BIOCHEMISTRY LAB FINALS - Because of the presence of double bonds,

unsaturated fatty acids are oils (liquids) at room

SOLUBILITY OF LIPIDS
temperature while saturated fatty acids are fats
Lipids – are water-insoluble substances of (solids) at room temperature.
biological origin.
Waxes - are made up of long fatty acids,
- They are either hydrophobic (nonpolar) or however, esterified with monohydric alcohol.
amphipathic (polar and nonpolar regions).
- Beeswax is a good example of this group. It is
- The fat deposits of animals contain mainly a combination of palmitic acid and myricyl
triacylglycerol (commonly known as alcohol.
triglyceride), which is an ester of glycerol with
- Waxes are used as ointments, polishes, floor
three fatty acid molecules.
waxes and creams.
- In contrast, most cells other than adipose
Complex lipids - contain other constituents
tissues contain much less fat; their lipids
aside from lipids like glycolipids, which contain
consists largely of phospholipids and
a sugar group, phospholipids have phosphate
cholesterol.
group while sphingolipids have sphingosine
- Lipids perform three biological functions: (1) rather than glycerol.
lipids in the form of a bilayer are essential
Prostaglandins - resemble hormones in
components of biological membranes;
function but not in structure.
(2)lipids with hydrocarbon side chains serve as
- They have 20-carbon fatty acids.
energy stores; and
- They are present in all cells and serve as
(3) many intra- and intercellular signaling events
message carriers.
involve lipid molecules.
Cholesterol - is a member of a large group of
Lipids can be classified into three groups:
substances called steroid.
Simple lipids - include glycerides and waxes
- It is important constituent of many membranes
Compound lipids - are of three major types: and precursor for synthesis of many substances.
phospholipids, sphingolipids and lipoproteins.
- It influences membrane fluidity by its bulky
Derived lipids - consist of steroids and fat- structure on animal membranes.
soluble vitamins.
- The lipid material occurring in nature is
ENZYMATIC BROWNING OF FRUITS
insoluble in water and soluble in certain organic
AND VEGETABLES
solvents.
Enzymatic activity – causes the rapid darkening
- The effect of oil on hard water is a
(usually browning) of fruits and vegetable after
consequence of a large reduction in the water’s
they have been peeled, cut, and sliced.
surface tension as emulsion form.
- The mechanism of brown color development
Fatty acids - simplest form of lipids, may be
involves oxygen from the air or from the
saturated or unsaturated.
intercellular spaces within the tissue in contact
- Saturated fatty acids have no double bonds with the cut surface that contains enzyme
while unsaturated fatty acids have. polyphenoloxidases (PPO) and phenolic
compounds as suitable substrates.
- Brushing or other injury to the tissue allows
the contents to make contact with oxygen and
causes browning.
Enzymatic browning produces undesirable
changes such as:
1. Darkening of the cut surfaces of fruits
and vegetables
2. Deterioration of the flavor, odor and
nutritive value
- The methods of prevention most commonly
practiced concentrates on the enzyme and
oxygen because the elimination of the substrate
(phenolic compounds) is not practical.
- The principal approaches are:
(a) inactivation of the enzyme
polyphenoloxidases (PPO) via blanching, use of
inhibitors and lowering of pH; and
(b) minimize contact with oxygen through use of
syrup solution and use of antioxidants such as
ascorbic acid and sulfur dioxide.
DNA EXTRACTION: A SIMPLIFIED
TECHNIQUE
Deoxyribonucleic acid (DNA) – is the genetic
material present in all organisms.
 Blueprint of an organism
Nucleotide – single subunit of DNA
- consists of a nitrogen-containing base, a sugar,
and a phosphate group.
- Hundreds of thousands of nucleotides are
hooked together to form a chain, and two chains
are paired together and twisted into a double
helix to form the complete DNA molecule.
- In organisms with nucleated cells such as
humans, DNA is coupled with protein in
structures called chromosomes that are
contained within a membrane-bound nucleus
inside a cell.
- DNA plays various roles in the metabolism and
growth of an organism and influences most of its
characteristics.
