Ecotoxicology and Environmental Safety 236 (2022) 113494

Contents lists available at ScienceDirect

Ecotoxicology and Environmental Safety

journal homepage: www.elsevier.com/locate/ecoenv

Cadmium chloride-induced apoptosis of HK-2 cells via interfering with

mitochondrial respiratory chain
Yan Wang a, 1, Huiqin Chi b, 1, Feifei Xu b, 1, Zhini He b, Ziyin Li b, Fan Wu a, Yueqi Li a,
Gaoqiang Zhang a, Xinyue Peng a, Susu Yu a, Jiani Yang a, Wenjuan Zhang a, *, Xingfen Yang b, **
a
Department of public health and preventive medicine, School of Medicine, Jinan University, Guangzhou, Guangdong 510632, PR China
b
Food Safety and Health Research Center, Guangdong Provincial Key Laboratory of Tropical Disease Research, Guangdong, School of Public Health, Southern Medical
University, Guangzhou, Guangdong 510515, PR China

A R T I C L E I N F O A B S T R A C T

Edited by Dr Fernando Barbosa Cadmium could induce cell apoptosis, probably related to the dysfunction of the mitochondrial respiratory chain.
The human renal proximal tubule (HK-2) was used to explore the mechanism of mitochondrial respiratory chain
Keywords: dysfunction during apoptosis induced by cadmium chloride (CdCl2). Cell viability was evaluated by cell prolif­
HK-2 eration assay and different concentrations of 60, 80 and 100 μM were selected to evaluate the mitochondrial
Cadmium chloride
toxicity of CdCl2 respectively. Under the CdCl2 treatment for 24 h, the mitochondrial reactive oxygen species
Respiratory chain complex
(ROS) of HK-2 cells increased and the superoxide dismutase (SOD) activity was inhibited at the above three
CoQ10B
Oxidative stress concentrations separately. Both ATP content and mitochondrial membrane potential decreased significantly at
Apoptosis 100 μM concentration. The levels of procaspase-3 and Bcl-2 had fallen in a concentration-dependent manner and
Bax was significantly increased at 60, 80 and 100 μM concentration compared with no CdCl2 treatment
respectively, which activated the mitochondrial apoptosis pathway. N-acetyl-cysteine (NAC) could partially
resist CdCl2-induced cell apoptosis, while myxothiazol (Myx) promoted the process. Mitochondria relative al­
terations manifested as inhibition of complex III and V. In addition, both the quantity of mitochondrial coenzyme
Q-binding protein CoQ10 homolog B (CoQ10B) and cytochrome c (Cyt c) had decreased significantly. Taken
together, CdCl2 induced HK-2 apoptosis due to the mitochondrial respiratory chain dysfunction by reducing the
CoQ10B level, offering a novel evaluating indicator for the environmental toxicity of CdCl2.

1. Introduction environmental pollutants, the toxicity mechanism of cadmium (Cd) had

As the important excretory organ, kidney played a critical role in
maintaining the filtration of blood, regulation of water, electrolyte and
acid-base balance for body health (Dipiro et al., 2014). However, it was
often confronted with many risks from biotic and abiotic stresses (Yan
and Allen, 2021), such as ischemia (Scholz et al., 2021), drug toxicity
(Cohen et al., 2021), environmental heavy metal exposure (Lash, 2021),
hypertension (Kyle et al., 2021), immune impairment (Pu and Lianos,
2011) and so on. The kidney diseases from environmental pollutants and
occupational toxicants brought about very important public health is­
sues (Orr and Bridges, 2017). As one of the most dangerous
always been a focal point for human health.
Cd was absorbed into the blood circulation via the gastrointestinal
tract, respiratory tract or skin from Cd-contaminated water, food or
cigarettes (Kim et al., 2003). After entering the body, Cd was selectively
enriched in the kidney, liver, placenta and mainly excreted by feces
(Newton et al., 1984), with a half-life of 10 ~ 30 years (Liu et al., 2020).
As the main target organ to the occupational and general population, the
kidney accounted for 50% of Cd load, while the liver composed around
15% (Christoffersen et al., 1988). Cd exposure was closely associated
with renal insufficiency and kidney injury, inducing polyuria and pro­
teinuria (Vervaet et al., 2017). Chronic Cd exposure mainly damaged the

Abbreviations: HK-2, human renal proximal tubule; CdCl2, cadmium chloride; ATP, adenosine triphosphate; CoQ10B, coenzyme Q-binding protein homolog B; Cyt
c, cytochrome c; Caspase, cysteinyl aspartate specific protein; SOD, superoxide dismutase; ROS, reactive oxygen species; NAC, N-acetyl-cysteine; Myx, myxothiazol.
* Corresponding author.
** Correspondence to: Food Safety and Health Research Center, School of Public Health, Southern Medical University, Guangzhou 510515, China.
E-mail addresses: zwj2080@126.com (W. Zhang), xfyang@vip.163.com (X. Yang).
1
These authors contributed equally to this work.

