxide fixation in plant
(c) Azospirillum Symbiotic nitrogen fixing bacteria
(d) Azotobacter Biocontrol for several species of insects

6. Given below are some statements derived from Darwin's theory of evolution. Select the one
which is incorrect:
(a) Darwin's Variation were small and directional
(b) Fitness is the end result of the capability of an individual to get selected by nature
(c) New species evolve from ancestral form by the struggle for limited resources
(d) Abrupt and drastic changes cause speciation

7. The figure below shows the structure of a plasmid.

A foreign DNA was ligated at BamH1. The transformants were then grown in a medium containing
antibiotics tetracycline and ampicillin. Choose the correct observation for the growth of bacterial
colonies from the given table

Medium with Tetracycline Medium with Ampicillin

(a) Growth No growth

(b) No growth Growth

(c) No growth No Growth

(d) Growth Growth

8. A fragment of DNA molecule on cutting with restriction enzyme yielded 4 fragments of sizes 3 kb ,2.5
kb, 8 kb and 6.7 kb. Identify the correct match of DNA fragment with its location on the gel plate.
DNA Fragments Location
(a) 3 kb Near the positive electrode farthest from Wells
(b) 6.7 kb. Near the negative electrode close to the well
(c) 8 kb Near the positive electrode farthest from Wells
(d) 2.5 kb In middle Slows down after few minutes
9. Transgenic animals are genetically created for a variety of medical reasons, except:
(a) for testing vaccine safety
(b) For manufacturing of physiologically important proteins
(c) stimulations of pathogenicity
(d) for toxicity tests

10. A Bacterium that is genetically engineered to express a gene from a plant, will:
(a) Synthesize two protein with same structure in functions
(b) synthesize a protein with almost same sequence of amino acids where difference due to verbal
pairing may arise
(c) not be able to synthesize a functional protein going to differences in cellular organisation
(d) synthesize a non functional protein due to presence of eggs on splicing sequences in plant
genome

11. Exotic species sometimes become invasive and starts spreading fast because of
(a) Natural predators
(b) Abundant Natural competitor
(c) Invaded land not having its natural predators
(d) mutation in their genome

12. Which of the following is an example of ex- situ conservation strategy?

(a) Biosphere Reserves
(b) sacred groves
(c) Hotspots
(d) zoological parks

Question No. 13 to 16 consist of two statements – Assertion (A) and Reason (R). Answer these questions
selecting the appropriate option given below:
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.
(c) A is true but R is false.
(d) A is False but R is true.

13. Assertion (A) : Our Immune system always recognise the ‘self’ cells and destroys the ‘foreign’
proteins
Reason (R) : When it fails to recognise the ‘self’ from ‘non self’ it starts destroying the body's own
proteins. This is known as autoimmunity.
14. Assertion (A) : The distance between two polynucleotide chains in DNA remain almost constant.
Reason (R) : A purine is paired with pyrimidine with hydrogen bonds.

15. Assertion (A) : Constant gene frequencies over several generations indicate an absence of
evolutionary progress.
Reason (R) : Evolution occurs when genetic equilibrium is absent.
 16. Assertion (A) : Apomictic embryos are genetically identical to the parent plant.
Reason (R) : Apomixis is the production of seeds without fertilization.

SECTION: B
17. FSH is the Follicle Stimulating Hormone. Write its site of secretion and target tissues.

18. A cross is made between a tall plant with yellow seeds (genotype TtYy) and a tall plant with green
seeds (genotype Ttyy). What will be the proportions of phenotypes of their offspring in F1
generation?

19. In the figure given below the process of Recombinant DNA technology is depicted:

(a) What is the role of enzyme Z in the above experiment?

(b) Will the outcome of this experiment be successful? Give your opinion along with your answer.

20. Study the diagram given below and answer questions:

(i) With reference to the above flowchart identify the microbes P and Q and write their generic names.
(ii) All of the above products derived from microorganisms have one common procedure, identify the
procedure and name it.

21. The density of a population in any given Habitat during the specific period fluctuates these changes
 are associated with phenomenon A and B shown below:

(i) What are A and B?

(ii) How do A and B affect the population density?
OR
What will happen if the predator is too efficient and over exploits its prey?
SECTION -C
22. Draw a diagram of human female reproductive system. Label ovaries and fallopian tubes and write
the functions of these two parts.

23. (i) In prokaryotic cells the length of their DNA is longer than body size then how does their DNA fit in
such a small space?
(ii) In a nucleosome how do histone acquire positive charge?