- DNA enables various cells to develop and
work together to form a fully functional body,
and controls characteristics such as skin color,
eye vision, even the ability to roll the tongue
into a U shape.
- The information encoded by the DNA is
passed on from one generation to the next.
- A complete copy of the DNA is found in every
cell of an organism.
- The cell in the eye has the same set of DNA as
the hair and skin cells.
DNA extraction – is the removal of DNA from
the cells or viruses in which it normally resides.
- It is used as an early step in many diagnostic
processes to detect bacteria and viruses in the
environment as well as in diagnosing disease
and genetic disorders.
- Isolating DNA from a cell is the first step for
many laboratory procedures in biotechnology.
- In order to release the DNA for analysis, the
cell wall of plants and the cell membrane of
animals should be broken and structural proteins
and enzymes should be removed so they will not
interfere with the DNA structure.
- The simplified procedure in this experiment is
expected to release a large amount of DNA;
however, it does not produce purified DNA.
THE GENETIC CODE AND PROTEIN
SYTHESIS
Genetic Code - is the set of rules which govern
the translation of the nucleotide sequence of the
gene, through the medium of mRNA (messenger
RNA), into the amino acid sequence of a
protein.
- The genetic code is used in all organisms.
- The human genome is composed of about 3
billion base pairs of DNA and contains more
than 25,000 genes.
- The DNA that makes up the human genome is
subdivided into sections which store information
bytes, such as genes.
Proteins - which are then responsible for certain
functions like immune responses and catalytic
actions.
- Genes also provide instruction for structures
and features such as hair type and color, eye
color, height, and others.
DOUBLE-STRANDED DNA –
Replication – process wherein the DNA is
duplicated before the cell divides
- This allows the two daughter cells to have the
same set of DNA.
- Cells use the two-step process of transcription
and translation to read each gene and produce
the string of amino acids that makes up a
protein.
- The basic rules in translating a gene into a
protein are laid out in the Universal Genetic
Code.
Transcription - DNA is converted into a
complementary mRNA [ribonucleic acid].
- RNA polymerase, an enzyme which unravels
DNA helix, recruits RNA nucleotides and,
through base pairing, matches them to the DNA
genes sequence. -- RNA differs from DNA in
two aspects;
1) the sugar in the nucleotide in RNA is ribose
rather than deoxyribose [hence, the name
ribonucleotide]; and
2) RNA contains the base uracil [U] instead of
thymine [T] in DNA.
- The three distinct steps of transcription are
initiation, elongation, and termination.
SINGLE-STRANDED RNA – The RNA
stranded does not remain hydrogen-bonded to
the DNA template strand.
- Thus, the RNA molecule produced by
transcription is single stranded.
- In addition, RNA is much shorter than DNA
molecules because it is copied from only a
limited region of the DNA.
- There are 3 kinds of RNAs;
1) mRNA [messenger] - which contains genetic
information and is translated into a protein;
2) Rrna [ribosomal] - which is the structural
component of a ribosomes; and;
3) tRNA [transfer] - which transports amino
acids to the ribosomes during protein synthesis.
- In eukaryotic cells, RNA transcripts are subject
to a series of processing steps in the nucleus
such as RNA splicing before they are allowed to
exit from the nucleus and be translated into a
protein.
- Furthermore, although most genes have
proteins as the final product, some genes have
RNA as the final product.
- These RNAs fold into precise structures that
have structural and catalytic role in the cell.
- To further discuss mRNA slicing, it is
important to mention that the genes are
composed of small pieces of coding sequence
called exons which are the expresses sequence,
and introns, the intervening sequence.
- RNA splicing is the removal of these intron
sequences.
Translation - is the process of expressing the
mRNA code into a polypeptide chain that makes
up the protein.
Protein - are the major structural and functional
constituents of the cells.
A protein exhibits a complex molecular structure
formed by polypeptide chains made of basic
subunits called amino acids.
Figure 12: Secondary Base Codon
- The sequence of nucleotides in the mRNA
molecule is always read consecutively in groups
of three.
