2002 Null

Singh - Prelims 17/9/02 12:00 pm Page i
Taenia solium Cysticercosis
From Basic to Clinical Science
Downloaded from https://cabidigitallibrary.org by 223.255.231.132, on 03/21/24.

Subject to the CABI Digital Library Terms & Conditions, available at https://cabidigitallibrary.org/terms-and-conditions
Singh - Prelims 17/9/02 12:00 pm Page iii
Taenia solium Cysticercosis
From Basic to Clinical Science
Edited by
Gagandeep Singh
Dayanand Medical College & Hospital Ludhiana

Punjab, India
and
Sudesh Prabhakar
Department of Neurology
Postgraduate Institute of Medical Education and Research
Chandigarh, India
CABI Publishing

Singh - Prelims 17/9/02 12:00 pm Page iv
CABI Publishing is a division of CAB International
CABI Publishing CABI Publishing

CAB International 10 E 40th Street
Wallingford Suite 3203
Oxon OX10 8DE New York, NY 10016
UK USA
Tel: +44 (0)1491 832111 Tel: +1 212 481 7018

Fax: +44 (0)1491 833508 Fax: +1 212 686 7993
E-mail: cabi@cabi.org E-mail: cabi-nao@cabi.org
Web site: www.cabi-publishing.org
© CAB International 2002. All rights reserved. No part of

this publication may be reproduced in any form or by any
means, electronically, mechanically, by photocopying,
recording or otherwise, without the prior permission of
the copyright owners.
A catalogue record for this book is available from the British Library,
London, UK.
Library of Congress Cataloging-in-Publication Data

Singh, G. (Gagandeep)
Taenia solium cysticercosis : from basic to clinical science / edited
by G. Singh and S. Prabhakar.
p. cm.
Includes bibliographical references and index.
ISBN 0-85199-628-0
1. Cysticercosis. 2. Taenia. I. Prabhakar, S. (Sudesh) II. Title.
RC136.7 .S545 2002
616.9’64--dc21 2002001332
ISBN 0 85199 628 0
Typeset in Palatino by Columns Design Ltd, Reading, UK

Printed and bound in the UK by Biddles Ltd, Guildford and Kings Lynn.

Singh - Prelims 17/9/02 12:00 pm Page v
Contents
Contributors ix
Preface xiii
Abbreviations xiv
SECTION I TAENIA SOLIUM CYSTICERCOSIS: BASIC SCIENCE
1. Taenia solium: Basic Biology and Transmission 1

Zbigniew S. Pawlowski
2. Taenia solium Cysticercosis: New and Revisited Immunological Aspects 15
Ana Flisser, Dolores Correa and Carlton A.W. Evans
3. Molecular Determinants of Host–Parasite Interactions: Focus on Parasite 25
José L. Molinari and Patricia Tato
4. Animal Models of Taenia solium Cysticercosis: Role in Understanding
Host–Parasite Interactions 35
Astrid E. Cardona and Judy M. Teale
5. Mitochondrial DNA of Taenia solium: From Basic to Applied Science 47
Akira Ito, Minoru Nakao, Munehiro Okamoto, Yasuhito Sako and Hiroshi Yamasaki
6. Hereditary Factors in Neurocysticercosis with Emphasis on Single, Small,
Enhancing CT Lesions 57
Vasantha Padma, Satish Jain, Achal Srivastava, Manjari Tripathi and
Mahesh C. Maheshwari
SECTION II EPIDEMIOLOGY
7. Taenia solium Cysticercosis: an Overview of Global Distribution and

Transmission 63
Peter M. Schantz
8. What Have We Learnt From Epidemiological Studies of Taenia solium
Cysticercosis in Peru? 75
Hector H. García, Robert H. Gilman, Armando E. Gonzalez, Manuela Verastegui,
Victor C.W. Tsang and The Cysticercosis Working Group in Peru
v
Singh - Prelims 17/9/02 12:00 pm Page vi
vi Contents
9. Epidemiology of Taenia solium Taeniasis and Cysticercosis in Mexico 83

Elsa Sarti
10. Taenia solium Taeniasis and Cysticercosis in Central America 91
José Garcia-Noval, Ana L. Sanchez and James C. Allan
11. Neurocysticercosis in Brazil: Epidemiological Aspects 101
Svetlana Agapejev
12. Taenia solium Taeniasis and Cysticercosis in Asia 111
Gagandeep Singh, Sudesh Prabhakar, Akira Ito, Seung Yull Cho and Dong-Chuan Qiu
13. Taenia solium Cysticercosis in Africa 129
Michel Druet-Cabanac, Bienvenue Ramanankandrasana, Sylvie Bisser, Louis Dongmo,
Gilbert Avodé, Léopold Nzisabira, Michel Dumas and Pierre-Marie Preux
14. Taenia solium Cysticercosis: the Special Case of the United States 139
Wayne X. Shandera, Peter M. Schantz and A. Clinton White Jr
15. Porcine Cysticercosis 145
Armando E. Gonzalez, Patricia P. Wilkins and Teresa Lopez
16. Taenia solium: A Historical Note 157
Noshir H. Wadia and Gagandeep Singh
SECTION III TAENIA SOLIUM CYSTICERCOSIS: CLINICAL ASPECTS
17. Neurocysticercosis: an Overview of Clinical Presentations 169

Sudesh Prabhakar and Gagandeep Singh
18. Meningeal Cysticercosis 177
Oscar H. Del Brutto
19. Heavy Multilesional Cysticercotic Syndromes 189
Oscar H. Del Brutto, Hector H. García and Sudesh Prabhakar
20. Intraventricular Neurocysticercosis 199
Albert C. Cuetter and Russell J. Andrews
21. Neurocysticercosis and Epilepsy 211
Arturo Carpio and W. Allen Hauser
22. Cerebrovascular Manifestations of Neurocysticercosis 221
Fernando Barinagarrementeria and Carlos Cantú
23. Taenia solium Cysticercosis: Uncommon Manifestations 229
Gagandeep Singh and Indermohan S. Sawhney
24. The Story Behind Solitary Cysticercus Granuloma 241
Vedantam Rajshekhar
25. Seizures Due to Solitary Cysticercus Granuloma 251
J.M.K. Murthy
26. Paediatric Neurocysticercosis 257
27. Psychiatric Manifestations of Neurocysticercosis 263
Orestes V. Forlenza
28. Taenia solium Cysticercosis: Ophthalmic Aspects 269
Atul Kumar and Namrata Sharma

Singh - Prelims 17/9/02 12:00 pm Page vii
Contents vii
29. Neurocysticercosis: Diagnosis and Treatment in Special Situations 281

Ravindra K. Garg and Alok M. Kar
SECTION IV CYSTICERCOSIS: PATHOLOGY
30. The Pathology of Neurocysticercosis 289

Alfonso Escobar and Karen M. Weidenheim
31. Single Small Enhancing Computed Tomography Lesions –
Pathological Correlates 307
Geeta Chacko
SECTION V NEUROCYSTICERCOSIS: INVESTIGATIONAL ASPECTS
32. Imaging and Spectroscopy of Neurocysticercosis 311

Deepshikha Sharda, Sanjeev Chawla and Rakesh K. Gupta
33. Taenia solium Cysticercosis: Immunodiagnosis of Neurocysticercosis
and Taeniasis 329
Patricia P. Wilkins, Marianna Wilson, James C. Allan and Victor C.W. Tsang
34. Antigen-based Immunoassays in the Diagnosis of Taenia solium Cysticercosis 343
Dolores Correa, Raquel Tapia-Romero, Antonio Meza-Lucas and Olga Mata-Ruiz
35. Polymerase Chain Reaction in the Diagnosis of Taenia solium Cysticercosis 351
Taru Meri and Seppo Meri
36. Immunodiagnosis in Solitary Cysticercus Granulomas 359
Anna Oomen
SECTION VI TAENIASIS–CYSTICERCOSIS: THERAPY AND PREVENTION
37. Pharmacology of Anticysticercal Therapy 363

Helgi Jung and Dinora F. González-Esquivel
38. Controversies in the Drug Treatment of Neurocysticercosis 375
Bhim S. Singhal and Rodrigo A. Salinas
39. Neurocysticercosis: Neurosurgical Perspective 387
Bhawani S. Sharma and P. Sarat Chandra
40. Endoscopic Management of Intraventricular Cysticercosis 399
Marvin Bergsneider and Jaime H. Nieto
41. Control of Taenia solium with Emphasis on Treatment of Taeniasis 411
James C. Allan, Philip S. Craig and Zbigniew S. Pawlowski
42. Taenia solium Vaccination: Present Status and Future Prospects 421
Carlton A.W. Evans
43. Control of Taenia solium with Porcine Chemotherapy 431
Armando E. Gonzalez
44. Use of a Simulation Model to Evaluate Control Programmes against Taenia
solium Cysticercosis 437
Armando E. Gonzalez, Robert H. Gilman, Hector H. García and Teresa Lopez
Index 449

Singh - Prelims 17/9/02 12:00 pm Page ix
Contributors
Svetlana Agapejev, Department of Neurology and Psychiatry, PO Box 540, School of

Medicine, UNESP, 18618-000 Botucatu, São Paulo, Brazil.
James C. Allan, Pfizer Global Research and Development – Veterinary Medicine Clinical
Development, Pfizer Ltd, Sandwich, CT13 9NJ, UK.
Russell J. Andrews, Department of Neurology, Texas Tech University Health Sciences Center,
El Paso, Texas 79905, USA.
Gilbert Avodé, School of Medicine, Cotonou, Benin.
Fernando Barinagarrementeria, Department of Neurology, Instituto Nacional de Ciencias
Medicas y Nutricion, ‘Salvador Zubiran’, México City, México.
Marvin Bergsneider, Division of Neurosurgery, University of California, Los Angeles,
Harbor–UCLA Medical Center, Los Angeles, California, USA.
Sylvie Bisser, Institut d’Epidémiologie Neurologique et de Neurologie Tropicale, EA 3174
(Neuroparasitologie et Neuroépidémiologie Tropicale) Faculté de Médecine, 2 rue du Dr
Marcland, 87025 Limoges, France.
Carlos Cantú, Department of Neurology, Instituto Nacional de Neurologia y Neurocirgia
‘Manuel Velasco Suarez’, México City, México.
Astrid E. Cardona, Department of Microbiology, The University of Texas Health Science
Center at San Antonio, San Antonio, Texas 78229, USA.
Arturo Carpio, Comprehensive Epilepsy Center, School of Medicine, University of Cuenca,
Ecuador, PO Box 0101-719, Cuenca, Ecuador.
Geeta Chacko, Division of Neuropathology, Department of Neurological Sciences, Christian
Medical College and Hospital, Vellore 632 004, Tamil Nadu, India.
P. Sarat Chandra, Department of Neurosurgery, CN Center, Room 720, All India Institute of
Medical Sciences, Ansari Nagar, New Delhi 110 029, India.
Sanjeev Chawla, Department of Radiodiagnosis, Sanjay Gandhi Postgraduate Institute of
Medical Sciences, Rae Bareli Road, Lucknow 226 014, Uttar Pradesh, India.
Seung Yull Cho, Section of Molecular Parasitology, Department of Molecular Medicine,
Sungkyunkwan University College of Medicine, Sungkyunkwan, Korea.
Dolores Correa, Departmento de Biotecnologia, Instituto de Diagnostico y Referencia
Epidemiologicos (INDRE), Secretaria de Salud, México DF, México.
Philip S. Craig, Department of Biological Sciences, School of Environment and Life Sciences,
University of Salford, Salford, M5 5W7, UK.
Albert C. Cuetter, Department of Neurology, Texas Tech University Health Sciences Center,
El Paso, Texas 79905, USA.
© CAB International 2002. Taenia solium Cysticercosis
(eds G. Singh and S. Prabhakar) ix

Singh - Prelims 17/9/02 12:00 pm Page x
x Contributors
Oscar H. Del Brutto, Department of Neurology, Luis Vernaza Hospital, Guayaquil, Ecuador.
Louis Dongmo, School of Medicine, Yaoude, Cameroon.
Michel Druet-Cabanac, Institut d’Epidémiologie Neurologique et de Neurologie Tropicale,
EA 3174 (Neuroparasitologie et Neuroépidémiologie Tropicale) Faculté de Médecine, 2 rue
du Dr Marcland, 87025 Limoges, France.
Michel Dumas, Institut d’Epidémiologie Neurologique et de Neurologie Tropicale, EA 3174
(Neuroparasitologie et Neuroépidémiologie Tropicale) Faculté de Médecine, 2 rue du Dr
Marcland, 87025 Limoges, France.
Alfonso Escobar, Instituto de Investigaciones, Biomedicas, National Autonomous University
of México, Ciudad Universitaria 04510, México DF, México.
Carlton A.W. Evans, Imperial College, Department of Infectious Diseases, Hammersmith
Hospital, Du Cane Road, London W12 0NN, UK.
Ana Flisser, Departmento de Microbiologia y Parasitologia, Facultad de Medicina, National
Autonomous University of México, Ciudad Universitaria, San Angel, México 04510 DF,
México.
Orestes V. Forlenza, Laboratory of Neuroscience (LIM-27), Department and Institute of
Psychiatry, Faculty of Medicine, University of São Paulo, São Paulo, Brazil.
Hector H. García, Departments of Transmissible Diseases, Microbiology, and Pathology,
Universidad Peruana Cayetano Heredia, Lima, Peru.
José Garcia-Noval, Centro de Investigaciones de las Ciencias de la Salud, Facultad de
Ciencias Medicas, Universidad de San Carlos, Zona 12, Guatemala City, Guatemala.
Ravindra K. Garg, Department of Neurology, King George’s Medical College, Lucknow,
226 003, Uttar Pradesh, India.
Robert H. Gilman, Department of International Health, Johns Hopkins School of Public
Health, Johns Hopkins University, 615 N Wolfe St, Room W 3501, Baltimore, Maryland
21205, USA.
Armando E. Gonzalez, Facultad de Medicina Veterinaria, Universidad Nacional Mayor de
San Marcos, Lima, Peru.
Dinora F. González-Esquivel, Laboratorio de Neuropsicofarmacologia, Instituto Nacional de
Neurologia y Neurocirugia, México City, México.
Rakesh K. Gupta, Department of Radiodiagnosis, Sanjay Gandhi Postgraduate Institute of
Medical Sciences, Rae Bareli Road, Lucknow 226 014, Uttar Pradesh, India.
W. Allen Hauser, Department of Neurology and Public Health, College of Physicians and
Surgeons, Columbia University, GH Sergievsky Center, 630 West 168th Street, New York
10032, USA.
Akira Ito, Department of Parasitology, Asahikawa Medical College, Midorigaoka-Higashi
2-1-1-1, Asahikawa 078-8510, Hokkaido, Japan.
Satish Jain, Department of Neurology, Neurosciences Center, All India Institute of Medical
Sciences, New Delhi, 110 029, India.
Helgi Jung, Laboratorio de Neuropsicofarmacologia, Instituto Nacional de Neurologia y
Neurocirugia, México City, México.
Alok M. Kar, Department of Neurology, King George’s Medical College, Lucknow, 226 003,
Uttar Pradesh, India.
Atul Kumar, Dr Rajendra Prasad Center for Ophthalmic Sciences, All India Institute of
Medical Sciences, Ansari Nagar, New Delhi 110 029, India.
Teresa Lopez, Laboratorio de Micribiologia y Parasitologia, Facultad de Medicina
Veterinaria, Universidad Nacional Mayor de San Macos, Cdra. 29 Av. Circunvalacion s/n
San Borja, Lima, Peru.
Mahesh C. Maheshwari, Department of Neurology, Neurosciences Center, All India Institute
of Medical Sciences, New Delhi, 110 029, India.
Olga Mata-Ruiz, Departmento de Biotecnologia, Instituto de Diagnostico y Referencia
Epidemiologicos, Secretaria de Salud, México DF, México.

Singh - Prelims 17/9/02 12:00 pm Page xi
Contributors xi
Seppo Meri, Department of Bacteriology and Immunology, Haartman Insitute, PO Box 21

(Haartmaninkatu 3) 00014, University of Helsinki, Finland.
Taru Meri, Department of Bacteriology and Immunology, Haartman Insitute, PO Box 21
(Haartmaninkatu 3) 00014, University of Helsinki, Finland.
Antonio Meza-Lucas, Departmento de Biotecnologia, Instituto de Diagnostico y Referencia
José L. Molinari, Department of Molecular Genetics, Institute of Cellular Physiology, National
Autonomous University of México, México DF 04510, Apartado Postal 70–242, México.
J.M.K. Murthy, Department of Neurology, The Institute of Neurological Sciences, CARE
Hospital, Nampally, Hyderabad, 500 001, India.
Minoru Nakao, Department of Parasitology, Asahikawa Medical College, Midorigaoka-
Higashi 2-1-1-1, Asahikawa 078-8510, Hokkaido, Japan.
Jaime H. Nieto, Division of Neurosurgery, University of California, Los Angeles,
Harbor–UCLA Medical Center, Los Angeles, California, USA.
Léopold Nzisabira, School of Medicine, Bujumbura, Burundi.
Munehiro Okamoto, Department of Laboratory Animal Sciences, School of Veterinary
Medicine, Faculty of Agriculture, Tottori University, Koyamacho-Minami 4-101, Tottori
680-8553, Tottori, Japan.
Anna Oomen, Neurochemistry Laboratory, Department of Neurological Sciences, CMC
Hospital, Vellore 632 004, India.
Vasantha Padma, Department of Neurology, Neurosciences Center, All India Institute of
Medical Sciences, New Delhi, 110 029, India.
Zbigniew S. Pawlowski, Clinic of Parasitic and Tropical Diseases, ul., Przybyszewskiego 49,
60-355 Poznan, Poland.
Sudesh Prabhakar, Department of Neurology, Postgraduate Institute of Medical Education
and Research, Chandigarh, 161 001, India.
Pierre-Marie Preux, Institut d’Epidémiologie Neurologique et de Neurologie Tropicale, EA
3174 (Neuroparasitologie et Neuroépidémiologie Tropicale) Faculté de Médecine, 2 rue du
Dr Marcland, 87025 Limoges, France.
Dong-Chuan Qiu, Sichuan Institute of Parasitic Diseases, 10 University Road, Chengdu
610041, Sichuan Province, People’s Republic of China.
Vedantam Rajshekhar, Department of Neurological Sciences, Christian Medical College and
Hospital, Vellore, 632 004, India.
Bienvenue Ramanankandrasana, Institut d’Epidémiologie Neurologique et de Neurologie
Tropicale, EA 3174 (Neuroparasitologie et Neuroépidémiologie Tropicale) Faculté de
Médecine, 2 rue du Dr Marcland, 87025 Limoges, France.
Yasuhito Sako, Department of Parasitology, Asahikawa Medical College, Midorigaoka-
Higashi 2-1-1-1, Asahikawa 078-8510, Hokkaido, Japan.
Rodrigo A. Salinas, Healthcare Programmes Division, Ministry of Health, Chile.
Ana L. Sanchez, Department of Microbiology, National Autonomous University of
Honduras, Tegucigalpa, Honduras.
Elsa Sarti, INDRE, Carpio no. 470, 3rd floor, Col. Sto. Tomás, CP 04230, Mexico City, Mexico.
Indermohan S. Sawhney, Department of Neurology, Morriston Hospital, Morriston,
Swansea SA6 6NL, UK.
Peter M. Schantz, Division of Parasitic Diseases, National Center for Infectious Diseases
Centers for Disease Control and Prevention, Atlanta, Georgia 30341, USA.
Wayne X. Shandera, Department of Medicine, Sections of General Internal Medicine and
Infectious Diseases, Baylor College of Medicine and Ben Taub General Hospital, Houston,
Texas 77030, USA.
Deepshikka Sharda, Department of Radiodiagnosis, Sanjay Gandhi Postgraduate Institute of
Medical Sciences, Rae Bareli Road, Lucknow, 226 014, Uttar Pradesh, India.

Singh - Prelims 17/9/02 12:00 pm Page xii
xii Contributors
Bhawani S. Sharma, Department of Neurosurgery, CN Center, Room 720, All India Institute
of Medical Sciences, Ansari Nagar, New Delhi, 110 029, India.
Namrata Sharma, Dr Rajendra Prasad Center of Ophthalmic Sciences, All India Institute of
Medical Sciences, Ansari Nagar, New Delhi, 110 029, India.
Gagandeep Singh, Department of Neurology, Dayanand Medical College and Hospital,
Ludhiana, 141 001, Punjab, India.
Bhim S. Singhal, Department of Neurology, Bombay Hospital Institute of Medical Sciences,
12 Marine Lines, Mumbai, 400 0020, India.
Achal Srivastava, Department of Neurology, Neurosciences Center, All India Institute of
Raquel Tapia-Romero, Departmento de Biotecnologia, Instituto de Diagnostico y Referencia
Patricia Tato, Department of Microbiology and Parasitology, Faculty of Medicine, National
Autonomous University of México, México DF 04510, México.
Judy M. Teale, Department of Microbiology, The University of Texas Health Science Center at
San Antonio, San Antonio, Texas 78229, USA.
Manjari Tripathi, Department of Neurology, Neurosciences Center, All India Institute of
Victor C.W. Tsang, Division of Parasitic Diseases, National Center for Infectious Diseases,
Manuela Verastegui, Laboratorio de Parasitologia, Facultad de Ciencias, Universidad
Peruana Cayetano Heredia, Av. Honorio Delgado s/n Urbanizacion Ingeniera, San Martin
de Porres, Lima, Peru.
Noshir H. Wadia, Director of Neurology, Jaslok Hospital and Research Center, Mumbai,
India.
Karen M. Weidenheim, Division of Neuropathology, Montefiore Medical Center, AECOM,
YU111, East 210th Street, Bronx, New York 10467, USA.
A. Clinton White Jr, Infectious Disease Section, Department of Medicine, Baylor College of
Medicine, One Baylor Plaza, Houston, Texas 77030, USA.
Patricia P. Wilkins, Division of Parasitic Diseases, National Center for Infectious Diseases,
Marianna Wilson, Division of Parasitic Diseases, National Center for Infectious Diseases,
Hiroshi Yamasaki, Department of Parasitology, Asahikawa Medical College, Midorigaoka-
Higashi 2-1-1-1, Asahikawa, 078-8510, Hokkaido, Japan.

Singh - Prelims 17/9/02 12:00 pm Page xiii
Preface
Neurocysticercosis and the macroparasite Taenia solium, which causes it, have been known
about for time immemorial. Through history, one can follow the development of concepts
regarding the aetiology, pathology, clinical science and treatment of the disorder. Recent
times have however been complicated by accumulating knowledge regarding molecular biol-
ogy, immunology and genetics of the disorder. The relationship between the molecular labo-
ratory and bedside clinical practice is becoming increasingly powerful. In these times of
molecular advances, a review of neurocysticercosis and T. solium that focuses on past accom-
plishments, current understanding and future hopes seems appropriate. A number of scien-
tific antecedents mean that the goals of effective treatment and, more importantly, eradication
are foreseeable. This alone prompted the genesis of this textbook, which symbolizes the spirit
of unity between basic researchers, clinicians and field workers. Since the book involved a
large number of subspeciality areas including parasitology, immunology, biology, genetics,
epidemiology and public health, clinical neurology, radiology and veterinary medicine, it
was impossible for two authors alone to write such a volume. Therefore, we solicited the con-
tribution of a number of experts, each with great depth of knowledge and experience in their
respective areas. The contributors to this book are its principal strength and we are indebted
to them for their time and effort spent not only in writing their respective chapters but also
for the years of painstaking work that led to the realization of knowledge through basic, clini-
cal or field research. It is because of their involvement, that the book turns out what it was
meant to be, a ‘one-stop shop for T. solium cysticercosis’.
We express our appreciation of several associates among the contributors, who gave
invaluable suggestions while planning the book project and were also involved in stimulat-
ing discussions: James Allan, Peter Schantz, Ana Flisser, Patricia Wilkins, Hector García,
Akira Ito, Phillip Craig, Arturo Carpio, Carlton Evans and Svetlana Agapejev. Davinder
Singh and Arun Gupta provided excellent editorial assistance with the text and illustrations,
respectively. Finally, this book is a tribute to those millions afflicted by the disorder. They
have contributed in their own way to the understanding of the disorder. It is our fervent
hope that the recent accomplishments in scientific understanding brought out in this volume
will ultimately lead to the goal of complete global eradication of the parasite, T. solium.

(eds G. Singh and S. Prabhakar) xiii
Singh - Prelims 17/9/02 12:00 pm Page xiv
Abbreviations
AED antiepileptic drug

AFB acid-fast bacilli
AIDS acquired immune-deficiency syndrome
ALBSO albendazole sulphoxide
ATT antitubercular treatment
AUC area under the plasma concentration–time curve
C1 first cervical vertebra
CDC Centers for Disease Control
cDNA complementary deoxyribonucleic acid
CECT contrast enhanced CT
CI confidence interval
Cmax maximal concentration
CNS central nervous system
COI cytochrome c oxidase subunit I
COII cytochrome c oxidase subunit II
COIII cytochrome c oxidase subunit III
Con A concanavalin A
CSF cerebrospinal fluid
CT computed tomography
CWG Cysticercosis Working Group
DTH delayed type hypersensitivity
EDTA ethylenediamine tetra-acetic acid
EEG electroencephalography
EITB enzyme-linked immunoelectrotransfer blot
ELISA enzyme-linked immunosorbent assay
ES excretory–secretory
FLAIR fluid attenuation inversion recovery
FMO flavin-containing monoxygenase
Gd gadolinium
GIS global information system
GPL glycoproteins
GST glutathione-S-transferase
HIV human immunodeficiency virus
HLA human leucocyte antigen
HPLC-ELISA high pressure liquid chromatography-ELISA
hsps heat shock proteins
xiv

Singh - Prelims 17/9/02 12:00 pm Page xv
Abbreviations xv
HU Hounsfield units
ICH intracranial hypertension
ICP intracranial pressure
IDEMSC intradural extramedullary spinal cysticercosis
IEF immunoelectrophoresis
IFN interferon
IgG immunoglobulin G
IgM immunoglobulin M
IHA indirect haemagglutination assay
IL interleukin
ILAE International League Against Epilepsy
IMOA intramuscular oncosphere assay
IMSC intramedullary spinal cysticercosis
IP intraperitoneal
IV intravascular
IVNC intraventricular neurocysticercosis
LLGP lentil lectin-bound glycoproteins
LrRNA large subunit rRNA
MAb monoclonal antibody
MF metacestode factor
MoAb monoclonal antibody
MRI magnetic resonance imaging
mtDNA mitochondrial deoxyribonucleic acid
NADH reduced nicotinamide-adenine dinucleotide
NADPH nicotinamide-adenine dinucleotide phosphate (reduced form)
NC neurocysticercosis
Nd:YAG neodymium:yttrium alminium-garnet
NOD-SCID non-obese diabetic-severe combined immunodeficiency
Pc corrected P value
PCR polymerase chain reaction
PD proton density
PoAb polyclonal antibody
PRA participatory rural appraisal
Rnase ribonuclease
RR relative risk
rRNA ribosomal ribonucleic acid
SCG solitary cysticercus granuloma
SDS-PAGE sodium dodecyl sulphate-polyacrylamide gel electrophoresis
SrRNA small subunit rRNA
SSECTL single small enhancing CT lesion
sTS synthetic Taenia solium
TCD transcranial doppler
Th T helper cell
TNF tumour necrosis factor
tRNA transfer ribonucleic acid
VPS ventriculoperitoneal shunt

Singh - Chap 01 4/9/02 4:37 pm Page 1
1 Taenia solium: Basic Biology and

Transmission
Zbigniew S. Pawlowski
No animal has been responsible for more hypotheses, discussions and errors than the tapeworm
Casimir Joseph Davaine, 18601
Introduction would take time in several developing coun-

tries where cysticercosis is endemic.
Even today, the above statement by the Recently, schemes for short-term control
author of a French textbook of parasitology have been developed with an aim to bring
deserves attention. While some of the earlier about immediate control of T. solium infec-
controversies regarding the taxonomic station in developing countries (reviewed in
tus, life cycle and pathogenicity of Taenia Chapters 41–44). These methods require
solium have been solved, several issues in multidisciplinary collaboration between
relation to basic biology, modalities of trans- clinical, veterinary and public health ser-
mission and control remain unsettled. A vices, and immunology and parasitology
major reason for these persisting uncertain- disciplines as well as support at the commu-
ties has been that the study of Taeniidae is nity and national levels3. In order to under-
neither a research nor a control priority. stand the basis of the control strategies, it is
Fifty years ago in UK, and in many coun- necessary to have sound knowledge of the
tries today, taeniasis in humans was consid- life cycle and mechanisms of transmission of
ered a trifle, and regarded as more suitable infection. This chapter reviews basic biology
for an examination question than for consid- of T. solium with emphasis on aspects related
eration as a potential threat of cysticercosis2. to its transmission.
Basic, experimental as well as field studies
upon T. solium infection are still few. The
control of human cysticercosis for a long Taxonomic Status of T. solium
time was left to veterinary services alone.
The eradication of human cysticercosis in The origin of tapeworms still remains a
Europe made it clear that certain economic controversial issue4,5. According to actual
and social standards and community disci- systematics, there are two major subclasses
pline and cooperation were necessary for of tapeworms: Cestodaria and Eucestoda.
successful control of infection. Since socio- Taenia solium belongs to the subclass,
economic improvement is a gradual and Eucestoda, order, Cyclophyllidea and
slow process, long-term control programmes family, Taeniidae5. The family, Taeniidae
(eds G. Singh and S. Prabhakar) 1

2 Z.S. Pawlowski
comprises 11 genera of small to large sized nata, and less frequently T. solium adult
tapeworms. They have a holdfast organ – tapeworms have been noted, often giving
the scolex – and an elongated-segmented rise to taxonomic confusion in the past. The
tape-like body. Each segment has intri- taxonomic revision of genus Taenia, pub-
cately developed sexual organs but does lished by Verster, recognizes only two
not have an alimentary canal. The genus species of Taeniidae, namely, T. solium and
Taenia has about 20 species; important T. saginata as capable of parasitizing the
among these are T. solium (pork tapeworm), human gut8,9. The so called Asian Taenia,
T. saginata (beef tapeworm), T. crassiceps first described in 1980s in Taiwan, was ini-
(rodent tapeworm), T. hydatigena (canine tially proposed to be a new species but is
tapeworm), T. ovis (canine tapeworm) and now accepted to be a subspecies of T. sagi-
T. pisiformis (canine tapeworm). Only a few nata namely, T. saginata asiatica (see Chapter
species among Taeniidae present potential 5)10,11. The adult stage of T. solium needs to
health hazards to humans: Taenia solium, T. be differentiated from other Taeniidae, par-
saginata, Echinococcus granulosus and E. mul- ticularly the closely related T. saginata (Table
tilocularis. In addition, there are anecdotal 1.1, Fig. 1.1). Differences between scolices of
reports of human infection with T. crassi- T. solium and T. saginata were recognized as
ceps, T. hydatigena and T. multiceps. Few early as in the 17th century7. T. solium scol-
other zoonotic species, e.g. T. taeniaeformis, ices are armed with hooks, while T. saginata
T. ovis and T. hydatigena are good models scolices are not. This easily visible criterion
for laboratory and field studies; the latter is now of little routine diagnostic value as
can hardly be performed with T. solium on intact scolices can rarely be found after
account of its high pathogenic risk poten- treatment with modern anthelminthics (that
tial. Therefore, studies of related species cause considerable damage to the worm). In
constitute a useful source of information on general, the adult T. solium is smaller and
biology and transmission of T. solium. more delicate than T. saginata. For nearly
Although the ‘Standardized Nomenclature 150 years, gravid proglottides of T. solium
of Animal Parasitic Diseases’ recommended and T. saginata were differentiated by count-
the use of the term ‘taeniosis’ (T. solium tae- ing the number of lateral uterine branches.
niosis, T. saginata taeniosis), the term, ‘taeni- In 1967, Verster questioned this criterion
asis’ continues to be widely used6. The term, and proposed three morphological charac-
‘cysticercosis’ denotes infection with the teristics for distinguishing T. solium from T.
metacestode stage (cysticercus) of Taenia. It saginata, namely the presence of an armed
was as late as 1853 that cysticerci were rostellum, three-lobed ovary and the
demonstrated to be a developmental stage absence of a vaginal sphincter (Table 1.1,
of T. solium and not a separate parasite Fig. 1.1)8. These differences are rarely
species as was previously held7. The terms, observed in routine diagnostic parasitol-
‘cysticercus cellulosae’ and ‘cysticercus ogy practice as scolices and mature
bovis’ were introduced in the 18th century; proglottides are not commonly available
these are of historic value only and should and counting ovarian lobes as well as find-
never be used in a generic fashion. In med- ing the vaginal sphincter requires fixation
ical literature, the expression ‘cysticercosis’ and staining of mature proglottides, which
synonymously denotes T. solium metaces- is an arduous procedure.
tode infection unless otherwise specified, Enzyme electrophoresis for the differentia-
e.g. bovine cysticercosis. tion of Taeniidae was elaborated in the early
1970s; it has been replaced by DNA finger-
printing in the 1990s12,13. Specific DNA probes
Differences between T. solium, T. saginata for T. solium and T. saginata are now avail-
and T. saginata asiatica able13. Intraspecific DNA differences were
demonstrated between T. solium tapeworms
Several morphological abnormalities of originating from various continents (reviewed
strobila or individual proglottides of T. sagi- in Chapter 5)14. These molecular studies also

Singh - Chap 01
Table 1.1. Morphological differences between T. solium, T. saginata and T. saginata asiatica (compiled from references 10, 18, 37 and 46).
4/9/02
Characteristic T. solium T. saginata T. saginata asiatica
Intermediate host Pig, wild boar Cattle, reindeer Pig, cattle, goat, some wild mammals
Metacestodes
4:37 pm
Site Brain, skin, muscle Muscle, viscera Liver (exclusively)

Size (mm) 5.6–8.5 3.1–6.5 7–10 4–6 22
Scolex Rostellum and hooks No rostellum Rostellum, rudimentary hooklets (1–37)
Bladder surface Wart-like formations Rugae Wart-like formations
Page 3
Adult tapeworm
Scolex
Diameter (m) 0.6–1.0 1.5–2.0 0.8
Number of suckers 4 4 4
Diameter of suckers (mm) 0.4–0.5 0.7–0.8 0.24–0.29
Rostellum Present Absent Present
Number of hooks 22–32 Absent Absent
Proglottides
Length (mm) 1.5–8 4–12 c. 3.5
Maximal breadth (mm) 7–10 12–14 c. 9.5
Basic Biology and Transmission
Number of proglottides 700–1000 c. 2000 260–1016

Mature proglottides
Number of testes 375–575 800–1200 868–904
Ovary Three lobes Two lobes Two lobes
Vaginal sphincter Absent Present Present
Cirrus pouch extending to excretory vessels Yes No No
Gravid proglottides
Number of uterine branches 7–12 (16) 18–32 (15) 16–21 (32)
Branching pattern Dendritic Dichotomous Dichotomous
Expulsion from host Mainly in groups, passively Single, spontaneously Single, spontaneously
3
4 Z.S. Pawlowski
0.5 mm
(a) (b) (c)
2 mm
(d) (e)
(f) (g)
ut
5 mm
(h) (i) (j)
Fig. 1.1. Diagrammatic representation of the comparative morphological features of adult T. solium (a, d,
f, h), T. saginata (b, g, i) and T. saginata asiatica (c, e, j) (adapted from references 8, 10, 47). Note that
tri-lobed ovary in the mature proglottid of T. solium (d), in comparison to two lobes in the mature
proglottid of T. saginata and T. saginata asiatica (e), the presence of the vaginal sphincter in the atrium
genitale of T. saginata (g). Note also the differences in the branching pattern of the uterus of T. solium
(h), T. saginata (i) and T. saginata asiatica (j) proglottides.

Basic Biology and Transmission 5
support speciation of T. saginata asiatica as a Stages in Development of T. solium

subspecies of T. saginata15. Recently, a sero-
logic assay, using T. solium excretory–secre- The life cycle of T. solium is divided into six
tory antigens that is 95% sensitive and 100% characteristic developmental stages (Fig. 1.2):
specific, has been developed to identify T.
solium tapeworms carriers (reviewed in 1. Preadult tapeworm: a stage between the
Chapter 33)16. A rapid, highly sensitive and cysticercus, after it has successfully invaded
specific dot blot assay has also been devel- the definite host, and the mature tapeworm.
oped for detection of T. solium eggs, which 2. Adult tapeworm: a reproductive stage
otherwise cannot be differentiated from T. sag- capable of producing thousands of eggs.
inata and some other taeniid eggs by morpho- 3. Egg: a small embryo covered by an
logical criteria alone17. The differentiation of embryophore, a stage responsible for dis-
T. solium and T. saginata taeniasis is important semination to the external environment.
for clinical reasons and epidemiological pur- 4. Oncosphere: a hexacanth larva which
poses. However, in regions, where both are migrates from the intestine to internal tissues
endemic in animals, and when species-spe- or organs within the intermediate host.
cific diagnosis in humans is not possible, any 5. Postoncospheral form: an intermediate
case of taeniasis should be considered and stage between an oncosphere in the tissues
treated without delay as suspected T. solium and a fully developed cysticercus.
infection. 6. Cysticercus: a bladder metacestode form
that parasitizes tissues of the intermediate
host, mainly pigs as well as humans.
Taenia solium Infection: Host
Characteristics
Preadult and adult tapeworm
Humans are the major natural final host of T.
solium, implying that man, the only natural The ingestion of pork contaminated with
definite host, is the most important multi- cysticerci by man is a prerequisite for this
plier, reservoir and disseminator of the infec- stage. Upon reaching the human intestine
tion to pigs. However, experimental the cysticercus evaginates and loses its
infections with adult T. solium after ingestion bladder wall. The adult tapeworm grows
of cysticerci have been successfully estab- up from behind the scolex of the cysticer-
lished in lar gibbon (Hylobates lar), chacma cus. It takes approximately 2 months to
baboon (Papio ursinus) and golden hamster develop into a mature, reproductively com-
(Mesocricetus auratus). T. solium metacestodes petent, adult tapeworm that is capable of
are less specific than adult cestodes18. The producing eggs.
list of mammals in which cysticerci armed The adult tapeworm has a scolex, an elon-
with hooks have been found includes mon- gated neck and a strobila4. The scolex is the
keys (Ateles, Cercopithecus, Macacus sp.), wild holdfast organ armed with four suckers and a
boars, bush pigs, bush babies, camels, rab- rostellum displaying 22–32 characteristic
bits, hares, rock hyraxes, brown bears, dogs, hooks4. The strobila consists of 700–1000 seg-
foxes, cats, polecats, coatis, rats and mice18. ments proglottids and can be extremely long
In addition, experimental infection with T. (Fig. 1.3). It is made up of immature, mature
solium oncospheres has been successfully and gravid proglottids, which differ in size,
established in immunosuppressed mice (see shape and stage of development with respect
Chapter 4)19. However, many of the to their internal reproductive organs and egg
reported cysticerci differed in the size of content (Fig. 1.1). Proglottids located proxi-
hooks and immunoelectrophoretic pattern mally are small, short and reproductively
of T. solium cysticerci; not all armed cys- immature. Mature proglottids are almost rec-
ticerci are those of T. solium18. Humans are tangular and have fully developed sexual
unique in that they can harbour both adult organs. The gravid segments, located towards
and metacestode stages. the very distal end of the strobila, are

6 Z.S. Pawlowski
Stages Habitat Number Time
*Human taeniasis
HUMANS
**Human cysticercosis around a carrier

**Human cysticercosis: external / internal autoinfection
1. Preadult Gut One 2 months

tapeworm
2. Adult Gut One In years

tapeworm
(Gravid Several in a
proglottids) week
ENVIRONMENT
3. Eggs Soil, water, 300,000 per day One year

dirt
Transmission of human cysticercosis
PIGS
4. Oncosphere Gut / tissue One–several 2 days
5. Post-oncosphere Muscle, brain, One–several 10–12 weeks

other organs
6. Cysticercus Muscle, brain, One–several <1 year

other organs
Transmission of human taeniasis: meatborne
Fig. 1.2. Diagrammatic representation of the life cycle of T. solium.

elongated (20 5 mm) and each is packed testes; each connected to the sperm duct
with a uterus full of eggs. The gravid proglot- (vas deferens) leading to the genital pore.
tids detach from the strobila by ‘apolysis’ The female reproductive system comprises
either individually or in groups of two to five, of a vagina, also located within the genital
and are passed in the faeces a few times in a pore, a receptaculum seminis, an oviduct, a
week20. Discharged proglottides remain active trilobed ovary and a vitelline gland. Both
and may show some movements. self- and cross-fertilization may occur.
The tapeworm is a protoandrous her- Spermatozoa formed in the testes are con-
maphrodite4. Its reproductive system is veyed through the sperm duct to the genital
intricately developed. Within each mature pore and thereafter to the vagina to finally
proglottid, a centrally located ovary, a reach the receptaculum seminis and the
vitelline gland and uterus, surrounded by oviduct. The ovary discharges eggs in to the
numerous testes can be seen. The male oviduct, where the latter are fertilized by
reproductive organs include numerous spermatozoa. The fertilized eggs acquire
Fig. 1.3. Picture depicting the entire length of the adult T. solium tapeworm. (Source: Ana Flisser,
National Autonomous University of México, México DF, México.)

8 Z.S. Pawlowski
yolk cells from a vitelline gland in the being noticed in the faeces. Usually, a single
oviduct itself and are relocated into the T. solium tapeworm parasitizes the human
uterus, where they are stored. As the uterus gut; however, multiple infections may occur.
tube is closed without any opening to out- Superinfection probably exists; it has been
side it develops several ramifications packed documented in experimental T. saginata
with eggs, thus occupying most of the infection27.
gravid proglottid. Besides the reproductive
system, the adult tapeworm has four major
organ systems: tegument, nervous system, Taenia solium eggs
osmoregulatory system and muscular sys-
tem. It has no digestive canal4. The eggs of T. solium are morphologically
While the tapeworm lives in human small indistinguishable from those of other Taenia
intestine, its scolex is temporarily fixed in the sp. (Fig. 1.4a). As with eggs of other
duodenum and the strobila is bent a few Taeniidae, the outer shell of T. solium eggs is
times21. However, it frequently moves up very delicate and is usually lost while leav-
and down, in synchrony with the passage of ing the uterus. What is found in the faeces is
incoming food. It adapts to the rather hostile an oncosphere covered by an embryophore,
intestinal environment, being mobile, anaer- characteristic for all Taenia. The embryophore
obic, and is able to withstand the varying pH is globular in shape and measures 31–43 m
and digestive enzymes within the intestine. in diameter28. It has a thick striated cover
The adult worm is believed to survive for a and contains an oncosphere armed with six
few years; new proglottides constantly typical embryonic hooklets (giving it the
replace those expelled. Studies performed by name, ‘hexacanth embryo’), usually visible
Yoshino in the 1930s are of interest22–26. He through the embryophore cover. The
himself swallowed three T. solium cysticerci embryophore protects the oncosphere
and noted passage of proglottides starting against various unfavourable environmental
from 2 months after infection and lasting for conditions but is easily broken in the gut of
2 years and 3 months26. A tapeworm that the intermediate host where the substance
dies naturally or after treatment is easily cementing the keratin-like prismatic ele-
digested and disappears quickly without ments of its cover is digested.
(a)
(b) (b)
(a)
Fig. 1.4. Taenia solium eggs (a) and oncospheres (b). The eggs are 40 30 m in size and surrounded
by a shell; in the centre of figure (a) is a disintegrating egg, showing the process of hatching of an
oncosphere. The oncospheres can be seen surrounding a single egg in (b); their size is smaller (30 20
m) and they contain characteristic embryonic hooklets. (Source: Akivo Ito, Asahikawa Medical College,
Asahikawa, Japan.)

The T. solium tapeworm can shed up to E. granulosus oncospheres). Others are

300,000 eggs daily29. Each apolysed proglot- mature and readily infective to humans
tid has approximately 40,000 eggs. Most of and/or pigs. There are also few senile
the eggs are discharged from a pore at the oncospheres that are incapable of develop-
anterior part of the proglottid, but some ing further; nevertheless, they serve as
remain in the uterus. Eggs that are shed into immunizing factors while disintegrating in
faeces may serve as a source of external the intermediate host31. It is held that lumi-
autoinfection to people in close contact with nal factors such as bile salts are involved in
the carrier. However, most eggs are dissemi- the liberation and activation of mature
nated to the environment. The fate of T. oncospheres in the gut. Within 2 hours of
solium eggs in the environment has not been liberation, oncospheres enter submucosal
adequately studied. In regions that lack sani- blood and/or lymphatic vessels and migrate
tation, free-ranging pigs feed upon faecal to internal organs such as liver, lungs, mus-
matter that is indiscriminately deposited by cles and brain. Why oncospheres have a
people. This is a natural method to reduce predilection for certain sites such as muscle,
contamination of the environment but it brain and subcutaneous tissue is not clear.
increases incidence of swine cysticercosis.
The high reproductive potential of the
adult T. solium tapeworm is counterbalanced Postoncospheral stage or cysticercus
by an enormous egg loss in the external envi-
ronment29. Factors influencing egg survival The postoncospheral development of the
and infectivity have been studied in other larva (also designated as ‘metacestode’) pro-
members of the genus Taenia and have been ceeds within the intermediate host. During
comprehensively reviewed elsewhere30–34. this stage, the parasite does not attain sexual
Egg survival is adversely affected by maturity. The metacestode of the genus
extremes of temperature and desiccation. Taenia is known as ‘cysticercus’. The parasite
Conversely, humidity and temperatures is located in a cavity lined by host epitheloid
between 10°C and room temperature favour cells originating from small vessels. The
egg survival29. A number of agents such as oncosphere quickly change from a solid
wind and water, and some invertebrates and larva into a bladder form filled with fluid
birds are believed to aid in taeniid egg dis- and having a group of cells that will differen-
persal30–35. However, egg dispersal may be of tiate further into an invaginated scolex. The
less importance in the life cycle of T. solium experiments performed by Yoshino, referred
than in that of Echinococcus sp., where sheep to earlier, helped to clarify the sequence of
presumably get infected while grazing heav- development of the metacestode23–25. When
ily contaminated pasturage31. the freed oncosphere enters the intestinal
wall, it is less than 0.03 mm in size23. At
about 6 days, the metacestode is still solid
Oncosphere and measures 0.4 0.3 mm23. It has an outer
membranous wall comprising of pleomorphic
The mature oncosphere is a globular larva, cells, while its inner contents are myxoma-
30 m in diameter (Fig. 1.4b). Its body is tous. By 12 days, the metacestode is larger
composed of a few hundred cells differenti- and becomes cystic. Between 20 and 30 days,
ated into muscle, excretory and nervous sys- a rudimentary scolex is discernable24. Hooks
tem; it also has six characteristic embryonic appear by 40 days and the rostellum and
hooklets and a pair of penetration glands suckers are distinguishable by 40–50 days25.
that are helpful in migration5. The metacestode reaches its fully grown size
Oncospheres, enclosed within embryo- of 5.6–8.5 mm 3.1–6.5 mm by 60–70 days.
phores while leaving the human gut, are in The cysticercus is an ovoid bladder stage.
various stages of development. A few oncos- It is filled with an opalescent fluid and con-
pheres are not fully developed and will tains an invaginated scolex. The bladder con-
mature in the environment (as in the case of sists of outer and inner layers. The outer

10 Z.S. Pawlowski
layer has characteristic hair-like processes. route of self-infection. Internal autoinfection,

This layer not only plays a protective role suggested by Leukart in 1856 and cited by
but also serves as a trophoblast that absorbs others, implies infection with eggs through
nutrients and excretes metabolites36. reverse peristalsis37. Internal autoinfection
Between the outer and inner layers there are appears theoretically improbable since eggs
few muscle bundles, fine fibres, flame cells, are required to pass through a brief period of
calcareous corpuscles, neural and duct sys- peptic digestion that is necessary for disinte-
tems and a group of non-differentiated oval gration of the embryophores before being
cells. Any change in osmotic pressure causes invasive to human tissue37. The possibility of
the scolex to become everted. The survival internal autoinfection cannot be totally disre-
time of a cysticercus is limited to a few years. garded however, and merits further study.
The naturally degenerating cysticercus From 5 to 40% of adult T. solium carriers
becomes necrotic and eventually gets calci- have been reported to develop
fied, or forms a granuloma that finally trans- cysticercosis38. In the case of infection with T.
forms into a fibrotic scar. saginata, it has been demonstrated that the
The cysticercus is typically found in the immediate environment of the infected indi-
intermediate host, i.e. the pig. In humans, the vidual is heavily contaminated39. This may
cysticercus constitutes a dead-end stage, i.e. not be the case, however, with pork tape-
its life cycle cannot progress any further. worm infection, because unlike T. saginata,
However, its development in pigs, known as the proglottides of T. solium do not pass out
porcine cysticercosis, perpetuates the life actively through the anus. Nevertheless, the
cycle of the parasite when man ingests conta- high rates of cysticercosis in individuals with
minated pork with viable cysticerci. intestinal taeniasis and their family members
and household contacts confirm that
faecal–oral self- and cross-infection is com-
Biological and Economic Cycles of T. mon38. Similarly, there is the theoretical pos-
solium: Implications for Control sibility of outbreak of cysticercosis around T.
solium carriers in schools, closed institutions
Biological cycle and public eating facilities, though this has
never been adequately confirmed.
The relatively simple natural biological cycle
of T. solium zoonosis consists of two hosts
and the environment. Man, the final host, Economic cycle
harbours the adult tapeworm, which pro-
duces several thousands of eggs daily for One can imagine that in addition to the bio-
years. The eggs are disseminated to the envi- logical cycle of T. solium described above, an
ronment through faeces. The pig, which is economic cycle exists in several developing
the intermediate host, ingests some of these countries40,41. Several economic factors sus-
eggs; the latter develop into cysticerci. When tain the life cycle of T. solium in underdevel-
man consumes contaminated pork contain- oped regions. Each rural household, in
ing cysticerci, the latter develop into an adult certain developing countries, rears pigs in
worm inhabiting the human intestine. This small numbers; the latter constitute an
completes the life cycle of the parasite (Fig. important source not only of meat but also of
1.2). However, man may also be infected by immediate income. The production of free-
T. solium eggs through internal and external ranging animals needs minimal investment
autoinfection. External autoinfection implies and running costs for the rural poor. In
faecal–oral infection with T. solium eggs in an absence of sanitary infrastructure, people use
individual with intestinal taeniasis. Neglect houseyards, open areas and fields for defeca-
of hygienic standards such as washing hands tion and ablution. This allows free-ranging
after defecation and before consuming meals pigs access to human faeces and perpetuates
are principal reasons for external autoinfec- transmission of parasite from man to pig.
tion. External autoinfection is an established Individual rural pork producers and unli-

censed pig dealers are not motivated to pass there is no significant wildlife reservoir and
pork through meat inspection because of finally a feasible intervention is available in
threat of condemnation. Furthermore, the the form of mass chemotherapy of human
lack of fuel as well as the local culinary taeniasis with safe and effective drugs
habits facilitate the consumption of raw or (reviewed in Chapter 41).
semi-cooked meat. These factors lead to the
transmission of the parasite from pig to man
in endemic areas42. The socio-ecological and Conclusions
economic factors strongly influence the
transmission of T. solium infection and are Six major stages of development have been
responsible for its concentration in certain recognized in the life cycle of T. solium. Man
areas, making short-term control with taeniais a major reservoir, multiplier of the parasite
sis therapy possible (discussed in Chapter and disseminator of infection to both himself
41)43,44. and to the pig. The pig does not play the
most important role in spreading human
cysticercosis, as was believed until not long
Implications for control ago. The role of the external environment in
transmission of T. solium infection is incom-
In 1993, the Task Force for Disease pletely understood. The control of taenia-
Eradication (Centers for Disease Control, sis/cysticercosis depends much not only on
Atlanta, USA) itemized four diseases that the biological life cycle but also on the ‘eco-
were potentially eradicable in the future; nomic’ cycle of T. solium. Several factors
these included lymphatic filariasis, mumps, including inadequacies in pig husbandry,
rubella and T. solium taeniasis/cysticerco- sanitary facilities, meat inspection, personal
sis45. Several characteristics of T. solium hygiene and local feeding habits are
infection make it suitable for eradication, involved in the perpetuation of the life cycle
namely, adult tapeworm infection in of T. solium in the developing world. Control
humans is the only source of infection for strategies should be able to deal with these
intermediate hosts (pigs); the animal inter- deficiencies in order to be effective in eradi-
mediate host population can be managed; cating taeniasis/cysticercosis.
References
1. Davaine, C.J. (1860) Traite des Entozoaires et des Maladies Vermineuses de l’Homme et des Animaux
Domestiques. JB Bailière et fils, Paris, France.
2. Asher, R. (1953) Troublesome tapeworms. Lancet i, 1019–1021.
3. Schantz, P.M., Cruz, M., Sarti, E., et al. (1993) Potential eradicability of taeniasis and cysticercosis.
Bulletin of the Pan American Health Organization 27, 397–403.
4. Wardle, R.A., McLeod, J.A., Radinovsky, S. (1974) Advances in the Zoology of Tapeworms 1950–1970.
University of Minnesota Press, Minneapolis, pp. 10–22.
5. Smyth, J.D. (1994) Introduction to Animal Parasitology, 3rd edn. Cambridge University Press,
Cambridge, pp. 277–387.
6. Kassai, T., Cordero del Campillo, M., Euzeby, J., et al. (1988) Standardized nomenclature of animal
parasitic diseases (SNOAPAD). Veterinary Parasitology 29, 299–326.
7. Grove, D.I. (1990) Taenia solium taeniasis and cysticercosis. In: A History of Human Helminthology.
CAB International, Wallingford, UK, pp. 355–383.
8. Verster, A. (1967) Redescription of Taenia solium Linnaeus, 1758 and Taenia saginata Goeze, 1782.
Zeitschrift fuer Parasitenkunde 29, 313–328.
9. Verster, A. (1969) A taxonomic revision of the genus Taenia Linnaeus, 1758. Journal of Veterinary
Research 36, 3–58.
10. Eom, K.S., Rim, H.J. (1993) Morphological descriptions of Taenia asiatica sp. Korean Journal of
Parasitology 31, 1–6.

12 Z.S. Pawlowski
11. Fan, P.C., Chung, W.C. (1998) Taenia saginata asiatica: Epidemiology, infection, and immunological
and molecular studies. Journal of Microbiology, Immunology and Infection 31, 84–89.
12. La Riche, P.D., Sewell, M.M.H. (1978) Differentiation of taeniid cestodes by enzyme electrophoresis.
International Journal of Parasitology 8, 479–483.
13. McManus, D.P. (1990) Characterization of taeniid cestodes by DNA analysis. Revue Scientifique et
Technique 9, 489–510.
14. Rishi, A.K., McManus, D.P. (1988) Molecular cloning of Taenia solium genomic DNA and characteri-
zation of taeniid cestodes by DNA analysis. Parasitology 97, 161–176.
15. Zarlenga, D.S., McManus, D.P., Fan, P.C., et al. (1991) Characterization and detection of a newly
described Asian taeniid using cloned ribosomal DNA fragments and sequence amplification by the
polymerase chain reaction. Experimental Parasitology 72, 174–183.
16. Wilkins, P.P., Allan, J.C., Verastegui, M., et al. (1999) Development of a serologic assay to detect
Taenia solium taeniasis. American Journal of Tropical Medicine and Hygiene 60, 199–204.
17. Chapman, A., Vallejo, V., Mossie, K.G., et al. (1995) Isolation and characterization of species-specific
DNA probes from Taenia solium and Taenia saginata and their use in an egg detection assay. Journal of
Clinical Microbiology 33, 1283–1288.
18. Pawlowski, Z.S. (1982) Taeniasis and cysticercosis. In: Steele, J.H. (ed.) Handbook Series. Zoonoses.
Section C: Parasitic Zoonoses. CRC Press, Boca Raton, Florida Vol. 1, part 2, pp. 313–348.
19. Wang, I.C., Ma, Y.X., Guo, J.X., et al. (1999) Oncospheres of Taenia solium and Taenia saginata asiatica
develop into metacestodes in normal and immunosuppressed mice. Journal of Helminthology 73,
183–186.
20. Pawlowski, Z.S. (1994) Taeniasis and cysticercosis. In: Hui, Y.H., Gorham, J.R., Murrel, K.D., et al.
(eds) Foodborne Disease Handbook. Diseases Caused by Viruses, Parasites and Fungi. Marcel Dekker, New
York, Vol. 2, pp. 199–254.
21. Prevot, R., Hornbostel, H., Dorken, H. (1952) Lokalisations-studien bei Taenia saginata. Klinische
Wochenschrift 30, 78–80.
22. Yoshino, K. (1933) Studies on the postembryonal development of Taenia solium. Part I. On the hatch-
ing of eggs of Taenia solium. Journal of Medical Association of Formosa 32, 139–141 (English summary).
23. Yoshino, K. (1933) Studies on the postembryonal development of Taenia solium. Part II. On the
youngest form of cysticercus cellulosae and on the migratory course of the oncospheres of Taenia
solium within the intermediate host. Journal of Medical Association of Formosa 32, 155–158 (English
summary).
24. Yoshino, K. (1933) Studies on the postembryonal development of Taenia solium. Part III. On the
development of cysticercus cellulosae within the definite intermediate host. Journal of Medical
Association of Formosa 32, 166–169 (English summary).
25. Yoshino, K. (1933) Experimental studies on the formation of the scolex of Taenia solium. Journal of
Medical Association of Formosa 32, 169–171 (English summary).
26. Yoshino, K. (1934) On the subjective symptoms caused by parasitism of Taenia solium and its devel-
opment in man. Journal of Medical Association of Formosa 33, 183–194 (English summary).
27. Hornbostel, H. (1959) Bandwurmprobleme in neuer Sicht. Ferdinand Enke Verlag, Stuttgart, Germany,
pp. 1–59.
28. Laclette, J.P., Ornelas, Y., Merchant, M.T., et al. (1982) Ultrastructure of the surrounding envelopes of
Taenia solium eggs. In: Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of
Knowledge and Perspectives. Academic Press, New York, pp. 375–387.
29. Lawson, J.R., Gemmell, M.A. (1983) Hydatidosis and cysticercosis: the dynamics of transmission.
In: Baker, J.R., Muller, R. (eds) Advances in Parasitology. Academic Press, London, Vol. 22,
pp. 262–308.
30. Gemmell, M.A., Johnstone, P.D. (1976) Factors regulating tapeworm populations: dispersion of eggs
of Taenia hydatigena on pasture. Annals of Tropical Medicine and Parasitology 70, 431.
31. Gemmell, M, Lawson, J.R., Roberts, M.G. (1987) Population dynamics in echinococcosis and cys-
ticercosis: evaluation of the biological parameters of Taenia hydatigena and T. ovis and comparison
with those of Echinococcus granulosus. Parasitology 94, 161–180.
32. Gemmell, M.A., Lawson, J.R. (1989) The ovine cysticercosis as models for research into the epidemi-
ology and control of the human and porcine cysticercosis Taenia solium. I. Epidemiological consider-
ations. Acta Leidensia 57, 165–172.
33. Gemmell, M.A., Johnstone, P.D., Boswell, C.C. (1978) Factors regulating tapeworm population dis-
persion patterns of Taenia hydatigena eggs on pasture. Research in Veterinary Science 24, 334–338.

34. Gemmel, M.A., Lawson, J.R. (1982) Ovine cysticercosis: an epidemiological model for the cysticer-
cosies II. Host immunity and regulation of the parasite population. In: Flisser, A., Willms, K.,
Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New
York, pp. 647–660.
35. Lonc, E. (1980) The possible role of the soil fauna in the epizootiology of cysticercosis in cattle. I.
Earthworms, II. Dung beetles – the biotic factor in a transmission of Taenia saginata eggs. Angewandte
Parasitologie 21, 133–138, and 139–144
36. Bon, E.R., Merchant, M.T., Gonzalez-del Pliego, M., et al. (1982) Ultrastructre of the bladder wall of
the metacestode of Taenia solium. In: Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis:
Present State of Knowledge and Perspectives. Academic Press, New York, pp. 261–280.
37. Goennert, R., Meister, G., Strufe, R., et al. (1967) Biologische Probleme bei Taenia solium. Journal of
Tropical Medicine and Parasitology 18, 76–81.
38. Schantz, P.M., Wilkins, P.P., Tsang, V.C.W. (1998) Immigrants, imaging, and immunoblots: the emer-
gence of neurocysticercosis as a significant public health problem. In: Scheld, W.M., Craig, W.A.,
Hughes, J.M. (eds) Emerging Infections. ASM Press, Washington, DC, pp. 213–242.
39. Pawlowski, Z., Schultz, M.G. (1972) Taeniasis and cysticercosis (Taenia saginata). Advances in
40. Pawlowski, Z. (1991) Control of Taenia solium taeniasis and cysticercosis by focus oriented
chemotherapy of taeniasis. Southeast Asian Journal of Tropical Medicine and Public Health 22, 284–286.
41. The Cysticercosis Working Group in Peru (1993) The marketing of cysticercotic pigs in the Sierra of
Peru. Bulletin of the World Health Organization 71, 223–228.
42. Pawlowski, Z.S. (1990) Perspectives on the control of Taenia solium. Parasitology Today 6, 371–373.
43. Cruz, M., Davis, A., Dixon, H., et al. (1989) Operational studies on the control of Taenia solium taenia-
sis/cysticercosis in Ecuador. Bulletin of the World Health Organization 67, 401–407.
44. Craig, P.S., Rogan, M.T., Allan, J.C. (1996) Detection, screening and community epidemiology of
taeniid cestode zoonoses: cystic echinococcosis, alveolar echinococcosis and neurocysticercosis.
Advances in Parasitology 38, 169–250.
45. Centers for Disease Control and Prevention (1993) Recommendations of the International Task Force
for Disease Eradication. Mortality and Morbidity Weekly Report 42, 1–27.
46. Fan, P.C. (1988) Taiwan Taenia and taeniasis. Parasitology Today 4, 86–88.
47. Faust, E.C., Russell, P.F., Jung, R.C. (1974) Clinical Parasitology. Lea and Fibiger, Philadelphia, USA.

2 Taenia solium Cysticercosis: New and

Revisited Immunological Aspects
Ana Flisser, Dolores Correa and Carlton A.W. Evans
Introduction with disease pathogenesis. Living cysticerci

may cause an asymptomatic infection
It has taken almost 25 years to unravel and through active evasion and suppression of
understand some of the characteristics and immunity. Histological studies have shown
mechanisms of the immune response elicited that both in humans and pigs, live, viable cys-
against Taenia solium cysticercus within the ticerci have little or no surrounding inflam-
human host. Some of these are presently quite mation. Cysticerci may persist in the human
clear, for instance, the heterogeneity of the host for long periods of time, often for years
humoral immune response, the existence of without eliciting surrounding host inflamma-
immune evasive mechanisms and the fact tory reaction. In contrast, the immune medi-
that the immune response can both protect ated inflammation around one or more
and harm the host, as demonstrated in several degenerating cysts may precipitate sympto-
studies performed in animals. Others are still matic disease. When the parasite begins to
at the stage of requiring precise identification, involute, either naturally or after treatment
such as the type and interactions of the com- with anticysticercal drugs, a surrounding
ponents of the cellular immune response, granulomatous inflammatory response devel-
with specific reference to cytokines that may ops both in human and porcine infections.
play important roles in different stages of the Predominant components of this inflamma-
host–parasite relationship. Four different tory response include plasma cells, lympho-
aspects of the immunology of human T. cytes, eosinophils and macrophages. The
solium cysticercosis are discussed in this chap- latter engulf parasite remnants, eventually
ter: (i) components and characteristics of the leaving a gliotic scar with calcification.
immune response; (ii) evasion of the host Several correlative clinical, neuroimaging,
immune response by the parasites; (iii) neuro- immunological and histopathological studies
cysticercosis (NC) and neoplasia; and (iv) pro- have amply demonstrated that symptomatic
tective immunity induced against T. solium. human cysticercosis corresponds to the pres-
ence of tissue inflammation around involut-
ing cysticerci that are transiting between the
Components and Characteristics of live, viable stage and the calcified stage1–5.
the Immune Response to T. solium The host immunological response to cysticerci
Cysticercosis is becoming more and more complicated as
more knowledge is accumulating. Broadly it
The immunology of NC is particularly impor- can be divided into humoral and cellular
tant because of its paradoxical relationship components, outlined below.


16 A. Flisser et al.
Humoral immune response be proportional to the intensity and dura-

tion of infection. In human cysticercosis, dif-
The humoral immune response is better ferences were also found between benign
understood than the cellular one. The fact and malignant cysticercosis, for instance,
that humans respond immunologically to cysticercotic encephalitis is very immuno-
antigens of T. solium cysticerci is well evi- genic6,9,16. Thus, the humoral immune
dent from the number of immunodiagnostic response in patients with NC is quite hetero-
assays that have been developed using dif- geneous. Its heterogeneity is also evident
ferent types of antigens6,7. Several from the number of antigens recognized:
immunoglobulin (Ig) classes are produced patients’ antibodies may react with one to
as specific antibodies against the parasite. eight antigens in immunoelectrophoresis
The most frequent is IgG, which can be and up to 30 antigens in EITB3,22,23.
detected in serum, cerebrospinal fluid (CSF)
and saliva and suggests that infection is of
long duration8–15. An interesting aspect of Cellular immune response
the humoral immune response is its com-
partmentalization; there is evidence for local Some of the earlier studies that evaluated
synthesis of specific IgG antibodies within cellular immune responses in hospitalized
the brain and the presence of a given anti- patients with NC under corticosteroid treat-
body class in one compartment (i.e. CSF or ment reported low proliferation of periph-
serum) and its absence in the other compart- eral blood mononuclear cells after
ments11,16–21. Those cases where both CSF stimulation with mitogens and high propor-
and serum samples were obtained from the tions of CD8+ cells22,24. These initial studies
same patient and were positive only in one, generated the belief that cellular responses
suggest that the blood–brain barrier is not were impaired in NC. On the contrary, a
always damaged by the parasite. On the recent study that compared immune
other hand, seemingly there is a correlation responses in individuals with active,
between the presence of antibodies and the untreated NC with paired controls, showed
intensity of infection1. Enzyme-linked that most patients responded adequately to
immunoelectrotransfer blot (EITB) detected concanavalin A and to cysticercus antigens;
only 28% of cases with a single cysticercus also, CD4+ and CD8+ counts were not signif-
compared with 94% of those with two or icantly different from those of controls25.
more cysts. Furthermore, antibodies were Precise patterns and pathways of the cellular
found in most cases that had live or involut- responses in human NC are still under study
ing parasites, but only in few cases with cal- and until recently, no clear hypothesis was
cified cysts, thereby suggesting that the available before demonstration of the
presence of antibodies is influenced by the Th1/Th2 duality of the T-helper-cell
evolutionary stage of the parasite. Similarly, response (Fig. 2.1)26*. Precise molecular
in pigs, antibody responses were found to mechanisms underlying Th1 and Th2
*T cells are of the following two types: helper (Th, CD3+/CD4+) and cytotoxic (CTL, CD3+/CD8+). The
former produce molecules that regulate the immune response, while the latter lyse histocompatible infected
or transformed cells (Fig. 2.1). The type of response elicited by Th cells depends on the subtype they transform
themselves to after antigen priming, i.e. Th1 or Th2. The two responses are becoming increasingly difficult to
understand as knowledge about them accumulates. Nevertheless, it can generally be said that Th1 cells
produce cytokines [including tumour necrosis factor- (TNF-) and interferon-gamma (IFN-)] that promote
inflammation, macrophage activation, and intracellular destruction of infectious agents; they also stimulate
proliferation of CD8+ cells. Thus, this response is primarily ‘cellular’. On the other hand, Th2 cells stimulate
most of the antibody responses, as well as granulocyte proliferation, differentiation and chemotaxis. The
major cytokines produced by the Th2 cells are interleukin-4 (IL-4), IL-5, IL-10 and IL-13. This type of response
is primarily ‘humoral’. Each response reciprocally down-regulates the other, for instance, IFN- stimulates the
Th1 response and inhibits Th2, while IL-4 promotes Th2 response and down-regulates Th1 response.

Cytotoxic
cell
Singh - Chap 02
CD8+
4/9/02
CTL
CD8+
Antigens
MHC class I TNF-

4:37 pm
IFN-
Macrophage
IL-15 activation
Antigen- IL-12
presenting
cell (APC) Th1
Page 17
CD4+
MHC class II
Th0
CD4+
T helper
cells
IL-4 IL-4
Antibodies
Th2 IL-5
CD4+ IL-6 IgM
IL-13 IgG
New and Revisited Immunological Aspects
IgA
B cell IgE
Plasma cell
17
Fig. 2.1. Diagrammatic overview of the Th1 and Th2 host immune responses.
immune responses to natural and experi- anticysticercal treatment and after vaccina-
mental cysticercosis are yet to be clarified. tion35,36. This suggests that eosinophils may
Studies so far have addressed molecular play an important role in the degenerative
components in the CSF, serum and the gran- phase in this parasitic infection. Another
uloma itself. Increased levels of interleukin study showed that IL-2 was synthesized by
(IL)-1 and IL-6 have been reported in CSF of the peripheral blood cells of 58% of individu-
patients with inflammatory NC27. High lev- als with untreated, recently diagnosed NC,
els of IL-6 in CSF of patients with subarach- while interferon- (IFN-), IL-4 and IL-10,
noid NC have also been reported; this were only found in 11%, 10% and 14%,
possibly represents an acute phase response. respectively25. Interestingly, only IFN- was
In addition, high levels of tumour necrosis increased in the group of patients as com-
factor-alpha (TNF-alpha) have also been pared to controls.
noted in CSF of children with active NC28. The macroscopic disappearance of killed
TNF-alpha was undetectable in controls and cysticerci takes about 2 months, but the
children with inactive NC. immunological processes that occur within
In asymptomatic humans, a single low the involuting granulomas are poorly under-
dose of the taeniacidal drug praziquantel, stood. Very few immunohistochemical stud-
given to treat intestinal parasites may cause ies of the inflammatory response within
sufficient damage to latent asymptomatic cysticercus granulomas located in the human
cysticerci that inflammation and seizures central nervous system have been performed,
result29. Similarly, full dose anticysticercal mainly due to limited specimen tissue37,38.
therapy administered in heavy infections Available reports suggest an intermixture of
has precipitated fatal cerebral inflamma- Th1 and Th2 responses in human brain cys-
tion30,31. An immunological study of NC ticercus granulomas. Observations made in
patients treated with praziquantel (without animals are of interest in understanding the
major adverse effects) reported elevated sol- complex phenomena that occur in granulo-
uble IL-2 in the CSF suggesting a Th1-type mas within the central nervous system.
immune response to therapy, in contrast Destruction of parasites in the natural inter-
with the Th2-type immune response found mediate host, the pig, is mediated by a gran-
in animal models of viable cysticerci32. It ulomatous eosinophil-rich inflammation
was therefore hypothesized that living cys- (driven by the Th2 response), followed by
ticerci facilitate immune evasion by induc- macrophage/lymphocyte-driven resolution
ing a Th2-type immune response until the (involving the Th1 response)35. In apparent
death of the larval parasite allows a Th1- discordance, a Th1 response prevails in
mediated inflammatory response to ‘early’ granulomas, that is, when metaces-
develop. This model however, is not consis- todes are intact in a rodent model of cysticer-
tent with some of the other findings listed cosis (T. crassiceps in mice)39. In the same
above and it seems likely that the regulation model, ‘late’ granulomas, wherein parasite
of immunity in T. solium cysticercosis is a destruction is complete, exhibit a mixture of
complex phenomenon. Th1 and Th2 cytokines (IL-4). It would seem
Increased levels of eotaxin and IL-5, both then that if the first antibody–complement
eosinophil-selective mediators, have been phenomenon does not destroy the onco-
found in the sera of patients with NC33. sphere, the latter develops into a metaces-
These cytokines are involved in recruiting tode, giving rise to a host–parasite
eosinophils locally as well as systemically. relationship that, while in equilibrium, has a
Interestingly, in the mouse model of more ‘silent’ Th1-like pattern (i.e. IL-2), with
Angiostrongylus cantonensis infection, abla- concomitant presence of antibodies mostly of
tion of IL-5 activity with anti-IL-5 mono- the IgG class. When this equilibrium is bro-
clonal antibody resulted in more severe ken, a pro-inflammatory granulomatous
intracranial disease34. Furthermore, the pres- Th2-like process provokes parasite destruc-
ence of eosinophils as the first attack cells tion. This would be followed by resolution of
was reported in porcine cysticercosis after the inflammatory reaction induced by Th1

New and Revisited Immunological Aspects 19
cytokines (i.e. macrophages/lymphocytes). Masking of cysticercal antigens by host

The change from ‘equilibrium’ to ‘destruc- Igs
tion’ has been demonstrated in cysticercal
granulomas in naturally infected pigs35,36. Cysts obtained from brain, eye and muscle of
patients with cysticercosis have demonstrable
IgG, IgM, IgA and IgE on their surface, while
Evasion of Host Immune Responses specific antibodies of these classes, except for
by Parasites IgG, have not been detected in the surround-
ing fluids45. Morphologically intact cysticerci
One of the most interesting phenomena in excised from pigs also present host Ig on their
immunoparasitology is the evasion of host surface46. These results suggest that living
immune responses by the parasite. As parasites mask themselves with host Igs,
alluded to earlier, cysticerci are capable of probably through Fc receptors on the surface
surviving in the human host for several of the tegument, which could play a role in
years before their degeneration sets in. Live, the process of Ig endocytosis4750.
viable cysticerci are associated with little sur-
rounding inflammation. This allows for the
maintenance of a host–parasite equilibrium Concomitant immunity
as a result of which the parasite is able to
survive in the host for long periods of time. Concomitant immunity refers to protection
The mechanisms underlying this process are conferred by already established parasites
complex and may involve the following40–42. against newly invading parasites of the same
species in a given host. Concomitant immu-
nity may result from ‘shifts’ in the expressed
Survival of parasites lodged in antigens as parasites develop through their
‘immunologically privileged sites’ life cycle. Hence, during initial infection, cys-
ticerci may be able to counteract immune
After a brief period of migration, T. solium effector mechanisms that kill less developed
oncospheres lodge in host tissues and trans- forms. Experimental studies in the porcine
form into cysticerci. The site where they set- model of cysticercosis have shown that rein-
tle and the nature of their relationship to the fection following a challenge with T. solium
encapsulating host may contribute to seques- eggs results in the partial destruction of estab-
tration of the parasites from immune attack. lished cysticerci rather than establishment of
The unequal distribution of cysticerci additional tissue cysts51. This implies that
throughout body tissues does not mirror prior infection protects against new infection.
regional blood flow but may result from It may be surmised that this protective effect
selective invasion by the parasite or differen- results from ‘shifts’ in the antigens expressed
tial survival of larvae in ‘immunologically by parasites through different stages of their
privileged sites’43. For example, an experi- development in the host. Hence, fully devel-
mental model of intraocular T. crassiceps cys- oped cysticerci may express different antigens
ticercosis, where the parasite is maintained that are able to withstand host immune
with ease in the anterior chamber of the eye, responses more effectively than developing
has demonstrated that there is little inflam- cysticerci. It is known that after 1 week of
matory response to the parasite in that loca- infection, the surface of parasites, previously
tion44. Similarly, experimental chemotherapy covered by microvilli, changes to
studies in pigs showed that parasites lodged microtriches52 and that surface antigens
within the brain remained alive longer after change during development in Hymenolepis
anticysticercal treatment than those located nana53. Concomitant immunity may explain
in the muscles35. These studies indicate that the lack of overwhelming cysticercosis in
in naive hosts, cysticerci may develop or per- hyperendemic regions, since animals may
sist better in the eye and the brain, as com- only be able to acquire cysticercosis for 1 or 2
pared to other tissues or organs. weeks after primary exposure54.

Molecular mimicry and in healthy controls69,70. Also, 17% of 43

patients with glioma but only 3% of 172 con-
Parasites may evade immune recognition by trols had NC65. Whether these chromosomal
synthesizing host-like antigenic determi- alterations in lymphocytes or increased
nants. Immunoglobulin G on the surface of cytokine synthesis are responsible for the
T. solium cysticerci does not show specificity establishment of neoplasia is not clear. Even
for antigens on the cysticercus55. The possi- though, as mentioned in the earlier sections
bility that it is synthesized by the parasite of this chapter, cysticerci do not seem to
was tested in vitro by translation of parasite- induce a generalized immune suppression,
derived messenger-RNA55. Though not ade- since patients produce antibodies, inflamma-
quately proven, molecular mimicry, i.e. tory reaction, and cytokines, have normal
synthesis of host-like antigens by the para- white cell counts and generally good state of
site, may be one the mechanisms involved in health and their immune cells respond in
immune evasion. vitro to parasite antigens and mitogens.
Suppression or deviation of the host Protective Mechanisms against

responses T. solium Cysticercosis
The presence of anti-complementary activity Since there are many Taenia species that
described long ago suggested that the classi- infect mammals, there are numerous studies
cal and the alternative pathways of the com-
in rodents, ovine and bovines which demon-
plement cascade are inhibited by cysticerci56.
strate that it is possible to acquire protection
Paramyosin (previously known as antigen B)
against cysticercosis by vaccination. In most
was shown to bind and inhibit C1q, the first
studies, crude antigens have been obtained
component of the complement cascade57.
from oncospheres, cysticerci or tape-
Since this antigen is being released by cys-
worms59,71. These studies have been rela-
ticerci and due to the fact that it is recog-
tively easy to perform since the different
nized by antibodies of most patients with
NC, it could have a dual role in immune eva- stages of the parasite (cysticerci and tape-
sion: inhibition of C1q and deviation of anti- worms) can develop in animals. Various
bodies to host tissues7,11,57,58. There are degrees of protection have been reported,
several reports of the presence of immuno- living oncospheres and oncospheral antigens
suppressive factors in extracts prepared from being the most effective immunogens59,71.
metacestodes of various Taenia species, Recombinant proteins and DNA vaccines
which inhibit proliferation of lymphocytes have yielded high degrees of immunity72–78.
against mitogens, or the synthesis of IL- The reader is referred to a detailed discus-
259–64, that are reviewed by Molinari and Tato sion of this aspect in Chapter 42.
in Chapter 3.
Conclusions
NC and Neoplasia
It is known that antibodies and complement
A recent analysis of autopsy files suggested are protective against T. solium oncospheres
that NC might be a risk factor for human (Fig. 2.2), but if the pace of the host immune
cancer, specifically of the lymphoid response is slow, then the parasites develop
tissues65–68. Several data support this mechanisms to evade the latter. As a result,
hypothesis. Chromosome aberrations in metacestodes establish and antibodies and
peripheral blood lymphocytes are more com- complement are no longer effective in
mon in patients with NC and in cysticercotic destroying them. Thus, a race between
pigs as compared to those observed in the development of protective immune mecha-
same cases after anticysticercal treatment nisms by the host and evasive mechanisms

Phase II. Viable cysticerci and concomitant IR.

5 Immune evasion?
3 Phase III.
Resolution.
IR
Phase I: Oncosphere and Immunotherapy?

developing immune
2 response (IR).
Vaccination?
0
0 5 10 15 20
Infection time
Fig. 2.2. Phases of cysticercosis in relation to immune response. The initial Phase I is characterized by
the development of immune mediated protective mechanisms in the host and the differentiation of the
oncosphere into a metacestode. Phase II is a period during which the parasite and the host coexist due
to the development of immune evasive mechanisms by the parasite. Finally, in Phase III, the
host–parasite equilibrium is broken and the parasite is destroyed by an immune reaction that sometimes
even damages the host. This final phase leads to resolution of the infection.
by the parasite occurs during the initial probably chemo-attracted to the site by
period of infection. Subsequently, an equili- lymphoid cells. It is surmised that this spe-
brated host–parasite relationship develops cific response is mediated by Th2 cytokines.
that may last for long periods of time and Finally, an intense granulomatous type of
maintains concomitant immunity. The inflammatory reaction occurs that leads to
immune response against T. solium cys- complete parasite destruction and resolu-
ticerci appears to have both Th1 and Th2 tion with fibrosis. This last mechanism is
components, although their precise roles probably of the Th1-type. Thus, it seems
remain controversial. Through not yet that the Th1 and Th2 cytokines play differ-
understood mechanisms, the parasite is ent roles during various stages of the
killed primarily by eosinophils, which are host–parasite relationship.
References
1. Correa, D., Medina-Escutia, E. (1999) Host–parasite immune relationship in Taenia solium taeniosis
and cysticercosis. In: García, H.H., Martínez, S.M. (eds) Taenia solium Taeniasis/Cisticercosis, 2nd
edn. Editorial Universo, Lima, Perú, pp. 15–24.
2. de Aluja, A., Vargas, G. (1988) The histopathology of porcine cysticercosis. Veterinary Parasitology 28,
65–77.
3. Flisser, A. (1994) Taeniasis and cysticercosis due to Taenia solium. In: Sun, T. (ed) Progress in Clinical
Parasitology. CRC Press, Boca Raton, Florida, pp. 77–116.
4. Sciutto, E., Fragoso, G., Fleury, A., et al. (2000) Taenia solium disease in humans and pigs: an ancient
parasitosis disease rooted in developing countries and emerging as a major health problem of
global dimensions. Microbes and Infection 2, 1875–1890.