https://doi.org/10.1016/j.ecoenv.2022.113494
Received 9 December 2021; Received in revised form 2 April 2022; Accepted 4 April 2022
Available online 9 April 2022
0147-6513/© 2022 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-
nc-nd/4.0/).
Y. Wang et al.
proximal tubules S1 and S2 and caused renal dysfunction (Sabath and
Robles-Osorio, 2012). Therefore, it’s very important to explore the
toxicity mechanism of exogenous Cd exposure to renal injury.
After entering human body, Cd was mostly combined with metal­
lothionein (MT) to form a Cd-MT complex and then transported to the
kidney by the bloodstream. Because of the small molecular weight, Cd-
MT could pass directly through the glomerular filtration membrane and
enter the tubular cells in the form of endocytosis. In renal tubule cells,
the lysosomes could separate Cd-MT, which made free Cd release and
deposit in kidney (Yang et al., 2013). Cd accumulation could cause renal
tubular cell apoptosis or necrosis by affecting mitochondrial function.
Therefore, Cd-induced apoptosis of renal proximal tubule epithelial cells
was the key clue in its nephrotoxicity.
Cd could induce cell apoptosis through oxidative stress and mito­
chondrial damage. The first theory was to replace the metal element of
enzymes. Cd reduced the activity of antioxidant enzymes including SOD,
GSH-Px and CAT, accounted for the accumulation of free radicals and
then caused oxidative damage (Dykens et al., 2007; Wang et al., 2018).
Reactive oxygen scavengers, N-acetyl-L-cysteine (NAC) could effectively
inhibit Cd-induced apoptosis (Friedmann et al., 2000). The second was
due to the similar physical properties of Cd and calcium. Cd could enter
the mitochondrial matrix through the calcium ion channel and thus
changed the ion homeostasis and membrane permeability, releasing the
apoptotic signals (Mario and Ildikò, 1995). The third was that Cd
interfered with the electron transport process (Wang et al., 2004) and
inhibited the activity of the respiratory chain complex (Heyno et al.,
2010), increasing ROS production and mitochondrial function damages.
The mitochondrial respiratory chain was closely related to cell en­
ergy metabolism and endogenous ROS production. The decrease of
respiration function from Cd exposure was connected with the Cd ions
effect on the electron transport chain and the inhibition of the enzymes’
activities involved in electron transport (Korotkov et al., 1999; Miccadei
and Floridi, 1993 ). In exploring the determinants of Cd-induced
apoptosis, the role of the mitochondrial respiratory chain should be
clarified firstly. The mechanisms between Cd-exposed apoptosis with
mitochondrial respiratory chain inhibition need to be fully elaborated.
In this study, we constructed the cell apoptosis model of HK-2
induced by cadmium chloride (CdCl2) to explore its inhibition effect
on the respiratory chain complex, trying to explain the key connection
between respiratory chain dysfunction and apoptosis after Cd exposure.
2. Materials and methods
2.1. Cell culture and exposure treatment
HK-2 cell line was purchased from Guangzhou PythonBio Co., Ltd.,
and propagated in F-12 Dulbecco’s Modified Eagle Medium (DMEM/
F12, Gibco, USA) supplied with 10% fetal bovine serum (Biological In­
dustries, Israel) and 1% penicillin and streptomycin (Gibco, USA).
Conditions of constant temperature incubator (Thermo Fisher, USA)
were strictly controlled at 37 ℃, 95% relative humidity and 5% CO2.
HK-2 cells were seeded into plates and then treated with different con­
centrations of CdCl2 for 24 h for subsequent experiments. The 5 μM
myxothiazol (Myx) and 5 mM NAC were used to combine with CdCl2 to
observe the intervention effects.
2.2. Cell viability detection
Cell viability was performed using the Cell Counting Kit-8 (CCK-8)
according to the manufacturer’s protocol (Dojindo, Japan). The 5 × 104
cells/well were inoculated in 96-well plates and incubated with F-12
medium for 24 h and treated with CdCl2 in different concentrations (0,
20, 40, 60, 80, 100, 120, 140 μM) for another 24 h. Then 10 μl of CCK-8
reagent was added to 100 μl fresh cultured medium per well and incu­
bated for 45 min. The OD values were measured using a microplate
reader (BioTek, USA) at 450 nm.
2
Ecotoxicology and Environmental Safety 236 (2022) 113494
2.3. Cell apoptosis assay
Apoptosis degree was measured by Annexin-V-FITC Apoptosis
Detection Kit (Keygen Biotech, China) accordingly using the flow cy­
tometer (BD LSRFortessa X-20, USA). Briefly, cells were collected and
washed twice using PBS, and then resuspended with binding buffer.
Meanwhile, the 5 μl Annexin V-FITC dye solution and 5 μl PI dye solu­
tion were added into the cells and incubated for 15 min at room tem­
perature, avoiding light. The ratios of apoptotic cells were assessed by
flow cytometry. The results were analyzed by software Flow Jo V10
(NovoExpress 1.2.5).
2.4. The ATP content assay by chemiluminescence
The ATP content was detected by the Enhanced ATP Assay Kit
(Beyotime, China). Briefly, HK-2 cells were seeded into 6-well plates at a
density of 1 × 105 cells/well for 24 h and then subjected to different
dosages of CdCl2 for 24 h. The cells were lysed and centrifuged at
12,000 g for 5 min. The 20 μl of supernatant was collected and mixed
with 100 μl working solution. The relative optical unit (RLU) value was
then measured by a chemiluminescence detector (Promega, USA) to
calculate the ATP concentration.
2.5. Mitochondrial membrane potential
The mitochondrial membrane potential was measured by JC-1 dye
using JC-1 Apoptosis Detection Kit (Keygen Biotech, China). JC-1
aggregated within the mitochondria and generated red fluorescence in
healthy cells (Ex 535 nm, Em 590 nm). During mitochondrial depolar­
ization, JC-1 monomers diffused throughout the cells, producing green
fluorescence (Ex 485 nm, Em 530 nm). Flow cytometry was used to
measure the percentage of cells with red or green fluorescence. Each
group of cells were incubated with JC-1 dye for 20 min at 37 ◦ C followed
by Incubation Buffer. Then, samples were examined by flow cytometry
(BD LSRFortessa X-20, USA).
2.6. Mitochondrial ROS
Mitochondrial ROS level was measured with Mito SOX Red (Invi­
trogen, USA) assay. The redox-sensitive fluorescent probe was selec­
tively targeted to the mitochondria superoxide. Briefly, cells were
incubated with the 5 μmol/L Mito SOX Red probe for 10 min at 37 ℃
and then washed twice with HBSS. The red fluorescence was determined
at 510/580 nm using the flow cytometer (BD LSRFortessa X-20, USA). A
total of 10,000 events were acquired for each analysis. The mean cellular
fluorescence intensity was performed by the software Flow Jo V10
(Novo Express 1.2.5).
2.7. Detection of superoxide dismutase (SOD) activity
The SOD activity was performed according to the instructions of the
commercial kit (Elabsecience, E-BC-K022-M, China) as described (Li
et al., 2019). When SOD was added into the reaction system, the su­
peroxide anion radical had experienced a disproportionation reaction,
reducing the formation of nitrite, and then the purplish-red color
became lighter. Meanwhile, the mixture of chloroform and ethanol
treated samples only resulted in MnSOD inactivation. The activity of
total SOD and CuZnSOD were calculated according to the absorbance
difference between the sample tube and the control separately. MnSOD
activity was taken as the difference between total SOD activity and
CuZnSOD activity. Briefly, total protein samples were collected and the
SOD mixture was incubated at 37˚C for 50 min. Then the absorbance was
determined at 550 nm by spectrophotometry with a microplate reader
(BioTek Synergy H1, USA). One unit of SOD activity was defined as the
amount of enzyme necessary to produce a 50% inhibition of the nitro­
blue tetrazolium reduction rate measured at 550 nm. SOD activity was
Y. Wang et al.
expressed as SOD units/mg protein.
2.8. Determination of respiratory chain complex activity
The mitochondria respiratory chain complex I-V activity was deter­
mined with the commercial activity detection kit (Solarbio, China) ac­
cording to the manufacturer’s instructions as described (Shih et al.,
2021), including mitochondrial respiratory chain complex I (Solarbio,
BC0515), II (Solarbio, BC3235), III (Solarbio, BC3245), IV (Solarbio,
BC0945) and V (Solarbio, BC1445) respectively.
Briefly, no less than 2 × 107 cells were harvested from each group
and lysed to extract mitochondria with a Cell mitochondria isolation kit
(Beyotime, China). Taking the Complex III activity determination as an
example, mitochondrial protein samples were added to a mixture of Cyt
c, sodium azide and CoQ. Reduced Cyt c has characteristic light ab­
sorption at 550 nm, so the increased rate of light absorption at 550 nm
could reflect the activity of Complex III. As for Complex V, the enzyme
catalyzed ATP synthesis using a proton electrochemical gradient
generated by the respiratory chain and also reversibly hydrolyzed ATP
to produce ADP and Pi. Therefore, the activity was determined by
measuring the rate of Pi increase. Firstly, ATP and mitochondrial protein
samples were mixed in buffer solution and incubated at 37 ℃ water bath
for 30 min. After that, samples were centrifuged at 8000 rpm, 4 ℃ for 10
min. The supernatant was collected and mixed with Vitamin c and
ammonium molybdate, and then experienced a 40 ◦ C water bath for 10
min. Absorbance at 660 nm was determined then using a microplate
reader (BioTek Synergy H1, USA).
2.9. Real-time RT-PCR for mRNA level