Codon – each group of three nucleotides
- each codon specifies either one amino acid or a
STOP to end the translation process.
AUG - is the start codon which initiates the
translation of a protein.
Most of the effective antibiotics used in
medicine today are compound made by fungi
that act by inhibiting bacterial protein synthesis.
- These drugs make use of the structural and
functional difference between bacterial and
eukaryotic ribosomes.
- This is the reason why some of these
antibiotics can be taken in high doses without
causing toxicity to humans.
Below are the list of some antibiotics
(inhibitors) which act only on bacteria, on
bacteria and eukaryotes, an on eukaryotes but
not on bacteria, and their specific effects.
Acting only on Bacteria
Tetracycline – Blocks the binding of
aminoacyl-tRNA A-site ribosome
Streptomycin – Prevents the transition from
initiation complex to chain-elongating ribosome
and causes miscoding
Erythromycin – Blocks the translocation
reaction on ribosome
Chloramphenicol – Blocks the peptidyl
transferase on ribosome
Acting on Bacteria and Eukaryotes
Actinomycin D – Binds to DNA and blocks the
movement of RNA polymerase
Acting only Eukaryotes but not on Bacteria
α-Amanitin – Blocks mRNA synthesis by
binding preferentially to RNA polymerase II.
Mutations - are random accidents and errors
occurring both in the storage and copying of
genetic information.
- It rearranges the DNA sequence, the might,
therefore, alter the mRNA sequence.
- It may modify the product of a gene or it can
prevent the gene from carrying out its normal
functions.
- Mutagenic chemicals, radiation, viruses, and
errors in DNA replication are just a few causes
of mutations.
Example of genetic code exercise:
Given the following DNA sequence, derive the
complementary RNA and the polypeptide chain.
5’ 3’
TTTGGAGTCCGAATCCCGGAATGCCGAT
GC
1. First, to derive the complementary RNA,
consider the pairing rules (A pairs with T in
DNA but with U in RNA, and C with G).
Second, the DNA and RNA strands must be
anti-parallel (i.e., 5’ and 3’ ends are opposite
each other)
5’
TTTCTAGTCCGAATCCCGGAATTGCCGCA
TGC 3’ – DNA 3’
AAAGAUCAGGCUUAGGGCCUUAACGGG
CGUACG 5’ – mRNA
2. To get the amino acid sequence, mRNA
should start from the 5’ end. In this case, rewrite
the mRNA sequence so that it reads 5’ to 3’.
5’GCAUGCGGCAAUUCCGGGAUUCGGAC
UAGAAA 3’
3. Look for the start codon AUG which codes
for methionine (met). Start unlocking the codes
of amino acids. Translation would stoop with the
end codons UAA, UAG, UGA.
5’GCAUGCGGCAAUUCCGGGAUUCGGAC
UAGAAA 3’ Met-arg-gln-
phe-arg-asp-ser-asp – peptide sequence
GENETIC ENGINEERING
Selective Breeding – Hunters in the 1800’s
needed a hunting dog that was big, strong, fast,
and aggressive
Example:
Mastiff – Big and strong, but lacked speed and
aggression
American Bulldog – Fat and aggressive, but
lacked size
Bullmastiff – Big, strong, fast, and aggressive
- Humans use selective breeding, which takes
advantage of naturally occurring genetic
variation, to pass wanted traits on to the next
generation of organisms
- All of the different plants produced from wild
mustard by selective breeding.
Luther Burbank – developed over 800 varieties
of plants
Polyploid Plants and Fruits – Polyploid plants
with an uneven number of sets of chromosomes
are sterile.