5. Willms, K., Sotelo, J. (2001) Cestodes. In: Gillespie, S., Pearson R.D. (eds) Principles and Practice of
Clinical Parasitology. John Wiley & Sons, New York, pp. 613–633.
6. Flisser, A., Larralde, C. (1986) Cysticercosis. In: Walls, K.W., Schantz, P.M. (eds) Immunodiagnosis of
Parasitic Diseases. Academic Press, New York, pp. 109–161.
7. Flisser, A., Woodhouse, E., Larralde, C. (1980) Human cysticercosis: antigens, antibodies and non-
responders. Clinical and Experimental Immunology 39, 27–37.
8. Grogl, M., Estrada, J.J., MacDonald, G., et al. (1985) Antigen–antibody analyses in neurocysticerco-
sis. Journal of Parasitology 71, 433–442.
9. Cho, S.Y., Kim, S.I., Kang, S.Y., et al. (1986) Evaluation of enzyme-linked immunosorbent assay in
serological diagnosis of human neurocysticercosis using paired samples of serum and cerebrospinal
fluid. Korean Journal of Parasitology 24, 25–41.
10. Corona, T., Pascoe, D., Gonzalez-Barranco, D., et al. (1986) Anticysticercus antibodies in serum and
cerebrospinal fluid in patients with cerebral cysticercosis. Journal of Neurology, Neurosurgery and
Psychiatry 49, 1044–1049.
11. Espinoza, B., Ruiz-Palacios, G., Tovar, A., et al. (1986) Characterization by enzyme linked
immunosorbent assay of the humoral immune response in patients with neurocysticercosis and its
application in immunodiagnosis. Journal of Clinical Microbiology 24, 536–541.
12. Feldman, M., Plancarte, A., Sandoval, M., et al. (1990) Comparison of two assays (EIA and EITB) and
two samples (saliva and serum) for the diagnosis of neurocysticercosis. Transactions of the Royal
Society of Tropical Medicine and Hygiene 84, 559–562.
13. Zini, D., Farrell, V.J.R., Wadee, A.A. (1990) The relationship of antibody levels to the clinical spec-
trum of human neurocysticercosis. Journal of Neurology, Neurosurgery and Psychiatry 53, 656–661.
14. Short, J.A., Heiner, D.C., Hsiao, R.L., et al. (1991) Immunoglobulin E and G4 antibodies in cysticerco-
sis. Journal of Clinical Microbiology 28, 1635–1639.
15. Spina-Franca, A., Livramento, J.A. (1982) Cerebrospinal fluid immunology in neurocysticercosis.
European Review of Medicine and Pharmacological Science 4, 385–388.
16. Miller, B.L., Heiner, D., Golderg, M.A. (1983) The immunology of cerebral cysticercosis. Bulletin of
Clinical Neurosciences 48, 18–23.
17. Pammenter, M.D., Rossouw, E.J., Epstein, S.R. (1987) Diagnosis of neurocysticercosis by enzyme-
linked immunosorbent assay. South African Medical Journal 71, 512–514.
18. Cho, S.Y., Kim, S.I., Kang, S.Y., et al. (1988) Intracranial synthesis of specific IgG antibody in cere-
brospinal fluid of neurocysticercosis patients. Korean Journal of Parasitology 26, 15–26.
19. Correa, D., Plancarte, A., Sandoval, M.A., et al. (1989) Immunodiagnosis of human and porcine cys-
ticercosis. Detection of antibodies and parasite products. Acta Leidensia 57, 93–100.
20. Estañol, B., Juarez, H., Irigoyen, M.C., et al. (1989) Humoral immune response in patients with cere-
bral parenchymal cysticercosis treated with praziquantel. Journal of Neurology, Neurosurgery and
21. Bueno, E.C., Vaz, A.J., Machado, L.R., et al. (2000) Total IgE detection in paired cerebrospinal fluid
and serum samples from patients with neurocysticercosis. Revista do Instituto de Medicina Tropical de
São Paulo (Sao Pãulo) 42, 67–70.
22. Flisser, A., Rivera, L., Trueba, J., et al. (1982) Immunology of human neurocysticercosis. In: Flisser,
A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives.
Academic Press, New York, pp. 549–563.
23. Larralde, C., Montoya, R.M., Sciutto, E., et al. (1989) Deciphering western blots of tapeworm in anti-
gens. Taenia solium, Echinococcus granulosus and Taenia crassiceps resolving with sera from neurocys-
ticercosis and hydatid disease patients. American Journal of Tropical Medicine and Hygiene 40, 282–290.
24. Correa, D., Tovar, A., Espinoza, B., et al. (1989) Cisticercosis humana: relación inmunológica
huésped-parásito. In: Flisser, A., Malagon, F. (eds) Cisticercosis Humana y Porcina. Su Conocimiento e
Investigacion en Mexico. Limusa-Noriega, Mexico DF, Mexico, pp. 31–43.
25. Medina-Escutia, E., Morales-López, Z., Proaño, J.V., et al. (2001) Cellular immune response and
Th1/Th2 cytokines in human neurocysticercosis: lack of immune suppression. Parasitology 87,
587–590.
26. Mosmann, T.R., Coffman, R.L. (1989) Th1 and Th2 cells: different patterns of lymphokine secretion
lead to different functional properties. Annual Review of Immunology 7, 145–173.
27. Ostrosky-Zeichner, L., García-Mendoza, E., Ríos, C., et al. (1996) Humoral and cellular immune
response within the subarachnoid space of patients with neurocysticercosis. Archives of Medical
Research 27, 513–517.

28. Aguilar-Robolledo, F., Cedillo-Rivera, R., Llaguno-Violante, P., et al. (2001) Interleukin levels in cere-
brospinal fluid from children with neurocysticercosis. American Journal of Tropical Medicine and
Hygiene 64, 35–40.
29. Flisser, A., Madrazo, I., Plancarte, A., et al. (1993) Neurological symptoms in occult neurocysticerco-
sis after a single taeniacidal dose of praziquantel. Lancet 342, 748.
30. Wadia, N., Desai, S., Bhatt, M. (1988) Disseminated cysticercosis: new observations, including CT
scan findings and experience with treatment by praziquantel. Brain 111, 597–614.
31. Takayanagui, O.M., Chimelli, L.L. (1998) Disseminated muscular cysticercosis with myositis
induced by praziquantel therapy. American Journal of Tropical Medicine and Hygiene 59, 1002–1003.
32. Cruz-Revilla, C., Rosas, G., Fragoso, G., et al. (2000) Taenia crassiceps cysticercosis: protective effect
and immune response elicited by DNA immunization. Journal of Parasitology 86, 67–74.
33. Evans, C.A.W., García, H.H., Hartnell, A., et al. (1998) Elevated concentration of eotaxin and inter-
leukin-5 in human neurocysticercosis. Infections and Immunity 66, 4522–4525.
34. Sasaki, O., Suguya, H., Ishida, K., et al. (1993) Ablation of eosinophils with anti IL-5 antibody
enhances the survival of intracranial worms of Angiostrongylus cantonensis in the mouse. Parasite
Immunology 15, 349–354.
35. Flisser, A., Gonzalez, D., Skhurovich, M., et al. (1990) Praziquantel treatment of porcine brain and
muscle Taenia solium cysticercosis. 1. Radiological, physiological and histopathological studies.
Parasitology Research 76, 263–269.
36. Molinari, J.L., Meza, R., Suarez, B., et al. (1983) Taenia solium: immunity in hogs to the cysticercus.
Experimental Parasitology 55, 340–357.
37. Restrepo, B., Llaguno, P., Sandoval, M.A., et al. (1998) Analysis of immune lesions in neurocysticer-
cosis patients: central nervous system response to helminth appears Th1-like instead of Th2. Journal
of Neuroimmunology 89, 64–72.
38. Restrepo, B.I., Alvarez, J.I., Castano, L.F., et al. (2001) Brain granulomas in neurocysticercosis are
associated with a Th1 and Th2 profile. Infections and Immunity 69, 4554–4560.
39. Robinson, P., Altamar, R., Lewis, D., et al. (1997) Granuloma cytokines in murine cysticercosis.
Infections and Immunity 65, 2925–2931.
40. Mitchell, G.F. (1982) Genetic variation in resistance of mice to Taenia taeniaeformis: analysis of host-
protective immunity and immune evasion. In: Flisser, A., Willms, K., Laclette, J.P., et al. (eds)
Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp. 575–584.
41. Flisser, A. (1989) Taenia solium cysticercosis: some mechanisms of parasite survival in immunocom-
petent hosts. Acta Leidensia 57, 259–263.
42. White, A.C. Jr, Robinson, P., Kuhn, R. (1997) Taenia solium cysticercosis: host–parasite interaction and
the immune response. Clinical Immunology 66, 209–230.
43. Barker, C.F., Billingham, R.E. (1977) Immunologically privileged sites. In: Kunkel, H.G., Dixon, F.J.
(eds) Advances in Immunology, Vol. 25. Academic Press, New York, pp. 1–54.
44. Cárdenas, F., Plancarte, A., Quiroz, H., et al. (1989) Taenia crassiceps: experimental model of intraocu-
lar cysticercosis. Experimental Parasitology 69, 324–329.
45. Correa, D., Dalma, D., Espinoza, B., et al. (1985) Heterogeneity of humoral immune components in
human cysticercosis. Journal of Parasitology 71, 535–541.
46. Willms, K., Arcos, L. (1977) Taenia solium: host serum proteins on the cysticercus surface identified
by an ultrastructural immuno-enzyme technique. Experimental Parasitology 43, 396–401.
47. Mandujano, A., Vela, M., Alcántara, P., et al. (1990) Presence of a receptor for the Fc fraction of IgG in
Taenia solium (Abstract). Bulletin de la Societie de la Socièté Française Parasitologie 8 (Suppl. 1), 578.
48. Kalinna, B., MacManus, D.P. (1993) An IgG (Fc gamma)-binding protein of Taenia crassiceps
(Cestoda) exhibits sequence homology and antigenic similarity with schistosome paramyosin.
49. Hayunga, E.G., Sumner, M.P., Letonja, T. (1989) Evidence of selective incorporation of host
immunoglobulin by strobilocerci of Taenia taeniaeformis. Journal of Parasitology 75, 638–642.
50. Ambrosio, J., Landa, A., Merchant, M.T., et al. (1994) Protein uptake by cysticerci of Taenia crassiceps.
Archives of Medical Research 25, 325–330.
51. Herbert, I.V., Oberg, C. (1974) Cysticercosis in pigs due to infection with Taenia solium Linnaeus,
1758. In: Soulsby, E.J.L. (ed.) Parasitic Zoonosis. Academic Press, New York, pp. 199–211.
52. Williams, J.F., Engelkirk, P.G., Lindsay, M.C. (1982) Mechanisms of immunity in rodent cysticercosis.
In: Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and
Perspectives. Academic Press, New York, pp. 621–631.
53. Ito, A., Onitake, K. (1987) Changes in surface antigens of Hymenolepis nana during differentiation
and maturation in mice. Journal of Helminthology 61, 129–136.

54. Gemmell, M.A. (1972) Hydatidosis and cysticercosis 4. Acquired resistance to Taenia hydatigena
under conditions of a strong infection pressure. Australian Veterinary Journal 48, 26–28.
55. Willms, K., Arcos, L. (1997) Taenia solium cysticercosis: host–parasite interactions and the immune
response. Clinical Immunology 66, 209–230.
56. Hammemberg, B., Williams, J.F. (1978) Physico-chemical characterization of complement-interacting
factors from Taenia taeniaeformis. Journal of Immunology 120, 1039–1045.
57. Laclette, J.P., Shoemaker, C., Richter, D., et al. (1992) Paramyosin inhibits complement C1. Journal of
58. Laclette, J.P., Merchant, M.T., Willms, K. (1987) Histological and ultrastructural localization of anti-
gen B in the metacestode of Taenia solium. Journal of Parasitology 73, 121–125.
59. Flisser, A., Pérez-Montford, R., Larralde, C. (1979) The immunology of human and animal cysticer-
cosis: a review. Bulletin of the World Health Organization 57, 839–856.
60. Burger, C.J., Rikihisa, Y., Lin, Y.C. (1986) Taenia taeniaeformis inhibition of mitogen induced prolifera-
tion and interleukin-2 production in rat splenocytes by larval in vitro products. Experimental
61. Molinari, J.L., Tato, P., Reynoso, O.A., et al. (1990) Depressive effect of a Taenia solium cysticercus fac-
tor on cultured human lymphocytes stimulated with phytohemaglutinin. Annals of Tropical Medicine
and Parasitology 84, 205–208.
62. Sciutto, E., Fragoso, G., Baca, M., et al. (1995) Depressed T cell proliferation associated with suscepti-
bility to experimental infection with Taenia crassiceps infection. Infections and Immunology 63,
2277–2281.
63. Tato, P., Castro, A.M., Rodríguez, D., et al. (1995) Suppression of murine lymphocyte proliferation
induced by a small RNA purified from the Taenia solium metacestode. Parasitology Research 81,
181–187.
64. Arechavaleta, F., Molinari, J.L., Tato, P. (1998) A Taenia solium metacestode factor non-specifically
inhibits cytokine production. Parasitology Research 84, 117–122.
65. Del Brutto, O.H., Castillo, P.R., Mena, I.X., et al. (1997) Neurocysticercosis among patients with cere-
bral glioma. Archives of Neurology 54, 1125–1128.
66. Herrera, L.A., Benita-Bordes, A., Sotelo, J., et al. (1999) Possible relationship between neurocysticer-
cosis and hematological malignancies. Archives of Medical Research 30, 154–158.
67. Herrera, L.A., Ostrosky-Wegman, P. (2001) Do helminths play a role in carcinogenesis? Trends in
68. Herrera, L.A., Ramírez, T., Rodríguez, U., et al. (2000) Possible association between Taenia solium cys-
ticercosis and cancer: increased frequency of DNA damage in peripheral lymphocytes from neuro-
cysticercosis patients. Transactions of the Royal Society of Tropical Medicine and Hygiene 94, 1–5.
69. Montero, R., Flisser, A., Madrazo, I., et al. (1994) Mutation at the HPRT locus in patients with neuro-
cysticercosis treated with praziquantel. Mutation Research 305, 181–188.
70. Flisser, A., González, D., Plancarte, A., et al. (1990) Praziquantel treatment of brain and muscle
porcine Taenia solium cysticercosis. 2. Immunological and cytogenetic studies. Parasitology Research
76, 640–642.
71. Lightowlers, M.W. (1994) Vaccination against animal parasites. Veterinary Parasitology 54, 177–204.
72. Johnson, K.S., Harrison, G.B.L., Lightowlers, M.W., et al. (1989) Vaccination against ovine cysticerco-
sis using a defined recombinant antigen. Nature 338, 585–587.
73. Mitchel, G.F. (1990) Vaccines and vaccination strategies against helminths. In: Agabian, N., Cerami,
A. (eds) Parasites. Molecular Biology, Drug and Vaccine Design, Wiley-Liss Publications, New York,
pp. 349–363.
74. Harrison, G.B.L., Heath, D.D., Dempster, R.P., et al. (1996) Identification and cDNA cloning of two
novel low molecular weight host-protective antigens from Taenia ovis oncospheres. International
Journal of Parasitology 26, 195–204.
75. Lightowlers, M.W., Rolfe, R., Gaucci, C.G. (1996) Taenia saginata: vaccination against cysticercosis in
cattle with recombinant oncosphere antigens. Experimental Parasitology 84, 330–338.
76. Rosas, G., Cruz-Revilla, G., Fragoso, G., et al. (1998) Taenia crassiceps cysticercosis: humoral immune
response and protection elicited by DNA immunization. Journal of Parasitology 84, 516–523.
77. Plancarte, A., Flisser, A., Gaucci, C.G., Lightowlers, M.W. (1999) Vaccination against Taenia solium
cysticercosis in pigs using native and recombinant oncosphere antigens. International Journal for
78. Flisser, A., Lightowlers, M.W. (2000) Vaccination against Taenia solium cysticercosis. Memorias do
Instituto Oswaldo Cruz 96, 353–356.

3
Molecular Determinants of
Host–Parasite Interactions: Focus on
Parasite
José L. Molinari and Patricia Tato
Introduction been studied. An idea of the process can be

obtained from studies involving other
The relationship between helminths and their helminths. For instance, Hymenolepis nana
hosts is complex and interesting. It is well oncospheres make use of certain proteases in
known that parasites elicit immunological addition to three pairs of hooks in order to
responses in their hosts. What is less well invade host tissues1. Similarly, serine pro-
known and appreciated, is that parasites tease activity and excretory–secretory pepti-
have evolved numerous ways of evading the dases have been isolated from penetration
consequences of host immunological glands of oncospheres of H. diminuta and T.
response. The net outcome is that parasites saginata, respectively2,3. It is held that these
frequently survive for long periods in fully enzymes participate in tissue invasion in
immunocompetent hosts. Host lymphocytes addition to performing nutritional functions.
and their cytokines play a crucial role in Finally, T. solium egg infection induces
determining the outcome of parasitic infec- humoral immunological responses in human
tion (reviewed in Chapter 2). In this chapter, hosts. This assumption is based on evidence
we review certain aspects of the host–parasite from in vitro studies, where serum from cys-
interaction in Taenia solium cysticercosis with ticercotic individuals destroys oncospheres in
special emphasis on parasite related factors. presence of complement4.
Host–oncosphere interactions Host–metacestode interactions
Ingestion of food or water contaminated with Host inflammatory response directed against
T. solium eggs is the most preliminary step in T. solium metacestodes is a major determinant
the development of human cysticercosis. of clinical symptoms and signs of NC. There
Hatched and activated oncospheres penetrate is great variability in its onset, duration and
intestinal tissues, perforate small intestinal severity. The seminal study by Dixon and
blood vessels, and reach the bloodstream. Lipscomb has established that metacestodes
Here, they passively migrate and finally remain in host tissues in a viable, non-degen-
lodge in target tissues and develop into erate state for variable and prolonged periods
metacestodes. Specific mechanisms underly- of time5. Eventually, usually after 4–5 years,
ing T. solium oncosphere penetration have not local and systemic immune responses against


26 J.L. Molinari and P. Tato
metacestodes develop. As a result, metaces- natants of live T. solium metacestodes was

todes pass through a series of degenerative- designed. The isolate was tested at different
evolutionary stages that are described in doses in human lymphocyte cultures, stimu-
detail in Chapters 30 and 32. Clinical symp- lated with phytohaemagglutinin and was
toms and signs owe their appearance and found to suppress (3H) thymidine uptake by
evolution to the host immune responses. lymphocytes. The suppression was fore-
Furthermore, histological studies corroborate stalled by pre-digestion with ribonuclease
the relationship between the evolutionary (RNase), suggesting that the active molecule
stages of metacestodes and host immune may be a RNA fraction16. A suppression of
response. In both humans and pigs, live and (3H) thymidine uptake has also been demon-
viable metacestodes are surrounded by only strated in T lymphocytes from naturally
discrete inflammatory reaction6,7. In compari- infected-cysticercotic pigs17.
son, studies on pigs pre-immunized with cys- The material that suppresses (3H) thymi-
ticercus antigens have revealed intense dine uptake was assigned the name,
granulomatous inflammation surrounding metacestode factor (MF). We proceeded to
the metacestodes8. These clinical, histological study its effects in vivo. Mice were inoculated
and experimental observations have led sev- with MF (four doses of 100 g per mouse)
eral workers including ourselves, to postulate and challenged with one LD50 of Salmonella
that live T. solium metacestodes are able to typhimurium virulent bacilli18. Mice were
down-modulate host immune responses by either treated with S. typhimurium antigen
virtue of producing certain specific mole- alone or MF alone, or with S. typhimurium
cules. Several such molecules have been pre- antigens and MF in combination. A control
viously described9–11. Taenia metacestodes group consisted of mice inoculated with
modulate complement function by sulphated saline solution. We observed that mice
polysaccharides that activate and consume treated with MF alone, or with both S.
complement9. Among other molecules, taeni- typhimurium antigens and MF, died faster
aestatin inhibits both classic and alternative and in greater number than control mice. In
complement pathways and paramyosin contrast, all mice survived in the group that
inhibits C1q activation10,11. was given S. typhimurium antigens alone.
When batches of MF were filtered
through a Bio-gel P-6 column, two peaks (F1
Metacestode Factor (MF) and F2) were obtained. Further, F1 and F2
were tested in proliferation assays19. While,
Studies evaluating peripheral blood T cells F1 induced a dose-dependent suppressive
in naturally and experimentally infected cys- effect, F2 induced an increase of the (3H)
ticercotic pigs, have consistently revealed thymidine uptake elicited by mitogen.
diminution of CD4+ cell counts in proportion Thereafter, an attempt was made to charac-
to parasite loads12,13. We postulated that T- terize F1 by treating it with several inactivat-
cell suppression in cysticercotic pigs might ing factors such as RNase, proteases and
be related to substances secreted by T. solium heat. After treatment, F1 was tested again in
metacestodes. Similarly, low molecular proliferation assays. RNase-treated F1 lost its
weight isolates from Schistosoma mansoni and suppressive effect. In contrast, trypsin and
Onchocerca gibsoni have previously been papain augmented (3H) thymidine uptake
reported to induce depression of (3H) thymi- inhibition. Chymotrypsin or heat had no
dine uptake by lymphocytes stimulated with effect. Finally, the effect of F1 was studied in
Concanavalin-A (Con-A)14,15. co-cultures of murine macrophages and lym-
phocytes. It was shown that macrophages
pre-incubated with F1 and subsequently co-
Isolation and preliminary characterization cultured with fresh lymphocytes did not
affect (3H) thymidine uptake. In contrast,
A method to isolate substances of molecular incorporation of (3H) thymidine by fresh
weight less than 3500 Dalton from super- lymphocytes co-cultured with lymphocytes

Molecular Determinants of Host–Parasite Interactions 27
pre-incubated with F1 was inhibited. This parenchymal tissues and tegument; the
study provided specific evidence for the hooks were dispersed in necrotic tissue.
probable existence of a RNA molecule, F1, Moderate inflammatory reaction sur-
whose principal site of action was shown to rounded the metacestodes.
be the lymphocyte.
Local inflammatory responses were also
evaluated using scanning electron
microscopy in the experimental protocol out-
Effect on local inflammatory reactions lined above21. Samples from metacestodes
removed at 6 and 12 days post-implantation
In vivo studies further examined the effects were studied.
of MF on the inflammatory reaction around At 6 days post-implantation, it was
implanted metacestodes in mice20. Female found that:
BALB/c syngeneic mice were divided into
four groups based upon the following 1. In control mice, metacestodes were disin-
experimental protocol. One group of mice tegrated and covered by an intense inflam-
was treated with 100 g of MF (one dose matory reaction (Fig. 3.1a).
every 96 h for 12 days). A second group 2. Metacestodes removed from mice treated
consisted of mice inoculated with metaces- with MF alone were intact and exhibited a
tode antigens (100 g as a single dose) scarce inflammation on the bladder tegu-
alone, while a third group was constituted ment (Fig. 3.1b).
by mice that were first inoculated with 3. An evaginated metacestode removed
metacestode antigens and then treated with from a mouse inoculated with metacestode
MF. In the fourth (control) group, mice were antigen alone displayed inflammatory reac-
inoculated with inert normal saline alone. tion on its scolex. Inflammatory cells were
Subsequently, mice in all four groups were disseminated on the double crown of hooks,
implanted with live T. solium metacestodes suckers and the neck tegument; whereas the
(six metacestodes/mouse), obtained from bladder wall tegument was covered by a
cysticercotic pig meat under sterile condi- dense net of fibrous material embedding
tions. Twelve days after the metacestode numerous inflammatory cells.
implantation, the mice were killed. 4. Metacestodes removed from mice immu-
Histopathological studies revealed that: nized with metacestode antigens and subse-
quently treated with MF exhibited few
1. Metacestodes implanted in control mice inflammatory cells on their bladder wall
were completely destroyed and their rem- teguments.
nants were surrounded by an intense inflam-
matory reaction predominantly made up of At 12 days post-implantation:
neutrophils and eosinophils. 1. Metacestodes removed from control mice
2. In metacestodes of mice that were treated were completely enmeshed in an intense
with MF alone, there were clearly identifi- inflammatory reaction, with a dense colla-
able and intact suckers, rostellum, tegument gen-like matrix embedding numerous
and hooks. Few neutrophils, plasma cells, inflammatory cells and covering the whole
lymphocytes and histiocytes were noted in bladder wall tegument.
spiral canals; eosinophils were not observed. 2. The inflammatory reaction surrounding
3. Metacestodes implanted in mice immu- metacestodes removed from mice treated
nized with metacestode antigens alone were with MF alone was more intense than that
completely destroyed; their caseous rem- observed on day 6. In one partially evagi-
nants were intensely surrounded and infil- nated metacestode, the scolex was apparently
trated by neutrophils and eosinophils. intact, with minimal amount of inflammatory
4. Finally, in mice immunized with infiltrate in the folds of its neck. At higher
metacestode antigens and subsequently magnification ( 1500), the microtriches were
treated with MF, there were clearly identifi- visibly intact with scarce inflammatory cells
able (albeit necrotic) rostellum, suckers, and eosinophil like-granules.

Fig. 3.1a. Scanning electron micrograph of a Taenia solium metacestode removed from a control mouse
at day 6. (Reproduced with permission from reference 21.) (ST, subtegument; T, tegument.)
Fig. 3.1b. Scanning electron micrograph of a metacestode removed from a MF-treated mouse at day 6.
(Reproduced with permission from reference 21.)
3. Metacestodes from mice immunized with different kinds of white cells, cell debris and
metacestode antigens exhibited much fibrinoid material was apparent.
stronger inflammatory reactions on the 4. In mice immunized with metacestode anti-
scolex tegument in comparison to day-6. gen and treated subsequently with MF, the
Copious inflammatory infiltrate was visible inflammatory reaction on the bladder wall
surrounding the tegument of an evaginated tegument was less extensive in comparison to
scolex (Fig. 3.2). Ruptures of different size immunized (with metacestode antigens) or
and depth were evident in the tegument and control groups. Very few inflammatory cells,
sub-tegumental suckers. At higher magnifi- cell debris and fibrous material were found
cation ( 1500), an intense accumulation of adherent to intact microtriches.

Fig. 3.2. Scanning electron micrograph of an evaginated scolex removed from an immunized mouse at day
12. An intense inflammatory reaction completely covers the scolex tegument. Note the large cell aggregates
and several ruptures of the sucker and rostellum teguments. (Reproduced with permission from reference 21.)
Effects on humoral and cellular immune were measured in culture supernatants in

responses order to study the effects of MF on cytokine
production22. When cultured with MF, cells
Humoral and cellular immune responses to showed significantly decreased production
inoculation with metacestode antigens, treat- of interleukin 2 (IL-2), interferon- (IFN-),
ment with MF and metacestode implantation and interleukin 4 (IL-4) as compared to mito-
were also studied in the experimental model gen alone. Exogenous recombinant IL-2 and
outlined above. Sera from mice immunized recombinant IL-4 largely restored prolifera-
with metacestode antigens and treated with tion responses (85% and 71% of control cells,
MF showed a significant decrease in antibody respectively). MF also inhibited the produc-
titres compared with those of mice treated tion of tumour necrosis factor-alpha (TNF-
with metacestode antigens alone. Metacestode alpha) by macrophages stimulated with
implantation further suppressed antibody lipopolysaccharide and IFN-. The results of
responses to metacestode antigens. Antibody the above study provide additional evidence
titres were least in sera of implanted mice of an inhibitory effect of MF upon cytokine
treated with MF alone (Fig. 3.3). A suppressive production, regardless of the cell type or
effect of MF was also noted on cellular cytokine (Fig. 3.5). It may be surmised that
immune functions. Splenic lymphocytes from impairment, specifically of IL-2 and IFN-
mice immunized with metacestode antigens production may underlie modulatory influ-
and treated with MF exhibited a significant ences of MF of the nature noted in experi-
decrease in (3H) thymidine uptake in compari- ments with metacestodes implanted in mice.
son with lymphocytes from mice inoculated
with metacestode antigens alone (Fig. 3.4)20.
Metacestode Proteases
Effects on cytokines There is sufficient evidence for the existence

of several parasitic secretory proteases. The
Murine spleen cells were stimulated in vitro latter are believed to be involved in invasion,
with Con-A and cytokine concentrations nutrition and immune evasion23–25. White et

1.4
1.2
1.0
0.8
A (492)
0.6
0.4
0.2
0
0 100 200 300 400 500 600 700 800 900 1000
Dilutions
I IF IM
IFM C
Fig. 3.3. Antibody titres determined by ELISA in sera from mice inoculated with Taenia solium
metacestode antigens (I), inoculated with metacestode antigens plus MF (IF), inoculated with
metacestode antigens and implanted with six metacestodes (IM), inoculated with metacestode antigens
plus MF and implanted with six metacestodes (IFM), and inoculated with saline (C). Data are expressed
as mean values SE for each treatment (n = 4) (P0.05 for I versus IF, IM or IFM). (Reproduced with
permission from reference 20.)
10,000
9000
8000
(3H) Thymidine uptake cpm
7000
6000
5000
4000
3000
2000
1000
0
C CM I IF F IM IMF MF
Fig. 3.4. Effect of Taenia solium metacestode antigens on the proliferation of murine splenic
lymphocytes from the following groups of mice: (C) control; (CM) implanted with six metacestodes; (I)
inoculated with metacestode antigens; (IF) inoculated with metacestode antigens plus MF; (F) inoculated
with MF; (IM) inoculated with metacestode antigens and implanted with six metacestodes; (IMF)
inoculated with metacestode antigens plus MF and implanted with six metacestodes; and (MF)
inoculated with MF and implanted with six metacestodes. Bars represent mean values SE for thymidine
uptake by cells stimulated with 1 g of metacestode antigens (P0.05 for I and IM versus IF, IMF, CM or
C). (Reproduced with permission from reference 20.)

(a) (b)
150 25
IFN- concentration (ng ml–1)

IL-2 concentration (U ml–1)
100
15
50
5
C– C+ 10 20 C– C+ 10 20
(c) (d)
50 5
TNF- concentration (ng ml–1)
IL-4 concentration (U ml–1)
30 3
10 1
C– C+ 10 20 C– C+ 10 20
MF (g) MF (g)
Fig. 3.5. Effect of Taenia solium MF on the production of cytokines. IL-2, IFN- and IL-4 were measured in
supernatants of mouse spleen cells treated with 10 and 20 g of MF (measured as ribose) and stimulated
with Con-A. TNF-alpha was detected in supernatants of murine macrophage line (IC-21) treated with 10
and 20 g of MF and stimulated with lipopolysaccharide and recombinant IFN-. C are the cytokine
concentrations from cells incubated in RPMI medium; C+ are the cytokine values from cells stimulated with
Con-A or lipopolysaccharide/recombinant IFN-. (Reproduced with permission from reference 22.)
al., described cysteine, metallo- and serine T. solium metacestodes (96% viability) at
protease activities in acid extracts from 37°C for 2 h. Cells were separated, washed
lyophilized T. solium metacestodes. The and stained with monoclonal antibodies, anti-
authors reported IgG digestion by the extracts CD4 FITC (fluoresceinated) and anti-CD8 PE
in vitro26. We postulated that immunoglobulin (phycoerythrinated). Flow cytometric analysis
molecules behaved as target substrates and revealed significant decrease in CD4+ expres-
molecular nutrients for T. solium proteases. sion (Fig. 3.6). The cause and effect relation-
Supernatants of live metacestode cultures ship between protease activity and decrease
were evaluated for protease activity on pep- in CD4 expression was demonstrated when
tide substrates with T cell surface proteins27. human lymphocytes were cultured with
Substantial cysteine protease activity in addi- metacestode excretory–secretory products in
tion to metallo- and serine protease activities presence of L-cysteine, a reducing substance.
was found. Isolated human lymphocytes Cells were washed and stained and analysed
from volunteers were co-cultured with live by flow cytometry. Metacestode excretory–

R1 : 8467 R1 : 2210 R1 : 5685

104
104
104
a b c
103
103
103
FL2-H
FL2-H
FL2-H
CD8
102
102
102
101
101
101
100
100
100
100 101 102 103 104 100 101 102 103 104 100 101 102 103 104
FL1-H FL1-H FL1-H
CD4
Fig. 3.6. Flow cytometry analysis of human T cells co-cultured with 100 Taenia solium metacestodes after
cells were separated and stained with monoclonal antibody fluoresceinated anti-human CD4 and
phycoerythrinated anti-human CD8. (a) Control cells in RPMI 1640 medium without metacestodes. (b)
Cells co-cultured for 2 hours with 100 metacestodes. (c) Cells co-cultured for 2 hours with 100
metacestodes and 100 g of rabbit antiserum to metacestode excretory-secretory products. Values are
expressed as gated percentages of CD8+and CD4+cells. (Reproduced with permission from reference 27.)
secretory products pre-incubated with E-64 (a inhibit cytokine, particularly IFN- and IL-2,
specific inhibitor of cysteine protease) served and to a lesser degree IL-4 production in vitro.
as control material. A significant decrease in Live metacestodes also secrete cysteine, met-
CD4 expression, attributable to cysteine pro- allo- and serine proteases. Cysteine protease
tease activity was again demonstrated. activity significantly depletes CD4+ cells in
Furthermore, treatment with E-64 resulted in vitro. The elucidation of these molecules and
the reversion of the inhibitory effect on CD4 of their actions in experimental conditions
expression. have provided insights into the mechanisms
by which T. solium metacestodes evade host
immunological attack and are able to survive
Conclusions for long periods of time.
T. solium metacestodes exert a modulatory

influence on host immunological responses Acknowledgements
through several molecular agents. MF, a
3500 Da RNA-like molecule is most signifi- This work was supported by grants from
cant in this regard. It inhibits humoral and National Council of Science and Technology
cellular immune responses as well as inflam- (Mexico) 23672-M, and National Autonomous
matory reaction around implanted metaces- University of Mexico. Authors thank Dr.
todes in mice. It has also been shown to Rodolfo Paredes for photographic material.
References
1. Miyasato, T., Furukawa, T., Inoue, M., et al. (1977) Electron microscopic observations on the penetra-
tion of oncospheres of Hymenolepis nana into the intestine of the mouse. Acta Medica Kinki University
2, 1–18.
2. Moczon, T. (1996) A serine proteinase in the penetration glands of the hexacants of Hymenolepis
diminuta (Cestoda, Cyclophyllidea). Parasitology Research 82, 67–71.
3. White, A.C. Jr, Baig, S., Robinson, P. (1996) Taenia saginata oncosphere excretory/secretory pepti-
dases. Journal of Parasitology 82, 7–10.

4. Molinari, J.L., Tato, P., Lara, A.R., et al. (1993) Effects of serum from neurocysticercosis patients on
the structure and viability of Taenia solium oncospheres. Journal of Parasitology 79, 124–127.
5. Dixon, H.B.F., Lipscomb, F.M. (1961) Cysticercosis. An analysis and follow-up of 450 cases. Medical
Research Council Special Reports Series. Her Majesty’s Stationery Office, London, 299, 1–56.
6. Marquez, H. (1971) Cysticercosis. In: Marcial, R. (ed.) Pathology of Protozoal and Helminth Diseases.
Williams and Wilkins, Baltimore, Maryland, pp. 592–617.
7. Hernandez, J.P.A., Marquez, M.H., Sastre, O.S. (1973) Cysticercosis of the central nervous system in
hogs. American Journal of Veterinary Research 34, 451–453.
8. Molinari, J.L., Meza, R., Suarez, B., et al. (1983) Taenia solium: immunity in hogs to the cysticercus.
Experimental Parasitology 55, 340–357.
9. Hammerberg, B., William, J.F. (1978) Interaction between Taenia taeniaeformis and the complement
system. Journal of Immunology 120, 1033–1038.
10. Suquet, C., Green, E.C., Leid, R.W. (1984) Isolation and partial characterization of a Taenia taeniae-
formis metacestode proteinase inhibitor. International Journal of Parasitology 14, 165–172.
11. Laclette, J.P., Shoemaker, C.B., Richter, D., et al. (1992) Paramyosin inhibits complement C1. Journal
of Immunology 148, 124–128.
12. Tato, P., Valles, Y., Rolon, R., et al. (1987) Effect of the immunization on immunodepressed hogs,
infected naturally by Cysticercus cellulosae. Revista LatinoAmericana de Microbiologia (México) 29,
67–71.
13. Molinari, J.L., Tato, P., Valles, Y. (1987) Immunodepression of T lymphocytes in hogs modulated by
Cysticercus cellulosae. Revista LatinoAmericana de Microbiologia (México) 29, 293–300.
14. Dessaint, J.P., Camus, D., Fisher, E., et al. (1977) Inhibition of lymphocyte proliferation by factor(s)
produced by Schistosoma mansoni. European Journal of Immunology 7, 624–629.
15. Yin, F.D., Nowak, M., Copeman, B., et al. (1983) A low molecular weight immunosuppressive factor
produced by Onchocerca gibsoni. Veterinary Immunology and Parasitology 4, 445–451.
16. Molinari, J.L., Tato, P., Reynoso, O.A., et al. (1990) Depressive effect of a Taenia solium cysticercus fac-
tor on cultured human lymphocytes stimulated with phytohemagglutinin. Annals of Tropical
Medicine and Parasitology 84, 205–208.
17. Molinari, J.L., Soto, R., Tato, P., et al. (1993) Immunization against porcine cysticercosis in an
endemic area in Mexico: a field and laboratory study. American Journal of Tropical Medicine and
Hygiene 49, 502–512.
18. Molinari, J.L., Tato, P., Reynoso, O.A., et al. (1989) Modulation effects on mice response to a
Salmonella typhimurium infection by a Taenia solium cysticerci product of low molecular weight.
Revista LatinoAmericana de Microbiologia (México) 31, 327–333.
19. Tato, P., Castro, A.M., Rodriguez, D., et al. (1995) Suppression of murine lymphocyte proliferation
induced by a small RNA purified from Taenia solium metacestodes. Parasitology Research 81, 181–187.
20. Tato, P., White, A.C. Jr, Willms, K., et al. (1996) Immunosuppression and inhibition of inflammation
in mice induced by a small Taenia solium RNA-peptide to implanted T. solium metacestodes.
21. Molinari, J.L., Tato, P., Rodriguez, D., et al. (1998) Impairment of the inflammatory reaction on
implanted Taenia solium metacestodes in mice by a T. solium RNA-peptide: a scanning electron
microscopy study. Parasitology Research 84, 173–180.
22. Arechavaleta, F., Molinari, J.L., Tato, P. (1998) A Taenia solium metacestode factor nonspecifically
inhibits cytokine production. Parasitology Research 84, 117–122.
23. McKerrow, J.H., Jones, P., Sage, H., et al. (1985) Proteinases from invasive larvae of the trematode
parasite Schistosoma mansoni degrade connective tissue and basement membrane macromolecules.
Biochemical Journal 231, 47–51.
24. Hotez, P.J., Trang, N.L., McKerrow, J.H., et al. (1985) Isolation and characterization of a proteolytic
enzyme from the adult Ancylostoma caninum. Journal of Biological Chemistry 260, 7343–7348.
25. Chappel, C.L., Dresden, M.H. (1986) Schistosoma mansoni: proteinase activity of ‘hemoglobinase’
from the digestive tracts of adult worms. Experimental Parasitology 61, 160–167.
26. White, A.C. Jr, Molinari, J.L., Pillai, A.V., et al. (1992) Detection and preliminary characterization of
Taenia solium metacestode proteases. Journal of Parasitology 78, 281–287.
27. Molinari, J.L., Mejia, H., Clinton, A.C. Jr, et al. (2000) Taenia solium: a cysteine protease secreted by
metacestodes depletes human CD4 lymphocytes in vitro. Experimental Parasitology 94, 133–142.

4 Animal Models of Taenia solium

Cysticercosis: Role in Understanding
Host–Parasite Interactions
Astrid E. Cardona and Judy M. Teale
Introduction levels, animal models are critical to furthering

our knowledge of the host–parasite relation-
An important outcome of initial clinical stud- ship. Furthermore, animal models are useful
ies of neurocysticercosis (NC) was the realiza- in the study of other factors associated with
tion that the brain is not only affected by the disease acquisition, e.g. genetic factors both in
presence of metacestodes, but more signifi- relation to the host (see Chapter 6)10,11and par-
cantly by the inflammatory response and its asite and in the development of novel thera-
sequelae1–3. In the human central nervous sys- peutic agents and schemes (see Chapter 15).
tem (CNS), host responses to Taenia solium The development of animal models to study
cysticerci range from complete absence, to T. solium infection has been an arduous task.
severe inflammatory reaction4. In most cases, The earliest experience with animal models
viable parasites have little surrounding was studies exploring immunological mecha-
inflammation5, which correlates with an nisms of resistance to larval cestodes in mice
asymptomatic stage of NC. In contrast, virtu- and rats infected with Taenia taeniaeformis12,13.
ally all cases of symptomatic disease are char- These studies elucidated components of the
acterized by prominent immunological peripheral response to T. taeniaeformis and
responses in host nervous tissue6–9. The found that antibodies and complement were
reader is referred to Chapter 2 for an implicated in host defence mechanisms12,13.
overview of host immune responses to cys-
ticercosis. Besides the host immune response,
the location, stage, number and the Animal Models for Adult T. solium
immunomodulatory effects of the metaces-
todes (reviewed in Chapter 3) also contribute Several mammals have been evaluated as
to disease outcome. However, the extent of experimental models of adult T. solium. The
contribution of these factors and how such oral route of infection with T. solium cysticerci
factors influence each other is still not clear. It obtained from infected pigs has been
is difficult to segregate and study each of the employed in these models14. In young dogs,
factors individually in humans. Given the tapeworms survived only for 8 days. Mice,
large number of variables involved, the lack albino rats and guinea pigs were not suscepti-
of predictability of their interactions in ble to T. solium infection. Rhesus monkeys,
human hosts and complexity of the host cats and rabbits did not prove to be useful
immune system at cellular and subcellular models14. In contrast, in gerbils and golden


36 A.E. Cardona and J.M. Teale
hamsters (Mesocricetus auratus), tapeworms pigs are the natural intermediate host of the
developed and exhibited greater sexual devel- helminth. Most researchers employing this
opment, though mature and infectious oncos- model so far have used naturally infected
pheres were not produced14–16. Cysternal pigs21,22, although experimentally induced
infection with scolex and membranes from T. infections have also been studied (see also
solium cysticerci resulted in an intense granu- Chapter 15)23. The number of T. solium eggs
lomatous inflammatory response consisting of required for inducing experimental infection
lymphocytes in rabbits17. Interestingly, the varied between 1000 and 380,00023. The
most successful hosts to date for adult T. porcine model has provided information
solium tapeworms are chinchillas (Chin- related to progression of the parasitosis in
chillidae family of rodents), in which larvae liver, muscles and lungs. In parallel to human
develop into gravid proglottides, eventually CNS infections, histological studies in this
producing infective oncospheres. Infectivity of model revealed the presence of immature,
eggs obtained from the chinchilla model was mature, degenerate and calcified cysts in pig
demonstrated in pigs. Metacestodes were liver and muscle22,24. As yet, a detailed analy-
found in pig skeletal muscle, 12 weeks after sis of the specific immunological elements
oral infection with gravid proglottides recov- has not been described in the porcine model.
ered from chinchillas14. A major area of application of porcine
Immunosuppressive treatment with models has been the development of treat-
steroids (prednisolone and methyl pred- ment strategies to control porcine cysticerco-
nisolone) facilitates the establishment and sis with the ultimate goal of preventing
development of adult T. solium and a related human infection. Two of the drugs that are
cestode, T. crassiceps in experimental host currently used for treatment of human cys-
intestine14,18. The basis of the facilitatory ticercosis, albendazole and praziquantel,
effect of steroid treatment presumably relates have been used in several different protocols
to suppression of local mucosal inflamma- to determine their efficacy for treatment of
tory responses to worm attachment19. When porcine cysticercosis21, 22, 25, 26. Another drug,
T cells were depleted in vivo in Mongolian oxfendazole has been found effective in con-
gerbils (Meriones unguiculatus) infected with trolling swine cysticercosis (reviewed in
T. crassiceps ova, only destrobilated adult Chapter 43)27. These studies together with
worms were harvested in the faeces20. This the epidemiological studies are important for
indicated that T cells in some way prevented the development of interventions to eradi-
strobilar attachment to enteral mucosa. A cate T. solium infection28,29. However, the
similar effect was observed in prednisolone- scarcity of infected pigs in non-endemic
treated gerbils, arguably due to an effect of areas, and the difficulty in obtaining T.
prednisolone upon T cells20. solium eggs have limited the widespread use
The development of an experimental of the porcine model. Moreover, there are
model that allows the recovery of T. solium difficulties in handling pigs, and a high cost
eggs is likely to have a significant impact of support is involved. Therefore, other ani-
upon future research. Eggs will be available mal species have been used to develop
for antigen cloning, analysis and purification. experimental models for cysticercosis using
Further application of the chinchilla model related parasites.
will be valuable in the areas of vaccine design
and host–adult parasite interactions.
Experimental intraocular cysticercosis
Animal Models for Cysticercosis The eye is an immunologically privileged

site. T. crassiceps metacestodes have also been
T. solium cysticercosis in pigs used in experimental models of intraocular/
intravitreous cysticercosis in rabbits30,31.
Porcine cysticercosis is a successful experi- Living T. crassiceps cysticerci in the vitreous
mental model for T. solium cysticercosis, as cavity produced ocular lesions with an

Animal Models of T. solium Cysticercosis 37
intense inflammatory response in those rab- production of interleukin-2 (IL-2) and IFN-
bits that had been previously infected decreased and DTH was depressed, while
through the intraperitoneal route or had IL-4, IL-10, IgG2b and IgG1 production was
been inoculated with cysticercus antigen30,31. up-regulated. These results suggest that
A granulomatous response comprising there is a shift from an initial parasite-restric-
eosinophils and polymorphonuclear cells tive, Th1-type based response to a later para-
was noted. Naive rabbits and steroid treated site-permissive, Th2 response. While the
rabbits did not exhibit inflammatory ocular early response suppresses infection by
lesions30,31. These models are significant in metacestodes, the latter allows establishment
the understanding of immune reactions and growth of T. crassiceps metacestodes in
specifically involved in the intraocular com- murine hosts36,38.
partment as well as the treatment of ocular Analyses of the immunological response
cysticercosis. around peritoneal granulomas formed 3–14
weeks after infection indicate that early
granulomas are predominantly associated
T. crassiceps experimental cysticercosis with a Th1-type response, whereas later
granulomas, in which parasite destruction is
Two related cestode parasites, T. crassiceps complete, have a mixture of Th1- and Th2-
and Mesocestoides corti have been used exten- type responses39. These data suggest that
sively as animal models of cysticercosis. dying parasites can no longer modulate host
Their metacestodes are infectious to mice, immunological responses. The Th1 granulo-
and the larval stages of these parasites are matous response is likely to be involved in
easily maintained in the peritoneal cavity of the pathogenesis of symptomatic human
infected mice32,33. Intraperitoneal injection of infection in which active inflammation is a
either organism results in invasion of liver major cause of disease. As the parasite is
and peritoneum. Intraperitoneal inoculation, destroyed, the response shifts to involve
however, does not produce CNS lesions, a greater Th2-type cytokine expression, per-
major drawback of initial investigations with haps as a means of down-regulating inflam-
these models. Recently, however, infection mation39. Interestingly, it was demonstrated
with either organism was accomplished in that subcutaneous inoculation with larvae
the brain, thereby facilitating the study of induces protection against subsequent
infective mechanisms specific to the CNS34. intraperitoneal challenge. Parasite destruc-
T. crassiceps has a canine definitive host tion was associated with adherence of host
and a rodent intermediate host32,35. In nat- cells to the tegument of larvae. The crucial
ural infections, the larval form invades sev- effector population of host cells involved in
eral tissues including the peritoneal cavity of parasite death is not known40.
the rodent. In BALB/c mice, chronic infec- The T. crassiceps animal model has also
tion with T. crassiceps induced host immuno- been used to investigate mechanisms of
suppression. Analysis of the temporal course immunological regulation that the parasite
of the immune response in mice inoculated can exhibit in the host. T. crassiceps larvae
intraperitoneally with T. crassiceps, revealed release factors that are capable of down-reg-
a time dependent variation in the intensity of ulating both proliferative responses of and
Th1 and Th2 type responses (see Chapter 2 cytokine production by T cells41. These para-
for an overview of the Th1 and Th2 site factors were found to down-regulate
responses)36–38. In the early stages of infec- production of IFN- and IL-4 by mitogen
tion when few or no parasites could be stimulated spleen cells41. This inhibitory
recovered from the peritoneal cavity, mice effect was caused by excretory–secretory
exhibited a strong Th1 type of immuno- products from the larvae in the early stages
logical response characterized by high of infection. In contrast, excretory–secretory
interferon- (IFN-) production, IgG2a dom- products from larvae harvested late in
inated antibody response and delayed type infection were not suppressive40. Future
hypersensitivity (DTH). Late in infection, studies will be critical to elucidate immuno-

logical mechanisms involved in larval human leukocyte antigen system10,11.

destruction by the host and immunomodu- Expression of the Qa-2, non-classic Class I
latory mechanisms by which the parasite major histocompatibility complex antigen
persists in the host. was associated with resistance to T. crassiceps
A major outcome of the development of infection in BALB/cAnN mice10. An under-
the mouse–T. crassiceps, host–parasite model standing of such protective genetic factors is
has been the recognition of several host fac- likely to have an impact upon the develop-
tors that influence infection by metacestodes. ment of genetically engineered animals,
The sex specific behaviour of the cestode is which are inherently resistant to cysticercosis,
an outstanding example of one such host fac- a novel strategy for its prevention and control.
tor. In mouse models, T. crassiceps parasitize
female mice in preference to male mice in
large numbers following intraperitoneal
Mesocestoides corti experimental
inoculation42. Gonadectomy was found to
cysticercosis
increase parasite population in male mice
but had an opposite effect in female mice42,43.
Similar to T. crassiceps, intraperitoneal
Replacement with 17 -oestradiol favours
injection of the larval stage of the metaces-
parasite proliferation in host mice, an effect
tode parasite, M. corti results in chronic
that is more prominent in male mice44. The
infection in mice33,51,52. In nature, M. corti
sex specific behaviours are not observed in
ova are believed to be ingested by terres-
irradiated or neonatally thymectomized mice
trial arthropods. An intermediate host such
suggesting that sex hormones interact with
as the mouse or lizard then consumes the
the immune system in order to favour or
arthropod, where upon the oncosphere
suppress infection43,45. It has been surmised
develops into the mature larva or metaces-
that oestrogens inhibit immune mechanisms
tode53. Upon ingestion of the intermediate
and are thereby permissive to T. crassiceps
host by a carnivorous mammal such as
proliferation in mice.
dog, cat or skunk, a mature intestinal tape-
The sex-related differences in rate and
worm develops releasing eggs and perpet-
intensity of establishment described above
are evident in the early stages of T. crassiceps uating the life cycle. M. corti infected mice
infection in mice. In chronically parasitized develop splenomegaly and hepatomegaly,
mice, the parasite establishes itself in large with encystment of the organism in the
numbers in male mice as well. The effect of liver33,51,52.
chronic T. crassiceps infection on sexual
behaviour and related morphological and
biochemical parameters is of interest. Animal Models for
Chronic infection results in inhibition of sex- Neurocysticercosis
ual responses in male mice, gonadal atrophy
in male mice and hypertrophy in female To study the immunological response in the
mice and an overwhelming increase of brain during NC, we have developed a
plasma oestradiol levels and corresponding mouse model using M. corti and T. crassi-
reduction in plasma testosterone levels in ceps metacestodes. Due to lack of CNS
male mice46,47. Likewise, an increase in the involvement in intraperitoneally infected
expression of genes and enzymes associated mice, intracranial inoculation of the
with oestrogen synthesis has been noted in metacestodes was used to analyse immuno-
male mice48,49. Recently, it was demonstrated logical responses in CNS. This model has
that the parasite could utilize sex hormone allowed us to follow the kinetics of
precursors from the host to synthesize sex immunological response in brain. With a
hormones required for its own development view to parallel human disease, metaces-
and sustenance50. todes were injected intracranially, avoiding
Another example of host factors involved penetration of brain parenchyma. Mice
in T. crassiceps infection is influence of the were sacrificed at different time points after

infection34. The associated pathological and M. corti metacestodes were found to be

immunological responses in the brain were highly invasive. They infiltrated ventricles,
analysed using haematoxylin and eosin subarachnoid spaces and brain parenchyma
staining (Fig. 4.1) and in situ immunohisto- within days (Fig. 4.2). Pathological studies
chemistry of brain cryosections34. revealed presence of lesions with active
Fig. 4.1. Haematoxylin and eosin staining of a brain cryosection, 10 m in thickness. Mesocestoides
corti metacestode is present in parenchyma associated with small inflammatory infiltrate shown by the
long arrow. The short arrow demarcates a parasite in a lateral ventricle.
100
80
Percentage of parasites
P
60
EP
40
20
0
2 days 1 3 5 10 16
Time p.i (weeks)
Fig. 4.2. Distribution of Mesocestoides corti larvae in the brain of BALB/c mice. Haematoxylin and eosin
stained sections from infected mouse brains were analysed for the presence and location of larva.
Parasites were counted and classified as P (parenchymal) or EP (extraparenchymal, i.e. located in
ventricle, subarachnoid space or meninges). Each data point represents the average of three mice.

necrosis in brain parenchyma (Fig. 4.3). An larger and fewer organisms were able to
accumulation of inflammatory cells in the penetrate brain parenchyma.
ventricles and meninges was noted (Fig. In the mouse model, infection of CNS
4.4). Massive accumulation of gamma/delta appears to induce initially an innate type
T lymphocytes, macrophages, and to a of immunological response evidenced by
lesser extent, dendritic cells, NK cells, mast the presence of neutrophils, macrophages
cells and B cells was observed (Fig. 4.5). A and natural killer cells. By 3 days postin-
Th1 pathway of cytokine expression was fection, an early-induced response devel-
observed in the brain after M. corti infection ops with the added participation of large
with high levels of IL-2, IL-12, IL-15 and numbers of gamma/delta T cells. By 7
IFN- (Fig. 4.6). Importantly, Th2-related days postinfection, an adaptive immuno-
cytokines (IL-10 and IL-13) were either logical response is evident with parasite
undetectable or found in very low levels specific T and B cells.
(IL-4). Interestingly, gamma/delta T lym- The immunological response that devel-
phocytes were found in the CNS by 2 days ops in mouse brain has been evaluated in
postinfection. These cells co-localized to both infected BALB/c and C57BL/6 mice.
areas where Th1 cytokines were detected34. Little difference was found in the type of the
The immunological response in the CNS in cellular and cytokine response in the CNS in
mice infected with T. crassiceps was similar these two strains of mice. This is of interest
with the exception that this organism was since these two strains often differ dramati-
cally in their response to infectious organ-
isms such as Leishmania54,55.
(a)
(a)
(b)
(b)
Fig. 4.3. Haematoxylin and eosin staining reveal

the presence of areas of active necrosis. (a)
Hanks balanced salt solution inoculated mice do
not reveal pathology showing normal parenchymal Fig. 4.4. Intense inflammatory response
tissue. (b) The parasite (P) is associated with associated with parasite (P) in ventricle (a) and
active areas of necrosis lacking cellularity subarachnoid space (b) (magnification 150 in (a)
(magnification: 150). and 100 in (b)).

3
Number of
cells
0
2 days 5 days 1 5 13
Time p.i (weeks)

CD19
Fig. 4.5. Immunological response in the brain after Mesocestoides corti infection. Two mouse brains
obtained after intracranial inoculation with M. corti metacestodes were analysed by immuno-
histochemistry for the presence of various cell types. Cells in the extraparenchymal regions were
counted, and the score given represents: 1–100 cells (1), 100–300 cells (2), 300–500 cells (3). The
results represent the average of two mice.
3
Number of
cells
0
2 days 5 days 1 5 13
Time p.i (weeks)
IL-12
IL-4
Fig. 4.6. Predominance of a Th1 pathway of cytokine response in the brain after Mesocestoides corti
infection. Results of immunohistochemical staining for IL-12 and IL-4 are shown. Cells were counted and
scores given as described in Fig. 4.5. The results represent the average of two mice.
Data from the mouse model are consistent Macrophages, NK cells and pro-inflamma-
with previous reports of the cellular tory cytokines predominate with little or no
immunological responses in human brain. detection of eosinophils, mast cells and IL-4

production8. Within the brain, host responses Two of these molecules are temperature-
to the parasite appears to be of Th1 inflam- induced heat shock proteins (hsps) of the hsp70
matory type in contrast to the Th2 response and hsp60 families58. Since gamma/delta T
which is a characteristic response to cells might be able to recognize whole proteins
helminths in peripheral extraneural tissue. in an antibody-like manner60,61, M. corti hsps
However, as disease progresses with granu- have a potential role in the development of an
loma formation, a mixed Th1 and Th2 inflammatory response in the CNS.
response is likely. Furthermore, phospholipids have been found
The presence of gamma/delta T cells in to induce specific expansion of human
large numbers predicts their important role gamma/delta T cells62–64. Future studies with
in NC. In lymphoid tissues, gamma/delta T M. corti lipids may help define the mechanism
cells represent a minor proportion of T cells by which the parasite induces an inflamma-
and their specific functions are uncertain56,57. tory response in the brain.
We hypothesized that gamma/delta T cells
play important immunoregulatory functions
by producing cytokines that modulate the Conclusions
development of inflammatory response in
CNS. Further studies in the animal model Animal models contribute to the areas of
may improve our understanding of the role parasite biology and immunology and are
of this T cell subset in the human disease. valuable for the recognition of new mecha-
The interactions between immunological nisms involved in the host–parasite relation-
cells and resident brain cells in the mouse ship during cestode infection. These models,
model are of interest with specific reference to and the data obtained from human studies
T cells. A question that needs to be answered will be critical for the understanding of the
is which antigens may be activating the progression of the disease in the human host.
gamma/delta T cell response? Previous stud- The animal models hitherto described have
ies have indicated that M. corti secretes a num- been instrumental in the understanding of
ber of molecules when propagated in vitro58,59. host–parasite interactions involved in NC.
References
1. Dixon, H., Lipscomb, F.M. (1991) Cysticercosis: an analysis and follow up of 450 cases. Medical
Research Council Special Report Series. Her Majesty’s Stationery Office, London, 299, pp. 1–58.
2. Wiederholt, W.C., Grisiola, J.S. (1982) Cysticercosis: an old scourge revisited. Archives of Neurology
39, 533–535.
3. Shandera, W.X., White, A.C. Jr, Chen, J.C., et al. (1994) Neurocysticercosis in Houston, Texas: a report
of 112 cases. Medicine 73, 37–52.
4. Ostrosky-Zeichner, P., Garcia-Mendoza, E., Rios, C., et al. (1996) Humoral and cellular immunologi-
cal response within the subarachnoid space of patients with neurocysticercosis. Archives of Medical
Research 27, 513–517.
5. White, A.C. Jr (2000) Neurocysticercosis: updates on epidemiology, pathogenesis, diagnosis, and
management. Annual Review of Medicine 51, 187–206.
6. Cecilia, R. (1983) Clinical aspects, pathology and treatment of human cysticercosis. In: Flisser, A.,
Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic
Press, New York, pp. 179–199.
7. Correa, D., Dalma, D., Espinoca, B. (1985) Heterogeneity of humoral immunological components in
human cysticercosis. Journal of Parasitology 71, 535–541.
8. Restrepo, B.I., Llaguno, P., Sandoval, M.A., et al. (1998) Analysis of immunological lesions in neuro-
cysticercosis patients: central nervous system response to helminth appears Th1-like instead of Th2.
Journal of Neuroimmunology 89, 64–72.
9. Grewal, J.S., Kaur, S., Bhatti, G., et al. (2000) Cellular immunological responses in human neurocys-
ticercosis. Parasitology Research 86, 500–503.

10. Frogoso, G., Lamoyi, E., Mellor, A., et al. (1996) Genetic control of susceptibility to Taenia crassiceps
cysticercosis. Parasitology 112, 119–124.
11. Frogoso, G., Lamoyi, E., Mellor, A., et al. (1998) Increased resistance to Taenia crassiceps murine cys-
ticercosis in Qa-2 transgenic mice. Infection and Immunity 66, 760–764.
12. Rickard, M., Williams, J. (1982) Hydatidosis/cysticercosis: immunological mechanisms and immu-
nization against infection. Advances in Parasitology 21, 229–296.
13. Lloyd, S. (1987) Cysticercosis. In: Soulsby, E.J.L. (ed.) Immunological Responses to Parasite Infections,
Vol. 2. CRC Press, Boca Raton, Florida, pp. 183–212.
14. Maravilla, P., Avila, G., Cabrera, V., et al. (1998) Comparative development of Taenia solium experi-
mental models. Journal of Parasitology 84, 882–886.
15. Merchant, M.T., Aguilar, L., Avila, G., et al. (1998) Taenia solium: description of intestinal implanta-
tion sites in experimental hamster infections. Journal of Parasitology 84, 681–985.
16. Allan, J.C., Garcia-Dominguez, Craig, P.S., et al. (1991) Sexual development of Taenia solium in ham-
sters. Annals of Tropical Medicine and Parasitology 85, 473–477.
17. Garcia de Llano, C.A., Mateos, J.H., Rivas, A. (1989) Reacción inflamatoria en la neurocisticercosis
estudio experimental en conejo. Archivos de Investigacion Medica (Mexico) 20, 61–68.
18. Sato, H., Oku, Y., Rausch, R.L., et al. (1993) Establishment and survival of the strobilar stage of Taenia
crassiceps in hamsters, gerbils, and mice, with reference to different helminth isolates. Parasitology
Research 79, 619–623.
19. Sato, H., Kamiya, H., Oku, Y., et al. (1994) Infection course of the strobilar stage of Taenia crassiceps in
golden hamsters, with reference to host responses. Parasitology Research 80, 99–103.
20. Sato, H., Ihama, Y., Kamiya, H. (2000) Survival of destrobilated adults of Taenia crassiceps in T-cell-
depleted Mongolian gerbils. Parasitology Research 86, 284–289.
21. Flisser, A., Gonzalez, D., Shkurovich, M., et al. (1990) Praziquantel treatment of porcine brain and
muscle Taenia solium cysticercosis. Parasitology Research 76, 263–269.
22. Flisser, A., Gonzalez, D., Plancarte, A., et al. (1990) Praziquantel treatment of brain and muscle
porcine Taenia solium cysticercosis 2. Immunological and cytogenetics studies. Parasitology Research
76, 640–642.
23. Fan, P.C., Chung, W.C., Lin, C.Y., et al. (1990) The pig as an intermediate host for Taiwan Taenia
infection. Journal of Helminthology 64, 223–231.
24. Kaur, M., Joshi, K., Ganguly, R., et al. (1995) Evaluation of the efficacy of albendazol against the lar-
vae of Taenia solium in experimentally infected pigs, and kinetics of the immunological response.
25. Torres, A., Plancarte, A., Villalobos, A.N.M., et al. (1992) Praziquantel treatment of porcine brain and
muscle Taenia solium cysticercosis 3. Effect of 1-day treatment. Parasitology Research 78, 161–164.
26. Gonzales, A.E., García, H.H., Gilman, R.H., et al. (1995) Treatment of porcine cysticercosis with
albendazol. American Journal of Tropical Medicine and Hygiene 53, 571–574.
27. Gonzalez, A.E., Falcon, N., Gavidia, C., et al. (1998) Time–response curve of oxfendazole in the treat-
ment of swine cysticercosis. American Journal of Tropical Medicine and Hygiene 59, 832–836.
28. Evans, C., Gonzales, A.E., Gilman, R.H., et al. (1997) Immunotherapy for porcine cysticercosis:
implications for prevention of human disease. American Journal of Tropical Medicine and Hygiene 56,
33–37.
29. Gilman, R.H., García, H.H., Gonzales, A.E., et al. (1999) Short cuts to development: methods to con-
trol the transmission of cysticercosis in developing countries. In: García, H.H., Martinez, S.M. (eds)
Taenia solium Taeniosis/Cysticercosis. Editorial Universo, Lima, Peru, pp. 313–326.
30. Cardenas, F., Plancarte, A., Quiroz, H., et al. (1989) Taenia crassiceps: experimental model of intraocu-
lar cysticercosis. Experimental Parasitology 69, 324.
31. Santos, A., Paczka, J.A., Jimenez-Sierra, J.M., et al. (1996) Experimental intravitreous cysticercosis.
Graefe’s Archives of Clinical and Experimental Ophthalmology 234, 515–520.
32. Freeman, R.S. (1962) Studies on the biology of Taenia crassiceps. Canadian Journal of Zoology 40,
969–971.
33. Mitchell, G.F., Machalonis, J.J., Smith, P.M., et al. (1977) Studies on immunological responses to lar-
val cestodes in mice. Immunoglobulins associated with the larvae of Mesocestoides corti. Australian
Journal of Experimental Biology and Medical Science 55, 187–211.
34. Cardona, A.E., Restrepo, B.I., Jaramillo, J.M., et al. (1999) Development of an animal model for neu-
rocysticercosis: immunological response in the central nervous system is characterized by a pre-
dominance of gamma/delta T cells. Journal of Immunology 162, 995–1002.

35. Smyth, J.D. (1994) Introduction to Animal Parasitology. Cambridge University Press, New York,
1189 pp.
36. Terrazas, L.I., Bojalil, R., Govezensky, T., et al. (1998) Shift from an early protective Th1-type
immunological response to a late permissive Th2-type response in murine cysticercosis (Taenia cras-
siceps). Journal of Parasitology 84, 74–81.
37. Villa, O.F., Kuhn, R.E. (1996) Mice infected with the larvae of Taenia crassiceps exhibit a Th2-like
immunological response with concomitant anergy and downregulation of Th1-associated phenom-
ena. Parasitology 112, 561–570.
38. Toenjes, S.A., Spolski, R.J., Mooney, K.A., et al. (1999) The systemic immunological response of
BALB/c mice infected with larval Taenia crassiceps is a mixed Th1/Th2-type response. Parasitology
118, 623–633.
39. Robinson, P., Atmar, R.L., Lewis, D.E., et al. (1997) Granuloma cytokines in murine cysticercosis.
Infection and Immunity 65, 2925–2931.
40. Mooney, K.A., Spolski, R.J., See, E.J., et al. (2000) Immunological destruction of larval Taenia crassi-
ceps in mice. Infection and Immunity 68, 2393–2401.
41. Spolski, R.J., Corson, J., Thomas, P.G., et al. (2000) Parasite secreted products regulate the host
response to larval Taenia crassiceps. Parasite Immunity 22, 297–305.
42. Garcia Tamayo, F., Terrazas Valdez, L.I. (1992) Immune response to parasitic infection in mice with-
out seminal vesicles. Archives of Medical Research 23, 149–150.
43. Huerta, L., Terrazas, L.I., Sciutto, E., et al. (1992) Immunological mediation of gonadal effects on experi-
mental murine cysticercosis caused by Taenia crassiceps metacestodes. Journal of Parasitology 78, 471–476.
44. Terrazas, L.I., Bojalil, R., Govezensky, T., et al. (1994) A role for 17-BETA-estradiol in immunoen-
docrine regulation of murine cysticercosis (Taenia crassiceps). Journal of Parasitology 80, 563–568.
45. Bojalil, R., Terrazas, L.I., Govezensky, T., et al. (1993) Thymus-related cellular immune mechanisms
in sex-associated resistance to experimental murine cysticercosis (Taenia crassiceps). Journal of
46. Larralde, C., Morales, J., Terrazas, L.I., et al. (1995) Sex hormone changes induced by the parasite
lead to feminization of the male host in murine Taenia crassiceps cysticercosis. Journal of Steroid
Biochemistry and Molecular Biology 52, 575–580.
47. Morales, J., Larralde, C., Arteaga, M., et al. (1996) Inhibition of sexual behaviour in male mice
infected with Taenia crassiceps cysticerci. Journal of Parasitology 82, 689–693.
48. Morales-Montor, J., Rodriguez-Dorantes, M., Mendoza-Rodriguez, C.A., et al. (1998) Differential
expression of the estrogen-regulated proto-oncogenes c-fos, c-jun, and bc1–2 and of the tumor-
suppressor p53 gene in the male mouse chronically infected with Taenia crassiceps cysticerci.
49. Morales-Montor, J., Rodriguez-Dorantes, M., Cerbon, M.A. (1999) Modified expression of steroid 5
alpha-reductase as well as aromatase, but not cholesterol side-chain cleavage enzyme, in the repro-
ductive system of male mice during (Taenia crassiceps) cysticercosis. Parasitology Research 85, 393–398.
50. Gomez, Y., Valdez, R.A., Larralde, C., et al. (2000) Sex steroids and parasitism: Taenia crassiceps cys-
ticercus metabolizes exogenous androstenedione to testosterone in vitro. Journal of Steroid
Biochemistry and Molecular Biology 74, 143–147.
51. Johnson, G.W., Nicholas, D., Metcalf, D., et al. (1979) Peritoneal cell population of mice infected with
Mesocestoides corti as a source of eosinophils. International Archives of Immunology 59, 315–317.
52. Chapman, C.P., Knopf, P., Hicks, J., et al. (1979) IgG1 hypergammaglobulinemia in chronic parasitic
infections in mice: magnitude of the response in mice infected with various parasites. Australian
Journal of Experimental Biology and Medical Science 57, 369–372.
53. Novak, M. (1972) Quantitative studies on the growth and multiplication of tetrathyridia of
Mesocestoides corti (Hoeppli, 1925) (Cestoda: Cyclophyllidia) in rodents. Canadian Journal of Zoology
50, 1189–1199.
54. Heinzel, F., Sadick, M., Holaday, B., et al. (1989) Reciprocal expression of interferon-gamma or inter-
leukin 4 during the resolution or progression of murine leishmaniasis. Evidence for the expansion
of distinct helper T cell subsets. Journal of Experimental Medicine 169, 59–72.
55. Heinzel, F., Sadick, M., Mutha, S., et al. (1991) Production of interferon-gamma, interleukin 2, inter-
leukin 4, and interleukin 10 by CD4+ lymphocytes in vivo during healing and progressive murine
leishmaniasis. Proceedings of the National Academy of Sciences USA 88, 7011–7015.
56. Haas, W., Pereira, P., Tonegawa, S. (1993) Gamma/delta cells. Annual Review of Immunology 11,
637–685.

57. Modlin, R.L., Pirmez, C., Horman, F.M., et al. (1989) Lymphocytes bearing antigen-specific
gamma/delta T cell receptors accumulate in human infectious disease lesions. Nature 339, 8–12.
58. Estes, D.M., Teale, J.M. (1991) Biochemical and functional analysis of extracellular stress proteins of
Mesocestoides corti. Journal of Immunology 147, 3926–3934.
59. Teale, J.M., Abraham, K.M. (1987) Regulation of antibody class expression. Immunology Today 138,
1699–1672.
60. Li, H., Lebedeva, M.I., Llera, A.S., et al. (1998) Structure of the Vdelta domain of the human
gamma/delta T-cell receptor. Nature 391, 502–506.
61. Groh, V., Steinle, A., Bauer, S., et al. (1998) Recognition of stress-induced MHC molecules by intesti-
nal epithelial gamma/delta T cells. Science 279, 1737–1739.
62. Morita, C., Beckman, E., Bukowski, J., et al. (1995) Direct presentation of nonpeptide prenyl
pyrophosphate antigens to human gamma/delta T cells. Immunity 3, 495–507.
63. Tanaka, Y., Morita, C., Nieves, E., et al. (1995) Natural and synthetic non-peptide antigens recog-
nized by human gamma/delta T cells. Nature 375, 155–158.
64. Tanaka, Y., Sano, S., Nieves, E., et al. (1994) Nonpeptide ligands for human gamma/delta T cells.
Proceedings of the National Academy of Sciences USA 91, 8175–8179.

5 Mitochondrial DNA of Taenia solium:

From Basic to Applied Science
Akira Ito, Minoru Nakao, Munehiro Okamoto, Yasuhito Sako and

Hiroshi Yamasaki
Introduction Comparative Studies of mtDNA in

T. solium, T. saginata and T. saginata
The mitochondrial genome has been asiatica
sequenced and its variations have been estab-
lished in humans and several other animal and Figure 5.1 depicts the molecular phylogeny
plant species. Little is, however, known about of major cestodes. Taenia solium and T. sagi-
mitochondrial DNA (mtDNA) of the parasitic nata are well known cosmopolitan human
flatworms, cestodes and trematodes1–4. While tapeworms. In addition, a third taeniid, the
the study of human mitochondrial genome has Asian Taenia has been recognized lately.
led to the understanding of genetic basis of a There is a high prevalence of this taeniid
wide range of diseases, a similar study in flat- among aboriginal inhabitants of several
worms has important bearing upon three dif- East and Southeast Asian countries, includ-
ferent areas of knowledge. First, variations in ing Korea, Taiwan, China, Malaysia,
the mitochondrial genome of different Thailand, Philippines and the Samosir
species have been utilized for deducing phy- Island of North Sumatra, Indonesia9–13. The
logenic relationships and studying evolu- Asian Taenia bears similarities to, and is dif-
tionary sequences among different members ferent from both T. solium and T. saginata. It
of a phylum5–8. Secondly, the study of taeniid resembles the latter in morphology.
mtDNA has been useful in speciation as well However, a major distinguishing feature
as in elucidating similarities and differences from T. saginata on one hand and a similar-
between individual species. A good example ity to T. solium on the other hand is its uti-
has been the utilization of knowledge of lization of swine and not cattle as
mtDNA structure in establishing the status of intermediate hosts. However, it is not clear
a novel taeniid, Taenia saginata asiatica (see whether humans can also serve as interme-
below). Finally, it could also provide insights diate hosts to Asian Taenia. Indeed, if
into epidemiological aspects of pathogenicity human transmission were possible, cases of
and zoogeography of individual flatworms. neurocysticercosis (NC) would abound in
Here, we review intra-species variations countries of East Asia. Fortunately, this is
in relation to geographical location and not the case. Two major factors account for
molecular evolution of T. solium and their the non-pathogenic nature of the Asian
implications for the understanding of its Taenia. Firstly, its metacestodes are far
pathogenicity and epidemiology. smaller in comparison to those of T. solium,


48 A. Ito et al.
E. multilocularis
1000
E. granulosus
LrRNA gene T. hydatigena

(377–387 bp)
T. solium
956
T. saginata
1000
T. asiatica
T. crassiceps
T. pisiformis
0.02 T. taeniaeformis
H. diminuta
669
986 H. nana
H. microstoma
M. corti
M. expansa
D. caninum
1000 D. latum
D. ditremum
F. hepatica
Fig. 5.1. A neighbour-joining phylogenic tree of 17 cestodes based on the sequences of partial LrRNA
genes. Bootstrap values more than 500 are shown in the tree. The trematode, Fasciola hepatica served
as an outgroup. The cestodes examined were Echinococcus multilocularis, E. granulosus, Taenia
hydatigena, T. solium, T. saginata, T. asiatica, T. crassiceps, T. pisiformis, T. taeniaeformis, Hymenolepis
diminuta, H. nana, H. microstoma, Mesocestoides corti, Moniezia expansa, Dipylidium caninum,
Diphyllobothrium latum and D. ditremum.
a factor that may affect its potential to pro- (T. asiatica vs. variant of T. saginata (T. saginata
duce neurological symptoms. However, we asiatica)),9–11 and also with reference to its
have shown that larvae of the Asian Taenia potential to cause human cysticercosis12,13.
can develop to 10 mm or larger in diameter Mitochondrial DNA analysis15–18 and compara-
in non-obese diabetic-severe combined tive studies of morphology and development
immunodeficiency (NOD-SCID) mice14. of metacestodes of each species in experimen-
Secondly, while T. solium is neuro- and myo- tal animal models14,19–23 have provided prelim-
tropic, the Asian Taenia is hepato- and vis- inary insights into differences in the biological
cero-tropic. In other words, in swine and behaviour of the three human taeniids. Both
possibly in humans, metacestodes of the lat- suggest that the Asian Taenia is highly homolo-
ter are primarily found in the liver and vis- gous to T. saginata, and although there are bio-
cera and not in the brain and muscles, as is logical differences between the two9,14, T.
the case with T. solium. asiatica should not be classified as a new
Given the above background, controversy species but rather a subspecies of T. saginata,
exists with regard to speciation of Asian Taenia i.e., T. saginata asiatica16–18,23.

Mitochondrial DNA of T. solium 49
Taenia solium mtDNA illustration, it is clear that the gene arrange-

ment in the T. solium mitochondrion is
The structure of the mtDNA in T. solium and a highly unique and differs from nematodes
related cestode, Echinococcus multilocularis has as well as other animal phyla. In studies
been recently established using polymerase performed on cestodes and trematodes, this
chain reaction-amplification and nucleotide unique arrangement has been found to be
sequencing. Between the two species, there highly conserved24,35.
are minor variations in the size of the mito-
chondrial genome (13,709 bp in the case of T.
solium and 13,738 bp for E. multilocularis) (M. Initiating and stop codons
Nakao et al., Asahikawa, unpublished obser-
vations). The heavy chains of the mtDNA of The earliest breakthrough in the study of
each have 12 genes encoding proteins, two mtDNA of the phylum Platyhelminthes was
ribosomal RNA (rRNA) genes and 22 transfer the determination of the sequence and codon
RNA (tRNA) genes (Fig. 5.2). assignments of a 3.5 kb mtDNA segment of
the trematode, Fasciola hepatica25–27,35. Bessho
et al.27 partially sequenced the cytochrome c
Gene order within mtDNA oxidase subunit I (COI) gene of mtDNA of
the planaria, Dugesia japonica and proposed a
Gene sequences constituting mitochondrial unique genetic code for planarian mtDNA.
genomes of various animal phyla are dia- The codon assignments of trematode and
grammatically depicted in Fig. 5.3. From the planarian are nearly similar except that the
Fig. 5.2. The mitochondrial genome of Taenia solium. Arrows indicate the direction of transcription
(COI–III: cytochrome c oxidase subunits I–III; ND1–6 and 4L: NADH dehydrogenase subunits 1–6 and
4L; ATP6: ATPase subunit 6; LrRNA and SrRNA: large and small subunit rRNAs). Genes for tRNAs are
indicated as abbreviated capital letters for amino acids. The gene arrangement of T. solium mtDNA is the
same as those of Echinococcus multilocularis and T. crassiceps mtDNAs.

50 A. Ito et al.
Vertebrata
Mus musculus
(16,295 bp)
Echinodermata
S. purpuratus
(15,650 bp)
Arthropoda
D. yakuba
(16,019 bp)
Nematoda
Caenorhabditis
elegans
(13,794 bp)
Platyhelminthes
Taenia solium
(13,709 bp)
Fig. 5.3. The arrangements of protein and rRNA genes among representative metazoan mitochondrial
genomes. The sites of tRNA genes are omitted from this figure. Arrows indicate the direction of transcription.
UAA codon specifies tyrosine in the latter. are unpaired and replaced by loops of 6–9
The codon sequences are unified into the nt. This unorthodox structure, particularly
mitochondrial code of the entire phylum in tRNAArg and tRNACys, has not been found
Platyhelminthes, and its range is conceived to in any other metazoan mitochondrion so
cover all three classes: Turbellaria, Trematoda far28.
and Cestoda. The genetic code is similar to The cestode mtDNA contains genes for
that of echinoderm mitochondria5; however large and small subunit rRNAs (LrRNA and
it differs from the universal code27. Our SrRNA) of mitochondrial ribosomes. The
group28 recently found that GUG is an initiat- putative LrRNA and SrRNA genes are 983
ing methionine codon and UAA is a termi- and 704 nt long, respectively (M. Nakao et
nating codon (Table 5.1). al., Asahikawa, unpublished observations).
The length of these genes are similar to those
of their nematode counterparts29 but are
tRNA and rRNA genes shorter than those of other metazoan mito-
chondrial rRNAs, so far reported. It is specu-
Individual sizes of 22 tRNA genes identified lated that the compactness of the cestode
in the cestode mtDNA range from 58 to 73 rRNAs results from the pressure to minimize
nucleotides (nt). The variations in length are the size of the mitochodrial genome.
mostly due to differences in stem and loop Predicted secondary structures of cestode
sizes of the D and T arms (M. Nakao et al., LrRNA and SrRNA are more similar to those
Asahikawa, unpublished observations). The of nematodes30 and trematodes2.
nucleotide compositions of cestode and
nematode mtDNAs are similar. However,
the secondary structures of their tRNAs dif- Polymorphism of T. solium: global
fer from each other. A majority of cestode variations
tRNAs (18 out of 22) can be folded into con-
ventional four-arm cloverleaf structures, A comparison of sequences of complete COI
whereas the remaining four [tRNASer(AGN), genes in different isolates of T. solium from
tRNASer(UCN), tRNAArg and tRNACys] have Asia (China, India, Indonesia, Thailand),
unorthodox structures wherein their D-arms Africa (Mozambique, Tanzania) and Latin

Table 5.1. The flatworm mitochondrial genetic code modified for cestodes.
TTT Phe (F) TCT Ser (S) TAT Tyr (Y) TGT Cys ( C )
TTC Phe (F) TCC Ser (S) TAC Tyr (Y) TGC Cys ( C )
TTA Leu (L) TCA Ser (S) TAA Stop TGA Trp (W)
TTG Leu (L) TCG Ser (S) TAG Stop TGG Trp (W)
CCT Leu (L) CCT Pro (P) CAT His (H) CGT Arg ( R )
CTC Leu (L) CCC Pro (P) CAC His (H) CGC Arg ( R )
CTA Leu (L) CCA Pro (P) CAA Gln (Q) CGA Arg ( R )
CTG Leu (L) CCG Pro (P) CAG Gln (Q) CGG Arg ( R)
ATT Ile (I) ACT Thr (T) AAT Asn (N) AGT Ser (S)
ATC Ile (I) ACC Thr (T) AAC Asn (N) AGC Ser (S)
ATA Ile (I) ACA Thr (T) AAA Asn (N) AGA Ser (S)
ATG* Met (M) ACG Thr (T) AAG Lys (K) AGG Ser (S)
GTT Val (V) GCT Ala (A) GAT Asp (D) GGT Gly (G)
GTC Val (V) GCC Ala (A) GAC Asp (D) GGC Gly (G)
GTA Val (V) GCA Ala (A) GAA Glu (E) GGA Gly (G)
GTG* Val (V) GCG Ala (A) GAG Glu (E) GGG Gly (G)
*Initiation codon.
America (Mexico, Ecuador and Peru) was rare in Asia. On the other hand, racemose
undertaken18,24. Based upon the sequencing cysticercosis is comparatively more com-
data, it was apparent that the Asian isolates mon in Central and South America.
differed from the African and American iso- Similarly, muscular cysticercosis leading to
lates (Fig. 5.4)24. We surmised that the simi- pseudohypertrophy has almost exclusively
larities between African and American been reported from China and India and is
isolates could be related to a common ances- uncommon in Central and South America.
tor or origin. Indeed, pigs were exported Furthermore, serological analysis of puri-
from Europe (perhaps, Spain or Portugal) to fied glycoproteins33 and the antigenic com-
Africa and America from the 15th century ponents of cyst fluid of T. solium cysticerci34
onwards. Therefore, it is conceivable that have revealed differences in the
African and American isolates of T. solium immunoblot profile of isolates from
were introduced by European colonization. Ecuador and Mozambique on one hand
The hypothesized export phenomenon and Irian Jaya, Indonesia and China on the
draws a parallel to the recent export of T. other hand (Fig. 5.5; A. Ito et al.,
solium from Bali to Irian Jaya after the latter Asahikawa, unpublished data).
came under Indonesian control in 196911,31,32. An increasing amount of travel, immigra-
The confirmation of the above hypothesis tion and refugeeism in the world is likely to
requires an analysis of the mtDNA of T. dilute strict geographical predilections of
solium isolated from Europe and the demon- any supposed strains and their different clin-
stration of its similarity to American and ical and serological expressions. This is likely
African strains24. to interfere with the determination of a logi-
The demonstrated differences in the COI cal inference of phylogenic relationships
gene sequences between Asian and between substrains as well as the study of
American–African isolates may be surmised epidemiology based on mitochondrial
to translate into different clinical implica- genomics. This however does not prevent us
tions. Indeed, there are differences in the from forming a preliminary opinion that
clinical spectrum of NC between Asia and there are indeed at least two different sub-
South America. For instance, parenchymal strains of T. solium based on differences in
NC and subcutaneous cysticercosis are their mitochondrial genomes, biological and
common while racemose cysticercosis is clinical behaviour.