Total RNA was isolated using Trizol reagent (Invitrogen, USA). Its
purity and concentration were assessed with a NanoDrop 2000 (Thermo
Fisher, USA). The cDNA was synthesized from total RNA using Pri­
meScipt Master Mix with gDNA Eraser (TaKaRa, Japan). The expression
levels of indicated genes were quantified using the SYBR Premix Ex
Tap™ II kit (TaKaRa, Japan) on the Lightcycler 96 instrument (Roche,
Germany). The primers sequences were shown in Table 1. GAPDH was
used as an internal control. The relative expression level of mRNA was
calculated using the 2-ΔΔt method. Δt = Ct (target gene) – Ct (internal
reference), ΔΔt = Δt (treatment group) − Δt (control group). For gene
relative expression, the mean value of the control group was defined as 1
or 100%. The relative level of the target gene was expressed as fold
change between the control and experimental group.
2.10. Western blotting for protein level
Total protein, mitochondrial protein and cytoplasmic protein sam­
ples were used for western blots. In brief, cells were lysed by RIPA Lysis
Table 1
The primer sequences used in this study.
Gene Forward primer（
（5’¡ 3’）
） Reverse primer（
ND1 ACTACAACCCTTCGCTGACG
ND2 TAGCCTCATCATCCCCACCA
ND3 GCGGCTTCGACCCTATATCC
ND4 CCCCATCGCTGGGTCAATAG
ND4L AACACCCACTCCCTCTTAGC
ND5 TCTCTACATCAAGCCAACT
ND6 CGCACCAATAGGATCCTCCC
Cyt b GCTATGTCCTCCCATGAGGC
COX I TGACTGGCATTGTATTAGCAAACTC
COX II CGACCTGCGACTCCTTGAC
COX III CTAAACACATCCGTATTACTCGCAT
ATPase6 CAAAACAAATGATAGCCATACACAA
ATPase8 CCCCATACTCCTTACACTATTCCTC
GAPDH CGGATTTGGTCGTATTGGG
D-loop GATTTGGGTACCACCCAAGTATTG
3
Ecotoxicology and Environmental Safety 236 (2022) 113494
Buffer (Beyotime, China) with a protease inhibitor cocktail (Beyotime,
China) and then centrifuged at 12,000 rpm for 15 min. The supernatant
was moved to a new EP tube as the total protein. Mitochondrial and
cytoplasmic protein were extracted as follows. The harvested cells were
treated by 1 ml mitochondrial isolating reagents (Beyotime, China),
supplemented with 1 mM of PMSF and incubated on ice for 10 min. The
cell suspension was gently homogenized with a glass Dounce homoge­
nizer and cell lysates were checked by trypan blue staining to ensure
lysis. The mixture was centrifuged at 600 g for 10 min at 4 ℃ and the
supernatant was transferred into a new EP tube and centrifuged at
12,000 g for 15 min at 4 ℃ to separate the mitochondrion and cyto­
plasmic fractions. The supernatants were collected as cytoplasmic pro­
teins. Mitochondrial suspensions were further lysed by probe sonication
to prepare mitochondrial proteins.
All proteins were separated on 10% SDS-polyacrylamide gels elec­
trophoresis (Beyotime, China) and transferred to polyvinylidene
difluoride membrane (Millipore, USA). The bolts were incubated with
the primary antibody of caspase-3 (Cell Signaling, USA, No. 14220), Bcl-
2 (Cell Signaling, USA, No. 3498), Bax (Cell Signaling, USA, No. 5023),
GAPDH (Ray, China, RM2002), COX Ⅳ (Cell Signaling, USA, No. 4850),
Cyt c (Cell Signaling, USA, No. 11940), UQCRFS1 (Abcam, UK,
ab191079), CoQ10B (Abcam, UK, ab41997) and CYC1 (Abcam, UK,
ab137757) antibody respectively overnight at 4 ℃. The membrane was
treated with goat anti-rabbit antibody (Cell Signaling, USA, No. 5174) or
goat anti-mouse antibody (Ray, China, RM2002) for 1 h. Proteins were
detected by an automatic chemiluminescence imaging analysis system
(Tanon-5200, Tanon, China) with Chemiluminescent HRP Substrate
(Millipore, USA). Western blots were expressed as the relative ratio to
GAPDH (total protein) or COX Ⅳ (mitochondrial protein) using Image J
software (Fiji, V1.8.0).
2.11. Statistical analysis
All experiments were performed at least in triplicate and the data
were expressed as mean ± SD. Multiple group comparisons were per­
formed with one-way ANOVA followed by Dunnett’s post hoc test or
Tukey’s test. Difference with a P value less than 0.05 was considered to
be statistically significant and marked as *P < 0.05, **P < 0.01 and ***P
< 0.001 respectively.
3. Results
3.1. CdCl2 induced HK-2 apoptosis through oxidative stress and
mitochondrial damage
The CdCl2-treated HK-2 cells were subjected to a cell viability test in
different concentrations of 0, 20, 40, 60, 80, 100, 120, 140 μM for 24 h
separately. As shown in Fig. 1A, the viability of HK-2 cells increased
（5’¡ 3’）
）
AGGAGGCCTAGGTTGAGGTT
GGAGGAATGGGGTGGGTTTT
GGCCAGACTTAGGGCTAGGA
CTACGAGGGCTATGTGGCTG
AGCATTGGAGTAGGCTTAGGT
GATTGAGCCAGAGCATAT
GTCAGGGGTTGAGGTCTTGG
CACTGAACCAGGTCTGTCCC
GGATTTTGGCGTAAGTTTGGTC
GGACGATGGGCATGAAACTG
TCGGAAATGGTGAAGGGAGAT
GTGTAAATGAGTGAGGCAGGAGTC
ATTTTCGTTCATTTTGGTTCTCAG
CGCTCCTGGAAGATGGTGAT
AATATTCATGGTGGCTGGCATGTA
Y. Wang et al.
Fig. 1. Apoptosis effects of CdCl2 on HK-2 cells. (A) Cell vitality was measured by CCK8 assay. (B) The apoptosis status of HK-2 cells was detected by flow cytometry
with Annexin V-FITC. (C) Apoptosis-related proteins were detected by western blotting. (D) Quantitative results of western blots for Fig. 1C. Statistical significance
with respect to control was marked with *P < 0.05, **P < 0.01 or ***P < 0.001 respectively.
slightly without significance under 40 μM and then it was decreased
gradually with the increase of CdCl2 concentration from 60 μM ~ 140
μM. As for the survival rate of HK-2 cells, the OD value was 1.06 ± 0.07,
0.93 ± 0.05 and 0.77 ± 0.05 at 60, 80 and 100 μM respectively. Cells
had the hormesis effects when CdCl2 concentration was less than 60 μM,
promoting cells proliferation. Cells showed significant inhibitory effects
at CdCl2 concentration greater than 100 μM. Based on the survival rate
of HK-2, the 60, 80 and 100 μM concentration of CdCl2 was selected as
low, medium and high concentration group respectively in the subse­
quent experiments.
Next, we observed the apoptosis effects from CdCl2 as shown in
Fig. 1B by flow cytometry. The apoptotic cells increased significantly,
especially for the late apoptotic cells in a concentration-dependent
manner in HK-2 cells. The apoptosis rate at 100 μM was (6.10 ± 1.68)
%, significantly increased compared with the control group of no CdCl2
treatment (P < 0.001). Meanwhile, as shown from Fig. 1C and D, the
apoptosis-related key proteins decreased significantly (P < 0.001)
including procaspase-3 and Bcl-2 in the high concentration group during
the process of apoptosis. The pro-apoptotic protein Bax level was
significantly increased in all groups compared with the control.
Then the results of ATP content and mitochondrial membrane po­
tential were evaluated in Fig. 2A and B to reflect the changes of mito­
chondrial function. With the increase of the CdCl2 concentration, both
ATP content and mitochondrial membrane potential were gradually
decreased in significance, while the mitochondrial ROS level increased
from Fig. 2C. As shown in Fig. 2D, the total SOD enzyme activity was
significantly inhibited. Moreover, both CuZnSOD and MnSOD activities
were decreased as shown in Fig. S1A, Fig. S1B. These results indicated
that CdCl2 induced mitochondrial damage and oxidative stress.
Therefore, a certain concentration of CdCl2 could induce HK-2
apoptosis, bringing about mitochondrial damage and disturbing the
oxidative stress pathways.
4
Ecotoxicology and Environmental Safety 236 (2022) 113494
3.2. Toxic effects of CdCl2 on mitochondrial respiratory chain complex
As the mitochondrial DNA encoded 13 peptides, including ND1–4,
ND4L, ND5–6, Cyt b, COX I, COX II, COX III, ATPase6 and ATPase8,
which were the component units of the respiratory chain complex, we
subsequently detected the mRNA expression levels of these subunits and
the results were shown in Table 2. The mRNA levels of most mito­
chondrial DNA subunits including ND3, COX III and ATPase 6 increased
after 24 h CdCl2 treatment compared with the control group. The
mtDNA-encoded complex subunits were promoted obviously after CdCl2
exposure. However, as shown in Fig. S1C, the mtDNA copy number
showed no statistical change in each group compared with the control.
Then the activities of the five respiratory chain complexes were
measured as shown from Fig. 3A to E. There was no significant change in
the activity of Complex I, Complex II and Complex Ⅳ compared with the
control group separately. But, the Complex III activity was inhibited at
100 μM (P < 0.05) and in the CdCl2 60, 80 and 100 μM concentration
group, the activity of Complex V was significantly lower than that of
control respectively, which suggested that the activity was inhibited to a
certain extent for Complex III and Complex V in HK-2 with 24 h CdCl2
treatment.
Due to the Complex III was at the center of the respiratory chain to
catalyze the electron transfer from CoQ to Cyt c. Thus, we focused on the
changes of some catalytic proteins with key roles in the process of
electron transport to reveal the inhibition reasons of Complex III activ­
ity, including CoQ10B, Cyt c, Cyt c1 and UQCRFS1 in mitochondria.
In Fig. 4, the COX IV protein was served as an internal control for
mitochondrial protein (Fig. 4A). Both contents of CoQ10B and Cyt c in
mitochondria were decreased significantly in the 80 μM and 100 μM
group (P < 0.001) compared with that of the control as shown in Fig. 4A
and B. No significant difference was found in the expression of Cyt c1 in
each group. The level of UQCRFS1 had a little increase at 100 μM than
that of control (P < 0.05).
These results indicated that CdCl2 could reduce the contents of
CoQ10B and Cyt C in mitochondrial proteins, inhibiting the activity of
Y. Wang et al. Ecotoxicology and Environmental Safety 236 (2022) 113494