24. (i) Identify the disease in the diagram given below and mention its causative organism:

(ii) Can this disease be transmitted directly by coming in contact with infected person?
(iii) Suggest any two preventive measures in order to reduce the incidence of this infection.

25. Give reason for the following:

(i) Plasmid is an important tool in biotechnology experiments.
(ii) Biotechnologist refer Agrobacterium tumefaciens as a natural genetic engineer of plants.
(iii) It is essential to have a selectable marker in a cloning vector.

26. cry I Ac and cry II Ab are introduced in a plant to prevent infestation by cotton bollworms.
(i) What would be the result of this process?
(ii) Summarise the action of this gene in the host it is introduced into.
OR
(i) Restriction endonucleases cut the DNA at specific sites containing palindromic nucleotide sequences.
What are palindromes? Relate with the help of an example.
(ii) Expand ELISA.

27. Observe the given below diagram of an ecological pyramid and answer the questions that follows:
(i) Energy is lost as heat at each step of the trophic level. What does it depict?
(ii) Can a given species occupy more than one trophic level in the same ecosystem at the same time?
(iii) Enlist any two limitations of ecological pyramids.

28. (i) The overall portrait describes the rate of species extinction caused by various anthropogenic
activities. Discuss how the loss of habitat has affected the animal population?
(ii) List other three major causes of loss of biodiversity?

SECTION -D
29. The Miller-Urey experiment was a simulation of conditions on the early Earth testing the idea that
life, or more specifically organic molecules, could have formed by nothing more than simple chemical
reactions. Miller’s success validated the theoretical ideas of A.I. Oparin and is considered to be the classic
experiment investigating the concept of abiogenesis.

(a) State the hypothesis which S.L. Miller tried to prove in the laboratory with the help of the set up
given above. (2)
(b) Name the organic compound observed by him in the liquid water after running the above
experiment.(1)
(c) A scientist simulated a similar setup and added CH4, NH3 and water vapour at 800°C. Which important
component is missing in his experiment? (1)
OR
(c )What was the purpose to put electrodes in this experimental setup? (1)
30. In angiosperms, the pollen grains are being transferred from the anther to the stigma and is termed
pollination. This phenomenon was first discovered by Camerarius (1694) in the end of the seventeenth
century. Pollen grains are immobile. They cannot reach the stigma by themselves. An external agent is
required for this. The pollination is mainly of two types-self pollination and cross pollination.
The diagram given below shows two plants of the same species showing different types of pollination.

(i) What is transferred between the plants in the process indicated by arrow P, Q and R? (1)
(ii) Which of the given processes (P/Q/R/ALL) represents a type of pollination that would result in greater
adaptability of the particular species to potential environmental changes? (1)
(iii) Identify the processes P,Q and R. (2)
OR
Geitonogamous flowering plants are genetically autogamous but functionally cross-pollinated. Justify. (2)

SECTION: E
31. The following figure shows transport of ovum, fertilisation and passage of growing embryo through
fallopian tube. On the basis of the given figure, answer the questions that follow: -

i) In the given figure, identify the structure labelled as ‘a’ and mention its role.
ii) Identify the stage represented by ‘b’ and explain the process.
iii) Name the two different types of cells found in ‘g’ and write their functions.
iv) Explain the fate of ‘a’ if the process in the stage ‘b’ does not occur?
 v) How are cells in ‘g’ arranged and mention their role.
OR
Observe and study the figure given below and answer the question that follow-

i) Name the part that labelled as ‘A’ and ‘B’.

ii) Identify the part labelled as ‘C’ and mention its ploidy and role.
iii) Name the part ‘D’ and mention its role and ploidy.
iv) Explain 7-celled, 8-nucleate nature of the female gametophyte in angiosperm.

32. (i) Give reason for:

a. Both strands of DNA are not copied during transcription.
b. Transcription and translation in bacteria can be coupled.
(ii) Differentiate between the process of transcription in prokaryotes and eukaryotes.
OR
(i) How did Griffith explain the transformation of R strain non-virulent bacteria into S strain virulent
bacteria?
(ii) Explain how Oswald Avery, Colin MacLeod and Maclyn McCarty determined the biochemical
nature of the molecule responsible for the above transformation?

33. (i) How is a cancerous cell different from a normal cell?

(ii) Explain what is meant by metastasis.
(iii) Name the primary and secondary lymphoid organs.