52 A. Ito et al.
Mexico
Peru
COI gene
(1620 bp)
Tanzania A
Mozambique
981
0.01 Da Ecuador
Thailand
1000
Taenia solium India
China 2 B
China 1
1000
Irian Jaya
Taenia saginata
1000
Taenia asiatica
Echinococcus multilocularis
Fig. 5.4. A neighbour-joining phylogenetic tree of various isolates of Taenia solium. The tree was
constructed from complete nucleotide sequences of COI genes. Bootstrap values are shown in the tree
(group A: the African and Latin American isolates; group B: the Asian isolates).
Suggested Protocol for Collection of few months14. Morphological, microscopic

Material for mtDNA Studies and mtDNA studies are then performed
upon the larval stage with the intent of
While setting up a mitochondrial genomics obtaining epidemiological, species and
laboratory is an elaborate affair, the collec- other biological data. Cysticerci resected
tion of biological material is relatively sim- either from the brain or subcutaneous tis-
ple. Viable segments or eggs from taeniasic sue of humans may also be used as a source
individuals may be frozen or stored in for mtDNA32.
80–100% ethanol in a capped tube at 4°C for
mtDNA studies. Viable T. solium eggs may
also be prepared immediately from fresh Conclusions
segments. At our laboratory, oncospheres
are hatched in vitro and inoculated into the Most recently, the Asahikawa group in
peritoneal cavity of NOD-SCID mice to Japan has analysed the complete sequence
obtain well-developed cysticerci within a of mtDNA of T. solium. The mtDNA of T.

other cestodes including E. multilocularis, E.

granulosus and T. crassiceps. These cestodes
have a unique gene order that is different
from other animals except trematodes.
MtDNA studies have established similarities
between the Asian Taenia and T. saginata.
Furthermore, sequencing of the complete
COI gene has revealed differences between
isolates of T. solium from Asia and those
from Africa and America18,24. The genetic
diversity may have important biological,
serological and clinical implications and it is
likely that the two geographical isolates
have different ancestral origins. More such
studies, from different geographical loca-
tions, particularly Europe, are required. The
African and American isolates are believed
to have arisen out of European colonization.
Mitochondrial DNA studies may be the key
Fig. 5.5. Immunoblot figures of cysticercosis to demonstrate a link between European
patients from Latin America (Ecuador) reacting and American–African substrains.
with various cyst fluid of Taenia solium from
different continents. Lanes 1–4: Cyst fluid of T.
solium from pigs in Ecuador (lane 1), in Irian Jaya, Acknowledgements
Indonesia (lane 2), in China (lane 3) and in
Mozambique (lane 4).
This study was supported in part by grants
from the Nissan Science Foundation and the
Uehara Memorial Foundation, by a Grant-in-
solium consists of 13,709 bp and 12 protein Aid for International Scientific Research
genes, two rRNA genes and 22 tRNA genes (Joint Research, 06044089, 07044243,
located exclusively on the heavy chain. It 09044279) and by a Grant-in-Aid for Scientific
uniquely uses GUG as an initiating methion- Research (A) 11694259, (B) 10557029,
ine codon and UAA as a terminating codon. 12557024 to A. Ito and by a Grant-in-Aid for
The unique codon usages are shared by Scientific Research (C) 70155670 to M. Nakao.
REFERENCES
1. Barker, S., Blair, D. (1996) Molecular phylogeny of Schistosoma species supports traditional group-
ings within the genus. Journal of Parasitology 82, 292–298.
2. Blair, D., Le, T.H., Després, L., et al. (1999) Mitochondrial genes of Schistosoma mansoni. Parasitology
119, 303–313.
3. McManus, D.P., Hope, M. (1993) Molecular variation in human schistosomes. Acta Tropica 53,
255–276.
4. Kokaze, A., Miyadera, H., Kita, K., et al. (1997) Phylogenetic identification of Sparganum proliferum as
a pseudophyllidean cestode. Parasitology International 46, 271–279.
5. Smith, M.J., Arndt, A., Gorski, S., et al. (1993) The phylogeny of echinoderm classes based on mito-
chondrial gene arrangements. Journal of Molecular Evolution 36, 545–554.
6. Boore, J.L., Collins, M., Stanton, D., et al. (1995) Deducing the patterns of arthropod phylogeny from
mitochondrial DNA rearrangements. Nature 376, 163–165.
7. Boore, J.L., Lavrov, D., Brown, W.M. (1998) Gene translocation links insects and crustaceans. Nature
392, 667–668.

54 A. Ito et al.
8. Boore, J.L. (1999) Animal mitochondrial genomes. Nucleic Acids Research 27, 1767–1780.
9. Fan, P.C. (1988) Taiwan Taenia and taeniasis. Parasitology Today 4, 86–88.
10. Eom, K.S., Rim, H.J. (1993) Morphologic descriptions of Taenia asiatica sp. North Korean Journal of
11. Simanjuntak, G.M., Margono, S.S., Okamoto, M., et al. (1997) Taeniasis/cysticercosis in Indonesia as
an emerging disease. Parasitology Today 13, 321–323.
12. Ito, A. (1992) Cysticercosis in Asia-Pacific regions. Parasitology Today 8, 182–183.
13. Galan-Puchardes, M.T., Fuentes, M.V. (1999) Human cysticercosis and larval tropism of Taenia asiat-
ica. Parasitology Today 16, 174.
14. Ito, A., Nakaya, K., Sako, Y., et al. (2001) NOD-SCID mouse as an experimental animal model for
cysticercosis. Southeast Asian Journal of Tropical Medicine and Public Health 32 (Suppl.), 85–89.
15. McManus, D.P. (1990) Characterization of taeniid cestodes by DNA analysis. Revue Scientifique et
Technique 9, 489–510.
16. Bowles, J., McManus, D.P. (1994) Genetic characterization of the Asian Taenia, a newly described
taeniid cestode of humans. American Journal of Tropical Medicine and Hygiene 50, 33–44.
17. Zarlenga, D.S., George, M. (1995) Taenia crassiceps: cloning and mapping of mitochondrial DNA and
its application to the phenetic analysis of a new species of Taenia from Southeast Asia. Experimental
18. Okamoto, M., Nakao, M., Sako, Y., et al. (2001) Molecular variation of Taenia solium in the world.
Southeast Asian Journal of Tropical Medicine and Public Health 32 (Suppl.), 90–93.
19. Ito, A., Cheng, W.C., Chen, C.C., et al. (1997) Human Taenia eggs develop into cysticerci in SCID
mice. Parasitology 114, 85–88.
20. Ito, A., Ito, M., Eom, K.S., et al. (1997) In vitro hatched oncospheres of Asian Taenia from Korea and
Taiwan develop into cysticerci in the peritoneal cavity of female scid (severe combined immunodefi-
ciency) mice. International Journal for Parasitology 27, 631–633.
21. Ito, A., Ma, L., Sato, Y. (1997) Cystic metacestodes of a rat-adapted Taenia taeniaeformis established in
the peritoneal cavity of scid and nude mice. International Journal for Parasitology 27, 903–905.
22. Ito, A., Ito, M. (1999) Human Taenia in severe combined immunodeficiency (SCID) mice. Parasitology
Today 15, 64–67.
23. Fan, P.C., et al. (1995) Morphological description of Taenia saginata asiatica (Cyclophyllidea:
Taeniidae) from man in Asia. Journal of Helminthology 69, 299–303.
24. Nakao, M., Okamoto, M., Sako, Y., et al. (2002) A hypothesis for the distribution of two genotypes of
the pork tapeworm Taenia solium worldwide. Parasitology 126 (in press).
25. Garey, J.R., Wolstenholme, D.R. (1989) Platyhelminth mitochondrial DNA: evidence for early evolu-
tionary origin of a tRNASerAGN that contains a dihydrouridine arm replacement loop, and of ser-
ine-specifying AGA and AGG codons. Journal of Molecular Evolution 28, 374–387.
26. Ohma, T., Osawa, S., Watanabe, K., et al. (1990) Evolution of the mitochondrial genetic code IV.
AAA as an asparagine codon in some animal mitochondria. Journal of Molecular Evolution 30,
329–332.
27. Bessho, Y., Ohama, T., Osawa, S. (1992) Planarian mitochondria II. The unique genetic code as
deduced from cytochrome c oxidase subunit I gene sequences. Journal of Molecular Evolution 34,
331–335.
28. Nakao, M., Sako, Y., Yokoyama, N., et al. (2000) Mitochondrial genetic code of cestodes. Molecular
Biochemistry and Parasitology 111, 415–424.
29. Okimoto, R., Macfarlane, J.L., Clary, D.O., et al. (1992) The mitochondrial genomes of two nema-
todes, Caenorhabditis elegans and Ascaris suum. Genetics 130, 471–498.
30. Okimoto, R., Macfarlane, J.L., Wolstenholme, D.R. (1994) The mitochondrial ribosomal RNA
genes of the nematodes Caenorhabditis elegans and Ascaris suum: consensus secondary-structure
models and conserved nucleotide sets for phylogenetic analysis. Journal of Molecular Evolution 39,
598–613.
31. Schantz, P.M., Wilkins, P.P., Tsang, V.C.W. (1998) Immigrants, imaging and immunoblots: the emer-
Hughes, J.M. (eds) Emerging Infections 2. ASM Press, Washington, DC, pp. 213–242.
32. Wandra, T., Subahar, R., Simanjuntak, G.M., et al. (2000) Resurgence of cases of epileptic seizures
and burns associated with cysticercosis in Assologaima, Jayawijaya, Irian Jaya, Indonesia, 1991–95.
Transactions of the Royal Society of Tropical Medicine and Hygiene 94, 46–50.

33. Ito, A., Sako, Y., Nakao, M., et al. (1999) ELISA and immunoblot using purified glycoproteins for
serodiagnosis of cycsticercosis in pigs naturally injected with Taenia solium. Journal of Helminthology
73, 363–365.
34. Ito, A., Plancarte, A., Ma, L., et al. (1998) Novel antigens for neurocysticercosis: simple method for
preparation and evaluation for serodiagnosis. American Journal of Tropical Medicine and Hygiene 59,
291–294.
35. Ito, A., Plancarte, A., Nakao, M., et al. (2002) Neurocysticercosis in Asia: serology/seroepidemiology
in humans and pigs. In: Craig, P., Pawlowski, Z. (eds) Cestode Zoonoses: Echinococcosis and
Cysticercosis – an Emergent and Global Problem. IOS Press, Amsterdam, pp. 25–31.
36. Le, T.H., Blair, D., Agatsuma, T., et al. (2002) Phylogenies inferred from mitochondrial gene orders –
a cautionary tale from parasitic flatworms. Molecular Biology and Evolution 17, 1123–1125.

6
Hereditary Factors in
Neurocysticercosis with Emphasis on
Single, Small, Enhancing CT Lesions
Vasantha Padma, Satish Jain, Achal Srivastava, Manjari Tripathi

and Mahesh C. Maheshwari
Introduction these, subpopulations to exhibit differences

in disease manifestations and behaviour. On
Most human disorders are a result of an a different note, the study of genetic factors
interaction between environmental and may also unravel novel control strategies of
genetic factors. In certain diseases, there is a developing genetically engineered pigs that
dominant genetic influence and environmen- are resistant to cysticercosis and can effec-
tal agencies exert a modulating influence. In tively check the human–environment–pig–
others, the primary cause is an environmen- human cycle.
tal agent, most often a microbial, toxic or an The study of genetic influences in human
immune element, but in addition, there is a T. solium cysticercosis is at a preliminary
small but definite genetic predisposition. A stage. In this review, we present some of our
number of infectious and inflammatory dis- data on HLA studies in single, small,
orders fall into the latter category. Significant enhancing CT lesions (SSECTLs)5,6 and
in this context is the predisposition conferred review some of the published human7 and
by the major histocompatibility complex, experimental evidence8,9 of the influence of
also known as the ‘human leucocyte antigen the major histocompatibility complex in dis-
(HLA)’ on chromosome 61. Different alleles ease acquisition.
of the HLA genes either predispose or pro-
tect against specific disorders. Multiple scle-
rosis, systemic lupus erythematosus and HLA Studies in SSECTL
diabetes are examples of such disorders2–4.
Neurocysticercosis (NC) is a somatic form Aetiology of SSECTL
of taeniasis that is acquired by ingestion of
Taenia solium eggs. Environmental factors Computed tomography (CT) often demon-
including poor personal hygiene, improper strates SSECTLs or the so-called ‘disappear-
sanitation and inadequate pig husbandry are ing CT lesions’ in individuals with recent
primary reasons for its occurrence. The role seizures in several developing countries,
of genetic factors in NC has not been suffi- including India. These lesions are seen to be
ciently recognized. It might be interesting to associated with a benign form of seizure dis-
postulate the existence of genetic influence, order. Rajshekhar has reviewed the events
that predisposes certain populations to that led to the recognition of the aetiological
acquire T. solium cysticercosis, and among agent for SSECTL. The reader is referred to


58 V. Padma et al.
Chapter 24 for a review of aetiological con- quently in 41 randomly selected probands),

siderations. Current opinion links an over- HLA-DR B1*13 occurred in 29.3% of probands
whelming majority of the SSECTLs to T. in comparison to 9.7% in healthy controls (2 =
solium cysticercosis. This has been based 10.35; Pc = 0.036; relative risk (RR) = 3.83). In
upon histological findings, which have been addition, HLA-DR B1*09 was observed with
summarized in this book by Chacko (see an increased frequency in probands (7.3 vs.
Chapter 31). However, other aetiological 1.3%; 2 = 4.69; RR = 6). No other class II anti-
agents such as tuberculosis, brain abscesses gens deviated significantly from control5. The
and miscellaneous inflammatory conditions HLA Class II genomic typing results in our
cannot be completely disregarded10. patients are statistically significant. These
associations may be surmised to be an indica-
tor of susceptibility to an infection or infesta-
HLA studies tion in Indian patients with seizures. From a
different viewpoint, our report adds to the list
We performed HLA studies in 63 Indian of results associating different class I and class
probands with seizures and SSECTL, and II alleles with epileptic syndromes such as
also studied the occurrence of seizure types juvenile myoclonic epilepsy, Lennox–Gastaut
among their family members5. All probands syndrome and severe myoclonic epilepsy in
included in the study were clinically evalu- infants11–17.
ated by one of the three authors (SJ, MCM, We hypothesized that the condition to
and VP). Family pedigrees were drawn to which we have been assigning different
include all the first- and second-degree rela- names is actually an ‘imaging phenotype’.
tives of the probands. Information on This CT lesion represents a benign epileptic
affected relatives was collected and, wher- syndrome that occurs predominantly in Asian
ever possible, the affected relatives were Indians. The results of our preliminary study
examined in the outpatient clinic. All prompted us to investigate further, hereditary
probands and affected relatives underwent factors in this syndrome. We reported clinical
electroencephalographic evaluations. CT features in 235 Indian probands with seizures
scan was done when possible and indicated. in association with SSECTL along with those
All 63 patients and 340 healthy controls were in their family members6. HLA class II anti-
serologically tested using complement medi- gen frequencies were further studied in 41
ated standard micro-lymphotoxicity test for randomly selected probands.
HLA-A, HLA-B and HLA-C antigens. A total of 235 individuals with SSECTL
We found a positive family history of were followed at the outpatient clinic of the
seizures among 16 out of 63 (25%) Neurology Department, Neurosciences
probands with SSECTL. Among affected Center, All India Institute of Medical
relatives, 13% had symptomatic general- Sciences, New Delhi. These patients repre-
ized epilepsy. A SSECTL was noted in four sented the ethnic groups of North Indian
relatives (17%). The occurrence of different Hindus. Follow-up CT scan revealed com-
epileptic syndromes among the relatives plete or nearly complete (only a residual cal-
prompted us to consider either a genetic cified dot) spontaneous resolution of the
contribution in the aetiopathogenesis of lesion in all cases with no specific therapy.
this syndrome or a hereditary susceptibility Individuals in whom the CT lesion resolved
to an environmental agent5. while they were taking antitubercular or
Further, preliminary results of HLA class I anticysticercal drugs, antibiotics and steroids
studies revealed that the frequencies of HLA- were excluded6. Family history of seizures
A11 were decreased, whereas those of HLA- was considered positive when one or more
B63 and HLA-B58 were increased in first- or second-degree relative had seizures.
probands, when compared with healthy con- Family pedigrees were similarly drawn for
trols (the values were not significant after probands having other neurological disease,
application of correction factor for P value). for instance, muscular dystrophy, to deter-
Among HLA class II antigens (tested subse- mine the occurrence of seizures in their fam-

Hereditary Factors in Neurocysticercosis 59
ily members. The affected relatives with 13 in Arab patients14,19,20. Some ‘genes’ pre-
seizures in these families also were examined disposing to the susceptibility to seizures
in the same way as the affected relatives of may be located near the HLA locus. From
probands. The 41 patients (from a total 235) this viewpoint, seizures in association with
included for HLA-DR typing were unrelated SSECTL in Asian Indians may represent a
and randomly selected. HLA-DR typing also genetically determined predisposition to a
was performed on 154 healthy controls (from unique benign epileptic syndrome with par-
the same ethnic groups living in the same ticular imaging characteristics.
geographic region)18.
A history of seizures was documented
among first- and second-degree relatives of HLA Studies in Human
50 (21%) probands. A first-degree relative Neurocysticercosis
was affected in 35 and a second-degree rela-
tive in 15 probands. Thirty-eight (3%) of 1212 From a contrasting point of view to that pre-
first-degree relatives and 28 (0.8%) of 3379 sented above, HLA associations have been
second-degree relatives were affected. reported with other infective diseases such
Therefore, the ratio of affected first- as leprosy, tuberculosis and cysticerco-
degree : second-degree relatives was 4.3 : 1. sis7,21,22. Del Brutto et al. reported signifi-
Localization-related epilepsies were more cantly increased frequency of HLA-A28 and
common among first-degree relatives decreased frequency of HLA-DQW2 in a
(P0.05), whereas generalized epilepsies Mexican cohort with parenchymal NC7. The
were more often noted among second-degree authors surmised that HLA-A28 confers sus-
relatives (P0.01). Interestingly, seven of 35 ceptibility to NC, while HLA-DQW2 accords
first-degree relatives had seizures in associa- resistance. With a similar view, our results of
tion with SSECTL compared with only one HLA studies in the Indian probands with
of 15 second-degree relatives. Other syn- SSECTLs point to an increased susceptibility
dromes were almost equally distributed to an infective agent such as cysticercosis. It
among the relatives. Among affected first- is also possible that affected relatives of
degree relatives, seven had localization- individuals with SSECTLs were exposed to
related epilepsy, while five had SSECTL. the common causative agent (through food
Among 1587 first- and 3797 second-degree and water for cysticercosis). The high preva-
relatives of 212 controls with neurological lence of seizures among first-degree rela-
diseases other than epilepsy, 20 first- and tives could also be reflection of an exposure
four second-degree relatives had epilepsy. to a common environmental agent.
Affected probands had a significantly higher
frequency or a positive family history in
comparison to controls6. Experimental Evidence for a Genetic
HLA-DR B1*13 was expressed in 29.3% of Contribution
probands in comparison to 97% in healthy
controls (2 = 10.35; RR = 3.83). On the other Fragoso et al. investigated the influence of non-
hand, HLA-DR B1*09 was observed with an classic Class I MHC Qa-2 antigen expression
increased frequency in probands (7.3 vs. 1.3%; and acquisition of T. crassiceps cysticercosis in
2 = 4.69; RR = 6). None of the other class II mice8. The authors found that the
antigens tested revealed any significant devia- BALB/cAnN substrain of mice, which did not
tion in patients as compared to controls6. express Qa-2 antigen was highly susceptible to
Several previously published reports sug- infection, while another substrain BALB/cJ,
gest a role of the HLA system in different which expressed Qa-2 was resistant to T. crassi-
epileptic syndromes11,13,14,19,20. Juvenile ceps cysticercosis. In further experiments, Qa-2
myoclonic epilepsy was shown to be linked transgenic mice (C57BL/67/BALBcAnN) were
to the BF and HLA loci on human chromo- backcrossed to BALB/cAnN mice and then
some 6 in two population groups from the infected with T. crassiceps9. A significantly
United States and Germany, and HLA-DRW lower yield of cysticercus larvae was noted in

60 V. Padma et al.
the Qa-2 transgenic mice than in non-transgenic Conclusions

mice. These studies have established a definite
relationship between Qa-2 antigen expression Several HLA molecules have been demon-
and resistance to infection with T. crassiceps cys- strated to confer susceptibility or resistance
ticercosis in mice. Furthermore, human Class I to cysticercosis in humans with SSECTLs,
MHC, HLA-G has been suggested to be func- NC and in experimental models of a related
tionally similar to murine Qa-2. The experimen- cysticercus. The identification of these
tal data outlined above are significant for the genetic factors offers the promise of develop-
understanding of factors that lead to resistance ing strategies for inducing resistance to cys-
or susceptibility to cysticercosis. ticercosis through genetic manipulation.
References
1. Robinson, J., Waller, M.J., Parham, P., et al. (2001) IMGT/HLA database – a sequence database for
the human major histocompatibility complex. Nucleic Acids Research 29, 210–213.
2. Ruiz, N., Giudecelli, V., Ginestoux, C., et al. (2000) IMGT, the international immunogenetics data-
base. Nucleic Acids Research 28, 219–221.
3. Nepom, G.T., Nepom, B.S. (1992) Prediction of susceptibility to rheumatoid arthritis by human
leukocyte antigen genotyping. Rheumatic Diseases Clinics of North America 18, 785–794.
4. Subbah, I., Savola, K., Ebeling, T., et al. (2000) Genetic, autoimmune and clinical characteristics of
childhood- and adult-onset type 1 diabetes. Diabetes Care 23, 1326–1332.
5. Jain, S., Padma, M.V., Kanga, U., et al. (1997) Human leukocyte antigen studies in Indian probands
with seizures associated with single small enhancing computed tomography lesions and seizure
types in their family members. Journal of Epilepsy 10, 55–61.
6. Jain, S., Padma, M.V., Kanga, U., et al. (1999) Family studies and human leukocyte antigen class II
typing in Indian probands with seizures in association with single small enhancing computed
tomography lesions. Epilepsia 40, 232–238.
7. Del Brutto, O.H., Granados, G., Talamas, O., et al. (1991) Genetic pattern of the HLA system: HLA A, B,
C, DR, DQ antigens in Mexican patients with parenchymal brain cysticercosis. Human Biology 63, 85–93.
8. Frogoso, G., Lamoyi, E., Mellor, A., et al. (1996) Genetic control of susceptibility to Taenia crassiceps
cysticercosis. Parasitology 112, 119–124.
9. Frogoso, G., Lamoyi, E., Mellor, A., et al. (1998) Increased resistance to Taenia crassiceps murine cys-
ticercosis in Qa-2 transgenic mice. Infection and Immunity 66, 760–764.
10. Padma, M.V., Behari, M., Misra, N.K., et al. (1994) Albendazole in single CT ring lesions in epilepsy.
Neurology 44, 1344–1346.
11. Durner, M., Janz, D., Zingsem, J., et al. (1992) Possible association of juvenile myoclonic epilepsy
with HLA-DRw6. Epilepsia 33, 814–816.
12. Arali, J.A. (1993) Immunological aspects of epilepsy. Brain Development 15, 41–49.
13. van Engelen, B.G., de Waal, L.P., Weemeas, C.M., et al. (1994) Serologic HLA typing in cryptogenic
Lennox Gastaut syndrome. Epilepsy Research 17, 43–47.
14. Obeid, T., el Rab, M.O., Daif, A.K., et al. (1994) Is HLA-DRw13 (W6) associated with juvenile
myoclonic epilepsy in Arab patients? Epilepsia 35, 319–321.
15. Moen, T., Brodtkorb, E., Michler, R.P., et al. (1995) Juvenile myoclonic epilepsy and human leukocyte
antigens. Seizure 4, 119–122.
16. Oguni, H., Uehara, T., Fzumi, T., et al. (1995) Immunogenetic study of patients with severe
myoclonic epilepsy in infants and its variant. Epilepsia 36 (Suppl. 3), S9–10.
17. Suastegui, R.A., De la Rosa, G., Fonzalez-Austiazaran, A., et al. (1995) HLA – class II genetic markers
are involved in resistance/susceptibility for the expression of massive spasm. Epilepsia 36 (Suppl. 3),
S10.
18. Mehra, N.K., Verduijn, W., Taneja, V., et al. (1991) Analysis of HLA-DR2 associated polymorphism
by oligonucleotide hybridization in an Asian Indian population. Human Immunology 32, 246–253.
19. Greenberg, D.A., Delgado-Escueta, A.V., Widlitz, H., et al. (1988) Juvenile myoclonic epilepsy may
be linked to the BF and HLA loci on human chromosome 6. American Journal of Medical Genetics
31, 185–192.

Hereditary Factors in Neurocysticercosis 61
20. Liu, A.W., Delgado-Escueta, A.V., Serratose, J.M., et al. (1995) Juvenile myoclonic epilepsy locus in
chromosome 6p21.2–p11: linkage to convulsions and electroencephalographic trait. American Journal
of Human Genetics 57, 368–381.
21. Zerva, L., Ciznam, B., Mehra, N.K., et al. (1996) Arginine at positions 13 or 70–71 in pocket 4 of
HLA-DRB1 alleles is associated with susceptibility to tuberculoid leprosy. Journal of Experimental
Medicine 183, 829–836.
22. Rajalingam, R., Mehra, N.K., Jain, R.C., et al. (1996) Polymerase chain reaction-based sequence spe-
cific oligonucleotide hybridization analysis of HLA class II antigens in pulmonary tuberculosis: rele-
vance to chemotherapy and disease severity. Journal of Infectious Diseases 173, 669–676.

7 Taenia solium Cysticercosis: an

Overview of Global Distribution and
Transmission
Peter M. Schantz
Introduction History
Taeniasis/cysticercosis caused by Taenia Prominently visible in both its intestinal and

solium, often referred to as the pork tape- tissue stages, the macroparasite T. solium has
worm, is a classical zoonosis, recognized been known since the earliest times.
since antiquity, which, as a result of a vari- Spontaneous elimination of individual tape-
ety of demographical, technological and worm segments was alluded to by writers at
political factors, has emerged as an increas- the beginnings of recorded history2. The
ingly important disease in regions where it ancient Greeks made reference to ‘measles’
has long been endemic, as well as in regions in pork, which were in fact larval cysticerci;
into which it has been imported or intro- however, their significance was not under-
duced. The two-host life cycle of the tape- stood. Aristotle compared their appearance
worm involves humans as definitive hosts to hailstones; he and others regarded them
and swine as intermediate hosts. Infected as worm-like animals. In the 16th century,
pigs are the source of human taeniasis, an European pathologists associated the condi-
intestinal tapeworm infection acquired by tion with disease in humans and described
eating undercooked pork contaminated cysticerci in the brains of epileptic persons.
with cysticerci, the larval stage of the ces- By the mid-19th century a number of investi-
tode. Cysticercosis, however, is acquired by gators had demonstrated the link between
ingesting Taenia eggs shed in the faeces of a cystic and strobilar (intestinal) forms of sev-
human tapeworm carrier and thus may eral species of Taenia by showing that cystic
occur in humans who neither eat pork nor forms metamorphosed into adult worms
share environments with pigs. Although when ingested by suitable hosts. This rela-
cysticerci may localize throughout the body, tionship for T. solium was confirmed in 1855
most clinical manifestations result from by Küchenmeister who administered cyst-
their presence in the central nervous system infected pork to a condemned criminal and
(neurocysticercosis (NC)), where they can observed developing adult forms in the
cause seizures, hydrocephalus and other man’s intestine after his execution2. About
neurological disorders1. the same time, van Beneden in Belgium


64 P.M. Schantz
demonstrated that he could produce cys- most of the rest of Western Europe, similar
ticerci in the muscles of pigs by feeding them or higher prevalence rates have been docu-
T. solium eggs obtained from tapeworm segmented recently in parts of Africa, Asia, and
ments passed by infected humans. Further Central and South America4. Improvements
studies confirmed that humans alone were in diagnosis (neuroimaging methods and
the definitive host of the worm and pigs specific antibody detection) have revolution-
were the only significant intermediate host; ized the antemortem recognition of this dis-
thus, the reasons for the well-recognized ease, thus improving our understanding of
paucity of infection in Moslems and Jews, for the nature of the disease and its true preva-
whom Mosaic laws forbade the ingestion of lence while large-scale migration of popula-
pork, could then be understood. Scattered tions in modern times have continued to
reports suggest that the infection was preva- expand its distribution.
lent in pigs and in humans in various parts
of the world; however, highest rates of trans-
mission most likely occurred in populations Geographic Distribution
with the poorest recorded medical documen-
tation. During the first half of the 19th Taenia solium infection is widely endemic in
century, approximately 2% of postmortem rural areas of developing countries in
examinations of humans conducted in Central and South America, Asia and Africa
Berlin, Germany, revealed cysticercosis and (Fig. 7.1). Published reports document the
details of the clinical and pathologic charac- occurrence of clinical NC in most of the
teristics of NC were extensively described in countries of the Americas (most notably
German medical literature by the turn of the Mexico, Guatemala, El Salvador, Honduras,
20th century3. Although the infection has Colombia, Ecuador, Peru, Bolivia and Brazil).
been virtually eliminated from Germany and The infection was reported to be present in
Fig. 7.1. Approximate global geographic distribution of Taenia solium.

Global Distribution and Transmission 65
18 countries of South and Central America West Kalimantan, Sulawesi, Flores, East
whose combined populations represented Timor and Irian Jaya10,11. The cestode was
94% of the total 1980 population of the Latin apparently introduced into Irian Jaya in
American countries5. Of the American coun- recent times when swine from Bali were
tries, only Canada, the United States, translocated to (former) West New Guinea12.
Argentina and Uruguay appear to be free of Improvements in socio-economic conditions
transmission in the pig–human cycle; how- were associated with reduction or disappear-
ever, these latter countries are observing an ance of the infection in Japan, Taiwan, Hong
increase in imported and introduced infec- Kong, Singapore, and Thailand, where, in
tions related to immigration of persons from recent years, most cases diagnosed were
neighbouring countries where T. solium apparently imported.
infection is endemic4. No information is In Africa, T. solium is transmitted through-
available concerning the occurrence, or out most of the continent with the exception
absence, of infection in Guyana, Suriname of the strictly Muslim areas of North and
and French Guiana. sub-Saharan Africa. NC is an important
In Asia, most available data are from cause of neurological disability in regions of
clinic-based populations and, consequently, Africa in which it has been studied; epilepsy
are biased in terms of the true geographic in several countries has been documented to
origin and epidemiologic factors associated be caused by T. solium infection in 30–51% of
with transmission. Transmission in much of cases13. In Africa, as in Asia, subcutaneous
Asia is strongly influenced by prevailing cul- localization of cysticerci, concomitant with
tural practices and socio-economic condi- intracerebral infection, is common (30%);
tions. In India, for example, intestinal-stage this is in contrast to the infection in
T. solium infections occur mainly in pork-eat- American countries where subcutaneous
ing populations, particularly in rural popula- localization in patients with NC is relatively
tions and lower socio-economic classes; 78% rare4. Because of the limited development of
of children of pig farmers were reported to medical and sanitary infrastructure, the
be passing taeniid eggs6,7. Vegetarian popu- impact of the disease may be underestimated
lations are presumably exposed to cysticer- to a greater degree than in other regions. The
cosis through direct and indirect contact widespread absence of sanitary services,
with Taenia carriers. The vast majority of especially adequate disposal of human
clinical cases reported in India are of the sin- excrement, and the frequent practice of
gle-lesion variety with relatively mild symp- allowing pigs to roam free, permits transmis-
toms and benign outcome; these are believed sion of T. solium in most of the regions.
to be associated with exposure to eggs in Controlled slaughter of swine is rarely prac-
contaminated foodstuffs or other indirect tised and consequently cysticerci-infected
exposure to tapeworm carriers8. Curiously, pork is generally consumed by humans who
the greatest number of cases of the rare, mas- either ignore or are ignorant of its signifi-
sive, disseminated form of the disease have cance14,15. In South Africa, Zimbabwe and
also been reported from India; the explana- Madagascar where medical services are rela-
tions for these extremes are unknown9. As tively sophisticated, NC has long been a sub-
might be expected, there are no reports from ject of scientific reports16–19; from other
the strictly Moslem countries of Iran, regions, however, there are very limited data
Pakistan, Afghanistan and Bangladesh. because of the lack of diagnostic facilities.
Human NC is reported widely from China NC is reportedly a common clinical entity in
and parts of Korea. It is known to occur also, many countries of West Africa (Senegal,
although few published data are available, in Benin, Ivory Coast, Togo, Ghana) and
the Southeastern Asian countries of Central Africa (Zaire, Cameroon, Burundi
Myanmar, Cambodia, Laos, Vietnam and and Rwanda)20. Few reports of NC in
parts of the Philippines. In Indonesia, T. humans in East Africa have been docu-
solium infection is endemic in parts of mented; however, a recent report of T. solium
numerous islands including Sumatra, Bali, cysticercosis in 13% of pigs slaughtered in

66 P.M. Schantz
three abattoirs in Tanzania suggests that the diagnoses of NC have been reported from
cestode occurs in at least some regions21. many other countries; however, such statis-
There is increasing recognition that the med- tics are misleading because differences in
ical and economic costs of T. solium cysticer- availability of medical services and lack of
cosis are greatly underestimated in countries comprehensive and consistent reporting in
like Tanzania, Zambia, Zimbabwe and South most countries confound attempts to com-
Africa and efforts are underway to docu- pare incidence and prevalence between coun-
ment these costs and to organize effective tries and, within a country, between rural and
methods of prevention and control (A.L. urban areas. For example, extensive docu-
Willingham, Frederiksberg, Denmark and mentation in the medical literature on the
R.C. Krecek, Onderstepoort, South Africa, occurrence of NC in Mexico over many years
personal communication, 2000). might have suggested that the disease was
Historically, T. solium occurred widely in more prevalent there than in neighbouring
European countries; indeed, many of the ear- countries; however, recent surveys using
liest recorded observations about the parasite modern diagnostic techniques reveal that the
and its life cycle were reported by European prevalences of T. solium infection in some
authors2. In the mid-19th century, it was countries of the region exceed rates in Mexico
reported that cysticerci were observed in 2% by considerable margins (Table 7.1). In all
of autopsied human cadavers in Germany countries, improved diagnostic technology,
and infections were commonly observed in new options for treatment, and greater
swine at slaughter2. The same was apparently awareness of cysticercosis by the medical and
true in many countries of the continent. public health communities have resulted in
Today, as a result of improvements in swine documentation of increased numbers of cases
husbandry, sanitation and hygiene, the infec- diagnosed in traditional disease-endemic
tion has largely disappeared; however, locally areas as well as new disclosures of active
acquired infections are still occasionally transmission from regions where the disease
reported from Spain (Castilla, Extremadura was previously unrecognized or not
and Andalucia)22,23, northern Portugal24, reported. Recent surveys and epidemiologi-
southern Italy25 and Poland (Z. Pawlowski cal studies, using state-of-the-art diagnostic
and A. Ramisz, Poznan, Poland, personal methods26, have begun to document the
communication, 1997), indicating persisting occurrence of the infection and its impact on
foci of transmission in some regions. affected populations. Table 7.1 compares
recent prevalence estimates for T. solium cys-
ticercosis and taeniasis in humans and cys-
Prevalence Data ticercosis in pigs in surveys of
community-based population samples in
Until recently, the only available quantitative Latin America in which comparable diagnos-
data on cysticercosis from any country were tic methods were used27–40. Prevalence varied
clinic-based statistics on the frequency of NC among communities; however, a consistent
among hospital patients or autopsied cadav- relative pattern of prevalence ratios of the
ers. In Mexico, for example, NC has long different forms of infection has been
been considered to have an important impact observed. Prevalences of intestinal stage
on health services expenditures. Through the infection (taeniasis) are relatively low; how-
1980s, this diagnosis accounted for nearly 9% ever, rates of cysticercosis in humans and
of admissions in neurology and neurosurgi- pigs are usually related quantitatively to the
cal services and was the final diagnosis in rates of taeniasis. People in affected commu-
11–25% of patients operated on for removal nities are not usually aware that the parasitic
of brain tumours1. NC was found in 2.8–3.6% cysts they see in the meat of pigs is the cause
of all autopsies in Mexico City hospitals and of seizures and other neurological disorders;
was reported as the cause of death in however, use of modern serological and
0.6–1.5% of hospitalized patients. Similar sta- imaging diagnostic technology has identified
tistics documenting the frequency of clinical NC as the most important contributor to the

Table 7.1. Prevalence estimates of Taenia solium cysticercosis and taeniasis in humans and pigs in
Latin American communities.
Sero- Prevalence
prevalence of Prevalence
Sample (EITB1) taeniasis in pigs
Country Community size (%) (%) (%) Reference
Mexico Angahuan 1552 10.8 0.3e 4.0t Sarti et al., 1992, 199428,27
Mexico Xoxocotla 1005 4.9 0.2e 6.5t Sarti et al., 199229
Guatemala Quesada 862 11.0 1.0c,e 4.0t Allan et al.,199630,
Garcia Noval et al., 200131
Guatemala El Jocote 955 20.0 2.8c,e 14.0t Allan et al.,199630,
Garcia-Noval et al., 200131
Honduras Military Ï urban

(363)
15.0 0 n.d. Sanchez et al.,
199832
recruits Ì rural 22.0 0.6e n.d.
Ó (41)
Honduras Agua 68 34.0 1.5e n.d. Sanchez et al.,
Caliente 536 199733
Honduras Salama 480 17.0 2.5e 27.1t Sanchez et al.,
County 199934 , Sakai
et al., 199835
Bolivia ‘rural 159 22.6 n.d. 38.9i Tsang and Wilson,
community’ 199536
Ecuador San Pablo 118 10.4 n.d. 7.5t Cruz et al., 199837
del Lago
Peru Lima 250 0 n.d. 0 Tsang and Wilson,
(urban) 199536
Peru Maceda 371 8.0 0.3e 43.0i Diaz et al., 199238
Peru Churusapa 134 7.0 n.d. 49.0i García et al., 199639
Peru Haparquilla 108 13.0 n.d. 46.0i García et al., 199639
Peru Monterredonda 489 16.0 n.d. 13.0i García et al., 199639
Peru Quilcas 18.0 n.d. 60–70i García et al., 199639
Peru Saylla 99 24.0 8.6i 36.0i García et al., 199639,
199940
Notes:
1. EITB: enzyme-linked immunoelectrotransfer blot.
2. Prevalence of antibodies to cysticercosis measured in humans by EITB assay (Reference 26).
3. Prevalence of taeniasis measured by examination of faecal specimens for eggs e or coproantigensc or
both.
4. Prevalence of cysticercosis in pigs measured by visual examination and palpation of tongue t or
detection of antibodies by EITB assay i.
5. n.d.: not done.
high rates of epilepsy and migraine serological (21–34%) or neurological imaging

headaches in many regions where T. solium (54–70%) evidence of NC31,37,41. It is impor-
infection is endemic. For example, in commu- tant to note that the seizure episodes in these
nity-based studies from Mexico, Guatemala, rural people had not previously been linked
Honduras, Ecuador and Peru, large propor- to NC and it required this type of active diag-
tions of persons with histories of seizures had nostic intervention to be able to demonstrate

68 P.M. Schantz
the impact of the disease on the health of purposefully, e.g. ‘pig-sty privies’, thus also
these communities. leading to transmission of T. solium. Such
Using data on seroprevalence and seizure conditions may appear to be the endpoint of
disorder rates from multiple population- social neglect but usually represent an effec-
based community studies in Peru, Bern et al. tive adaptation to poverty and circumstance
estimated that there were from 23,512 to whereby the pig is nourished adequately at
39,186 symptomatic cases of NC in Peru virtually no cost to the owner and, simulta-
alone42. Extrapolating from limited serologi- neously, serves as a community scavenger or
cal surveys in other countries of Latin ‘sanitary police’. Through coprophagy, pigs
America, these authors calculated that 30–50 readily become infected, often at high rates
million persons may have been exposed to T. and very intense levels. Recent surveys in
solium in Latin America alone and that there disease-endemic communities of Latin
were an estimated 400,000 infected persons America have revealed that infection rates in
with symptomatic disease. In most countries pigs approach 5–50%27–31,35,36,39,44–46. In T.
where T. solium infection is endemic, com- solium-endemic areas, local populations,
munity-based prevalence data are not yet including pig owners, are often unaware of
available and there exist no realistic, data- the threat to public health that this infection
based estimates of the worldwide prevalence in pigs represents and do not relate the
of T. solium infection in humans, however, lesions in their animals to disease in humans.
the diagnostic technology now exists to Nevertheless, pig owners may routinely
begin to amass such data. There is a need for check their live pigs for cysticercosis by
provision of diagnostic and therapeutic direct examination of the tongue. This con-
resources at the community level to deter- cern is motivated by the knowledge that cys-
mine the prevalence of infection and rates of ticerci-infected meat may be rejected at
associated morbidity. slaughter (where visual meat inspection is
practised) or will bring a significantly
reduced price. Consequently, infected pigs
Patterns of Transmission may be slaughtered and sold clandestinely
or consumed by the pig-owner’s family. In
Endemic transmission villages of Central Peru, where infection
rates in pigs varied from 14% to 25%, virtu-
Throughout its worldwide distribution, T. ally none of the infected pigs were processed
solium is maintained by cyclic transmission at the local slaughterhouse. Rather, pig own-
in swine and human hosts. More than 40 ers and vendors purposefully bypassed for-
years ago, T. solium infection was called a mal slaughterhouses. The investigators
‘testimony to under-development’43; that estimated that 23% of the total pork con-
characterization remains true today. sumed in the community was derived from
Transmission of T. solium requires that pigs pigs infected with cysticerci46. Studies in
have access to human faeces and that Mexico, Guatemala and Peru have shown
humans ingest inadequately cooked meat of that the principal factors associated with the
pigs. Such conditions are common in rural likelihood of infection in pigs include
areas of many under-developed or unevenly increasing age and access to human faeces.
developed countries characterized by poor Confined pigs tend to be protected from
hygiene, deficient sanitary facilities and infection but only if confinement is habitual
primitive swine husbandry practices that and they are not deliberately fed faeces28,29,47.
allow pigs to run loose all or part of the time; Improved understanding of the epi-
such communities have not yet directly ben- demiology of T. solium transmission
efited from the achievements in sanitation requires a better understanding of the risk
and hygiene often referred to as the ‘first factors for intestinal-stage infection and the
public health revolution’. In certain situa- modes of dispersal of infective eggs by
tions where pigs are kept in enclosures or are human tapeworm carriers because taeniid
restrained, they may be fed human faeces eggs in faeces or contamination of the

hands of infected humans are the direct Imported and introduced disease
source of cysticercosis in both pigs and
humans. Surveys in disease-endemic com- Imported cases of T. solium taeniasis/cysticer-
munities in Mexico, Guatemala, Peru and cosis are those acquired in a foreign country.
Honduras have shown rates of T. solium Onset of illness in NC typically occurs a year
taeniasis varying from 0.3% to or more after initial acquisition of the infec-
6%27,29,30,35,38. Factors associated with taeni- tion; therefore, among internationally mobile
asis include age (rates of intestinal taeniid persons exposed to infection, it is not uncom-
infections tend to peak in middle adult- mon that development of the disease occurs in
hood; however, infections occur in all age a country different from that in which the
groups) and frequency of pork consump- infection was acquired (‘imported case’).
tion11,29,30,38. In some populations, taeniid Returning tourists or immigrants can also
infections are observed significantly more import intestinal-stage T. solium infections into
frequently in women than in men29,30. The the country; when the tapeworm carrier trav-
presence of a tapeworm-infected individual els home or emigrates to a foreign country and
within a household is an important risk fac- inadvertently transmits the infection to
tor for exposure to T. solium cysticercosis another person, or to a pig, the infection has
and this risk may be increased if the tape- been ‘introduced’ to the host country. More
worm carrier is an individual engaged in rarely, the infection can be introduced by inter-
food preparation and child care activities. national transport of infected pigs and subse-
In Peruvian mountain villages, food han- quent consumption of their infected meat.10,12
dlers engaged in preparing and selling a
traditional pork dish (‘chicharrones’) were
Imported disease
shown to harbour intestinal taeniid infec-
tions at a significantly higher rate than A unique historical epidemic of imported
other persons in the community39,40. NC was that which occurred in British
Serological screening of humans from these troops stationed in India. In at least 450 cases
villages documented levels of apparent soldiers or their family members developed
exposure to T. solium cysticercosis varying symptoms 1–30 years (average: 5 years) fol-
from 5% to 24% (Table 7.1). Significantly lowing their deployment in India48.
higher levels of seropositivity in humans Approximately a quarter of these patients
were associated with low levels of sanitary reported a history of taeniasis; however, little
infrastructure and personal hygiene, age other information was reported on their pos-
more than 20 years and personal histories sible sources of infection. More recently,
of taeniasis. Highest seropositivity rates imported cases of NC are diagnosed every
were found in persons with multiple fac- year in countries throughout the world in
tors39, suggesting that these apparent risk immigrants or tourists returning from coun-
factors and behaviours acted cumulatively. tries where T. solium infection is endemic.
In some communities, there was evidence This phenomenon is fed by the recent
of ‘clustering’ of seropositive persons in increase in international movement as a
households of persons with histories of or result of tourist and business travel and emi-
current taeniasis28,29,30,37. In Guatemala, for gration (the World Tourist Organization cur-
example, one-third of all seropositive per- rently estimates that at least 400 million
sons were clustered within the same house- international border crossings occur each
holds30. These observations suggest a year). In recent years, imported cases of NC
‘focal’ pattern of transmission associated have been reported from Australia49–51,
with the presence of a tapeworm carrier. Norway52, Spain23, Argentina53, Denmark54
There is a need for further studies in other and the USA55. By virtue of the number of
areas where T. solium is currently transmit- immigrants entering the USA every year
ted to be able to provide baseline epidemio- from countries where T. solium infection
logical data and suggest strategies for is endemic, more cases of imported NC
control. are diagnosed in that country every year

70 P.M. Schantz
than in all other non-endemic countries com- Conclusions

bined. The recently completed 2000 US
Census recorded 35.3 million persons of The only effective solution to the public
Hispanic origin living in the USA represent- health problem of T. solium cysticercosis is
ing an increase of 12.9 million in the past to prevent transmission of the zoonotic ces-
decade56. Because immigration to the USA tode in the thousands of rural communities
from countries where T. solium infection is in Latin America, Africa and Asia where
endemic continues to rise, the numbers of conditions exist to permit the life cycle of T.
imported cases of NC as well as local trans- solium to be completed. Taenia solium infec-
mission from imported tapeworm carriers tion is widely endemic in rural areas of
are likely to increase. Aspects of the impact developing countries where political, socio-
of this continuing wave of immigration into economic and environmental conditions
the USA on the epidemiology of T. solium permit the tapeworm’s life cycle in pigs
infection are discussed in greater detail else- and humans to be completed. Active inter-
where in this volume (see Chapter 14) vention for control of T. solium infection is
still at its infancy and there are many eco-
nomic and social problems existing in most
Introduced disease
disease-endemic areas that hinder imple-
On rare occasions, T. solium has been intro- mentation of these programmes.
duced into a new area and spread epidemi- Even though special studies reveal that
cally. Such was the case in West Papua (Irian morbidity caused by NC can be severe in
Jaya) where the infection was introduced disease-endemic populations, the nature of
through swine brought from Bali and given the disease and the lack of locally available
to the local people (Ekari tribals) by the diagnostic facilities often make NC an
Indonesian government as part of an effort to essentially silent and unrecognized disease
induce them to accept Indonesian control. of humans within many affected communi-
Unfortunately, these gift pigs turned out to be ties; these realities complicate attempts to
a ‘Trojan horse’, because the swine were motivate and empower the community to
infected by cysticerci of T. solium and the initiate measures to control the disease. Pig
human population also became infected, with owners, however, easily recognize the
disastrous consequences (see Chapter 12). infection in their animals and are aware
Local cultural customs and pig husbandry that cysticercosis reduces the market value
practices facilitated the transmission and of infected pigs and the infection in this
rapid spread of the cestode. The first indica- valuable meat animal suggests a possible
tion of the problem was noted in 1971 when focus for education and prevention mea-
many of the people suffered seizures and sures. In contrast, people rarely understand
burns caused by NC12. As a result of exten- the relationship between cysticercosis in
sive migrations of people with their pigs, the pigs and taeniasis or cysticercosis in
infection has spread throughout the island, humans and thus lack knowledge and
possibly including Papua New Guinea, and incentive to change behaviour that fosters
is now considered a serious emerging health transmission. In many, if not most, commu-
problem10,11. There are no other documented nities where T. solium infection is endemic
instances of foreign ‘introduction’ and contin- there is an absence of piped water, sanitary
ued transmission of T. solium via infected infrastructure, waste disposal, and other
pigs, however, imported cases of human tae- basic services; consequently, to be effective
niasis occasionally are linked epidemiologi- in the short-term, intervention measures
cally to clusters of infected pigs in the United must be designed to circumvent these defi-
States. Such ‘outbreaks’ have been identified ciencies to the extent possible (see Chapters
by detection of infected swine during routine 41–44). Primary health care facilities are
inspection at slaughter and limited to the also often lacking or inadequate. Since the
exposed cohorts of pigs (Peter M. Schantz, disease is generally related to poverty and
unpublished observations). all its associated manifestations, strategies

to control the disease must consider costs new knowledge of the impact of the
and locally available resources. Never- zoonotic disease on local health and the
theless, the many recent advances in diag- economy, provide incentive and improved
nosis and treatment of the disease, and the means to undertake these tasks57–59.
References
1. Flisser, A. (1994) Taeniasis and cysticercosis due to Taenia solium. Progress in Clinical Parasitology 4,
77–115.
2. Grove, D.I. (1990) Taenia solium taeniasis and cysticercosis. In: A History of Human Helminthology.
CAB International, Wallingford, UK, pp. 335–383.
3. Henneberg, R. (1912) The animal parasites of the central nervous system. Handbook of Neurology
(German) 3, 642–683.
4. Anonymous (1997) PAHO/WHO Informal Consultation on the Taeniasis/Cysticercosis Complex. Pan
American Organization Series HCT/AIEPI-5. Washington, DC, pp. 1–20.
5. Schenone, H.R., Ramirez, A., Rojas, F., et al. (1982) Epidemiology of human cysticercosis in Latin
America. In: Flisser, A., Willms, K., Laclette J.P., et al. (eds) Cysticercosis: Present State of Knowledge and
6. Banerjee, P.S., Bhatia, B.B., Pandit, B.A. (1994) Sarcocystis suihominis infection in human beings in
India. Journal of Veterinary Parasitology 8, 57–58.
7. Singh, S., Singh, N.R., Pandav, C.S., et al. (1994) Toxoplasma gondii infection and its association with
iodine deficiency in a residential school in a tribal area of Maharashtra. Indian Journal of Medical
Research 99, 27–31.
8. Thakur, L.C., Anand, K.S. (1991) Childhood neurocysticercosis in South India. Indian Journal of
Pediatrics 58, 815–819.
9. Wadia, N.H., Desai, S., Bhatt, M.B. (1988) Disseminated cysticercosis. New observations including
CT scan findings and experience with treatment by praziquantel. Brain 11, 597–614.
10. Simanjuntak, G.M., Margono, S.S., Okamoto, M., et al. (1997) Taeniasis/Cysticercosis in Indonesia as
11. Wandra, T., Subahar, R., Simanjuntak, G.M., et al. (2000) Resurgence of epileptic seizures and burns
associated with cysticercosis in Assologaima, Jayawijaya, Irian Jaya, Indonesia, 1991–95. Transactions
of the Royal Society of Tropical Medicine and Hygiene 94, 46–50.
12. Gadjusek, D.C. (1978) Introduction of Taenia solium into West New Guinea with a note on an epi-
demic of burns from cysticercus epilepsy in the Ekari people of the Wissel Lake area. Papua New
Guinea Medical Journal 21, 329–342.
13. Preux, P.M., Avode, G., Bouteille, B.M., et al. (1996) Cysticercosis and neurocysticercosis in Africa:
current status. Neurological Infections and Epidemiology 1, 63–68.
14. Graber, M., Chailloux, A. (1970) Existence in Chad of porcine cysticercosis caused by Cysticercus
cellulosae (Rudolphi). Revue d’ Elevage et de Medecine Veterinaire de Pays Tropicaux (Paris) 23, 49–55.
15. Permin, A., Yelifari, L., Bloch, P., et al. (1999) Parasites in cross-bred pigs in the upper east region of
Ghana. Veterinary Parasitology 87, 63–71.
16. Gelfand, M., Jeffrey, C. (1973) Cerebral cysticercosis in Rhodesia. Journal of Tropical Medicine and
Hygiene 76, 87–89.
17. Mafojane, N.A. (1994) The neurocysticercosis project in Atteridgeville-Mamelodi townships. South
African Medical Journal 84, 208–211.
18. Powell, S.J., MacLeod, I.N., Proctor, E.M., et al. (1966) Cysticercosis and epilepsy in Africans: a clini-
cal and serological study. Annals of Tropical Medicine and Parasitology 60, 152–158.
19. Sachs, L.V., Berkowitz, I. (1991) Cysticercosis in an urban black South African community: preva-
lence and risk factors. Tropical Gastroenterology 11, 30–33.
20. Michel, P., Callies, P., Genin, C., et al. (1992) Cysticercosis in Madagascar: diagnostic and therapeutic
improvement. Dakar-Médical (Dakar) 37, 191–197.
21. Boa, M.E., Bogh, O.H., Kassuku, A.A., et al. (1995) The prevalence of Taenia solium metacestodes in
pigs in northern Tanzania. Journal of Helminthology 69, 113–117.
22. Chinchilla, N., De Andres, D., Gimenez-Roldan, S. (1989) Neurocysticercosis in the urban area of
Madrid. Archivos de Neurobiology 52, 287–294.

72 P.M. Schantz
23. Terraza, S., Pujol, T., Gascon, J., et al. (2001) Neurocysticercosis: an imported disease? Medicina
Clinica (Barcelona) 116, 261–263.
24. Santos Meneses Monteiro, L.A. (1995) Neurocisticercose no norte de Portugal: Doctoral
Disssertation, Institute Ciencias Biomed A. Salazar (ISBN 972–96591–0-9-DL No. 87526/95), 247 pp.
25. Saporiti, A., Brocchieri, A., Grignani, G. (1994) Neurocysticercosis as a cause of epilepsy. A case
report. Minerva Medica (Torino) 85, 403–407.
26. Tsang, V.C.W., Boyer, A.E., Brand, J.A. (1989) An enzyme-linked immunotransfer blot assay and gly-
coprotein antigens for diagnosing human cysticercosis (Taenia solium). Journal of Infectious Diseases
159, 50–59.
27. Sarti, E., Plancarte, A., Schantz, P.M., et al. (1994) Epidemiological investigation of Taenia solium tae-
niasis and cysticercosis in a rural village of Michoacan state, Mexico. Transactions of the Royal Society
of Tropical Medicine and Hygiene 88, 49–52.
28. Sarti, E., Aguilera, J., Lopez, A., et al. (1992) Epidemiologic observations on porcine cysticercosis in a
rural community of Michoacan State, Mexico. Veterinary Parasitology 41, 195–201.
29. Sarti, E., Flisser, A., Guiterrez, I.O., et al. (1992) Prevalence and risk factors for Taenia solium taeniasis
and cysticercosis in humans and pigs in a village in Morelos, Mexico. American Journal of Tropical
Medicine and Hygiene 46, 677–685.
30. Allan, J.C., Soto de Alfaro, H., Torres-Alvarez, R., et al. (1996) Epidemiology of intestinal taeniasis in
four rural Guatemalan communities. Annals of Tropical Medicine and Parasitology 90, 157–165.
31. Garcia-Noval, J., Moreno, E., De Mata, F., et al. (2001) An epidemiological study of epilepsy and
epileptic seizures in two rural Guatemalan communities. Annals of Tropical Medicine and Parasitology
95, 167–175.
32. Sanchez, A.L., Medina, M.T., Ljungstrom, I. (1998) Prevalence of taeniasis and cysticercosis in a pop-
ulation of urban residence in Honduras. Acta Tropica 69, 141–149.
33. Sanchez, A.L., Gomez, O., Allebeck, P., et al. (1997) Epidemiological study of Taenia solium infections
in a rural village in Honduras. Annals of Tropical Medicine and Parasitology 91, 163–171.
34. Sanchez, A.L., Lindback, J., Schantz, P.M., et al. (1999) A population-based case-control study on
Taenia solium taeniasis and cysticercosis. Annals of Tropical Medicine and Parasitology 93, 247–258.
35. Sakai, H., Sone, M., Castro, D.M., et al. (1998) Seroprevalence of Taenia solium cysticercosis in pigs in
a rural community of Honduras. Veterinary Parasitology 78, 233–238.
36. Tsang, V.C.W., Wilson, M. (1995) Taenia solium: an under recognized but serious public health prob-
lem. Parasitology Today 11, 124–126.
37. Cruz, M.E., Schantz, P.M., Cruz, I., et al. (1998) Epilepsy and neurocysticercosis in an Andean com-
munity. International Journal of Epidemiology 28, 799–803.
38. Diaz, J.F., Carcamo, C., Castro, M., et al. (1992) Epidemiology of taeniasis and cysticercosis in a
Peruvian village. American Journal of Epidemiology 185, 875–882.
39. García, H.H., Gilman, R.H., Gonzales, A.E., et al. (1996) Epidemiologia de la cysticercosis en el Peru.
In: García, H.H., Martinez, S.M. (eds) Taeniasis/Cisticercosis por T. solium. Editorial Universo SA,
Lima, Peru, pp. 313–326.
40. García, H.H., Araoz, R., Gilman, R.H., et al. (1999) Increased prevalence of cysticercosis and taeniasis
among professional fried pork vendors and the general population of a village in the Peruvian high-
lands. American Journal of Tropical Medicine and Hygiene 59, 902–905.
41. Schantz, P.M., Criales, J.L., Flisser, A., et al. (1994) Community-based epidemiological investigations
of cysticercosis due to Taenia solium: comparison of serological screening tests and clinical findings
in two populations in Mexico. Clinical Infectious Diseases 18, 879–885.
42. Bern, C., García, H.H., Evans, C., et al. (1999) Magnitude of the disease burden from neurocysticer-
cosis in a developing country. Clinical Infectious Diseases 29, 1203–1209.
43. Canelas, H.M. (1962) Neurocisticercose: incidencia diagnostico y formas. Arquivos de Neuropsiquiatria
20, 1–15.
44. Allan, J.C., Fletes, C., Velasquez-Tohom, M., et al. (1997) Mass chemotherapy for intestinal Taenia
solium infection: effect on prevalence in humans and pigs. Transactions of the Royal Society of Tropical
45. Garcia-Noval, J., Allan, J.C., Craig, P.S., et al. (1996) Epidemiology of Taenia solium taeniasis and cys-
ticercosis in two rural Guatemalan communities. American Journal of Tropical Medicine and Hygiene
55, 282–289.
46. Cysticercosis Working Group in Peru (1993) The marketing of cysticercotic pigs in the Sierra of Peru.
Bulletin of the World Health Organization 71, 223–228.

47. Diaz, J.F., Gallo, C., García, H.H., et al. (1992) Immunodiagnosis of human cysticercosis: a field com-
parison of an antibody enzyme-linked immunosorbent assay (ELISA), and an enzyme-linked
immunoelectrotransfer blot (EITB) assay in Peru. American Journal of Tropical Medicine and Hygiene
46, 610–615.
48. Dixon, H.B.F., Lipscomb, F.M. (1961) Cysticercosis: an analysis and follow-up of 450 cases. Medical
Research Special Report Series. Her Majesty’s Stationery Office, London, 229, 1–58.
49. Oman, K.M., Grayson, M.L., Kempster, P. (1994) Neurocysticercosis and new-onset seizures in short
term travelers to Bali. Medical Journal of Australia 161, 399.
50. Yong, J.L.C., Warren, B.A. (1994) Neurocysticercosis: a report of four cases. Pathology 26, 244–249.
51. McDowell, D., Harper, C.G. (1990) Neurocysticercosis – two Australian cases. Medical Journal of
Australia.152, 217–218.
52. Dietrichs, E., Aanonsen, N.O., Bakke, S.J., et al. (1994) Tapeworms in the brain – current problem in
Norway. The Journal of the Norwegian Medical Association 114, 3089–3092.
53. Villa, A.M., Monteverde, D.A., Rodriguez, W. (1993) Neurocisticercosis en un hospital de la ciudad
de Buenos Aires: estudio de once casos. Arquivos de Neuropsiquiatria 51, 333–336.
54. Hansen, N.J.D., Christensen, T., Hagelskjaer, L.H. (1992) Neurocysticercosis: a short review and pre-
sentation of a Scandinavian case. Scandinavian Journal of Infectious Diseases 24, 255–262.
55. Schantz, P.M., Wilkins, P.P., Tsang, V.C. (1998) Immigrants, imaging and immunoblots: the emer-
gence of neurocysticercosis as a significant public health problem. Emerging Infections, Vol. 2. ASM
Press, Washington, DC, pp. 213–242.
56. Guzman, B. (2001) The Hispanic population. Census 2000 brief. United States, Department of
Commerce, C2KBR/01-3, 8 pp. (www.census.gov)
57. Centers for Disease Control and Prevention (1993) Recommendations of the International Task Force
for Disease Eradication. Morbidity and Mortality Weekly Report 42 (No. RR-16), 1–27.
58. Gilman, R.H., Dunleavy, M., Evans, C.A.W., et al. (1996) Methods for the control of taeniasis-cys-
ticercosis. In: García, H.H., Martinez, M. (eds) Taeniasis/Cisticercosis por T. solium. Editorial Universo
SA, Lima, Peru, pp. 327–340.
59. Schantz, P.M., Cruz, M., Pawlowski, Z., et al. (1993) Potential eradicability of taeniasis and cysticer-
cosis. Bulletin of Pan American Health Organization 27, 397–403.

8
What Have We Learnt From
Epidemiological Studies of Taenia solium
Cysticercosis in Peru?
Hector H. García, Robert H. Gilman, Armando E. Gonzalez,

Manuela Verastegui, Victor C.W. Tsang, and The Cysticercosis
Working Group in Peru
Introduction ethnicity; most people are Catholic. The

country is divided into three clearly defined
Taenia solium taeniasis/cysticercosis has been zones by the Andean mountains: the arid
known since antiquity (it is probable that sus- Coast, the Highlands and the tropical Jungle.
picion as to its origins led some religions to The geographic divisions served well as a
expressly forbid the consumption of pork), but guide to define regional prevalence of T.
the epidemiology of human and porcine infec- solium infection within Peru. Cysticercosis
tion and disease has been poorly understood was believed to be endemic in the
until recently. The lack of an accurate screening Highlands, and certain zones of the Coast
tool in the community setting was a barrier to and Jungle.
the understanding of the magnitude of infec- The earliest surveys by the CWG were
tion burden. The design of the enzyme-linked carried out in communities that were
immunoelectrotransfer blot (EITB), the most believed to be highly endemic for T. solium
sensitive and specific serological assay so far cysticercosis1–3. In 1988, two Jungle commu-
available, was a turning point in population nities, Maceda (population: 421; altitude: 500
studies of cysticercosis. In Peru, South m)1 and Churusapa (population: 275; alti-
America, the Cysticercosis Working Group tude: 500 m) were sampled. Both were typi-
(CWG) was formed through the efforts of pro- cally representative of the High Jungle
fessionals of different disciplines (biologists, communities: each was located close to a
biochemists, clinicians, epidemiologists and river, had an agriculture-based economy
others), institutions and countries. The group and a tropical climate. The survey found
performed a series of studies oriented to that houses were made of adobe, with dirt
describe the epidemiological characteristics of floors. There was no electricity or water sup-
taeniasis/cysticercosis for T. solium. This infor- ply; water for consumption was obtained
mation is summarized in the present chapter. from the river. Further, pigs and other
domestic animals were raised free (rarely
corralled) and had access to human
Studies in General Population dwellings. Only a few houses had latrines.
Census, mapping, human stool sampling,
Overview of seroprevalence studies in Peru human and porcine blood sampling, and
porcine tongue examination were performed
Peru, located in South America has 24 mil- after obtaining population consent. A total
lion inhabitants. The population is of mixed of 25 soil samples (five in Maceda and 20 in

76 H.H. García et al.
Churusapa) and five water samples (each of the Mother’s Club of the village, and
after concentrating 250–500 l of river water) obtained similar findings3. In order to
were obtained. The study determined that obtain a thorough assessment of the
the EITB-human seroprevalence was 8% geographical prevalences within Peru, the
and porcine seroprevalence, 45% (Table 8.1). CWG studied an endemic community
The coproparasitological survey detected (Monteredondo) in the Coastal zone (popu-
Taenia eggs in about 1% of the human population: 1200; altitude: 300 m)4. An inspection
lation. Most seropositive individuals were of this region noted that pigs were kept tied,
neurologically asymptomatic. Taenia ova and human faeces were disposed in the
were not found in any soil or water sample. fields, but usually in fixed places. A total of
Subsequently, the CWG focused upon a 489 individuals were sampled and human
different geographical environment, the seroprevalence was estimated at 16%.
Highlands. A survey was carried out in However, interestingly, seroprevalence in
Haparquilla (population: 371; altitude: 3400 pigs (13%) was considerably less than
m), a village in the southern Highlands, human seroprevalence as well as prevalence
close to Cusco, in 19903. The Highlands are figures in porcine populations in other geo-
different from the jungle in that the graphic locations (Table 8.1)4. The low
weather is much colder. Moreover, the sur- prevalence in pigs was somewhat unex-
vey found that pigs were mostly corralled pected. When the CWG attempted to
in the backyards. There were virtually no analyse the reasons behind the low rates of
latrines and villagers defecated in their porcine infection in this community, it found
backyards. Electricity supply existed, how- that the Monteredondo community began to
ever there was no facility of potable water. grow rice, 3 years before the survey. This led
Human seroprevalence in the Highland the villagers to tether pigs in order to protect
community was found to be 13% and was the rice crop. Therefore, at the time of the
comparatively higher than in the jungle survey, all pigs were less than 3 years of age
communities. Porcine seroprevalence was and were tethered; accordingly seropositvity
similarly high (Table 8.1)2. Two years later, rates were low. Serological status in humans
we performed a survey in Saylla, another remained high since it represented the
community in the Highlands, with the help cumulative effects of exposure over a
Table 8.1. Characteristics of human and porcine populations and EITB based seroprevalence of Taenia
solium cysticercosis in Peru.
Jungle villages Highland villages Coastal village
Community Maceda Churusapa Haparquilla Saylla Monteredondo
Population
sampled 371 (88%)* 134 (48%)* 108 (30%)* 99 (20%)* 489
Type of sample General General General Mothers’ Club General
population population population and relatives population
Human
seroprevalence 8% 7% 13% 24% 16%
Males 7% 6% 10% 41% 13%
Females 9% 7% 15% 18% 20%
Stool disposal Open field Open field Backyard Backyard Defined
Porcine
seroprevalence 43% (57/133) 49% (43/87) 46% (51/110) 36% (19/53) 13%
Pig raising Free Free Free/corralled Free/corralled Tied
*Figures in parentheses represent the percentage of the total population of the village that was sampled.

Lessons from Epidemiological Studies in Peru 77
much longer period of time. Other commu- location (Quilcas, Central Highlands), 398
nity surveys have similarly described high villagers were sampled in 1996; 140 were
seroprevalence rates in endemic communi- found to seropositive while 258 were
ties within Peru; 15 (13%) out of 112 indi- seronegative. Three years later, in 1999, 69
viduals attending a health centre in out of the 140 that were initially seropositive
Pomabamba, Ancash, and 72 (21%) out of (50%; 95%CI: 41–58%) were now seronegative.
334 in Vichaycocha, Central Highlands These data demonstrated that many newly
were seropositive. Two large-scale surveys infected (or exposed) individuals developed
in a population of 3000 in Quilcas only transient serologic antibody reactions.
(Huancayo, Central Highlands) and 4500 These individuals may have been exposed to
in Andahuaylas (Apurimac, southern T. solium, but did not eventually develop
Highlands) established seroprevalence rates viable infection, or they may have had cys-
of 12–15%. In addition, a recent survey in ticercosis that spontaneously resolved. This
Tumbes in the northern Coast, found 22% of could also explain the discrepant finding of
individuals sampled to be seropositive. The high background levels of putatively inac-
above findings are representative of the tive, calcified brain lesions in seronegative
prevalence in T. solium endemic regions of controls8–10; it may be surmised that these
Peru. In non-endemic areas, the seropreva- currently seronegative individuals had tran-
lence has been consistently found to be less sient seropositivity in association with active
than 1% (1% in unselected urban groups in or transitional cysticercosis that eventually
Lima5 and a specialized sheep-raising coop- resolved with calcification.
erative farm in the Highlands6 and no
seropositive cases among the low-Jungle
communities in Iquitos and La Merced). From initial evaluation to intervention
The CWG also studied the feasibility of con-

Longitudinal studies of seroprevalence trol of T. solium with combined mass human
and porcine chemotherapy in the Central
The high seroprevalence rates of T. solium Highlands. The prevalence of porcine infec-
antibodies with EITB in disease-endemic tion did decrease temporarily; however it
populations contrasts with the relatively soon returned to the pre-intervention levels
small number of symptomatic cases of NC (CWG, unpublished data). The reader is
among seropositive individuals as well as a referred to Chapters 41 and 43 for more com-
large number of putatively inactive brain prehensive descriptions of these studies.
lesions (mainly calcifications) in seronegative Geographic position system analysis demon-
controls. These findings have been borne out strated clustering of new infections in pigs
in epidemiological studies of T. solium cys- around the houses with Taenia carriers (see
ticercosis in Peru in common with data from Chapter 15). Moreover, the pattern of
Mexico (see Chapter 9) and Central America appearance of new cases suggested that
(see Chapter 10). The discrepancies have immigration from other endemic areas was
often been a source of confusion. When lon- the major contributor to control failure
gitudinal serological data from general pop- (CWG, unpublished data).
ulation serosurveys in disease-endemic areas
were analysed, it was noted that about 40%
of initially seropositive individuals became Studies in Hospital-based Population
seronegative when resampled after one
year7. This phenomenon was first observed In order to determine the relationship
between 1993 and 1994 in Monteredondo4,7. between EITB-based T. solium seropositive
Between two consecutive serosurveys, 1 year status and neurological disease, 204 of 231
apart, six (32%, 95%CI: 11–52%) out of 19 ini- patients consecutively admitted to a neurol-
tially seropositive individuals in the commu- ogy ward in Lima were studied5. Twenty-
nity reverted to seronegative. In a different one (12%) of 173 patients, who agreed to

give blood samples were seropositive. seropositive cases were found among 16 indi-
There was however, discordance between viduals with history of seizures13. Eight of
clinical and serological diagnoses: over half them (four seropositive and four seronega-
of the patients clinically diagnosed as hav- tive) agreed to undergo complete neurologi-
ing cysticercosis were seronegative. On the cal and CT examination at a reference centre.
other hand, ten seropositive patients had All four seropositive individuals had evi-
diagnoses other than cysticercosis. One of dence of NC upon CT: single enhancing
them had intestinal Taenia infection and lesion (1), multiple live cysts and calcifica-
another previously had surgery for cerebral tions (1) and multiple calcifications (2). The
cysticercosis (antecedent was not recorded four seronegative individuals had normal
in the current clinical chart). Three seroposi- cerebral CT scans. Age of onset of seizures
tive subjects were diagnosed to have NC by was 17 or older in seven of the eight patients
computed tomography (CT) scan (showing (excepting one seropositive case).
multiple cysts) upon follow-up, one had a When results of consecutive EITB-based
lesion diagnosed on CT as ‘expansive tem- serological studies at a serological labora-
poral lesion’, and another patient had tory of a large hospital were evaluated, the
hydrocephalus5. overall proportion of positive cases was 18%
Another serological survey was per- in serum samples and 28% in CSF samples14.
formed upon patients visiting a private Factors potentially associated with seropos-
radiology centre for brain CT scan10. itivity were analysed using logistic regres-
Seroprevalence was 8% in this population. sion techniques. Four factors were
Again, there were discrepancies between significantly associated with a positive test:
radiological diagnoses and seropositive sta- to be born outside Lima, to have raised
tus. Moreover, when the scans were inter- pigs, age older than 20, and a history of tae-
preted by a second neuroradiologist niasis. We have also studied the time to dis-
(masked to the original interpretation), only appearance of antibodies in a series of 50
one of ten scans was confirmed as having patients with NC treated with albenda-
‘active’ NC, and five of 14 were not recog- zole15,16. Only three of the 14 cured patients
nized as having NC. At the Instituto de became seronegative at one year after suc-
Ciencias Neurológicas, Lima, 498 neurologi- cessful treatment. In most patients, who had
cal outpatients were examined by EITB11. strong baseline serology (displaying all
Of patients with seizures, 12% were seven reactive bands on EITB), the reactive
seropositive, compared with 3% of those bands persisted at the end of 1 year of fol-
with other neurological symptoms. low-up. Interestingly, an increase in the
Seroprevalence increased to 20% if patients number of bands was observed around the
had late-onset epilepsy or were born out- second week of therapy in patients with
side Lima, and to 29% if they had both risk viable cysts.
factors. A careful coproparasitological evaluation
The relationship between serological sta- of a prospective series of patients with NC
tus and seizures was also evaluated in the identified intestinal taeniasis in 15%. This
community setting during a survey in prevalence was higher than expected. A
Monteredondo12. Of 52 individuals who were direct correlation between the number of
evaluated, 49 had neurological symptoms. cysticerci and the presence of intestinal T.
Fourteen (34%) of 41 epileptic individuals solium was noted, suggesting that heavy
were found to be seropositive, in comparison infections were commonly the result of
to one (12.5%) of eight with headache and/or autoinfection17. Furthermore, we have con-
dizziness. Of the 14 seropositive epileptic firmed elsewhere that the frequency of adult
individuals, 13 agreed to undergo CT. Seven T. solium infection is high among patients
of these 13 scans revealed evidence of NC: with massive cysticercus infection18.
single cyst (2), multiple cysts (1), two calcifi- When imaging features in seropositive
cations (2), and multiple calcifications (2). In individuals were analysed it was found that
a different community in Huaraz, five (35%) individuals with transitional (enhancing)

lesions were younger in comparison to those sis28. The reader is referred to Chapter 15 for
with active (viable) cysts; at older ages both a comprehensive review of these studies.
active (viable) cysts and calcified lesions
were frequent. This suggested that some
infections (probably those with lesser num- Conclusions
bers of parasites) were controlled by the host
immune response resulting in early death of After more than a decade of studies by the
parasites, whereas others persisted for long CWG, several concepts have emerged while
periods. Patients with hydrocephalus were others have been clarified. The most signifi-
older than those with viable cysts, enhancing cant of these is that taeniasis/cysticercosis is
lesions, or calcifications alone (CWG, unpub- extremely common in Peru. The magnitude
lished data). of transmission may be as high as 25% of
humans infected at a given time in hyperen-
demic villages, and may easily be over 10%
Porcine Cysticercosis in many endemic zones. While seropreva-
lence rates are high, neurologically sympto-
Porcine cysticercosis has been reviewed by matic individuals constitute the tip of the
Gonzalez et al. (Chapter 15). Certain features iceberg. Also, a proportion of asymptomatic
that are specifically relevant to the under- individuals has imaging abnormalities sug-
standing of the epidemiology of T. solium cys- gestive of NC7–9; these are mainly seronega-
ticercosis in Peru are discussed here. Before tive individuals with residual, inactive
1990, the veterinary team of the CWG evalu- calcified brain lesions. On a converse note, it
ated the sensitivity and specificity of tongue is also common to encounter asymptomatic
palpation vis-à-vis EITB serology, in a con- seropositive individuals in community stud-
trolled design. When evaluated against ies. As for many other infectious diseases,
necropsy, tongue palpation was over 70% seropositivity in asymptomatic individuals is
sensitive and highly specific, whereas EITB generally interpreted as a marker of current
detected all necropsy-positive pigs19. The vet- subclinical or past infection.
erinary team also studied and identified the A common pitfall in the interpretation of
pig marketing circuits in Peru. They noted serological data is to compare different kinds
that official marketing and slaughtering facil- of populations. A 10% prevalence in neuro-
ities were completely circumvented by peas- logical patients at a large urban medical facil-
ants particularly in the Central Highlands. ity (where the overall seroprevalence is likely
Slaughtering was performed under clandes- to be below 10%) cannot be equated to a 10%
tine conditions; infested carcasses thus prevalence in the general population of an
obtained were later introduced into the for- endemic community (where surveying
mal market. A significant proportion of com- epileptic patients may reveal seroprevalence
mercialized pork was infected in the rates of 30–35%). Another pitfall is to assume
Highlands. Infected pork was sold at cheaper that, since the majority of seropositive indi-
prices and often mixed and disguised with viduals in endemic communities are asymp-
clean meat in order to facilitate its sale to tomatic, seropositivity has no relationship
public eating facilities20. Other major accom- with neurological symptoms. Some authors
plishments of the veterinary team of the have questioned the role of NC in the aetiol-
CWG include the establishment of the feasi- ogy of seizure disorders. However, studies by
bility of using sentinel pigs as an indicator of the CWG in Peru have demonstrated that
the burden of infection in a given area21, seroprevalence rates in neurological patients
demonstration of the passive transplacental are consistently much higher than in compa-
transfer of immunity and seropositivity22, the rable general populations. This increases fur-
use of drugs such as albendazole and ther when specific subgroups, for instance,
oxfendazole for treatment in control mea- those with late onset seizures are examined.
sures23–27 and of intramuscular inoculation in Another important outcome of the work done
an experimental model of porcine cysticerco- by the CWG is the realization of the intimate

relationship between domestic pig raising, The CWG is now in the concluding phase
taeniasis and human cysticercosis. Porcine of a randomized study designed to evaluate
seroprevalence reflects recent infection and the clinical benefits of anticysticercal therapy
porcine serosurveys are the fastest and least for NC, along with radiological (CT/MRI)
expensive method to document levels of and immunological (clinical significance of
ongoing transmission. Pigs are infected early individual antibodies, antigen detection30,31,
in life29 and are usually slaughtered by the cytokine pathways32) studies in the natural
age of 1 year. In a survey in an urban com- and post-treatment evolution of human NC.
mercial pig slaughterhouse, no animals had
cysticercosis. Usually porcine seroprevalence
is twice that of human seroprevalence. Acknowledgements
However, Monterendondo was an exception.
Thus human seroprevalence reflects cumula- Support from grants FD-R-001107 from the
tive effect of past exposure, while porcine Food and Drug Administration, and U19-
seroprevalence is an indicator of recent trends A145431 from NIAID/NIH (USA) is
in infection burden in a given community. acknowledged.
References
1. Diaz, F., García, H.H., Gilman, R.H., et al. (1992) Epidemiology of taeniasis and cysticercosis in a
2. García, H.H., Araoz, R., Gilman, R.H., et al. (1998) Increased risk for cysticercosis and taeniasis
3. García, H.H., Gilman, R.H., Gonzalez, A.E., et al. (1999) Human and porcine T. solium infection in a
village in the Highlands of Cusco, Peru. Acta Tropica 73, 31–36.
4. Gilman, R.H., García, H.H., Gonzalez, A.E., et al. (1999) Shortcuts to development: methods to con-
trol the transmission of cysticercosis in developing countries. In: García, H.H., Martínez, S.M. (eds)
Taenia solium Taeniasis/Cysticercosis, 2nd edn. Editorial Universo SA, Lima, Peru, pp. 313–326.
5. García, H.H., Martinez, M., Gilman, R.H., et al. (1991) Diagnosis of cysticercosis in endemic regions.
Lancet 338, 549–551.
6. Moro, P.L., Guevara, A., Verastegui, M., et al. (1994) Distribution of hydatidosis and cysticercosis in
different Peruvian populations as demonstrated by an enzyme-linked immunoelectrotransfer blot
(EITB) assay. American Journal of Tropical Medicine and Hygiene 51, 851–855.
7. García, H.H., Gonzalez, A.E., Gilman, R.H., et al. (2001) Transient antibody response in Taenia solium
infection in field conditions: a major contributor to high seroprevalence. American Journal of Tropical
Medicine and Hygiene (in press).
8. Cruz, M.E., Schantz, P.M., Cruz, I., et al. (1999) Epilepsy and neurocysticercosis in an Andean com-
munity. International Journal of Epidemiology 28, 799–803.
9. Sanchez, A.L., Lindback, J., Schantz, P.M., et al. (1999) A population-based, case-control study of
Taenia solium taeniasis and cysticercosis. Annals of Tropical Medicine and Parasitology 93, 247–258.
10. García, H.H., Herrera, G., Gilman, R.H., et al. (1994) Discrepancies between cerebral computed
tomography and western blot in the diagnosis of neurocysticercosis. American Journal of Tropical
11. García, H.H., Gilman, R., Martinez, M., et al. (1993) Cysticercosis as a major cause of epilepsy in
Peru. Lancet 341, 197–200.
12. García, H.H., Gilman, R.H., Tsang, V.C.W., et al. (1997) Clinical significance of neurocysticercosis in
endemic villages. Transactions of the Royal Society of Tropical Medicine and Hygiene 91, 176–178.
13. García, H.H., Talley, A., Gilman, R.H., et al. (1999) Epilepsy and neurocysticercosis in a village in
Huaraz, Perú. Clinical Neurology and Neurosurgery 101, 225–228.
14. García, H.H., Gilman, R.H., Tovar, M., et al. (1995) Factors associated with T. solium cysticercosis.
Analysis on 946 Peruvian neurologic patients. American Journal of Tropical Medicine and Hygiene 52,
147–150.

15. García, H.H., Gilman, R.H., Horton, J., et al. (1997) Albendazole therapy for neurocysticercosis: a
prospective double blind trial comparing 7 vs. 14 days of treatment. Neurology 48, 1421–1427.
16. García, H.H., Gilman, R.H., Catacora, M., et al. (1997) Serological evolution of neurocysticercosis
patients after antiparasitic therapy. Journal of Infectious Diseases 175, 486–489.
17. Gilman, R.H., Del Brutto, O.H., García, H.H., et al. (2000) Prevalence of taeniasis among neurocys-
ticercosis patients is related to the severity of cerebral infection. Neurology 55, 1062.
18. García, H.H., Del Brutto, O.H. and The Cysticercosis Working Group in Perú (1999) Heavy non-
encephalitic cerebral cysticercosis in tapeworm carriers. Neurology 53, 1582–1584.
19. Gonzalez, A.E., Cama, V., Gilman, R.H., et al. (1990) Prevalence and comparison of serologic assays,
necropsy, and tongue examination for the diagnosis of porcine cysticercosis in Peru. American
Journal of Tropical Medicine and Hygiene 43, 194–199.
20. Cysticercosis Working Group in Peru (1993) The marketing of cysticercotic pigs in the sierra of Peru.
21. Gonzalez, A.E., Gilman, R.H., García, H.H., et al. (1994) Use of sentinel pigs to monitor environmen-
tal Taenia solium contamination. American Journal of Tropical Medicine and Hygiene 51, 847–850.
22. Gonzalez, A.E., Verastegui, M., Noh, J.C., et al. (1999) Persistence of passively transferred antibodies
in porcine Taenia solium cysticercosis. Veterinary Parasitology 86, 113–118.
23. Gonzalez, A.E., García, H.H., Gilman, R.H., et al. (1995) Treatment of porcine cysticercosis with
albendazole. American Journal of Tropical Medicine and Hygiene 53, 571–574.
24. Gonzalez, A.E., García, H.H., Gilman, R.H., et al. (1996) Effective, single dose treatment of porcine
cysticercosis with oxfendazole. American Journal of Tropical Medicine and Hygiene 54, 391–394.
25. Gonzalez, A.E., Falcon, N., Gavidia, C., et al. (1997) Treatment of swine cysticercosis with oxfenda-
zole: a dose-response trial. Veterinary Record 141, 420–422.
27. Verastegui, M., Gonzalez, A.E., Gilman, R.H., et al. (2000) Experimental infection model for Taenia
solium cysticercosis in swine. Veterinary Parasitology 94, 33–44.
28. Gonzalez, A.E., Gavidia, C., Falcon, N., et al. (2001) Cysticercotic pigs treated with oxfendazole are
protected from further infection. American Journal of Tropical Medicine and Hygiene 65, 15–18.
29. Diaz, F., Verastegui, M., Gilman, R.H., et al. (1992) Immunodiagnosis of human cysticercosis (Taenia
solium): a field comparison of an antibody-enzyme-linked immunosorbent assay (ELISA) an anti-
gen-ELISA and an enzyme-linked immunoelectrotransfer blot (EITB) assay in Peru. American Journal
30. García, H.H., Harrison, L.J.S., Parkhouse, R.M.E., et al. (1998) Application of a specific antigen detec-
tion ELISA to the diagnosis of human neurocysticercosis. Transactions of the Royal Society of Tropical
31. García, H.H., Parkhouse, R.M.E., Gilman, R.H., et al. (2000) Serum antigen detection in the diagno-
sis, treatment, and follow-up of neurocysticercotic patients. Transactions of the Royal Society of Tropical
32. Evans, C.A.W., García, H.H., Hartnell, A., et al. (1998) Elevated concentrations of eotaxin and inter-
leukin-5 in human neurocysticercosis. Infection and Immunity 66, 4522–4525.