- This allows the production of seedless fruits.
e.g. bananas
- The Great Famine killed millions of people in
Ireland that depended on Irish potatoes as a
staple to get them through the winter
Luther Burbank – developed a new Irish
potato that did not get blight. This potato was
sent to Ireland
2 Types of Selective Breeding
Hybridization
- Crossing dissimilar individuals to bring
together the best of both worlds
- American botanist Luther Burbank selectively
bred 800 plants, called Varieties
- Many varieties can be found in your
supermarket
- Bred for size, disease resistance, flowering,
taste, color, and a variety of other reasons based
on preference
- Occurs in both plants and animals
- Creating hybrid plants is different than creating
hybrid animals
- Animals can be sterile if their chromosome Increasing Variation
number is odd, or if there are too many
- If the desired characteristic is not present,
mutations that occur when they breed naturally
scientists have induced mutations in hope of it
(rarely occurs in the wild)
causing the right effect
- Plants can be bred easily by gardeners or
Success stories:
botanists
- Oil-eating bacteria – used to clean up oil spills
- Many crops today are hybrids (can sometimes
occur naturally in the wild) - Creating polyploidy plants – usually larger and
stronger
Inbreeding
4 Ways plants can be modified
- Crossing breeds of individuals with similar
characteristics Mutagenesis – use of mutagens such as
radioactivity to induce random mutations,
- Maintains traits of that breed (purebreds)
creating the desired trait
- Risky - increases chance for mutation since
Cross breeding – Crossing two sexually
individuals are very genetically similar to each
compatible species to create a strain with the
other
combined desired traits of the parents
-Inbreeding uses two genetically similar
Transgenesis – Addition of a gene or genes
organisms, each being “the best of the best”
from sexually non-compatible species from
- Dog breeds are maintained by inbreeding
Steps of DNA Fingerprinting
- Characteristics that are unique to each breed
- Fragments are separated on the basis of size
are preserved
using a process called gel electrophoresis
- Very prevalent in cattle farming – gives
- DNA fragments are injected into wells and an
farmers the best possible livestock
electric current is applied along the gel causing
- Also can be very dangerous if two individuals the negatively charged fragments to move.
if two individuals have an underlying mutation
- The gel is made of agarose, a jelly-like
Hybridized Plants substance made out of seaweed that allows the
fragments of DNA to pass through
Characteristics of Hybridized Plants
- DNA fingerprinting is used for identification
- Have high resistance
- It depends on the probability of a match
- Have high yielding capacity
- Many people have the same number of repeats
- Have high productivity
in a certain region of DNA
- Have lifelongness
- The probability that two people share identical
Genetically-Engineered Hybrid Plants numbers of repeats in several locations is very
small
Examples:
Seedless grapes, Bananas, Corn
Uses of DNA Fingerprinting
- Evidence in criminal cases
- To determine paternity
- To diagnose genetic diseases
- Help to determine kinship in animals
- Compare similarities and differences between
species
Biotechnology – when scientists purposely
change the genetic makeup of an organism
- Uses in agriculture and medicine
- Bacterial mutations
 A strain of bacteria has been developed
that can digest oil to help clean oil spills
 Scientists are trying to produce bacteria
to clean up radioactive waste
Combining DNA Fragments - Since DNA is a
universal code, it can be
combined from 2 or more sources
• Changes the genetic composition of the living
organism
• This is called recombinant DNA
• Can also be used to make proteins like human
insulin, hepatitis B vaccine, and a clotting factor
for hemophilia patients
Recombinant DNA & Human Health
- Scientists can develop recombinant DNA to
produce human antibodies to fight disease
• Can also make proteins engineered in
transgenic sheep and pigs’ milk to be used in
disease prevention
• Can treat diseases caused by protein
deficiency
Protein and Health
Kwashiorkor – a deficiency disease caused by
inadequate protein in the presence of adequate
food energy
Edema – swelling of body tissue caused by
leakage of fluid from the blood vessels, seen in
protein deficiency
Genetically Modified Animals
• 30% of milk in US comes from cows injected
with hormones to increase milk production
• Pigs – produce more lean meat or high levels
of healthy omega-3 acids
• Salmon – faster growth to produce more fish•
Scientists in Canada combined spider genes into
lactating goats – produced silk along with their
milk.
- Silk was extracted and used to make military
uniforms, medical sutures, and tennis racket
strings
Web-spinning goats
- Researchers inserted a spiders' dragline silk
gene into the goats' DNA in such a way that the
goats would make the silk protein only in their
milk.