Fig. 2. Mitochondrial damages and oxidative stress effects of CdCl2 on HK-2 cells. (A) ATP contents were measured using the chemiluminescence detector. (B) Flow
cytometry results of mitochondrial membrane potential with the JC-1 detection. (C) Analysis of mitochondrial ROS with Mito SOX Red assay. (D) SOD activity.
Statistical significance with respect to control was marked with *P < 0.05, **P < 0.01 or ***P < 0.001 respectively.

Complex III and Complex V and then affecting the function of the res­
piratory chain.
3.3. Effects of intervention of Myx or NAC on CdCl2-treated HK-2 cells
In order to explore the intervention mechanism to the damage of
CdCl2-treated HK-2 cells, Myx or NAC were used to treat the cells jointly.
About the ATP content in each group as shown in Fig. 5A, it had no
significant change compared with that of the control after exposed to
5 μM Myx alone for 24 h, but decreased significantly in both 5 μM Myx
and 100 μM CdCl2 co-processing group, similar to that of 100 μM CdCl2
treatment alone. The ATP content was increased after treated with 5 mM
NAC alone (P < 0.05) and there was no significant difference between
NAC alone and NAC combined with 100 μM CdCl2 group (P > 0.05).
Meanwhile, the mitochondrial ROS results were showed in Fig. 5B.
The ROS content was increased after treated with Myx alone or com­
bined with 100 μM CdCl2 compared with that of the high concentration
group (P < 0.001). However, the ROS content of both Myx and CdCl2 co-
treatment was less than that of 5 μM Myx alone (P < 0.01). To NAC
treated alone or in combination with CdCl2, the ROS content of was
similar to that of the control group without statistical significance
(P > 0.05).
Finally, we tested the total protein levels of procaspase-3, Bcl-2, Bax,
cytoplasmic CoQ10B and Cyt c with results in Fig. 6A and B. In Myx
combined with the 100 μM CdCl2 group, the level of procaspase-3 was
further decreased than that in the high concentration group (P < 0.001).
The expression of Bax remained relatively high. Bcl-2 in both Myx and
CdCl2 group was significantly higher than that in 80 and 100 μM con­
centration groups (P < 0.001), but still lower than that of the control
(P < 0.001). Under the intervention of Myx and CdCl2, the content of
CoQ10B in the cytoplasm remained low, but Cyt C was significantly
higher than that in any other group.
In the NAC and CdCl2 co-treatment group, the expression was
increased for procaspase-3 and Bcl-2 compared with that in the high
concentration CdCl2 group (P < 0.001), while the expression of pro-
apoptotic protein Bax was significantly decreased (P < 0.001). The
cytoplasmic CoQ10B was not improved after NAC treatment and Cyt c
was consistent with that of control.
Taken together, Myx and CdCl2 co-treatment could promote the
occurrence of apoptosis, related to the high level of Bax and the
increased release of Cyt c from mitochondria into cytoplasm. NAC would
induce the expression of Bcl2, downregulate the level of Bax and activate
caspase-3 to alleviate the apoptosis process.
4. Discussion
CdCl2 induced HK-2 cells apoptosis and resulted in reduced mito­
chondrial membrane potential and Cyt c level in our research. Cyt c