9Epidemiology of Taenia solium

Taeniasis and Cysticercosis in Mexico
Elsa Sarti
Introduction the middle class, returned emigrants and the

young. The annual population growth rate is
Taenia solium taeniasis and cysticercosis are 1.96%. The nation underwent a rapid change
important public health problems in several in the last few decades of the 20th century
developing countries of Latin America, and Mexicans are viewed as urban, opening
Africa and Asia. Mexico has one of the high- to democracy and market-oriented.
est frequencies of disease in the Americas1–4.
It also has a long history, spanning over
three decades, of the development of sur- Human Intestinal Taeniasis
veillance, preventive and control strategies
with specific reference to T. solium cysticer- The reported prevalence of intestinal T.
cosis. These and several other aspects of epi- solium infection in Mexico is between 0.2%
demiology of human and porcine and 3.4%2,3,5–9. This amounts to nearly 1.5
cysticercosis and human taeniasis in Mexico million potential transmitters of Taenia eggs,
are reviewed in this chapter. capable of producing new cases of neuro-
Mexico is the third largest country in cysticercosis (NC). An average of 13,000
Latin America (after Brazil and Argentina), cases of Taenia sp. infection were reported
with an area of 1,972,550 square kilometres. every year during the last 5 years by the
It has a population of almost 100 million, National Epidemiological Surveillance
35% of which live under marginal condi- System, giving an incidence of 3.8 per
tions. Ethnically, most (60%) Mexicans are of 100,000 inhabitants (Fig. 9.1)7,10. Official sta-
Mestizo origin. The official literacy rate was tistics reveal highest frequency in individu-
88% in 1990. Health care personnel and facil- als under 14 years of age with no statistical
ities are generally concentrated in urban difference by gender7,10. In comparison, sev-
areas; care in rural areas consists of under- eral epidemiological surveys have estab-
staffed clinics operated mostly by medical lished peak levels between 16 and 45 years
graduates. Leading causes of death are infec- of age (economically productive life) with
tions, including parasitic diseases, and respi- predominance in women2,5–9,11. These dis-
ratory and circulatory failure. Spanish is the crepancies reflect differences in ‘taeniasis’
official language, spoken by nearly all. case definitions and methodologies adopted
However, knowledge of English is increasing by the two sources of data. While surveil-
rapidly, especially among business people, lance systems consider only patients


84
Singh - Chap 09
4/9/02
4:39 pm
Page 84
*Incidence rates by group of age

(100,000 inhabitants)
43
25
E. Sarti
0
Less than 1 year old
1–4
5–14
15–24
25–44
*Incidence rate by 100,000 inhabitants
45–64 in Mexico (average 3.0)
Older than 65 years 0.19 –2.87 (15 states)
2.88 –5.74 (13 states)

5.75 –11.48 (3 states)
11.49 –13.1 (1 state)
Fig. 9.1. State-wise and age-wise incidence of Taenia sp. infection in México, 1994–2000 (Source: National epidemiological surveillance system)10.
Epidemiology of Taeniasis and Cysticercosis in Mexico 85
requesting assistance in local health units, figure is at best, an underestimate. It is com-

planned epidemiological studies obtain mon to find a large number of informal
data from house-to-house surveys. The lat- slaughterhouses without veterinary inspec-
ter, apparently, are more representative of tion, in addition to the registered ones in
the community burden. the country. No information on the status of
porcine infection in these unauthorized
facilities is available. Swine in registered
Human Cysticercosis slaughterhouses represent only 40% of the
total swine slaughtered3,16. Besides, infected
Initially, considerable information on human pigs are unlikely to be brought to abattoirs
cysticercosis was derived from cases seen in for slaughter. Undernotification may also
neurological services of hospitals and occur on account of lack of trained person-
necropsy series of general hospitals in nel in slaughter facilities and of standard-
Mexico. The frequency of NC from hospital ized screening practices among meat
facilities in Mexico appeared to be as high as vendors. In addition to slaughterhouse-
8.6 per 100 patients1,3,12. Cysticercosis was based data, information has been collected
detected in 4–13% of large hospital-based from sampling domestic and free-ranging
autopsy series1,2,13. Neurocysticercosis was pigs in Mexico. Tongue inspection and pal-
listed as the cause of death in 40–80% of pation and EITB have been used as methods
autopsy protocols that reported cysticercal of evaluation in such studies. The preva-
infestation. Official sources from Mexican lence of porcine cysticercosis was found to
surveillance currently estimate an average vary between 1.4 and 4.0% using tongue
of 500 new cases every year, giving a nation- inspection or palpation and from 4.1% to
wide incidence of 0.6 per 100,000. These pro- 7.0% with EITB6,9,16–17,18. Seroprevalence
jections underestimate the incidence and rates increased with age and peaked at 11
prevalence of human cysticercosis in months.
Mexico, since a number of cases in rural
areas, where facilities for contemporary
diagnosis (like computed tomography, mag- An Overview of Epidemiological
netic resonance imaging and serology) do Studies from Mexico
not exist, are not registered. Nevertheless,
official registers do give us a general idea The study of the taeniasis–cysticercosis
about the geographical and demographic complex in Mexico has progressed through
predilections of human cysticercosis in logical and sequential steps. It began with
Mexico (Fig. 9.2). investigations into disease frequency at
The seroprevalence of cysticercosis using necropsy and later, in clinical series at neu-
immunoelectrophoresis (IEF) and indirect rological and neurosurgical services.
haemagglutination (IHA) was 1–3% of the Studies then progressed towards the search
population studied. With newer techniques of an adequate, reliable, and convenient
such as the ELISA and EITB (enzyme-linked diagnostic and screening test, available for
immunoelectrotransfer blot, better known as use, both in hospital facilities and the com-
‘blot’), the prevalence has been estimated at munity. In the 1970s, epidemiological stud-
around 10%5–9,14,15. Seroprevalence rates are ies were directed towards the study of
highest between 15 and 45 years of age and prevalence of T. solium. In the 1980s,
in women. research looked into risk factors for trans-
mission. Simultaneously, standardization of
methods for the diagnosis of taeniasis and
Swine Cysticercosis cysticercosis, for instance the use of EITB
and sound statistical techniques, was
The reported average prevalence of cys- undertaken. Finally in the 1990s, interven-
ticercosis in swine, from official registered tion studies began examining strategies for
slaughterhouses in Mexico is 0.2%3,16. This control of taeniasis–cysticercosis.

86
Singh - Chap 09
4/9/02
4:39 pm
Page 86
E. Sarti
*Incidence rates by group of age

(100,000 inhabitants)
12
6
0
Less than 1 year old *Incidence rate by 100,000 inhabitants
1–4 in Mexico (average 0.5)
5–14 0 –0.19 (4 states)
15–24 0.20– 0.63 (14 states)
25–44
0.64– 2.52 (9 states)
45–64
Older than 65 years 2.53– 3.94 (5 states)
Fig. 9.2. State-wise and age-wise incidence of neurocysticercosis in México, 1994–2000 (Source: National epidemiological surveillance system)10.
Step 1 (Estimation of disease prevalence) The prevalence of intestinal taeniasis

using standard coproparasitological evalua-
A national survey with urban representa- tions was 0.2–0.4%5,6,8,9,14,17,23,26–29. EITB
tion was carried out in 197419. Blood sam- based seroprevalence of human cysticercosis
ples of 18,417 individuals were examined varied between 4.9% and 10.9%5,6,8,9,14,17,23,26–
29. The prevalence of porcine cysticercosis
for anticysticercus antibodies by IEF; 1% of
the population was found to be positive. based on tongue inspection and palpation
Earlier, a survey in Oaxaca in 1971 revealed was 1.4% to 23.8% and using EITB was
a seropositivity of 3.3% by IHA20. In several around 4%6,9,16,18.
communities of Chiapas, seroprevalence by
IEF ranged between 0.4% and 7.6%21. Some
of the early epidemiological investigations Step 2 (Determination of risk factors)
were criticized for not having used rigorous
epidemiological methods. Nevertheless, a In the 1980s, a number of epidemiological
general idea of disease frequency could be and statistical investigations focused on
drawn. In 1992, a second nationwide sero- determination of magnitude of disease and
epidemiological survey was conducted risk factors. The first such study was under-
using a systematic approach. From 66,754 taken in ‘El Sótano’, a small community of
blood samples analysed by IHA, anticys- 150 inhabitants in 19845. An association
between ELISA seropositivity and tapeworm
ticercus antibodies were detected in 1.2%22.
carriage, symptoms compatible with cys-
The highest prevalences were noted in West
ticercosis (generalized convulsions), swine
and Southeast Mexico.
cysticercosis, and presence of latrines in
Our studies using EITB vis-à-vis ELISA
homes was observed in this study5. Clusters
for screening established an association of
of infection in the ‘El Sótano’ study, sug-
EITB positivity (but not ELISA positivity)
gested that the source of transmission of
with late-onset convulsions6,14,23. Neuro-
infection lay within the household (living
imaging abnormalities compatible with NC
closely with the tapeworm carrier) rather
were significantly more common in individ-
than the environment. Subsequent studies
uals with late-onset convulsions. This led us
from Mexico and Central America using
to infer a risk factor association between cys- EITB and structured questionnaires have
ticercosis and late-onset convulsions and confirmed the observations6,9,26,27,30,31. In
established the superiority of EITB over these studies, cardinal risk factors for human
ELISA as a tool for community screening. It taeniasis included: (i) history of having
was also found that immunological tests passed proglottides in stools; and (ii) con-
detect exposure to the parasite besides the sumption of uncooked or infected pork. Risk
infection and active disease. Therefore, in the practices that were associated with human
1990s, EITB was employed for further cysticercosis included: (i) drinking unboiled
human sero-surveys. water; and (ii) not washing hands before eat-
Coproparasitological examinations of fae- ing food and after defecation. On the other
ces with Ritchie, Katz and Faust techniques hand, rates of swine cysticercosis were deter-
and faecal antigen assays have been used for mined by numbers of free-ranging pigs with
screening of intestinal taeniasis24,25. access to human faeces. The above men-
However, both techniques yielded poor tioned human and porcine behaviours facili-
results. Incidentally, a simple inquiry about tate the ‘human–environment–pig–human’
having passed proglottides was found to be cycle. Modifications of these behaviours were
a fairly reliable indicator of intestinal taenia- considered as potential strategies for control
sis. This inquiry is simpler and more effec- of the taeniasis–cysticercosis complex.
tive than sophisticated, expensive and time- Transmission, other than the human–
consuming faecal tests. Therefore, therapeu- environment–pig–human cycle has been
tic taeniacidal intervention on the basis of suggested, for instance, through flies and by
this inquiry alone is recommended. ingestion of fruits and vegetables contami-

88 E. Sarti
nated by Taenia eggs32. These modalities of asis were measured by the frequency of
transmission have not been confirmed by Taenia coproantigens and Taenia eggs in fae-
studies in Mexico6,17,33. ces. Swine cysticercosis was measured by
palpating tongue and the presence of serum
antibodies. Changes in knowledge, attitudes
Step 3 (Developing interventions for and practices in the communities were eval-
control) uated by questionnaires prepared ex professo
as well as by direct observation by inter-
viewers. Praziquantel treatment reduced
An evaluation of the efficacy of mass tae-
rates of taeniasis by 66%. However, treat-
niacidal treatment was carried out during
ment alone, had no impact on swine cysticer-
1990, in a community in Sinaloa26.
cosis. A 66–77% decrease in swine
Praziquantel treatment was administered to
cysticercosis was observed in communities
the population of approximately 2000 inhabi-
where health education was provided (‘B’
tants. Before treatment, 1.3% of the individu- and ‘C’). Evaluation of long-term outcome
als had taeniasis and only one out of the 72 (42 months after the intervention) revealed a
pigs examined had cysticercosis. Treatment reduction of 48% of taeniasis in community
lead to complete eradication of intestinal tae- ‘B’. This underscored the importance of
niasis but data on porcine cysticercosis was health education in the effective control of
inadequate. By comparison, another study in taeniasis–cysticercosis. Health education
1987 provided insights into the role of health had a twofold effect. Improved sanitary
education, and demonstrated that health practices and curtailing free-ranging pigs
promotion could be a short-term alterna- led to a decrease in the frequency of
tive26,27. A promotional campaign emphasiz- porcine cysticercosis and ultimately human
ing upon the need to construct latrines in taeniasis. Secondly, awareness of the utility
every home and the hazards of open-air of taeniacidal treatment and its use pre-
defecation was conducted in schools. The vented human and porcine cysticercosis.
study demonstrated that the campaign cre- Results of our studies suggested that health
ated awareness about the parasite; unfortu- educational programmes are effective for T.
nately, mass taeniacidal treatment of solium control.
members of this community was not success-
ful as the prevalence of porcine cysticercosis
had doubled 1 year after intervention. It Mexican Surveillance to Monitor and
must be mentioned that this study was not Control Taeniasis–Cysticercosis
oriented to community intervention, but to
the identification of the risk factors. Mexico has a Unique Information System for
We have evaluated two alternative strate- Epidemiological Surveillance (SUIVE) gener-
gies for control of T. solium in the last decade: ating information on community health-
(i) mass taeniacidal drug administration; and related risk factors, treatment and control at
(ii) health education28,29,34. Both measures all operative levels. Information on several
were applied to three rural communities of diseases subject to epidemiological surveil-
Mexico with similar social, economical and lance, including taeniasis and cysticercosis is
cultural characteristics. Community ‘A’ collected in a specifically prepared format by
received mass praziquantel treatment (5 mg some 17,000 primary health care units and is
kg1), community ‘B’ received health educa- transmitted to State and Federal health
tion and community ‘C’ received both mass authorities for analysis at a national level.
praziquantel treatment and health education. Health care personnel manning the primary
Demographic, epidemiological, clinical, sani- health care units are imparted continuing
tary and sociological data from 98% of the education regarding simple and effective
inhabitants were obtained. Evaluations were screening and treatment of taeniasis and cys-
performed 6 and 42 months after interven- ticercosis. It is recommended that all individ-
tion. Prevalence and incidence rates of taeni- uals presenting to these centres for health

check-ups and treatment for any ailment swine cysticercosis may be as high as 23.8%.
should be screened for taeniasis–cysticerco- Risk behaviours for taeniasis include free-
sis. As mentioned earlier, a simple inquiry ranging pigs with access to human faeces
about the passage of proglottides suffices as and poor personal hygiene. Human cysticer-
a screening tool. Both cases that are identi- cosis, on the other hand, is clustered around
fied as positive by screening and their fami- intestinal adult T. solium carriers. Currently
lies should be offered taeniacidal treatment. intervention trials focusing on the modifica-
tion of these risks are underway. The impact
of health education and improving sanitary
Conclusions infrastructure is considered important.
Finally strategies employing the above inter-
The prevalence of human taeniasis in Mexico ventions both individually as well as in com-
varies between 0.2% and 0.4%, while that of bination, must be evaluated in order to
human cysticercosis is 4.9–10.9% and that of develop a unified national control policy.
REFERENCES
1. Sarti, E., Gutiérrez, I. (1986) La teniasis y cisticercosis en México (Revisión Bibliográfica). Salud
Púbica de México 28, 556–563.
2. Sarti, E. (1997) La teniosis y cisticercosis en México. Salud Pública de México 39, 225–231.
3. Organización Panamericana de la Salud (1994) Epidemiología y control de la teniosis y cisticercosis en
América Latina. OPS/OMS, Washington, DC.
4. Schantz, P., Cruz, M., Sarti, E., et al. (1993) Potential erradicability of taeniasis and cysticercosis.
5. Sarti, E., Schantz, P., Lara, R., et al. (1988) Taenia solium taeniasis and cysticercosis in a Mexican vil-
lage. American Journal of Tropical Medicine and Hygiene 39, 194–198.
6. Sarti, E., Schantz, P., Plancarte, A., et al. (1992) Prevalence and risk factors for Taenia solium taeniosis
7. Correa, M.D., Flisser, A., Sarti, E. (1994) Teniasis y cisticercosis. In: Valdespino-Gomez, J.L. (ed.)
Enfermedades Tropicales. Secretaría de Salud, México, DF, Mexico, pp. 335–345.
8. Díaz, S., Candil, R., Uribe, M., et al. (1990) Serology as an indicator of Taenia solium tapeworm infec-
tions in a rural community in Mexico. Transactions of the Royal Society of Tropical Medicine and Hygiene
84, 563–566.
9. Sarti, E., Schantz, P., Plancarte, A., et al. (1994) Epidemiological investigation of Taenia solium taenio-
sis and cysticercosis in a rural village of Michoacan State, Mexico. Transactions of the Royal Society of
Tropical Medicine and Hygiene 68, 49–52.
10. Secretaría de Salud (2000) Boletín Semanal de Epidemiología, 1994–2000. Dirección General de
Epidemiología, México DF, Mexico.
11. Schantz, P., Sarti, E. (1989) Diagnostic methods and epidemiologic surveillance of Taenia solium
infection. Acta Leidensia 57, 153–163.
12. Medina, M.T., Rosas, E., Rubio-Donnadieu, F., et al. (1990) Neurocysticercosis as the main cause of
late onset epilepsy in Mexico. Archives of Internal Medicine 150, 325–327.
13. Rabiela, M.T., Rivas, A., Rodriguez, I.J. (1979) Consideraciones anatomopatológicas de la cisticerco-
sis cerebral como causa de muerte. Patología (México) 17, 119–124.
14. Schantz, P., Sarti, E., Plancarte, A., et al. (1994) Community based epidemiological investigations of
cysticercosis due to Taenia solium. Comparison of serological screening tests and clinical findings in
two populations in Mexico. Clinical Infectious Diseases 18, 879–885.
15. Flisser, A., Correa, D., Plancarte, A., et al. (1990) New approaches for the diagnosis of Taenia solium
taeniasis/cysticercosis. Annals of Human and Comparative Parasitology 65, 95–98.
16. Aluja, A.S. (1982) Frequency of porcine cysticercosis in Mexico. In: Flisser, A., Willms, K., Laclette, J.,
et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York,
pp. 47–50.

90 E. Sarti
17. Sarti, E., Schantz, P., Aguilera, J., et al. (1992) Epidemiologic observations in a rural community of
Michoacan State, Mexico. Veterinary Parasitology 41, 195–201.
18. Aluja, A., Villalobos, N., Plancarte, A., et al. (1996) Experimental Taenia solium cysticercosis in pigs.
Characteristics of the infection and antibody response. Veterinary Parasitology 61, 49–58.
19. Woodhouse, E., Flisser, A., Larralde, C. (1982) Seroepidemiology of human cysticercosis in Mexico.
In: Flisser, A., Willms, K., Laclette, J., et al. (eds) Cysticercosis: Present State of Knowledge and
20. Goldsmith, R.S., Kagan, I.G., Reyes-González, M.A., et al. (1971) Estudios serepidemiológicos real-
izados en Oaxaca, Mexico. I. – Encuesta de anticuerpos parasitarios mediante la prueba de
hemaglutinación indirecta. Boletin de la Oficina Sanitaria Panamericana (Washington DC) 71, 500.
21. Flisser, A., Bulnes, I., Díaz, M.L., et al. (1976) Estudio seroepidemiológico de la cisticercosis humana
en poblaciones predominantemente indígenas y rurales del estado de Chiapas. Archives of Internal
Medicine (México) 7, 107–113.
22. Larralde, C., Padilla, A., Hernández, M., et al. (1992) Seroepidemiology of cysticercosis in Mexico.
Salud Pública de México 34, 197–210.
23. Schantz, P., Sarti, E., Plancarte, A., et al. (1991) Clinical, radiological and epidemiological correlation
of ELISA and immunoblot assays for Taenia solium cysticercosis in 2 populations. Mexico. American
24. Alan, J.C., Avila, G., Garcia-Noval, J., et al. (1990) Immunodiagnosis of taeniasis by coproantigen
detection. Parasitology 101, 473–477.
25. Díaz, S., Candil, R., Suate, P., et al. (1991) Epidemiologic study and control of Taenia solium infections
with praziquantel in a rural village of Mexico. American Journal of Tropical Medicine and Hygiene 45,
522–531.
26. Keilbach, N., Aluja, S., Sarti, E. (1989) A program to control taeniosis and cysticercosis (Taenia
solium). Experiences in a Mexican village. Acta Leidensia 57, 181–189.
27. Rodriguez Canul, R., Fraser, A., Allan, J.C., et al. (2000) Epidemiological study of Taenia solium taeni-
asis/cysticercosis in a rural village in Yucatan state, Mexico. Annals of Tropical Medicine and
28. Sarti, E., Flisser, A., Schantz, P.M., et al. (1997) Development and evaluation of health education
intervention against Taenia solium in a rural community in Mexico. American Journal of Tropical
29. Sarti, E., Schantz, P., Avila, G., et al. (2000) Mass treatment against human taeniosis for the control of
cysticercosis. A population based intervention study. Transactions of the Royal Society of Tropical
30. García, H.H., Gilman, R., Tovar, M., et al. (1995) Factors associated with Taenia solium cysticercosis:
analysis of nine hundred forty-six Peruvian neurologic patients. American Journal of Tropical Medicine
and Hygiene 52, 145–148.
31. Lawson, J.R., Gemmel, M.A. (1983) Hydatidosis and cysticercosis: the dynamics of transmission.
Advances in Parasitology 22, 261–308.
32. Spindola Feliz, N., Rojas Wastanino, G., de Haro, Arteaga, L., et al. (1996) Parasite search in straw-
berries from Irapuato, Guanajuato and Zamora, Michoacán (México). Archives of Medical Research 27,
229–231.
33. Sarti, E., Bronfman, M., Schantz, P., et al. (1993) Estructuración de un proyecto epidemiológico para el con-
trol de la Taenia solium. Comparación del uso de quimioterapia masiva contra la teniasis y de la impartición
de educación para la salud, como método de intervención de mayor utilidad. Conmemoración Jubileo.
Instituto de Investigaciones Biomédicas. UNAM. México DF, México 2, pp. 413–415.
34. Sarti, E. (1989) Epidemiología de la teniasis y cisticercosis. In: Flisser, A., Malagón, F. (eds)
Cisticercosis Humana y Porcina, su Conocimiento e Investigación en México. Limus Noriega, México DF,
México, pp. 233–242.

10 Taenia solium Taeniasis and

Cysticercosis in Central America
José Garcia-Noval, Ana L. Sanchez and James C. Allan
Introduction The presence of the parasite within the

region also has an impact further afield. Data
The Central American region, lying between from both Guatemala and Honduras indicate
Mexico and Colombia consists of seven that a significant number of individuals from
countries: Belize, Guatemala, Honduras, El rural communities, where T. solium is highly
Salvador, Nicaragua, Costa Rica and Panama prevalent, travel either to Guatemala City or
(Fig. 10.1). The region occupies approxi- Tegucigalpa for work13,14. Furthermore,
mately 524,000 km2 and had a population of migration also occurs to the United States,
approximately 36 million in 1999. Slightly such that in one study, 9.7% of a rural popu-
less than one-third of this population lives in lation, 100 km from Guatemala City were
Guatemala. Over half the population is rural travelling on a regular basis to Guatemala
and the United Nations classified 46% as liv- City or the United States for work13. There
ing in extreme poverty in 1994. In 1999, rates have been numerous reports of cysticercosis
of access to health services varied from 46% either in Central American immigrants or in
(Honduras) to 96% (Costa Rica)1. The region visitors to Central America made in the
is ethnically diverse: two-thirds of the popu- United States, Europe and Japan15–19.
lation being of mixed race, 49% of the Recently, the employment of domestic help
Guatemalan population being classified as from Latin America and in particular Central
indigenous American, up to 9% of the popu- America has been implicated in an outbreak
lation of Nicaragua being Afro-Caribbean of cysticercosis in the United States20,21.
and 87% of the population of Costa Rica
being of European origin. The region has an
estimated population of 3 million pigs. Taeniasis
Taenia solium has been recognized in
Central America for over a century2. From 1951 to 1960, a mean prevalence of
Neurocysticercosis (NC) was reported in 1.13% of T. solium taeniasis was detected in
Guatemala and Honduras in 1940 and 1956, the 157,085 faecal samples examined in the
respectively, and periodically thereafter over Institute of Tropical Diseases ‘Rodolfo
the next quarter-century3–8. The first Robles’, Guatemala City10. Of these cases,
Panamanian report of NC was made in 1984, 83% were aged between 18 and 45 years old
though T. solium was known to be endemic and 42% came from rural areas near
in Panama for decades prior to this9–12. Guatemala City. From 1983 to 1989, data


92 J. Garcia-Noval et al.
Belmopan
Belize
Guatemala Caribbean Sea

Guatemala City
Honduras
Tegucigalpa
San
Salvador
El Salvador Nicaragua
Managua
Pacific Ocean Costa Rica

San
Jose
Panama City
200 km Panama
Fig. 10.1. Map of Central America showing countries and capital cities.
from health centres in Honduras indicated a Carolina but none in migrants from Mexico
mean prevalence of 0.47% of intestinal taeni- or Haiti34. Data from field studies in rural
asis in 365,400 faecal samples22. The areas of Honduras and Guatemala have indi-
Honduran data also brought out significant cated that T. solium is responsible for
regional variation in prevalence with rates 75–100% of all Taenia species worms identi-
between 0.06% and 1%. From 1978 to 1987, a fied to the species level22,24–26. This contrasts
survey by the Ministry of Health, Costa Rica with hospital data from large urban centres
recorded a relatively low rate of intestinal where typically no diagnosis to the species
taeniasis, with a mean prevalence of 0.05% in level is carried out10,22.
1,176,332 faecal samples examined23. Recent There are clear patterns in the distribution
data on rates of taeniasis from rural Central of cases of taeniasis within the population of
America are available from Honduras and the region. Rates have been demonstrated to
Guatemala13,22,24–26. Rates of up to 6.2%, with vary considerably between, closely situated,
an average prevalence of 2% of intestinal tae- communities. For instance, in one study of
niasis have been recorded by microscopy in four similarly sized rural communities, all
Honduran communities22,25,26. Rates of within 5 km of each other, prevalence rates
approximately 1% have been detected by of taeniasis varied between 1% and 5.7%,
microscopy in Guatemala13,24,27. These data with statistically significant differences in
appear to indicate that, in comparison to prevalence between the communities13. The
countries in Latin America, rates in these two variations may be linked to socio-economic
countries are high. For instance, average factors such as sanitation, pig husbandry
prevalence in Mexico is typically below techniques and rates of pork consumption.
0.5%28–33. Interestingly, a study carried out in Furthermore, within individual communities
the United States indicated a prevalence of the inter-household distribution of intestinal
4.4% of intestinal taeniasis in Central taeniasis has been shown to be clus-
American migrant workers to North tered13,24,25. In the same Guatemalan study,

Taeniasis and Cysticercosis in Central America 93
rates of taeniasis in household members of study of 10,600 Costa Rican autopsy reports
indicator cases of the taeniasis were shown showed 24 cases of NC (0.23%)37. All the cases
to be nearly double that of the general rate of were aged above 7 years and the number of
taeniasis in the population (4.7% vs. 2.7%)13. the cysts was overdispersed, with 11 of the 24
This is consistent with the clustered pattern autopsies (41.6%) disclosing only one cyst, a
of intestinal taeniasis reported elsewhere in median of two cysts per person and a maxi-
Latin America28,30,31. Data from both hospi- mum of 17 cysts (Fig. 10.3)37. Retrospective
tals and rural communities within the region review indicated that 11 cases (45.8%) had
suggest that the highest rates of intestinal apparently been neurologically asymptomatic,
taeniasis are in individuals in their late teens intracranial hypertension had been diagnosed
to early forties (Fig. 10.2)10,13. Some data sug- in 7 cases (29.1%), convulsive crisis in three
gest that females may be at higher risk than cases (12.5%) and motor deficit in two cases
males13,22. Similar sex-biased distributions of (8.3%). One case was not classified37. More
intestinal taeniasis have been reported in recent hospital data from Costa Rica demon-
Ecuador and in Latin American immigrants strates the continued presence of low levels of
to the United States35,36. Once again the rea- human cysticercosis in that country23.
sons for this are unknown. When computed tomography (CT) scan-
ning was introduced to Guatemala in 1980,
the number of cases of NC diagnosed
Human Cysticercosis, increased greatly, resulting in the finding
Neurocysticercosis and Seizures that NC accounted for at least 8% of all
admissions to neurological wards in
From 1952 to 1961, in a study of hospital Guatemala City38. Similarly, the introduction
records from El Salvador and Guatemala, 118 of CT and ELISA to Honduras in the middle
cases of cysticercosis were detected by of the 1980s led to a fivefold increase in the
autopsy, of which 71 were shown to involve number of diagnoses of NC made in
cysts in the brain10. In 1967, a retrospective University Hospital, Tegucigalpa22.
5.0
4.5
4.0
Percentage prevalence
3.5
3.0
2.5
2.0
1.5
1.0
0.5
0
0–4 5–9 10–19 20 – 29 30 – 39 40 – 49 50 – 59 60 – 80
Age cohort (years)
Fig. 10.2. Age prevalence of intestinal taeniasis from a study of four rural communities in Guatemala13.
A total of 92 cases were diagnosed from a sample size of 3399 individuals (2.7% prevalence). Of the
cases 56 were Taenia solium, one case was T. saginata and in 35 cases it was not possible to determine
the species present.

12
10
Number of individuals
0
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
Number of cysticerci
Fig. 10.3. Distribution of intracerebral Taenia solium cysticerci detected in a retrospective study of
autopsy results carried out in Costa Rica37.
Seroepidemiology of human or sharing a house with an intestinal taeniasis

cysticercosis in Central America carrier are significant risk factors for cysticer-
cosis24. In the Honduran study, several socio-
Studies with the glycoprotein antigen based economic factors were associated with
enzyme-linked immunoelectrotransfer blot seropositivity including lack of potable water,
(EITB) have provided important insights into lack of a sanitary toilet, raising pigs and an
the burden of cysticercosis in Central earthen floor in the home14. In Guatemala
America39. For instance, seroprevalence rates females have been shown to be at higher risk
were 10% and 17%, respectively, in two rural of being seropositive (15% seropositive
communities in Guatemala, whilst sero- females vs. 11% seropositive males, odds ratio
prevalence rates were 17%, 22% and 34%, = 1.45, P0.016)24. Whether this reflects
respectively, in three different rural popula- greater exposure to infective eggs in the home
tions and 15% in an urban population from environment, or is a reflection of the higher
Tegucigalpa in Honduras14,24–26,40. These rates of intestinal taeniasis seen in females,
rates would suggest that infection rates in reported above, is unknown. This sex-specific
Guatemala and Honduras are higher than difference has, however, not been generally
those routinely reported from the remainder reported elsewhere, even within the region,
of Latin America such as Mexico, Peru, and so may represent a local phenomenon14,26.
Colombia or Bolivia, where rates are gener-
ally below 10%31,32,41–45. Indeed, a recent
assessment of data from Peru suggested a Epidemiology of seizure disorders in
mean seroprevalence of between 6% and Central America
10% there, although seroprevalence rates of
up to 35% have been reported43,46. Prevalence rates of seizure disorders are high
Studies within Central America have indi- among rural communities throughout the
cated, in common with data from other region24,26,47,48. The lowest rate reported to
regions, that infection with intestinal taeniasis date has been in one Guatemalan study that

indicated a prevalence of 5.8 cases of active neuroimaging studies than apparently neu-
epilepsy per 100048. Combined rates of active rologically normal controls (47% vs. 24%, P
and inactive epilepsy in rural Honduras have 0.007) (Fig. 10.4)24. In Honduras, one
been recorded at 22.7 per 100049. High rates study in a rural community found 41% of 90
of active epilepsy have been detected in other epileptics having lesions compatible with
studies. For instance, prevalence rates of 29 NC40. A second Honduran community study
per 1000 in rural Honduras26 and 18 per 1000 found a 17.6% rate of intracranial lesions
in rural Guatemala50 have been detected. suggestive of NC in persons with a normal
Furthermore, the estimated prevalence in a neurological examination26. Finally, an eval-
rural population of Guaymi Indians, living uation of family contacts of an indicator case
on the Caribbean coast near Costa Rica, was of cerebral cysticercosis at an urban
up to 57 per 1000, much higher than the rate Panamanian hospital resulted in the detec-
of active epilepsy in the lower social class tion of three of six other family members as
population of Panama City (22 per 1000)51. EITB positive and two of six (including one
of the three seropositives) as having calcified
lesions indicative of NC by CT (Fig. 10.4)52.
Neurocysticercosis and seizure disorder: In the clinical setting, a study in
imaging studies Honduran neurological patients indicated
that 84% of individuals with seizures and
Central American studies carried out in 69% of those with neurological problems
urban centres, rural populations and among other than seizures had lesions suggestive of
neurological patients have all established NC (Fig. 10.4)53. Furthermore, recent data
that cysticercosis is a major cause of morbid- from Honduras indicate that the two major
ity due to seizure disorders throughout the causes of seizures in that country were
region24–26,40,50,51. Data from two rural neonatal hypoxia, as a result of lack of med-
Guatemalan communities revealed that indi- ical attention during delivery, and NC (Ada
viduals with history of seizures had a signifi- Zelaya, National University of Honduras,
cantly greater chance of exhibiting abnormal personal communication). Finally, there is
intracranial lesions suggestive of NC upon evidence from a Honduran study to suggest
Neurological Number of Punctate Active/mixed Any

status individuals calcification lesions abnormality
Seizures 76 31 (41%) 9 (12%) 36 (47%)

Village population
(Guatemala)
No seizures 51 10 (20%) 3 (6%) 12 (24%)
Seizures 31 20 (65%) 6 (19%) 26 (84%)

Neurological patients
(Honduras)
No seizures 29 12 (41%) 8 (28%) 20 (69%)
Seizures 1 1 (100%)
Trace back to family
(Panama)
No seizures 6 2 (33%)
Fig. 10.4. Correlation between history of seizures and neuroimaging abnormalities detected by CT scan
in different populations in Central America: rural village population24; neurological patients52 and trace
back to family members of an individual in whom NC was diagnosed51.

that headache may also be linked to NC53. location of cystic infections. For instance in
This link has previously been reported from Central America there appears to be a rela-
a rural population in Ecuador and may bear tively high frequency of single active lesions
further investigation54. and calcified lesions detected by CT scan in
In both field epidemiological studies and rural populations (see Figs 10.3 and 10.4). It
studies of neurological patients the most com- is known that the EITB, though essentially
mon type of abnormal intracerebral lesions 100% specific for T. solium, is less sensitive in
seen by CT scanning have been punctate cal- infections involving single cysts and in indi-
cifications (Fig. 10.4)24,26,50,53. Furthermore, viduals with calcified lesions56. Furthermore,
studies from the region have indicated that, the high rates of NC in apparently asympto-
besides imposing a burden of neurological matic individuals in Central America and the
disease, that, conversely, significant numbers frequency of extraneural infection may fur-
of apparently neurologically normal individu- ther explain the apparent lack of association
als have abnormal intracranial lesion sugges- between serological status and epilepsy in
tive of NC14,24–26,50,52. This has led to the rural Central America. Some studies carried
suggestion that the majority of cases may, in out within the region have, however, demon-
fact, be asymptomatic as has been suggested strated association between epilepsy and
in other endemic regions24,26,54,55. serological status in rural populations.
Indeed Panamanian data, collected before the
introduction of the glycoprotein-based EITB
using an ELISA, demonstrated that signifi-
Human cysticercosis and seizure
cantly more active epileptics were seroposi-
disorder: serological observations
tive for cysticercosis than age- and sex-
matched controls in a population of Guaymi
Serological testing, particularly using the EITB Indians (44% vs. 6%, relative risk = 14)51.
has been useful in detecting areas of transmis-
sion, identifying risk factors associated with
infection and producing data that allow com- Porcine Cysticercosis
parison both within the region and between
Central America and other endemic areas39. In For many years there has been an under-
the hospital-based setting, clear associations standing that porcine cysticercosis imposes a
have been shown between T. solium specific significant economic burden on Central
serological status and seizure disorder. This American pork producers10,57,58. In a study
sometimes represents the only recently avail- carried out across the whole region, except
able data from some countries. For instance, in Belize, from 1959 to 1961, it was reported that
an ongoing study in Nicaragua, 14.7% of 88 68% of all the hogs condemned for any reason
epileptic patients and 2.94% of 102 controls in the six main abattoirs serving the capital
from Leon had antibodies detected by EITB cities of Guatemala City, San Salvador,
(P0.05, odds ratio = 4.25) (Felix Espinoza, Tegucigalpa, Managua, San José and Panama
National Autonomous University of City, were condemned because of cysticerco-
Nicaragua, personal communication). sis10. This represented 2.13% of all the pigs
Epidemiological studies in the region, and slaughtered over this period in these abat-
particularly those carried out in endemic toirs. This situation does not appear to have
communities, have, however, not generally improved: Honduran figures indicate that,
shown an association between either epilepsy from 1981 to 1986, an average of 4.8% of all
or abnormal CT images suggestive of cys- pigs slaughtered at the main abattoir serving
ticercosis and serological status in this Tegucigalpa were condemned due to cysticer-
test14,24–26. This contrasts with studies in other cosis22. Furthermore, in 1994 and 1995 respec-
areas41,42,46. These interregional variations tively, in the same abattoir, 2.8% and 3% of
may be related to the study design. There pigs slaughtered were condemned due to cys-
may, however, be some differences caused by ticercosis (Alexis Mendoza, PROMDECA,
the underlying prevalence and intensity and personal communication).

The failure of the meat inspection process Conclusions: Prospects for Control
to control this parasite can be seen in data
from the mid 1960s, where 6% and 6.5% The prospects for control of T. solium within
respectively, of 99 pork sausages and 107 Central America remain poor. None of the
‘chorizo’ (Spanish type) sausages purchased countries has a formal comprehensive con-
from a range of randomly selected establish- trol system and abattoir meat inspection is
ments in Guatemala City were found to har- ineffective due to slaughter of significant
bour cysticerci57. More recent studies from numbers of pigs outside the formal, regu-
Guatemala revealed that 4% and 14%, respec- lated, system. Further to this, for much of the
tively, of pigs in two rural communities had region, there is a lack, or indeed complete
cysts present in their tongues ante mortem24. In absence of epidemiological data. Without
these respective communities, 22% and 55% such data to assess the magnitude of the
of families raised pigs and 77% and 83% of problem, control programmes cannot be
those families that raised pigs allowed them
either properly planned or implemented.
to roam freely in the village. At least 75% of
Within the region, one study, carried out in
families stated that their main source of pork
Guatemala, has indicated that mass
was pigs killed either at home or in the village
chemotherapy with niclosamide significantly
with no official meat inspection. In one village
reduced prevalence of intestinal taeniasis and
27% of families were aware of having pur-
chased pork containing cysts while in the seroprevalence of cysticercosis in pigs 10
other community, 6% were aware of this24. months later60. Whether such an approach is
Further studies in Guatemala have indicated economically or logistically feasible is, in the
seroprevalences of antibodies to T. solium anti- current economic climate of much of the
gens using the glycoprotein-based EITB59 of region, questionable. If regional governments
40% and 64% in pigs from two communities60. were to identify T. solium as a problem that
Data from Honduras indicate that 27.1% of needed attention, this might improve the situ-
pigs in one community were seropositive in ation. The authors are unaware of any initia-
this test and that pigs may be infected soon tives on this parasite backed by any of the
after birth, although recent data on the pas- regional governments. Similarly, there
sive transfer of antibodies from infected sows appears to have been relatively little work
to piglets complicates the interpretation of the undertaken on this parasite by the local scien-
serological data61,62. tific, veterinary or public health communities.
References
1. Pan American Health Organization. (1999) Health Situation in the Americas. Basic Indicators. Special
Programme for Health Analysis, PAHO, Washington, DC.
2. Herrera, C.T. (1894) Frequent Endemics and Infections in Guatemala. Thesis, Faculty of Medicine,
University of San Carlos, Guatemala.
3. Aguilar, F.J. (1989) Natural history of cysticercosis. In: Aguilar, F.J., Masselli, R., Samayao, A. (eds)
Cisticercosis. Asociacion Guatemalteca de Parasitologia y Medicina Tropical, Guatemala, pp. 11–15.
4. Aguilar, F.J., Vizcaino, C. (1954) Cysticercosis in Guatemala. Revista del Collegio Medico (Guatemala) 5,
92–98.
5. Alvarez Rubio, O.A., Nazar, H.N. (1989) Neurocysticercosis in the Hospital Escuela. Revista Medica
Hondureña 57, 246–260.
6. Cueva, J.A. (1956) Cysticercosis in Honduras. Revista Medica Hondureña 24, 101–111.
7. Duron, R.A. (1967) Human cysticercosis in Honduras. A statistical review. Revista Medica Hondureña
35, 126–131.
8. Hernandez-Gonzalez, L.A., Arrredondo-Mendoza, F., Prado-Castro, J.A. (1990) Racimedullar neuro-
cysticercosis in Guatemala. Description of the ‘floating cystic lesion’ sign. Revista Mexicana
Radiologica 44, 165–169.
9. Acuna, E.R., Velasco Aparicio, G., Guzman Aranda, G. (1988) Neurocysticercosis in Panama. Revista
Medica Panama de 13, 9–16.

10. Acha, P.N., Aguilar, F.J. (1964) Studies on cysticercosis in Central America and Panama. American
11. Garrick, D. (1967) Current status of brucellosis, tuberculosis, rabies and cysticercosis in Central
America and Panama. Bulletin of the Pan American Health Organization 63, 142–150.
12. Paz, J.R. (1973) Present status of cysticercosis in Panama. Boletin Chileno de Parasitologia 28, 100–102.
13. Allan J.C., Velasquez Tohom, M., Garcia Noval, J., et al. (1996) Epidemiology of intestinal taeniasis in
four rural Guatemalan communities. Annals of Tropical Medicine and Parasitology 90, 157–165.
14. Sanchez, A.L., Medina, M.T., Ljungström, I. (1998) Prevalence of taeniasis and cysticercosis in a pop-
ulation of urban residence in Honduras. Acta Tropica 69, 141–149.
15. Shimizu, Y., Kagawa, S., Onuma, T. (1986) Cerebral cysticercosis – report of an operated case. No
Shinkei Geka 14, 209–213.
16. Ciesielski, S., Seed, J.R., Estrada, J., et al. (1993) The seroprevalence of cysticercosis, malaria, and
Trypanosoma cruzi among North Carolina migrant farmworkers. Public Health Reports 108, 736–741.
17. Steinmetz, R.L., Masket, S., Sidikaro, Y. (1989) The successful removal of a subretinal cysticercus by
pars plana vitrectomy. Retina 9, 276–280.
18. Chatel, G., Gulletta, M., Scolari, C., et al. (1999) Neurocysticercosis in an Italian traveller to Latin
America. American Journal of Tropical Medicine and Hygiene 60, 255–256.
19. Prosser, P.R., Wilson, C.B., Forsham, P.H. (1978) Intrasellar cysticercosis presenting as a pituitary
tumor: successful transsphenoidal cystectomy with preservation of pituitary function. American
20. Schantz, P.M., Moore, A.C., Munoz, J.L., et al. (1992) Neurocysticercosis in an Orthodox Jewish com-
munity in New York City. New England Journal of Medicine 327, 692–695.
21. Moore, A.C., Lutwick, L.I., Schantz, P.M., et al. (1995) Seroprevalence of cysticercosis in an Orthodox
Jewish community. American Journal of Tropical Medicine and Hygiene 53, 439–442.
22. Kaminsky, R.G. (1991) Taeniasis–cysticercosis in Honduras. Transactions of the Royal Society of Tropical
23. Arroyo, R. (1989) Taeniasis/cysticercosis in Costa Rica. In: Aguilar, F.J., Masselli, R., Samayao, A. (eds)
Cisticercosis. Asociacion Guatemalteca de Parasitologia y Medicina Tropical, Guatemala, pp. 75–79.
24. Garcia-Noval, J., Allan, J.C., Fletes, C., et al. (1996) Epidemiology of Taenia solium taeniasis and cys-
55, 282–289.
25. Sanchez, A.L., Gomez, O., Allebeck, P., et al. (1997) Epidemiological study of Taenia solium infections
in a rural village in Honduras. Annals of Tropical Medicine and Parasitology 91, 163–171.
26. Sanchez, A.L., Lindbäck, J., Schantz, P.M., et al. (1999) A population-based case-control study for T.
solium taeniasis and cysticercosis. Annals of Tropical Medicine and Parasitology 93, 247–258.
27. Allan, J.C., Velasquez Tohom, M., Torres Alvarez, R., et al. (1996) Field trial of diagnosis of Taenia
solium taeniasis by coproantigen enzyme linked immunosorbent assay. American Journal of Tropical
28. Diaz Camacho, S.P., Candil Ruiz, A., Suate Peraza, V., et al. (1991) Epidemiologic study and control
of Taenia solium infections with praziquantel in a rural village of Mexico. American Journal of Tropical
29. Diaz Camacho, S., Candil Ruiz, A., Uribe Beltran, M., et al. (1990) Serology as an indicator of Taenia
solium tapeworm infections in a rural community in Mexico. Transactions of the Royal Society of
30. Sarti-Gutierrez, E.J., Schantz, P.M., Lara-Aguilera, R., et al. (1988) Taenia solium taeniasis and cysticer-
cosis in a Mexican village. Tropical Medicine and Parasitology 39, 194–198.
31. Sarti, E., Schantz, P.M., Plancarte, A., et al. (1992) Prevalence and risk factors for Taenia solium taenia-
sis and cysticercosis in humans and pigs in a village in Morelos, Mexico. American Journal of Tropical
32. Sarti, E., Schantz, P.M., Plancarte, A., et al. (1994) Epidemiological investigation of Taenia solium tae-
33. Rodriguez-Canul, R., Fraser, A., Allan, J.C., et al. (1999) Epidemiological study of Taenia solium taeni-
asis/cysticercosis in a rural village of Yucatan, Mexico. Annals of Tropical Medicine and Parasitology
93, 57–67.
34. Ciesielski, S., Seed, J.R., Ortiz, J.C., et al. (1991) Intestinal parasites among North Carolina migrant
farmworkers. American Journal of Public Health 82, 1258–1262.

36. Richards, F.O. Jr, Schantz, P.M., Ruiz-Tiben, E., et al. (1985) Cysticercosis in Los Angeles County.
Journal of the American Medical Association 254, 3444–3448.
37. Piza, J., Fernandez, A., Soto, M., et al. (1967) Cerebral cysticercosis. a clinico–anatomical study of 24
cases in Costa Rica. Acta Medica Costaricense 10, 5–17.
38. Arredondo, F. (1989) Computerised tomography in the diagnosis of neurocysticercosis. In: Aguilar,
F.J., Masselli, R., Samayao, A. (eds) Cisticercosis. Asociacion Guatemalteca de Parasitologia y
Medicina Tropical, Guatemala, pp. 51–55.
39. Tsang, V., Brand, A.J., Boyer, A.E. (1989) An enzyme imunoelectrotransfer blot assay and glycoprotein
antigens for diagnosing human Taenia solium cysticercosis. Journal of Infectious Diseases 159, 50–59.
40. Sánchez, A.L., Duron, R., Osorio, J.R., et al. (1998) Evaluation of the enzyme-linked immunoelectro-
transfer blot (EITB) assay in epileptic patients from a rural community in Honduras. In: Proceedings
of the International Congress of Parasitology, ICOPA IX. Italy, pp. 185–189.
41. Diaz, J.F., Verastegui, M., Gilman, R.H., et al. (1992) Immunodiagnosis of human cysticercosis (Taenia
solium): a field comparison of an antibody-enzyme-linked immunosorbent assay (ELISA), an anti-
gen-ELISA, and an enzyme-linked immunoelectrotransfer blot (EITB) assay in Peru. The
Cysticercosis Working Group in Peru (CWG). American Journal of Tropical Medicine and Hygiene 46,
610–615.
42. Moro, P.L., Guevara, A., Verastegui, M., et al. (1997) Distribution of hydatidosis and cysticercosis in
different Peruvian populations as demonstrated by an enzyme-linked immunoelectrotransfer blot
(EITB) assay. The Cysticercosis Working Group in Peru (CWG). American Journal of Tropical Medicine
44. Palacio, L.G., Jimenez, I., García, H.H., et al. (1998) Neurocysticercosis in persons with epilepsy in
Medellin, Colombia. The Neuroepidemiological Research Group of Antioquia. Epilepsia 39,
1334–1339.
45. Jafri, H.S., Torrico, F., Noh, J.C., et al. (1998) Application of the enzyme-linked immunoelectrotrans-
fer blot to filter paper blood spots to estimate seroprevalence of cysticercosis in Bolivia. American
46. García, H.H., Talley, A., Gilman, R.H., et al. (1999) Epilepsy and neurocysticercosis in a village in
Huaraz, Peru. Clinical Neurology and Neurosurgery 101, 225–228.
47. Gracia, F.J., Bayard, V., Triana, E., et al. (1988) Prevalence of neurologic diseases in Belisario Porras
municipality, District of San Miguelito, Panama, 1986. Revista Medica de Panama 13, 40–45.
48. Mendizabal, J.E., Salguero, L.F. (1996) Prevalence of epilepsy in a rural community of Guatemala.
Epilepsia 37, 373–376.
49. Duron, R., Osorio, J.R., Martinez, L., et al. (1997) Epilepsy in Salama, Honduras: first phase of an epi-
demiological study. Revista Hondureña de Neurociencias 1, 9–18.
50. Garcia-Noval, J., Moreno, E., de Mata, F., et al. (2001) An epidemiological study of epilepsy and
epileptic seizures in two rural Guatemalan communities. Annals of Tropical Medicine and Parasitology
95, 167–175.
51. Gracia, F., de Lao, S.L., Castillo, L., et al. (1990) Epidemiology of epilepsy in Guaymi Indians from
Bocas del Toro Province, Republic of Panama. Epilepsia 31, 718–723.
52. Gracia, F., Chavarria, R., Archbold, C., et al. (1990) Neurocysticercosis in Panama: preliminary epi-
demiologic study in the Azuero region. American Journal of Tropical Medicine and Hygiene 42, 67–69.
53. Sanchez, A.L., Ljungström, I., Medina, M.T. (1999) Diagnosis of human neurocysticercosis in an
endemic area: a clinical study in Honduras. Parasitology International 48, 81–89.
54. Cruz, I., Cruz, M.E., Teran, W., et al. (1994) Human subcutaneous Taenia solium cysticercosis in an
Andean population with neurocysticercosis. American Journal of Tropical Medicine and Hygiene 51,
405–407.
55. Schantz, P.M., Sarti, E., Plancarte, A., et al. (1994) Community-based epidemiological investigations
56. Wilson, M., Bryan, R.T., Fried, J.A., et al. (1991) Clinical evaluation of the cysticercosis enzyme
linked immunotransfer blot (EITB) in patients with neurocysticercosis. Journal of Infectious Diseases
164, 107–109.

57. Zapatel, J., Ubieto, A., Martinez, M. (1965) Cysticerci in processed meat in Guatemala. American
58. Schenone, H. (1973) Some considerations on the occurrence of cysticercosis in swine in Latin
America. Boletin Chileno de Parasitologia 28, 106–107.
60. Allan, J.C., Velasquez-Tohom, M., Fletes, C., et al. (1997) Mass chemotherapy for intestinal Taenia
solium taeniasis: effect on prevalence in humans and pigs. Transactions of the Royal Society of Tropical
61. Sakai, H., Sone, M., Castro, D.M., et al. (1998) Seroprevalence of Taenia solium in pigs in a rural com-
munity of Honduras. Veterinary Parasitology 78, 233–238.
in porcine Taenia solium cysticercosis. Cysticercosis Working Group in Peru. Veterinary Parasitology
86, 113–118.

11 Neurocysticercosis in Brazil:
Epidemiological Aspects
Svetlana Agapejev
Introduction a sizeable collection of papers describing the

many aspects of the disorder. A major contri-
Human and swine cysticercosis is a disease bution of Brazilian work has been the gener-
caused by the metacestode larval form (cys- ation of autopsy (Table 11.1)1–22 and clinical
ticercus cellulosae) of the parasite, Taenia (Table 11.2)23–52 data. In comparison, seroepi-
solium. Factors contributing to the endemic demiologic studies are few but nevertheless
nature of taeniasis–cysticercosis are many. available (Table 11.3)53–59. This chapter is
Improper disposal of faeces from infected based on reports selected from an extensive
individuals in the absence of sanitary infra- review of papers from accessible Brazilian
structure, the existence of latrines and veg- literature and from more than 25 years of
etable gardens and/or orchards in the personal observations60. Together, the
vicinity of pig pens especially when irrigated autopsy, clinical and epidemiological infor-
with contaminated water or fertilized with mation reflect the epidemiological character-
human faeces, allow the swine access to istics of T. solium cysticercosis in Brazil.
human faeces. Rearing infected swine,
manipulation of contaminated meat through
unofficial markets, aberrant inspection at Geographical Prevalences
slaughterhouses and butchers’ shops and
consumption of raw or poorly cooked pork Brazil: geography, people and habits
are risk factors for acquiring human taenia-
sis. Finally, deficient health education and Brazil is the fifth largest country in the world
awareness, precarious personal hygiene such and the largest in South America. It has an
as ingestion of unwashed food and handling area of 8512 million km2 and a population of
of food with dirty and contaminated hands, 172,535 million. Most Brazilians are Catholic
and possibly the use of water from rivers, Christians. Food habits differ regionally and
streams or lakes, directly for consumption with economic conditions within Brazil.
are risk factors for human cysticercosis. Meat is an important dietary item, although
Several of these risk factors prevail in Brazil beef is eaten more frequently than pork.
giving it one of the highest prevalences of However, sausages made of pork are often
taeniasis–cysticercosis in the world (Fig. 11.1). consumed raw or undercooked. It is tradi-
A review of Brazilian literature on neuro- tional practice in North and Northeast Brazil
cysticercosis (NC) from 1907 to 2000 reveals to eat meat after salting it and then drying it


102 S. Agapejev
Fig. 11.1. Some endemic factors for the maintenance of taeniasis/cysticercosis complex: (a) Rubbish
near a sign (arrow) saying ‘No rubbish disposal ’. (b) Lake water used for drinking and hygiene for
humans (arrows) and swine (foreground). (c) Vegetable garden irrigated with contaminated water from
the river (arrow). (d) Contaminated pork at a clandestine slaughterhouse.
in the hot sun. In South and Southeast Brazil, Geographic prevalence of NC within
pork is roasted or fried. Brazil is a rapidly Brazil
developing country, making great strides in
industrialization. Piped water supply exists While NC is endemic throughout most of
in three-quarters and sewer or septic Brazil, definite information about the
cesspool facilities in one-half of the homes. endemic nature of the disease is available
The Brazilian Association of Pig Producers from several states (shown in Fig. 11.2). Other
has 12 million pigs registered in South Brazil, states have non-confirmed occurrence of NC.
9 million in Northeast Brazil, 7 million in These projections are mostly derived from
Southeast Brazil and 6 million in Central- hospital-based reports and these may not
West Brazil. This, however, is not a true esti- reflect the true prevalence of disease. For
mate of the porcine population, since a large instance, Northeast Brazil is an economically
number of pigs are raised in backyards or are underprivileged area and one would expect
free ranging. Official data from government large number of cases to be reported from
sources revealed that the prevalence of swine this region. However, this might not be the
cysticercosis for the period 1952–91 was case as a large proportion of cases may be
0.03–6.9%, through several regions in Brazil. undiagnosed on account of the lack of inves-
However, epidemiological surveys estimate tigative facilities like computed tomography
that the actual prevalence may be as high as (CT). Similarly, it appears from the review of
13–28% in certain regions within Brazil. literature that more severe cases like intracra-

Neurocysticercosis in Brazil 103
Fig. 11.2. Frequency of human neurocysticercosis in the Brazilian states.

(RS: Rio Grande do Sul; SC: Santa Catarina; PR: Paraná; MS: Mato Grosso do Sul; SP: São Paulo;
MT: Mato Grosso; MG: Minas Gerais; RJ: Rio de Janeiro; ES: Espírito Santo; TO: Tocantins;
FD: Federal District; GO: Goiás; BA: Bahia; SE: Sergipe; AL: Alagoas; PI: Piauí; PE: Pernambuco;
PB: Paraíba; AC: Acre; AM: Amazonas; PA: Pará; MA: Maranhão; CE: Ceará; RN: Rio Grande do Norte;
RR: Roraima; AP: Amapá.)
nial hypertension and racemose cysticercosis hospitals in Brazil indicate that NC was
are frequently seen in hospital services in responsible for about two admissions every
Southern and Southeast Brazil in comparison month there. These data are at best an underes-
to North and Northeast Brazil, where most of timate especially since the reporting of
the hospital-based reports are those of milder taeniasis–cysticercosis is not obligatory in
varieties of NC. These differences may Brazil.
merely reflect different referral patterns,
access to medical care and of expertise in the
treatment of more difficult cases in South and Epidemiological Characteristics
Southeast Brazil. Therefore geographical dif- Inferred from Autopsy
ferences in clinical presentations may be
more apparent than real (Figs 11.2 and 11.3). Autopsy is an important tool to confirm clin-
From a review of published autopsy and ical diagnosis and estimate disease fre-
clinical service-based data from 1907 to 2000 quency. Unfortunately, however, resort to
and 1915 to 2000, respectively, an average of autopsy is infrequent in Brazil, primarily
600 autopsy diagnoses of NC and 500 clinico- owing to factors such as excessive trust in
radiological diagnoses of NC were made every laboratory diagnoses, difficulty in obtaining
year60. Similarly, data available from general family authorization, lack of systematic

104 S. Agapejev
(a)
12.9% North-Northeast
Central-West
South-Southeast
Viable cysts
26% 5.2%
67% 4.6%
4.0%
2.0% 1.8%
1.6% 1.5%
0.4%
Autopsy Clinical series Seroepidemiology
(b) North-Northeast
77% South-Southeast
57%
50% 48%
47%
28%
10%
5%
Epilepsy Intracranial Psychiatric Headache

hypertension disturbance
Fig. 11.3. Brazilian regional differences in the frequency of neurocysticercosis: (a) and clinical
manifestations (b) expressed by the average of the reported incidences.
requirement of obligatory autopsy even in tion may provide a more realistic estimate of
university hospitals, and a high frequency of the prevalence of NC since ocular globes,
domiciliary deaths. Since autopsy is difficult skeletal muscles and spinal cord with the
to perform in many areas, many cases of dis- nerve roots are analysed in addition to the
ease go unnoticed. There is a lack of uniform brain. Nevertheless, NC ranked 19 among
protocol for organ examination at autopsy pathological diagnoses at autopsy in a gen-
services. Furthermore, slices are usually eral hospital in the city of São Paulo15.
made at more than 1 cm at autopsy; and as a The frequency of detection of NC at
result, a small pathological lesion may escape autopsy in different series in Brazil from
detection leading to an underestimation of 1915 onwards is shown in Table 11.1. A range
disease frequency. Survey of necropsy at of frequency from 0.12% to 9.0%, giving an
Legal Medicine institutes and in the popula- average of 1.5% has been reported1–22,60.

Table 11.1. Neurocysticercosis in Brazil – frequency based on autopsy studies.
Frequency Total number

Author (publication year) State* (%) of cases†
Almeida§1 (1915) SP 0.71 1,822

Trétiakoff and Silva§2 (1924) SP 3.6 250
Galvão§3 (1928) SP 1.6 997
Povoa§4 (1934) SP 1.03 1,073
Salles5 (1934) SP 0.12 4,000
Pinheiro and Mello§6 (1941) SP 0.43 465
Pupo et al.§7 (1945/1946) SP 1.5 1,000
Montenegro8 (1946) SP 2.5 312
Hellmeister and Faria9 (1973) SP 1.78 1,013
Guidugli-Neto and Matosinho-França10 (1977) SP 0.86 3,587
Queiroz and Martinez11 (1979) BA 0.30 4,000
Gobbi et al.12 (1980) MG 1.60 2,306
Almeida and Lima13 (1988) CE 0.45 1,773
Tavares et al.14 (1988) MG 9.0 1,160
Almeida et al.15 (1989) SP 1.5 200
Vianna et al.16 (1991) FD 1.6 1,520
Tavares§17 (1994) SP 1.85 3,681
Agapejev‡18 (1995) MG 0.77 20,741
Costa-Cruz et al.19 (1995) MG 1.22 2,862
Chimelli et al.20 (1998) SP 1.5 2,522
Lino et al.21 (1999) MG 3.3 1,596
Montemór-Netto et al.22 (2000) PR 3.1 901
Note: The data refer to frequency of neurocysticercosis and not to cysticercosis in general.
*Federal State of Brazil in which the study was conducted (see Fig. 11.2).
†Number of studied cases from which those with neurocysticercosis were selected.
‡Studies in general hospitals.
§Studies conducted on psychiatric patients.
Numbers reported depend primarily upon Autopsy data from Brazil also indicate
the autopsy protocol adopted, the repute of that NC is the primary cause of death in
the medical facility in treatment of disease 16–34% of those cases in which it was
and possibly on the geographical location detected1–22,60. The final cause of death was
within Brazil. For instance, high rates of found to be intracranial hypertension in
detection of NC have been noted in autopsy 47–69% of these cases18,20. Even in autopsies
series reported from Southeast Brazil performed in those who had neurological
(0.1–9.0%) in comparison with Northeast symptoms during life, NC may be an inci-
Brazil (0.30–0.45%). Dichotomy also exists in dental finding in about 26%18. While
the relative proportions of viable, asympto- parenchymal calcifications and viable cysts
matic and symptomatic cysticercosis. In a are the most common incidental findings,
large series from the state of Bahia in North autopsy could occasionally reveal asympto-
Brazil, 67% of examined parasites were matic intraventricular or cisternal cysticerco-
viable and there was a high proportion of sis. NC may also be diagnosed at autopsy in
asymptomatic NC11. The latter refers to those those patients who die as a result of other
autopsies in which the individuals had no infectious and parasitic diseases such as pul-
symptoms related to NC during life and monary tuberculosis, paracoccidiomycosis,
autopsy revealed incidental cysts. In com- Chagas’ disease and AIDS18,20. Co-infection
parison, data from our centre in Southeast probably reflects poor socio-economic and
Brazil revealed viable cysticerci in 26% of the health-related conditions that predispose to
autopsies18. both infections.

106 S. Agapejev
Prior to the 1980s, when CT was not avail- Epidemiological Characteristics

able, a diagnosis of NC was often made only Inferred from Hospital-based Studies
after death during necropsy. For instance, a
definite ante-mortem diagnosis of NC was Several large clinical series of patients with
made on the basis of cerebrospinal fluid exami- NC have been reported from Brazil (Table
nation in only 3.6% of cases in whom autopsy 11.2). The frequency of NC, the demographic
revealed NC. With the advent of CT, this figure profile and clinical manifestations depend
rose to 50–63%, demonstrating the dramatic upon the source of the series. For instance, in
impact of CT upon the diagnosis of NC15,18,43. four general hospitals in São Paulo state, two
Table 11.2. Neurocysticercosis in Brazil – frequency in clinical series.
Frequency Total number

Author (publication year) State* (%) of cases†
Lange¶|23 (1940) SP 0.31 4,200

Pupo et al.¶|7 (1945/1946) SP 10
Brotto24 (1947) SP 0.36 12,361
Spina-França25 (1956) SP 2.98 2,273
Canelas26 (1962) SP 3.39 4,900
Silva et al.27 (1965) PE 0.06 4,600
Camargo-Lima28 (1966) SP 355
Mega and Lison ¶|29 (1967) SP 3.08 2,500
Benício** (1970) PE 0.03 9,077
Reis31 (1970) SP 1.15
Manreza§32 (1982) SP 1.76
Takayanagui and Jardim33 (1983) SP 7.5 500
Machado et al.‡34 (1988) SP 0.19 126,968
Chequer and Vieira35 (1990) ES 45
Clemente and Werneck36 (1990) RJ 100
Vianna et al.37 (1990) FD 12.9 520
Spina-França et al.¶|39 (1993) SP 1.13 135,000
Agapejev‡18 (1995) SP 0.3 132,480
6.1 3,225
Ferreira et al.§40 (1994) FD 10
Tavares***17 (1994) MG 12.2 188
Azambuja et al.¶|41 (1995) RS 13.4 1,088
Camargo¶|42 (1995) PR 4.8 51,694
Gonçalves-Coêlho and Coêlho¶|43 (1996) PB 1.02 4,011
Freitas and Palermo44 (1996) PA 12
Takayanagui et al.45 (1996) SP 262
Andrade46 (1997) BA 157
Forlenza et al.***40 (1997) SP 38
Narata et al.¶|48 (1998) PR 9.2 2,554
3.3 973
Agapejev49 (1999) SP 299
Pfuetzenreiter and Ávila-Pires50 (1999) SC 57
Gomes et al.¶|51 (2000) BA 5.0 200
Silva et al.¶|52 (2000) RS 1.27 6,300
Note: The data refer to frequency of neurocysticercosis and not to cysticercosis in general.
*Federal State of Brazil in which the study was conducted (see Fig. 11.2).
†Number of studied cases from which those with neurocysticercosis were selected.
‡Studies in general hospitals.
§Studies limited to paediatric cases.
***Studies conducted on psychiatric patients.

**Cited by Schenone et al.30.
¶|
Studies based upon complementary tests (e.g. CT, CSF, etc.).

in the capital city and two outside the capi- quency of 2–6% in radiological investiga-
tal, NC was responsible for 0.1–0.2% and tions20,22,45,60. Several studies have addressed
0.3–2.5% of hospital admissions, respec- the frequency of diagnosis of NC among
tively60. In comparison, this disorder was patients referred to CT scan units38,41,43,48,52,61.
responsible for up to 13% of admissions to While these numbers give us an idea of the fre-
neurology and neurosurgery services. quency of NC in comparison to other neurolog-
Headaches and seizures are the most ical disorders, they cannot be extrapolated to
commonly reported symptoms; headaches establish prevalence of the disease in the com-
are more frequent in women, while seizures munity. In addition, the frequency may depend
are more common in men. Seizures occur upon whether the CT unit is that of a general
more frequently in series collected from out- hospital or a specialized neurological facility. In
patient departments in Brazil. most of such published series from Brazil, a
In available hospital-based reports of diagnosis of NC was made in 1–2% of the CT
series of patients with NC from Brazil, examinations38,41,43,48,52,61. More meaningful is
patients are mostly of rural origin (30–79%). the fact that the commonest CT abnormality in
However, urban origin becomes more fre- these reports has been either single or multiple
quent when more severe clinical presenta- parenchymal calcifications38,41,43,48,52,61.
tions of NC in children and adults are
considered60–62. Skin colour does not seem to
be a selection factor since its frequency was Compulsory Notification
proportional to the studied populations, with
no significant statistical difference18,46. In the The study of frequency and manifestations of
majority of published studies, the most NC seen in a single hospital does not reflect
affected age group is 11–60 years, with a fre- actual disease prevalence and patterns, since
quency of 22–67% between 21 and 40 years60. they are largely dependent on the pattern of
In general, there is a predominance of males referral to that hospital. Compulsory notifica-
(51–80%) in most series20,22,46,51,60,61. However, tion is a more accurate estimate of disease
severe manifestations are more commonly frequency and patterns45. Compulsory notifi-
reported among females47,48,50,60,63. cation in Ribeirão Preto, São Paulo, established
The period of hospitalization for patients a prevalence of 54/100,000 inhabitants45. While
with NC ranges from 1 to 254 days. Most compulsory notification is useful in estimating
patients require hospitalization for about a the prevalence of clinically overt NC, it would
week18,34. Nearly one half of the patients not be able to detect the large number of
require multiple admissions (up to nine, in asymptomatic cases known to exist.
Brazilian literature)18,34,35. The mortality rate in
several of the general hospital based series in
Brazil is low (approximately 0.3%). However, Community-based Serological
among patients with NC, the mortality rate is Studies
4.8–25.9%18,25,26,33,34,37. NC is responsible for
0.6–3.6% of hospital deaths due to neurologi- The seroepidemiology of human cysticerco-
cal disorders in Brazil. When studies from sis has not been systematically studied with
neurosurgical departments are evaluated, the the help of contemporary methods of evalua-
mortality may be as high as 60%64. tion. Some of the earlier studies have been
based upon indirect haemagglutination and
ELISA (reviewed in Table 11.3)52–59.
Epidemiological Data Inferred from
Imaging Facilities
Conclusions
While asymptomatic forms of NC (cases with
no neurological manifestations during life) are A plethora of clinical, hospital-based and
often diagnosed at autopsy, they can also be autopsy reports of human cysticercosis are
detected as an incidental finding with a fre- available from Brazil. These reports suggest

108 S. Agapejev
Table 11.3. Neurocysticercosis in Brazil – seroepidemiological studies.
Total number Frequency

Author (publication year) State* of cases† (%)
Ueda et al.53 (1984) SP 824 0.87

Vianna et al.54 (1986) FD 1122 5.2
Arruda et al.55 (1990) PR 1168 0.68
Vaz et al.56 (1990) SP 821 2.30
Silva-Vergara57 (1995) MG 1080 1.94
Lonardoni et al.58 (1996) PR 2180 3.2
Biondi et al.‡ (1998) AL 736 1.9
Pires et al.59 (2000) MA 756 6.22
Note: The data refer to incidence of positive reactions for cysticercosis in serum.
* Federal State of Brazil in which the study was conducted (see Fig. 11.2).
†Number of studied cases from which those with cysticercosis were selected.
‡Biondi, G.F., Nunes, C.M., Cruz, J.M.C., et al., 1998 – unpublished observations.
that human cysticercosis is an important evaluated on a preliminary basis in Brazil. It

public health problem there; however, they needs to be applied on a wider basis in order
do not provide a true estimate of the disease to determine areas of high prevalence. Once
prevalence. Compulsory notification of the this is done, control measures may be prefer-
disease is a useful method that has been entially applied to these areas.
References
1. Almeida, W. (1915) [Contribution of autopsy to clinical study of cerebral cysticercosis.] Archivos

Brasileiros de Psychiatria, Neurologia e Medicina Legal 11, 229–264.
2. Trétiakoff, C., Silva, A.C.P. (1924) [Contribution to the study of cerebral cysticercosis and in details
the farther toxic brain lesions in this infection.] Memorias do Hospício de Juquery 1, 37–66.
3. Galvão, S.T. (1928) [Incidence and Prophylaxis of Cysticercosis and Hydatidosis in São Paulo.]
Thesis, University of São Paulo, Brazil.
4. Povoa, H. (1932) [Cerebral cysticercosis.] Folha Médica 13, 241–246.
5. Salles, J.M.M. (1934) [Cerebral Cysticercosis.] Thesis, University of São Paulo, Brazil.
6. Pinheiro, J., Mello, A.R. (1941) [Considerations about cerebral cysticercosis.] Archivos Brasileiros de
Medicina 31, 192–212.
7. Pupo, P.P., Cardoso, W., Reis, J.B., et al. (1945/1946) [On brain cysticercosis. Its clinic, pathology,
radiology and cerebrospinal fluid syndrome.] Arquivos de Assistência aos Psicopatas do Estado de São
Paulo 10/11, 3–123.
8. Montenegro, J. (1946) [Blindness caused by brain cysticercosis.] Revista Paulista de Medicina 29,
348–356.
9. Hellmeister, C.R., Faria, J.L. (1973) [Neurocysticercosis. Necropsy details.] Revista da Associação
Médica Brasileira 19, 281–282.
10. Guidugli-Neto, J., Matosinho-França, L.C. (1977) [Neurocysticercosis: necroscopic study.] Revista
Médica do IAMSPE 8, 65–67.
11. Queiroz, A.C., Martinez, A.M.B. (1979) [The involvement of the central nervous system in cysticer-
cosis.] Arquivos de Neuropsiquiatria 37, 34–41.
12. Gobbi, H., Adad, S.J., Neves, R.R., et al. (1980) [Occurrence of cysticercosis (Cysticercus cellulosae) in
necropsied patients in Uberaba – MG, Brazil.] Revista de Patologia Tropical 9, 51–59.
13. Almeida, Y.M., Lima, J.H.C. (1988) [Neurocysticercosis in the state of Ceará: necropsy findings.]
Revista da Sociedade Brasileira de Medicina Tropical 11 (Suppl.), 97.
14. Taveras, A.R., Valadares-Neto, D., Pittella, L.E.M. (1988) [Frequency of neurocysticercosis at the
Hospital of Clinics of the Federal University of Minas Gerais confirmed by neuropathologic exami-
nation.] Arquivos de Neuropsiquiatria 46 (Suppl.), 75.

15. Almeida, M.C., Couto, L.A.A.M., Silva, L.H.F., et al. (1989) [Correlation between anatomo-clinical
diagnosis and retrospective assessment of clinical diagnosis in post mortem.] Revista de Saúde Pública
(São Paulo) 23, 285–291.
16. Vianna, L.G., Macedo, V., Costa, J.M. (1991) Musculocutaneous and visceral cysticercosis: a rare dis-
ease? Revista do Instituto de Medicina Tropical de São Paulo 33, 129–136.
17. Taveras, A.R. (1994) [Neuropsychiatric Aspects in Human Neurocysticercosis.] Thesis, Federal
University of São Paulo, Brazil.
18. Agapejev, S. (1995) Incidence of Neurocysticercosis at the University Hospital, Faculty of Medicine,
State University of São Paulo. (Abstract). Thesis. University of São Paulo, Brazil. Arquivos de
Neuropsiquiatria 53, 170–171.
19. Costa-Cruz, J.M., Rocha, A., Silva, A.M., et al. (1995) [Occurrence of cysticercosis in autopsies per-
formed in Uberlândia, Minas Gerais, Brazil.] Arquivos de Neuropsiquiatria 53, 227–232.
20. Chimelli, L., Lovalho, A.F., Takayanagui, O.M. (1998) [Neurocysticercosis: contribution of autopsies
to consolidation of the compulsory notification in Ribeirão Preto – SP, Brazil.] Arquivos de
21. Lino, R.S., Reis, M.A., Teixeira, V.P.A. (1999) [Occurrence of encephalic and cardiac cysticercosis
(Cysticercus cellulosae) in necropsy.] Revista de Saúde Pública (São Paulo) 33, 495–498.
22. Montemór-Netto, M.R., Gasparetto, E.L., Faoro, L.N., et al. (2000) [Neurocysticercosis: a clinical and
pathological study of 27 necropsied cases.] Arquivos de Neuropsiquiatria 58, 883–889.
23. Lange, O. (1940) [Cerebrospinal fluid syndrome in encephalic and meningeal cysticercosis.] Revista
de Neurologia e Psiquiatria de São Paulo 6, 35–48.
24. Brotto, W. (1947) [Neurologic aspects of cysticercosis.] Arquivos de Neuropsiquiatria 5, 258–294.
25. Spina-França, A. (1956) [Central nervous system cysticercosis. Considerations about 50 cases.]
Revista Paulista de Medicina 48, 59–70.
26. Canelas, H.M. (1962) [Neurocysticercosis: incidence, diagnosis and clinical pictures.] Arquivos de
27. Silva, W.F., Ataide, L., Chiappetta, J. (1965) [Neurocysticercosis: a proposal of 3 cases.] Neurobiologia
28, 51–58.
28. Camargo-Lima, J.G. (1966) [Brain Cysticercosis. Clinical Aspects.] Thesis. Federal University of São
Paulo, Brazil.
29. Mega, D., Lison, M.P. (1967) [Hypoglycorachie et cysticercose cérébro-méningée.] Schweizerisch
Archiv für Neurologie, Neurochirurgie und Psychiatrie 100, 425–430.
30. Schenone, H., Ramirez, R., Rojas, A. (1973) [Epidemiological aspects of neurocysticercosis in Latin
America.] Boletin Chileno de Parasitologia 28, 61–72.
31. Reis, J.B. (1970) [Incidence of Neurocysticercosis at the Department of Neurology and Neurosurgery
of the São Paulo School of Medicine During the Period of 1939–1969.] Thesis. Federal University of
São Paulo, Brazil.
32. Manreza, M.L.G. (1982) [Neurocysticercosis in childhood: clinical aspects and diagnosis.] Revista do
Hospital das Clínicas da Faculdade de Medicina de São Paulo 37, 206–211.
33. Takayanagui, O.M., Jardim, E. (1983) [Clinical aspects of neurocysticercosis: study of 500 cases.]
Arquivos de Neuropsiquiatria 41, 50–63.
34. Machado, A.B.B., Pialarissi, C.S.M., Vaz, A.J. (1988) [Human cysticercosis in a general hospital in S.
Paulo, Brazil.] Revista de Saúde Pública (São Paulo) 22, 240–244.
35. Chequer, R.S., Vieira, V.L.F. (1990) [Neurocysticercosis in the state of Espírito Santo, Brazil: evalua-
tion of 45 cases.] Arquivos de Neuropsiquiatria 48, 431–440.
36. Clemente, H.A.M., Werneck, A.L.S. (1990) [Neurocysticercosis: incidence in the Rio de Janeiro State.]
37. Vianna, L.G., Macedo, V., Mello, P., et al. (1990) [Clinical and laboratory study of neurocysticercosis
in Brasília.] Revista do Brasileira de Neurologia 26, 35–40.
38. Bruck, I., Antoniuk, A.S., Wittig, E., et al. (1991) [Neurocysticercosis in childhood I. Clinical and lab-
oratory diagnosis.] Arquivos de Neuropsiquiatria 49, 43–46.
39. Spina-França, A., Livramento, J.A., Machado, L.R. (1993) Cysticercosis of the central nervous system
and cerebrospinal fluid. Immunodiagnosis of 1573 patients in 63 years (1929–1992). Arquivos de
40. Ferreira, M.S., Costa-Cruz, J.M., Nishioka, S.A., et al. (1994) Neurocysticercosis in Brazilian children:
report of 10 cases. Tropical Medicine and Parasitology 45, 49–50.
41. Azambuja, N.D., Ambrós, S., Vanzin, J., et al. (1995) [Neurocysticercosis calcifications in computed tomog-
raphy: a report of the Department of Radiology of HSVP.] Revista do Hospital São Vicente de Paula 7, 14–19.

110 S. Agapejev
42. Camargo, N.J. (1995) Epidemiological situation of taeniasis/cysticercosis in the state of Paraná
(Southern part of Brazil) and strategie for its control. PAHO/AMRO WHO Informal Consultation.
43. Gonçalves-Coêlho, T.D., Coêlho, M.D.G. (1996) Neurocysticercosis in Paraíba, Northeast Brazil – an
endemic area? Arquivos de Neuropsiquiatria 54, 565–570.
44. Freitas, J., Palermo, E.N. (1996) [Taeniasis–cysticercosis complex in Northern Brazil.] Brazilian
Journal of Veterinary Research and Animal Science 33, 270–275.
45. Takayanagui, O.M., Castro e Silva, A.A.M.C., Santiago, R.C., et al. (1996) [Compulsory notification of
cysticercosis in Ribeirão Preto – SP.] Arquivos de Neuropsiquiatria 54, 557–564.
46. Andrade, A.S. (1997) [Neurocysticercosis: Clinical, Epidemiological and Diagnostic Aspects –
Prospective Study of 157 Patients in Northeastern Region – Bahia, Brazil.] Thesis. Federal University
of Rio de Janeiro, Brazil.
47. Forlenza, O.V., Guerra-Vieira, A.H., Nóbrega, J.P.S., et al. (1997) Psychiatric manifestations of neuro-
cysticercosis: a study of 38 patients from a neurology clinic in Brazil. Journal of Neurology,
Neurosurgery and Psychiatry 62, 612–616.
48. Narata, A.P., Arruda, W.O., Uemura, E., et al. (1998) [Neurocysticercosis: a CT-scan study in a series
of neurological patients.] Arquivos de Neuropsiquiatria 56, 245–249.
49. Agapejev, S. (1999) Standardization of tomographic indexes of the fourth ventricle and its character-
istics in patients with neurocysticercosis (Abstract). Thesis. University of the State of São Paulo,
Brazil. Arquivos de Neuropsiquiatria 57, 147–148.
50. Pfuetzenreiter, M.R., Ávila-Pires, F.D. (1999) [Clinical manifestations in patients with computerized
tomography diagnosis of neurocysticercosis.] Arquivos de Neuropsiquiatria 57, 653–658.
51. Gomes, J., Veiga, M., Correa, D., et al. (2000) Cysticercosis in epileptic patients of Mulungo do Morro
– Northeastern Brazil. Arquivos de Neuropsiquiatria 58, 621–624.
52. Silva, J.E., Diefenthaler, A.P., Palma, J.K. (2000) Frequency of suspected cases of neurocysticercosis
detected by computed skull tomography in Santa Maria, RS Brazil. Revista do Instituto de Medicina
Tropical de São Paulo 42, 57–58.
53. Ueda, M., Nakamura, P.M., Waldman, E.A., et al. (1984) [Frequency of anti-Cysticercus cellulosae
antibodies in a population with risk of cysticercosis in a considered normal population segment in
regions of the state of São Paulo, Brazil.] Revista do Instituto Adolfo Lutz 44, 25–28.
54. Vianna, L.G., Macedo, V., Costa, J.M., et al. (1996) [Seroepidemiologic study of human cysticercosis
in Brasília, Distrito Federal.] Revista da Sociedade Brasileira de Medicina Tropical 19, 149–153.
55. Arruda, W.O., Camargo, N.J., Coelho, R.C. (1990) Neurocysticercosis. An epidemiological survey in
two small rural communities. Arquivos de Neuropsiquiatria 48, 419–424.
56. Vaz, A.J., Hanashiro, A.S.G., Chieffi, P.P., et al. (1990) [Frequency of patients with anti-Cysticercus
cellulosae antibodies in 5 municipalities of the state of São Paulo.] Revista da Sociedade Brasileira de
Medicina Tropical 23, 97–99.
57. Silva-Vergara, M.L., Aluizio, P., Vieira, C.O., et al. (1995) [Epidemiological aspects of cysticercosis
due to Taenia solium in the endemic area of Lagamar, MG.] Revista da Sociedade Brasileira de Medicina
Tropical 28, 345–349.
58. Lonardoni, M.C.V., Bertolini, D.A., Silveira, T.G.V., et al. (1996) Frequency of anti-Cysticercus cellu-
losae antibodies in individuals from five counties in the southern region of Brazil. Revista de Saúde
pública (São Paulo) 30, 273–279.
59. Pires, M.A.S., Barbosa, S.P.F., Gonçalves-Pires, M.R.F., et al. (2000) Frequency of IgG anti-cysticercus
cellulosae antibodies in a human population of the São Luiz Island – MA, between March and June.
Annals of the XIII Sao Paulo State Journal of Parasitology, p. 35.
60. Agapejev, S. (1996) Epidemiology of neurocysticercosis in Brazil. Revista do Instituto de Medicina
Tropical de São Paulo 38, 207–216.
61. Trevisol-Bittencourt, P.C., Silva, N.C., Figueredo, R. (1998) [Prevalence of neurocysticercosis among
epileptic in-patients in the west of Santa Catarina – southern Brazil.] Arquivos de Neuropsiquiatria 56,
53–58.
62. Morales, N.M.O., Agapejev, S., Morales, R.R., et al. (2000) Clinical aspects of neurocysticercosis in
children. Pediatric Neurology 22, 287–291.
63. Dantas, F.L.R., Fagundes-Pereira, W.J., Souza, C.T., et al. (1999) [Intramedular cysticercosis: Case
report.] Arquivos de Neuropsiquiatria 57, 301–305.
64 Colli, B.O., Martelli, N., Assirati, J.A. Jr, et al. (1994) Cysticercosis of the central nervous system. I.
Surgical treatment of cerebral cysticercosis. A 23 years experience in the Hospital das Clínicas of
Ribeirão Preto Medical School. Arquivos de Neuropsiquiatria 52, 166–186.