OR
(i) What is sewage? In which way can sewage be harmful to us?
(ii) What is the key difference between primary and secondary sewage treatment?
(iii) Do you think microbes can also be used as source of energy? If yes, how?
 KENDRIYA VIDYALAYA SANGATHAN , BHOPAL REGION
PREBOARD EXAMINATION 2022-23
CLASS XII SET-3 BIOLOGY (044)
MARKING SCHEME
Q.
Value Points/ Hints Marks
No.
SECTION-A
1 a 1
2 c 1
3 b 1
4 d 1
5 a 1
6 d 1
7 b 1
8 a 1
9 c 1
10 a 1
11 c 1
12 d 1
13 b 1
14 a 1
15 a 1
16 a 1
SECTION-B
17 Anterior Pituitary, Ovarian Follicle 1+1
18 Correct Gametes: TY, Ty,tY,ty X Ty,ty 1
Correct Phenotype with ratio:
Tall & Yello 3: Tall & Green 3: Dwarf & yellow 1: Dwarf & green 1 1
19 Z: Ligase join Plasmid with gene of interest 1
No successful result as both DNA are cut with different restriction enzyme which will form
non complementary fragments 1
P: Lactobacillus, Q: Saccharomyces cerevisiae 1
20 Fermentation 1
21 A: Natality/ Immigration, B: Mortality/Emigration 1
Natality (B) and immigration (I) contribute to an increase in the population density,
whereas mortality (D) and emigration (E) contribute to a decrease in the population 1
density.
OR 2
If a predator is too efficient and over-exploits its prey, then the prey might become extinct
and following it, the predator will also become extinct due to lack of food.
SECTION-E
SECT Correct diagram & label
ION- 1) Ovaries - i) The ovaries produce and release eggs (oocytes). ii) They also produce the 1+1
C female hormones estrogen and progesterone. 1
22 2)fallopian tube - i) it is the site of fertilization. ii) It carries ova to ovaries. (Any one function
of each organ)
(i)Prokaryotic genome is composed of a single, double-stranded DNA molecule in the form 1
23 of a loop or circle. The region in the cell containing this genetic material is called a nucleoid.
 (ii) presence of basic amino acids which include arginine and lysine which give it the positive
charge. 1+1
24 (i)Elephantiasis /lymphatic Filariasis 1
(ii) Caused by Wuchereria bancrofti/W.malayi. Vector-borne illness/ Anopheles mosquito 1.5
/ not spread by direct contact
(iii) Prevent growth & breeding of Mosquitos/ General hygiene .5
25 (i) Plasmids are commonly used to multiply or express particular genes and act as vectors 1
to transfer piece of foreign DNA attached to them.
(ii) Agrobacterium tumefaciens is known as a natural genetic engineer of a plant because 1
it has the natural ability to integrates its plasmid genes into the plant genomes. It can
deliver a piece of T-DNA in the plant genome. 1
(iii) A selectable marker is essetial in a cloning vector because it helps in indentifing and
eliminating non transformant and selectively permiting the growth of the transformant .
26 (i) Cry II Ab and cry I Ab produce toxins that are formed by the introduction of Bt genes in 1
plants that helps to prevent them from small pests like cotton bollworms.
(ii)Correct events in Mechanism of RNAi 2
OR
(i) Definition & Any one suitable example of palindromic site 2
(ii) Enzyme Linked Immunosorbent Assay 1
27 (i) As little as 10 percent of the energy at any trophic level is transferred to the next level; 1
the rest is lost largely through metabolic processes as heat.
(ii) Yes, it is possible for one species to occupy more than one trophic level, the best
examples are omnivore animals. 1
(iii) Applicable only to simple food chains/Do not deliver any concept in relation to
variations in season and climate/ Do not consider the possibility of the existence of the 1
same species at different levels/Saprotophs or Decomposers do not have anty place in
ecological pyramids (Any 2)
28 (i) Habitat loss and fragmentation: This is the most common cause of the extinction of 1.5
animals and plants. The most dramatic example of habitat loss is the tropical rainforests.
Once covering more than 14% of earth's land surface, these rainforests now don't cover 1.5
even 6% of the land surface.
(ii) Alien species invasion, Co–extinction, Over – exploitation.
SECTION-D
29 (a) S.L. Miller tried to prove the hypothesis of Oparin and Haldane; it is as follows: 2
(i) The first from of life could have come from the pre-existing non-living organic molecules
like RNA, proteins, etc.
(ii) Formation of life was preceded by chemical evolution that resulted in the formation of
diverse organic molecules from inorganic constituents.
(b) Amino acids. 1
(c) Hydrogen is missing. 1
OR
The electrodes were used to spark the fire to imitate lightning and storm through water 1
vapour.
30 (i)Pollen grains 1
(ii)Q 1
(iii) In the given figure, processes P, Q and R represent geitonogamy (self pollination), 2
xenogamy (cross pollination) and autogamy (self pollination), respectively.
OR
Geitonogamous flowers are those where the pollen grain comes from the same plant. The
pollen is transferred to the stigma of another flower of the same plant. So it is functionally 2
 cross-pollination by involving pollinating agent but genetically it is autogamy (as the plant
is same).
SECTION-E
31 (i)Ovum, Female gamete 1+
(ii)Fertilisation 1+
(iii)Inner cell mass & tophoblast. The inner cell mass (ICM) gives rise to the tissues of the 2+
embryo proper, while the trophoblast later contributes to the placenta. 1/21/2
(iv) Menstruation
(v) Blastocyct, Implantation 1
OR 1
(i)Micropyle & Integument 1
(ii)Nucellus, 2N/Diploid 2
(iii) Egg Cell , Haploid/n
(iv) - The megaspore undergoes many mitotic divisions to form 7 celled 8 nucleate
structures. The central cell of the female gametophyte has two nuclei . Due to which female
gametophytes become 8 nucleated. /Name & no of nucleus/nuclei in each cell
32 (i) a. First, if both strands act a template, one segment of the DNA would be coding for two 1
different proteins, and this would complicate the genetic information transfer machinery.
Second, the two RNA molecules if produced simultaneously would be complementary to
1
each other, hence would form a double stranded RNA. This would prevent RNA from being
translated into protein
b. In bacteria, since the mRNA does not require any processing to become active, and also
since transcription and translation take place in the same place so the transcription and 1
translation can be coupled.
(ii) In eukaryotes, there are two additional complexities in the process of transcription:
a. 3 types of RNA polymerase; RNA polymerase I for rRNA, RNA polymerase II for hnRNA
(precursor of mRNA) and RNA polymerase III for tRNA
1
b. Processing of hnRNA in mRNA by splicing, capping and tailing processes.
OR
(a) Frederick Griffith’s Experiment: 1