5
Y. Wang et al. Ecotoxicology and Environmental Safety 236 (2022) 113494

Table 2
Mitochondrial DNA coding complex subunit mRNA expression results.
Gene Subordinate Complex 0 μM 60 μM 80 μM 100 μM

ND1 Complex I 1 0.87 ± 0.02 * * 1.2 ± 0.04 * ** 1.1 ± 0.03 *

ND2 Complex I 1 1.02 ± 0.01 1.13 ± 0.02 * ** 1.24 ± 0.02 * **
ND3 Complex I 1 1.11 ± 0.01 * ** 1.18 ± 0.02 * ** 1.48 ± 0.01 * **
ND4 Complex I 1 0.98 ± 0.02 1 ± 0.01 1.1 ± 0.01 * **
ND4L Complex I 1 1 ± 0.03 1.05 ± 0.01 1.14 ± 0.03 * **
ND5 Complex I 1 1.26 ± 0.04 * 0.79 ± 0.12 1.27 ± 0.06 *
ND6 Complex I 1 0.98 ± 0.01 1.06 ± 0.02 * * 1.05 ± 0.01 * *
Cyt b Complex III 1 1.08 ± 0.04 1.15 ± 0.05 * 1.21 ± 0.08 * *
COX I Complex Ⅳ 1 0.93 ± 0.01 1.01 ± 0.09 1.03 ± 0.06
COX II Complex Ⅳ 1 1.33 ± 0.09 * * 0.94 ± 0.01 1.34 ± 0.11 * *
COX III Complex Ⅳ 1 1.32 ± 0.04 * ** 1.35 ± 0.03 * ** 1.68 ± 0.04 * **
ATPase6 Complex V 1 1.38 ± 0.08 * * 1.39 ± 0.03 * * 1.47 ± 0.1 * **
ATPase8 Complex V 1 1.17 ± 0.01 1.44 ± 0.14 * * 1.35 ± 0.06 * *

The results are expressed as the means±S.D. All groups were compared with controls, n = 3, *P < 0.05, **P < 0.01, ***P < 0.001.

release was common from mitochondria to cytoplasm for multiple
apoptotic cells (Becila et al., 2010; Zhang et al., 2017) and it could move
on the mitochondrial surface of the membrane as an electron transporter
between Complex III and Ⅳ (Yang et al., 2007). However, Cyt c couldn’t
cross the mitochondrial membrane in general and only when cells suf­
fered apoptotic signals, the mitochondrial permeability transition pore
(MPTP) would transform into an irreversible opening state with lost H+
concentration gradient of mitochondrial inner and outer membrane,
followed by the gradual decline or disappearance for transmembrane
potential. Thus, Cyt c and AIF were released from mitochondrial inner
membrane into the cytoplasm. Bax could open MPTP via binding with
the adenine nucleotide translocator (ANT) and VDAC in outer mem­
brane and Bcl-2 inhibited apoptosis mainly by competitively binding to
ANT against Bax. Cd exposure affected the balance of Bcl-2 and Bax,
increasing Bcl-2 and procaspase-3 and cutting Bax. MPTP opening led to
membrane potential dissipation and Cyt c release, then activating the
mitochondria-mediated apoptosis pathway.
ROS activated various oxidative stress signal pathways, related with
electron transport leakage of mitochondrial respiratory chain, which
was a key link in the pathogenesis of Cd-induced nephrotoxicity (Hynes
et al., 2013). Our results showed that Cd could interfere with the elec­
tron transport process and inhibit SOD activity, affecting cellular redox
state. Meanwhile, ROS accumulation caused changes of cell membrane
fluidity and permeability, with mitochondrial membrane damage and
dissipation of membrane potential and then disorders of the respiratory
chain also produced more ROS. As mitochondria were also the key
targets of Cd, ROS and mitochondrial dysfunction were closely related to
its renal toxicity. Oxidative stress -induced homeostasis and mitochon­
drial dysfunction were triggers for Cd-induced apoptosis in rat proximal
renal tubule cells (Wang et al., 2009). Our study showed that besides
oxidative stress, CdCl2 also reduced mitochondrial membrane potential
and ATP level, leading to mitochondrial damage and apoptosis of HK-2,

Fig. 3. Alternations of mitochondrial respiratory chain complex activities related with CdCl2 on HK-2 cells. (A) Complex I activity. (B) Complex II activity. (C)
Complex III activity. (D) Complex IV activity. (E) Complex V activity. Statistical significance with respect to control was marked with *P < 0.05, **P < 0.01 or
***P < 0.001 respectively.

6
Y. Wang et al. Ecotoxicology and Environmental Safety 236 (2022) 113494

Fig. 4. Changes of key proteins of respiratory chain Complex III. (A) Levels of proteins from western blotting. (B) Quantitative results of western blots for Fig. 4A.
Statistical significance with respect to control was marked with *P < 0.05, **P < 0.01 or ***P < 0.001 respectively.

Fig. 5. Effects on ATP content and mitochondrial ROS after Myx or NAC treatment together with CdCl2 to HK-2 cells respectively. (A) Alteration of ATP content. (B)
Alteration of mitochondrial ROS. Statistical significance was marked with *P < 0.05, **P < 0.01 or ***P < 0.001.

Fig. 6. Changes of relevant proteins after Myx or NAC treatment together with CdCl2 respectively to HK-2 cells. (A) Western blots analysis of related proteins. (B)
Quantitative results of blots from Fig. 6A. Statistical significance was marked with * P < 0.05, **P < 0.01 or ***P < 0.001 respectively.