12 Taenia solium Taeniasis and

Cysticercosis in Asia
Gagandeep Singh, Sudesh Prabhakar, Akira Ito, Seung Yull Cho

and Dong-Chuan Qiu
Introduction Indonesia
Taenia solium infections remain widely Geography, people, customs and food
prevalent throughout Asia, Africa and habits
South and Central America. A large num-
ber of community-based, epidemiological Indonesia comprises 17,000 islands, of which
surveys carried out in several Latin 6000 are inhabited2. The islands are situated
American countries, provide accurate infor- on the archipelago between the Indian and
mation on the burden of T. solium taeniasis Pacific Oceans, straddling the equator.
and cysticercosis in these countries (see Important islands include Java, Sumatra,
Chapters 8–10). In this regard, a series of Borneo, Bali and Irian Jaya (now called West
investigations in Peru stands apart in terms Papua Guinea). The last mentioned comprises
of their completeness and accuracy of por- the western half of New Guinea, the other
trayal of the status of disease there (see eastern half of which is a separate country,
Chapter 8). In contrast, precise epidemio- namely Papua New Guinea (formerly East
logical proportions of T. solium infection Irian Jaya) (Fig. 12.1). Indonesia has a landed
have not been defined adequately in most area of 1.8 million km2 and a population of 21
Asian countries. All we know is that the million. About 88% of the population is
disease does exist in several countries like Moslem, the remaining 12% consists of
Indonesia, China, India and Nepal. More Christians, Hindus and Buddhists2. Certain
accurate data are, however, lacking. islands have a majority of non-Moslem com-
Information regarding taeniasis–cysticerco- munities, for instance of Christians in Irian
sis is now available from Indonesia1. In the Jaya and Hindus in Bali. Some 80% of the
present review, several researchers review people live in the countryside.
available knowledge about the situation of Reliance upon traditional sanitary prac-
T. solium cysticercosis in their countries, tices and inadequate cooking of infested
with particular emphasis upon Indonesia, pork are principal reasons for the high
India, Korea, China and Japan. prevalence of T. solium taeniasis and cys-


112 G. Singh et al.
Philippines
Pacific Ocean
Malaysia Irian Jaya
Borneo Papua New

Sumatra Guinea
South
Sulawesi
Flores
Java
Indian Ocean Bali Timor
Australia
Traditionally endemic areas

0 500 km
Areas rendered highly endemic
after introduced disease
INDONESIA Areas threatened to become
endemic
Fig. 12.1. Geographical representation of Taenia solium endemic regions in Indonesia.
ticercosis in Indonesia. For instance, the Intestinal taeniasis

tribal inhabitants of Bali use the dwellings of
their domestic animals, called ‘teba’, for Intestinal taeniasis is common in Bali,
ablution3. In Irian Jaya, an undeveloped Sumatra and Samosir Island, but beef Taenia
tribal habitat with complete lack of sanitary sp. and Asian Taenia sp. are believed to be
understructure, people defecate in their more common than pork Taenia sp.5,8–11.
house-yards and gardens and allow free- Recent data is available from a study by
ranging pigs to clear the excrement at night- Sutisna and co-workers12. They reported three
time. As if to complete the human– instances of Taenia sp. infection among 415
pig–human cycle, the Balinese traditional faecal samples surveyed in Bali; at a species
festival dish, ‘lavar’ is made from minced level, one was T. solium, while the other two
raw pork, mixed with coconut and spices4. were T. saginata. The occurrence of T. solium
In Irian Jaya, male tribals frequently feast taeniasis in Irian Jaya has been recognized
upon pork that is inadequately cooked with only lately. Indeed several of the surveys of
cassava in earthen ovens during tribal cere- intestinal parasitism, which were undertaken
monies5. Women are permitted to consume in the 1950s and 1960s, indicated a complete
the dish only after childbirth. absence of T. solium infection in this region.
Human and porcine cysticercosis are Thus, in at least two separate community-
infrequent in the Moslem dominated regions based coproparasitic surveys, van der Hoeven
of Indonesia1. However, they constitute and Rijpstra13 (1957), and Kelly and Vines14
major health and economic problems in Irian (1966), could not find a single case of T. solium
Jaya, Bali, Timor, Flores, Samosir Island of infection in Central Irian Jaya and neighbour-
North Sumatra, Lampung in South Sumatra, ing Papua New Guinea. The earliest report of
West Kalimantan and Sulawesi (Fig. 12.1)1,6,7. human intestinal T. solium infection in the
In these islands, the estimated prevalence Wissel Lakes area of Irian Jaya was probably
varies between 2% in Bali and 48% in Irian made in 197315. Several workers have recently
Jaya, the latter being one of the highest examined the prevalence of intestinal T.
reported figures in the world1,6,7. solium infection in Irian Jaya. Margono and

Taeniasis and Cysticercosis in Asia 113
co-workers6,7,16, and other workers17,18, have Human cysticercosis

reviewed these studies and found that the
reported prevalence varied from 8% to 51%. In 1983, Coker-Vann and co-workers,
The prevalence of intestinal taeniasis in other reported an estimated prevalence of 21% of
islands has not been studied in a comprehen- anticysticercus antibodies in sera based
sive manner, but rates in excess of 5% of the upon ELISA among inhabitants of Bali24. In
faecal samples examined have been noted in other regions, such as Samosir and Nias, the
North Sumatra and Timur16,19,20. prevalence of seropositivity was lower, in
the range of 3–4%24. More recent data have
revealed the continued presence, in low to
Porcine cysticercosis moderate levels, of anticysticercus seroposi-
tive status in Bali. Thus, Theis et al.
High levels of porcine infection have been reported an immunoblot-based seropositiv-
noted throughout Indonesia, particularly ity to be 13%25. Serological prevalence was
Bali and Irian Jaya. More accurate data to highest in the age group 21–30 years, with
indicate the prevalence of porcine cysticerco- no preference for any gender. In comparison
sis is recently available from Irian Jaya17. to the high prevalence found by Theis et
Approximately 24% of pigs examined in al.25, Sutisna and co-workers12 determined
Jayawijaya, Irian Jaya were noted to be heav- a seropositive status in only 1.65% of a pop-
ily infected and 74% (50 of 71 examined) ulation surveyed in Bali. All seropositive
demonstrated serological evidence of expo- cases were from one district only, suggest-
sure to T. solium17. ing regional variations with regard to the
The spread of a zoonotic disorder through seroprevalence of cysticercosis on the island
of Bali.
transport of animals across geographical
While human cysticercosis has been
boundaries is typically exemplified by the
known in Bali since at least the 1920s9,26–28,
story behind the occurrence of T. solium cys-
its occurrence in Irian Jaya is a recent phe-
ticercosis in Irian Jaya. Porcine cysticercosis
nomenon1. Tumada and Margono were the
was not known to occur in Irian Jaya prior to
first to report T. solium cysticercosis in 12
the 1970s. A mass transport of cysticercotic
patients in the Wissel Lakes area of Central
pigs was undertaken from Bali to Irian Jaya
Irian Jaya in 197315. Several other authors
in the early 1970s and the taeniasis–cysticer-
followed with reports of widespread infec-
cosis epidemic in Irian Jaya followed.
tion among Ekari tribals of this region29–32.
In 1978, Subianto et al. reported an
unprecedented increase in hospital admis-
Dog cysticercosis sions due to high-degree burns between
1973 and 1976 in Central Irian Jaya31.
The consumption of canine meat and brain is Burns were believed to be caused by noc-
customary among tribals of Irian Jaya. It turnal seizures in tribals who slept by com-
might be interesting to speculate that the dog munity fires during winter nights. Seizures
may also be involved in the transmission were recorded in 63%, subcutaneous nod-
cycle of T. solium. In this context, parallel may ules were found in 33% and intestinal T.
be drawn from evidence of T. saginata taenia- solium infection was demonstrated in 16%
sis arising from consumption of undercooked of 157 individuals, who were hospitalized
reindeer brain in the former USSR21. Indeed, with burns31.
some recent studies using serological markers To build up on the story of the epidemic,
suitable for humans and swine have demon- while cysticercosis was recognized in
strated serological evidence of exposure (to T. Central Irian Jaya in the 1970s it was then
solium) among dogs in Indonesia22,23. unheard of in West Irian Jaya or the neigh-
Moreover, T. solium cysticerci have also been bouring Papua New Guinea. However,
recovered from seropositive dogs (Ito et al., there is recent evidence of the spread of the
Jakarta, Indonesia, unpublished data). epidemic to East and South Irian Jaya.

114 G. Singh et al.
Wandra et al. reported 120 burn casualties Singapore is a developed country, it is ‘at-risk’
and new onset seizures in 293 individuals for T. solium cysticercosis, given the high vol-
among a community of 15,000 in Jayawijaya ume of travel to and from this country.
district in East Irian Jaya33. Histo-
pathological examination of subcutaneous
cysts removed from a number of affected Vietnam, Cambodia and Laos
individuals confirmed the diagnosis of cys-
ticercosis. Over the years, cross-border Studies in the post-Vietnam war period
migration between Indonesian Irian Jaya focused on morbidity patterns among war
and Papua New Guinea has given rise to veterans and refugees. Among various ill-
concerns about the disease getting estab- nesses, a high rate of helminthiasis was
lished in Papua New Guinea34. In fact, in described in war veterans and refugees by
1990, Fritzsche et al. detected a serologically several authors44–47. Several case reports
confirmed cases of cysticercosis among from medical facilities affirmed the occur-
Irianese refugees in Papua New Guinea35. rence of T. solium cysticercosis in good num-
More recently, however, a survey found 3% bers in Vietnam48–50. In 36 children
of the population of Papua New Guinea to convalescing from a flu-like illness in
be seropositive and among them, local Vietnam, 3% of the serum samples were
inhabitants were also positive18. positive for anticysticercus antibodies,
when tested in an ELISA in 1972–197324.
Contemporary data is now available;
Philippines Brandt et al. reported reported a seropositiv-
ity of 5.7% among inhabitants of North
The estimated prevalence of T. solium taenia- Vietnam51, while reliable estimates of
sis in Philippines is about 2%36. In one sur- seropositivity are around 8% in Hanoi and
vey of over 200,000 stool examinations in 10% in Cambodia and Laos (Carlo Urbani,
Manila and elsewhere within the country, the Hanoi, Vietnam, personal communication).
prevalence of T. solium infection was 0.02%37.
The estimated prevalence of porcine cysticer-
cosis is 0.16%38. A Medline search indicated Thailand
several reports of isolated cases and series of
NC originating from Philippines39,40. According to Vejjajiva, T. solium infestation
is uncommon in Thailand52. However,
reports of sporadic case and series have
Hong Kong and Singapore been made from several hospitals located
throughout Thailand53–57. These indicate
Published reports indicate the occurrence of that low levels of infection do exist in this
both indigenous and imported cases in Hong country. A recent report from a provincial
Kong, now part of China41,42. Local or indige- general hospital in Surin, in Northeast
nous cases result from consumption of pork Thailand, alluded to the frequent occurrence
imported from the Chinese mainland42. With of solitary cysticercus granulomas57. There, a
specific reference to exotic cases, Heap solitary cysticercus granuloma was identi-
reported that a diagnosis of cysticercosis was fied in 110 (11%) of 972 patients with a
quite common in Nepalese Gurkha recruits in seizure disorder over a 3-year period.
the Territorial Army43. The Gurkhas presum-
ably acquired infection while in Nepal. Coker-
Vann et al. surveyed three different ethnic Myanmar
communities using an anticysticercus ELISA
and determined an overall prevalence of 8%24. One of the earliest Asian reports of cys-
Rates were highest among individuals of ticercosis was made from Myanmar
Chinese origin (13%) in comparison to those of (Burma) (1912)58. However, a review of lit-
Indian (5%) or Malay (3%) origin24. While erature, including a Medline search did not

reveal a single recently published report of India

the disorder originating from Myanmar.
Surely, this must be because of lack of Geography, people, customs and food
awareness rather than the lack of occur- habits
rence of T. solium infections. Coker Vann et
al. performed a serological study in a local India is located in subtropical South Asia.
population using an ELISA format and With a population of over one billion, it is the
found anticysticercus antibodies in 6% of second most populated nation in the world.
the samples surveyed24. About 80% of the population is Hindu, 14% is
Moslem and the remaining 6%, of several reli-
gions. The average literacy rate is 52%. About
Malaysia and Bangladesh 80% of the people live in villages2. A good
majority of the population in India is vegetar-
Malaysians are mostly Moslems and hence ian59. Animal proteins account for about 20%
do not consume pork. Accordingly T. solium of protein intake in India, in comparison with
cysticercosis is recognized only infrequently 58% in developed countries60. An unimagin-
in this country (Zim Abdul Rashid, Kuala able disparity exists in the geography, ethnic-
Lumpur, Malaysia, personal communica- ity, religion, food and personal habits, level of
tion). Similarly, Islam is the official and most education and standards of living within the
widely endorsed religion in Bangladesh. country. The above listed factors have direct
Hence, indigenous cases of T. solium taenia- bearing on the frequency of T. solium infection
sis and cysticercosis do not occur and, consequently, there is significant varia-
(Muzuharal Mannan, Dhaka Neurological tion in the frequency of T. solium cysticercosis
Foundation, personal communication). throughout the country (Fig. 12.2).
Jammu and Kashmir

New Delhi
Uttar Pradesh
Bihar
Assam
Calcutta
Kerala
Areas believed to be endemic
Areas where transmission possibly exists
Areas with no or very few local cases
Fig. 12.2. Geographical representation of regions within India, from where Taenia solium taeniasis and
cysticercosis have been reported in considerable numbers.

116 G. Singh et al.
Porcine cysticercosis Another hospital-based evaluation of nearly

250,000 faecal samples in Northwest India
The estimated pig population in India is 15.4 revealed a prevalence of T. solium of
million59. The density of pigs in the plains of 0.5–2%65. When faecal samples were exam-
North India (states of Uttar Pradesh, Bihar, ined in a community-based survey in Uttar
Haryana and Punjab) is high and is Pradesh, a prevalence of 2% was
estimated at 10–18 km2 61. Here, the pig determined62. A survey of 2559 faecal sam-
industry largely consists of domestic pig ples in Sikkim in East India indicated a
rearers who follow the scavenging system, prevalence of 3.9%66. Prevalence was highest
where pigs are allowed to free range in the among Lepkhas, Tibetians and Bhotiyas and
morning and are enclosed in unhygienic was comparatively less among Hindus and
pens at night61. Data collected from abattoirs Nepalese66. Taenia solium taeniasis is less of a
from several locations in Uttar Pradesh in problem in South India67,68and in the north-
the northern plains revealed cysticercal ern state of Kashmir69. Community based
infestation in the muscles of 8–12% of the surveys in Tamil Nadu67and the Andaman
slaughtered pigs62. Another survey of and Nicobar Islands68 have revealed a high
slaughterhouses in Calcutta in eastern India prevalence of geohelminthiasis but no cases
revealed cysticercus cellulosae infestation in of Taenia sp. infection. On the other hand, in
7% of the slaughtered pigs63. Kashmir, where the population is predomi-
nantly Moslem, high prevalence of T. sagi-
nata infestation was found but no cases of T.
Human taeniasis solium were encountered in one survey69.
Public health and hospital records of British

soldiers posted in India in the early part of the Human cysticercosis
19th century were extremely useful for calcu-
lation of the incidence of T. solium taeniasis64. There is virtually no population-based data
At that time, it was customary to admit indi- that gives information about the community
viduals with diagnosed taeniasis to hospital burden, risk behaviours and geographical
on account of the complexity and toxicity of predilections of T. solium cysticercosis in
its treatment. Thus, between 1928 and 1932, a India. Medical facility-based data is however
total of 774 British soldiers were admitted to available in the form of large series of
hospital because of taeniasis. All of them were patients with neurocysticercosis (NC). Health
assumed to have acquired the infection while care providers all over the country with the
in India, because T. solium infection did not exception of a few states such as Kerala70 in
exist in Britain at that time. Therefore, all the extreme Southeast and Kashmir (Sushil
cases were presumed to be new and not exist- Razdan, Jammu, India, personal communica-
ing cases. During this period, approximately tion) in the extreme north (Fig. 12.2), do see
58,000 British troops were stationed in India. large number of patients with NC. Thus,
This gave a calculated incidence of at least when pre-computed-tomography (CT) era
1.3%. Infection was most commonly reported hospital records of a large referral hospital in
from the United Provinces (presently, Uttar Madras, South India were analysed, NC
Pradesh) (Fig. 12.2)64. accounted for 0.005% of all neurological
More recent data has indicated the persis- admissions71. At a tertiary care neurological
tence of T. solium infestation in significant referral service in the capital, New Delhi, NC
proportions in the areas mentioned above as constituted 2.5% of all intracranial space-
well a variation in the prevalence throughout occupying lesions72. In another tertiary hos-
the country. A stool survey of 1074 outpa- pital in Northwestern India, a survey of over
tients and inpatients in a hospital in Calcutta 6000 consecutive autopsy protocols revealed
revealed Taenia sp. infestation in 12 (1.11%)63. cerebral cysticercosis in 48 (0.75%)65.
When identified to a species level, T. solium Intensive evaluations of an unselected series
could be identified in only a single instance. of epileptics at a tertiary-care neurological

facility in Banglore, South India, in the period tals77,78. Amatya and Kimula collected 62
when CT and magnetic resonance imaging cases of cysticercus skin mucosal and breast
(MRI) were not accessible, revealed a diagno- nodules out of a total of 23,402 biopsies over
sis of cerebral cysticercosis in 2%73. With the a 5-year period at the Patan Hospital in the
availability of CT and MRI, the proportion of capital city of Kathmandu77. Cases were
seizures due to cerebral cysticercosis rose. drawn from all over the country, though the
Thus Murthy and Ravi, from Hyderabad in majority were from the capital city itself.
South India, diagnosed cerebral cysticercosis Most patients were less than 30 years of age.
in 220 (8.7%) of an unselected group of 2537 Data from neurological facilities indicate
consecutive patients with seizure disorder74. that NC is the commonest cause of sympto-
Similarly, Sawhney et al. noted cerebral cys- matic seizures in Nepal79. Both solitary and
ticercosis in 49 (31%) of 158 patients among a multiple forms of cerebral cysticercosis are
series of 407 patients with seizure disorder in seen, though the former predominates.
whom a CT scan was done75. In both series,
solitary cerebral cysticercus granulomas pre-
dominated. Sri Lanka
Within the country, NC appears to be
more prevalent in the northern region According to Senanayake (Peradinya, Sri
including the states of Bihar, Uttar Pradesh Lanka, personal communication), NC,
through Punjab. Other states also have a fair including the solitary cysticercus granuloma,
proportion of disease with the possible which occurs very commonly in several
exception of Kerala, where low levels of dis- neighbouring countries, does not occur
ease reflect efficient sanitation, pig hus- locally in Sri Lanka.
bandry and a superior socio-economic and
educational status and in Kashmir with its
predominant Moslem population, where the China
consumption of pork is forbidden.
Experience with contemporary tools of China has an area of 9.5 million km2 and a
epidemiogical evaluation such as the population of 1.2 billion. The country is
enzyme-linked immunoelectrotransfer blot divided by the river Yangtze into two: the
(EITB) is limited76. An EITB-based sero-sur-
warm tropical south and the cold and dry
vey of household family contacts of children
north. About 70% of the population is rural.
with solitary cysticercus granulomas found
There is a substantial portion of the popula-
anticysticercus antibodies in 27% of the fam-
tion that is Buddhist, Taoist or Moslem,
ily contacts. These figures are high because
important because these communities do not
they are from a population that is at risk of
consume pork. China also has the largest pig
exposure, possibly due to consumption of
population in the world. The Food and
common food items and similar socio-eco-
nomic and sanitary conditions as with index Agricultural Organization estimated in 1997
cases with solitary cysticercus granuloma. that there were 4.6 billion pigs in China59.
Despite this, levels of pork consumption do
not approach those noted in the Western
Nepal Hemisphere. Nevertheless, the conditions do
exist in China that may perpetuate the
A systematic evaluation of the dimensions of pig–human–environment cycle. Surveys in
the problems related to T. solium cysticercosis Yunnan Province indicated that significant
has not been undertaken in this Himalyan numbers of the Pumi and Bai minorities ate
nation with an area of 140,000 km2 and a raw meat80,81. Surveys in rural portions of the
population of 24 million. The disorder has Shandong Province revealed that pigs were
been recognized as a major health hazard in rarely corralled, human defecation was indis-
the country only lately as is evident from criminate and awareness of the means to rec-
few recent reports from major referral hospi- ognize infected pork was lacking82,83.

118 G. Singh et al.
Neurocysticercosis has been reported Neimeng and Shanxi), (iii) Northwest China
from hospitals all over China. Yingkun et al. (including Ganxu, Ningxia and Qinghai); (iv)
collected a series of 158 cases between 1956 a fourth zone comprising of Shandong,
and 1974 at a large hospital in Beijing84. Most Henan, Anhui and Hubei; and (v) finally, a
clinic-based data is however not published fifth zone comprising of Guangdong, Guangxi,
or is published in Chinese scientific litera- Hainan, Yunnan and Sichuan (Fig. 12.3).
ture, to which the rest of the world’s scien- Sporadic cases have also been reported from
tific community has poor access. the provinces of Jiangshu, Shanghai, Zhejiang,
Fujian, Taiwan, Guizhou, Xinjiang and Tibet.
Most epidemiological studies have
Intestinal taeniasis focused on the prevailing situation in
Shandong Province82,83,89. Here, 38 clinical
Adult T. solium infection is distributed broadly cases were detected among 35,512 patients
throughout China. Confirmed cases have been examined in 2000, giving a frequency of
noted in at least 28 provinces. Neimeng, 0.2%89. In this province, a seroprevalence
Henan, Shandong, Hebei and Anhui are con- (with a specific IgG4 antibody) of 2.2% was
sidered hyperendemic, while other provinces noted89. In another study using the indirect
like Guangxi, Guizhou, Yunnan, Sichuan and fluorescent antibody assay, a seroprevalence
Tibet have moderate prevalence of intestinal of 3.2% was found83. Seropositivity rates
infection85. The National Investigation of increased with age and were highest in per-
Human Parasitic Diseases estimated an aver- sons over 60 years of age. Other factors that
age prevalence of 0.112%; however, in certain were significantly associated with seroposi-
regions, local prevalence rates were as high as tivity were indiscriminate defecation, inabil-
0.66–6.0%86. The investigation estimated that ity to identify diseased pork and raising pigs.
there were approximately 1.26 million persons Outside the Shandong Province seropositiv-
with adult T. solium in the entire country. ity rates are reportedly low94: Haerbin city of
Several regional surveys have indicated vary- Helongjiang Province – 4.3%95; Liaoning
ing levels of infection in different provinces Province – 0.02%96; Henan Province –
within China. For instance, between 1975 and 0.1–1.2%97,98 and Sichuan – 0.8%97. Higher
1987, a coproparasitological evaluation of over seroprevalence rates have however been
34,000,000 individuals in Henan Province noted in the Pumi nation area of Yunnan
revealed T. solium taeniasis in 0.55%87. Province (11.2%)81 and Guangxi (9.5%)99.
Investigations in other regions have yielded
similar results: Shandong – 0.8%88; Jinan,
Taian and Laiwu City – 0.1%89; Yunnan – Korea
6.93%; Dali City (Louyi village of Eryuan
county) – 19.5%; Jilin (Yanji City) – 0.11%; Intestinal taeniasis
Liaoning (Shengyang and Dalian cities) –
0.005%80; Sichuan (Xide county) – 4.0%90 and During the past three decades, Taenia infec-
Fujian (Xianyou county) – 0.13%91. tion has decreased steadily in Korea. In a
series of national surveys for intestinal
helminth infections, undertaken every 5
Human cysticercosis years, the egg positive rates of Taenia species
were 1.9% in 1971, 0.7% in 1976, 1.1% in
The earliest report of confirmed human cys- 1981, 0.3% in 1986, 0.06% in 1992 and 0.002%
ticercosis from China was made in 193092. The in 1997, respectively, when one random
National Investigation of Human Parasitic sample of 1000 people was examined by
Diseases revealed that T. solium cysticercosis stool microscopy100. In interpreting these
was reported from 671 counties in 29 data, low sensitivity of stool microscopy for
provinces within China93. Five zones of high detecting Taenia infection should be consid-
endemicity have been described: (i) Northeast ered. However, the decreasing trend has well
provinces; (ii) North China (including Hebei, been depicted in the consecutive surveys.

Miles
600
300
0
300
Fig. 12.3. Geographical representation of Taenia solium endemic regions in China.

Non-endemic area
Zone 1
Zone 2
Zone 3
Zone 4
Zone 5

120 G. Singh et al.
By examining morphology of Taenia ally before the 1990s. The egg positive rate
expelled after chemotherapy, the proportion has always been the highest in Cheju
of T. solium was found in the wide range of Province, although the infections were
4.1–36.7%101 among the Taenia egg passers. found throughout the country (Fig. 12.4).
As of 1997, the least number of infected peo- Except for a few academic surveys, mass
ple with two species of Taenia was about chemotherapeutic control has not been
9000, which were mostly aged people older undertaken in Korea against intestinal Taenia
than 60 years, living in rural Korea. From infections. Instead, taeniafuges such as
them, nationwide number of T. solium infec- bithionol (marketed since 1964), niclosamide
tion could be estimated as being in the range (since 1976) and praziquantel (since 1981)
of 400–3200 out of 46 million people in were allowed to be available to the public,
Korea. The present intestinal infections are and infected individuals can purchase the
regarded as persisting ones contracted actu- drug without prescription.
Pyongyang
Seoul
Not surveyed
< 2.5%
2.5–4.9% Pusan
5.0–7.4%
> 7.5%
Cheju
Fig. 12.4. Geographic map of Korea depicting major geographical foci of Taenia solium taeniasis and cysticercosis.

Porcine cysticercosis In the 1980s, innovative progress was

achieved in diagnosis and patient manage-
Porcine infections with T. solium metaces- ment of NC including brain imaging by
todes had been as high as 7.4% in Cheju CT/MRI106, chemotherapeutics such as praz-
Province where pigs had been reared in pig- iquantel107, and antibody test by ELISA108.
pens in each household102. Swine infection As a result of the progress, it was found that
rates also decreased steadily throughout the at least 12.6% of 206 adult-onset epilepsy
1970s to 0.4–0.5%. After 1986, no more swine patients in 1982–1985 were diagnosed as due
infections were found when the Governor of to cysticercosis109. An epidemiological study
Cheju Province banned the use of pigpens. for anti-T. solium metacestode antibodies was
However, the principal reason of disappear- also undertaken. The antibody positive rate
ance of measly pork in the Korean market was 3.1% in epilepsy patients while that in
was the modernization of the pig breeding normal population was 1.8%110. Since 1984, a
industry. In 1980, about half of the pigs came multi-antigen screening system has been set
to market from farm households. However, up for specific antibodies to three helminth
industrialized pig breeding, which started in parasites. During 7 years from 1990 to 1997,
the 1960s by instigation of an Irish Catholic a total of 10,802 neurological patients with
Mission, has dominated the market since the abnormal brain images were examined for
mid-1980s. It is believed that the transmis- the antibody levels. Of them, 1580 (14.6%)
sion cycle from pig to human infection of were positive for anti-T. solium antibodies in
T. solium ceased in 1985. either serum or cerebrospinal fluid or both111.
After experiencing epidemic cysticercosis
in the early industrialization period, the situ-
Human cysticercosis ation of T. solium cysticercosis in Korea has
improved nowadays because of progress in
The earliest report of human cysticercosis in sanitation and pig husbandry. Innovative
Korea was made in 1937. Thereafter, spo- diagnostics and chemotherapeutics, together
radic case reports continued. Since the 1960s with improved patient care, have lessened
when the industrialization drive began and the social burden caused by the disease.
farmers migrated to industrial areas, the However, even if the transmission cycle of
demand for animal proteins increased. intestinal T. solium infection is stopped, mor-
During the same period, modernized pig bidity and mortality due to NC will continue
breeding also began, but most pigs origi- for decades because of the long-term nature
nated from farmhouses. Therefore in addi- of this larval disease.
tion to sporadic cases of cysticercosis from
rural areas, urban cases of subcutaneous
cysticercosis, orbital and intraocular cys- Japan
ticercosis (which represented recent trans-
mission and active infections) were Masuda et al. reviewed available published
frequently reported in literature in the and unpublished information on 345 cases
1970s103. One such report described that out of T. solium cysticercosis reported in
of 657 patients with benign and malignant Japan112. Subsequently, Nishiyama and
skin tumours, observed in Seoul during Araki added more cases to their review, giv-
1960–1972, 114 (24.3%) were caused by T. ing a total of 389 cases from 1908 till 1999.
solium cysticercosis104. Out of 174,770 biopsy Of these 325 were Japanese; 168 were from
specimens submitted to the surgical pathol- the Okinawa Island, where an endemic
ogy department of a University hospital in focus existed before the Second World War.
Seoul during 1968–1987, 580 cases (0.33%) Among others, there were 20 Chinese, 22
were diagnosed as parasitic diseases. Of Koreans, one Indian and 21 of whom no
them, 216 (37.2%) were due to cysticerco- record of nationality was available112,113. In
sis105. Cases of NC were also reported dur- most of the cases reviewed, there was no
ing the 1970s. evidence to suggest adult Taenia infection;

122 G. Singh et al.
presumably these cases acquired infection Conclusions

either during overseas travel or through per-
sons of foreign origin in Japan. Over the last Asia is a colossal mix of contrasting geogra-
few years, between five and ten cases were phies, cultures, religions and economies.
detected every year in Japan114–117. At the Understandably, therefore, remarkable varia-
Asahikawa Medical College, most cases tions are observed in the prevalence of T.
were in workers who visit endemic coun- solium-taeniasis and cysticercosis in the con-
tries115,117,118. However, two cases reported tinent. There are developed countries with
by Masuda et al. and Ohnishi et al. are of high standards of sanitation such as Japan
interest since both had no history of over- and Singapore, where T. solium infection is
seas travel and apparently acquired the dis- virtually non-existent, apart from an occa-
ease locally in Japan112,116. This raises the sional imported case in overseas travellers or
possibility of an outbreak of cysticercosis immigrants. There are also a number of
such as the one reported in New York in an Moslem countries in West Asia, but also oth-
orthodox Jewish community that never trav- ers such as Malaysia, where the consumption
elled abroad but nevertheless acquired cys- of pork is forbidden on religious grounds.
ticercosis through household food handlers Here again, though for a different reason, T.
from endemic countries119,120. solium infection does not occur. There are
also few rapidly developing economies such
as Korea, Thailand and Taiwan, where T.
West Asia (including Pakistan, solium infection was a major health problem
Afganistan, Iran, Iraq and the Arabian in the past, but its impact is now on the
Peninsula) decline. In contrast, there are a number of
developing countries such as Indonesia,
Most of West Asia is almost exclusively China, India and Nepal, where a significant
Moslem. Human and porcine cysticercosis burden of disease is believed to exist. Finally,
does not occur in these locations, though, there are a number of countries such as
given the high rate of travel to Arabia, the Vietnam, Cambodia, Myanmar and Bhutan
diagnostic possibility may be considered in for which no current information is available
foreigners who present with appropriate about the status of T. solium infection but lev-
clinical features121. els of infection can be imagined to be high.
References
1. Simanjuntak, G.M., Margono, S.S., Okamoto, M., et al. (1997) Taeniasis/cysticercosis in Indonesia as
2. www.geographic.org. India, Nepal, Korea, Indonesia and China.
3. Depary, A.A., Kosman, M.L. (1991) Taeniasis in Indonesia with special reference to Samosir Island,
North Sumatra. Southeast Asian Journal of Tropical Medicine and Public Health 22, 239–241.
4. Simanjuntak, G.M., Margono, S.S., Sachlan, R., et al. (1977) An investigation on taeniasis and cys-
ticercosis in Bali. Southeast Asian Journal of Tropical Medicine and Public Health 8, 494–497.
5. Sutisna, P. (1977) Human parasitic infections in Bali: a review. Bulletin Penelit Kesehat 17, 276–283.
6. Margono, S.S., Ito, A., Suroso, T. (2000) The problem of taeniasis and cysticercosis in Irian Jaya
(Papua), Indonesia. Proceedings of the Sixth Asian-Pacific Congress for Parasitic Zoonoses, pp. 55–64.
7. Margono, S.S., Subahar, R., Hamid, A., et al. (2000) Cysticercosis in Indonesia: epidemiological
aspects. Southeast Asian Journal of Tropical Medicine and Public Health 2 (Suppl.), 79-84.
8. Fan, P.C., Chung, W.C., Soh, C.T., et al. (1992) Eating habits of East Asian people and transmission of
taeniasis. Acta Tropica 50, 305–315.
9. Cross, J.H., Clarke, M.D., Cole, W.C., et al. (1976) Parasitological survey in northern Sumatra,
Indonesia. Journal of Tropical Medicine and Hygiene 79, 123–131.
10. Cross, J.H. (1987) Current status of some parasitic zoonoses in Asia and suggested studies on the
application of new technologies. Proceedings of the First Sino-American Symposium on Biotechnology of
Parasitic Diseases, pp. 1–5.

11. Kosin, E., Depary, A., Djohansjah, A. (1972) Taeniasis di pulau Samosir. Majalah Fakultas
Kedokteran, Universitas Sumatera Utara, Medan, 3, 5–11.
12. Sutisna, I.P., Fraser, A., Nengah Kapti, L., et al. (1999) Community prevalence study of taeniasis and
cysticercosis in Bali, Indonesia. Tropical Medicine and International Health 4, 288–294.
13. van der Hoeven, J.A., Rijpstra, A.C. (1957) Intestinal parasites in the Central Mountains District of
Netherlands, New Guinea: an important focus of Balanitidium coli. Tropical and Geographical Medicine
9, 225–228.
14. Kelly, A., Vines, A.P. (1966) Highland region survey of intestinal parasites. Medical Journal of
Australia 2, 635–640.
15. Tumada, L.R., Margono, S.S. (1973) Cysticercosis in the area of the Wissel Lakes, West Irian.
Southeast Asian Journal of Tropical Medicine and Public Health 4, 371–376.
16. Margono, S.S. (1997) Report for the Eighth Annual Meeting of the Indonesian Organization for
Parasitology. In: Simanjuntak, G.M., Margono, S.S., Okamoto, M., et al. (1997)
Taeniasis/Cysticercosis in Indonesia as an emerging disease. Parasitology Today 13, 321–322.
17. Subahar, R., Hamid, A., Purba, W., et al. (2001) Taenia solium infection in Irian Jaya (West Papua),
Indonesia: a pilot serological survey of human and porcine cysticercosis in Jayawijaya District.
18. Wandra, T., Subahar, R., Margono, S.S., et al. (2001) Sero-epidemiology of neurocysticercosis in Irian
Jaya (West Papua), Indonesia in 1996–1997 and Papua New Guinea in 1997. Acta Tropica (in press).
19. Kusharyono, C., Sukartinah, S. (1991) The current status of food-borne parasitic zoonoses in
Indonesia. Southeast Asian Journal of Tropical Medicine and Public Health 22, 8–10.
20. Suweta, G.P. (1991) The situation of cysticercosis and taeniasis in animals/man in Bali. Southeast
Asian Journal of Tropical Medicine and Public Health 22, 236–238.
21. Blazek, K., Kirichek, V.S., Schramlova, J. (1986) Cysticercus bovis infection in the reindeer.
Proceedings of the Second International Symposium on Taeniasis/Cysticercosis and
Echinococcosis/Hydatidosis, pp. 121–127.
22. Ito, A., Plancarte, A., Ma, L., et al. (1998) Novel antigens for neurocysticerosis: simple method for prepa-
ration and evaluation for serodiagnosis. American Journal of Tropical Medicine and Hygiene 59, 291–294.
23. Ito, A., Plancarte, A., Nakao, M., et al. (1999) ELISA and immunoblot using purified glycoproteins
for serodiagnosis of cysticercosis in pigs naturally infected with Taenia solium. Journal of
Helminthology 73, 363–365.
24. Coker-Vann, M.R., Subianto, D.B., Brown, P., et al. (1981) ELISA antibodies to cysticerci of Taenia
solium in human populations in New Guinea, Oceania and Southeast Asia. Southeast Asian Journal of
Tropical Medicine and Public Health 12, 499–505.
25. Theis, J.H., Goldsmith, R.S., Flisser, A., et al. (1994) Detection by immunoblot assay of antibodies to
Taenia solium cysticerci in sera from residents of rural communities and from epileptic patients in
Bali, Indonesia. Southeast Asian Journal of Tropical Medicine and Public Health 3, 464–468.
26. Hausman, R., Yoe, T.L., Fossen, A. (1950) Een geval van cysticercose met enkele aantekeningen over
taeniasis in Indinesia [A case of cysticercosis with some notes on taeniasis in Indonesia]. Documenta
Nederland Indonesia Morbidity Report 2, 59.
27. Hadidjaja, P., Rukmono, B., Sjamsudhajat, et al. (1971) Another case of cysticercosis in Djakarta.
Journal of Indonesian Medical Association 21, 461–465.
28. Joe, L.K., Gupito, C., Handojo, K. (1955) A case of cysticercosis in Indonesia. Documenta Nederland
Indonesia Morbidity Report 2, 134–136.
29. Muller, R., Lillywhite, J., Bending, J.J., et al. (1987) Human cysticercosis and intestinal parasitism
amongst the Ekari people of Irian Jaya. Journal of Tropical Medicine and Hygiene 90, 291–296.
30. Gajdusek, D.C. (1978) Introduction of Taenia solium into West New Guinea with a note on an epi-
demic of burns from cysticercus epilepsy in the Ekari people of the Wissel Lakes area. Papua New
Guinea Medical Journal 21, 329–342.
31. Subianto, D.B., Tumada, L.R., Margono, S.S. (1978) Burns and epileptic fits associated with cysticer-
cosis in mountain people of Irian Jaya. Tropical Geographic Medicine 30, 275–278.
32. Desowitz, R.S., Margono, S.S., Sutjahyo, et al. (1977) Observations on the application of counterim-
munoelectrophoresis for the seroepidemiology of human cysticercosis. Southeast Asian Journal of
Tropical Medicine and Public Health 8, 303–307.

124 G. Singh et al.
34. McManus, D.P. (1995) Improved diagnosis as an aid to better surveillance of Taenia solium cysticercosis,
a potential public health threat to Papua New Guinea. Papua New Guinea Medical Journal 38, 287–294.
35. Fritzsche, M., Gottstein, B., Wigglesworth, M.C., et al. (1990) Serological survey of human cysticerco-
sis in Irianese refugee camps in Papua New Guinea. Acta Tropica 47, 69–77.
36. Cross, J.H. (1988) Biotechnology research on cestodes in the Philippines, Malaysia and Indonesia.
37. Hinz, E. (1984) Human Helminthiases in the Philippines. The Epidemiology and Geomedical Situation.
Springer-Verlag, Berlin, pp. 166–170, 266–268.
38. Arambulo, P.V., Cabrera, B.D., Tongson, M.S. (1976) Studies on the zoonotic cycle of Taenia saginata
taeniasis and cysticercosis in the Philippines. International Journal of Zoonoses 3, 77–104.
39. Quimosing, E.M., Conde, J., Cross, J.H. (1984) Subcutaneous and cerebral cysticercosis treated with
praziquantel. Southeast Asian Journal of Tropical Medicine and Public Health 15, 201–205.
40. Jarin, P. Cysticercosis presenting as a tongue mass. UP-PGH ENT Journal. http://www.cm.upm.edu.
ph/dept/ent/journal 2.html
41. Ko, R.C. (1991) Current status of food-borne parasitic zoonoses in Hong Kong. Southeast Asian
Journal of Tropical Medicine and Public Health 22, 42–47.
42. Woo, E., Yu, Y.L., Huang, C.Y. (1988) Cerebral infarct precipitated by praziquantel in neurocysticer-
cosis – a cautionary note. Tropical Geographic Medicine 40, 143–146.
43. Heap, B.J. (1990) Cerebral cysticercosis as a common cause of epilepsy in Gurkhas in Hong Kong.
Journal of Royal Army Medical Corps 136, 146–149.
44. Colwell, E.J., Welsh, J.D., Boone, S.C., et al. (1971) Intestinal parasitism in residents of the Mekong
delta of Vietnam. Southeast Asian Journal of Tropical Medicine and Public Health 2, 25–28.
45. Berke, R., Wagshol, L.E., Sullivan, G. (1972) Incidence of intestinal parasites in Vietnam veterans.
Eosinophilia – a guide to diagnosis. American Journal of Gastroenterology 57, 63–67.
46. Picher, O., Aspock, H. (1980) Frequency and significance of parasitic infections in refugees from
Vietnam. Wiener Medizinische Wochenschrift 130, 190–193.
47. King, P.A., Duthie, S.J., Ma, H.K. (1990) Intestinal helminths in pregnant Vietnamese refugees.
Transactions of the Royal Society for Tropical Medicine and Hygiene 84, 723.
48. Pham, H.T., Van Knapen, F. (1989) Preliminary report of praziquantel treatment of cysticercosis
patients in Vietnam. Acta Leiden 57, 229–233.
49. Pascoe, M., Saines, N., Lyall, I., et al. (1987) Cerebral cysticercosis: a case report with particular reference
to recent advances in diagnosis and treatment. Australian and New Zealand Journal of Medicine 17, 55–57.
50. Perry, H.D., Font, R.L. (1978) Cysticercosis of the eyelid. Archives of Ophthalmology 96, 1255–1257.
51. Brandt, L. (2000) Taenia solium cysticercosis in Northern Vietnam. Third Seminar on Food-borne
Parasitic Diseases; Food, Water and Parasitic Zoonoses in the 21st Century, Bangkok, Thailand, 95pp.
52. Vejajiva, A. (1977) Neurology in Thailand. In: Spillane, J.D. (ed.) Tropical Neurology. Oxford
University Press, Oxford, UK, pp. 335–352.
53. Vanijanouta, S., Bunnag, D., Riganti, M. (1991) The treatment of neurocysticersosis with praziquan-
tel. Southeast Asian Journal of Tropical Medicine and Public Health 22, 275–278.
54. Morakote, N., Nawacharoen, W., Sukonthasun, K., et al. (1992) Comparison of cysticercus extract,
cyst fluid and Taenia saginata extract for use in ELISA for serodiagnosis of neurocysticercosis.
55. Chotmongkol, V., Silarugs, S. (1992) Transient paralytic attacks with cerebral cysticercosis. Southeast
Asian Journal of Tropical Medicine and Public Health 23, 165–166.
56. Bhoopat, W., Poungarin, N., Issaragrisil, R., et al. (1989) CT diagnosis of cerebral cysticercosis.
Journal of Medical Association of Thailand 72, 673–681.
57. Yodnopaklow, P., Mahuntussanapong, A. (2000) Single small enhancing CT lesions in Thai patients
with acute symptomatic seizures: a clinico-radiological study. Tropical Medicine and International
Health 5, 250–255.
58. Krishnaswami, C.S. (1912) Case of Cysticercus cellulosae. Indian Medical Gazette 47, 43–44.
59. Anonymous. FAO Production Yearbook, 1997–98. Food and Agriculture Organization of the United
Nations, Rome, Italy 1998.
60. Griggs, D. (1993) International variations in food consumption. Geography 3, 251–266.
61. Sastry, N.S.R. (1995) Livestock Sector of India: Regional Aspects. International Book Distributing Co.,
Lucknow, India.
62. Pathak, K.N., Gaur, S.N. (1989) Prevalence and economic implications of Taenia solium taeniasis and
cysticercosis in Uttar Pradesh state of India. Acta Leiden 57, 197–200.

63. Ratnam, S., Khanna, P.N., Bandyopadhyay, A.K. (1983) Incidence of taeniasis in man. Indian Journal
of Public Health 27, 70–74.
Research Council Special Report Series 299, 1–58.
65. Mahajan, R.C. (1982) Geographical distribution of human cysticercosis. In: Flisser, A., Willms, K.,
Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New
York, pp. 39–46.
66. Mitra, S., Patwari, A. (1998) Intestinal taeniasis in Sikkim. Journal of the Association of Physicians of
India 45, 124–126.
67. Kang, G., Mary, S., Mathew, D., et al. (1998) Prevalence of intestinal parasites in rural southern
Indians. Tropical Medicine and International Health 3, 70–75.
68. Sugunan, A.P., Murhekar, M.V., Sehgal, S.C. (1996) Intestinal parasitic infection among different
population groups of Andaman and Nicobar Islands. Journal of Communicable Diseases 28, 253–259.
69. Patwari, A., Aneja, S., Singh, G., et al. (1980) A study of taeniasis in children. Indian Pediatrics 17,
515–517.
70. Kuruvilla, A., Pandian, J.D., Nair, M.D., et al. (2001) Neurocysticercosis: a clinico-radiological
appraisal from Kerala state, South India. Singapore Medical Journal 42, 297–303.
71. Ramamurthi, B., Balasubramaniam, V. (1970) Experience with cerebral cysticercosis. Neurology India
18, 89–91.
72. Wani, M.A., Banerjee, A.K., Tandon, P.N., et al. (1981) Neurocysticercosis – some uncommon presen-
tations. Neurology India 29, 58–63.
73. Mani, A., Ramesh, C.K., Ahuja, G.K., et al. (1974) Cysticercosis presenting as epilepsy. Neurology
India 22, 30.
74. Murthy, J.M.K., Ravi, Y. (1995) The syndromic classification of the International League Against
Epilepsy: a hospital based study from South India. In: Chopra, J.S., Sawhney, I.M.S. (eds) Progress in
Neurology. BI Churchill Livingstone, New Delhi, India, pp. 53–67.
75. Sawhney, I.M.S., Lekhra, O.P., Chopra, J.S. (1995) Evaluation of epilepsy management and future
guidelines for a developing country. In: Chopra, J.S., Sawhney, I.M.S. (eds) Progress in Neurology. BI
Churchill Livingstone, New Delhi, India, pp. 28–37.
76. Singh, G., Ram, S., Kaushal, V., et al. (2000) Risk of seizures and neurocysticercosis in household
family contacts of children with single enhancing lesions. Journal of the Neurological Sciences 176,
131–135.
77. Amatya, B.M., Kimula, Y. (1999) Cysticercosis in Nepal: a histopathologic study of sixty-two cases.
American Journal of Surgical Pathology 23, 1276–1279.
78. Shrestha, S.P., Henning, A., Pradhan, D., et al. (1999) Subconjunctival and intraocular cysticercosis in
Nepal. Tropical Doctor 29, 251–253.
79. Rajbhandari, K.C. (2000) Clinical profile of epilepsy with neurocysticercosis in Nepal. In: Proceedings
of the Third Congress of Asian Oceanian Epilepsy Organization, New Delhi, pp. 18.
80. Fang, W., Lian, Z.Q., Fang, C., et al. (1996) The investigation of infection actuality and epidemic fac-
tors of Taenia solium taeniasis/cysticercosis in Bai minority of Dali, Yunnan. Journal of Practical
Parasitic Diseases 4, 62.
81. Wang, H.Z., Zhang, H.M., Zhang, L.L., et al. (1997) The seroepidemiological survey of cysticercosis
in Pumi minority focusing region of Yunnan Province. The Chinese Journal of Prevention and Care of
Parasitic Diseases 10, 306.
82. Cao, W., van der Ploeg, C.P., Xu, J., et al. (1997) Risk factors for human cysticercosis morbidity: a
population-based case control study. Epidemiology and Infections 119, 231–235.
83. Cao, W., van der Ploeg, C.P., Gao, C.L., et al. (1996) Seroprevalence and risk factors of human cys-
ticercosis in a community of Shandong, China. Southeast Asian Journal of Tropical Medicine and Public
Health 27, 279–285.
84. Yingkun, F., Shan, O., Xiuzhen, Z., et al. (1979) Clinicoelectroencephalographic studies of cerebral
cysticercosis, 158 cases. Chinese Medical Journal 92, 770–786.
85. Li, W., Ma, Y. (1995) The epidemiological status of Taenia solium taeniasis in China. Henan Preventive
Medicine Journal 6, 44–45.
86. Wang, Z. (1991) The Address to the Meeting of National Antiparasitic Diseases. Guilin, pp.1–4.
87. Ma, Y.X. (1991) The status and countermeasure of prevention and cure of echinococcosis and cys-
ticercosis in China. The Chinese Journal of Prevention and Care of Parasitic Diseases (Suppl.) 4, 50–52.

126 G. Singh et al.
88. Liu, X., Deng, X.L., Zhao, Z.P., et al. (2000) The epidemiological survey of Taenia solium
taeniasis/cysticercosis in the center of Shangdong Province. The Chinese Journal of Prevention and
Care of Parasitic Diseases 13, 34–36.
89. Zhou, K.X. (1998) The epidemiology and prevention of Taenia solium taeniasis/cysticercosis in
China. The Chinese Journal of Prevention and Care of Parasitic Diseases 11, 344–345.
90. Zhou, G.X., Zhang, G.H., Wang, S.Y., et al. (1993) The epidemiological survey of Taenia solium taenia-
sis/cysticercosis in Xide County of Sichuan. Journal of Practical Parasitic Diseases 1, 25–27.
91. Xu, X.R., Yin, H.Z., Chen, B.J., et al. (1998) The prevention and cure of Taenia solium taeniasis/cys-
ticercosis in Xianyou County. The Haixia Journal of Preventive Medicine 4, 53–54.
92. Zhao, W.X. (1983) The Human Parasitology, 1st edn. People’s Sanitation Publishing Co., Beijing,
China, pp. 492–509.
93. Xu, L.Q., Jiang, Z.X., Zhou, C.H., et al. (1999) The investigation of cysticercosis’s distribution in
China. The Chinese Journal of Prevention and Care of Parasitic Diseases 12, 30–32.
94. Li, X.C., Sun, D.P., Hu, B.Y., et al. The epidemiological survey of Taenia solium taeniasis/cysticercosis
and the study of corresponding countermeasure in Gunzhou City. The Chinese Journal of Prevention
and Care of Parasitic Diseases 12, 150.
95. Ji, K.B., Tong, S.F., Liu, Y.L., et al. (1996) The seroepidemiological survey of cysticercosis in Ha Erbin
City. The Chinese Journal of Prevention and Care of Parasitic Diseases 9, 313.
96. Li, F.H., Xu, J.T., Sun, T., et al. (1998) The epidemiological investigation of human Taenia solium taeni-
asis/cysticercosis in Liaoning Province. The Chinese Public Health Journal 14, 227–228.
97. Li, Y., Mo, Q.X., Wang, H., et al. (1997) The investigation of epidemic situation and epidemic factors
of Taenia solium taeniasis/cysticercosis in Xiayi county. The Henan Journal of Preventive Medicine 8,
9–10.
98. Wang, Z.Q., Ma, Y.X., Cui, J., et al. (1999) The seroepidemiological survey of human Taenia solium
taeniasis/cysticercosis in Weishi County of Henan Province. The Chinese Journal of Prevention and
Care of Parasitic Diseases 12, 236–237.
99. Mai, F.Z., Xie, Z.Y., Lu, X.G., et al. (1999) The seroepidemiological survey of Taenia solium
taeniasis/cysticercosis in the minority focusing region of Guangxi. The Guangxi Journal of Preventive
Medicine 5, 121.
100. Ministry of Health and Welfare, Korea Association of Health (1997) Prevalence of Intestinal Parasitic
Infections in Korea: the Sixth Report, pp. 1–287.
101. Rim, H.J., Song, K.W., Joo, K.H., et al. (1980) An epidemiological note on the taeniasis in Korea.
Korean Journal of Parasitology 18, 235–240.
102. Han, H.R. (1969) A survey on Cysticercus cellulosae infection in swine of Cheju-Do. Korean Journal of
Public Health 6, 23–28.
103. Lee, K.T., Kim, C.H., Park, C.T., et al. (1966) Cysticercosis and taeniasis in Chollapukdo Province.
Korean Journal of Parasitology 4, 39–45.
104. Cho, B.K., Houh, W., Shim, S.I., et al. (1973) A study on 657 skin tumors. Korean Journal of
Dermatology 11, 3–8.
105. Chi, J.G., Sung, R.H., Cho, S.Y. (1988) Tissue parasitic diseases in Korea. Journal of Korean Medical
Science 3, 51–62.
106. Chang, K.H., Kim, W.S., Cho, S.Y., et al. (1988) Comparative evaluation of brain CT and ELISA in the
diagnosis of neurocysticercosis. American Journal of Neuroradiology 9, 125–130.
107. Rim, H.J., Lee, J.S., Joo, K.H., et al. (1982) Therapeutic trial of praziquantel (Embay 8440; Biltricide)
on the dermal and cerebral human cysticercosis. Korean Journal of Parsitology 20, 169–190.
108. Cho, S.Y., Kim, S.I., Kang, S.Y., et al. (1986) Evaluation of enzyme-linked immunosorbent assay in
serological diagnosis of human neurocysticercosis using paired samples of serum and cerebrospinal
fluid. Korean Journal of Parasitology 24, 25–41.
109. Han, S.H., Myung, H.J. (1986) A clinical study on epileptic seizures of late onset. Journal of Korean
Neurological Association 4, 218–226.
110. Kong, Y., Cho, S.Y., Cho, M.S., et al. (1993) Seroepidemiological observation of Taenia solium cysticer-
cosis in epileptic patients in Korea. Journal of Korean Medical Science 8, 145–152.
111. Cho, S.Y., Kong, Y., Kang, S.Y., et al. (1997) Multi-antigen screening for antibodies to three
helminthes parasites in neurologic patients in Korea. Proceedings of the Third Korea-Japan
Parasitologists’ Seminar, pp. 39–41.
112. Masuda, H., Niida, M., Nakamura, N., et al. (1980) Cysticercosis in Japan: one case after 30 years of
infection with reference of 345 reported cases. Showa Medical College Journal 40, 669–688.

113. Nishiyama, T., Araki, T. (1999) Cysticercosis: clinical and epidemiological aspects. Progress in Medical
Parasitology in Japan, 7, 263–274.
114. Miyake, H., Takahashi, K., Tsuji, M., et al. (1993) A surgical case of solitary cerebral cysticercosis. No
115. Ohsaki, Y., Matsumoto, A., Miyamoto, K., et al. (1999) Neurocysticercosis without detectable specific
antibody. Internal Medicine 38, 67–70.
116. Ohnishi, K., Murata, M., Nakane, M., et al. (1993) Cerebral cysticercosis. Internal Medicine 32,
569–573.
117. Ito, A., Nakao, M., Itoh, Y., et al. (1999) Neurocysticercosis case with a single cyst in the brain show-
ing a dramatic drop in specific antibody titers within 1 year after curative resection. Parasitology
International 48, 95–99.
118. Ito, A., Nako, M., Sako, Y., et al. (2000) Neurocysticercosis and echinococcosis in Asia: recent
advances in the establishment of highly reliable differential serodiagnosis for international collabo-
ration. Southeast Asian Journal of Tropical Medicine and Public Health 31 (Suppl. 1), 16–20.
119. Schantz, P.M., Moore, A.C., Munoz, J.L., et al. (1992) Neurocysticercosis in an orthodox Jewish com-
120. European Commission (2000) Opinion of the Scientific Committee on Veterinary Measures Relating to
Public Health of the Control of Taeniasis/Cysticercosis in Man and Animals. pp. 31.
121. Kak, V.K., Al-Joshi, A.A., Daftary, S.G., et al. (1994) Cerebral cysticercosis presenting as a ring
enhancing lesion with partial seizures (A case report with review of literature). Baharin Medical
Bulletin 16, 26–28.

13 Taenia solium Cysticercosis in Africa
Michel Druet-Cabanac, Bienvenue Ramanankandrasana, Sylvie

Bisser, Louis Dongmo, Gilbert Avodé, Léopold Nzisabira, Michel
Dumas and Pierre-Marie Preux
Introduction covers almost one-quarter of Africa. Two-

thirds of the continent has a tropical or sub-
Taenia solium cysticercosis exists in Africa but tropical climate. Africa has nearly 600 million
published reports are scarce. Its spread is not inhabitants. Its rate of population growth is
well understood, owing to the lack of well- the highest in the world, but actually it is
developed medical infrastructure, and of sparsely populated, the average population
trained medical staff and diagnostic facili- density being around 20 inhabitants per km2.
ties. Several sub-Saharan African countries Differences in language, religion, ethnic ori-
have high rates of cysticercosis, because of gin and culture are enormous but compara-
indiscriminate pork consumption, poor sani- ble to other continents. Regarding religious
tary conditions, free-roaming pigs around status, Africa can be divided in two parts: the
residential areas, and lack of veterinary con- Moslem dominated northern part and ani-
trol at slaughter facilities. Even in South mist and Christian dominated sub-Saharan
Africa, where sanitary and medical facilities region. Owing to religious beliefs, pork is not
are better developed, the disease is well rec- consumed in Moslem dominated regions of
ognized, with a high prevalence having been Africa, resulting in a low prevalence of cys-
reported. In West Africa, similar high rates ticercosis in these areas. We have chosen to
have been reported in countries where epi- include Madagascar, an island off the African
demiological studies have been carried out. coast, in this review because of the similari-
This chapter, based on a previous review1, ties of the environmental conditions between
gives an account of available data concern- this country and the African continent.
ing T. solium cysticercosis in Africa. The overall socio-economic standard of the
population in Africa is low, the illiteracy rate
is high, and cultural backgrounds are difficult
Geography, people and their habits and to modify. There is a dearth of robust sanitary
environment and medical understructure and trained med-
ical personnel. Access to improved sanitary
Africa covers more than 30 million km2 of facilities and training of qualified medical
area and, after Asia, it is the second largest staff is dependent upon socio-economic stan-
continent. It is divided into two parts by the dards of the society. The latter in turn are neg-
equator. One-third of the continent is desert. atively influenced by the number of diseases
The Sahara, the largest desert in the world, existing in the African continent, resulting in


130 M. Druet-Cabanac et al.
an important loss of productivity. This forms sis is limited. The clinical presentation of neu-
a vicious cycle that is very difficult to break. rocysticercosis (NC) is extremely variable and
In most rural areas, meat inspection is the diagnosis is easy to miss. It is interesting
improper or absent. Even in localities where that diagnosis of the first case of NC in a
slaughterhouses exist, illegal channels of meat country often follows the completion of train-
marketing exist. Moreover, slaughterhouses ing of the first neurologist in that country.
do not exist in villages and people butcher The first autopsy report of human cys-
their own animals, offering the meat for sale. ticercosis in Africa was made from
Free-ranging pigs with access to human fae- Madagascar in 1910 by Andrianjafy3.
ces abound. Too many inhabitants in remote Bettencourt in 1911, reported cysticerci in an
areas of the continent ignore the danger of Angolan individual who died of trypanoso-
eating meat infected with cysticerci. Different miasis. In 1938, Gallais reported NC in an
gastronomic customs and beliefs concerning epileptic individual from Benin4.
meat consumption also play an important Review of international literature indicates
role in transmission of T. solium cysticercosis. that T. solium cysticercosis has been reported
In a few ethnic groups, pork infested with from many African countries. Cases have been
cysticercosis is believed to have a better taste reported from Senegal5–7, Benin8, Ivory
than healthy meat. Raw or insufficiently Coast9–11, Togo12, Ghana13, Burkina Faso1 and
cooked pork meat is consumed to ensure Nigeria14 in West Africa, Democratic Republic
virility in certain other communities. In some of Congo (ex-Zaire)15–17, Cameroon18, Burundi19,
tribes of South Africa, tapeworm proglot- Kenya20, Rwanda21–23, Tanzania1 and Uganda1
tides are a component of the ‘muti’ adminis- in Central and East Africa, and Zimbabwe24–26,
tered by native herbalists to expel intestinal South Africa27–35 and Madagascar36 in southern
worms2. Africa.
In Africa, maybe more than anywhere Human cysticercosis was found in 7% of
else, environment and disease are closely 300 autopsies carried out at Butare,
related. As with other communicable dis- Rwanda23. Gelfand reported cysticercosis in
eases, the geographic, demographic and cul- 0.45% of 2148 autopsies conducted in
tural characteristics of the region influence Zimbabwe24. Proctor, identified 71 cases of
the epidemiology of cysticercosis. For taeniasis in an autopsy survey of 7597 cases,
instance, T. solium egg survival in the exter- most of them also had cysticercosis25.
nal environment is influenced by tempera- In Togo, 38 (1.45%) of 2604 consecutive
ture and humidity. The tropical climate of patients presenting for neurological consulta-
Africa favours egg survival. In addition, ova tion to the outpatient department of a teaching
can be transported over many kilometres by hospital, were found to have cysticercosis12.
streams and rivers, and mechanically over Mason et al. observed that 12% of 630 hospital-
long distances by birds. Some insects may ized patients were seropositive for anticys-
also transmit the disease. The use of irriga- ticercus antibodies with an ELISA26. Sacks and
tion water contaminated by animal wastes Berkowitz noted a seropositivity rate of 7.4%
contributes to transmission of cysticercosis. among hospitalized adult patients in
Finally, a high rate of transmission is noted Johannesburg with an ELISA test35. In
in specific familial environments. Madagascar, Michel et al., using ELISA and
enzyme-linked immunoelectrotransfer blot
(EITB) reported a seroprevalence rate of 36%
Human Cysticercosis among 1132 neurologic patients36.
Hospital-based case reports and series

Human NC and seizure disorder
In most African countries, neurologists are A review of published studies from Africa
few and general practitioners are not aware reveals that seizures are the most frequent
of cysticercosis. Access to modern neu- presenting manifestation of NC in common
roimaging techniques and serological diagno- with data available from other continents.

T. solium Cysticercosis in Africa 131
Powell et al. noted seizures in 58% of 48 Several studies from South and Central
patients with proven cysticercosis from America indicate that NC is the most com-
Zimbabwe37. In Madagascar, seizures were mon cause of adult-onset seizures40–42.
the presenting symptom in 57% of 241 Studies from Africa have produced conflict-
patients with NC38. A total of 33 (87%) of 38 ing viewpoints on the association between
patients with NC presented with seizures in NC and seizures (Tables 13.1 and
Togo12. Shasha et al. analysed 141 cases of 13.2)2,12,34,37,43–50. Dumas et al. demonstrated
cysticercosis from South Africa and reported evidence of cysticercosis in 26 of 88 individ-
seizures with or without other neurological uals with seizure disorder identified during
syndromes in 95 (67.4%) of them39. In a pae- a population-based survey in Togo48. The
diatric cohort of 61 cases of cerebral cysticer- diagnosis of cysticercosis was based upon
cosis from South Africa, seizures were presence of one of the following findings:
recorded in 43%30. positive serology by ELISA; presence of
Table 13.1. Prevalence of cysticercosis among epileptic patients in sub-Saharan Africa.
Number of Prevalence Diagnostic

Country Year Reference epileptic patients (%) method *
Burundi 1992 43 98 40.8 S, R, N

1997 44 103 11.7 S
Cameroon 2000 † 93 18.3 S
South Africa 1962 45 200 12.8 S
5.5 R
1965 2 200 15.5 S, R
1966 37 180 34.4 S, R, N
1987 46 70 30.0 CT
1987 47 106 50.9 CT
1991 34 578 28.0 CT
Togo 1989 48 88 29.5 S, R, N
1995 12 305 10.8 S, R, N, CT
2000 49 170 13.5 S
*S: serology; R: calcifications on standard radiographs; N: subcutaneous cysticercus nodules;

CT: computerized tomography cerebral scan.
†Louis Dongmo, Yaounde, Cameroon unpublished data.
Table 13.2. Seroprevalence of cysticercosis in case–control and transversal studies in sub-Saharan Africa.
Number Prevalence Prevalence

of epileptic in epileptics Number of in controls
Country Year Reference patients (%) controls (%)
Benin 2000 * 65 1.5 130 1.5

Burundi 1997 44 103 11.7 72 2.8
2000 † 61 26.0 87 24.0
Cameroon 2000 ‡ 93 18.3 81 14.8
Central African Republic 1999 50 187 4.0 374 2.4
Kenya 2000 * 98 5.0 124 2.4
Togo 2000 49 115 13.5 1343 3.8
*Pierre-Marie Preux, Limoges, France, unpublished data.

†Nsengiyumva, Burundi, unpublished data.
‡Louis Dongmo, Yaounde, Cameroon, unpublished data.

calcifications characteristic of cysticercosis However, subcutaneous cysticerci need to be

on standard radiographs; proof of cysticerci differentiated from onchocerciasis nodules in
in subcutaneous nodules by histology. Using certain parts of Africa, where the latter is
the same criteria, evidence of cysticercosis endemic. For example, cysticerci were found
was found in 40 of 98 individuals with in 12 cases (22.7%), while onchocerci were
seizures in Burundi43. Of these, 25 patients found in 36 cases (67.9%) out of 53 biopsies
had a positive cerebrospinal fluid (CSF) of subcutaneous nodules in Togo48. The
serology. In a hospital-based study from study further showed that clinical examina-
Madagascar, Michel et al. reported 36% tion had excellent positive predictive value
seropositivity for cysticercosis among 1132 for onchocerciasis (100%) in comparison
consecutive hospitalized patients with neu- with cysticercosis (45.8%). Among the 12
rological complaints38. Laurence and Levi individuals with subcutaneous cysticerci, a
also emphasized the aetiological role of cys- diagnosis of NC could not be confirmed in
ticercosis in epilepsy in Zimbabwe, Malawi five. Interestingly, the study revealed that
and Zambia51. However, in several other there were three epileptics among the 36
case-control studies, no difference was cases with histologically proven onchocercal
found between the seroprevalence rates in subcutaneous nodules; two of them had
individuals with seizures and controls intracranial calcifications typical of NC. This
(Table 13.2). More studies with contempo- raises the possibility of co-infection in areas
rary methods of case finding such as the that are endemic for both disorders.
EITB are needed in order to determine if
these differences are real or only due to
methodological discrepancies1, 41. Community-based data on T. solium
cysticercosis
Human NC and other neurological
While there are several reports of NC in hos-
presentations
pitalized patients from Africa, very few com-
Other presentations including intracranial munity-based studies have been undertaken.
hypertension (ICH), psychiatric symptoms When available, studies are often subject to
and focal neurological deficits have been bias because of lack of random sampling or
reported from Africa. ICH was a presenting other appropriate epidemiological methods.
symptom in 24% of 61 children with cerebral This may explain the high variability of
cysticercosis in South Africa30. In this report, prevalence rates among different regions
headache and meningoencephalitis were within Africa. Nevertheless, preliminary
noted in 28% and 13%, respectively. data has emerged to show that most
Meningoencephalitis was reported in two sub-Saharan countries have a high preva-
patients from Togo12. Some patients having lence of T. solium cysticercosis (Table
NC present with multiple signs and symp- 13.3)2,14,36,48–50,52–57.
toms. Avodé et al. reported a patient from
Benin with diffuse cysticercosis, who pre-
West Africa
sented with seizures, ICH, confusion, myosi-
tis and subcutaneous cysticercus nodules8. A population-based survey evaluated the
Spinal cord involvement or ocular cysticerco- prevalence of cysticercosis and epilepsy in
sis has been rarely reported from Africa. the Kozah region of northern Togo in
Michel et al. reported ocular cysticercosis in 198748,58. The study included 5264 randomly
3% of 266 patients with cysticercosis36. selected subjects above 15 years of age. In
this population, the prevalence rate for
epilepsy was 16.7 per 1000 (95%CI: 12.3–21.2
Subcutaneous cysticercosis
per 1000). The overall prevalence of cysticer-
The finding of subcutaneous nodules in indi- cosis was 2.4%. Serological studies were
viduals with seizures may be taken as pre- undertaken in part of this sample (i.e.
sumptive evidence of T. solium cysticercosis. among epileptic subjects, their relatives and

Table 13.3. Prevalence of human cysticercosis in sub-Saharan Africa and Madagascar.
Population Prevalence Sample Diagnostic

Country Year Reference studied * (% ) size method†
Benin 1996 52 GP 3.5 319 S

1998 53 GP 3.9 1443 S
1998 54 GP 1.5 2625 S
Burundi 2000 ‡ GP 24.0 87 S
Cameroon 1987 55 GP 2.4 764 S
2002 14 GP 0.8 4128 S
2000 § GP 16.7 174 S
Central African Republic 1999 50 GP 2.4 374 S
Madagascar 1993 36 GP 18.0 1408 S
South Africa 1965 2 GP 8.5 2124 S
1987 56 SC: Transkei 0.23 736 S
SC: KwaZulu 2.49 677 S
1991 57 SC 5.5 1352 S
Togo 1989 48 GP 2.4 5264 S, R, N
2000 49 GP 3.8 1343 S
*GP: general population; SC: school children.

†S: serology; R: calcifications on standard radiographs; N: subcutaneous cysticercus nodules.
‡Nsengiyumva, Burundi, unpublished data.
§Louis Dongmo, Yaounde, Cameroon, unpublished data.
neighbours). In this subsample, seropreva- subjects in Vekky, a lake-side village situ-

lence was 8.4% (95%CI: 6.5–10.7%), and the ated near Cotonou in the Atlantique
difference in prevalence between epileptic province of Benin, found 11 (3.5%) positive
individuals and others was statistically sig- cases (95%CI: 1.8–6.3%)52. Houinato et al.
nificant (P0.001). Another survey in the evaluated 2625 sera using ELISA and
Tone region of Togo, found 170 individuals immunoblot collected from six regions
with seizure disorder among 9155 exam- within Benin by cluster sampling54. The
ined, giving a prevalence of 18.6 per 100049. sera, therefore, constituted a representative
The seroprevalence of cysticercosis was sig- sample of the national population. A total
nificantly higher (P106) in subjects with of 35 (1.3%) subjects were seropositive for
seizure disorder (135 per 1000) than in a cysticercosis (95%CI: 0.9–1.9%). Two regions,
control group consisting of 1343 randomly Atacora (3.3%) and Atlantique (3.0%) had
selected individuals (38 per 1000). Using higher seroprevalence rates than the
similar methods and case definitions, a sur- national average. The Moslem dominated
vey of 1443 subjects older than 5 years in the regions of Borgou (0.3%), Ouémé (0.8%)
Savalou region of Benin, in 1993, indicated a had low seroprevalence rates. The preva-
prevalence rate of seizure disorder of 15.2 lence rate was higher in men (1.9%; 95%CI:
per 1000 (95%CI: 9.8–23.4 per 1000). 1.2–2.7%) than in women (0.8%; 95%CI:
Prevalence rates were comparable to those 0.4–1.5%) (P0.05). Benin can then be con-
found in Togo52,54. The seroprevalence rate sidered as a country with medium endemic-
for cysticercosis was 3.9% (95%CI: 3.0–5.1%). ity for cysticercosis with several foci of
No statistically significant difference was hyper-endemicity53,59.
found between seropositivity rates among
individuals with and without seizures. Two
East Africa
other studies were carried out in Benin by
the same team. A serological study for cys- In Kazanya, northern Burundi, 25% of indi-
ticercosis on a representative sample of 319 viduals with seizure disorder were assigned

a diagnosis of NC based on the finding of Porcine Cysticercosis

anticysticercus antibodies in CSF in a com-
munity-based survey43. To our knowledge, Only few studies have examined the burden
this is the only population-based study from of porcine cysticercosis in Africa. In
East Africa. Burundi, the prevalence was found to be
around 20%56. In northern Togo, 17% of pigs
were reported to be infected58. In South
Southern Africa
Africa, prevalence of porcine cysticercosis
A serological survey using complement fix- was 4% in 198445. Similar data are also avail-
ation and precipitin reactions found an able from other African countries14,62.
overall prevalence rate of 8.5% of cysticer- Veterinary meat inspection is an important
cosis among a rural black population in method of prevention. Unfortunately, in
South Africa2. In an ELISA based serosur- most parts of Africa, only a very small per-
vey, 22 of 736 school children from Transkei centage of pig carcasses undergo veterinary
were found to be serologically positive meat inspection. We believe that the situa-
while only eight of 677 KwaZulu children tion in Africa is similar to that reported in
were positive56. These results, when cor- Peru, where about 65% of the pork con-
rected for the sensitivity and specificity of sumed is obtained through informal chan-
ELISA, indicate a prevalence rate for cys- nels, in order to avoid financial losses from
ticercosis of 2.49% in Transkeian school the condemnation of infected pigs63. One
children and 0.23% in the KwaZulu. The way to circumvent these problems would be
differences in prevalence between the two to establish an official market for infected
regions are in keeping with the meat-eating meat. The meat brought there, at a some-
habits of the two communities. While what lower price, could then be processed
KwaZulu is primarily a cattle and meat- using methods that would kill all cysts.
producing area, the Transkei region has a The production of free-roaming pigs,
large number of free-roaming pigs in addi- which feed on domestic wastes and faecal
tion to cattle. An earlier study in 1966 matter, with minimal feeding and mainte-
revealed that the frequency of porcine cys- nance costs is a considerable source of
ticercosis detected in slaughterhouses in income for small farmers. None of the peas-
the Transkei area was nearly seven times ants who raised pigs in Vekky (Benin) prac-
higher than in those close to the KwaZulu tised indoor husbandry52. Similarly, in
area60. Another ELISA based serosurvey, Savalou (Benin), 92.6% of the pigs are pro-
carried out on school children in Transkei duced using free-range methods53. In west-
in 1991, determined an overall seropreva- ern Cameroon, pigs are raised in household
lence rate of 5.5%57. The rates were similar pens but humans frequently defecate inside
for regions with different climatic condi- these pens64.
tions. An interesting revelation that
emerged from this study was the lower
seroprevalence rate in undernourished chil- Intestinal Taeniasis
dren (3.3%) in comparison with those with
good nutritional status (7.3%). The authors Data on intestinal taeniasis in Africa is
attributed this discrepancy to an impaired extremely limited. Furthermore, there are
antibody response associated with protein- discrepancies between the low prevalence of
energy malnutrition. intestinal taeniasis and the high prevalence
In Madagascar, 91 of 34,137 persons with of cysticercosis in the same area. For
neurological symptoms were found to instance, Dumas et al. found T. solium eggs
have NC61. When 1408 sera from healthy and proglottides in one case out of 1163
individuals from six provinces of stool examinations and eggs alone in eight
Madagascar were evaluated by the anticys- (0.5%) out of 1157 faecal samples48. Only one
ticercus ELISA/EITB, a high seroprevalence of these eight cases was seropositive
rate of 18% was obtained36,38. (ELISA) for cysticercosis. Newell et al.

established a prevalence of taeniasis (both T. Besides, cysticercosis has also been recog-
solium and T. saginata) of 0.16% in 1992, nized in West Africa and southern Africa.
0.25% in 1993 and 0.25% in 1994 among Studies from Benin and Togo have succeeded
school children in Rumonge, Burundi44. The in increasing the awareness of local political,
highest reported prevalence was reported administrative and public health authorities
from South Africa, where a survey found concerning cysticercosis and NC. In Benin,
10% prevalence of adult Taenia infection. information on sanitation has been dissemi-
nated through a published handbook. More
work of this nature on a collaborative basis
Conclusions involving countries within Africa and
beyond are clearly required to assess and
While human and porcine cysticercosis have contain the situation in Africa.
been recognized as major health and eco-
nomic problems in Latin America and also in
few developed countries, their impact upon Acknowledgements
health and economy in Africa has not been
adequately appreciated. Preliminary epi- We would like to thank the Conseil Régional
demiological data indicate that sub-Saharan du Limousin for their financial help and Dr
Africa may be a major focus of disease. Bernard Bouteille for technical assistance.
References
1. Preux, P.M., Melaku, Z., Druet-Cabanac, M., et al. (1996) Cysticercosis and neurocysticercosis in
Africa: current status. Neurological Infections and Epidemiology 1, 63–68.
2. Heinz, H.J., MacNab, G.M. (1965) Cysticercosis in the Bantu of Southern Africa. South African Journal
of Medical Sciences 30, 19–31.
3. Andrianjafy, A. (1910) Cysticercose humaine. S S Mad 2, 53–60.
4. Gallais, P. (1938) Deux cas de cysticercose cérébrale avec manifestations épileptiques. Bulletin de la
Société de Pathologie Exotique 31, 915–919.
5. Collomb, H., Lariviere, M., Philippe, Y. (1961) Cysticercose cérébrale (premier cas au Sénégal).
Bulletin de la Société de Médicine d’African Noire 6, 695–700.
6. Dumas, M., N’Diaye, I.P., Daumens, J.P., et al. (1976) Cysticercose cérébrale (deux nouveaux cas
sénégalais). Bulletin de la Société de Médicine d’African Noire 21, 203–211.
7. Collomb, H., Larivière, M., Phillipe, Y., et al. (1964) Foyer de cysticercose de la Basse Casamance
(Sénégal). Bulletin et Mémoires de la Faculté Mixte de Médecine et de Pharmacie de Dakar, Sénégal 12, 148–155.
8. Avodé, D.G., Bouteille, B., Avimadjé, M., et al. (1994) Epilepsie, hypertension intracrânienne, syn-
drome confusionnel et cysticercose cutanée, à propos d’un cas observé en milieu hospitalier au
Bénin. Bulletin de la Société de Pathologie Exotique 87, 186–188.
9. Heroin, P., Loubière, R., Doucet, J., et al. (1972) Un cas de cysticercose sous-cutanée en Côte d’Ivoire.
Revue Médicale Côte d’Ivoire 8, 26.
10. Giordano, C., Vedrenne, H., Dago-Ekribi, A., et al. (1976) Cysticercose cérébrale à forme confusion-
nelle avec aspects périodiques à l’EEG, étude anatomo-clinique. Médicine d’Afrique Noire 23, 43 – 51.
11. Bullock, A. (1980) La cysticercose cérébrale. A Propos d’une Observation Clinique, Electrique et
Anatomique. Medical thesis, Abidjan, Ivory Coast, 75 pp.
12. Grunitzky, E.K., Balogou, A.K., M’Bella, M., et al. (1995) La cysticercose chez des malades neu-
rologiques en milieu hospitalier à Lomé, Togo. Annales de Médecine Interne 146, 419–422.
13. Odamtten, S.E., Laing, W.N. (1967) Cysticercosis of the brain. Ghana Medical 6, 97–105.
14. Geerts, S., Zoli, A., Wallingham, L., et al. (2002) Taenia solium cysticercosis in Africa: an under-recog-
nised problem. In: Craig, P.S., Pawlowski, Z.S. (eds) Tapeworm Zoonoses: – an Emergent and Global
Problem. IOS Press, Amsterdam, pp. 13–23.
15. Fain, A., Duren, P., Fels, P. (1956) Cysticercose généralisée et plasmocytose médullaire (myélome)
associés chez une femme de race Muhutu. Annales de la Société de Belge Médecine Tropicale 36,
239–246.

16. Denisoff, N., Haenecour, F. (1958) Nouveau cas de cysticercose généralisée dans l’Est Congolais.
Annales de la Société de Belge de Médecine Tropicale 38, 529–530.
17. Lelo, T., Malenga, M., Ndoma, K., et al. (1992) La cysticercose cérébrale à Kinshasa, à propos de deux
observations. African Journal of Neurological Sciences 11, 36–37.
18. Marty, P., Herzog, U., Marty-Jaussan, et al. (1985) 2 cas de cysticercose observés au Cameroun.
Médecine Tropicale 45, 83–86.
19. Aubry, P., Ndayiragije, A., Kamamfu, G., et al. (1990) A propos de 2 cas de cysticercose au Burundi.
Bulletin de la Société de Pathologie Exotique 83, 288–289.
20. Ruberti, R.F., Mwingi, S.M.G., Dekker, N., et al. (1985) Epilepsy in the Kenyan Africans. African
Journal of Neurological Sciences 4, 1–3.
21. Kestelyn, P., Taelman, H. (1985) Effect of praziquantel in intraocular cysticercosis: a case report.
British Journal of Ophthalmology 69, 788–790.
22. Gascon, J., Corachan, M., Ramirez, J. (1989) A propos de 5 cas de cysticercose au Rwanda. Médecine
Tropicale 49, 77–80.
23. Vanderick, F.X., Moboryingabo, P. (1972) La cysticercose humaine au Rwanda. Annales de la Société
de Belge de Médecine Tropicale 52, 153–155.
24. Gelfand, M. (1948) Cysticercosis of the brain in the Africans of Rhodesia. East African Medical Journal
25, 110–112.
25. Proctor, N.S.T. (1963) Problems associated with tapeworm infestation of the central nervous system.
In: van Bogaert, L., Kafer, J.P., Poch, G.F. (eds) Tropical Neurology. Lopez Libreros Editores, Buenos
Aires, Argentina, pp. 140.
26. Mason, P., Houston, S., Gwanzura, L. (1992) Neurocysticercosis: experience with diagnosis by ELISA
serology and computerized tomography in Zimbabwe. Central African Journal of Medicine 38, 149– 154.
27. Becker, B.J.P., Jacobson, S. (1951) Infestation of the human brain with Coenurus cerebralis. Lancet 29,
1202–1204.
28. De Villiers, P.D. (1953) Cerebral cysticercosis: an aspect of the diagnosis. South African Medical
Journal 27, 1097–1098.
29. Gelfand, M., Jeffrey, C. (1973) Cerebral cysticercosis in Rhodesia. Journal of Tropical Medicine and
Hygiene 76, 87–89.
30. Thomson, A.J., De Villiers, J.C., Moosa, A., et al. (1984) Cerebral cysticercosis in children in South
Africa. Annals of Tropical Paediatrics 4, 67–77.
31. Tuch, P.S., Saffer, D. (1984) Cerebral cysticercosis: a case report and review of literature. South
African Medical Journal 65, 211–216.
32. Joubert, J., Joubert, M.J., Lombaard, C.M. (1985) Neurocysticercosis – a comprehensive approach to
medical treatment. South African Medical Journal 68, 11–14.
33. Zini, D., Farrell, V.J.R., Wadee, A.A. (1990) The relationship of antibody levels to the clinical spec-
trum of human neurocysticercosis. Journal of Neurology, Neurosurgery and Psychiatry 53, 656–661.
34. Van As, A.D., Joubert, J. (1991) Neurocysticercosis in 578 black epileptic patients. South African
Medical Journal 80, 327–328.
35. Sacks, L.V., Berkowitz, I. (1990) Cysticercosis in urban black South African community: prevalence
and risk factors. Tropical Gastroenterology 11, 30–33.
36. Michel, P., Callies, P., Raharison, H., et al. (1993) Epidémiologie de la cysticercose à Madagascar.
Bulletin de la Société de Pathologie Exotique 86, 62–67.
37. Powell, S.J., Proctor, E.M., Wilmot, A.J., et al. (1966) Cysticercosis and epilepsy in Africans: a clinical
and serological study. Annals of Tropical Medicine and Parasitology 60, 152–158.
38. Michel, P., Callies, P., Raharison, H., et al. (1992) La cysticercose à Madagascar: mise au point diag-
nostique et thérapeutique. Dakar Médical 37, 191–197.
39. Shasha, W., Van Dellen, J., Cakata, E. (1986) Cysticercosis: an analysis of 141 cases in South Africa.
South African Journal of Epidemiology and Infection 1, 94–97.
40. Medina, M.T., Rosas, E., Rubio-Donnadieu, F., et al. (1990) Neurocysticerosis as the main cause of
late-onset epilepsy in Mexico. Archives of Internal Medicine 150, 325–327.
41. Carpio, A., Escobar, A., Hauser, W.A. (1998) Cysticercosis and epilepsy: a critical review. Epilepsia 39,
1025–1040.
42. Pal, D.K., Carpio, A., Sander, J.W.A.S. (2000) Neurocysticercosis and epilepsy in developing coun-
tries. Journal of Neurology, Neurosurgery and Psychiatry 68, 137–143.
43. Nzisabira, L., Nsengiyumva, G., Bouteille, B., et al. (1992) La cysticercose dans la province de
Kayanza (Burundi). Bulletin de la Société de Pathologie Exotique 85, 374–377.