- This "silk milk" could then be used to
manufacture a web- like material called Biosteel.
Glowing Organisms
- Genes that make jellyfish glow are inserted
into other organisms
- The organism glows under UV light
SIGNIFICANCE OF GFP (Green Fluorescent
Protein)
Practical uses in industry
- Biological marker
- Fluorescence imaging
- Therapeutic drug monitoring
Functionality
- Many derivatives
- Easily expressed
- Scientists are using glow in the dark cats to
study AIDS
Transgenic Organisms
• Scientists find specific genes and can add
them to any organism
• Organisms with genes from other species are
called transgenic organisms
• Ex: Red Fluorescent Protein (RFP) in cats
• Cat with the GFP is red under UV light, while
a normal cat glows green
Transgenic Organisms
A transgenic organism contains a gene from
another organism, typically of another species.
Transgenic organisms have been used to
produce:
 human insulin in large quantities
(Humulin - made by genetically
modified bacteria)
 human growth hormone (HGH - for
some people, without HGH, dwarfism
can result)
 the hormone erythropoietin (EPO),
which stimulates production of red
blood cells
 vaccines
Transgenic Mouse
Alzheimer's Mouse - In the brain of
Alzheimer's patients, dead nerve cells are
entangled in a protein called amyloid.
- Mouse made by introducing amyloid precursor
gene into fertilized egg of mice.
Smart Mouse - Biological model engineered to
overexpress NR2B receptor in the synaptic
pathway.
- This makes the mice learn faster like juveniles
throughout their lives.
Oncomouse – Mouse model to study cancer
- Made by inserting activated oncogenes
Genetic Modification
• If you’ve eaten corn, potatoes, or soy
products this week, chances are you’ve eaten
genetically modified (GM) food – it doesn’t
have to be recorded on food labels!
• Many plants are genetically modified
• Resistance to insects, herbicides (weed killer),
and viral infections
• Resistance to rot or spoilage
Bt Corn - The DNA of this corn was modified
by adding a gene from a bacteria, Bacillus
thuringiensis (Bt), so that the corn produces a
natural pesticide
Genetically Modified – Process - Involves the
insertion of DNA from one organism into
another OR modification of an organism's DNA
in order to achieve a desired trait.
How genes are cloned
- The procedure consists of inserting a gene
from one organism, often referred to as "foreign
DNA," into the genetic material of a carrier
called a vector.
- Examples of vectors include bacteria, yeast
cells, and viruses.
- After the gene is inserted, the vector is placed
in laboratory conditions that prompt it to
multiply, resulting in the gene being copied
many times over.
Cloning - A clone is a member of a population
of genetically identical cells produced from a
single cell
 – insert “suicide” genes into cancer cells that
activate a drug

Genetic Modification
- Gene therapy has many technical challenges.
Good or Bad?
– inserting gene into correct cells
• Ideally, GM plants and animals could lead to
– controlling gene expression
better, less expensive, and more nutritious
– determining effect on other genes
food as well as less-harmful manufacturing
Gene therapy – process of changing a gene to
processes
treat a medical disease/disorder
• Farmers and ranchers hope cloning will allow
• Bad gene is replaced with a good gene
them to duplicate prize animals, providing
• 1st – need a virus to transport the gene into the
better quality and more food to a rising organism

population • 2nd – patient’s cells are infected with the

new gene, hopefully correcting the defect
Genetics – provides a basis for new medical
treatments
- Genetic screening can detect genetic
disorders.
• Genetic screening involves the testing of DNA.
– determines risk of having or passing on a
genetic disorder
– used to detect specific genes or proteins
– can detect some genes related to an increased
risk of cancer
– can detect some genes known to cause genetic
disorders
Gene therapy - is the replacement of faulty
genes.
• Gene therapy replaces defective or missing
genes, or adds new genes, to treat a disease
- Several experimental techniques are used for
gene therapy.
– genetically engineered viruses used to “infect”
a patient’s cells
– insert gene to stimulate immune system to
attack cancer cells