7
Y. Wang et al.
which revealed that oxidative stress and mitochondrial damage were the
key effects of Cd cytotoxicity.
About the cytoplasm Cyt c, there was no significant difference among
the groups except those treated with Myx alone with CdCl2. Given
apoptosis results, the high proportion of late apoptotic cells might be
due to the high-level Cd exposure, resulting in the combination with
APAF-1 of Cyt c in the cytoplasm and procaspase-9 into apoptotic
bodies. Additionally, in NAC and CdCl2 co-treated group, ROS and ATP
were restored to the control level. NAC did not completely prevent the
occurrence of apoptosis, but only alleviated it to some extent, indicating
that NAC could antagonize the CdCl2-induced apoptosis partially.
Mitochondrial DNA (mtDNA) encoded 13 kinds of respiratory chain
complex subunits and the assembly needed close coordination between
mitochondrial and nuclear gene expression. The nucleus and mito­
chondria controlled the processes strictly and coordinately, including
the stability of mtDNA, the expression of nuclear-coded subunits and its
import, structure protein insertion into the intima, auxiliary base added
process and final assembly into the respiratory chain complexes (Fon­
tanesi et al., 2006; Maria et al., 2006), which could be changed by
mtDNA transcription imbalance and the respiratory chain dysfunction.
In our study, the increased levels of most mitochondrial genes were due
to that CdCl2 disturbed the coordinated coding program of the respira­
tory chain complex by nuclear and mitochondrial DNA. Therefore, the
mitochondrial genome increased the levels of most genes as the
compensatory effects to deal with the decline of mitochondrial function.
Complex III contained three common catalytic subunits including
Cyt b, Cyt c1 and iron-sulfur proteins in different species, as a multi-
subunit membrane protein, responsible for catalyzing electron transfer
from CoQ to Cyt c and proton transfer from mitochondrial matrix to the
inner membrane space (Berry et al., 1999; Stroebel et al., 2003). Among
them, only Cyt b was encoded by mitochondria in Complex III. CoQ was
responsible for transferring electrons from Complex I or II to III. It was in
the equilibrium state among the reduced state of ubiquinol (CoQH2)
after obtaining two electrons, the semi-reduced state of semiquinone
(CoQH⋅) and the oxidation state of ubiquinone (CoQ) (Alcázar-Fabra
et al., 2016). The catalytic electron transfer of Complex III was mainly
based on the CoQ cycle (Mitchell, 1976) and Cyt b had two different
quinone binding sites on both sides of the membrane (Xia et al., 1997).
The Qo site on the positive side was used for CoQH2 oxidation, while the
Qi site was for CoQ reduction. CoQH2 was the electron donor for the CoQ
cycle of Complex III and Cyt c was the electron acceptor. The Cd
inhibitory site was located between CoQH⋅ and Cyt b (Wang et al.,
2004). Cd treatment in vitro showed the most obvious inhibitory effect
on mitochondrial Complex III. The accumulation of CoQH⋅might be due
to the competition of Cd binding to CoQH⋅ and Cyt bL combination site
in the Qo site (Wang et al., 2004). The CoQH⋅ was unstable and easy to
transfer an electron to molecular oxygen to form superoxide, which was
consistent with our results.
In this study, we found the sensitively inhibited electron transport
chain was Complex III in CdCl2-exposed HK-2 cells, consistent with the
results in the Cd treatment on mitochondria in vitro (Wang et al., 2004).
Considering the changes of Cyt c, Cyt c1, ISP and CoQ10B in mito­
chondria, the main effect of Cd on the respiratory chain was that it
interfered with the electron transport process of Complex III and ATP
generation process of Complex V, containing the inhibition of Complex
III activity and the decrease of CoQ10B and Cyt c. The downregulation of
Cyt c was due to the dissipation of membrane potential and MPTP
opening. The decrease of CoQ10B was in a Cd-concentration-dependent
manner in mitochondrial and cytoplasmic protein.
NAC treatment relieved oxidative stress and mitochondrial damage,
but the cytoplasmic CoQ10B did not return to the normal level. In
Saccharomyces cerevisiae, CoQ10 chaperoned CoQ to the functional site
as a putative START domain protein. Humans had two orthologs
including CoQ10A and CoQ10B (Tsui et al., 2019) and CoQ10B was
necessary for the correct localization of CoQ within the mitochondrial
membrane (Desbats et al., 2014). The inhibition of Complex III was
8
Ecotoxicology and Environmental Safety 236 (2022) 113494
probably due to the decrease of CoQ10B. The dysfunction of CoQ had a
strong correlation with CdCl2 toxicity, downregulating mitochondrial
respiratory complex activity and membrane potential and upregulating
ROS production.
The key targets of Cd were the sulfhydryl groups of proteins (Sabolic
et al., 2002). Metallothionein was rich in cysteines for sulfhydryl group
donor and had a strong combination with heavy metal ions (Schmitt
et al., 2007), as a free radical scavenger to reduce oxidative damage or
heavy metal toxicity (Liu, 1998). The heme of class c cytochrome was
covalently bounded by the thioether bond formed by the addition of the
vinyl group and the cysteine sulfhydryl group in the protein molecule,
including Cyt c and Cyt c1. Furthermore, the iron-sulfur cluster was also
linked to the sulfhydryl group of cysteine by iron atom (Zhang et al.,
1989). Therefore, the changes of Complex III, CoQ10B and Cyt c were
the key events in oxidative stress-mitochondrial damage-apoptosis
pathway. The more detailed mechanisms of Cd toxicity affecting Cyt b,
CoQ10B and Cyt c needed to be elaborated further.
In all, after HK-2 cells encountered acute CdCl2 exposure, the mito­
chondrial CoQ10B and Cyt c were downregulated and the activities of
Complex III and V were inhibited, inducing oxidative stress and mito­