44. Newell, E., Vyungimana, F., Geerts, S., et al. (1997) Prevalence of cysticercosis in epileptics and mem-
bers of their families in Burundi. Transactions of the Royal Society of Tropical Medicine and Hygiene 91,
389–391.
45. Bird, A.V., Heinz, H.J., Klintworth, G. (1962) Convulsive disorders in Bantu mine workers. Epilepsia
3, 175–187.
46. Naidoo, D.V., Pammenter, M.D., Moosa, A., et al. (1987) Seventy black epileptics: cysticercosis, com-
puted tomography, and electroencephalography. South African Medical Journal 72, 837– 838.
47. Campbell, G.D., Farrell, V.J.R. (1987) Brain scans, epilepsy and cerebral cysticercosis. South African
Medical Journal 72, 885–886.
48. Dumas, M., Grunitzky, E.K., Deniau, M., et al. (1989) Epidemiological study of neurocysticercosis in
Northern Togo (West Africa). Acta Leidensia 57, 191–196.
49. Balogou, A.K., Grunitzky, E.K., Beketi, K.A., et al. (2000) Cysticercose et épilepsie au nord du Togo
dans le Tone. Revue Neurologique (Paris) 156, 270–273.
50. Druet-Cabanac, M., Preux, P.M., Bouteille, B., et al. (1999) Onchocerciasis and epilepsy: a matched
case-control study in Central African Republic. American Journal of Epidemiology 149, 565–570.
51. Laurence, F., Levi, S. (1990) Epilepsia in Rhodesia, Zambia and Malawi. African Journal of Medical
Science 1, 291–303.
52. Adjidé, C.C., Bouteille, B., Josse, R., et al. (1996) Séroprévalence de la cysticercose dans la commune
lacustre de Vekky, département de l’Atlantique (Bénin). Bulletin de la Société de Pathologie Exotique 89,
24–29.
53. Avodé, D.G., Bouteille, B., Houngbe, F., et al. (1998) Epilepsy, cysticercosis and neurocysticercosis in
Benin. European Neurology 39, 60–61.
54. Houinato, D., Ramanankandrasana, B., Adjidé, C.C., et al. (1998) Seroprevalence of cysticercosis in
Benin. Transactions of the Royal Society of Tropical Medicine and Hygiene 92, 621–624.
55. Zoli, A., Geerts, S., Vervoort, T. (1987) An important focus of porcine and human cysticercosis in
West Cameroon. In: Geerts, S., Kumar, V., Brandt, J. (eds) Helminth Zoonoses. Martinus Nijhoff
Publishers, Dordrecht, pp. 85–91.
56. Pammenter, M.D., Rossouw, E.J., Dingle, C.E. (1987) Serological detection of cysticercosis in two
rural areas of South Africa. Transactions of the Royal Society of Tropical Medicine and Hygiene 81,
242–244.
57. Shasha, W., Pammenter, M.D. (1991) Sero-epidemiological studies of cysticercosis in school children
from two rural areas of Transkei, South Africa. Annals of Tropical Medicine and Parasitology 85,
349–355.
58. Dumas, M., Grunitzky, K., Belo, M., et al. (1990) Cysticercose et neurocysticercose: Enquête épidémi-
ologique dans le nord du Togo. Bulletin de la Société de Pathologie Exotique 83, 263–274.
59. Avode, D.G., Capo-Chichi, O.B., Gandaho, P., et al. (1996) Epilepsie provoquée par la cysticercose. A
propos d’une enquête sociologique et culturelle réalisée à Savalou au Bénin. Bulletin de la Société de
Pathologie Exotique 89, 45–47.
60. Verster, A. (1966) Cysticercosis, hydatidosis and coenurosis in the republic of South Africa. Journal of
South African Veterinary Medical Association 37, 37–45.
61. Andriamiandra, A., Cros, J., Dodin, A., et al. (1969) La cysticercose à Madagascar. Bulletin de la
Société de Pathologie Exotique 62, 894–900.
62. Geerts, S. (1993) The taeniosis–cysticercosis complex in Africa. Bulletin Séances de l’Académie des
Sciences d’Outre-Mer 38, 245–264.
63. Cysticercosis Working Group in Peru. (1993) The marketing of cysticercotic pigs in the Sierra of
64. Marty, P., Mary, C., Pagliardini, G., et al. (1986) Courte enquête sur la cysticercose et le taeniosis à
Taenia solium dans un village de l’ouest Cameroun. Médecine Tropicale 46, 181–183.

14 Taenia solium Cysticercosis: the

Special Case of the United States
Wayne X. Shandera, Peter M. Schantz and A. Clinton White Jr.
Introduction acquired largely in India. Key insights

included the observation of the protracted
Neurocysticercosis (NC) is commonly con- interval between acquisition of disease and
sidered a disease of the developing world. onset of symptoms. For example, of over 450
Nonetheless, NC is also diagnosed in the British citizens who acquired infection pri-
developed world. By virtue of the number of marily in India, clinical disease did not pre-
immigrants entering the United States of sent until several years (average: 5 years,
America (USA) every year from countries range 1–30 years) later in their homeland2.
where Taenia solium infection is endemic, In the USA, T. solium cysticercosis has
more cases of imported NC are diagnosed in always been predominantly an imported dis-
the USA every year than in all other devel- ease. Even in the early 19th century, when
oped countries combined. While NC cases in ‘thousands of swine’ roamed streets in New
the USA occur primarily among immigrants York City and other communities, cysticerco-
from the developing world, a few cases arise sis was rarely described in the USA.
autochthonously. In this chapter we discuss Occasional cases were reported in the late
the epidemiology of NC in the developed 19th century and early 20th century, but most
world by focusing on the USA. patients were German and Eastern European
immigrants who were infected before immi-
gration. A review published in 1899, for
Early American Reports example, describes only eight cases including
the first case, a German woman reported
The earliest studies on NC were from from New York in 18573. Few cases were
Europe. These include descriptions of Taenia reported in the first half of the 20th century4.
morphology, clarification of the animal hosts’ Two larger case series were published in the
differences between T. solium (originally clas- 1950s. The first described two new cases from
sified by Linnaeus) and T. saginata (classified Louisiana as well as a literature review of 40
by the German scientist, Johann Goeze in the additional American cases5. Overall, 31%
18th century) and the detailed elucidation of showed ocular disease, and only 49%
the Taenia life cycle by the 19th-century parenchymal brain disease, suggesting that
German scientist Karl Leuckart1. Many of the neurological manifestations were often over-
clinical manifestations were defined by looked. Only three (7%) of the cases had
British investigators studying clinical disease clearly acquired their infection in the USA.


140 W.X. Shandera et al.
Another American series of cysticercosis revealed 447 cases diagnosed with NC11. The
cases diagnosed in the USA involved two number of cases, however, only began to
intraventricular cases and one parenchymal increase during the last few years of the
case6. The three patients were from Portugal, 1970s. There was a fourfold increase in the
Guatemala (the intraventricular cases) and number of cases diagnosed between l977 and
Angola (the parenchymal case). Subsequent l981, which was far greater than the increase
articles broadened the clinical spectrum of in the number of immigrants. The major fac-
disease, and showed that surgical interven- tor associated with the increased number of
tion improved the outcome of selected cases was the introduction and widespread
cases7–9. Thus, the number of cases described utilization of CT scans. This technology so
before the 1970s was limited, perhaps due to enhanced the clinician’s ability to identify
limitations of diagnostic tests. In addition, the and define the nature of intracerebral lesions
spectrum of disease was skewed towards that its introduction overshadowed any other
cases that were obvious (e.g. patients with factors. The vast majority of the patients
parasites visible in the eye) or more severe reported during this period were Hispanic.
(e.g. intraventricular disease). Most were presumably from Mexico. Even in
this early report, however, 12 of the cases
(3%) had no history of travel to disease-
T. solium Infections: 1970 Onwards endemic areas outside of the USA11. Thus, their
infections were presumably acquired locally.
The spurt in T. solium cases in the 1970s As the number of immigrants increased
and the geographic range of Hispanic immi-
In the late 1970s, computed tomography (CT) gration broadened, so did the extent of NC.
scanning became widely available in the USA. By the 1990s, we estimated that 1000 NC cases
The result was that parasites in the central ner- were diagnosed in the USA each year12. With
vous system could be identified without inva- the continued increase in immigration from,
sive testing. At about the same time, the and travel to endemic areas, the number of
number of immigrants from endemic areas cases is probably higher now. In support of
began to increase. Between 1960 and the 1990s, this is the continuing increase in the number
the proportion of the US population born in of cases in Los Angeles13. While cases were
foreign countries doubled. Furthermore, there initially noted in southern California, large
was a shift in the country of origin for US cases series have subsequently been reported
immigrants. Prior to the 1970s, most immi- from Colorado, Texas, Chicago and New
grants to the USA were of Canadian or York12,14–17. Interestingly, these case series are
European origin. Changes in immigration pol- reported from cities with large immigrant
icy led to the influx of large numbers of immi- populations, especially those from Mexico
grants from Latin America and Asia. The and Central America. However, up to 42% of
recently completed 2000 US Census recorded the patients were persons born in the
35.3 million persons of Hispanic origin living USA15,16. Reported sources of possible expo-
in the USA, representing an increase of 12.9 sure in these persons included travel to
million in the past decade10. US immigrants of Mexico or Central America (50%) or visitors
Mexican origin now number over 20 million. in the home from Latin America (20%).
There was also increased travel to endemic To document the extent of disease, an
areas with an estimated 200 million persons ongoing multi-state surveillance project of 11
crossing the US–Mexico border every year. university-affiliated hospital emergency
Increased immigration plus widespread departments was begun in the late 1990s18.
availability of non-invasive neuroimaging NC was documented as the apparent cause
tests resulted in a dramatic increase in recog- of approximately 2% of cases of seizures.
nition of NC. This was initially noted in Most cases were seen in the southwestern
California. For example, review of hospital states. Patients with no travel history and in
records from four large medical centres in whom infections may have been locally
Los Angeles for the period 1973–1983 acquired represented 8% of identified cases.

T. solium Cysticercosis in the USA 141
Risk factors for T. solium infection in USA may have been due to ascertainment bias,
with only more severe or obvious cases
To further characterize the epidemiology of being diagnosed.
NC, we interviewed NC cases diagnosed in
Houston19. Of 35 immigrants questioned,
83% were from families that raised pigs, 43% Locally acquired infections
had a history of taeniasis, and 54% had a
family history of taeniasis. The median Locally acquired infections have also occa-
period from immigration to diagnosis was 28 sionally been noted. Pigs sold and consumed
months for the 13 patients who had not left in the USA however, are infrequently infected
the USA after immigration. Thus, NC cases with cysticercosis and among over 80 million
were concentrated in immigrants from vil- swine slaughtered annually, fewer than 10
lages in known endemic regions. Travel pigs show evidence of infection1. Thus, local
between the endemic villages and cities in acquisition of T. solium adult tapeworms (tae-
the USA was surprisingly frequent19,20. niasis) is unlikely to be a significant problem.
In the late 1980s, NC was made a By contrast, local acquisition of NC has been
reportable disease in southern California. noted. Twelve US-born patients with NC
Surveillance was started in 1988 and within 3 who had not left the USA were identified in
years the county health system in Los the hospital-based survey from Los
Angeles was notified of 138 cases21. The Angeles21. Similarly, locally acquired cases
number of cases was significantly fewer than were also identified in patients from
would be predicted from hospital surveys, Massachusetts and North Carolina24. A small
suggesting significant underreporting. As series of patients with no travel outside of the
might be expected the case rates were over USA was also reported from Chicago16.
2.5 times higher in the Hispanic than in the Direct or circumstantial evidence commonly
non-Hispanic communities. In addition, links these cases to direct or indirect exposure
many of the non-Hispanic patients were to immigrants from Latin America, who pre-
Asian immigrants. sumably are (or were previously) carriers of
With the increase in numbers of cases, adult-stage T. solium. This was most dramati-
there was also a shift in the spectrum of dis- cally shown in a cluster of cases in four unre-
ease. Most cases diagnosed after the wide- lated families of an Orthodox Jewish
spread use of neuroimaging studies were community in New York City25. The clue to
due to parenchymal cysticerci. Previously, it the epidemiological puzzle in these cases was
was widely assumed that NC carried a grave the employment of ‘live-in’ housekeepers in
prognosis and that patients would do poorly all of the exposed households. These female
unless treated with anticysticercal drugs. employees had recently emigrated from Latin
Based on uncontrolled studies, praziquantel American countries where T. solium is
and subsequently albendazole became endemic and were considered the most likely
widely used. During the early 1980s, neither sources of infection for the infected members
of these drugs was widely available in the of these households. Examination of six
USA. Several investigators in California fol- housekeepers currently or previously
lowed the natural history of patients treated employed in the four case households
with only symptomatic therapy22,23. US revealed an active Taenia sp. infection in one
investigators reported that most patients and a positive serological test result in
with NC presented with seizures and usually another. Employment of immigrants as
a single enhancing lesion on CT scans. These domestic workers was very common in this
patients did very well with only sympto- community; a random telephone survey
matic therapy. By contrast, ocular, ventricu- determined that 94% of the approximately
lar and meningeal disease (which comprised 7000 households in the community employed
most of the reported cases before the CT era) housekeepers, almost all of whom had
were only a small minority of cases. Thus, recently emigrated from rural areas of
the poor prognosis reported in older series Mexico or countries of Central America.

142 W.X. Shandera et al.
Each household employed an average of (4.4%), but none in those from Haiti or
three such women per year. Mexico27. Thus, widespread employment of
To further evaluate the extent of this domestic workers from disease-endemic
problem, a serosurvey was conducted in the regions and high employee turnover may
same community which sought to identify contribute to exposure risk. It is unclear,
exposures and practices associated with however, whether local transmission is in
acquisition of infection. Anticysticercus anti- fact rare or merely under-recognized. In
bodies were detected by enyme-linked Los Angeles, Sorvillo et al. attempted to
immunoelectrotransfer blot (EITB) in 23 identify tapeworms among contacts of NC
(1.3%) of 1789 persons from 612 families26. patients21. They identified carriers in 1.1%
All 23 seropositive persons were asympto- of the household contacts of their patients.
matic, and no intracerebral lesions were Among the subgroup of NC patients that
found in the 21 seropositive persons who were not from and had not travelled to
underwent brain imaging. Seropositivity endemic areas, 22% had tapeworm carriers
was significantly associated (P 0.05) with among household contacts.
female sex, employment of domestic work-
ers for child care duties, and with employ-
ment of persons from Central America. This Conclusions
cluster of patients within a community in
New York that never ate pork and enjoyed Overall, NC is a growing public health prob-
modern hygienic facilities underscored the lem in the USA. Initial recognition resulted
importance of faecal–oral hygiene in the from improved imaging studies and has
transmission cycle. The prevalence of these included more cases of mild disease (e.g. sin-
risk factors among the US population in gen- gle parenchymal cysticerci) than in most
eral is unknown. series from developing countries. NC in the
The prevalence of taeniasis among USA is primarily a disease of immigrants
immigrant employees in surveyed house- infected abroad. Thus, as immigration and
holds is unknown and may be difficult to travel from Latin America and Asia increase,
determine. Most employees live in the so the number of cases. In addition, small
households; many are undocumented numbers of cases of locally acquired infec-
aliens; access to the population is limited, tions are recognized. While the number of
and confidentiality of test results is difficult such cases is small, the risk factors associated
to ensure. A stool examination survey of with locally acquired infection need better
migrant workers in North Carolina found definition and the magnitude of this problem
taeniasis in Central American workers requires further study.
References
1. Schantz, P.M., Wilkins, P.P., Tsang, V.C.W. (1998) Immigrants, imaging, and immunoblots: the emer-
gence of neurocysticercosis as a major public health problem. In: Scheld, W.M., Craig, W.A.,
Hughes, J.M. (eds) Emerging Infections 2. ASM Press, Washington, DC, pp. 213–242.
Research Council Special Report Series. Her Majesty’s Stationery Office, London, pp. 1–58.
3. Diamond, I.B. (1899) Cysticercosis of brain and spinal cord. Journal of the American Medical
Association 32, 1365–1369.
4. Dandy, W.E. (1950) Animal parasites invading the central nervous system: cysticercosis cellulosae.
In: Lewis’ Practice of Surgery, Vol. 12. W. F. Prior Co, Hagertown, USA, pp. 377–382.
5. Campagna, M., Swartzwelder, C. (1954) Human cysticercosis in the United States. Journal of
Parasitology 40 (Suppl.), 46.
6. White, J.S., Sweet, W.H., Richardson, E.P. (1957) Cysticercosis cerebri. New England Journal of
Medicine 256, 479–486.

T. solium Cysticercosis in the USA 143
7. Orihel, T.C., Gonzalez, F., Beaver, P.C. (1970) Coenurus from the neck of a Texas woman. American
8. Simms, N.M., Maxwell, R.E., Christenson, P.C., et al. (1969) Internal hydrocephalus secondary to
cysticercosis cerebri: treatment with a ventriculoatrial shunt. Journal of Neurosurgery 30, 305–309.
9. Carmalt, J.E., Theis, J., Goldstein, E. (1975) Spinal cysticercosis. Western Journal of Medicine 123,
311–314.
10. Guzman, B. (2001) The Hispanic population. Census 2000 Brief. US Department of Commerce, 8 pp.
11. Richards, F.O., Schantz, P.M., Ruiz-Tiben, E., et al. (1985) Cysticercosis in Los Angeles county. Journal
of American Medical Association 254, 3444–3448.
12. Shandera, W.X., White, A.C. Jr, Chen, J., et al. (1994) Cysticercosis in Houston, Texas: a report of 112
cases. Medicine 73, 37–52.
13. Zee, C.S., Go, J.L., Kim, P.E., et al. (2000) Imaging of neurocysticercosis. Neuroimaging Clinics of North
America 10, 391–407.
14. Earnest, M.P., Reller, L.B., Filley, C.M., et al. (1987) Neurocysticercosis in the United States: 35 cases
and a review. Reviews in Infectious Diseases 9, 961–979.
15. Rosenfeld, E.A., Byrd, S.E., Shulman, S.T. (1996) Neurocysticercosis among children in Chicago.
Clinical Infectious Diseases 23, 262–268.
16. Stamos, J.K., Rowley, A.H., Hahn, Y.S., et al. (1996) Neurocysticercosis: report of unusual paediatric
cases. Pediatrics 98, 974–977.
17. Buitrago, M., Edwards, B., Rosner, F. (1995) Neurocysticercosis: report of fifteen cases. Mount Sinai
Journal of Medicine 62, 439–444.
18. Ong, S., Moran, G.J., Talan, D.A., et al. (1998) Radiographically-imaged seizures and neurocysticer-
cosis. Program and abstracts of the International Conference on Emerging Infectious Diseases, Atlanta,
Georgia (abstract 28.4).
19. de la Garza, Y., Graviss, E., Shandera, W., et al. (1998) Epidemiology of neurocysticercosis in
Houston, Texas. International Conference on Emerging Infectious Diseases, Atlanta, Georgia (abstract).
20. Allan, J.C., Velasquez-Tohom, M., Garcia-Noval, J., et al. (1996) Epidemiology of intestinal taeniasis
in four, rural, Guatemalan communities. Annals of Tropical Medicine and Parasitology 90, 157–165.
21. Sorvillo, F.J., Waterman, S.H., Richards, F.O., et al. (1992) Cysticercosis surveillance: locally acquired
and travel-related infection and detection of intestinal tapeworm carriers in Los Angeles. American
22. Mitchell, W.G., Crawford, T.O. (1988) Intraparenchymal cerebral cysticercosis in children: diagnosis
and treatment. Pediatrics 82, 76–82.
23. Kramer, L.D., Locke, G.E., Byrd, S.E. (1989) Cerebral cysticercosis: documentation of natural history
with CT. Radiology 171, 459–462.
24. Centers for Disease Control and Prevention (1992) Locally acquired neurocysticercosis – North
Carolina, Massachusetts, and South Carolina, 1989–1991. Morbidity and Mortality Weekly Report 41,
1–4.
25. Schantz, P.M., Moore, A.C., Muñoz, J.L., et al. (1992) Neurocysticercosis in an Orthodox Jewish com-
27. Ciesielski, S.D., Seed, J.R., Ortiz, J.C., et al. (1992) Intestinal parasites among North Carolina migrant
farmworkers. American Journal of Public Health 82, 1258–1262.

15 Porcine Cysticercosis
Armando E. Gonzalez, Patricia P. Wilkins and Teresa Lopez
Introduction Before development of the enzyme-

linked immunoelectrotransfer blot (EITB),
Porcine cysticercosis visibly affects the qual- serological diagnosis of porcine cysticercosis
ity of pork and results in widespread eco- was hampered by the lack of a reliable test
nomic losses in areas where Taenia solium is to establish previous exposure to T. solium
endemic. The rates of porcine infection are eggs. The EITB, which utilizes purified gly-
variable, but in highly endemic regions, over coprotein antigens, is highly specific and
20% to 42% of pigs may be infected1. Figures more sensitive than either ELISA or tongue
obtained from slaughterhouse inspection examination for the detection of T. solium
generally provide lower levels of infection infection in pigs3,5.
because obviously infected pigs are not Other serological methods have also been
brought to the abattoir for slaughter2. developed for the surveillance, control and
prevention of porcine cysticercosis (reviewed
in Chapters 33 and 34). Glycoproteins puri-
Diagnostics fied from T. solium cysts by isoelectric focus-
ing6, as also four polypeptides found in the
Infection by T. solium in pigs can be detected soluble fraction prepared from T. solium
by one of three methods: necropsy, palpation cysts7, were shown to react with sera from
or visualization of cysts in the tongue, and pigs with confirmed cysticercosis in ELISA
immunological assays to demonstrate either and immunoblot formats. Four antigen
antibodies or circulating antigen. The first is preparations from T. solium and T. crassiceps
not practically useful, as most infected pigs were evaluated for the diagnosis of porcine
are killed in a clandestine manner2. Tongue cysticercosis8–10. These studies found that
examination, although specific, is only mod- antigens from T. crassiceps cyst fluid were
erately sensitive, requires highly trained per- superior to crude extracts prepared from T.
sonnel, is time-consuming and involves the solium. Also, an ELISA that used
risk of being bitten3,4. Immunological assays excretory–secretory antigens, prepared from
appear to be best suited for field surveys. in vitro cultured T. solium cysticerci, was
Pigs can be bled rapidly from the anterior shown to be highly sensitive and specific11.
vena cava, a task that requires less training, The presence of T. solium specific antibod-
and involves less danger than examination ies does not always correlate with the detec-
of the tongue3. tion of parasites at necropsy; often, positive


146 A.E. Gonzalez et al.
serological results are obtained and subse- others, suggesting that maternally trans-
quent necropsy results are negative. D’Souza ferred antibodies may confound results
and Hafeez described that 33.33% of free- obtained by using serological methods15,16.
ranging pigs, in which parasites could not be Subsequently, it was demonstrated that pas-
detected at meat inspection, were positive sive humoral immunity persists in piglets
using ELISA11. This problem affects any anti- born to seropositive sows up to 35 weeks
body-based diagnostic test, including the postpartum4. Infection-specific antibody pat-
highly sensitive and specific EITB assay. terns in the piglets are indistinguishable from
Sciutto et al. reported that antigen and anti- maternally transferred antibody reactions. In
body detection assays showed lower sensi- contrast, new reaction bands produced by the
tivity and specificity when used in pigs that piglet alone most certainly represent a new
were reared in rural environments versus antigenic stimulus, and therefore are pre-
those raised on commercial farms12. These sumed to be the result of new infection14.
data demonstrate that it is not uncommon to Although the presence of antibodies in
detect specific antibody responses in pigs necropsy-negative pigs may, in some ways,
from endemic areas, especially if pigs are limit the use of EITB, the number of bands in
free ranging. A positive serological result in the infected animals suggests that diagnostic
the face of a negative necropsy could occur patterns do not happen at random and that
from either prior effective treatment, past these results may be related to the final infec-
infection that has cleared, or exposure to T. tion outcome (A.E. Gonzalez, unpublished
solium, among other explanations. data).
In the past, when investigators used the A study was designed to answer some of
EITB to diagnose porcine cysticercosis, the these questions to enable a better understand-
problem of passively transferred maternal ing of the EITB results. A total of 482 pigs were
antibodies was recognized as a potential sampled from an endemic area in Huancayo,
source of bias13. The presence of passive anti- in the Peruvian Central Highlands. A total of
bodies hampers the use of cohort studies for 279 pigs were found to be EITB positive. The
porcine cysticercosis because in highly prevalence of seropositive pigs in the area was
endemic villages most piglets must be therefore calculated to be 53.59–62.41%
excluded due to the presence of maternal (95%CI). A subset of 84 from the 279 EITB-posi-
antibodies, which cannot be differentiated tive pigs were bought and necropsied. The
from acquired antibodies. Investigators number of EITB bands and necropsy results
addressed this issue by sampling only pigs were registered by age and have been tabu-
that were older than 3 months. Later, the lated (Table 15.1). The information (Table 15.1)
presence of maternal anticysticercal antibod- was used to develop a stochastic model in a
ies was noted in sentinel pigs that were older spreadsheet (Excel 2000) format using simula-
than 3 months14. Seropositive results that did tion software @risk (Palisade). The probability
not correlate with age were also reported by function of having a necropsy-positive result
Table 15.1. Distribution of necropsy-positive animals by EITB reaction and age.
Age
Number of 8 months 8 months
EITB bands
diagnosed Positive Negative Positive Negative
1–2 7 13 3 15
3 5 7 20 7
4+ 2 1 3 1
Total 14 21 26 23
EITB: enzyme-linked immunoelectrotransfer blot.

Porcine Cysticercosis 147
given a band and age combination was simu- to another, the minimum number of living
lated using distributions. The original 279 cysticerci that could be detected was 88.
positive pigs were also organized by age and Animals harbouring only dead cysticerci
number of bands (Table 15.2). The confidence gave negative reactions and cross-reactions
limits for the number of expected positive pigs were observed with sera infected by other
for each group were simulated using binomial taeniids. The test was also able to detect cir-
distributions that considered the number of culating antigen in sheep and pigs, infected
positive pigs observed in each group and the with T. ovis and T. solium respectively, and in
probability previously calculated. The distri- serum samples of confirmed cases of human
butions above described were then used to cysticercosis18. Another MAb, the HP10, gen-
simulate the number of necropsy-positive pigs erated against a repetitive epitope present on
in each stratum in 500 interactions. The simu- the surface and in excretory–secretory anti-
lation results showed that the mean preva- gens of T. saginata cysticerci was selected for
lence of EITB seropositivity was 28% (90%CI: its ability to detect circulating antigen in a
22–33%) (Fig. 15.1). double antibody sandwich ELISA19. The
Antigen detection assays (reviewed in assay was evaluated in a randomized study
Chapter 34) have also been evaluated in pigs. using control, positive, negative and heterol-
Monoclonal antibodies (MAbs) produced ogous infection sera (A.E. Gonzalez, unpub-
against T. saginata excretory–secretory prod- lished data). Sensitivity and specificity
ucts were unable to detect lightly infected values were calculated using sera (that
animals17. Brandt et al. developed an assay served as control) from 40 necropsy-positive
using two MAbs that recognized antigenic pigs with varying infection burdens and 40
components of T. saginata18. Although the necropsy-negative pigs from non-endemic
sensitivity of the test varied from one animal areas. Cross-reactions were evaluated using
sera from pigs infected with Cysticercus
tenuicollis, hydatid cysts and liver flukes.
Sensitivity was 83% (95%CI: 71–94%) with a
Table 15.2. Frequency of positive pigs by age.
specificity of 88% (95%CI: 77–98%). After
Bands 8 months 8 months grouping positive sera according to infection
burden, it was found that 10 of 15 (67%) sera
1–2 78 47
from mild infections, 10 of 12 from moderate
3 39 75
4+ 15 25
infections (83%) and 13 of 13 from heavy
infections gave positive results. Also, 24 of 27
16
Mean = 0.2790083
Distribution for prevalence/H27
14
12
10
0
0.18 0.23 0.28 0.33 0.38
5% 90% 5%
0.23 0.33
Fig. 15.1. Simulated prevalence of Taenia solium cysticercosis in swine.

sera from pigs infected with C. tenuicollis els of environmental contamination by T.

reacted in the antigen detection ELISA. solium eggs persisted in the village. Whether
Cross-reactions with hydatid, liver fluke and this represented eggs that had survived in
mixed infections (C. tenuicollis and either the soil, or were disseminated by new or
hydatid or liver fluke) occurred with 1 of 13 previously untreated human infection can-
(8%), 0 of 4 (0%) and 25 of 28 (89%) samples, not be determined.
respectively. Although this antigen detection As in Latin America, porcine cysticercosis
assay may be potentially used to monitor caused by T. solium is a widespread infection
treatment and experimental infections, the in Africa in those areas where free-ranging
use of the test is limited to those areas with a pigs wander about in the villages, and are
low prevalence of T. hydatigena infections raised in the traditional way. The reported
(A.E. Gonzalez, unpublished data). prevalences in Zaire ranged from 10% to
30%24. The overall prevalence of porcine cys-
ticercosis found in three slaughterhouses in
Epidemiology Tanzania was 13%25. The prevalence of T.
solium cysticercosis in slaughter pigs was
Field epidemiology studied in the Nsukka area of Enugu State,
Nigeria26. Infection status was diagnosed by
The prevalence and risk factors for T. solium ante-mortem examination of the tongue and
infection in pigs were studied in a rural pop- detailed post-mortem examination of the car-
ulation in Michoacan State, Mexico20–22. casses using standard meat-inspection proce-
Visual inspection of the tongues of 216 pigs dures. Over 20% (483 of 2358) of the pigs
revealed cysticerci in 14 (6.5%). The preva- were found to be positive26.
lence was slightly but not significantly higher
in male (10 of 105) than female pigs (4 of 110).
The most important risk factors for infection An appraisal of the environmental
in pigs were access to human faeces, the pres- contamination by T. solium
ence of an indoor latrine, and indiscriminate
disposal of human faeces around the pig Direct appraisal
owner’s household21,22. Similarly, the seroepi-
demiology of human and porcine cysticerco- A field study performed in Peru showed
sis using an EITB assay was studied in a that it was not possible to demonstrate envi-
Peruvian jungle community23. Sera and ronmental contamination by Taenia eggs
stools were collected from nearly all villagers. using standard techniques23. Five samples of
Those positive for tapeworm eggs or who river water obtained at different points were
were serologically positive were treated. pumped through a 0.1 m nylon filter.
Thirty (8%) of the 371 inhabitants were Water quantity varied between 200 and 400 l
seropositive. After niclosamide therapy, four depending on the amount of sediment pre-
Taenia sp. worms were identified in the EITB sent in the water. In addition, five soil sam-
positive group compared with one in the con- ples were taken near the edge of stool pits or
trols (P=0.06). Pigs were found to be fre- latrines and examined for the presence of
quently infected; 32% had positive tongue Taenia sp. eggs using sedimentation tech-
examination and 43% were positive by EITB. niques. None were positive for Taenia eggs23.
Interestingly, the main risk factor for porcine Likewise, in a study carried out in a rural
cysticercosis was the presence of a latrine in community in Mexico, 400 soil samples and
the house, corroborating the previous report 600 flies were examined for the presence of
from Mexico. Of the households 71% had at Taenia sp. eggs, all with negative results27.
least one EITB positive pig. Two years later, Direct detection of eggs in the environment
a serological survey of pigs less than 1 year is extremely difficult because Taenia sp. eggs
old was able to demonstrate that over 40% are scarce and large amounts of soil must be
of the pigs remained serologically positive23. processed and examined microscopically to
These results strongly suggest that high lev- find a single egg28.

Sentinel pigs pig’s life span rarely exceeds 1 year, whilst

human life span is 60 years on average).
Most cysticercosis intervention programmes Furthermore, the pig is constantly sampling
use human antiparasitic treatment, stool its environment and thus is a very sensitive
examination and human serodiagnosis to indicator of the prevalence of the parasite.
determine disease prevalence, but these meth- Changes in the percentage of infected pigs
ods are generally expensive, slow and diffi- mirror changes in the intensity of environ-
cult to comply with, partly because of cultural mental contamination. Pigs are generally sold
problems associated with obtaining human at less than 1 year of age, therefore, there is a
blood and stool samples29,30. Indicators of suc- regular supply of new, susceptible animals
cess of therapy in village treatment schemes available for study32. Disease acquisition can
have been difficult to measure. Docu- easily be determined, since each year there is
mentation of significant changes in an ideal a new population of pigs.
indicator would best be accomplished by one Twelve 2-month-old piglets from Lima,
which requires a small number of subjects, Peru (a non-endemic area for T. solium cys-
permits sampling at least once a year, is cul- ticercosis) were tested by serum EITB for T.
turally acceptable and feasible to perform in solium antibodies and relocated to Maceda, an
rural communities. The prevalence of neuro- endemic area13. All native 2-month-old piglets
logical symptoms in the human population in Maceda (n=157) were also tested by EITB at
has been claimed to change in a few years the same time. The 12 non-native pigs and 28
after an intervention programme31. However, surviving native pigs were re-tested at 9
there are too many unknown parameters months of age. The dams of 115 of the native
behind this: What proportion of infected piglets were also tested, and these piglets were
humans will have brain cysts?; What propor- evaluated at 5 and 9 months of age. In piglets
tion of these will ever be symptomatic?; What from infected (EITB-positive) sows, reactions
proportion of old infections will become to bands that were different from those of the
apparent years after? Similarly, nothing is yet mother were presumed to indicate new infec-
known about clinical significance and the rate tion. Of the 12 non-native pigs, four (33%) had
of change in the serological status of infected acquired antibody to EITB bands after 9
humans in field conditions. Detection of months, but these bands were rather faint. Of
human taeniasis is difficult because of its low 28 native pigs, 18 (64%) acquired new infec-
prevalence and the poor sensitivity of avail- tion by 9 months of age; 56% (nine of 16) of the
able assays. Testing pigs for infection by serol- initially negative pigs showed antibody bands
ogy fulfils the requirements for consideration and 75% (nine of 12) of the initially positive
as an ideal indicator of the presence of T. native pigs showed new antibody bands.
solium as a whole, both among different hosts, Results indicated a trend for higher infection
and in the environment. Since pigs become rates (though not statistically significant) in
infected only by ingesting eggs from human native pigs. Three years before this experi-
faeces, pig infection rates must, therefore, ment, mass niclosamide chemotherapy had
reflect the relative quantity of T. solium eggs in been given to 93% of the seropositive humans
the environment. Obtaining blood samples in the village of Maceda. At that time, 43% (67
from pigs is acceptable to villagers, and is eas- of 153) of all pigs were EITB positive13. The
ily performed; thus, serodiagnosis in pigs results showed that environmental contamina-
may be a valid and practical way to monitor tion with T. solium eggs was persisting at the
the potential for cysticercosis infection and time of the second study and that niclosamide,
can be used to evaluate the efficacy of control as applied, did not break the cycle of infec-
programmes. Monitoring T. solium transmis- tion and transmission. Furthermore, as pig
sion by evaluating the porcine population is populations were renewed yearly, EITB posi-
more sensitive than sampling human popula- tivity rates in piglets less than 1 year old per-
tions, because porcine prevalence is usually mitted assessment of interventions and
double that of human prevalence. Infection intensity of environmental contamination by
occurs over a much smaller period of time (a T. solium with time2.

The feasibility of using sentinel pigs as a willing either to pay for the service, or
surveillance tool in intervention pro- expose their animals to the risk of confisca-
grammes, as well as an alternative to experi- tion2. Evaluation of environmental contami-
mental infection, was further assessed in two nation by direct detection of T. solium eggs in
trials32. In the first, 51 sentinel pigs were the soil has proved inefficient every time it
exposed to T. solium eggs from February to has been tried. Taenia sp. eggs are rarely
April 1996 (Casacancha) and April to June found in soil or water, or even in sewage-irri-
1996 (Rangra). In the second trial, a total of gated vegetables13,29,30. Tongue examination
38 sentinel pigs were relocated and exposed of pigs will only detect a subset of heavily
in Casacancha during April to June 1997. infected animals, and miss out on infections
Basically, the sentinel pig model consists of outside the tongue3. More importantly,
relocating a group of susceptible pigs from a tongue examination is familiar to villagers,
cysticercosis-free area into an endemic and the decision to bring their pigs for
region. After 3 months of exposure, pigs are inspection may be biased towards bringing
transported to a cysticercosis free area, kept only healthy pigs if they have fear of confis-
for an additional 3-month period to allow for cation, or only those pigs more at risk if they
cysts to achieve full growth, and then killed. feel they can use the service to ‘screen’ their
The infection status is determined by sero- animals2. Serological determination of
logical examination and detailed necropsy32. porcine prevalence is somewhat similar to
The experiments were successful in the sentinel pig model, but has the disadvan-
Casacancha, where over two-thirds of sen- tage of dealing with a population with a fast
tinel pigs were recovered at both opportuni- turn-over and long-lived passive anticys-
ties, but not in Rangra, where only one-third ticercal antibodies4.
of animals were recovered. The low recovery
percentage in Rangra prompted the cancella-
tion of this village in the second experiment. Socio-economic aspects
The overall attack rate for the first trial was
50% (12/24). Ten out of the 12 EITB-positive Economic losses resulting from food-borne
pigs had cysts or cyst scars at necropsy. parasitic zoonoses are difficult to assess.
Apparently, the infection rate was higher in Estimation of the global economic impact of
Rangra (7 of 10) than in Casacancha (5 of 14) these diseases is handicapped by inadequate
in the first trial, but the numbers involved information on the prevalence and public
were small and hence not statistically signifi- health importance of parasitic zoonoses for
cant. The overall attack rate in the second most countries. However, the economic
trial was 55% (16 of 29). Again, almost all the losses due to porcine cysticercosis have been
EITB-positive pigs yielded necropsy-positive estimated for some countries; in these
results (15 of 16). The application of the sen- instances the costs are significant33. In
tinel pig model demonstrated a high level of Mexico, for example, porcine cysticercosis is
environmental contamination in the study responsible for a loss of more than one-half
area in both trials. Currently used monitor- of the national investment in swine produc-
ing tools (slaughterhouse inspection, search tion whereas for all Latin America, porcine
for Taenia eggs in the environment, estima- cysticercosis accounts for an economic loss
tion of porcine cysticercosis by tongue exam- of US$164 million34. Besides, T. solium not
ination or serology, estimation of the only causes severe economic losses to the
prevalence of human taeniasis by stool pig industry but also causes a severe
examination, of human neurocysticercosis zoonotic disease35.
(NC) by clinical screening, or of human cys- Peasants practise pig rearing for short-
ticercosis by serology) would not have per- term savings. Furthermore, they optimize
mitted this demonstration. In Peru, as in the profit of rearing pigs by keeping invest-
other developing countries, pigs do not ment to a minimum. This attitude towards
always go through slaughterhouse inspec- pig rearing explains why pigs range freely to
tion. Even if available, villagers would not be obtain a variety of foods, including human

faeces36. The driving force behind peasants’ and consequent risk assessment in other
practices and attitudes to T. solium is the eco- tropical disorders such as malaria, onchocer-
nomic benefit in the short- and mid-term ciasis and schistosomiasis40–42. Global posi-
periods. People will require an economic tioning satellite technology was used to
incentive for changing their pig-rearing prac- determine the exact position of every house-
tices. Control strategies that fail to recognize hold in a village with sub-metre accuracy40.
the economic significance of pig keeping are After processing, global positioning satellite
unlikely to be successful in controlling T. files were directly exported to a GIS data-
solium. An interesting observation in a rural base for analysis, showing that clusters of
community in coastal Peru illustrates this incident cases are related to tapeworm carri-
point36. Factors responsible for the reduction ers (Fig. 15.2). Although T. solium cysticerco-
in the prevalence of porcine cysticercosis in sis clusters have been previously
this community over a 2-year period were demonstrated using prevalence data, the
studied. The decrease was found to be linked clusters were not as clearly defined as when
to the practice of corralling or tethering of incident cases were studied using the GIS
pigs, which was enforced to protect the technique. Furthermore, the map made evi-
recently introduced rice crop from being dent that not all tapeworms contaminate the
ruined by free-ranging pigs (see Chapter 8). environment. It became clear that careful
Rice cropping was not only more profitable, observation of infection within longitudinal
but also provided by-products to feed the studies provided the most useful informa-
corralled pigs. Therefore, the community tion on transmission dynamics.
agreed to corral their animals. Porcine cys-
ticercosis then decreased because tethering
and corralling indirectly prevented the ani- The marketing of cysticercotic pigs in the
mals from accessing human faeces. Sierra of Peru
In Peru, consumption of pork supplied from

Use of geographic information systems regulated slaughterhouses is primarily
(GIS) to elucidate transmission of porcine restricted to the large cities on the coast.
cysticercosis Approximately 65% of the pork consumed
in the country is obtained through informal
The survival and dispersal in T. solium eggs channels that are not inspected or super-
is believed to be similar to those of T. hydati- vised. The pathways via which pigs are sold
gena and T. ovis37. It has been demonstrated were studied in Huancayo (population:
that although most of the eggs of the latter 500,000; altitude: 3215 m), a major commer-
parasites remain within about 180 m of the cial and agricultural city, 560 km west of
site of deposition, some disperse rapidly in Lima, in the Peruvian Sierra (Central
all directions by means of agents of egg dis- Highlands), where cysticercosis is endemic.
persal, such as birds, wind, rainfall, arthro- Official purchase, slaughter and market
pods, earthworms, the feet of other animals records were reviewed in addition to direct
and blowflies38,39. However, T. solium eggs surveys and participant observation carried
may not require dispersion of eggs to infect out at two informal meat markets in
intermediate hosts. Pigs actively seek and 1988–19892. Based on estimates by the
readily ingest human faeces, thus favouring National Statistics Office, 1988, there were
clusters of cases around tapeworm 35,000 pigs in Huancayo. Of this number,
carriers37. A GIS database was used to inves- 25,000 were butchered every year (c. 1220
tigate the presence of clusters in T. solium tonnes of meat per annum). Officially, none
cysticercosis and examine the relationship of the inspected and condemned meat in
between adult tapeworm carriers and inter- Huancayo was reported to be cysticercotic.
mediate hosts (A.E. Gonzalez, unpublished The two official abattoirs butchered only 18
data). The GIS has been used for spatial pigs in 1988 and none in 1989. The meat sold
analysis of vector habitats and infections in the official market was graded for its

Incident pigs
one
two
Taenia
one
two
House
Road
River
Main square
Other buildings
Ruins
Llacta
100 0 100 200 300 400 500 600 700 800 900
Fig. 15.2. GIS map of a village endemic for Taenia solium cysticercosis depicting location of tapeworms
and incident pigs.
quality and inspected for cysticercosis. No Infected pigs were often bought by buyers
restrictions were placed on the sale of the because of their low price. Buyers men-
meat, based on where or how the carcass tioned that they also examined the pigs’
was obtained. Infected meat was not sold in tongues for scars; sellers would apparently
the official market. At four visits to the mar- excise cysts from the tongue in order to
ket for the purpose of direct observation, increase the market value of the pigs. Based
220 pig carcasses were inspected and only on findings of the tongue examinations per-
two were found to be infected. These car- formed by buyers, approximately 15% of the
casses were then returned to their owner. pigs sold in the live market were considered
Observations were then carried out at two to be infected.
local live pig markets in the area surround- A total of 52 pigs were inspected at six
ing Huancayo. Official pig inspections were informal slaughterhouses. Examination of the
never observed in over ten separate visits to heads and carcasses of these pigs indicated
each fair. Instead, tongue examinations were that seven (14%) had cysticercotic cysts in the
routinely performed by local peasants in an muscles or brain. Interviews with the infor-
attempt to establish the value of the pigs. mal butcher revealed that infected meat was

sold either to another city or for use in fried A novel method for infecting pigs with T.
pork (chicharrones). Infected meat was sold solium using an intramuscular inoculum of
only to selected individuals known to the oncospheres was investigated in a series of
seller. Two processed meat sellers were inter- five experiments in 18 animals49. The first
viewed, both admitted to selling infected experiment evaluated three routes of infec-
meat; small quantities of infected meat were tion: intraperitoneal (IP; n=4), intravenous
mixed with non-infected meat, and the mix- (IV; n=2) and intraduodenal infection (n=1)
ture was then roasted or fried in fat. with either 6000 or 15,000 oncospheres.
Successful infections were obtained follow-
ing IP and IV inoculation. All cysts in IP
Intramuscular Oncosphere Assay inoculated pigs were viable, whilst cysts
(IMOA): a Novel Experimental were either viable or degenerated in IV inoc-
Infection Model to Evaluate ulated pigs. After one IP inoculation, a well-
Chemotherapeutic Agents defined cluster of 35 cysts was found in the
abdominal muscle. It became apparent that
Previously, experimental models for taeniid the injection of oncospheres was accidentally
tapeworms have employed oral challenge of made into the muscle rather than into the
hosts, other than the natural intermediate peritoneal cavity. The results prompted four
hosts (e.g. sheep for T. saginata, SCID mice for consecutive experiments devoted to stan-
Asian Taenia and T. solium, and rodents for T. dardize inoculation site, time to necropsy,
solium) (reviewed in Chapter 4)43–46. Methods and inoculation dose via the intramuscular
other than oral egg challenge, for instance, route and to evaluate the feasibility of oncos-
intramuscular injection of T. saginata oncosphere activation in the intramuscular model.
pheres and subcutaneous T. solium and Asian Histopathologically, the cysts that developed
Taenia oncosphere injection in SCID mice in the IMOA were no different from those
have also been tried. Currently, the evalua- seen with natural infection.
tion of porcine cysticercosis model vaccines is The IMOA model is simple to perform,
requires a minimal number of oncospheres,
limited to pigs infected through the oral route
permits multiple infections per animal, and
because no other experimental model exists.
decreases the variability in the numbers of
However, infecting pigs with eggs or proglot-
cysts recovered, inherent to oral infection
tides requires very large numbers of infective
models. The direct injection technique is sim-
eggs and results in unpredictable numbers of
ple and reproducible. It produces relatively
cysts. No more than 21 cysts were found in
constant levels of infection with the same
any of the pigs when infected with three
inoculum in different pigs. Also the number
gravid proglottides in one experiment47. In
of cysts produced is relatively large so that
another Mexican study, oral challenge with
differential effects can be easily observed. In
105 eggs eventually produced from four to
contrast, an intestinal model permits only
212 cysts per pig48. The poor yield may be one inoculum per test pig and produces
due to variations in intestinal transit times, marked variation in the number of animals
which might affect the dissolution of the infected and in cyst numbers. Thus, the
eggshell. Furthermore, obtaining T. solium IMOA may be a valuable tool to evaluate
with gravid proglottides is not easy since therapeutic agents or potential vaccines for
standard therapy with niclosamide or prazi- porcine cysticercosis.
quantel often destroys the proglottid. In addi- Immunity to T. solium was investigated
tion, each experiment requires the use of using the IMOA model in a series of experi-
25,000–100,000 eggs to obtain reasonable ments (M. Verastegui, A.E. Gonzalez, R.H.
infection. The large number of eggs required Gilman et al., unpublished observations).
for each animal restricts studies to a small Three naturally infected pigs were treated
number of animals. These limitations of the with oxfendazole and then inoculated with
oral model have prevented its widespread oncospheres using the intramuscular route
use in vaccine and therapeutic trials. 3 months after treatment. None of the

treated pigs developed cysts after intramus- cysticercosis in pigs: tongue inspection and
cular inoculation, while the three unin- palpation, meat inspection in abattoirs and
fected, untreated, control pigs developed serum EITB. The last of these has been found
intramuscular cysts following inoculation, to be most sensitive, specific, safe and eco-
confirming that successful treatment with nomical. The prevalence of porcine cysticer-
oxfendazole provided immunity against cosis in a population at any given time has
further challenge. In a second experiment, been shown to be a sensitive indicator of the
two pigs were injected with oncospheres current levels of T. solium in that population.
once a week, at different sites. No new cysts The sentinel pig model has been found to be
developed after the second injection in particularly useful in this regard. Briefly, it
these pigs. In a third study, two groups of involves translocation of pigs from a cys-
three pigs each were immunized with crude ticercosis-free zone to an endemic zone for 3
T. solium oncosphere and metacestode anti- months and then back to the former for
gens, respectively, and subsequently inocu- another 3 months. Porcine infection rates are
lated intramuscularly with oncospheres. determined at the end of 6 months; they
Immunization with crude oncosphere anti- indicate levels of T. solium infection in the
gens induced 100% protection, whilst endemic community.
metacestode antigens provided partial pro- Porcine cysticercosis not only poses
tection to oncosphere challenge since ani- health hazards to humans but is a major
mals immunized with this antigen produced cause for economic loss to pork-producing
some, albeit degenerated, cysts. These farmers since the price of infested pork is
results are similar to other studies where considerably less than that of healthy pork.
immunization with metacestode extracts did Therefore, control of porcine cysticercosis
not appear to provide complete protection accrues not only health-related but also
against cysticercosis (see Chapter 3). financial benefits. The viewpoint that only
those control measures that provide eco-
nomic benefits are likely to be successfully
Conclusions implemented is presented. However, for the
present, most cysticercotic pigs bypass offi-
The study of the epidemiology of porcine cial meat inspection channels in developing
cysticercosis has now provided important countries; this is a major cause for concern
insights in to the burden and control of T. to all involved in initiatives to control T.
solium infection. Three methods are available solium infection through strategies targeting
for the determination of the prevalence of the pig.
References
1. García, H.H., Gilman, R.H., Gonzalez, A.E., et al. (1999) Epidemiology of Taenia solium infection in
Peru. In: García, H.H., Martinez, S.M. (eds) Taenia solium Taeniasis/Cysticercosis. Editorial Universo,
Lima, Peru, pp. 297–306.
Bulletin of World Health Organization 71, 223–228.
in porcine Taenia solium cysticercosis. American Journal of Tropical Medicine and Hygiene 86, 113–118.
5. Tsang, V.C.W., Brand, J., Boyer, E., et al. (1989) Enzyme-linked immunoelectrotransfer blot assay and
glycoprotein antigens for diagnosing human cysticercosis (Taenia solium). Journal of Infectious
Diseases 159, 50–59.
6. Pathak, K.M., Allan, J.C., Ersfeld, K., et al. (1994) A western blot and ELISA assay for the diagnosis of
Taenia solium infection in pigs. Veterinary Parasitology 53, 209–217.

8. Nunes, C.M., Biondi, G.F., Heinemann, M.B., et al. (2000) Comparative evaluation of an indirect
ELISA test for the diagnosis of swine cysticercosis employing antigen from Taenia solium and Taenia
crassiceps metacestode. Veterinary Parasitology 93, 135–140.
9. Pinto, P.S., Vaz, A.J., Germano, P.M., et al. (2000) ELISA test for the diagnosis of cysticercosis anti-
gens of Taenia solium and Taenia crassiceps. Revista do Instituto de Medicina Tropical (São Paulo) 42,
71–79.
10. Pinto, P.S., Vaz, A.J., Germano, P.M., et al. (2000) Performance of an ELISA test for swine cysticerco-
sis antigens of Taenia solium and Taenia crassiceps. Veterinary Parasitology 88, 127–130.
11. D’Souza, P.E., Hafeez, M. (1999) Detection of Taenia solium cysticercosis in pigs by ELISA with an
excretory-secretory antigen. Veterinary Research Communications 23, 293–298.
12. Sciutto, E., Aluja, A., Fragoso, G., et al. (1995) Immunization of pigs against Taenia solium cysticerco-
sis: factors related to effective protection. Veterinary Parasitology 60, 53–67.
14. Sakai, H., Sone, M., Castro, D.M., et al. (1998) Seroprevalence of Taenia solium cysticercosis in pigs in
a rural community of Honduras. Veterinary Parasitology 14, 233–238.
15. Sciutto, E., Martinez, J.J., Villalobos, N.M., et al. (1998) Limitations of current diagnostic procedures
for the diagnosis of Taenia solium cysticercosis in rural pigs. Veterinary Parasitology 79, 299–313.
16. Geerts, S., Kumar, V., Mortelmans, J. (1981) Sheep as an experimental model of Taenia saginata cys-
ticercosis. Tropical Animal and Health Production 13, 37–40.
17. Harrison, L.J.S., Parkhouse, R.M.E. (1985) Antigens in taeniid cestodes in protection, diagnosis and
escape. Current Topics in Microbiology and Immunology 120, 159–172.
18. Brandt, J.R., Geerts, S., De Deken, R. (1992) A monoclonal antibody-based ELISA for the detection of
circulating excretory-secretory antigens in Taenia saginata cysticercosis. International Journal of
19. Harrison, L.J.S., Joshua, G.W., Wright, S.H., et al. (1989) Specific detection of circulating/secreted
glycoprotein of viable cysticerci in Taenia saginata cysticercosis. Parasite Immunology 120, 159–172.
20. Sarti, E., Schantz, P., Aguilera, J., et al. (1992) Epidemiologic observations on porcine cysticercosis in
a rural community of Michoacan State, Mexico. Veterinary Parasitology 41, 195–201.
niasis and cysticercosis in a rural village of Michoacan State, Mexico. Transactions of the Royal Society
22. Sarti, E., Schantz, P., Plancarte, A., et al. (1992) Prevalence and risk factors for Taenia solium taeniasis
24. Chartier, C., Mutesi, U., Ndakala, N.O. (1990) Helminths of domestic pork in Ituri, Upper Zaire.
Annales de la Societe Belge de Medicine Tropicale (Brussels) 70, 213–225.
25. Bao, M.E., Bogh, H.O., Kasuku, A.A., et al. (1995) The prevalence of Taenia solium metacestodes in
pigs in northern Tanzania. Journal of Helminthology 69, 270.
26. Onah, D.N., Chiejina, S.N. (1995) Taenia solium cysticercosis and human taeniasis in the Nsukka area
of Enugu State, Nigeria. Annals of Tropical Medicine and Parasitology 89, 399–407.
27. Keilbach, N.M., De Aluja, A.S., Sarti, E. (1989) A programme to control taeniasis-cysticercosis (Taenia
solium): experiences in a Mexican village. Acta Leiden 57, 181–189.
30. Sarti, E., Schantz, P.M., Avila, G., et al. (2000) Mass treatment against human taeniasis for the control
of cysticercosis: a population-based intervention study. Transactions of the Royal Society of Tropical
31. Fernandez, M., Gutierrez, A. (1986) Como son las Comunidades de la Zona Intermedia del Valle del
Montaro, La Gardenia. Serie Comunidades, Lima, Peru, 50 pp.

32. Gonzalez, A.E., Gavidia, C., Falcon, N., et al. (2001) Sentinel pigs to monitor Taenia solium transmis-
sion in the Peruvian highlands. American Journal of Tropical Medicine and Hygiene 65, 31–32.
33. Murrel, K.D. (1991) Economic losses resulting from food-borne parasitic zoonosis. Southeast Asian
34. Acevedo-Hernandez, A. (1982) Economic impact of porcine cysticercosis. In: Flisser, A., Willms, K.,
Laclette, P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New
York, pp. 63–68.
35. Gonzalez, A.E. (1977) Evaluation of a Control Programme for Taenia solium Cysticercosis Targeting
Human and Porcine Health. PhD thesis. University of Reading, Reading, UK.
36. Gilman, R.H., García, H.H., Gonzalez, A.E., et al. (1999) Short cuts to development: methods to con-
trol the transmission of cysticercosis in developing countries. In: García, H.H., Martinez, S.M. (eds)
Taenia solium Taeniasis/Cysticercosis. Editorial Universo, Lima, Peru, pp. 313–326.
37. Gemmel, M.A. (1999) Current knowledge of the epidemiology of the family Taeniidae: operational
research needs in planning control of Taenia solium. In: García, H.H., Martinez, S.M. (eds) Taenia
solium Taeniasis/Cysticercosis. Editorial Universo, Lima, Peru, pp. 219–244.
38. Lawson, J.R., Gemmell, M.A. (1985) The potential role of blowflies in the transmission of taeniid
tapeworm eggs. Parasitology 91, 129–143.
39. Lawson, J.R., Gemmell, M.A. (1990) Transmission of taeniid tapeworm eggs via blowflies to inter-
mediate hosts. Parasitology 100, 143–146.
40. Hightower, A.W., Klein, R.E. (1995) Building a geographic information system (GIS) public health
infrastructure for research and control of tropical diseases. Emerging Infectious Diseases 4, 156–157.
41. Malone, J.B., Huh, O.K., Fehler, D.P., et al. (1994) Temperature data from satellite imagery and the
distribution of schistosomiasis in Egypt. American Journal of Tropical Medicine and Hygiene 50,
714–722.
42. Richards, F.O. (1993) Use of geographic information systems in control programs for onchocerciasis
in Guatemala. Bulletin of the Pan American Health Organization 27, 52–55.
43. Gemmell, M., Matyas, Z., Pawlowsky, Z., et al. (1983) Guidelines for Surveillance and Control of
Taeniasis/Cysticercosis. VPH/83.49. World Health Organization, Geneva, Switzerland, pp. 1–207.
44. Froyd, G., Round, M.C. (1960) The artificial infection of adult cattle with Cysticercus bovis. Research in
Veterinary Science 1, 275–282.
45. Ito, A., Ito, M., Eom, K.S., et al. (1997) In vitro hatched oncospheres of Asian Taenia from Korea and
Taiwan develop into cysticerci in the peritoneal cavity of female scid (severe combined immunodefi-
ciency) mice. International Journal of Parasitology 27, 631–633.
46. Ito, A., Chung, W.C., Chen, C.C., et al. (1997) Human Taenia eggs develop into cysticerci in scid mice.
47. Pathak, K.M., Gaur, S.N. (1990) Immunization of pigs with culture antigens of Taenia solium.
Veterinary Parasitology 34, 353–356.
48. Nascimento, E., Costa, J.O., Guimaraes, M.P., et al. (1995) Effective immune protection of pigs
against cysticercosis. Veterinary Immunology and Immunopathology 45, 127–137.
49. Verastegui, M., Gonzalez, A., Gilman, R.H., et al. (2000) Experimental infection model for Taenia
solium cysticercosis in swine. Veterinary Parasitology 20, 33–44.

Singh Chapter 16 17/9/02 12:01 pm Page 157
16 Taenia solium: a Historical Note
Noshir H. Wadia and Gagandeep Singh
The farther backwards you look, the farther forwards you can see.
Winston Churchill
Introduction and tapeworms and their treatment.

However, Flisser believes that the tape-
The amazing incongruities and controversies worms were of the beef Taenia sp. because
of Taenia solium cysticercosis make sense once the Egyptians never ate pork2.
we understand the origins of the knowledge Infestation of pork with bladderworms
regarding the disorder and the parasite. The were known to ancient Greeks as well, as is
authors of this chapter have attempted to apparent from mention of measled pork in
trace early knowledge about the pathogen, T. the History of Animals written by Aristotle
solium and its biological behaviour that then (384–322 BC)3. However, the Greeks did not
led to realization of the malady it caused and appreciate the helminthic origin of measled
its treatment. The essay consists of random pork. A reference to cysticercosis was per-
notes and is not intended to be a comprehen- haps made by Aristophanes in his comedy,
sive and complete review of the history of T. The Knights, in the 5th century BC. In the
solium cysticercosis. play, a slave mentioned examining another
person’s tongue in the same way as one
would examine a pig’s tongue to see if he
Early Historical Impressions was ‘measled’. Further down in history,
Pliny (AD 25–79) was perhaps the first to use
Among the earliest references to tapeworms the term, ‘Taenia’2. Arabian physicians
are the works of ancient Egyptians that date around AD 1000 classified parasitic heminths
back to almost 2000 BC. Evidence that the into longworms, tapeworms, roundworms
Egyptians were aware of the existence of and smallworms2,4. It is believed that their
tapeworms is available from the study of the concept of tapeworm was actually one of a
Eber’s papyrus, a written documentary of chain of worms, each represented by what
the Egyptian perception of maladies of a we now know to be individual
non-surgical nature and their medical as proglottides2. They named these ‘individual
well as mystical treatment1. Indeed, there worms’ as ‘cucurbitini’, a name derived
are several references to the existence of from their resemblance to cucumber seed
worms, including perhaps, schistosomes but also significant because cucumber seeds

158 N.H. Wadia and G. Singh
constituted a herbal remedy for intestinal For a detailed account of the developments
taeniasis. References to intestinal parasitism in classification and nomenclature of tape-
also appear in the Chinese Yellow worms, the reader is referred to Mönnig
Emperor’s Canon of Medicine written in 200 (1950)7. The unravelling of the structure of
BC5. More specifically, Chao alluded to Taenia the tapeworms is credited to several workers
in his Etiology and Symptoms of Diseases in AD including Edward Tyson (AD 1650–1708),
6106. The ancient Indian treatise on medi- Karl Asmund Rudolphi (AD 1771–1832) (Fig.
cine, the Charaka Samhita also mentions 16.1a) and P.J. van Beneden. Carl Linnaeus
worms and specifically flatworms, which (AD 1707–1778) (Fig. 16.1b) described the
are broad, white and tape-like. At one place, taxonomy of tapeworms, assigning the
it states that worms (in general) can cause genus Taenia for all types of tapeworms in
maladies of the head, where they may be his work Systema Naturae8–10. In 1782, Goeze
observed. However, seizures are not men- published Versuch einer Naturgeschichte de
tioned as a symptom of this malady and Eingeweidewurmer hierischer Korper and clas-
there is no reference to pork or meat as a sified tapeworms on the basis of Linnaeus’s
causative agent in the chapter on epilepsy. It nomenclature11. He also put forward the
is thus conjectural if cysticercosis existed in theory that tapeworms could be inherited.
ancient India. Rudolph Leuckart (AD 1822–1898) (Fig. 16.1c)
made notable contributions to the study of
science of tapeworms. Significant among
Beginnings of the Modern them were the recognition of facts that T. sag-
Understanding of the Biology of inata occurred only in cattle and T. solium in
T. solium the pig12. He and Rudolph Virchow were
instrumental in the realization of meat
The classification of tapeworms inspection laws in Germany in the latter part
of the 18th century. He also published a
Records of modern attempts at understand- series of ‘Wandtafeln’ (wall charts) depicting
ing the biology, life cycle, morphology and the morphology of tapeworms among sev-
nomenclature of tapeworms date to AD 1600. eral other animal species (Fig. 16.2).
(a) (b) (c)

Fig. 16.1. (a) Karl Asmund Rudolphi (1771–1832). (Source: Parasitology 1921, Vol. 13, Cambridge
University Press, Cambridge, UK. Reproduced with permission.)
(b) Carl Linnaeus (1707–1778).
(c) Rudolph Leuckart (1822–1898). (Source: Marine Biological Laboratories. Reproduced with permission.)

T. solium: a Historical Note 159
Fig. 16.2. Wall chart (Wandtafeln) of Rudolph Leuckart, depicting flatworms. (Source: Marine Biological
laboratories. Reproduced with permission.)
The link between adult and larval forms of 158814. None of the early workers recognized
tapeworms the link between adult tapeworms and cys-
ticercosis. In fact, Goeze segregated tape-
The earliest description of cysticercosis was worms into two different classes, T. visceralis
by Paranolus in 1550, who described vesicles (cystic forms) and T. intestinalis (worm-like
in the corpus callosum13. Rumler detected forms) based upon whether they were cystic
cysts in the dura mater of an epileptic in or worm-like in morphology11. Thus, while

he appreciated the proximity of relationship 1902, Volovatz published an account of 414

between cystic tapeworms and adult tape- patients with cysticercosis. Vosgein described
worms, he did not sense the fact that they clinical features in 807 affected individuals
were different stages of the same helminth. comprising mostly French soldiers who had
Zeder (AD 1800) was probably the first to use lived overseas in his thesis, ‘Le Cysticercus cel-
the term, ‘Cysticercus’ (cystis: bladder; cer- lulosae chez l’homme et chez les animmaux’22.
cos: tail (Greek)), for the larva of T. hydatigena, According to Brumpt, the distribution of cys-
the dog tapeworm. Again, he believed that ticerci in the human body in Vosgein’s series
the ‘Cysticercus’ was a distinct genus15. was as follows: ocular – 46%; central nervous
Much of the credit for establishing a link system – 40%; skin – 6%; and muscle – 3%23.
between adult tapeworms and ‘Blasenwürmer’ Later, Henneberg in 1912, described clinical
or bladderworms goes to Freidrich features and evolved a classification based
Küchenmeister, a German gynaecologist16,17. upon strictly compartmentalized clinical fea-
Around 1850, he performed a series of experi- tures, including generalized (actually referred
ments first on dogs and then on imprisoned to as ‘essential’) epilepsy, focal epilepsy, neu-
human convicts. In his preliminary experi- ropsychiatric presentations, intraventricular
ments, he fed bladderworms from rabbits to cysticercosis, meningeal cysticercosis, spinal
dogs and demonstrated the subsequent devel- cysticercosis and asymptomatic cysticercosis.
opment of the adult tapeworm, T. pisiformis in
dog intestine. Subsequently, he extended his
experimental design to humans awaiting exe- Taenia solium: the British Military
cution in a German prison, whom he fed with Connection
bladderworms from infested pigs. Upon
autopsy after execution of the death sentence, In the 1930s, interest in the study of human
he detected the presence of developing and cysticercosis was aroused by several British
adult tapeworms in the intestines. military doctors at the Queen Alexandria
Küchenmeister’s work was criticized Military Hospital, Millbank, London, includ-
from several quarters on account of the ing Colonel (later Lieutenant General)
ethics of the nature of his experiments and William Porter MacArthur (1884–1964) and
the validity of his conclusions. For instance, Colonel (later Brigadier) Henry Byran Frost
von Siebold maintained that cysticerci were Dixon (1891–1962)24–31. At that time, Queen
tapeworms with hydropically degenerate Alexandria Hospital was a specialist military
bodies, which developed in an abnormal facility dealing with infirmity of civilian
host4. He however agreed that bladder- nature in army personnel and their families.
worms in pigs develop from tapeworm eggs Trauma was therefore not a priority here,
and were not foreign bodies, as was the pre- and a variety of non-war related ailments
vailing view at that time18,19. Grove describes including epilepsy were observed here.
the crossfire on the issue of ethics of MacArthur first noticed a high rate of
Küchenmeister’s work in detail20. seizures due to cerebral cysticercosis among
soldiers returning after military placements
in India. He thus wrote24: ‘About 100 soldiers
Early clinical impressions are yearly discharged from the army for
epilepsy; during 1933 twenty cases of cys-
In the latter part of the 18th through to the ticercosis were identified at Millbank.’
early part of the 19th century, there were spo- MacArthur published his landmark paper,
radic descriptions of T. solium cysticercosis. ‘Cysticercosis as seen in the British army,
Virchow described racemose cysticercosis in with special reference to the production of
his paper entitled ‘Traubenhydatiden der epilepsy’ in 193425. Sir Hamilton Fairley’s
weichen Hirnaut’ in 186021 (Figs 16.3a, b). remarks on the title of the paper were expli-
Griesenger, a German psychiatrist, wrote an catory27: ‘The title may suggest that this dis-
account in 1862 of neurocysticercosis (NC) ease is peculiar to Army, but MacArthur’s
with emphasis on the seizure disorder. In experience was limited to the Army.’

(a) (b)
Singh Chapter 16
17/9/02
12:01 pm
Page 161
T. solium: a Historical Note
Fig. 16.3. (a) Cover of the journal that contains Rudolph Virchow’s landmark article ‘Traubenhydatiden der weichen Hirnaut’, believed to be the first description of racemose
cysticercosis. (Source: Clendening Library of the History of Medicine, Kansas University Medical Center, USA. Reproduced with permission.) (b) Diagrammatic description of the
161
pathology of racemose cysticercosis by Virchow. (Source: Clendening Library of the History of Medicine, Kansas University Medical Center, USA. Reproduced with permission.)
Indeed, an overwhelming majority of ova were being passed by native servants

cases of cerebral cysticercosis were drawn employed in the barracks; but as I have said
from the Army and included personnel before, I do not think that even this class of
who were deputed to India, implying that Indian will eat the flesh of the village pig.
cysticercosis was acquired from exposure Mackie’s views were confirmed by sev-
to T. solium through food during their stay eral subsequent observations by Dixon and
in India. Even at that time, T. solium infesta- his colleagues who noted that the disorder
tion was extremely rare in native Britons. occurred exclusively in corporals and pri-
One redeeming aspect of cerebral cysticer- vates, many of whom were cooks and that
cosis was that British military provisions the officers were mostly spared. He went on
enabled soldiers discharged from duty on to advise that the incidence of T. solium infec-
account of seizures with a diagnosis of cys- tion should be ascertained in Indians, espe-
ticercosis to a disability pension. In this cially the barracks’s servants, through the
regard, the following impressions of records of hospitals and laboratories around
MacArthur are noteworthy25: military establishments; unfortunately this
Although the diagnosis benefits the man does not seem to have been done.
himself but little, the presence of cysticerci The remarkable British papers have been
gives him material gain when it has been quoted somewhat extensively as they reflect
caused by service abroad, it gives him great indirectly on the status of the infection in
mental ease when he can be reassured that India then and have much relevance to the
there is no chance of epilepsy appearing in his conditions prevailing even today. Though
children and when mental deterioration cysticercosis was documented in large num-
necessitates his certification as insane it carries
bers among the British military, reports in
to his relatives no slur of familial lunacy.
Indian natives were few in comparison, per-
haps reflecting different eating habits of the
Insights into the transmission of two. Nevertheless, it is quite evident that
T. solium cysticercosis must have been prevalent in
India in the 19th century. Since there is no
Mackie’s comments on MacArthur’s presen- earlier record, it remains conjectural as to
tation on cysticercosis in British troops sta- when it first appeared. Was it brought by the
tioned in India reflect his perceptive views pork-eating European conquerors, when
on the transmission of disease from pig to they arrived in the 15th to 17th centuries,
man. He stated: when cysticercosis was known to be preva-
lent in Europe? Or did traders and travellers
The clinical histories of the cases referred to
introduce it across the Chinese borders?
seemed to show that most of the patients were
infected in India and, granted that this appears After all, predominant vegetarianism and a
to be probable, one would like to know more taboo against eating pork and rearing pigs,
about the methods of transmission from the especially during Mogul rule, was the pre-
pig to man. Pig meat in any form is a very vailing practice in India.
unusual article of diet in India… Very low caste
Hindus and outcasts and some jungle tribes eat
pig flesh but even then it is generally wild pig Cysticercosis: the clinical disorder
and not domestic animal. The most likely
source of infection for the rank and file is the It is said that in the early days of
cheap eating houses in the bazaars run by MacArthur’s investigations, it was difficult
Eurasian or low caste Hindus, where locally
to convince the medical profession that
killed pig meat may occasionally be served.
such a condition as cysticercosis ever
The soldiers referred to by Colonel MacArthur
must obviously be infected either from the existed, but subsequently the pendulum
adult T. solium, which they themselves were swung to overdiagnosis. Scores of reports of
harbouring or from someone in close contact cerebral cysticercosis were made around
with them or concerned in the preparation of this time (Fig. 16.4)24–31. In one such report,
their food. The presumption is, then, that the Dixon remarked28: ‘These two cases illus-

Unless evidence of cysticercosis is

systematically sought for, the diagnosis may be
missed, as the subcutaneous nodules which are
suggestive of the disease may be absent of
examination, only to come out in crops at a
later date, remaining for a varying period of
time and then disappearing, and radiological
evidence may not be convincing for some years
as calcification does not usually take place until
some four or five years after infestation.
Every case suspected of cysticercosis should
be re-examined at six-monthly or yearly
intervals for the presence of subcutaneous
nodules and calcification of the soft parts.
The observations of the British workers

had an impact upon the understanding of
the pathogenesis of the disease. For instance,
MacArthur wondered why ‘new’ subcuta-
neous cysts appeared over so many years,
even when the source of infection was no
more present. He showed that the so-called
new cysts were all tense and contained dead
larva and propounded that living cysts were
flaccid and not easily palpable, but with
impending death they became turgid and
tense. In fact, they were not ‘new’ but ‘old’.
He also extrapolated that allied changes
must be affecting the cerebral parasites,
explaining the long delay in the onset of neu-
rological symptoms after the first subcuta-
neous nodule could be palpated. It was
believed that living cysticerci caused little
nervous disturbance unless lodged in large
Fig. 16.4. Cover of the landmark publication,
numbers in ‘some responsive centre’. Indeed,
Cysticercosis: An analysis and follow-up of 450
cases by H.B.F. Dixon and F.M. Lipscomb published
MacArthur maintained that the varied clini-
in 196131. (Source: Wellcome Library for the History cal presentation could be explained on the
of Medicine, London. Reproduced with permission.) basis of the location of the cysticerci. It was
realized that cysticercosis could remain
asymptomatic for prolonged periods of time.
The recognition of the incubation period, i.e.
trate how necessary it is to view with suspi- the period of time that elapsed between
cion all alleged idiopathic epilepsy occur- infection with the larval stage of T. solium
ring in soldiers, aged 24 to 26, who and the onset of symptoms of cysticercosis,
suddenly develop fits in the later years of was also a derivation from these initial stud-
their service overseas.’ ies30–32. The time of initial infection could be
The clinical studies carried out at confidently estimated from study of records
Millbank were significant in that they clari- of military placements in India, upon an
fied several important aspects of the clini- assumption that T. solium infection was
cal behaviour of the disorder. The acquired in India alone, especially since the
following observations of Dixon and T. solium did not occur in Britain. The incu-
Smithers exemplify several of such out- bation period so inferred varied between a
standing observations30: few months and 20 years. This was a signifi-

cant finding because in several of the subse- resonance imaging (MRI) in the present
quent series of cysticercosis that followed day era, would have been missed. We
these initial studies and were published from now know that solitary or few cysts36 are
endemic areas of Brazil and Mexico, it was far more common than multilesional-
not possible to determine the incubation disseminated cysticercosis37; the former
period, because in endemic regions exposure carry a good prognosis in comparison to
could have occurred at any time33,34. Finally, heavy, multiple cysticercosis.
the fact that symptoms of cerebral cysticerco-
sis were related to degeneration of larvae
was also appreciated: Serodiagnosis of T. solium cysticercosis
These parasites cause little disturbance in the
early stages, and the patient may live for years Weinberg in 1909 was the first to use the
with numerous cysts in both cerebral complement fixation test on the serum of
hemispheres. After their death, however, the cysticercotic pigs38. In 1910, Robin and
parasites may cause symptoms partly by their Fiessenger first performed the test upon
toxic effects and partly by their increase in size. humans. Other notable contributions so far
(Dixon and Smithers, 193430) to the serological diagnosis of cysticercosis
Early studies, particularly by MacArthur, have been those of Rothfeld39, Biagi and
pictured a uniformly dismal prognosis of the Tay40, and Neito41. Studies at this stage were
disorder, with virtually every case ending up not optimistic about the role of serological
in lunacy and leading to death24–26. Dixon studies in the clinical context, though Neito
and Hargreaves disagreed with MacArthur’s reported excellent results of his lengthy and
view and remarked31: remarkable set-up with the complement fixa-
tion tests in the spinal fluid41.
Our observations have not borne out the view Serological confusion compounded clini-
of MacArthur, who believed that the general
cal confusion with neurosyphilis, an impor-
tendency was one of retrogression, as
tant disorder in the early part of the 19th
evidenced by signs of mental deterioration
which might be so marked so as to necessitate century. In an account of one such confusion,
institutional segregation. Castellani described the occurrence of subcu-
taneous nodules, a positive Wasserman’s
When MacArthur reviewed Dixon and reaction in the serum and response to anti-
Hargreaves’s paper in the Tropical Diseases syphilitic treatment in three persons under
Bulletin he countered35: the name, ‘luetic pseudo-cysticercosis’41,42.
In my experience, relapse has followed
symptom free intervals which had lasted for
10, 13, and 20 years. I believe that when a long Radiology
remission occurs, one can but wait and hope
for the best, while cautiously remembering the According to Grove, the earliest roentgeno-
scriptural injunction, ‘Judge none blessed logical description of dead cysticerci was by
before his death.’
Roth in 192620,43. Broughton-Alcock and
The reason why early workers inferred a Weinbren described muscle calcification
discouraging outcome can now be related to picked up incidentally on a radiograph of a
the lack of availability of contemporary meth- gunshot wound44. They compared radiologi-
ods of diagnosis. The diagnosis of cysticerco- cal appearances of calcification due to dead
sis was based upon histology from excised cysticerci with those of Trichenella spiralis in a
subcutaneous cysts or radiology depicting radiograph of a post-mortem specimen of
soft tissue calcification/s. Obviously, only the muscle obtained from Sir Arthur Keith. They
most severe forms were diagnosed by these found that calcifications of Taenia solium were
archaic tools. On the other hand, benign larger than those of Trichenella spiralis. Major
oligolesional forms like those due to a solitary contributions on the radiology also came
or few cysts that would be easily picked up from Morrison45 and Brailsford46,47. It was
on computed tomography (CT) or magnetic recognized that cerebral calcification was

less common and appeared later than muscle aracae)6,52. Other remedies used in the early
calcification and if the soft tissue radi- part of the last century included ‘betel nut’
ographs did not reveal calcifications, skull boiled in water, tetrachloroethylene, thymol,
roentgenograms rarely contributed to the carbon tetrachloride and hexylresorcinol51–57.
diagnosis. Brailsford was eloquent in his Thus Allan in 191255 and Carman in 193156
opinion on the role and limitations of reported the use of thymol and carbon tetra-
roentgenography47: chloride respectively. In the 1930s through
Radiography permits of the diagnosis of 1950s, filix mas and carbon tetrachloride were
cysticercosis when the parasites have most often used for the treatment of tape-
degenerated and calcified but affords no help worms. With both remedies, prior starvation
in the earlier years of infestation. … Actually it and subsequent purgation was advocated.
is rare to obtain radiographic evidence of For 2 days before the administration of filicis
cysticerci in the brain in patients with liquidum, the individual was fed upon a liq-
symptoms of central nervous system disease. uid diet consisting of orange juice and dex-
… In the later years, when symptoms have as a
trose. Following the active drug, a saline
rule ceased, radiography for other reasons may
reveal the calcified parasites.
purgative was administered. Castor oil was
specifically contraindicated as it dissolved the
In 1945, Arana and Asenjo published a filix mas and led to intoxication. The stools
landmark paper on the ventriculographic obtained following the purge were sieved and
diagnosis of posterior fossa cysticercosis examined against a black background to iden-
from Santiago, Chile48. Incidentally, tify the head of the tapeworm. The identifica-
MacArthur expressed surprise over the tion of the head of the tapeworm was taken to
authors’ observations and commented49: be an indicator of successful taeniacidal ther-
It looks, therefore, as if the commoner types apy. If the head was not passed, treatment
which would bring the above more into their was repeated and, if still unsuccessful, a duo-
proper proportions may not be coming to denal tube was passed and the drugs were
light. Perhaps the explanation is that only infused directly through the tube. However, it
patients supposed to be suffering from a was soon recognized that these chemicals
cerebral tumour were sent to the institute
were associated with severe toxicity, primarily
for investigation.
renal and hepatic.
In the 1940s and 1950s, attention focused
on the use of atarabine as a taeniacidal
The Search for an Effective Treatment agent57–59. Though anecdotally this drug
proved to be effective, its major limitations
The history of the search for effective treat- were the side effects of severe vomiting and
ment for taeniasis and cysticercosis is as old encephalopathy. Vomiting was prevented by
as the recognition of tapeworms and cys- the concomitant administration of largactil
ticerci. The oldest remedies were the herbal or by intraduodenal administration of atara-
remedies used, for instance, by the ancient bine. Delirium was treated by the concomi-
Egyptians and Chinese. One can find men- tant administration of phenobarbitone
tion of the use of herbs such as Acacia nilotica (phenobarbital).
and Aloe vera for treatment of worms in the While in the early part of the 19th century
Egyptian papyri1. Similarly, a fungus, several efforts were made to develop an
‘Raigan’ (Omphalia lapidescens), that grows on effective taeniafuge, similar drives for the
bamboo, has been used by the Chinese as an development of anticysticercal agents were
anthelminthic for nearly 2000 years50. not evident. In fact, in a discussion on
One of the early remedies for the tape- MacArthur’s paper25, Sir Hamilton Fairley
worm was an extract of the male fern, pointed out that according to Colonel
Dryopteris filix-mas, the active medicament of MacArthur’s description, the cysticerci
which was filix mas51. Other important reme- should be kept alive as long as possible; spe-
dies included the ground seeds of Cucurbita cific drug therapy was contraindicated27.
moschata (pumpkin) and Areca catecho (semen Similarly Dixon and Smithers stated29:

There is no known treatment for the established to us that the only surgical operation justi-
disease, in fact the administration of such fied is decompression in order to save sight.’
substances as Tartar emetic have in some cases
produced an exacerbation of symptoms or a
fresh crop of palpable nodules, presumably by
Conclusions
causing the death of more parasites.
Thus the fact that specific chemotherapy In about 1969, a United States General
of larvae could cause exacerbation of symp- remarked that it was time to close the book
toms and the mechanisms thereof were rec- on infectious diseases. His remark was at
ognized very early. Other agents such as best a gross underestimate. Taenia solium
neoarsphenamine and bismuth (both anti- cysticercosis is a classical example of a re-
syphilitic treatments), atarabine, quinine, emerging disease that the United States has
antimony tartrate, chloroquine, sulfasalazine to cope with, as a result of increasing immi-
and streptomycin were tried with no good gration, travel and general globalization.
results. Radiation therapy was also tried but This is one aspect of the global epidemiol-
results were not satisfactory5. Henneberg ogy of T. solium. The other, which is per-
advocated repeated lumbar punctures in haps less well appreciated, is the presumed
selected patients with intracranial hyperten- but precisely unknown large number of
sion as a palliative measure60. Another pal- people affected by the disorder in several
liative measure comprised of the use of developing countries. For these countries,
bromides and luminal for control of seizures. their governments and authorities, history
The earliest attempt at surgical treatment professes that T. solium, which was once
was by Krausse in 190161. MacArthur clearly widely prevalent in Europe, was eradicated
advocated against resorting to surgery in solely by developing sanitary infrastructure
view of the widespread distribution of lar- and enforcing meat hygiene. Perhaps, the
vae24–26. In a series of 99 patients reported best thing that they can learn from history
by Dixon and Hargreaves, 14 were is that the only way to surely eradicate
operated31. Indications for surgery included, cysticercosis is by improving sanitation,
the lack of diagnosis, as a relief measure for meat inspection, human behaviours and
control of intracranial hypertension and con- attitudes and most importantly by socio-
trol of seizures. They concluded: ‘It appears economic development.
References
1. Eber’s Papyrus. http://www.crystalinks.com/egyptmedicine.html

2. Flisser, A. Taeniasis and cysticercosis due to Taenia solium. In: Sun, T. (ed.) Progress in Clinical
3. Thompson, D.W. History of Animals by Aristotle. http://www.classics.mit.edu/Aristotle/
historyanim.html
4. Wardle, R.A., McLeod, J.A. (1952) The Zoology of Tapeworms. University of Minnesota Press,
Minneapolis, pp. 45–91, 155–172.
cysticercosis: 158 cases. Chinese Medical Journal 92, 770–786.
6. Hoeppli, R., Ch’iang, I.H. (1940) Selections from old Chinese medical literature on various subjects
of helminthological interest. Chinese Medical Journal 57, 373–380.
7. Mönnig, H.O. (1950) Veterinary Helminthology and Entomology. The Diseases of Domesticated Animals
Caused by Helminth and Arthropod Parasites, 3rd edn. Tindall and Cox, London, 11 pp.
8. Linnaeus, C. (1735) Systema Naturae sive segna tria Naturae Systematice Proposita per Classes, Ordines,
Genera et Species. Uppsala, Sweden.
9. Linnaeus, C. (1758) Systemae Naturae per regni tria Naturae, Secundum Classes, Ordines, Genera, Species
Characteribus, Differentis, Synonymis, Locis. Tomus 1, Edition decima. Reformata, Stockholm, Sweden.