1+1+1

He concluded that the R strain bacteria had somehow been transformed by the heat-killed
S strain bacteria (Trasforming principle)
(ii) Biochemical Characterisation of Transforming Principle
They purified biochemicals (proteins, DNA, RNA, etc.) from the heat-killed S cells to see
which ones could transform live R cells into S cells. They discovered that DNA alone from S
bacteria caused R bacteria to become transformed. 1
They also discovered that protein-digesting enzymes (proteases) and RNA-digesting
enzymes (RNases) did not affect transformation, so the transforming substance was not a
 protein or RNA. Digestion with DNase did inhibit transformation, suggesting that the DNA 1
caused the transformation.
33 (a) Normal cells show a property called contact inhibition by virtue of which contact with 1+ 1/2
other cells inhibits their uncontrolled growth. Cancer cells appears to have lost this
property 1+ 1/2
(b) Cells sloughed Cancerous tumors reach distant sites through blood, and wherever they
get lodged in the body, they start a new tumor there. This property called metastasis is the 1 +1
most feared property of malignant tumors.
(c) The primary lymphoid organs are bone marrow and thymus where immature
lymphocytes differentiate into antigen-sensitive lymphocytes.
After maturation the lymphocytes migrate to secondary lymphoid organs like spleen, 1+1
lymph nodes, tonsils, Peyer’s patches of small intestine and appendix.
OR
(a )The municipal waste-water which have human excreta as major component is also 1+1
called sewage. It contains large
amounts of organic matter and microbes. Many of which are pathogenic.
(b) Primary treatment : These treatment steps basically involve physical removal of 1
particles – large and small – from the sewage through filtration and sedimentation.
Secondary treatment is the Biological treatment with aerobic and anaerobic bacteria.
(c) Yes. Biogas is a mixture of gases (containing predominantly methane) produced by the
microbial activity in the Biogas plant and which may be used as fuel.

Previous Years
CBSE
Sample Papers
Follow Link

https://drive.google.com/drive/folders/14evbIz7mI_BrN7rfZQ-
NMrAuS1bEvV9p?usp=sharing