chondrial damage and then affecting the respiratory chain function to
activate the mitochondria-mediated apoptosis pathway, which could be
partially alleviated by NAC. Our research offered novel perspectives for
toxic targets of exogenous CdCl2 exposure. CoQ and its cycle related
with Complex III under Cd exposure need to be explored in depth to seek
appropriate prevention and intervention measures.
Funding
This work was funded by Guangdong Key Research and Development
Program (2019B020210002), National Natural Science Foundation of
China (81872642), Natural Science Foundation of Guangdong Province
of China (2021A1515011220), Top Young Talents of Guangdong Hun­
dreds of Millions of Projects (87316004), Outstanding Young Talent of
Double Hundred Talents Plan in Jinan University and National Natural
Science Foundation of China (81473014).
CRediT authorship contribution statement
Yan Wang: Writing − original draft, Writing − review & editing.
Huiqin Chi: Methodology, Validation. Feifei Xu: Methodology, Re­
sources. Zhini He: Investigation, Validation. Ziyin Li: Formal analysis.
Fan Wu: Data curation. Yueqi Li: Software. Gaoqiang Zhang: Valida­
tion. Xinyue Peng: Resources. Susu Yu: Resources. Jiani Yang: Re­
sources. Wenjuan Zhang: Project administration, Writing − review &
editing, Visualization. Xingfen Yang: Funding acquisition, Conceptu­
alization, Supervision.
Declaration of Competing Interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
Appendix A. Supporting information
Supplementary data associated with this article can be found in the
online version at doi:10.1016/j.ecoenv.2022.113494.
References
Alcázar-Fabra, M., Navas, P., Brea-Calvo, G., 2016. Coenzyme Q biosynthesis and its role
in the respiratory chain structure. Biochim. Biophys. Acta. 1857 (8), 1073–1078.
https://doi.org/10.1016/j.bbabio.2016.03.010.
Becila, S., Herrera-Mendez, C.H., Coulis, G., Labas, R., Astruc, T., Picard, B.,
Boudjellal, A., Pelissier, P., Bremaud, L., Ouali, A., 2010. Postmortem muscle cells
Y. Wang et al.
die through apoptosis. Eur. Food Res. Technol. 231 (3), 485–493. https://doi.org/
10.1007/s00217-010-1296-5.
Berry, E.A., Zhang, Z., Huang, L.S., Kim, S.H., 1999. Structures of quinone-binding sites
in bc complexes: functional implications. Biochem. Soc. Trans. 27, 565. https://doi.
org/10.1042/bst0270565.
Christoffersen, J., Christoffersen, M.R., Larsen, R., Rostrup, E., Tingsgaard, P.,
Andersen, O., Grandjean PJ, CT I., 1988. Interaction of cadmium ions with calcium
hydroxyapatite crystals: a possible mechanism contributing to the pathogenesis of
cadmium-induced bone diseases. Calcif. Tissue Int. 42 (5), 331–339. https://doi.org/
10.1007/BF02556369.
Cohen, A., Ioannidis, K., Ehrlich, A., Regenbaum, S., Nahmias, Y., 2021. Mechanism and
reversal of drug-induced nephrotoxicity on a chip. Sci. Transl. Med. 13 (582),
eabd6299. https://doi.org/10.1126/scitranslmed.abd6299.
Desbats, M.A., Lunardi, G., Doimo, M., Trevisson, E., Salviati, L., 2014. Genetic bases and
clinical manifestations of coenzyme Q (CoQ) deficiency. J. Inherit. Metab. Dis. 38
(1), 145. https://doi.org/10.1007/s10545-014-9749-9.
Dipiro J.T., Talbet R.L., Yee G.C., Matzke G.R., Wells B.G., 2014, PHARMACOTHERAPY -
A PATHOPHYSIOLOC APPROACH.
Dykens, J.A., Marroquin, L.D., Will, Y., 2007. Strategies to reduce late-stage drug
attrition due to mitochondrial toxicity. Expert Rev. Mol. Diagn. 7 (2), 161–175.
https://doi.org/10.1586/14737159.7.2.161.
Fontanesi, F., Soto, I.C., Horn, D., Barrientos, A., 2006. Assembly of mitochondrial
cytochrome c-oxidase, a complicated and highly regulated cellular process. Am. J.
Physiol. Cell Physiol. 291 (6), 1129–1147. https://doi.org/10.1152/
ajpcell.00233.2006.
Friedmann, J.M., Katsen, A.D., Hauser, I.A., 2000. Up-regulation of multidrug resistance
P-glycoprotein via nuclear factor-kappaB activation protects kidney proximal tubule
cells from cadmium- and reactive oxygen species-induced apoptosis. J. Biol. Chem.
275 (3), 1887–1896. https://doi.org/10.1074/jbc.275.3.1887.
Heyno, E., Klose, C., Krieger-Liszkay, A., 2010. Origin of cadmium-induced reactive
oxygen species production: mitochondrial electron transfer versus plasma membrane
NADPH oxidase. New Phytol. 179 (3), 687–699. https://doi.org/10.1111/j.1469-
8137.2008.02512.x.
Hynes, J., Nadanaciva, S., Swiss, R., Carey, C., Kirwan, S., Will, Y., 2013. A high-
throughput dual parameter assay for assessing drug-induced mitochondrial
dysfunction provides additional predictivity over two established mitochondrial
toxicity assays. Toxicol. Vitr. Int. J. Publ. Assoc. Bibra 27 (2), 560–569. https://doi.
org/10.1016/j.tiv.2012.11.002.
Kim, S.C., Cho, M.K., Kim, S.G., 2003. Cadmium-induced non-apoptotic cell death
mediated by oxidative stress under the condition of sulfhydryl deficiency. Toxicol.
Lett. 144 (3), 325–336. https://doi.org/10.1016/s0378-4274(03)00233-9.
Korotkov, S.M., Glazunov, V.V., Rozengart, E.V., Suvorov, A.A., Nikitina, E.R., 1999.
Effects of Cd2 and two cadmium organic complexes on isolated rat liver
mitochondria. J. Biochem. Mol. Toxicol. 13 (3–4), 149–157. https://doi.org/
10.1002/(sici)1099-0461(1999)13:3/4<149::aid-jbt5>3.0.co;2-g.
Kyle, W., Vedat, Y., Xiao, M., Ajay, M., Jessica, H., Rachel, S., Satoskar, A.A., Lee, H.,
Iouri, I., Laura, B., 2021. Hypertension and the Kidney: Reduced Kidney Mass Is Bad
for Both Normotensive and Hypertensive Rats. Am. J. Hypertens. 34 (11),
1196–1202. https://doi.org/10.1093/ajh/hpab103.
Lash, L.H., 2021. Diverse Roles of Mitochondria in Renal Injury from Environmental
Toxicants and Therapeutic Drugs. Int J. Mol. Sci. 22 (8), 4172. https://doi.org/
10.3390/ijms22084172.
Li, P., Fu, X., Chen, M., Zhang, L., Li, S., 2019. Proteomic profiling and integrated
analysis with transcriptomic data bring new insights in the stress responses of
Kluyveromyces marxianus after an arrest during high-temperature ethanol