10. Linnaeus, C. (1761) Fauna Svecia Sistens Animalia Sveciae Regni: Mamalia, Avesm Amphibia, Pisces,
Insecta, Vermes. Distributa per Classes and Ordines, Genera and Species, cum Differenttis Specierum,
Synonymis Auctorum, Nomiininibus Incolarum, Locis Natulium, Descrptionibus Insectorum. Edition
altera, auctoris, Stockholm, Sweden.
11. Goeze, J.A.E. (1782) Versuch einer Naturgeschichte der Eingeweidewürmer thierischer Körper. PA Pape,
Blankenburg, Germany, pp. 471. Cited in Ref. 20.
12. Leuckart, R. (1856) Die Blasenbandwürmer und ihre Entwickelng. Giessen, Germany, pp. 162. Cited in
Ref. 20.
13. Panarolus, D. (1652) Iatrologismorum, seu Medicinalium Observationum Pentecostae Quinque. F Moneta,
Romae, pp. 445. Cited in Ref. 2.
14. Rumler, J.U. (1558) Secto, a me, in capite, pustulae supra duram meningen apparuerunt, erosa ipsa
et cerebro per foramina eminente pluribus in locis. Observationes Medicae. Cited in Ref. 20.
15. Zeder, J.G. (1803) Anleitung zur Naturgeschichte der Eingeweidewürmer. Bamberg, Germany, pp. 432.
Cited in Ref. 20.
16. Küchenmeister, F. (1855) Offenes Sendschreiben an die k.k. Gesellschaft der Aertze zu Wein.
Experimenteller Nachweis, dass Cysticercus cellulosae innerhalb des menschlinchen Darmkanales
sich in Taenia solium umwandelt. Wiener medizinische Wochenschrift 5, 1–4. Translated in: Kean, B.H.,
Mott, J.E., Russell, A.J. (eds) Tropical Medicine and Parasitology Classic Investigations. Cornell
University Press, Ithaca, New York, 1978, pp. 677.
17. Küchenmeister, F. (1855) Die in und an dem Körper des lebenden Menschen vorkommenden
Parasiten. In: Ein Lehr- und Handbuch der Diagnose and Behandlung der thierischen und pflanzichen
Parasiten des Menschen. BG Teubner, Leipzig, p. 486. Translated in: Lankester, E. (1857) On Animal
and Vegetable Parasites of the Human Body, Vol. 1, Animal Parasites Belonging to the Group Entozoa. The
Sydenham Society, London, 1857, pp. 452.
18. von Siebold, C.T. (1835) Helminthologische Beiträge. Archiv für Naturgeschichte 1, 45–83.
19. von Siebold, C.T. (1836) Ueber die Spermatozoen der Crustacean, Insecten, Gasteropoden und
einiger anderer wirbellosen Thiere. Archiv für Anatomie und Physiologie (Muller) 13–53.
20. Grove, D.I. (1990) A History of Human Helminthology. CAB International, Wallingford, UK,
pp. 355–383.
21. Virchow, R. (1860) Helmintologischen Notizen 5. Traubenhydatiden der weichen Hirnhaut. Virchows
Archiv für Pathologische Anatomie un Physiologie und für Klinische Medizin 16, 528–535.
22. Vosgien, W. (1911) Le Cysticercus cellulosae Chez l’homme et Ches les Animaux. Thése de la Faculte
de Medecine, Paris.
23. Brumpt, E. (1936) Precis de Paristologie, 5th edn. Paris, France.
24. MacArthur, W.P. (1933) Cysticercosis as a cause of epilepsy in man. Transactions of the Royal Society of
25. MacArthur, W.P. (1934) Cysticercosis as seen in the British army, with special reference to the pro-
duction of epilepsy. Transactions of the Royal Society of Tropical Medicine and Hygiene 27, 343–357.
26. MacArthur, W.P. (1935) Cysticercosis of the brain. British Medical Journal ii, 1229.
27. Fairley, H. (1934) Tropical Diseases Bulletin 31, 784–785.
28. Dixon, H.B.F. (1933) Two cases of cysticercosis (Taenia solium). Journal of Royal Army Medical Corps 61,
126–128.
29. Dixon, H.B.F., Smithers, D.W. (1935) Cysticercosis (Taenia solium). Journal of Royal Army Medical Corps
64, 227–234, 300–306, 375–380.
30. Dixon, H.B.F., Smithers, D.W. (1934) Epilepsy in cysticercosis (Taenia solium). A study of seventy-one
cases. Quarterly Journal of Medicine 3, 603–616.
31. Dixon, H.B.F., Hargreaves, W.H. (1944) Cysticercosis (Taenia solium). A further ten years clinical
study covering 284 cases. Quarterly Journal of Medicine 13, 107–121.
32. Dixon, H.B.F., Lipscomb, F.M. (1961) Cysticercosis: an analysis and follow up of 450 cases. Medical
Research Council Special Report Series No. 299. Her Majesty’s Stationery Office, London, pp. 1–58.
33. Machado, A.B.B., Pialarissi, C.S.M., Vaz, A.J. (1988) Human cysticercosis in a general hospital in S.
Paulo, Brazil. Revista de Saúde Pública (São Paulo) 22, 240–244.
34. Takayanagui, O.M., Jardim, E. (1983) Clinical aspects of neurocysticercosis: Study of 500 cases.
35. MacArthur, W.P. (1945) Tropical Diseases Bulletin 42, 907–908.
and treatment. Paediatrics 82, 76–82.

37. Wadia, N., Desai, S., Bhatt, M. (1988) Disseminated cysticercosis: New observations, including CT
scan findings and experience with treatment with praziquantel. Brain 111, 597–614.
38. Weinberg, G. (1909) Recherches des anticorps specifiques dans la distomatose et la cysticercose.
Comptes Rendus Hebdomadaires des Seances et Memoires de la Societe de Biologie (France) 66, 219–221.
39. Rothfeld, J. (1935) Über die Präcipitationsreaktion bei Hirncysticerkose. Deutsche Zeitschrift
Nervenheilk 137, 93–102.
40. Biagi, F.F., Tay, J. (1958) A precipitin reaction for diagnosis of cysticercosis. American Journal of
41. Nieto, D. (1956) Cysticercosis of the nervous system. Diagnosis by means of the spinal fluid comple-
ment test. Neurology 6, 725–738.
42. Castellani, A. (1938) Brief notes on cysticercosis and luetic pseudo-cysticercosis. Journal of Tropical
43. Roth, E.J. (1926) Man as the intermediate host of the Taenia solium. British Medical Journal ii, 470–471.
44. Broughton-Alcock, W., Weinbren, M. (1930) Generalised infection of muscles with Cysticercosis cellu-
losae; measurement of cysts and comparison with those of Trichinella spiralis. Proceedings of the Royal
Society of Medicine 24, 222–224.
45. Morrison, W.K. (1934) Cysticercosis in twin brothers aged 13 years with a radiological study of calci-
fied cysticercus in twelve cases. British Medical Journal i, 13–14.
46. Brailsford, J.F. (1941) Cysticercus cellulosae – its radiographic detection in the musculature and cen-
tral nervous system. British Journal of Radiology 14, 79–93.
47. Brailsford, J.F. (1942) Unrecognized cysticercosis. Lancet i, 127–128.
48. Arana, R., Asenjo, A. (1945) Ventriculographic diagnosis of cysticercosis of the posterior fossa.
Journal of Neurosurgery 2, 181–190.
50. Ryo, S. (1937) A new anthelminthic ‘Raigan’ in taeniasis. Journal of Oriental Medicine 26, 799–845.
51. Sandground, J.H. (1938) Newer drugs for the treatment of tapeworm infestations. Some results
obtained with carbon tetrachloride, tetrachlorethylene and hexylresorcinol. New England Journal of
Medicine 218, 298–304.
52. Liu, H.L. (1936) Betel nut as a useful taeniafuge. Chinese Medical Journal 50, 1273.
53. Ogle, J.W. (1863) Observations of the treatment of Taenia, especially by the use of oil of male fern.
British Medical Journal i, 264–266.
54. Pankhurst, R. (1969) The traditional taenicides of Ethiopia. Journal of the History of Medicine 24,
323–334.
55. Allan, W. (1912) Thymol for Taenia saginata. Journal of American Medical Association 59, 197.
56. Carman, J.A. (1931) A note on the clinical aspect of the treatment of taeniasis with carbon tetrachlo-
ride. Transactions of the Royal Society of Tropical Medicine and Hygiene 25, 187–190.
57. Schnelewa, A.A. (1931) Anwendüng de Düodenal sonde bei Austreibung von Bandwürmen. Revue
Microbiologie Epidemiologie et Parasitologie 10, 297–303.
58. Mazzotti, L., Trevino, A. (1953) Ensayo de tratamiento con ‘Dietilcarbamazina’ (Hetrazan) en tres
casos de cistecercosis humana. Revista do Instituto Salubridad y Enfermedades Tropicale México 13,
209–211.
59. Mazzotti, L., Torroella, J. (1955) Resultados negatives de Hetrazan en des casos humans de cesticer-
cosis ocular. Revista do Instituto Salubridad y Enfermedades Tropicale México 15, 217–219.
60. Henneberg, R. (1936) Die tierschen Parasiten des Zentralnervensystem. In: Bumke und Foerster’s
Handbuch der Neurlogie. Vierzehuten Band. Springer-Verlag, Berlin, Germany, pp. 286–322.
61. Olive, J.I., Angulo-Rivero, P. (1962) Cysticercosis of the nervous system. Panel discussion. A.
Introduction and general aspects. Journal of Neurosurgery 19, 632–634.

17 Neurocysticercosis: an Overview of
Clinical Presentations
Introduction History and Physical Examination
The manifestations of neurocysticercosis The symptoms and signs of NC are non-

(NC) are a puzzling concern to clinicians in specific. Parenchymal NC commonly pre-
endemic and non-endemic countries alike. sents with seizures and headaches. Seizures
No symptom or sign is specific for the dismay be single, clustered or recurrent. They
order. Furthermore, a plethora of clinical are either focal with or without secondary
presentations (reviewed in Chapters 18–29) generalization or may be generalized at the
have been described, giving NC the appro- onset. Headaches may be transient-
priate title of the modern-day successor of migraineous, continuous-tension type or
syphilis, the master imitator of all diseases. more uncommonly, severe portending
In non-endemic regions, which are experi- intracranial hypertension. Other less com-
encing a reemergence of the disorder, the mon features include focal neurological
lack of awareness of NC often leads to deficits (usually brief, though rarely persua-
delay in diagnosis and resort to unneces- sive), a variety of psychiatric manifestations
sary invasive, potentially harmful and and dementia. In patients with extra-
time-consuming tests such a stereotactic parenchymal NC, the most common patho-
biopsy and so forth1. Contrariwise, in logical determinant of clinical symptoms and
endemic areas, clinicians often pronounce a signs is hydrocephalus4,5. These patients pre-
diagnosis of NC only to realize an alterna- sent with headaches, which may or may not
tive diagnosis much later2,3. In this view, it be associated with nausea and vomiting and
is obviously important to classify the disor- visual disturbances resulting from papil-
der, put down diagnostic criteria and famil- loedema and secondary optic atrophy. In
iarize clinicians with salient clinical addition, they may develop features of
manifestations. Accordingly, an overview meningismus, stroke-like presentations or
of available and practised systems of stag- cranial nerve palsies.
ing, classification and diagnosis are dis- General physical examination is usually
cussed in the clinical context in this normal, though subcutaneous nodules may
chapter; more detailed reviews of individ- be felt or seen (Fig. 17.1) and ocular examina-
ual clinical presentations follow in the sub- tion may disclose ophthalmic cysticercosis
sequent chapters. (Fig. 17.2) (reviewed in Chapter 28). The sub-


170 S. Prabhakar and G. Singh
Fig. 17.1. Lingual and subcutaneous cysticerci.
but may be visible over the tongue, face and

neck, where the skin is thin (Fig. 17.1).
Indeed, the detection of subcutaneous nod-
ules was hitherto considered to be an impor-
tant aspect of diagnosis of Taenia solium
cysticercosis. In a large series of 450 patients
reported by Dixon and Lipscomb, 54% had
nodules6. Subcutaneous nodules are now
becoming rare in view of the rapidity with
which a diagnosis of NC is made with the
help of computed tomography (CT) and
magnetic resonance imaging (MRI).
In most cases, neurological examination is
normal. Focal neurological deficits if present
are subtle and evanescent. In a subset of
patients with a large parenchymal burden of
disease or extraparenchymal NC7,8, the pre-
Fig. 17.2. Ocular cysticercosis. senting signs may be those due to intracra-
nial hypertension and/or dementia
(reviewed in Chapter 19). These patients
cutaneous nodules represent cysticerci in commonly have papilloedema, impairment
underlying muscles. The nodules are the size in cognitive protocols and somnolence or
of a pea and are painless. They often go varying levels of consciousness.
unnoticed by the patient but when recog- A definite, probable and possible diagno-
nized they may be a cause of concern to sis of NC can be made on the basis of clini-
him/her, requiring several assurances from cal, radiological and epidemiological criteria,
the physician. The skin over the nodules is tabulated in Box 17.1. These criteria were
movable. Nodules are usually detected by proposed by Del Brutto et al., in 19969, and
palpation alone over the trunk and limbs, revised in 200110.

An Overview of Clinical Presentations 171
Box 17.1. Diagnostic criteria for neurocysticercosis (NC). (Adapted from references 9 and 10.)
Absolute criteria
1. Histological demonstration of cysticerci from either a central or peripheral source.
2. Direct visualization of ophthalmologic cysticerci.
3. Demonstration of a cyst containing a scolex upon neuroimaging study.
Major criteria
1. Evidence of lesions suggestive of NC on neuroimaging studies without demonstration of a
scolex (MRI or CT showing cystic lesions, ring-enhancing lesions, parenchymal brain
calcifications, hydrocephalus, and abnormal enhancement of the leptomeninges. Myelograms
showing multiple filling defects in the column of contrast material).
2. Serum anti-cysticercal antibodies demonstrated by immunoblot, or spinal fluid
anticysticercal antibodies demonstrated by immunoblot or ELISA.
3. Characteristic cigar-shaped calcifications demonstrated by soft-tissue radiographs of the
thigh and calf.
Minor criteria
1. Subcutaneous nodules suggestive of cysticerci (without histological confirmation).
2. Punctate intracerebral or soft-tissue calcifications on plain radiographs.
3. Clinical manifestations suggestive of NC (seizures, focal neurological deficits, symptoms of
increased intracranial pressure, dementia).
4. Disappearance of intracranial lesions after treatment with anticysticercal drugs.
Epidemiologic criteria
1. Residence in a cysticercosis endemic area.
2. Frequent travel to cysticercosis endemic areas.
3. Household contact with an individual infected with Taenia solium.
Based on the above diagnostic criteria, the following diagnostic categories were proposed:
A. Definite NC (one of the following)
One absolute criterion
Two major criteria
One major, two minor and one epidemiologic criterion
B. Probable NC (one of the following)
One major and two minor criteria
One major, one minor and one epidemiologic criterion
Three minor and one epidemiologic criterion
C. Possible NC (one of the following)
One major criteria
Two minor criteria
One minor and one epidemiologic criterion
Overview of Disease Staging and tions11. This was one of the earliest versions
Classification of more contemporary classifications. A
major objective of classification is to guide
The lack of pathognomic clinical features management approaches and obtain prog-
despite the large number of clinical presenta- nostic information. Since in the early part of
tions of human T. solium cysticercosis was the 20th century, surgery was the only estab-
recognized very early by medical scientists. lished method of treatment, initial classifica-
This led to attempts at systematic classification systems were made in order to
tion of disease. Thus, Küchenmeister recog- determine the need and nature of surgical
nized the presence of cysticercosis in approach. Several orderly classifications
meningeal, cortical and ventricular loca- were given and perhaps that of Stepien and

Table 17.1. Surgically oriented classification of neurocysticercosis. (Source: reference 12.)
Group Clinical characteristics Surgical implication
I Space occupying intracranial tumour-like behaviour Exeresis often indicated

producing focal neurological manifestations (focal
seizures, hemiparesis, visual pathway deficits, cranial
neuropathy/ies, cerebellar symptoms and signs) and
ultimately raised intracranial pressure (in case of third/
fourth ventricular cysticercosis: posterior fossa mass
and obstructive hydrocephalus)
II Diffuse cerebral syndrome due to numerous cysticerci Exeresis rarely useful but may be
leading to cerebral oedema, intracranial hypertension undertaken in life-threatening
(leading to vision loss), organic brain syndrome conditions
III Basal meningeal or ventricular cysticerci giving rise to Cerebrospinal fluid diversion
hydrocephalus (and intracranial hypertension), rarely procedure
focal signs and mental disturbances
Chorobski is most well known (Table 17.1)12. included in active disease presentations.
The classification worked well in those Parenchymal calcifications and hydrocephalus
times, effectively dictating the surgical secondary to meningeal fibrosis were classified
approach in the absence of modern tools of into inactive forms. Thus, symptoms of active
diagnosis like CT, MRI and enzyme- forms of NC included seizures (most com-
linked immunoelectrotransfer blot (EITB). monly), acute or subacute hydrocephalus (less
Understandably, it has been replaced by clas-
sification/s that incorporate contemporary
diagnostic and therapeutic options13,14.
Table 17.2. Anatomical classification of neuro-
Classifying NC according to the anatomic cysticercosis (NC).
compartment of involvement is advantageous
to clinicians, radiologists and pathologists 1 Parenchymal NC
(Table 17.2). It separates clinical concomitants 2 Extraparenchymal NC
into those of parenchymal NC (presenting with Venticular
seizures, space-occupying effects and intracra- Subarachnoid
3 Mixed
nial hypertension), subarachnoid NC (present-
ing with meningitis, space-occupying effects
and hydrocephalus) and ventricular NC (man-
ifesting as acute hydrocephalus, meningitis or
Table 17.3. Classification of neurocysticercosis
rarely space-occupying lesions). A classifica-
into active and inactive forms. (Reproduced with
tion system that is oriented purely anatomi- permission from reference 15.)
cally however, does not take into account the
evolutionary stage of NC, which also influ- Active forms of NC
ences clinical presentation. In 1985, Sotelo et al. Arachnoiditis
proposed the classification of NC into active Hydrocephalus secondary to meningeal
inflammation
and inactive disease (Table 17.3)15. The classifi-
Parenchymal cysts
cation derives from pathological-radiological
Brain infarction secondary to vasculitis
staging of NC, which have been described else- Mass effect due to large cyst or cyst clumps
where in the book (Chapters 30 and 32) in 753 Intraventricular cysts
cases. Both viable, live (non-inflamed) Spinal cysts
parenchymal cysts and degenerating
Inactive forms of NC
parenchymal cysts represented the active form.
Parenchymal calcifications
Extraparenchymal presentations of active Hydrocephalus secondary to meningeal fibrosis
meningitis or arachnoiditis were likewise

common) due to meningeal inflammation, involuting. Thus this patient may pass
arachnoiditis, obstruction by intraventricular through several stages of NC: active (asymp-
cysts, meningitis and stroke (not uncommon) tomatic) initially, transitional, inactive and
and mass effect due to space-occupying lesions then again, transitional.
(rare) and myelopathy (rare). Clinical presenta- The usual course of illness in most
tions of inactive NC included seizures due to patients, particularly those with one or few
parenchymal calcified NC and chronic hydro- parenchymal cysts, is benign and self-limit-
cephalus. The purpose of this classification was ing. These patients have few seizures, often
to differentiate between those cases that clustered, that remit rapidly. It is not uncom-
required definitive medical (anticysticercal mon to find some parenchymal cysts under-
treatment and/or steroids) or surgical manage- going involution/degeneration at about the
ment versus those that required only sympto- same time rather than one after another
matic medical (antiseizure medications) or upon CT. The simultaneous involution is
surgical (ventriculoperitoneal shunt) manage- surmised to result from an antigenic stimula-
ment. This classification is perhaps the most tion following degeneration of one cyst that
widely used in the present day. Carpio et al. induces an immune response against the
classified NC into active, transitional and inac- other cysts as well. This often is the reason
tive forms16. This classification is an appropri- for the short, self-limiting course of NC
ate staging system based upon clinical and rather than a protracted course. In contrast,
imaging characteristics and has therapeutic clinical syndromes associated with multiple
implications as well. Active NC forms, which inflamed parenchymal cysticercosis, often
refer to live, viable parenchymal or extra- synonymously called cysticercotic encephali-
parenchymal cysts, rarely produce symptoms tis and profuse, non-inflamed cysticercosis,
apart from the rare instance of mass effect. also called ‘disseminated cysticercosis’
Symptomatic NC is incident upon the transi- (reviewed in Chapter 19), or even few cysts
tional forms, where degenerating parenchymal in the intraventricular (discussed in Chapter
cysts produce acute symptomatic seizures. 20) or subarachnoid (discussed in Chapter
Likewise degenerating subarachnoid cysts pro- 18) locations, often have a foreboding course.
duce meningitis, arachnoiditis and hydro-
cephalus and ventricular cysts lead to acute
hydrocephalus. Inactive disease again is exem- Temporal and Geographical Trends in
plified by single or multiple parenchymal calci- Clinical Presentation
fication/s and/or hydrocephalus secondary to
meningeal fibrosis. Temporal trends
Some of the earliest descriptions of NC in

Natural course of disease literature portrayed a uniformly dismal
prognosis17,18. This was not borne out by
It must be remembered that no compartmen- several subsequent studies, which suggested
talization is strict, and good proportions of that ‘the prognosis was not as bad as previ-
patients simultaneously have several ously felt’19,20. More recent experience sug-
anatomical or evolutionary attributes. Thus, gests the existence of benign self-limiting or
it is not uncommon to find a patient with oligolesional disease in large numbers20–23.
multiple active, involuting and calcified This does not indicate a shift in the clinical
parenchymal cysts in addition to the presence spectrum of disease from more severe to
of cysticercotic hydrocephalus due to chronic benign forms but merely reflects early diag-
arachnoiditis. Likewise, another patient may nosis and the recognition of benign, oligole-
be having seizures due to transitional forms sional NC with modern modalities of
of NC that ultimately resolve with calcifica- neuroimaging such as CT and MRI. For
tions. A few years later, this patient may instance, the average time period between
again experience seizures due to a fresh crop the first neurological symptom and estab-
of parenchymal cysticerci that have begun lishment of a diagnosis of cysticercosis was

8.2 years with a range of 1–52 years before be resolved by careful prospective collec-
19626. This time period has been reduced to tion of data from similar facilities that are
days or months in most developing coun- matched for therapeutic expertise and rep-
tries and most certainly to hours or days in utation, referral pattern and patient vol-
developed countries. In another example, ume. Some of the important published
the traditional viewpoint prevailed in India series of NC in persons of Latin American
that regarded NC as a disorder with multi- origin are summarized in Table 17.4. These
ple parenchymal cysts. With the advent of have been compared with a series collected
CT in the early 1980s, a solitary ring-enhanc- in a large tertiary care public hospital facil-
ing lesion that resolved spontaneously in ity in India. The presence of NC was estab-
3–6 months was noted upon CT. It took clin- lished by imaging, surgical pathology and
ical neurologists nearly a decade to under- autopsy in this series. Indeed, comparison
stand and accept that these single of these series does not reveal differences in
self-limiting forms were of cysticercal aetiol- clinical presentation.
ogy. In this regard, therefore, CT and later
MRI have made the most dramatic impact
on our understanding of the disorder. Conclusions
A spectrum of clinical manifestations from

Geographical trends asymptomatic larval infestation to severe
presentations with life-threatening intracra-
Several authors have considered geograph- nial hypertension, irrecoverable cognitive
ical differences in clinical presentation deterioration and altered sensorium
before. In fact, as early as 1938, MacArthur impending upon death has been noted in
was surprised to note the occurrence NC. Most patients, however, lie between
of subarachnoid cysticercosis diagnosed these two extremes with occasional
by ventriculography in South America, seizures and/or headaches. Clinical mani-
although he had not encountered any such festations vary according to the anatomical
form in his vast experience with the disor- site of lesion/s and the evolutionary stage
der in India21,22. His comments continue to of the cysticercus. By the former approach,
fuel speculations that parenchymal NC is NC is classified into parenchymal and
more common in India and other South and extraparenchymal. Parenchymal disease
Southeast Asian countries, while subarach- results from infection within the brain
noid–ventricular forms are more common parenchyma, most commonly at the corti-
in Latin America. These differences are per- cal–subcortical interface. Extraparenchymal
haps more imaginary than real. Actually, NC implies involvement of the cranial and
the spectrum of clinical presentations is spinal subarachnoid space and the ventri-
likely to vary with the volume of patients cles. Commonly, the clinician encounters
seen and the referral pattern linked to the patients with combined disease or disease
repute of the medical facility in terms of which changes from one compartment to
treating the disorder either medically or the other. The classification of NC into
surgically (H.H. García, Lima, personal active (and transitional) and inactive forms
communication). Thus, a series of patients is particularly advantageous and has
compiled from a general hospital may have important therapeutic implications. It is
seizures as the dominant manifestation, conceivable that with the unfolding of
while a series from a tertiary care neurosur- novel immune mechanisms that underlie
gical facility may have a predominance of clinical presentations and application of
subarachnoid and ventricular forms. It immune therapies against molecular
appears therefore, that available published domains, a classification based upon molec-
clinical series cannot be strictly compared. ular immunology may ultimately replace
Nevertheless, the issue of geographical existing clinical, pathological and radiolog-
variations in clinical presentation needs to ical classifications.

Table 17.4. Clinical syndromes (not necessarily the presenting ones) of neurocysticercosis in various
published series in the 1980s, about the time when computed tomography was becoming available.
Reference 23 15* 24 25 26
Authors McCormick et al. Sotelo et al. Grisiola and Scharff Veerendra

Wiederholt Kumar
Collection period 1970–1980 1977–1981 1972–1981 1981–1986 1974–1980
Location Los Angeles, Mexico City, San Diego, Los Angeles, Bangalore,
CA, USA Mexico CA, USA CA, USA India
Number of patients 127 753 17 238 81
Age (range) in years 11–83 5–76 7–58 2–82 1–65
Age (mean) in years na 32 na 35 na
Males 68 (53.5%) (50.8%) 10 (58.8%) 139 (58.4%)
Females 59 (46.5%) (49.2%) 7 (41.2%) 99 (41.6%)
Clinical syndrome
Seizures 70 (55.1%) (52.4%) 6 (35.3%) 134 (56.3%) 37 (45.7%)
Intracranial
hypertension 48 (37.8%) (43.4%) 11 (64.7%) 51 (21.4%) 31 (38.3%)
Dementia 13 (10.2%) (15.8%) na 5 (2.1%) 6 (7.4%)
Meningio-encephalitis† 54 (42.5%) (29.5%) 14 (82.4%) 13 (5.5%) 11 (13.6%)
Stroke 15 (11.8%) (2.3%) 3 (17.6%) 10 (4.2%) 1 (1.2%)
Psychiatric presentation‡ na (7.4%) na 8 (3.4%) 3 (3.7%)
Spinal cysticercosis 0 (0%) (1.4%) 1 (5.9%) 1 (0.4%) 2 (2.5%)
Muscular cysticercosis na na na na 2 (2.5%)
Ocular cysticercosis na na na na 4 (4.9%)
*Only percentages available.

†The criteria for diagnosis of meningitis were variable (including the presence of meningeal signs and
cerebrospinal fluid pleocytosis).

‡Does not imply a primary psychiatric presentation.
References
1. Miyake, H., Takahashi, K., Tsuji, M., et al. (1993) A surgical case of solitary cerebral cysticercosis. No
2. Matson, D.O., Rouah, E., Lee, R.T., et al. (1988) Acanthamoeba meningoencephalitis masquerading
as neurocysticercosis. Pediatric Infectious Diseases Journal 7, 121–124.
3. Walus, M.A., Young, E.J. (1990) Concomitant neurocysticercosis and brucellosis. American Journal of
Clinical Pathology 94, 790–792.
4. Bandres, J.C., White, A.C., Jr, Samo, T., et al. (1992) Extraparenchymal NC: report of five cases and
review of management. Clinical Infectious Diseases 15, 799–811.
5. Lobato, R.D., Lamas, E., Portillo, J.M., et al. (1981) Hydrocephalus in cerebral cysticercosis.
Pathogenic and therapeutic considerations. Journal of Neurosurgery 55, 786–793.
Research Council Special Report. Series No. 299. Her Majesty’s Stationery Office, London, pp. 1–58.
7. Wadia, N.H., Desai, S.B., Bhatt, M.B. (1988) Disseminated cysticercosis – new observations including
8. Garcia, H.H., Del Brutto, O.H. (1999) Heavy nonencephalitic cerebral cysticercosis in tapeworm car-
riers. Neurology 53, 1582–1584.
9. Del Brutto, O.H., Wadia, N.H., Dumas, M., et al. (1996) Proposal of diagnostic criteria for human
cysticercosis and NC. Journal of the Neurological Sciences 142, 1–6.
10. Del Brutto, O.H., Rajshekhar, V., White, A.C., Jr, et al. (2001) Proposed diagnostic criteria for neuro-
cysticerosis. Neurology 57, 177–183.

11. Küchenmeister, F. (1855) Die in und an dem Körper des lebenden Menschen vorkommenden
Parasiten. Ein Lehr- und Handbuch der Diagnose and Behandlung der thierischen und pflanzichen Parasiten
des Menschen. BG Teubner, Leipzig, pp. 486. Translated by E. Lankester (1857). In: On Animal and
Vegetable Parasites of the Human Body. Vol. 1. Animal Parasites Belonging to the Group Entozoa. The
Sydenham Society, London, pp. 452.
12. Stepieñ, L., Choróbski, J. (1949) Cysticercosis cerebri and its operative treatment. Archives of
Neurology and Psychiatry (Chicago) 61, 499–527.
13. Colli, B.O., Martelli, N., Assirati, J.A., et al. (1994) Cysticercosis of the central nervous system. I.
Surgical treatment of cerebral cysticercosis. Arquivos de Neuropsiquiatria 52, 166–186.
14. Colli, B.O., Martelli, N., Assirati, J.A., et al. (1995) Surgical treatment of cysticercosis of the central
nervous system. Neurosurgery Quarterly 5, 34–54.
15. Sotelo, J., Guerrero, V., Rubio, F. (1985) Neurocysticercosis: a new classification based on active and
inactive forms. A study of 753 cases. Archives of Internal Medicine 145, 442–445.
16. Carpio, A., Placencia, M., Santillán, F., et al. (1994) A proposal for classification of neurocysticercosis.
Canadian Journal of Neurological Sciences 21, 43–47.
20. Dixon, H.B.F., Hargreaves, W.H. (1944) Cysticercosis (Taenia solium). A further ten years clinical
study covering 284 cases. Quarterly Journal of Medicine 13, 107–121.
23. McCormick, G.F., Zee, C.S., Heiden, J. (1982) Cysticercosis cerebri: review of 127 cases. Archives of
Neurology 39, 534–539.
24. Grisiola, J.S., Wiederholt, W.C. (1982) CNS cysticercosis. Archives of Neurology 39, 540–544.
25. Scharff, D. (1988) Neurocysticercosis. Two hundred thirty-eight cases from a California hospital.
Archives of Neurology 45, 777–780.
26. Veerendra Kumar, M. (1986) Clinico-pathological Study of Neurocysticercosis. Thesis. University of
Bangalore, Bangalore, India.

18 Meningeal Cysticercosis
Oscar H. Del Brutto
Introduction lated conditions from different Taenia sp.12.

Actually, the term ‘cysticercus cellulosae’
The meningeal form of cysticercosis was was initially used to describe an unique
probably first described in 1860 by Virchow, parasitic infection at a time when it was not
who found membranous structures at the known that cysticerci merely represent the
base of the brain at necropsy of an individual larval stage of Taenia solium13. Therefore,
who died of a chronic neurological disorder1. neither of the terms, ‘cysticercus cellulosae’
Virchow, however, did not recognize the cor- and ‘cysticercus racemosus’ are scientifi-
rect nature of those membranes which he cally acceptable. Flisser proposed the terms
called ‘racemose hydatids’ (Traubenhydatiden). ‘cellulose form of T. solium cysticercosis’
In 1882, Zenker demonstrated cysticercal scol- and ‘racemose form of T. solium cysticerco-
ices within such membranes and coined the sis’ in order to differentiate between the
term ‘cysticercus racemosus’ (quoted by two conditions14.
Henneberg)2. According to Zenker’s original
description – based on the pathological study
of 15 cases – this parasite was a variant of cys- Pathology
ticercus cellulosae, which developed into an
abnormal shape and size. Only a few Taenia solium cysticercus is a vesicle that
authors3–5 described meningeal cysticerci sub- consists of two main parts: the vesicular
sequently, until Bickerstaff and co-workers6,7, wall and an invaginated scolex. The vesicu-
described their pathological and clinical man- lar wall is a membranous structure with fes-
ifestations in detail, in their classical papers tooned appearance made up of an outer
‘The racemose form of cerebral cysticercosis’ eosinophilic layer called the ‘cuticular man-
and ‘Cysticercosis of the posterior fossa’. tle’, a middle cellular layer with pseudoep-
It has been common practice to describe ithelial structure, and an inner layer formed
cysticerci located in the brain parenchyma by circular muscle and reticular fibres15. It
or within cortical sulci between two cere- may be considered equivalent to the tegu-
bral convolutions as ‘cysticercus cellulosae’ ment across which the parasite obtains
and those cysticerci located within the metabolites and nutrition through absorp-
basal cisterns as ‘cysticercus racemosus8–11. tion and diffusion16. Inside the vesicle, there
However, this terminology may be mis- is an invaginated scolex, structurally similar
leading and indicate that these are unre- to that of the adult T. solium, including its


178 O.H. Del Brutto
head armed with suckers and hooks, an their location. Cysticerci located at the corti-
elongated neck, and a rudimentary body. A cal surface of the brain usually have a scolex
scolex may not be identified in all cysticer- and are of the cellulose form (Fig. 18.1). This
cus vesicles. These latter forms consist of is the most common location of intracranial
several membranes attached to each other, cysticerci in pathological series15,17. The
usually located within basal cisterns17,18. cysts rarely measure greater than 10 mm
Histological studies have shown that these because pressure of the brain parenchyma
structures represent proliferation of para- prevents further growth of vesicles. In con-
sitic membranes after degeneration of the trast, cysticerci located within basal cisterns
scolex. Their histochemical composition is often attain sizes of about 50 mm since their
unique, because of the presence of acid growth is not limited by brain parenchyma.
mucosubstances and hydrophilic lipids in Giant cysts usually lack a scolex. They are
large amounts19. commonly located within the Sylvian fis-
Rabiela et al. described the morphologi- sures, cerebellopontine angles, perimesen-
cal characteristics of cellulose and racemose cephalic and prepontine cisterns, and
forms of the cysticercus, providing evi- optochiasmatic region.
dence that they arise from a single Taenia Upon involution, meningeal cysticerci
sp.20,21. The authors also described another elicit severe inflammatory reaction in the
form of cysticercus that conserves the subarachnoid space with formation of
scolex but has two or more small bladders dense exudates composed of collagen fibres,
sprouting from the main vesicle. This is an lymphocytes, multinucleated giant cells,
‘intermediate form of cysticercus’, repre- eosinophils and hyalinized parasitic
senting an initial stage in the transforma- membranes, leading to thickening of
tion from cellulose to racemose form. leptomeninges (Fig. 18.2). Meningeal
Mechanisms responsible for this transfor- inflammation may be disseminated, induc-
mation are incompletely understood. It is ing neural and vascular damage distant
believed that vesicles grow and their scol- from the sites where parasites lodge.
ices disappear as the result of hydropic Indeed, leptomeningitis may extend from
degeneration, caused by the continuous the optochiasmatic region to the foramen
adsorption of cerebrospinal fluid (CSF)18. magnum15,18. The optic chiasm is frequently
Macroscopic appearances of meningeal trapped by this dense exudate, leading to
(subarachnoid) cysticerci vary according to visual field defects22. Cranial nerves arising
Fig. 18.1. Small subarachnoid cysticercus located in the depths of cortical sulci. (Reproduced with

Meningeal Cysticercosis 179
Fig. 18.2. Cysticercotic arachnoiditis causing abnormal thickening of leptomeninges around the brainstem.
from the ventral aspect of the brainstem ticerci enter the spinal subarachnoid space
may also be encased, giving rise to cranial by retrograde flow through epidural verte-
nerve palsies23. The foramina of Luschka bral veins32. Cysticerci located in the spinal
and Magendie may also be occluded by subarachnoid space cause spinal lepto-
thickened leptomeninges and parasitic meningitis with resulting inflammatory or
membranes with subsequent development demyelinating changes in ventral and dor-
of obstructive hydrocephalus24. The sub- sal roots or peripheral nerves.
arachnoid inflammatory reaction elicited by
meningeal cysticerci may also involve
intracranial vessels. Walls of small penetrat- Clinical Manifestations
ing arteries arising from the circle of Willis
are invaded by inflammatory cells, leading The clinical pleomorphism of meningeal cys-
to endarteritis, adventitial thickening, ticercosis is related to individual variations
medial fibrosis and endothelial hyperplasia in number, size and location of parasites, as
(Fig. 18.3). The hyperplasia reduces or well as the severity of the subarachnoid
occludes the lumen of the vessels, leading inflammatory reaction33,34. While a typical
on to cerebral infarction25. Major intracra- syndrome of meningeal cysticercosis cannot
nial arteries may also be occluded by be defined, focal neurological deficits,
atheroma-like luminal deposits resulting meningitis and intracranial hypertension in
from disruption of the endothelium; this varying combinations are the most common
vascular involvement may cause large cere- presenting features33–35.
bral infarcts in the territory of the anterior
or middle cerebral arteries26–28. Adherence
of the cysticercus to a subarachnoid blood Focal neurological deficits
vessel may weaken the vessel wall, result-
ing in the formation of a mycotic As previously noted, cysticercotic arach-
aneurysm29. Finally, meningeal cysticerci noiditis causes entrapment of cranial
may also be located at the spinal subarach- nerves arising from brainstem. The oculo-
noid space30,31. These are the result of motor nerves, which run a long course
migration of cysts from the intracranial sub- along the basal meninges from their origin
arachnoid space. It is also possible that cys- until their entrance into the cavernous

180 O.H. Del Brutto
Fig. 18.3. Microscopic section of an occluded leptomeningeal blood vessel affected by cysticercotic
endarteritis. A dense collagen capsule and parasitic membranes surround the vessel. (Reproduced with
sinuses, are particularly susceptible in this noiditis associated with subarachnoid cysts
regard. Clinical manifestations include in the suprasellar cisterns. These infarcts
diplopia due to extraocular muscle paraly- are located in the posterior limb of the
sis, and blurred vision due to pupillary internal capsule or corona radiata, and pro-
abnormalities36. Encasement of the optic duce syndromes such as pure motor hemi-
nerves and/or optic chiasm by suprasellar paresis and ataxic hemiparesis, that are
exudates leads to decreased visual acuity clinically indistinguishable from those
and visual field defects37,38. Large cyst/s in caused by hypertension43,44. Lacunar
the cerebellopontine angle cistern present infarcts may also be located in the midbrain
with a syndrome characterized by various and thalamus, particularly when the para-
combinations of sensorineural hearing loss, median thalamopeduncular branches of the
vertigo, facial palsy, facial numbness and mesencephalic artery are involved by the
pain, that may be accompanied by signs of process of angiitis; in these cases, clinical
long-tract dysfunction, motor weakness manifestations include impaired vertical
and cerebellar ataxia39. Likewise, clumps of gaze, pupillary abnormalities, somnolence,
cysts inside the Sylvian fissure may cause paraparesis, and urinary incontinence25.
contralateral motor weakness and sensory Large cerebral infarcts are caused by
deficits and language disturbances40. Most occlusion of the internal carotid artery, or
manifestations described above have a the anterior or middle cerebral arter-
subacute onset and progressive course, ies26–28,45–47. Patients present with severe
often mimicking brain tumours33–40. Stroke- focal neurological deficits secondary to an
like presentations occur in 3% of the infarct involving the basal ganglia and/or
patients with subarachnoid cysticercosis41. cerebral cortex. Finally, there are anecdotal
Ischaemic cerebrovascular complications reports of patients with subarachnoid
include lacunar as well as large cerebral haemorrhage due to rupture of mycotic
infarcts5,42. Lacunar infarcts occur as the aneurysms of the basilar artery related to
result of inflammatory occlusion of small large subarachnoid cysticerci attached to
perforating arteries secondary to arach- the artery29.

Meningitis specifically addressing characteristics of

seizure disorder associated with cortical sub-
Cysticercotic meningitis is most often subarachnoid cysticerci, but it may be assumed
acute to chronic.34 It presents with cranial that the latter give rise to partial seizures with
nerve dysfunction or symptoms and signs of or without secondary generalization as a result
increased intracranial pressure. Fever is of focal irritative mechanisms.
rarely noted. It is generally believed that
meningeal cysticerci do not cause acute
meningitis33. However, a recent report Myelopathy and radiculopathy
described an acute meningeal syndrome
attributable to cysticercosis in 27 Subarachnoid cysticerci of the spinal canal
individuals48. Fever was noted in 74% and usually cause a non-specific clinical picture
neck stiffness in 44% of the patients. The characterized by a combination of radicular
report suggests that cysticercosis should be pain and motor deficits of subacute onset
included in the differential diagnosis acute and progressive course51,52. Cervical lep-
meningitis, particularly in endemic regions48. tomeningeal cysts may cause a compressive
myelopathy with signs of upper motor neu-
ron damage in the lower limbs (spastic para-
Intracranial hypertension paresis with bilateral Babinski’s signs)
associated with atrophy and fasciculations of
Meningeal cysticercosis may cause intracranial hand muscles53. In contrast, leptomeningeal
hypertension by two main mechanisms. The cauda equina cysts present with flaccid para-
most common is development of hydro- paresis and arreflexia in the lower limbs54.
cephalus due to inflammatory occlusion of the The reader is referred to Chapter 23 for a
foramina of Luschka and Magendie, with detailed discussion on spinal cysticercosis.
blockage of CSF transit from the fourth ventri-
cle to the subarachnoid space24. This severe or
even fatal complication of meningeal cysticer- Diagnostic Evaluation
cosis presents with a subacute syndrome of
intracranial hypertension (headache, vomiting, Given the clinical pleomorphism of
papilloedema)49. It may be accompanied by meningeal cysticercosis, a definitive diagno-
symptoms and signs of cranial nerve dysfunc- sis on clinical grounds alone is difficult.
tion and cerebral infarcts due to the hitherto Complementary investigations are required
outlined mechanisms18. Intracranial hyperten- to differentiate this condition from other
sion may also be incidental to growing clumps tumours and infections with similar clinical
of cysts in locations such as Sylvian fissures, manifestations. Diagnostic work-up includes
anterior interhemispheric fissure, or cerebello- neuroimaging, lumbar puncture and
pontine angle cisterns39,40. In the latter event, immunological tests34.
focal neurological deficits precede develop-
ment of symptoms and signs of intracranial
hypertension by several weeks to months. Neuroimaging studies
Hydrocephalus, involving lateral, third and

Seizures fourth ventricles, is the most common neu-
roimaging finding in meningeal cysticerco-
While seizures are common manifestations of sis55. Fibrous arachnoiditis can be seen as
parenchymal brain cysticercosis, they may also areas of abnormal enhancement of the lep-
occur in meningeal cysticercosis. Subarachnoid tomeninges at the base of the brain on com-
cysticerci located at the cortical surface of the puted tomography (CT) and magnetic
brain, between two cerebral convolutions, resonance imaging (MRI) (Fig. 18.4). In addi-
induce seizures by irritation of the subjacent tion, single or multiple subarachnoid and
cerebral cortex50. There is a lack of literature parenchymal brain cysts or calcifications may

182 O.H. Del Brutto
be noted, a finding that facilitates the diagno- However, other conditions with similar pre-
sis of neurocysticercosis (NC). Small sub- sentation, including fungal, tuberculous and
arachnoid cysts over the convexity of the carcinomatous meningitis should be consid-
cerebral hemispheres were considered rare in ered in the differential diagnosis. Angio-
initial CT studies of NC56,57. However, the graphic findings in cysticercotic angiitis
development of new generation CT equip- include segmental narrowing of the middle
ment and MRI led to the recognition of such cerebral artery, occlusion of the anterior or
lesions58,59. It is unusual for large cysts to middle cerebral arteries or even the internal
develop over the convexity of cerebral hemi- carotid artery, and mycotic aneurysms26–29,44,46.
spheres, although isolated cases have been The exact prevalence of angiographic abnor-
reported40. These cysts are spherical rather malities in NC is unknown. However, a recent
than multilobulated and in some cases, a report suggests that angiographically docu-
large hyperdense nodule corresponding to the mented arteritis is relatively common in
scolex may be seen. Large cysts usually have meningeal cysticercosis, including cases
a multilobulated appearance, displace neigh- without clinical or neuroimaging evidence of
bouring structures, and behave as space-occu- cerebral infarction61.
pying lesions in the Sylvian fissure, CT and MRI are often non-contributory in
cerebellopontine angle and the ambiens and the diagnosis of spinal meningeal cysticerco-
prepontine cisterns (Fig. 18.5)39,60. sis. Myelography may be useful in such situa-
Ischaemic cerebrovascular complications tions and may demonstrate multiple filling
are well visualized with CT and MRI42. defects in the column of contrast material cor-
Findings are, however, non-specific since the responding to the cysts. These cysts may be
appearance of NC-related cerebral infarcts is freely mobile within the spinal subarachnoid
similar to those due to other causes. The space and may change their position during
accompanying presence of subarachnoid cys- myelographic examination according to
tic lesions or abnormal enhancement of basal movements of the patient on the exploration
leptomeninges may establish a diagnosis of table. This finding is of diagnostic
meningeal cysticercosis in some instances43,44. significance30,54,62.
Fig. 18.4. Contrast-enhanced MRI of a patient Fig. 18.5. MRI showing a giant cysticercus in the
with severe cysticercotic arachnoiditis showing Sylvian fissure. Note the multilobulate appearance
abnormal enhancement of basal leptomeninges. of the lesion and the displacement of the midline.

Table 18.1. Differences between larval cellulose and racemose forms of Taenia solium.
Characteristics Metacestode form Racemose form
Shape Round Multilobulated

Scolex Present Absent
Diameter 1–20 mm 20–77 mm
Location Parenchymal, convexity Basal subarachnoid space
subarachnoid space
Number 1–2000 1–3
Cerebrospinal fluid manifestation Normal/abnormal Mostly abnormal
Clinical manifestation Seizures, headaches Intracranial hypertension, cranial
nerve palsies
Prognosis Relatively benign Severe
CSF analysis tolerance to the parasite without antibody

production, and false-positive results are due
Abnormalities in the cytochemical composi- to previous contact with the adult T. solium
tion of CSF have been reported in up to 80% or to cross-reactivity with other helminths34.
of patients with meningeal cysticercosis34,41. The complement fixation test is positive in
The most common finding is moderate more than 80% of patients with meningeal
mononuclear pleocytosis, with cell counts cysticercosis who have inflammatory
rarely exceeding 300 mm−3. However, as changes in the CSF but only in 22% of those
many as 5000 cells mm−3 (with predomi- who have a normal CSF analysis41. More
nance of neutrophils) may be observed in than 30% of patients with meningeal cys-
some instances48. Eosinophils are increased ticercosis may have a false-negative result
in almost 60% of cases with pleocytosis. and a similar percentage of individuals may
However, this finding is not diagnostic and have false-positive results with ELISA in the
may be seen in other infectious and non- serum64. In contrast, ELISA measuring anti-
infectious diseases. CSF glucose levels are cysticercal antibodies in CSF is more accu-
usually within the normal range despite rate (87% sensitivity and 95% specificity)65.
active meningeal disease. Indeed, normal The enzyme-linked immunoelectrotransfer
CSF glucose levels are useful in excluding a blot (EITB) assay is considered highly reli-
diagnosis of tuberculous meningitis, where able for the diagnosis of meningeal cysticer-
low CSF glucose levels are usual. However, cosis (94% to 98% sensitive and 100%
hypoglycorrhagia (< 40 mg dl−1) has been specific)66. One of the drawbacks of this
reported in 12–18% of NC patients9,41. Very assay is that it may be positive in individu-
low glucose levels (< 10 mg dl−1) have been als with taeniasis. Therefore, EITB results
associated with poor prognosis63. Elevated must be interpreted in context of the clinical
protein levels in the CSF are common in manifestations, neuroimaging findings and
patients with pleocytosis. Proteins are mod- the habitat of the patient. A positive EITB in
erately raised, usually 50–300 mg dl−1, serum is of questionable diagnostic value in
although protein levels as high as 1600 mg individuals with neurological disease in
dl−1 have been reported63. endemic areas, while is highly diagnostic in
those areas where cysticercosis is rare34. The
development of monoclonal antibody-based
Immunological tests ELISA to detect presence of cysticercal anti-
gens in CSF may improve diagnostic accu-
An immunological diagnosis of meningeal racy for meningeal cysticercosis67.
cysticercosis has the inherent problems of According to a recent report, the sensitivity
unsatisfactory sensitivity and specificity. of the test is 86% and its specificity is
False-negative results are related to immune 100%68.

184 O.H. Del Brutto
Treatment and Outcome noid cysts to intracranial blood vessels47.

Dexamethasone administration is useful in the
A common therapeutic scheme cannot be put prevention and management of this complica-
forward for the management of meningeal tion72. It is recommended that dexamethasone
cysticercosis on account of its variable clini- administration should precede the institution
cal, pathological and radiological behav- of anticysticercal therapy by a few days.
iour69,70. Therapy includes combinations of Furthermore, it may be used for several days
symptomatic drugs, specific anticysticercal after completion of anticysticercal therapy.
drugs, surgical resection of lesions and There is anecdotal evidence of the benefit of
placement of ventricular shunts35. Medical neuroprotective drugs, such as nimodipine, in
treatment of small convexity-subarachnoid the prevention of cerebral infarction during
cysts is similar to that of parenchymal brain anticysticercal drug administration to individ-
cysts, with the difference that albendazole uals with subarachnoid cysticerci75.
(15 mg kg−1 day−1 for 8 days) is the preferred The mainstay of management of hydro-
drug since it penetrates the subarachnoid cephalus due to cysticercotic arachnoiditis is
space better than praziquantel71. the placement of a ventricular shunt
There is controversy on the management of device70. The condition runs a protracted
giant subarachnoid cysts. Some authors rec- course and carries a poor prognosis owing
ommend surgical resection of these lesions40. to a high frequency of shunt dysfunction35.
However, medical therapy is equally effective A long-term follow-up study demonstrated
yet less aggressive69. There are several reports 50% mortality rate within the first 2 years of
of clinical and neuroimaging improvement ventricular shunting. The mortality corre-
with albendazole (Fig. 18.6)72–74. The inflam- lated with the number of surgical interven-
matory reaction that follows albendazole- tions to revise the shunt76. Shunt
induced cyst degeneration may lead to dysfunction manifests with headache, vom-
occlusive endarteritis resulting in cerebral iting and progressive deterioration of the
infarction due to the proximity of subarach- neurological status. Prompt recognition is
Fig. 18.6. CT before (a) and 3 months after (b) albendazole therapy of a patient with a subarachnoid
cysticercus in the interhemispheric fissure. Note resolution of lesion as the result of therapy.

important to avoid further neurological shunt. A drawback of the new shunt device
damage. The continued administration of was insufficient drainage of CSF, a problem
prednisone in doses of 50 mg three times a that may be resolved by increasing the
week for up to 2 years can reduce the risk cross-sectional internal area of the peri-
of shunt dysfunction from 60% to 13%77. toneal end of the catheter.
Sotelo recently designed a new shunt
device that functions at a constant flow
without a valvular mechanism78. This pre- Conclusions
vents the entry of spinal CSF into the ven-
tricular system towards the inlet of the Meningeal cysticercosis involves the basal
shunt device. The inversion of CSF transit CSF cisterns or the convexity CSF spaces.
is one of the most common causes of shunt The pathological appearance is one of
dysfunction as it allows the entry of sub- grape-like multilobulated vesicles, without
arachnoid inflammatory cells and parasitic a scolex, occupying much of the volume of
debris into the ventricular system79. A the basal cistern or of small cystic struc-
recent study reported good shunt function tures with a scolex over the cerebral con-
at a mean of 9 months in 96% of patients vexity. Focal neurological deficits,
with hydrocephalus due to cysticercotic meningitis and intracranial hypertension
arachnoiditis80. Another study compared are the most common presenting clinical
the effectiveness of this new shunt with features. In addition, convexity meningeal
that of a conventional Pudenz-type shunt81. cysticerci may present with seizures.
One year after follow-up, the Pudenz-type Imaging studies reveal a constellation of
shunt had to be withdrawn or surgically findings in varying combination: cysts,
revised in 45% of the patients. This com- infarcts and hydrocephalus. Treatment
pared with the requirement of shunt revi- includes surgical and medical options. A
sion in 30% of those with the new shunt judicious choice between the use of the
implant. The main cause of shunt dysfunc- anticysticercal drug, albendazole for small
tion in Pudenz-type shunt is shunt occlu- cysts, and surgery for large cysts and
sion. This complication is rare with the new hydrocephalus needs to be made.
References
1. Virchow, R. (1860) Helmintologischen Notizen 5. Traubenhydatiden der weichen Hirnhaut. Virchows

Archiv für Pathologische Anatomie un Physiologie und für Klinische Medizin 16, 528–535.
2. Henneberg, R. (1912) Die tierischen Parasiten des Zentralnervensystems. I. Des Cysticercus cellu-
losae. In: Lewandowsky, M. (ed.) Handbuch der Neurologie, Vol. III, Spezielle Neurologie II. Verlag von
Julius Springer, Berlin, pp. 643–709.
3. Moniz, E., Loff, R., Pacheco, L. (1932) Sur le diagnostic de la cysticercose cérébrale. A propos de
deux cas. L’Encéphale 27, 42–53.
5. Escobar, A. (1952) Cisticercosis cerebral. Con el estudio de 20 casos. Archivos Mexicanos Neurologia y
Psiquiatria 1, 149–167.
6. Bickerstaff, E.R., Cloake, P.C.P., Hughes, B., et al. (1952) The racemose form of cerebral cysticercosis.
Brain 75, 1–18.
7. Bickerstaff, E.R., Small, J.M., Woolf, A.L. (1956) Cysticercosis of the posterior fossa. Brain 79,
622–634.
8. Loo, L., Braude, A. (1982) Cerebral cysticercosis in San Diego. A report of 23 cases and a review of
the literature. Medicine 61, 341–359.

186 O.H. Del Brutto
9. McCormick, G.F. (1985) Cysticercosis – Review of 230 patients. Bulletin of Clinical Neurosciences 50,
76–101.
10. Rodacki, M.A., Detoni, X.A., Teixeira, W.R., et al. (1989) CT features of cellulosae and racemosus
neurocysticercosis. Journal of Computer Assisted Tomography 13, 1013–1016.
11. Suh, D.C., Chang, K.H., Han, M.H., et al. (1989) Unusual MR manifestations of neurocysticercosis.
Neuroradiology 31, 396–402.
12. Biagi, F.F., Briceño, C.E., Martínez, B. (1961) Diferencias entre Cysticercus cellulosae y Cysticercus race-
mosus. Revista de Biologia Tropical (México) 9, 141–151.
13. Grove, D.I. (1990) A History of Human Helminthology. CAB International, Wallingford, UK, pp.
355–383.
14. Flisser, A. (1994) Taeniasis and cysticercosis due to Taenia solium. In: Sun, T. (ed.) Progress in Clinical
15. Pittella, J.E.H. (1997) Neurocysticercosis. Brain Pathology 7, 681–693.
16. Lumsden, R.D., Voge, M., Sogandares-Bernal, F. (1982) The metacestode tegument: fine structure,
development, topochemistry, and interactions with the host. In: Flisser, A., Willms, K., Laclete, J.P.,
et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp.
307–361.
17. Escobar, A., Nieto, D. (1972) Parasitic diseases. In: Minckler, J. (ed.) Pathology of the Nervous System,
Vol. 3. McGraw-Hill, New York, pp. 2503–2521.
18. Escobar, A. (1983) The pathology of neurocysticercosis. In: Palacios, E., Rodriguez-Carbajal, J.,
Taveras, J.M. (eds.) Cysticercosis of the Central Nervous System. Charles C. Thomas, Springfield,
Illinois, pp. 27–54.
19. Valkounova, J., Zdarska, Z., Slais, J. (1992) Histochemistry of the racemose form of Cysticercus cellu-
losae. Folia Parasitoligica (Praha) 39, 207–226.
20. Rabiela, M.T., Rivas, A., Castillo, S., et al. (1985) Pruebas morfológicas de que C. cellulosae y C. race-
mosus son larvas de Taenia solium. Archives of Investigative Medicine (México) 16, 83–86.
21. Rabiela, M.T., Rivas, A., Flisser, A. (1989) Morphological types of Taenia solium cysticerci. Parasitology
Today 5, 357–359.
22. Del Brutto, O.H., Guevara, J., Sotelo, J. (1988) Intrasellar cysticercosis. Journal of Neurosurgery 69,
58–60.
23. Revuelta, R., Juambelz, P., Balderrama, J., et al. (1995) Contralateral trigeminal neuralgia. A new clin-
ical manifestation of neurocysticercosis: case report. Neurosurgery 37, 138–140.
24. Estañol, B., Kleriga, E., Loyo, M., et al. (1983) Mechanisms of hydrocephalus in cerebral cysticercosis:
implications for therapy. Neurosurgery 13, 119–123.
25. Del Brutto, O.H. (1992) Cysticercosis and cerebrovascular disease: a review. Journal of Neurology,
26. Monteiro, L., Almeida-Pinto, J., Leite, I., et al. (1994) Cerebral cysticercus arteritis: five angiographic
cases. Cerebrovascular Disease 4, 125–133.
27. Rodriguez-Carbajal, J., Del Brutto, O.H., Penagos, P., et al. (1989) Occlusion of the middle cerebral
artery due to cysticercotic angiitis. Stroke 20, 1095–1099.
28. terPenning, B., Litchmanm, C.D., Heier, L. (1992) Bilateral middle cerebral artery occlusions in neu-
rocysticercosis. Stroke 23, 280–283.
29. Soto-Hernández, J.L., Gomez-Llata, S., Rojas-Echeverri, L.A., et al. (1996) Subarachnoid haemor-
rhage secondary to a ruptured inflammatory aneurysm: a possible manifestation of neurocysticerco-
sis: case report. Neurosurgery 38, 197–200.
30. Kim, K.S., Weinberg, P.E. (1985) Spinal cysticercosis. Surgical Neurology 24, 80–82.
31. De Souza-Queiroz, L., Filho, A.P., Callegaro, D., et al. (1975) Intramedullary cysticercosis: case
report, literature review and comments on pathogenesis. Journal of the Neurological Sciences 26, 61–70.
32. Sperlescu, A., Balbo, R.J., Rossitti, S.L. (1989) Breve comentário sobre a patogenia da cisticercose
espinhal. Arquivos de Neuropsiquiatria 47, 105–109.
33. Del Brutto, O.H., Sotelo, J. (1988) Neurocysticercosis: an update. Review of Infectious Diseases 10,
1075–1087.
34. Del Brutto, O.H., Sotelo, J., Román, G.C. (1998) Neurocysticercosis: a Clinical Handbook. Swets &
Zeitlingler, Lisse, the Netherlands.
35. Bandres, J.C., White, A.C., Jr, Samo, T., et al. (1992) Extraparenchymal neurocysticercosis: report of
five cases and review of management. Clinical Infectious Disease 15, 799–811.

36. Keane, J.R. (1982) Neuro-ophthalmologic signs and symptoms of cysticercosis. Archives of
Ophthalmology 100, 1445–1448.
37. Keane, J.R. (1993) Cysticercosis: unusual neuro-ophthalmologic signs. Journal of Clinical Neuro-oph-
thalmology 13, 194–199.
38. Santoyo, H., Corona, R., Sotelo, J. (1991) Total recovery of visual function after treatment for cerebral
cysticercosis. New England Journal of Medicine 324, 1137–1139.
39. Celis, M.A., Mourier, K.L., Polivka, M., et al. (1992) Cysticercose cisternale de l’ángle ponto-cerebel-
laux. Observatión d’un cas operé et revue de la literature. Neurochirurgie 38, 108–112.
40. Ramina, R., Hunhevicz, S.C. (1986) Cerebral cysticercosis presenting as mass lesions. Surgical
inactive forms. Archives of Internal Medicine 145, 442–445.
42. Cantú, C., Barinagarrementeria, F. (1996) Cerebrovascular complications of neurocysticercosis.
Clinical and neuroimaging spectrum. Archives of Neurology 53, 233–239.
43. Barinagarrementeria, F., Del Brutto, O.H. (1988) Neurocysticercosis and pure motor hemiparesis.
Stroke 19, 1156–1158.
44. Barinagarrementeria, F., Del Brutto, O.H. (1989) Lacunar syndrome due to neurocysticercosis.
45. McCormick, G.F., Giannotta, S., Zee, C.S., et al. (1983) Carotid occlusion in cysticercosis. Neurology
33, 1078–1080.
46. Levy, A.S., Lillehei, K.O., Rubinstein, D., et al. (1995) Subarachnoid neurocysticercosis with occlu-
sion of the major intracranial arteries: case report. Neurosurgery 36, 183–188.
47. Bang, O.Y., Heo, J.H., Choi, S.A., et al. (1997) Large cerebral infarction during praziquantel therapy
in neurocysticercosis. Stroke 28, 211–213.
48. Bonametti, A.M., Baldy, J.L.S., Bortoliero, A.L., et al. (1994) Neurocisticercose com quadro clínico ini-
cial de meningite aguda. Revista do Instituto de Medicina Tropical de São Paulo 36, 27–32.
49. Keane, J.R. (1984) Death from cysticercosis. Seven patients with unrecognized obstructive hydro-
cephalus. Western Journal of Medicine (San Fransisco) 140, 787–789.
50. Del Brutto, O.H., Santibañez, R., Noboa, C.A., et al. (1992) Epilepsy due to neurocysticercosis: analy-
sis of 203 patients. Neurology 42, 389–392.
51. Carydakis, C., Baulac, M., Laplane, D., et al. (1984) Cysticercose spinale pure. Note sur le liquide
céphalorachidien. Revue Neurologique (Paris) 140, 590–593.
52. Malzacher, V.D., Bogumil-Schott, E., Neu, I.S. (1994) Intraspinale manifestation der zystizerkose –
Cysticercus racemosus. Nervenarzt 65, 563–567.
53. Kahn, P. (1972) Cysticercosis of the central nervous system with amyotrophic lateral sclerosis: case
report and review of the literature. Journal of Neurology, Neurosurgery and Psychiatry 35, 81–87.
54. Hyman, A.D., Gary, C.E., Lanzieri, C., et al. (1986) Tapeworm cysts of the cauda equina. AJNR
American Journal of Neuroradiology 7, 977.
55. Rodriguez-Carbajal, J., Arredondo-Estrada, H., Vázquez-Sánchez, H. (1990) La neuroradiología de
la neurocisticercosis humana. Revista Mexicana de Radiologia 44, 157–164.
56. Carbajal, J.R., Palacios, E., Azar-Kia, B., et al. (1977) Radiology of cysticercosis of the central nervous
system including computed tomography. Radiology 125, 127–131.
57. Bentson, J.R., Wilson, G.H., Helmer, E., et al. (1977) Computed tomography in intracranial cysticer-
cosis. Journal of Computer Assisted Tomography 1, 464–471.
58. Suss, R.A., Maravilla, K.R., Thompson, J. (1986) MR imaging of intracranial cysticercosis: compari-
son with CT and anatomopathologic features. AJNR American Journal of Neuroradiology 7, 235–242.
59. Martinez, H.R., Rangel-Guerra, R., Elizondo, G., et al. (1989) MR imaging in neurocysticercosis: a
study of 56 cases. AJNR American Journal of Neuroradiology 10, 1011–1019.
60. Berman, J.D., Beaver, P.C., Cheever, A.W., et al. (1981) Cysticercus of 60-milliliter volume in human
brain. American Journal of Tropical Medicine and Hygiene 30, 616–619.
61. Barinagarrementeria, F., Cantu, C. (1996) Cysticercotic arteritis: frequency in subarachnoid cysticer-
cosis. Neurology 46, A240 (Abstract).
62. Hernández-Gonzalez, L.A., Arredondo-Mendoza, F., Prado-Castro, J.A. (1990) Neurocisticercosis
raquimedular en Guatemala. Descripción del signo de ‘lesión quística flotante’. Revista Mexicana de
Radiologia 44, 165–169.
63. McCormick, G.F., Zee, C.S., Heiden, J. (1982) Cysticercosis cerebri. review of 127 cases. Archives of

188 O.H. Del Brutto
64. Ramos-Kuri, M., Montoya, R.M., Padilla, A., et al. (1992) Immunodiagnosis of neurocysticercosis.
Disappointing performance of serology (enzyme-linked immunosorbent assay) in an unbiased sam-
ple of neurological patients. Archives of Neurology 49, 633–636.
65. Rosas, N., Sotelo, J., Nieto, D. (1986) ELISA in the diagnosis of neurocysticercosis. Archives of
66. Richards, F., Jr, Schantz, P.M. (1991) Laboratory diagnosis of cysticercosis. Clinical Laboratory
Medicine 11, 1011–1028.
67. Wang, C.Y., Zhang, H.H., Ge, L.Y. (1992) A Mab-based ELISA for detecting circulating antigen in
CSF of patients with neurocysticercosis. Hybridoma 11, 825–827.
68. Garcia, H.H., Harrison, L.J.S., Parkhouse, R.M.E., et al. (1998) A specific antigen-detection ELISA for
the diagnosis of human neurocysticercosis. Transactions of the Royal Society of Tropical Medicine and
Hygiene 92, 411–414.
69. Del Brutto, O.H., Sotelo, J., Román, G.C. (1993) Therapy for neurocysticercosis: a reappraisal.
70. White, A.C., Jr (2000) Neurocysticercosis. Current Treatment of Infectious Diseases 2, 78–87.
71. Jung, H., Hurtado, M., Sanchez, M., et al. (1990) Plasma and CSF levels of albendazole and prazi-
quantel in patients with neurocysticercosis. Clinical Neuropharmacology 13, 559–564.
72. Del Brutto, O.H., Sotelo, J., Aguirre, R., et al. (1992) Albendazole therapy for giant subarachnoid cys-
ticerci. Archives of Neurology 49, 535–538.
73. Del Brutto, O.H. (1997) Albendazole therapy for subarachnoid cysticerci: clinical and neuroimaging
analysis of 17 patients. Journal of Neurology, Neurosurgery and Psychiatry 62, 659–661.
74. Castellanos, F., Montes, I., Porras, L.F., et al. (2000) Quistes subaracnoideos gigantes por neurocis-
ticercosis: a propósito de dos casos observados en un área rural de Extremadura. Revue Neurologique
(Paris) 30, 433–435.
75. Del Brutto, O.H. (1997) Clues to prevent cerebrovascular hazards of cysticidal drug therapy. Stroke
28, 1088.
76. Sotelo, J., Marin, C. (1987) Hydrocephalus secondary to cysticercotic arachnoiditis. A long-term fol-
low-up review of 92 cases. Journal of Neurosurgery 66, 686–689.
77. Roman, R.A.S., Soto-Hernández, J.L., Sotelo, J. (1996) Effects of prednisone on ventriculoperitoneal
shunt function in hydrocephalus secondary to cysticercosis: a preliminary study. Journal of
Neurosurgery 84, 629–633.
78. Sotelo, J. (1993) A new ventriculoperitoneal shunt for treatment of hydrocephalus. Experimental
results. RBM European Journal of Biomedical Technology 15, 257–262.
79. Rubalcava, M.A., Sotelo, J. (1995) Differences between ventricular and lumbar cerebrospinal fluid in
hydrocephalus secondary to cysticercosis. Neurosurgery 37, 668–672.
80. Sotelo, J., Rubalcava, M.A., Gomez-Llata, S. (1995) A new shunt for hydrocephalus that relies on
CSF production rather than on ventricular pressure: initial clinical experiences. Surgical Neurology
43, 324–332.
81. Sotelo, J. (1996) Update: the new ventriculoperitoneal shunt at the Institute of Neurology of Mexico.
Surgical Neurology 46, 19–20.

19 Heavy Multilesional Cysticercotic

Syndromes
Oscar H. Del Brutto, Hector H. García and Sudesh Prabhakar
Introduction ticerci of homogeneously small size (Fig.

19.1) was first described by Stepien and
Most individuals with neurocysticercosis Chorobsky, in 19495, and was re-visited after
(NC) have one or a few cysts in the brain, con- the introduction of computed tomography
stituting what is appreciated as the benign (CT) scanning by Rangel et al. in 19876. Its
end of the clinical spectrum of the disorder1–3. clinical manifestations are related to severe
However, among the wide spectrum of infec- intracranial hypertension due to the inflam-
tion and clinical manifestations of human matory reaction around several dying cys-
Taenia solium cysticercosis, a small subset of ticerci. There probably is a booster effect
individuals harbour massive infections and caused by the simultaneous degeneration of
develop clinical manifestations related to it1–4. many parasites at the same time. Some
Clinical presentations vary even within this authors have attributed this syndrome to the
subset. We will review separately the more phase of brain invasion by the embryos.
defined presentations of heavy infections in Although the latter theory cannot be dis-
human cysticercosis, according to Table 19.1. carded, it does not account for the long dura-
tion of symptoms (several months) in most
cases reported6. Moreover, the development
Cysticercotic Encephalitis of cystic parasite vesicles has been shown to
take only a few weeks in experimental infec-
Characteristics tion in pigs. The severity of the clinical pic-
ture will depend on the number of the
This syndrome of intracranial hypertension parasites and the degree of inflammation
associated with multiple parenchymal cys- and can be severe enough to be fatal.
Table 19.1. Principal neurocysticercosis (NC) syndromes characterized by heavy infestations.
Syndrome Localization Characteristics
Cysticercotic encephalitis Brain parenchyma Severe inflammation with intracranial hyper-

tension
Heavy non-encephalitic NC Brain parenchyma Massive brain infection with minimal
inflammatory response
Disseminated cysticercosis Anywhere in the body Involvement of several organs


190 O.H. Del Brutto et al.
between white and grey matter. Upon con-

trast-enhanced CT, multiple small ring/disc
lesions are noted. In the past, several
authors have described CT appearances of
diffuse brain oedema without any identifi-
able cystic lesions, giving rise to a considera-
tion of benign intracranial hypertension9,10.
This was often seen with older generation
CT scans; however, with more contempo-
rary CT infrastructure and magnetic reso-
nance imaging (MRI), the cysticercal
aetiology cannot be missed.
Therapy and outcome
The mainstay of medical treatment is the use

of corticosteroids to control the inflamma-
tory reaction11. Dexamethasone has been
Fig. 19.1. Post-gadolinum T1 weighted coronal reported to achieve this successfully,
MRI demonstrating cysticercotic encephalitis. although required doses may be as high as
32 mg day−1. Furosemide, glycerol and
osmotic agents are useful adjuncts. On occa-
sion, resort to decompressive craniotomy or
Clinical manifestations craniectomy may be undertaken in order to
control intracranial hypertension that threat-
Cysticercotic encephalitis seems to occur ens vision or life. The use of anticysticercal
more frequently in females and at younger agents, either albendazole or praziquantel, is
ages, and has also been described in series of contraindicated since they may lead to more
paediatric NC7,8. Seven of the eight patients degeneration of parasites and worsen the
in the series described by Rangel et al. were intracranial hypertension. A number of
females, 10–27 years of age6. Symptoms were affected individuals for whom follow-up is
noted for a maximum of 18 months (mean: 6 available required readmission for manage-
months) before diagnosis. Presenting symp- ment of intracranial hypertension6,7. At
toms include headaches that intensify times, the latter may prove fatal. Other
rapidly prior to diagnosis and seizures6. important sequelae of cysticercotic enceph-
Among the clinical signs, those due to alitis include loss of vision and neuropsychi-
intracranial hypertension including papil- atric impairment.
loedema often leading on to secondary optic
atrophy, false localizing third and sixth cra-
nial nerve palsies, deep tendon hyperreflexia Heavy Non-encephalitic NC
and Babinski’s responses are noteworthy6.
Characteristics
Imaging Two of the authors (OHD and HHG) have

recently described a different syndrome with
Computed tomography discloses multiple multiple cerebral parenchymal cysticerci of
or confluent hypodense areas representing homogeneously small size (Fig. 19.2). This
intense brain oedema6,9. The presence and condition called heavy non-encephalitic NC
severity of the oedema can be appreciated differs from cysticercotic encephalitis in that
from the effacement of sulci, reduced ven- no inflammatory reaction can be seen around
tricular size and loss of differentiation the cysts, i.e. all parasites are viable and,

Heavy Multilesional Cysticercotic Syndromes 191
our series at the time of diagnosis of NC12.

Whether the presence of an intestinal tape-
worm, besides being a close source of infec-
tion, relates to the mild symptomatic
expression of this syndrome has not been
determined12,13.
Imaging features
Several hundred non-enhancing homoge-

neously sized, viable cysts are noted
throughout the brain parenchyma upon CT
and MRI (Fig. 19.2). A scolex is demonstrable
in the majority of the cysts.
Therapy
Adequate control of seizures with

antiepileptic drugs (AEDs) is mandatory, as
in other varieties of NC with seizures. Since
Fig. 19.2. T1 weighted axial MRI showing heavy
it is expected that most cysts will leave
non-encephalitic neurocysticercosis.
residual calcifications and thus predispose
to seizure relapse in the future, the use of
AED/s will probably be required for the
therefore, do not enhance with contrast upon life of the patients. Available options in
CT/MRI12. It also differs from disseminated specific therapy include the use of anticys-
cysticercosis, described in the following sec- ticercal drugs or inactive observation
tion, by comparatively fewer parasitic num- allowing the parasites to go through nat-
bers and absence of overwhelming ural involution and then control inflamma-
involvement of the muscle and subcuta- tion with long-term corticosteroid therapy.
neous tissue. As a rough rule, there are a few The use of anticysticercal drugs in heavy
hundred live parasites in heavy non- non-encephalitic cysticercosis has been
encephalitic NC, while the number in dis- demonstrated to be effective in destroying
seminated cysticercosis is in thousands. the cysts but may lead to severe side effects
at the time of death of the cysts. Often,
more than one course of anticysticercal
Clinical manifestations therapy is required12,14. Observational clini-
cal and pharmacological data suggest that
There is no clear predominance of this syn- the action of albendazole is less abrupt than
drome by sex and the condition seems to that of praziquantel; therefore we suggest
occur more frequently during the third or the former at first election. In this case,
fourth decades of life. Its clinical manifesta- simultaneous use of corticosteroids (dex-
tions are mild. Patients present with amethasone, 0.1 mg kg−1 day−1 and increas-
seizures, and subtle neuropsychological ing doses according to the clinical
abnormalities. Features of intracranial condition) is mandatory. If anticysticercal
hypertension are absent or mild in most drugs are not used, then serial imaging
patients. Involvement of other parts of the evaluations should be performed at least
body is frequent but not predominant. once every year, and the use of depot corti-
Interestingly, intestinal tapeworms were costeroids is suggested to avoid sequelae of
detected in up to 90% of the individuals in parasite involution.

Disseminated Cysticercosis nodules and muscle pains were the first

symptoms14,15,20–22,29,33. Muscular pseudohy-
Characteristics pertrophy followed these initial symptoms
by a few weeks to 1 year. The onset of mus-
The term, ‘disseminated cysticercosis’ was cular pseudohypertrophy is often marked by
coined by Priest in 1926 to refer to the pres- a transient febrile illness and skin
ence of a plethora of cysticerci in multiple rash14,22,25,29. Two patients reported by Wadia
locations in the same patient15. The loca- et al., developed skin rash after the adminis-
tions include the subcutaneous tissue, mus- tration of praziquantel14. Muscle pain and
cles, eye, brain and heart15–17. Sporadic tightness are important symptoms but may
descriptions of this condition have not be forthcoming in certain patients
appeared mainly in literature published because of associated cognitive impairment.
from India and China14,18–33. The number of
reported cases since then have been few by
all standards and apart from a few excep-
tions have emanated from India. We stud-
ied clinical and laboratory features in 18
cases that have been reported in the English
literature14,19–30,33.
Two important phenomena contribute to
the unique symptom complex of dissemi-
nated cysticercosis. One is the sheer number
of live cysticerci. The second is the absence
of a host inflammatory response to cysticerci.
Factors responsible for the massive cyst load
and the absence of an inflammatory response
are not known. Unlike the recent description
of the association between heavy non-
encephalitic parenchymal cysticercosis and
intestinal taeniasis, none of the reports of
disseminated cysticercosis mention an asso-
ciation with intestinal taeniais based on fae-
cal evaluations or recent or remote history of
intestinal taeniasis12. A good number of
reported subjects ate pork, but the condition
has been reported in vegetarians as well,
suggesting that it was not necessary to har-
bour adult worms in order to develop mas-
sive dissemination25,26.
Clinical manifestations
Disseminated cysticercosis typically presents

in young age (mean ±SD of reviewed cases:
22 ±10 years; range: 9–45 years). Among
reported cases, males were twice as com-
monly affected as females.
Muscular pseudohypertrophy (Fig. 19.3)
was the presenting complaint in eight Fig. 19.3. Muscular pseudohypertrophy due to
reported cases19,21,24,27,29. In the remaining disseminated cysticercosis. (Reproduced with
reports, seizures, dementia, subcutaneous permission from reference 27.)