fermentation. Biotechnol. Biofuels 12, 49. https://doi.org/10.1186/s13068-019-
1390-2.
Liu, K.J., 1998. Induction of metallothionein as an adaptive mechanism affecting the
magnitude and progression of toxicological injury. Environ. Health Perspect 106,
297–300. https://doi.org/10.1289/ehp.98106s1297.
Liu, Y., Li, Y., Xia, Y., Liu, K., Ren, L., Ji, Y., 2020. The Dysbiosis of Gut Microbiota
Caused by Low-Dose Cadmium Aggravate the Injury of Mice Liver through
Increasing Intestinal Permeability. Microorganisms 8 (2), 211. https://doi.org/
10.3390/microorganisms8020211.
Maria, C., Liegro, D., Luparello, C., Rinaldi, A.M., 2006. Mitochondrial protein
expression in rat and in human cells. Caryologia 59 (4), 371–374. https://doi.org/
10.1021/bi048389g.
Mario, Z., Ildikò, S., 1995. The mitochondrial permeability transition. Biochim. Et.
Biophys. Acta Rev. Biomembr. 1241 (2), 139–176. https://doi.org/10.1002/
biof.5520080315.
Ecotoxicology and Environmental Safety 236 (2022) 113494
Miccadei, S., Floridi, A., 1993. Sites of inhibition of mitochondrial electron transport by
cadmium. Chem. Biol. Interact 89 (2–3), 159–167. https://doi.org/10.1016/0009-
2797(93)90006-k.
Mitchell, P., 1976. Possible molecular mechanisms of the protonmotive function of
cytochrome systems. J. Theor. Biol. 62 (2), 327–367. https://doi.org/10.1016/0022-
5193(76)90124-7.
Newton, D., Johnson, P., Lally, A.E., Pentreath, R.J., Swift, D.J., 1984. The uptake by
man of cadmium ingested in crab meat. Hum. Toxicol. 3 (1), 23–28. https://doi.org/
10.1177/0960327184003001031.
Orr, S.E., Bridges, C.C., 2017. Chronic kidney disease and exposure to nephrotoxic
metals. Int J. Mol. Sci. 18 (5), 1039. https://doi.org/10.3390/ijms18051039.
Pu, D., Lianos, E.A., 2011. Mechanisms of HO-1 mediated attenuation of renal immune
injury: a gene profiling study. Transl. Res. 158 (4), 249–261. https://doi.org/
10.1016/j.trsl.2011.06.001.
Sabath, E., Robles-Osorio, M.L., 2012. Renal health and the environment: Heavy metal
nephrotoxicity. Nefrologia: publicacion oficial de la Sociedad Espanola. Nefrologia
32 (3), 279–286. https://doi.org/10.3265/Nefrologia.pre2012.Jan.10928.
Sabolic, I., Ljubojevic, M., Herak-Kramberger, C.M., Brown, D., 2002. Cd-MT causes
endocytosis of brush-border transporters in rat renal proximal tubules. Am. J.
Physiol. Ren. Physiol. 283 (6), F1389. https://doi.org/10.1152/
ajprenal.00066.2002.
Schmitt, C.J., Whyte, J.J., Roberts, A.P., Annis, M.L., May, T.W., Tillitt, D.E., 2007.
Biomarkers of metals exposure in fish from lead-zinc mining areas of Southeastern
Missouri, USA - ScienceDirect. Ecotoxicol. Environ. Saf. 67 (1), 31–47. https://doi.
org/10.1016/j.ecoenv.2006.12.011.
Scholz, H., Boivin, F.J., Kai, S.O., Bachmann, S., Persson, P.B., 2021. Kidney physiology
and susceptibility to acute kidney injury: implications for renoprotection. Nat. Rev.
Nephrol. 17 (5), 335–349. https://doi.org/10.1038/s41581-021-00394-7.
Shih, M.K., Tain, Y.L., Cheng, C.M., Hsu, C.N., Chen, Y.W., Huang, H.T., Chang, C.I.,
Hou, C.Y., 2021. Separation and Identification of Resveratrol Butyrate Ester
Complexes and Their Bioactivity in HepG2 Cell Models. Int. J. Mol. Sci. 22 (24),
13539. https://doi.org/10.3390/ijms222413539.
Stroebel, D., Choquet, Y., Popot, J.L., Picot, D., 2003. An atypical haem in the
cytochrome b6f complex. Nature 426 (6965), 413–418. https://doi.org/10.1038/
nature02155.
Tsui, H.S., Pham, N.V.B., Amer, B.R., Bradley, M.C., Clarke, C.F., Gosschalk, J.E.,
Gallagher-Jones, M., Ibarra, H., Clubb, R.T., Blaby-Haas, C.E., 2019T. Human
COQ10A and COQ10B are distinct lipid-binding START domain proteins required for
coenzyme Q function. J. Lipid Res. 60 (7), 1293–1310. https://doi.org/10.1194/jlr.
M093534.
Vervaet, B.A., D’Haese, P.C., Verhulst, A., 2017. Environmental toxin-induced acute
kidney injury. Clin. Kidney J. 10 (6), 747–758. https://doi.org/10.1093/ckj/sfx062.
Wang, H., Gao, Z., Liu, X., Agarwal, P., He, X., 2018. Targeted production of reactive
oxygen species in mitochondria to overcome cancer drug resistance. Nat. Commun. 9
(1), 562. https://doi.org/10.1038/s41467-018-02915-8.
Wang, L., Cao, J., Chen, D., Liu, X., Lu, H., Liu, Z., 2009. Role of oxidative stress,
apoptosis, and intracellular homeostasis in primary cultures of rat proximal tubular
cells exposed to cadmium. Biol. Trace Elem. Res. 127, 53–68. https://doi.org/
10.1007/s12011-008-8223-7.
Wang, Y., Fang, J., Leonard, S.S., Rao, K.M.K., 2004. Cadmium inhibits the electron
transfer chain and induces reactive oxygen species. Free Radic. Biol. Med. 36 (11),
1434–1443. https://doi.org/10.1016/j.freeradbiomed.2004.03.010.
Xia, D., Yu, C.A., Kim, H., Xia, J.Z., Kachurin, A.M., Zhang, L., Yu, L., Deisenhofer, J.,
1997. Crystal structure of the cytochrome bc1 complex from bovine heart
mitochondria. Science 277 (5322), 60–66. https://doi.org/10.1126/
science.277.5322.60.
Yan, L.J., Allen, D.C., 2021. Cadmium-induced kidney injury: oxidative damage as a
unifying mechanism. Biomolecules 11 (11), 1575. https://doi.org/10.3390/
biom11111575.
Yang, F., Zhou, B.R., Zhang, P., Zhao, Y.F., Chen, J., Liang, Y., 2007. Binding of ferulic
acid to cytochrome c enhances stability of the protein at physiological pH and
inhibits cytochrome c-induced apoptosis. Chem. Biol. Inter. 170 (3), 231–243.
https://doi.org/10.1016/j.cbi.2007.08.005.
Yang, W., Zhao, X., Zhang, D., Ji, W., Liu, Y., 2013. Research progress of cadmium
toxicity and mechanism of injury. Occup. and Health 29 (8), 1001–1003.
Zhang, C., Ren, B., Li, Y., Committee of China Medical Encyclopedia, 1989. Encyclopedia
of Chinese Medicine.17. Biochemistry. Shanghai Science and Technology Publishing
House.
Zhang, J., Yu, Q., Han, L., Chen, C., Li, H., Han, G., 2017. Study on the apoptosis
mediated by cytochrome c and factors that affect the activation of bovine
longissimus muscle during postmortem aging. Apoptosis 22 (6), 777–785. https://
doi.org/10.1007/s10495-017-1374-2.