Muscular pseudohypertrophy is notice- identified at physical examination when

able in the calves, thighs, arms, glutei, present. A helpful tool is to ask the patient
trapezius, nuchal muscles and masseters. about noticing the nodules. It should be
Usually, there is smooth enlargement of noted here that subcutaneous cysticerci are
muscles, but a few authors have described more frequently reported in Asia than in
nodularity20,22. Pseudohypertrophy often Latin America despite similar endemicity of
assumes Herculean proportions. MacRobert’s disease38. Subcutaneous cysticercosis is
description of a man ‘who went to hospital invariably associated with muscle involve-
because of gross alteration in his physical ment. Ocular cysts may be noted by careful
appearance, which had come to resemble examination14,15,20,21. Dementia and behav-
that of a professional wrestler to the amuse- ioural disturbances have been reported in
ment of his friend and dismay of his house- approximately 50% of the reviewed
hold’ is apt in this regard23. Cysticercal cases14,20–22,29. Strangely, despite the massive
muscular pseudohypertrophy is easily dis- infestation of the brain, focal neurological
tinguished from other more common causes deficits and intracranial hypertension are
of pseudohypertrophy like Duchenne’s and rare22,29.
Becker’s muscular dystrophy by the short
history, age of onset and associated central
nervous system symptoms. Muscles may Laboratory investigations
rarely be tender on palpation though com-
monly there is no tenderness20–23. Muscular Soft-tissue calcifications are lacking in the
weakness is mild and never profound. In majority of cases but a few authors have
certain cases, it may not be possible to detect reported diminutive spotty calcifications in
and quantify weakness on account of limb radiographs of individuals with dis-
impaired cognitive status14. Jolly and Pallis seminated cysticercosis. Most reports have
stressed the absence of muscular weakness not alluded to the status of muscle enzymes
in their patients, all of whom had significant in this condition. Wadia et al. categorically
dementia21. Rao et al. described a patient described normal serum creatine kinase lev-
with muscular pseudohypertrophy with no els in two of their patients with pseudohy-
detectable weakness or central nervous pertrophy14. Electromyographic sampling of
system involvement25. Deep tendon reflexes muscle was unremarkable in two cases and
may be absent, normal or even brisk22,25,28. showed features of an inflammatory
It is worthwhile to stress here that mus- myopathy in one case described by the
cular involvement, though common, is authors. Eosinophilia is an important sup-
rarely symptomatic (except in pseudohyper- porting feature in the laboratory diagnosis
trophic myopathy) in cysticercosis. In the of this condition. CT of the brain has been
past, muscular involvement was detected performed in only the most recently
when plain radiographs were performed reported cases14. A unifying feature is the
either for diagnostic purposes or because of presence of a plethora of live, not calcified
unrelated medical conditions34–37. In a well- cysts throughout the cerebral parenchyma
known series of 450 British soldiers return- (Fig. 19.4a). Wadia et al. analysed the CT
ing from India, over 70% were diagnosed as appearance of muscle infested by cysticerci
having muscle calcifications sometime dur- and described profuse infestation by large
ing their follow-up38. This can not be inter- numbers giving rise to a honeycomb
preted as a usual frequency, however, since appearance (Fig. 19.4b)14. Cysts in the mus-
many of these cases were diagnosed by this cle were larger than those in the brain and
finding and thus there was a strong selection scolices were more difficult to identify.
bias in the series34–37. Cysticercal invasion of the muscle has
The obviously more noticeable clinical been demonstrated histologically in all
manifestations of disseminated cysticercosis reported patients except one. Cysts are alive,
arise from cerebral and ocular involvement, 3–30 mm in size, and have scolices without
and subcutaneous cysticerci that are easily calcification. Jolly and Pallis stressed the

Therapy and outcome
The majority of published reports do not

describe follow-up. A limited follow-up of
one case described by McGill revealed per-
sisting pseudohypertrophy for at least 19
months22. It would be interesting to specu-
late that the radiological picture of multiple
profuse soft-tissue calcifications is a sequel to
cysticercal infestation in muscular pseudo-
hypertrophy. However, no case of cysticercal
muscular pseudohypertrophy has been fol-
lowed up to the point of calcification. A more
realistic description of overall outcome is
death due the effects of cysticercal infesta-
tion at other sites, particularly the brain14.
One of the patients reported by Wadia et al.
died of status epilepticus within 5 months of
presentation. Another died after the institu-
tion of praziquantel therapy and a third had
a sudden death 2 months after presentation.
The cause of death in the third patient is not
clear, but it may be interesting to speculate
an anaphylactic reaction due to massive
release of cysticercal antigens from degener-
ating cysts as the cause of death.
Wadia et al. treated their patients with dis-
seminated cysticercosis with praziquantel
and noted an adverse prognosis. Muscle
girth initially increased with praziquantel
treatment but ultimately resolved in two
patients. The third patient died very soon
after the institution of anticysticercal therapy.
In contrast with the adverse results of prazi-
quantel administration noted by Wadia et al.
several Chinese authors have reported
Fig. 19.4. CT scan of the brain (a) and muscle (b) improved outcome with treatment31,32.
of a patient with disseminated cysticercosis. It is imperative that orbital cysticercosis
(Source: Noshir H. Wadia, Mumbai, India.) (ocular or extraocular cysts) should be care-
fully searched for in all cases of disseminated
cysticercosis. The reason for this is that
observation of tense cysts, implying early cyst/s in these locations may damage visual
degeneration during involution of function if treated inadvertently. Up till now,
cysticerci21. Microscopically, all features of the treatment of choice for ocular cysticerco-
cysticercus cellulosae can be identified, sis has been surgical excision with vitrec-
including calcareal corpuscles and the tomy, although there are recent reports of
canalicular system. The cysts are sur- using albendazole along with local corticos-
rounded by an inflammatory infiltrate of teroid injections (see Chapter 28). Targeting
round cells. Inflammatory as well as necrotic NC is the next therapeutic priority; these
changes in the muscle have been exception- patients should be approached as described
ally noted25,29. More typically, the muscle is above for non-encephalitic NC. The use of
histologically normal. symptomatic treatment including AEDs; an

individualized decision on the use of anti- result from either a massive load of T. solium
cysticercal drugs; adequate supportive mea- eggs, or a continued source of infection, and
sures when using them; maintenance of the degree of inflammation, closely correlated
imaging surveillance; and long-term corti- to the clinical expression, is probably depen-
costeroid therapy if anticysticercal agents are dent on the previous exposure of the host
not prescribed, are all important aspects of immune system to T. solium antigens41,42.
the treatment plan. Subcutaneous and mus-
cular cysticercosis do not require specific
therapy unless mass effects due to cyst Conclusions
clumps occur. In these cases, either surgical
excision or anticysticercal therapy is effective Three major clinical syndromes with heavy,
(again, after first ruling out the possibility of multilesional cysticercosis have been
ocular or cerebral cysticercosis). described. The first, cysticercotic encephalitis,
is characterized by a profuse inflammatory
response to several degenerating cysticerci in
Comment the cerebral parenchyma, giving rise to cere-
bral oedema and intracranial hypertension.
Evidence from animal studies (Gonzalez et In the second condition, known as ‘heavy non-
al., unpublished data, 2001) and data on soft- encephalitic NC’, there are hundreds of live,
tissue roentgenograms from older series of active and viable cysts throughout the brain
cysticercosis suggest that almost all human parenchyma with no surrounding oedema.
cases of NC are disseminated to an extent. The condition, which is not catastrophic like
This dissemination, however, does not cause cysticercotic encephalitis, manifests with
discernible manifestations because infection intracranial hypertension and neuropsychi-
is controlled by the host immunity in sites atric features. The third form, i.e. ‘dissemi-
other than the brain39. If this is the case, the nated cysticercosis’, implies the existence of
heavy infections described hitherto imply cysticerci, again live, in still larger numbers,
that either the host’s immune system is ill- probably thousands, throughout the brain,
prepared to counteract tissue infection, or muscles, skin and eyes. The latter presents
that the infecting parasite load was large with muscular pseudohypertrophy in addi-
enough to overcome the host’s ability to tion to dementia and other neuropsychiatric
destroy cysts. Although the diagnosis of cys- disturbances. The clinical behaviour and
ticercosis in these cases will easily fulfil the imaging characteristics of the three syn-
recommended criteria for NC40, identification dromes differ; however, a uniting feature is
of specific syndromes is necessary for sound the proclivity of anticysticercal therapy to
and appropriate therapy. Since only a few cause serious, often life-threatening adverse
reports of each syndrome are available, some effects due to massive inflammatory oedema
degree of overlap between them does occur. and intracranial hypertension that may fol-
In any case, one or more of these syndromes low death of the cysticerci. Therefore,
can be clearly identified when a patient pre- extreme caution is to be exercised if resort to
sents with massive infection. All these forms anticysticercal therapy is sought.
References
1. Del Brutto, O.H., Sotelo, J., Román, G.C. (1997) Neurocysticercosis. A Clinical Handbook. Swets and
Zeiliger, Lisse, the Netherlands, pp. 207.
2. García, H.H., Martinez, S.M. (1999) Taenia solium Taeniasis/Cysticercosis, 2nd edn. Editorial
Universo, Lima, Peru, pp. 346.
3. Garcia, H.H., Del Brutto, O.H. (2000) T. solium taeniasis/cysticercosis. Infectious Diseases Clinics of
North America 14, 97–120.

5. Stepien, L., Chorobsky, J. (1949) Cysticercosis cerebri and its operative treatment. Archives of
6. Rangel, R., Torres, B., Del Brutto, O., et al. (1987) Cysticercotic encephalitis: a severe form in young
females. American Journal of Tropical Medicine and Hygiene 36, 387–392.
7. Del Brutto, O.H., Garcia, E., Talamas, O., et al. (1988) Sex-related severity of inflammation in
parenchymal brain cysticercosis. Archives of Internal Medicine 148, 544–547.
8. Lopez-Hernandez, A., Garayzar, C. (1982) Analysis of 89 cases of infantile cerebral cysticercosis. In:
Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives.
9. Sharma, K., Gupta, R.K. (1993) Scan negative neurocysticercosis. Pediatric Neurosurgery 19, 206–208.
10. Agapejev, S., Yela, D.A., Gomes, A.E. (1998) Edema cerebral crônico na neurocisticercose. Arquivios
de Neuropsiquiatria 56, 569–576.
11. Del Brutto, O.H., Sotelo, J., Roman, G.C. (1993) Therapy for neurocysticerosis: a reappraisal. Clinical
Infectious Diseases 17, 730–735.
12. García, H.H., Del Brutto, O.H., and The Cysticercosis Working Group in Perú (1999) Heavy non-
encephalitic cerebral cysticercosis in tapeworm carriers. Neurology 53, 1582–1584.
13. Gilman, R.H., Del Brutto, O.H., García, H.H., et al. (2000) Prevalence of taeniosis among neurocys-
ticercosis patients is related to the severity of cerebral infection. Neurology 55, 1062.
14. Wadia, N., Desai, S., Bhatt, M. (1988) Disseminated cysticercosis. New observations, including CT
scan findings and experience with treatment with praziquantel. Brain 111, 597–614.
15. Priest, R. (1926) A case of extensive somatic dissemination of Cysticercus cellulosae in man. British
Medical Journal ii, 471–472.
16. Cheung, Y.Y., Steinbaum, S., Yuh, W.T., et al. (1987) MR findings in extracranial cysticercosis. Journal
of Computed Assisted Tomography 11, 179–181.
17. Mandal, D.K., Banerjee, S., Ghosh, A., et al. (1989) Neurocysticercosis with rare presentations. Journal
of the Indian Medical Association 87, 142–144.
18. Krishnaswami, C.S. (1912) Case of Cysticercus cellulosae. Indian Medical Gazette 47, 43–44.
19. Armbrust-Figueiredo, J., Speciali, J.G., Lison, M.P. (1970) Forma myopatica da cysticercose. Arquivos
de Neuropsiquitria 28, 385–390.
20. Jacob, J.C., Mathew, N.T. (1968) Pseudohypertrophic myopathy in cysticercosis. Neurology 18,
767–771.
21. Jolly, S.S., Pallis, C. (1971) Muscular pseudohypertrophy due to cysticercosis. Journal of Neurological
Sciences 12, 155–162.
22. McGill, R.J. (1948) Cysticercosis resembling myopathy. Lancet ii, 728–730.
23. MacRobert, G.R. (1944) Somatic taeniasis (Solium cysticercosis). Indian Medical Gazette 79, 399–400.
24. Prakash, C., Kumar, A. (1965) Cysticercosis with taeniasis in a vegetarian. Journal of Tropical Medicine
25. Rao, C.M., Sattar, S.A., Gopal, P.S., et al. (1972) Cysticercosis resembling myopathy: report of a case.
Indian Journal of Medical Sciences 26, 841–843.
26. Salgaokar, S.V., Watcha, M.F. (1974) Muscular hypertrophy in cysticercosis: a case report. Journal of
Postgraduate Medicine, Bombay, India 20, 148–152.
27. Sawhney, B.B., Chopra, J.S., Banerji, A.K., et al. (1976) Pseudohypertrophic myopathy in cysticerco-
sis. Neurology 26, 270–272.
28. Singh, A., Jolly, S.S. (1957) Cysticercosis: case report. Indian Journal of Medical Sciences 11, 98–101.
29. Vigg, B., Rai, V. (1975) Muscular involvement in cysticercosis with pseudohypertrophy of muscles.
Journal of the Association of Physicians of India 23, 593–595.
30. Vijayan, G.P., Venkatraman, S., Suri, M.L., et al. (1977) Neurological and related manifestation of cys-
ticercosis. Tropical and Geographical Medicine 29, 271–278.
31. Zhu, D., Xu, W. (1983) Effect of biltricide on cysticercosis cellulosae with muscular psuedohyper-
trophy: a report of three cases. Chi Sheng Chung Hsueh Yu Chi Sheng Chung Ping Tsa Chih 1,
185–186.
32. Xu, Z., Chen, W., Zong, H., et al. (1985) Praziquantel in treatment of cysticercosis cellulosae. Report
of 200 cases. Chinese Medical Journal 98, 489–494.
33. Takayanagui, O.M., Chimelli, L. (1998) Disseminated muscular cysticercosis with myositis induced
by praziquantel therapy. American Journal of Tropical Medicine and Hygiene 59, 1002–1003.
34. Cruz, I., Cruz, M.E., Teran, W., et al. (1994) Human subcutaneous Taenia solium cysticercosis, in an
Andean population with neurocysticercosis. American Journal of Tropical Medicine and Hygiene 51, 405–407.

35. McArthur, W.P. (1934) Cysticercosis as seen in the British army with special reference to the produc-
tion of epilepsy. Transactions of the Royal Society of Tropical Medicine and Hygiene 27, 343–363.
37. Dixon, H.B.F., Hargreaves, W.H. (1944) Cysticercosis (Taenia solium): a further ten years’ clinical
study, covering 284 cases. Quarterly Journal of Medicine 13, 107–121.
Research Council Special Report. Series No. 299. Her Majesty’s Stationery Office, London, pp. 1–58.
39. Garcia, H.H., Gonzalez, A.E., Gilman, R.H., et al. (2001) Transient antibody response in Taenia solium
infection in field conditions: a major contributor to high seroprevalence. American Journal of Tropical
40. Del Brutto, O.H., Rajshekhar, V., White, A.C., et al. (2001) Proposed diagnostic criteria for neurocys-
ticercosis. Neurology 57, 177–183.
41. Gonzalez, A.E., Gavidia, C., Falcon, N., et al. (2001) Protection of pigs with cysticercosis from further
infections after treatment with oxfendazole. American Journal of Tropical Medicine and Hygiene 65,
15–18.
42. Evans, C.A.W., Gonzalez, A.E., Gilman, R.H., et al. (1997) Immunotherapy for porcine cysticercosis:
Implications for prevention of human disease. American Journal of Tropical Medicine and Hygiene 56,
33–37.

20 Intraventricular Neurocysticercosis
Albert C. Cuetter and Russell J. Andrews
Introduction cysts5,6. Approximately 30% of all patients

with NC develop hydrocephalus due to CSF
Intraventricular neurocysticercosis (IVNC) flow obstruction by the cysts either inside
is the presence of tapeworm cysts inside the ventricles or in the subarachnoid space7.
the cerebral ventricular system. IVNC com-
monly results in intraventricular obstruc-
tion, increased intracranial pressure (ICP), Clinical Features
meningoencephalitis and ventriculitis.
IVNC is a serious condition with an The classification of Carpio et al., of neuro-
obscure natural history, and in many cases, cysticercosis (NC) into active (vesicular,
a poor prognosis. viable), inflammatory (involutional, transi-
About 30% of patients with NC have tional, colloidal), and inactive lesions is
intraventricular cysts1,2. In the ventricular descriptive and convenient8. Intra-
system cysts are firmly encapsulated, either ventricular cysts have a more aggressive
float freely throughout the cerebrospinal behaviour than parenchymal cysts. The
fluid (CSF) pathways, or are attached to the symptoms in parenchymal cysticercosis
ependyma, anywhere in the ventricles but largely result from the host inflammatory
with predilection for the occipital horn of response to the dead or dying larva with
the lateral ventricle and the fourth irritation and oedema of the brain and the
ventricle3. Intraventricular cysts can be sin- occurrence of epileptic seizures. However,
gle or multiple. Many patients with cysts in intraventricular cysts may become sympto-
the lateral ventricles have multiple matic at the time of implantation due to
parenchymal and subarachnoid cysts2,4. obstruction of the CSF flow, with conse-
Therefore, most of the patients with intra- quent hydrocephalus and symptoms, signs,
ventricular cysts suffer from seizures before and consequences of increased ICP. As the
they develop hydrocephalic symptoms4. process of involution begins, the inflamma-
The larvae prefer to lodge in the well-irri- tory reaction around a dead or dying cyst
gated parenchyma, and the ventricles are produces ependymitis, scarring, obstruction
used as a lodging site when the and ventriculitis.
parenchyma is filled. However, a cyst in the The secondary symptomatology of coex-
fourth ventricle tends to be a solitary mass, isting parenchymal involutional cysts may
without accompanying parenchymal lead to discovery of asymptomatic intraven-


200 A.C. Cuetter and R.J. Andrews
tricular cysts with or without hydrocephalus. vation of arterial blood pressure, seizures,
Thus, there are patients presenting with and alteration of consciousness. Abrupt
seizures due to parenchymal involutional intermittent obstruction of the intraventricu-
cysts who also have asymptomatic intraven- lar CSF flow by the cyst produces abnormali-
tricular cysts (Fig. 20.1). ties lasting hours to days. Sudden changes of
head position may change the location of the
cyst and trigger or alleviate the headaches4,9.
Symptoms mainly due to obstruction of Also, sudden change of head position may
the CSF flow produce fleeting loss of strength or muscle
tone9. These drop attacks may be due to
Intraventricular cysts may totally obstruct associated sudden bilateral ischaemic
the CSF flow. This obstruction can be abrupt changes in brainstem. Abrupt permanent
or gradual. Cysts moving freely within the obstruction leads to acute hydrocephalus
ventricular system may lodge in one of the with stupor, coma, and death from brain her-
vital communication passages of the ventric- niation4,9–12. Obstruction may occur in the
ular system with intermittent or permanent foramen of Monro, third ventricle, aqueduct
blockade of CSF flow4. of Sylvius, or fourth ventricle11. Any
obstructing cyst located in the ventricles
results in a non-communicating hydro-
Abrupt obstruction
cephalus that requires prompt therapeutic
Abrupt obstruction of the ventricular system intervention to prevent brain herniation.
results in acute hydrocephalus with symp- In the fourth ventricle, direct compression
toms and signs such as headache, diplopia, of the brainstem and midcerebellar structures
dizziness, vomiting, restlessness, drowsi- produces, in addition to symptoms of
ness, respiratory changes, bradycardia, ele- increased ICP, focal deficits due to local mass
Fig. 20.1. Axial T1-weighted post-contrast MRI shows multiple parenchymal cysts and an intraventricular
cyst in the occipital horn of the right lateral ventricle. This 32-year-old man presented with seizures. The
hydrocephalus had not yet produced symptoms.

Intraventricular Neurocysticercosis 201
effects, such as gait ataxia, dysmetria and medical and surgical treatment1,16. Fixed cysts
diplopia13,14. In children, this clinical presen- are not susceptible to surgical removal with-
tation may suggest the presence of a midline out damage to brain tissue1,7.
cerebellar tumour. A superior aqueductal Patients present with a picture of
syndrome is seen in patients with blockade of increased ICP, meningoencephalitis (fever,
the aqueduct of Sylvius. These patients have alteration of consciousness and nuchal rigid-
paralysis of vertical gaze as well as other ity), focal neurological deficit and inflamma-
symptoms and signs of increased ICP15. tory reaction in the CSF7,17. A final clinical
stage includes mental deterioration, blind-
Chronic obstruction ness, quadriparesis, and ataxia, despite
appropriate treatment17. There are many
Most cases present with insidious, gradual complications contributing to clinical deteri-
onset of increased ICP4. The obstruction of oration, including cerebral and brainstem
the CSF circulation may be due to the pres- infarcts due to angiitis, hypothalamic dys-
ence of a large cyst in the ventricular cavi- function, infections, repeated shunt failure,
ties, particularly in the fourth ventricle. and progression of the disease with arach-
Symptoms include headaches, nausea, vom- noiditis, ependymitis, ventriculitis and irre-
iting, somnolence, memory and behavioral versible tissue damage.
changes, and gait disturbance for several Inflammatory cysts in the fourth ventricle
months before presentation4,5,9,12. The neuro- pose a difficult problem because there is
logical examination may reveal decreased associated widespread granular ependymitis
alertness, papilloedema, and focal motor and ventriculitis. This leads to ventricular
neurological deficits, including corticospinal enlargement that may persist even after a
tract signs and frontal lobe motor apraxia. ventriculoperitoneal shunt (VPS) is placed
The latter is due to extensive bilateral lesions for the relief of the hydrocephalus7.
of long motor tracts originating from the Although there may be single or multiple
frontal lobes by the enlarging lateral ventri- involutional cysts in the fourth ventricle, in
cles. Also, ventricular expansion is maximal many cases there are no cysts detected by
in the frontal horns with consequent impair- neuroimaging or found during surgery.
ment of frontal lobe functions. If not treated,
these patients can decompensate and deteri-
orate abruptly9.
Communicating hydrocephalus from
basilar arachnoiditis and leptomeningeal
scarring
Symptoms due to both obstruction of
CSF flow and inflammation
This type of basilar meningeal cysticercosis
Most people who die from chronic complica- is discussed in Chapter 18.
tions belong to this category. When the larva
in the cyst dies, the involutional process and
inflammation turn an asymptomatic intraven- Radiological and Laboratory Diagnosis
tricular cyst into a symptomatic one. The invo-
lutional cyst liberates antigenic substances that The criteria for the diagnosis of IVNC are
generate an inflammatory reaction throughout based on clinical presentation, magnetic res-
the ventricular system, and a severe localized onance imaging (MRI) evidence of cystic
reaction of granular ependymitis that fixes the lesions containing the scolex, and histologi-
cyst capsule to the ventricular wall with cal demonstration of the parasite from the
strong adhesions and fibrosis that may pro- brain lesions or from the CSF. Since the clini-
duce irreversible blockade of the CSF circula- cal presentation of IVNC is by no means spe-
tion. The fourth ventricle is frequently cific, it is important to review the clinical
affected. The result is progressive hydro- history, laboratory findings and imaging
cephalus, increased ICP, and poor response to studies to arrive at a correct diagnosis.

Computed tomography (CT) ment with surrounding oedema similar to

inflammatory parenchymal cysts (Fig.
Small cysts that do not deform the ventricles 20.2b)19. Differentiation of such a ring-like
are not visualized upon CT because: (i) they enhancing lesion from neoplastic processes
have the same density as the CSF; (ii) the or other inflammatory processes may be dif-
wall of the cyst, and the scolex are not ficult based on imaging findings only19.
visible18,19; and (iii) the cyst does not show Obstructing cysts and consequent hydro-
contrast enhancement20. In the absence of cephalus are well demonstrated on MRI.
hydrocephalus, a large intraventricular cyst Sometimes, there is hydrocephalus and
may be visualized on CT scan if it deforms other MRI findings of NC, but no cysts are
the ventricle and the cyst mass is outlined by seen in the ventricles. In some of these cases
the normal ventricular cavity. A cyst deform- the enlargement of the ventricles may be a
ing or enlarging the fourth ventricle is well result of ependymitis, scarring, or
visualized on CT. If the cyst is in the inflam- meningeal involvement. A cyst in the third
matory stage, there may be oedema of the ventricle or the foramen of Monro gives rise
adjacent tissues. A CT scan may also show to enlargement of the lateral ventricles,
calcified inactive parenchymal lesions. The sometimes unilateral only. Cysts in the
finding of cysts in different stages of evolu- fourth ventricle produce significant hydro-
tion, including calcifications, and the pres- cephalus and usually are not accompanied
ence of hydrocephalus on CT, even if the by parenchymal cysts19.
obstructing cysts are not visualized, helps in
the diagnosis.
Immunodiagnosis
Magnetic resonance imaging (MRI) Over 80% of patients with intraventricular

inflammatory lesions have positive enzyme-
MRI readily visualizes intraventricular cysts linked immunoelectrotransfer blot (EITB) in
in about 80% of the cases21. On T1-weighted serum and CSF. Antibodies are detectable as
imaging and fluid attenuation inversion frequently in serum as in CSF, regardless of
recovery (FLAIR) imaging (Fig. 20.2c), a the number or apparent condition of the
viable, active intraventricular cyst appears as cysts23. Recent data shows that ELISA in
a spherical lesion of 10–20 mm in diameter, serum does not perform well with this dis-
often with the scolex visualized as a mural ease and has a high rate of both false-posi-
nodule that has the hyperintensity of fat tis- tive and false-negative results24. A negative
sue. Evidence of cystic lesions containing the result does not exclude NC; a positive result
scolex is one of the absolute criteria for diag- is not specific for NC, especially in groups
nosis22. The cyst wall is a thin hyperintensity with high exposure.
outlined between the darkness of the cyst
content and the ventricular CSF. On T2-
weighted imaging, the inside of the cyst is CSF examination
isointense with the surrounding tissues, and
the scolex is hyperintense. Lumbar puncture is contraindicated in
Ring-like or nodular enhancement has patients with increased ICP. In these cases
been correlated with the presence of granu- the CSF may be obtained through a ventricu-
lar ependymitis that accompanies inflamma- lostomy. CSF abnormalities are directly pro-
tory, involutional cysts. T1-weighted imaging portional to the degree of local inflammation
without gadolinium shows the inflammatory and ventriculitis. The CSF examination may
features of an involutional cyst: (i) hyperin- show no cells, and normal protein and glu-
tense cyst wall; (ii) hyperintense scolex; and cose in about half the number of cases9. The
(iii) oedema around the cyst (Fig. 20.2a–c). other half of patients have a moderate
On T1-weighted images with gadolinium, degree of mixed pleocytosis, increased pro-
inflammatory cysts have a ring-like enhance- tein and hypoglycorrhagia. There is both

(a)
(b) (c)
Fig. 20.2. (a) Sagittal T1-weighted MRI shows a large inflammatory (involutional, transitional) cyst in the
fourth ventricle. The mural nodule is visible. There is oedema of adjacent brain tissue. (b) Axial T1-weighted
post-contrast MRI shows an inflammatory cyst in the fourth ventricle with a ring-like enhancement. There is
oedema of adjacent brain tissue. (c) An axial fluid attenuation inversion recovery (FLAIR) MRI shows an
inflammatory cyst in the fourth ventricle, oedema in the surrounding brain tissue, and the mural nodule.
polymorphonuclear and lymphomononu- Differential Diagnosis

clear pleocytosis, but the latter pre-
dominates4,9,12,25. Eosinophilia occurs in Histological demonstration of the miniature
about 20% of patients with pleocytosis12. parasite from surgically resected tissue is an
Glucose is reduced in about 6%; protein is important diagnostic criterion22. The tissue
elevated up to a maximum of 420 mg dl−1 12. may be the surgical specimen from cysts

removed, or the intraventricular content • use of anticysticercal drugs (albendazole,

obtained through ventriculostomy. The differ- praziquantel);
ential diagnosis of IVNC includes toxoplas- • use of corticosteroids.
mosis, fungal and bacterial meningitis,
hydrocephalic sequelae of tubercular
meningitis, echinococcosis, intraventricular Acute hydrocephalus; viable cyst
neoplasms6,13,26 and non-infectious granulo-
matous chronic meningitis. Toxoplasmosis According to current standards, acute hydro-
may present with enlarged ventricles due to cephalus requires ventriculostomy followed
ependymitis and aqueductal stenosis18. On by surgical or endoscopic extirpation of
neuroimaging, bacterial and coccidioidal viable cyst/s obstructing the CSF flow, par-
ependymitis with ventriculitis produces ticularly those in the fourth ventri-
hydrocephalus and associated enhancement cle1,6,9,11,19,29,30. After initial placement of a
of the ependymal walls of lateral ventricles. ventriculostomy catheter, a definitive proce-
However, the clinical picture is different, and dure to extirpate the cyst/s is highly advis-
there are no cysts, or other signs of NC. able. The choice between open surgical
Granulomatous tubercular meningitis may removal and endoscopic removal depends
present with hydrocephalus, but there is upon the operator’s experience. The reader
involvement of the meninges at the base of is referred to Chapter 40 for a detailed dis-
the skull on post-gadolinium MRI27,28. On cussion on the merits and demerits of each
MRI, the multiloculated parietal cystic struc- procedure, as well as technical details of the
ture of echinococcosis may overlap the ven- endoscopic approach.
tricular silhouette resembling IVNC. A third
ventricular cysticercus may mimic a colloid
cyst. Fourth ventricle cysts simulate neo- Acute hydocephalus; inflamed cyst
plasms such as cystic medulloblastoma, astro-
cytoma or ependymoma, with obstruction of When there is neuroimaging evidence of
the ventricular flow, neuroimaging cystic ependymitis, VPS without surgical attempts
changes of a tumoural mass, and oedema of to remove the cyst is preferable because invo-
adjacent brain tissues (Figs 20.2a–c). However, lutional inflammatory cysts are fixed to the
tumours enhance with gadolinium, have ventricular wall with strong adhesions and
much more oedema in the adjacent tissues, thickening, and cannot easily be removed
and show extension up and down in the ven- without damaging brain tissue1,7,11,31. Even if
tricle and laterally into prepontine cisterns. the cyst is removed, there is a likelihood that
Finally, non-infectious conditions such as sar- VPS may still be necessary6,11.
coidosis and meningeal carcinomatosis may Unfortunately, in most cases, a differentia-
produce chronic hydrocephalus due to lep- tion between a viable and an inflammatory
tomeningitis and pachymeningitis18. intraventricular cyst cannot be made. Several
clinical points are helpful. A viable cyst does
not have clinical symptoms and signs of
Treatment meningitis, and has no or only discrete
inflammatory reaction on CSF that has been
The treatment of IVNC is symptom specific. obtained by ventriculostomy. Conversely, an
The choice of treatment from available thera- involutional inflammatory cyst shows symp-
peutic modalities shown below depends on toms and signs of meningitis, focal neurologi-
the condition of the patient at the time of cal deficit and inflammatory response on CSF
presentation, location of cyst, and evolu- examination7. On T1-weighted MRI, an
tional stage of the cyst: inflammatory cyst has a hyperintense wall,
• emergent temporary ventriculostomy; and there is oedema of adjacent brain tissue
• VPS procedure; (Fig. 20.2a). On T1-weighted post-gadolinium
• surgical or endoscopic extirpation of imaging, there is a ring-like enhancement in
obstructing cysts; the wall of the inflammatory cyst (Fig. 20.2b).

It is recommended that patients with cysts, or by high CSF protein37. In some

acute hydrocephalus due to intraventricular instances, a lack of improvement after a shunt-
inflammatory cysts be treated with emergent ing procedure is explained by mass effect due
temporary ventriculostomy, followed by a to an enlarging cyst or inadequate decompres-
permanent VPS procedure11,32,33. The use of sion, and in the latter situation, a revision of
dexamethasone in therapeutic declining dose the shunt is required12,35. Recurrent shunt
therapy may afford some benefit to these obstruction by cyst material is another reason
patients if it relieves the inflammatory stage for excision of intraventricular cysts5.
and brain oedema4,5,25,34.
Anticysticercal drugs
Chronic hydrocephalus; viable cysts
Some investigators have advocated the use
Patients with chronic hydrocephalus and of anticysticercal drugs in conjunction with
increased ICP usually require a permanent VPS5,12 to decrease shunt failures and
VPS35. Open surgical or endoscopic removal destroy viable cysts. The use of praziquantel,
of the viable cysts should be done if they are an isoquinoline with broad anthelmintic
large, if they obstruct the CSF flow, if they activity, in IVNC is controversial, since ear-
complicate shunting, if they cause a mass lier studies have associated such therapy
effect despite shunting, and if the diagnosis with a poor outcome38. Both failures2,17,38–40,
is uncertain35. Viable cysts in the fourth ven- and successes5,41,42, with praziquantel have
tricle should be extirpated because by their been observed in the treatment of intraven-
mass effect, these cysts may cause herniation tricular cysts. The recommended dose is 50
even after VPS9. A transcortical approach is mg kg−1 day−1 for 14 days with concomitant
used for removal of cysts from lateral ventri- use of dexamethasone.
cles; a transcallosal approach for cysts in the There are several reports describing the
third ventricle; and a midline suboccipital successful treatment of intraventricular cysts
direct approach for cysts in the fourth ventri- with albendazole (Fig. 20.3a,b)2,43–45. In some
cle1,11,32. Bergsneider and Nieto (see Chapter series, intraventricular cysts disappeared
40) discuss the option of direct endoscopic within 3 months after this approach2,43–45.
removal of cyst/s without resort to VPS. Albendazole is used at a dose of 15 mg kg−1
The surgeon must consider the possibility of day−1 for 15 days. The daily dose is divided
cyst migration between the time of diagnosis and into three administrations, and dexametha-
craniotomy36. Migration of the targeted cyst must sone is given concomitantly. Two courses of
be ruled out by a neuroimaging procedure done medication are given 1 month apart.
immediately before surgery19,33. In cases of multi- Intermittent long-term steroid therapy may
ple cysts and multiple obstructions with locu- reduce shunt malfunction46.
lated hydrocephalus, there may be a need for The favourable response to treatment of
multiple shunt procedures, each draining a sepa- IVNC with either praziquantel or albenda-
rate compartment31. Patients with intraventricu- zole is by no means definite and may be a
lar cysts without hydrocephalus, or with only reflection of the natural history of the condi-
slight dilatation of the ventricles, require close tion. When the larva in the cyst dies as a
supervision in case shunting becomes necessary. result of anticysticercal therapy, there is an
inflammatory reaction similar to the one seen
with the natural death of the larva47,48. The
Chronic hydrocephalus; inflamed cyst local reaction with scarring and granuloma-
tous ependymitis may lead to an irreversible
VPS remains the mainstay of therapy of blockade of CSF flow due to a permanent tis-
inflamed IVNC. However, shunts are prone to sue damage. In addition, resolution with
complications in these patients. The most anticysticercal drugs may take a long period
common cause of dysfunction of VPS is of time, usually in months. During this
obstruction either by gelatinous material from period, the patient is at risk of developing

(a)
(b)
Fig. 20.3. (a) T1-weighted MRI shows an intraventricular cyst in the frontal horn of the right lateral
ventricle. (b) Same patient as in (a), 12 months later. There was a resolution of the cyst.
complications such as ependymitis and acute long-term sequelae49. Therefore, the use of
ventricular obstruction. For this reason, some anticysticercal therapy in IVNC continues to
authors question the effectiveness of anticys- be debated50. Collaborative clinical trials are
ticercal therapy in IVNC, even suggesting needed to evaluate specific medical treatment
that the treatment with anticysticercal agents of IVNC and to develop a better understand-
is associated with an increase in frequency of ing of the clinical course49.

Prognosis rior fossa is less well tolerated than at other

sites. Significant morbidity is associated with
IVNC is potentially lethal. Early studies fourth ventricular cysts even after VPS12.
showed that the mortality of acute hydro- Cysts in the fourth ventricle usually present
cephalus is 13%33. However, many patients in the inflammatory state with oedema and
who have surgical removal of the intraven- adhesion to the adjacent tissue (Fig. 20.2c), at
tricular cysts and VPS to relieve hydro- which time the resection of the entire lesion
cephalus, improve with resolution of the is difficult. Hydrocephalus returns in some
hydrocephalus26. The prognosis for patients patients with IVNC, even after cysts have
with IVNC of the fourth ventricle is not disappeared (Fig. 20.4a–c)2,14,20. Although a
good. The mass effect of a cyst in the poste- reinfection can be the cause of this relapse, in
(a)
(b) (c)
Fig. 20.4. (a) CT scan of a 46-year-old man shows intraventricular and parenchymal active cysts. (b) CT
scan, 11 months later shows resolution of the cyst. (c) One year later the patient presented with
increased intracranial pressure. CT scan showed non-communicating hydrocephalus.

some cases, the most likely reason is the increased ICP and meningoencephalitis.
obstruction of the CSF pathways by chronic Neuroimaging is the most important tool for
adhesions and thickening left by involu- the diagnosis of IVNC. The finding of cysts in
tional cysts. This emphasizes the need for different stages of evolution helps in the diag-
aggressive initial treatment in these patients. nosis. The treatment of IVNC is symptom
specific. Surgical treatment of acute hydro-
cephalus consists of ventriculostomy followed
Conclusions by permanent VPS. Dexamethasone alleviates
the increased ICP, cerebral oedema and
IVNC is a serious and disabling condition inflammation. In chronic hydrocephalus and
with obscure peculiarities in its natural his- intraventricular cysts, the selection of treat-
tory, grave complications, and a high rate of ment modalities such as VPS, surgical removal
poor outcomes. Active, viable intraventricular of the cysts, and anticysticercal therapy is a
cysts produce no reaction from the host, but subject that challenges the common sense,
can mechanically interfere with CSF flow, experience, and judgement of the treating
leading to complex clinical syndromes mainly physician. There are reports of successes and
because of obstructive hydrocephalus. These failures with the use of anticysticercal medica-
cysts can migrate freely in the ventricular sys- tion. The use of anticysticercal medications to
tem, giving rise to acute intermittent or per- hasten the involution of intraventricular viable
manent symptoms from hydrocephalus and cysts may trigger an inflammatory response
increased ICP. When the larva dies, there similar to the one seen with the natural death
occurs a local granulomatous ependymitis and of the parasite, with consequent increased fre-
generalized ventriculitis with hydrocephalus, quency of long-term sequelae.
References
1. Madrazo, I., Garcia-Renteria, J.A., Sandoval, M., et al. (1983) Intraventricular cysticercosis.
2. Cuetter, A.C., Garcia-Bobadilla, J., Guerra, L.G., et al. (1997) Neurocysticercosis: focus on intraven-
tricular disease. Clinical Infectious Diseases 24, 157–164.
3. Botero, D. (1989) Cysticercosis. In: Goldsmith, R., Heyneman, D. (eds) Tropical Medicine and
Parasitology. Appleton & Lange, Norwalk, Connecticut, pp. 498.
4. Lobato, R.D., Lamas, E., Portillo, J.M., et al. (1981) Hydrocephalus in cerebral cysticercosis: patho-
genic and therapeutic considerations. Journal of Neurosurgery 55, 786–793.
5. Bandres, J.C., White, A.C., Jr, Samo, T., et al. (1992) Extraparenchymal neurocysticercosis: report of
five cases and review of management. Clinical Infectious Diseases 15, 799–811.
6. Couldwell, W.T., Chandrasoma, P., Apuzzo, M.L.J., et al. (1995) Third ventricular cysticercal cyst
mimicking a colloid cyst: case report. Neurosurgery 37, 1200–1203.
7. Salazar, A., Sotelo, J., Martinez, H., et al. (1983) Differential diagnosis between ventriculitis and
fourth ventricle cyst in neurocysticercosis. Journal of Neurosurgery 59, 660–663.
8. Carpio, A., Placencia, M., Santillán, F., et al. (1994) A proposal for classification of neurocysticercosis.
Canadian Journal of Neurological Sciences 21, 43–47.
9. McCormick, G.F. (1985) Cysticercosis: review of 230 patients. Bulletin of Clinical Neuroscience 50,
76–101.
10. Estañol, B., Kleriga, E., Loyo, M., et al. (1983) Mechanisms of hydrocephalus in cerebral cysticercosis:
11. Apuzzo, M.L.J., Dobkin, W.R., Zee, C.S., et al. (1984) Surgical considerations in treatment of intra-
ventricular cysticercosis: an analysis of 45 cases. Journal of Neurosurgery 60, 400–407.
12. Shandera, W.X., White, A.C., Jr, Chen. J.C., et al. (1994) Cysticercosis in Houston, Texas: a report of
112 cases. Medicine 73, 37–52.
13. de Morais-Rego, S.F., Latuf, N.L. (1978) Cisticercose do quarto ventrículo simulando neoplasia da
fossa posterior à cintillografia cerebral. Relato de um caso. Arquivos de Neuropsiquiatria 36, 371–374.

14. Colli, B.O., Pereira, C.U., Assirati, J.A. (1993) Isolated fourth ventricle in neurocysticercosis: patho-
physiology, diagnosis, and treatment. Surgical Neurology 39, 305–310.
15. Stern, W.E. (1981) Neurosurgical considerations in cysticercosis of the central nervous system.
16. Rabiela, M.Y., Rivas-Hernandez, A., Rodriguez Ibarra, J. (1979) Consideraciones anatomopatológi-
cas sobre cisticercosis cerebral como causa de muerte. Patología 17, 119–136.
17. Joubert, J. (1990) Cysticercal meningitis: a pernicious form of neurocysticercosis which responds
poorly to praziquantel. South African Medical Journal 77, 528–530.
18. Kanamalla, U.S., Ibarra, R.A., Jinkins, J.R. (2000) Imaging of cranial meningitis and ventriculitis.
Neuroimaging Clinics of North America 325, 309–331.
19. Zee, C.S., Go, J.L., Kim, P.E., et al. (2000) Imaging of neurocysticercosis. Neuroimaging Clinics of North
America 325, 391–407.
20. Hanlon, K.A., Vern, B.A., Tan, W.S., et al. (1988) MRI in intraventricular neurocysticercosis: a case
report. Infection 16, 242–244.
21. Chang, K.H., Lee, J.H., Han, M.H., et al. (1991) The role of contrast-enhanced MR imaging in the
diagnosis of neurocysticercosis. AJNR American Journal of Neuroradiology 12, 509–512.
cysticercosis and neurocysticercosis. Journal of the Neurological Sciences 142, 1–6.
23. Wilson, M., Bryan, R.T., Fried, J.A., et al. (1991) Clinical evaluation of the cysticercosis enzyme-
linked immunoelectrotransfer blot in patients with neurocysticercosis. Journal of Infectious Diseases
164, 1007–1009.
24. Schantz, P.M., Sarti, E., Plancarte, A., et al. (1994) Community-based epidemiological investigation
25. Bonametti, A.M., Baldy, J.L., Bortoliero, A.L., et al. (1994) Neurocisticercose com quadro clínico ini-
cial de meningite aguda. Revista do Instituto de Medicina Tropical de São Paulo (São Paulo) 36, 27–32.
26. Zee, C.S., Segal, H.D., Destian, S., et al. (1993) MRI of intraventricular cysticersosis: surgical implica-
tions. Journal of Computer Assisted Tomography 17, 932–939.
27. Shah, G.V. (2000) Central nervous system tuberculosis: imaging manifestations. Neuroimaging Clinics
of North America 325, 355–374.
28. Bekonakli, E., Cayli, S., Turgut, M., et al. (1998) Primary giant granulomatous basal meningitis: an
unusual presentation of tuberculosis. Childs Nervous System 14, 79–81.
29. Bello Martinez, E., de Górgolas Hernández-Mora, M., Albisua Sanchez, J., et al. (1997)
Neurocisticercosis en un hospital terciario. Nuevos avances en el diagnóstico y tratamiento. Revista
Clinicia Espanola 197, 604–610.
30. Sotelo, J. (1997) Treatment of brain cysticercosis. Surgical Neurology 48, 110–112.
31. Amar, A.P., Ghosh, S., Apuzzo, M.L.J. (2000) Treatment of central nervous system infections.
32. Couldwell, W.T., Apuzzo, M.L.J. (1989) Management of cysticercosis cerebri. Contemporary
33. Zee, C.S., Segall, H.D., Apuzzo, M.L.J., et al. (1984) Intraventricular cysticercal cysts: further neuro-
radiologic observations and neurosurgical implications. AJNR American Journal of Neuroradiology 5,
727–730.
34. Rogel-Ortiz, F., Vera-Pedro, M. (1997) Meningitis cisticercosa. Gaceta Medica de Mexico (Mexico) 133,
301–305.
35. Colli, B.O., Martelli, N., Assirati, J.A., Jr, et al. (1986) Results of surgical treatment of neurocysticerco-
sis in 69 cases. Journal of Neurosurgery 65, 309–315.
36. Del Brutto, O.H., Sotelo, J., Roman, G.C. (1993) Therapy for neurocysticercosis: a reappraisal.
37. Sandoval, M., Madrazo, I., Garcia-Renteria, J.A., et al. (1990) Obstruction of the ventricular catheter
of a CSF shunt system due to the own cyst of Taenia solium. Archives of Investigative Medicine (México)
21, 95–98.
38. Vasconcelos, D., Cruz-Segura, H., Mateos-Gomez, H., et al. (1987) Selective indications for the use of
praziquantel in the treatment of brain cysticercosis. Journal of Neurology, Neurosurgery and Psychiatry
50, 383–388.
39. Duplessis, E., Dorwling-Carter, D., Vidaillet, M., et al. (1988) Neurocysticercose intraventriculaire. A
propos de trois observations. Neurochirurgie 34, 275–279.

40. Monteiro, L., Almeida-Pinto, J., Stocker, A., et al. (1993) Active neurocysticercosis, parenchymal and
extraparenchymal: a study of 38 patients. Journal of Neurology 241, 15–21.
41. Allcut, D.A., Coulthard, A. (1991) Neurocysticercosis: regression of a fourth ventricular cyst with
praziquantel. Journal of Neurology, Neurosurgery and Psychiatry 54, 461–462.
42. Proano, J.V., Madrazo, I., Garcia, L., et al. (1997) Albendazole and praziquantel treatment in neuro-
cysticercosis of the fourth ventricle. Journal of Neurosurgery 87, 29–33.
43. Sotelo, J., Penagos, P., Escobedo, F., et al. (1988) Short course of albendazole therapy for neurocys-
ticercosis. Archives of Neurology 45, 1130–1133.
44. Del Brutto, O.H., Sotelo, J. (1990) Albendazole therapy for subarachnoid and ventricular cysticerco-
sis. Journal of Neurosurgery 72, 816–817.
45. Villarreal, H.J., Rangel-Guerra, R., Martinez, H.R., et al. (1990) Cisticercosis parenquimatosa y ven-
tricular tratada con albendazole. Archivos del Instituto Nacional de Neurología y Neurocirugía de México
5, 207–208.
46. Suastegui Roman, R.A., Soto-Hernandez, J.L., Sotelo, J. (1996) Effects of prednisone on ventriculo-
peritoneal shunt function in hydrocephalus secondary to cysticercosis: a preliminary study. Journal
of Neurosurgery 84, 629–633.
47. Spina-Franca, A., Nobrega, J.P.S. (1980) Neurocysticercose e praziquantel. Revista Paulista de
Medicina 95, 34–36.
48. Garcia, H.H., Gilman, R.H., Horton, J., et al. (1997) Albendazole therapy for neurocysticercosis: a
prospective double-blind trial comparing 7 versus 14 days of treatment. Neurology 48, 1421–1427.
49. Carpio, A., Santillan, F., Leon, P., et al. (1995) Is the course of neurocysticercosis modified by treat-
ment with anthelminthic agents? Archives of Internal Medicine 155, 1982–1988.
50. Salinas, R., Counsell, C., Prasad, K., et al. (1999) Treating neurocysticercosis medically: a systematic
review of randomized, controlled trials. Tropical Medicine and International Health 4, 713–718.

21 Neurocysticercosis and Epilepsy
Arturo Carpio and W. Allen Hauser
Introduction Epidemiology of Epilepsy and

Cysticercosis
The natural history of neurocysticercosis
(NC) and its clinical course are poorly under- The incidence of epilepsy in developing
stood. Presumably, a high percentage of the countries is twice that in developed coun-
population harbouring NC remains asympto- tries14,15. Three-quarters of the 50 million
matic. Among symptomatic patients, clinical people with epilepsy live in economically
manifestations of NC vary, depending on disadvantaged countries of the world. Most
the number and localization of the cyst(s), of those with epilepsy in these countries
as well as the host immune response to the are untreated16,17.
parasite1–5. Acute symptomatic seizures Taeniasis–cysticercosis is endemic in Latin
are the most common clinical manifestation America, India and China, and possibly also
of NC in those patients in whom the para- in sub-Saharan Africa17. Poor hygiene and liv-
site(s) are located in brain parenchyma6–8. ing conditions, allowing pigs access to human
Based on prospective studies, the tradi- faeces, put people at risk of developing taeni-
tional view that NC is the principal cause of asis–cysticercosis. A recent epidemiological
epilepsy in developing countries can be study has shown that household contacts of
questioned9,10. Similarly, the view that patients with NC had a threefold higher risk
epilepsy attributable to NC generally has an of positive serology for cysticercosis, in com-
unfavourable course and prognosis, con- parison to the general population18. While
trasts with recent reports showing an these findings are still consistent with a com-
overall favourable prognosis in terms of mon environmental source of infection with
seizure control and seizure remission2,3,11–13. Taenia solium eggs, they also suggest a poten-
Although some authors have suggested that tial role for direct human-to-human contami-
anticysticercal treatment is associated with nation. Migrant workers into the USA and
reduced seizure recurrence10,11 there are no other developed countries have also imported
hard data to support this from controlled T. solium infections5,19.
clinical trials. The controversial issues of Immunoserological assays, such as
treatment approach and the relationship enzyme-linked immunoelectrotransfer blot
between NC and epilepsy are reviewed in (EITB) or ELISA, detect antibodies against
this chapter. T. solium cysticercosis1,2,20. Epidemiological


212 A. Carpio and W.A. Hauser
surveys for human cysticercosis, using (ILAE’s) Commission on Epidemiology and

EITB, report a seroprevalence from 8% to Prognosis26, ‘provoked’ or ‘acute sympto-
12% in some regions of Latin America20–24. matic seizures’ are seizures which occur in
These assays are useful for identification of close temporal association with an acute
individuals who have had systemic contact brain lesion (infection, stroke, cranial
with the parasite at some time. trauma, etc.); such seizures are often iso-
Seropositivity, however, does not necessar- lated epileptic events associated with acute
ily mean an active systemic infection or cen- conditions, but may recur if the acute condi-
tral nervous system involvement at any tion recurs. Unprovoked seizures (epilepsy,
time. Most seropositive individuals in the if seizures recur) may occur subsequent to a
populations surveyed were asymptomatic. well-demonstrated antecedent condition,
Some studies21,23,24 but not all22 have known to substantially increase the risk of
reported an association between seizures epileptic seizures. Symptomatic unpro-
and seropositivity. Although a higher provoked seizures are categorized into two
portion of patients with epilepsy have been major subgroups: (i) remote symptomatic
shown to be EITB positive when compared unprovoked seizures that follow conditions
with those without epilepsy, the proportion resulting in a static encephalopathy, such as
of seropositivity in epileptic patients is sim- infection, cerebral trauma, or cerebrovascu-
ilar to that reported in the general popula- lar disease, generally presumed to be the
tion in these same areas. There is also a result of this non-progressive (static) lesion;
discrepancy between EITB positivity and and (ii) progressive symptomatic seizures
computed tomography (CT) findings: more occurring in association with progressive
than 50% of those diagnosed as having NC neurological disorder (brain trauma, degen-
by CT were seronegative22,23. This is espe- erative brain disease).
cially true in patients with only single or Seizures associated with NC may be cate-
calcified lesions. gorized as either acute symptomatic or as
remote symptomatic seizures. Individuals
with cysticerci in the transitional form27 or
Seizures and epilepsy as main clinical degenerative phase develop acute sympto-
manifestations of NC matic seizures due to the acute inflammatory
response of the brain; on the other hand, a
It is widely accepted that seizures are the patient with seizures who has active, viable
most common symptom of NC, occurring in cysts and/or inactive, non-inflamed calcified
70–90% of patients2,3,5,6,8,12. There is no con- parasites may be categorized as having
sistency in the reported distribution of unprovoked seizures. NC has an unpre-
seizure types in patients with NC. Some dictable clinical course, which makes it diffi-
authors report a higher frequency of partial cult to categorize all cases into the proposed
seizures9,14, others conclude that generalized classification of the ILAE Commission. For
seizures are more common7,8. It seems that instance, a patient with chronic recurrent
either generalized seizures or partial seizures seizures, whose imaging studies show sev-
with secondary generalization are most com- eral non-inflamed parenchymal calcifica-
monly reported, while complex partial tions, should be categorized as having
seizures are less frequent. remote symptomatic unprovoked seizures.
Some authors use the term ‘seizures’ The same patient, some years later, can
indiscriminately for epilepsy, and vice develop hydrocephalus associated with
versa10,11. All people with epilepsy experi- intraventricular cysts or experience a recur-
ence seizures, but not all individuals with rence of parenchymal transitional cysts. This
seizures have epilepsy25. This distinction is case should be considered to have multiple
not only semantic; it is important from the episodes of NC now resulting in acute symp-
clinical and epidemiological standpoint. tomatic seizures. The seizure disorder
According to the definitions suggested by should not be categorized as progressive
the International League Against Epilepsy’s symptomatic unprovoked seizures (epilepsy)

Neurocysticercosis and Epilepsy 213
owing to a progressive neurological NC as the main cause of epilepsy, accounting

disorder2. Neurologists from developing for 30–50% of patients1,9. The proportion of
countries frequently see patients in whom epilepsy cases associated with cysticercosis
the first seizure occurred many years before using an immunoserological test as a diag-
consultation, and when the second seizure nostic tool is considerably lower than the
occurs at the time of consultation, the imag- proportion of NC using CT. Only 12% of
ing study shows one or more calcifications epileptic patients attending an outpatient
and one cyst in the transitional form with clinic in Peru had serological evidence of T.
perilesional oedema. We can assume that solium as shown by the EITB test21.
when the first seizure occurred, the patient New information now available from
had cysts in a transitional form, which even- developing countries shows that the propor-
tually became calcified, and currently the tion of idiopathic (60–70%) to symptomatic
patient has new acute seizures27. According epilepsy (30–40%) is similar to that reported
to the ILAE Commission we should catego- in studies from developed countries4,14.
rize these patients as having isolated epilep- Among the symptomatic group, infection
tic events associated with a recurrent acute and parasitic diseases, particularly NC, peri-
condition (transitional form)26. Ultimately, in natal brain damage, and head trauma are the
patients with NC, what matters most is to most frequent disorders reported as a cause
differentiate between provoked or acute of epilepsy1,6,21,28,29. In studies from India, in
symptomatic seizures and recurrent unpro- which acute symptomatic seizures were
voked seizures (epilepsy). This differentia- excluded, only 5.3% and 11% of patients
tion is very important, because of its with epilepsy had NC30,31. In a recent
implications concerning treatment and prog- prospective cohort study, among patients
nosis, as will be discussed below. with newly diagnosed epilepsy seen at the
Presumably, the inclusion of people with five main hospitals in the three major cities
only acute symptomatic seizures as cases of of Ecuador, the ratio of idiopathic/crypto-
epilepsy is one of the reasons for the high genic (63%) to symptomatic epilepsy (37%)
proportion of epilepsy in some studies. was also similar to the studies from devel-
oped countries32. Perinatal brain damage
(9%), NC (8.3%), central nervous system
Is NC the most frequent aetiology of infections (4.2%), stroke (4.8%) and head
epilepsy in developing countries? trauma (4.2%) were the most frequent disor-
ders reported as causes of epilepsy (Fig.
It is extremely difficult to compare results of 21.1). Although NC is one of the most fre-
studies of epilepsy due to NC. These studies quent antecedents among the symptomatic
are few, and are frequently targeted at all group, this disease is not the main cause of
seizures, instead of epilepsy alone. Almost epilepsy, as has been previously suggested.
all the studies are prevalent case-series,
which are not useful for identifying the
cause of seizures. There are broad differences Relationship Between NC and
in the definition (if any) of NC, as well as Epilepsy
failure to define criteria for diagnosis of
either seizures or epilepsy. There is no infor- There are clinical inconsistencies in the link
mation on the latency between the first acute between epilepsy and NC. Parasite location
symptomatic seizure and the first unpro- may be remote from the apparent epilepto-
voked seizure, or regarding the age of the genic region33. There is also no correlation
patient at the time of onset of seizures in between the NC burden of lesions and the
relation to the age of the patient at the time severity of the epilepsy. Patients with severe
of diagnosis of NC. Studies of highly refractory seizures may have only one calci-
selected patients with epilepsy (or seizures?) fied lesion; on the other hand, there are
in neurological services of hospital settings patients with multiple cysts or calcifications
from some Latin American countries report but no seizures. NC and epilepsy are com-

9.60%
3.50% Cysticercosis
0.90% Others
Tumours
5.70%
Stroke
5.20% Infections
61.70%
Head trauma
3.90%
Perinatal insult
9.60%
Idiopathic
Fig. 21.1. Aetiology of epilepsy in Ecuador. (Source: reference 32.)
mon diseases in most developing countries. EEG findings have poor correlation with
Because of their high prevalence, a causal as symptoms and CT lesions in patients with
well as fortuitous relationship between the NC5,41–43. A positive correlation between CT
two conditions might exist3,34–36. lesions and localizing or lateralizing EEG
Seizures may occur at any evolutionary abnormalities has been reported for only
stage of the parasite. Acute seizures are more 15–30% of patients. Similarly, the correlation
frequent with the transitional form owing to between seizure type and EEG abnormalities
the inflammatory reaction in the vicinity of ranges from around 7% to 20%43.
cortically or subcortically located cysts. In Discrepancies between clinical localization
the active form, seizures have been attrib- based on seizure semiology and location of
uted to mechanical compression by cysticer- the lesion on neuroimaging is not uncom-
cal cysts2,27. We can theorize that risk of mon in patients with NC. Nevertheless,
seizure recurrence (i.e. epilepsy) probably some authors suggest that this reflects the
occurs in the inactive or calcified form of spread of seizure discharges37,42. In patients
NC37. This possibility has been attributed to with occipital-lobe epilepsy, an occipitotem-
residual perilesional gliosis that results in poral spread was demonstrated in those
chronic epileptogenic foci38. This theory, patients who had automatisms typical of
however, requires further confirmatory stud- temporal-lobe seizures, and suprasylvian
ies. Some authors have suggested that mild spread was demonstrated in those patients
inflammation, visible on contrast-enhanced who presented tonic or clonic motor mani-
MRI or CT, may persist in the calcified stage festations44. A non-causal relationship
of NC, and may be associated with an between epilepsy and cysticercosis in some
increased risk of recurrent seizures39,40. cases might explain these apparent discrep-
These authors theorize that the perilesional ancies37. Studies correlating epileptic foci
oedema surrounding calcified lesions due to and intracranial calcifications suggest that
NC is a persistent host-inflammatory calcifications themselves were not the origin
response provoked by antigens released of the epileptogenic lesion in at least 50% of
from the calcified lesions. However, in the cases36. Some authors tried to correlate
patients with multiple calcifications, it is not EEG with the cyst viability41. They found
clear why only some of the calcified lesions interictal EEG abnormalities in 28% of
would induce inflammation. patients with any form of NC, but no EEG
Electroencephalography (EEG) has been abnormalities in patients with inactive NC.
found to be abnormal in 30–50% of patients These authors suggested that perilesional
with seizures due to NC. It is assumed that gliosis might be insufficient to cause scalp

EEG abnormality in the inactive form of NC. are no controlled clinical trials to establish
Further prospective cohort studies, properly specific indications, definitive doses, and
designed to study ictal and interictal EEG duration of treatment2. A critical review of
abnormalities in patients with seizures, cor- the literature suggests that the studies upon
related with the different evolutionary stages which these assumptions are based are
of the parasite, may clarify the relationship flawed in terms of patient selection, assign-
between NC and epilepsy. ment to treatment, and selection and mea-
The coexistence of hippocampal atrophy surement of outcome variables. Many
and extrahippocampal pathological abnor- authors have appropriately criticized publi-
malities, such as cortical dysgenesis and glio- cations on this topic and have concluded that
sis, referred as ‘dual pathology’, has been no adequate studies of efficacy have been
reported in 5–30% of patients with medically reported (see Chapter 38)5,17,46,47. Other
refractory partial seizures33,45. Dual pathol- authors have warned that this therapy might
ogy implies that both lesions somehow inter- be harmful in some patients, particularly
act with each other and contribute to when cysts are in the subarachnoidal loca-
epileptogenesis through mechanisms still tion, because these drugs might lead to the
poorly understood. Some authors have also development of arachnoiditis, arteritis and
attributed hippocampal sclerosis to NC3,35. hydrocephalus48,49.
Patients with calcifications due to NC and A randomized clinical trial of treatment of
mesial temporal lobe epilepsy (hippocampal patients with newly identified active NC
sclerosis) became seizure-free after used oral prednisolone alone, praziquantel
anteromesial temporal lobectomy, without with prednisolone, or albendazole with
resection of the cysticercotic lesion, suggest- prednisolone49. At 6 months and at 1 year
ing the two phenomena are independent34. after treatment there were no differences in
The possibility of dual pathology related to the three treatment groups in terms of the
NC needs further clarification in prospective proportion of cases free of cysts, or the rela-
cohort studies. tive reduction in number of cysts. At 2 years,
Considering that epileptogenicity of cys- there was no difference in the proportion of
ticercotic lesions is probably low for residual cases free of seizures over the entire follow-
calcifications, one should consider the up period. Based on these results, it appears
chance association between the two condi- that treatment with anticysticercal drugs
tions34,35. Unequivocal evidence of causal does not modify the prognosis of seizures in
relationship between NC and epilepsy could patients with NC. This study addressed
be deduced from correlation between clini- questions about to what extent and in which
cal, EEG, and imaging data. This evidence patients, treatment with either praziquantel
should be demonstrated in patients with sin- or albendazole is indicated. The improve-
gle or multiple NC lesions shown by imag- ment attributed to anticysticercal drugs in
ing studies, in whom video-EEG monitoring previous studies may be related to the lack
displays ictal and interictal abnormalities of appropriate controls and is likely to be a
correlated with type of seizures. The associa- reflection of the natural history of the condi-
tion could be confirmed and the level of risk tion. Placebo-controlled trials for NC treat-
determined through appropriate epidemio- ment that are under way should clarify these
logical studies. uncertainties. It has been suggested that
seizure control in patients with NC is
improved and that the chance of remaining
Effect of Anticysticercal Treatment on seizure-free after the withdrawal of
Epilepsy antiepileptic drug (AED) is greater after a
course of anticysticercal drugs when com-
Despite the first reports regarding treatment pared with seizure control in those in whom
for NC with anticysticercal drugs such as the disease is left untreated10,11. However,
praziquantel and albendazole being pub- these studies do not distinguish between
lished more than 15 years ago2, to date there acute symptomatic seizures, chronic recur-

rent seizures that antedate the infection and ment plus the anticysticercal drug, albenda-
patients with newly diagnosed recurrent zole, 15 mg kg1 day1, for 8 days (44
unprovoked seizures. These distinctions are patients). Thirty patients (39%) experienced
crucial in order to interpret results of such seizure recurrence; however, when using
interventions. Kaplan–Meier survival analysis, 60% of cases
experienced a seizure recurrence in the 5-year
period following a first acute symptomatic
Prognosis of First Seizure due to NC seizure. Half of these recurrences occurred in
the first year. The estimated recurrence was
There are inconsistent data on the risk of fur- 20% at 6 months, 29% at 12 months, 35% at 24
ther seizures in patients with first seizure due months, and 60% at 48 months. This high
to NC. In most studies, the sample size has recurrence is in part related to recurrence of
been small, assessment has been carried out acute symptomatic seizures. Among a large
retrospectively, and optimal analytical meth- array of variables that were assessed as poten-
ods have not been used. Some authors report tial risk factors for recurrence, only persistence
that NC patients with acute symptomatic of abnormalities on follow-up CT scan was
seizures have a good prognosis in terms of predictive of seizure recurrence. Recurrence
remission of seizures3,7,12,13; others report that risk ranged from 22% in patients in whom
most patients have a high risk of seizure cysts disappeared, to 78% in patients showing
recurrence, and suggest that prognosis no change in number of cysts. There were no
improves after anticysticercal treatment10,11. significant differences in the Kaplan–Meier
In a prospective cohort study, patients with curves of recurrence when treatment groups
a first seizure and evidence of an active or were compared (Fig. 21.2). It appears that anti-
transitional form of NC were enrolled and fol- cysticercal treatment did not modify the risk
lowed up for up to 5 years to identify the risk of seizure recurrence. A similar seizure recur-
of subsequent seizures49,50. Additional analysis rence risk (37%) has been reported in patients
was performed after stratification by treat- with single enhancing CT lesions42. This
ment of the acute condition: symptomatic relapse rate is similar to that reported in other
treatment alone using AED(s) and pred- studies of seizure recurrence in cases with a
nisolone (33 patients), or symptomatic treat- first acute symptomatic seizure35,51,52.
1.1
1.0
Cumulative probability
0.9
0.8
0.7 Anticysticercal
treatment
0.6
Yes
0.5 Yes-censored
0.4 No
0 10 20 30 40 50 60 No-censored
Follow-up in months
Fig. 21.2. Probability of seizure recurrence after a first seizure in 77 patients with neurocysticercosis as
a function of anticysticercal treatment. (Source: reference 32.)

There are no guidelines regarding the even if they occur many months after pre-
duration for which AEDs should be contin- sentation. It is appropriate to monitor cyst
ued following an acute NC episode. Some activity with CT scanning and to continue
clinicians routinely continue AEDs for 1 year AEDs until resolution of the acute lesion.
but shorter and longer intervals have been After this time, AEDs may be discontinued.
recommended12. The antiseizure medications Seizures occurring in individuals after reso-
currently used have no antiepileptogenic lution of oedema and resorption or calcifica-
effect but do effectively prevent acute symp- tion of the degenerating cyst should be
tomatic seizure recurrence53. One assumes considered unprovoked and, in this situa-
that the risk of seizures is substantial as long tion, long-term AEDs are warranted (Fig.
as there is an active ongoing process as char- 21.3). These are individuals who truly have
acterized by persistence of oedema around epilepsy42. Seizure recurrence among those
the degenerating lesion. Because of this, we with cyst resolution was about 20%, a figure
feel CT scan is a useful tool for these treat- in accord with studies evaluating unpro-
ment decisions. Seizures in the context of voked seizure risk among individuals with
oedema and a degenerative lesion should be structural brain abnormalities and acute
considered to be acute symptomatic seizures, symptomatic seizures25,51,52.
Degenerative (transitional)
and/or active cysts Only calcification
Initiate AED
Initiate AED
CT or MRI after 3–6 months
Cyst(s) resolved and

no seizure recurrence
Seizure
No seizure
recurrence
Cyst(s) resolved recurrence
Cyst(s) not
but seizure for 1 year
resolved with or
recurrence
without seizure
recurrence
Maintain AED Maintain AED for

Maintain AED
for 1–2 years Withdraw AED 1–2 years
and CT or MRI after last seizure
after last
at 3–6 months
seizure
Fig. 21.3. Suggested protocol for antiepileptic drugs for patients with first seizure due to
neurocysticercosis.

It seems that interpretation of risks of to residual perilesional gliosis. There are

seizures after NC is difficult because of the inconsistencies in the link between NC and
failure to distinguish acute symptomatic epilepsy. Because of the high prevalence of
seizures from epilepsy. This distinction must each condition, a causal as well as fortuitous
be considered in future studies of the effects relationship between the two might exist. A
of treatment on seizure recurrence in people correlation between lesions seen on neu-
with cysticercosis. These difficulties are roimaging and EEG abnormalities has been
increased in those patients who have mixed reported for only 15–30% of patients. Visible
forms, including active, transitional and calci- calcifications do not seem to be the source of
fied lesions. Further studies should be per- the epileptogenic lesion in at least 50% of
formed in order to estimate recurrence risk in cases. Prospective cohort studies, properly
those patients with probable unprovoked designed to study ictal and interictal EEG
seizures due to calcifications alone, in com- abnormalities in patients with seizures, corre-
parison with patients with acute seizures due lated with the different parasite evolutionary
to transitional cysts. These studies should stages, may clarify the relationship between
include a systematic assessment of treatment NC and epilepsy.
strategies. Persons with acute NC should be NC patients have a good prognosis in
treated with antiseizure medication until cyst terms of remission of seizures. Some authors
resolution is demonstrated on CT. suggest that prognosis improves after anti-
cysticercal treatment. Recent prospective
studies have shown that anticysticercal treat-
Conclusions and Recommendations ment does not modify the risk of seizure
for Future Research recurrence. This requires confirmation in con-
trolled clinical trials. There are no guidelines
Epilepsy and NC are common diseases in regarding the duration for which antiseizure
developing countries and cysticercosis is medication should be continued after an
increasingly diagnosed in industrialized acute NC episode. The risk of seizures is sub-
nations as a result of migration from endemic stantial as long as there is an active ongoing
regions. Seizures are the most common process as characterized by persistence of
symptom in patients with a parenchymal oedema around the degenerating lesion.
location of the parasite. NC is not necessarily Because of this, CT scans are useful for treat-
the main cause of epilepsy in developing ment decisions. Seizures in the context of
countries, although it is one of the most fre- oedema and a degenerative lesion should be
quent antecedents among patients with considered to be acute symptomatic seizures
symptomatic seizures. Seizures may occur at even if they occur many months after presen-
any evolutionary stage of the parasite. Acute tation. After resolution of the acute lesion,
symptomatic seizures are more frequent in antiseizure medication may be discontinued.
the transitional form owing to the inflamma- Seizures occurring after resolution of oedema
tory response of the brain. The risk of seizure or calcification of the degenerating cyst
recurrence (epilepsy) occurs in the inactive or should be considered unprovoked and, in
calcified form of NC. This has been attributed this situation, long term AEDs are warranted.
References
1. Bittencourt, P.R.M., Adamolekun, B., Bharucha, N., et al. (1996) Epilepsy in the tropics: II. Clinical
presentations, pathophysiology, immunologic diagnosis, economics and therapy. Epilepsia 37,
1121–1127.
1025–1040.
3. Manreza, M.L. (2000) Epilepsia e neurociticercose. In: Guerreiro, C.A.M., Guerreiro, M.M., Cendes,
F., et al. (eds) Epilepsia. Lemos Editorial & Gráficos Ltda, Sao Paulo, Brazil, pp. 255–264.

4. Martínez, S.M. (1996) Controversias clínicas y terapeúticas en neurocisticercosis. In: García, H.H.,
Martínez, S.M. (eds) Taeniasis/Cisticercosis por T. solium. Editorial Universo SA, Lima, Peru, pp.
207–216.
5. White, A.C. (2000) Neurocysticercosis. Current Treatment Options in Infectious Diseases 2, 78–87.
6. Adamolekun, A., Carpio, A., Carvalho-Filho, F., et al. (1994) Relationship between epilepsy and
tropical diseases. Epilepsia 35, 89–93.
7. Monteiro, L., Nunes, B., Mendonaca, D., et al. (1995) Spectrum of epilepsy in neurocysticercosis: a
long-term follow-up of 143 patients. Acta Neurologica Scandinavia 92, 133–140.
8. Nogales-Gaete, J., Arriagada, C., Gonzáles, J. (1997) Sindromes anatomo-clínicos de la neurocisticer-
cosis. In: Arriagada, C., Nogales-Gaete, J., Apt, W. (eds) Neurocisticercosis. Aspectos Epidemiológicos,
Patológicos, Immunológicos, Clínicos, Imagenológicos y Terapéuticos. Arrynog Ediciones, Santiago, Chile,
pp. 117–138.
10. Medina, M.T., Genton, P., Montoya, M.C., et al. (1993) Effect of anticysticercal treatment on the prog-
nosis of epilepsy in neurocysticercosis: a pilot trial. Epilepsia 34, 1024–1027.
11. Vázquez, V., Sotelo, J. (1992) The course of seizures after treatment for cerebral cysticercosis. New
England Journal of Medicine 327, 696–701.
12. Mitchel, W.G. (1997) How to manage patients with neurocysticercosis? Pediatric neurocysticercosis
in North America. European Neurology 37, 126–129.
13. Morales, N.M., Agapejev, S., Morales, R.R., et al. (2000) Clinical aspects of neurocysticercosis in chil-
dren. Pediatric Neurology 22, 287–291.
14. Carpio, A., Bittencourt, P.R.M. (1998) Epilepsy in the Tropics. In: Chopra, J.S., Sawhney, I.M.S. (eds)
Neurology in Tropics. B.I. Churchill-Livingstone, New Delhi, India, pp. 527–532.
15. Sander, J.W., Shorvon, S.D. (1996) Epidemiology of the epilepsies. Journal of Neurology, Neurosurgery
and Psychiatry 61, 433–443.
16. Carpio, A. (1995) Epidemiology of tropical neurology in South America. In: Rose, F.C. (ed.) Recent
Advances in Tropical Neurology. Elsevier Science, Amsterdam, the Netherlands, pp. 31–42.
17. Pal, D.K., Carpio, A., Sander, J.W.A.S. (2000) Neurocysticercosis and epilepsy. Journal of Neurology,
18. Goodman, K., Ballagh, S.A., Carpio, A. (1999) Case control study of seropositivity for cysticercosis
in Cuenca, Ecuador. American Journal of Tropical Medicine and Hygiene 60, 70–74.
19. Schantz, P.M., Moore, A.C., Munoz, J.L., et al. (1992) Neurocysticercosis in an orthodox Jewish com-
munity in New York city. New England Journal of Medicine 327, 692–695.
20. Tsang, V.C., García, H.H. (1996) Immunoblot diagnostic test (EITB) for Taenia solium cysticercosis
and its contribution to the definition of this under-recognized but serious public health problem. In:
García, H.H., Martínez, S. (eds) Taeniasis/Cisticercosis por T. solium. Editorial Universo, SA, Lima,
Peru, pp. 259–268.
Peru. Lancet 341, 197–200.
55, 282–289.
23. Palacio, L.G., Jimenez, I., García, H.H., et al. (1998) Neurocysticercosis in persons with epilepsy in
Medellin, Colombia. Epilepsia 39, 1334–1339.
sis and cysticercosis in humans and pigs in a village in Morelos, México. American Journal of Tropical
25. Hauser, W.A., Hesdorffer, D.H. (1990) Epilepsy: Frequency, Causes and Consequences. Demos Press,
New York, pp. 197–244.
26. Commission on Epidemiology and Prognosis of the International League Against Epilepsy (1997)
The epidemiology of the epilepsies: future directions. Epilepsia 38, 614–618.
27. Carpio, A., Placencia, M., Santillan, F., et al. (1994) Proposal for a new classification of neurocysticer-
cosis. Canadian Journal of Neurological Sciences 21, 43–47.
28. Martinez, H.R., Rangel-Guerra, R., Arredondo-Estrada, J.H., et al. (1995) Medical and surgical treat-
ment in neurocysticercosis. A magnetic resonance study of 161 cases. Journal of the Neurological
Sciences 130, 25–34.

29. Singhal, B.S., Ladiwala, U. (1995) Neurocysticercosis in India. In: Rose, F.C. (ed.) Recent Advances in
Tropical Neurology. Elsevier Sciences, Amsterdam, the Netherlands, pp. 31–42.
30. Ahuja, G.K., Mohanta, A. (1982) Late onset epilepsy. Acta Neurologica Scandinavia 66, 216–226.
31. Sawhney, I.M., Lekhra, O.P., Shashi, J.S., et al. (1996) Evaluation of epilepsy management in a devel-
oping country: a prospective study of 407 patients. Acta Neurologica Scandinavia 94, 19–23.
32. Carpio, A., Hauser, W.A. (1999) Prognosis of first seizure in patients with neurocysticercosis.
Epilepsia 40 (Suppl. 2), 271.
33. Rodriguéz-Carbajal, J., Placencia, M., Carpio, A. (1983) Calcificaciones intracraneales anormales: 135
casos estudiados por T.A.C. Neurologia Neurocirurgica y Psiquiatria 24, 49–60.
34. Leite, J.P., Terra-Bustamante, V.C., Fernandes, R.M.F., et al. (2000) Calcified neurocysticercosis lesions
and postsurgery seizure control on temporal lobe epilepsy. Neurology 55, 1485–1491.
35. Sakamoto, A.C., Bustamante, V.C.T., Garzón, E., et al. (1992) Cysticercosis and epilepsy. In: Kotagal,
P., Luders, H.O. (eds) The Epilepsies: Etiologies and Prevention. Academic Press, San Diego, pp.
275–282.
36. Terra, V., Sakamoto, A.C., Santos, A.C., et al. (1995) Epilepsy and cerebral cysticercosis: correlation
between CT, EEG, and clinical findings. Epilepsia 36 (Suppl.3), 226.
37. Singh, G., Sachdev, M.S., Tirath, A., et al. (2000) Focal cortical-subcortical calcifications (FCSCs) and
epilepsy in the Indian subcontinent. Epilepsia 41, 718–726.
38. Pradhan, S., Kathuria, M.K., Gupta, R.K. (2000) Perilesional gliosis and seizure outcome: a study
based on magnetization transfer magnetic resonance imaging in patients with neurocysticercosis.
Annals of Neurology 48, 181–187.
39. Nash, T.E., Petronas, N.J. (1999) Edema associated with calcified lesions in neurocysticercosis.
40. Sheth, T.N., Pilon, L., Keystone, J., et al. (1998) Persistent MR contrast enhancement of calcified neu-
rocysticercosis lesions. American Journal of Neuroradiology 19, 79–82.
41. Chayasirisobhon, S., Menoni, R., Chayasirisobhon, W., et al. (1999) Correlation of electroencephalog-
raphy and the active and inactive forms of neurocysticercosis. Clinical Electroencephalography 30,
9–11.
42. Murthy, J.M., Reddy, V.S. (1998) Clinical characteristics, seizure spread patterns and prognosis of
seizures associated with a single small cerebral calcified CT lesion. Seizure 7, 153–157.
43. Cukiert, A., Puglia, P., Scapola, H.B., et al. (1994) Congruence of the topography of intracranial calci-
fications and epileptic foci. Arquivos de Neuropsiquiatria 52, 289–294.
44. Williamson, P.D., Thadani, V.M., Darcey, T.M., et al. (1882) Occipital lobe epilepsy: clinical character-
istics, seizures spread patterns, and results of surgery. Annals of Neurology 31, 3–13.
45. Cendes, F., Cook, M.J., Watson, C., et al. (1995) Frequency and characteristics of dual pathology in
patients with lesional epilepsy. Neurology 45, 2058–2064.
46. Salinas, R., Prasad, K. (1998) Drugs in neurocysticercosis (tapeworm infection of the brain). In:
Garner, P., Gelband, H., Olliaro, P., et al. (eds.) Infectious Diseases Module of The Cochrane Database of
Systematic Reviews [database on disk, CDROM and online; updated 02 December 1997]. The
Cochrane Collaboration; Issue 1. Update Software, Oxford.
47. Kramer, L.D. (1995) Medical treatment of cysticercosis. Ineffective. Archives of Neurology 52, 101–102.
48. Caplan, L.R., Estanol, B., Mitchel, W.G., et al. (1997) How to manage patients with neurocysticerco-
sis. European Neurology 37, 124–131.
50. Carpio, A., Hauser, W.A., Lisanti, N., et al. (1999) Prognosis of epilepsy in Ecuador: a preliminary
report. Epilepsia 40 (Suppl. 2), 110.
51. Cockerell, O.C., Johnson, A.L., Sander, J.W.A.S., et al. (1997) Prognosis of epilepsy: a review and fur-
ther analysis of the first nine years of British National General Practice Study of Epilepsy, a prospec-
tive population-based study. Epilepsia 38, 47–55.
52. Semah, F., Picot, M.C., Adam, C., et al. (1998) Is the underlying cause of epilepsy a major prognostic
factor for recurrence? Neurology 51, 1256–1262.
53. Annerges, J.F., Hauser, W.A., Coan, S.P., et al. (1998) A population-based study of seizures after trau-
matic brain injuries. New England Journal of Medicine 338, 20–24.

22 Cerebrovascular Manifestations of
Neurocysticercosis
Fernando Barinagarrementeria and Carlos Cantú
Introduction Cerebrovascular complications of neuro-

cysticercosis (NC) were first described in the
Arteritis or vasculitis refers to inflammation early part of the 19th century in a patient
of the wall of an artery (arteritis) or vein with cysticercal meningitis, in whom
(phlebitis). It has been attributed to a variety necropsy disclosed intracranial arteritis8.
of aetiological agents1. Intracranial arteritis is While several reports have emphasized the
a well-recognized complication of several existing relationship between NC and stroke
infectious diseases2–4. The presence of Taenia during the last few years, these have been
solium metacestodes in human tissue triggers limited to isolated case reports and small
an inflammatory response that varies from clinical series2,9–16. This clinical aspect of NC
patient to patient and from tissue to tissue. has been poorly reviewed in world literature
The severity of the inflammatory reaction is and despite its global recognition, NC is usu-
related to different stages of the cysticercus, ally not described as a cause of stroke in con-
being less intense in the foremost and last temporary neurology and stroke textbooks.
stages of its life cycle5. It may involve blood
vessels located in the vicinity of the cysts. In
the given circumstances, all three layers of Frequency of Cerebrovascular
the vessel wall may be affected, producing a Disease in NC
true panarteritis6. Cysticercotic endarteritis
has been classically considered as a small The frequency of stroke in several large pub-
vessel disease related to cyst(s) located in lished series of NC varies between 2% and
close relation to basal arteries5,6. Therefore, 15%17–19. Among 352 consecutive patients
small deep (lacunar) infarcts are frequent. with NC, Barinagarrementeria and Del
However, major arteries may also be Brutto, found seven (2%) instances of lacunar
involved and are often thickened and nar- stroke10. On a different note, among more
rowed by arteritis. There is histopathological than 700 consecutive stroke patients who
evidence of adventitial thickening, medial attended a stroke clinic until 1991, the same
fibrosis and endothelial hyperplasia, which group reported 144 cases with lacunar syn-
evolve to occlusion of the arterial lumen and dromes; 12 (8%) of them were due to NC20.
cerebral infarction. As a rule, cerebral arteri- One may also obtain an idea about the inci-
tis is related to presence of chronic meningi- dence of cerebrovascular involvement by
tis and focal or diffuse arachnoiditis7. studying the frequency of angiographic


222 F. Barinagarrementeria and C. Cantú
abnormalities in NC. Thus, Monteiro et al. Thalamomesencephalic syndrome

from Portugal found cysticercotic arteritis in
2% of patients with NC21. In comparison, This is a condition with grave prognosis and
Rocca and Monteagudo reported angio- stuttering but relentless progression, inciden-
graphic abnormalities compatible with arteri- tal to severe perimesencephalic arachnoiditis
tis in 23 (50%) of 46 patients with NC22. In our and occlusion of the thalamopeduncular
series of 28 patients with subarachnoid cys- branches of the mesencephalic artery25.
ticercosis, angiographic abnormalities com- Clinical features include impaired vertical
patible with arteritis were noted in 15 (54%)23. gaze, pupillary abnormalities, somnolence,
paraparesis and urinary incontinence.
Clinical Features
Large territorial infarction
In common with other non-atherosclerotic
vasculopathies, cysticercotic arteritis is com- Occlusion of large blood vessels including the
monly encountered in young individuals. The middle and anterior cerebral arteries and
mean age at diagnosis was 36 years in a series even the internal carotid artery may occur in
of 65 patients described by Cantú and NC13,15,16,25. Large infarctions are infrequent in
Barinagarrementeria7. Generally, individuals comparison to deep small infarcts. Large ves-
with stroke due to NC have no underlying sel arteritis results from inflammatory degen-
vascular risk factors. Cysticercotic arteritis can eration of closely located cysticerci. On
involve the small, medium and large sized occasion, large vessel arteritis and consequent
vessels. Small vessel occlusion with conse- infarction is precipitated by an inflammatory
quent lacunar infarction is most frequent. response to the administration of anticysticer-
cal drugs9,15. The latter should, therefore, be
administered with caution in those patients
Lacunar syndromes with extensive cyst load, located particularly
in relation to major arteries.
The term ‘lacunar syndromes’ originally
referred to clinical features associated with
small infarcts resulting from atheromatous or Haemorrhagic stroke
embolic occlusion of penetrating branches of
large arteries. It was later realized that these Subarachnoid, parenchymal and intracystic
syndromes might also result from inflamma- haemorrhage may occur in the setting of
tory arteriopathies. In the particular context NC3,25,26. These complications are extremely
of NC, Barinagarrementeria and Del Brutto rare. Subarachnoid haemorrhage may result
described seven patients with lacunar syn- from the rupture of a mycotic aneurysm that
dromes due to NC10. The patients presented develops in relation to a racemose cyst
with typical lacunar syndromes including adherent to an artery (Fig. 22.2)25,26.
pure motor hemiparesis, ataxic hemiparesis
and sensorimotor paralysis10,24. Lacunar
infarctions were located in the posterior limb Clinicopathological Correlations
of internal capsule or corona radiata on com-
puted tomography or magnetic resonance Occlusive stroke characteristically occurs in
imaging (CT/MRI) (Fig. 22.1a–c). Four of the setting of meningeal racemose cysticerco-
these patients had evidence of a racemose sis25. Among various locations and stages,
cyst in the ipsilateral suprasellar cistern. It stroke is more commonly seen with involve-
was surmised that the cyst and the surround- ment of the basal cisterns and during the
ing meningeal inflammatory reaction and inflammatory stages as recognized by pleocy-
subsequent arachnoiditis led to occlusion of a tosis and/or increased protein upon cere-
penetrating branch of the proximal segment brospinal fluid (CSF) examination. Very
of the middle cerebral artery (Fig. 22.1a–c). rarely, arterial occlusion may occur in the set-

Cerebrovascular Manifestations of Neurocysticercosis 223
Fig. 22.1. (a) Axial T2-weighted MRI scan shows a cystic lesion in the left suprachiasmatic cistern,
adjacent to the middle cerebral artery. (b) Axial T2-weighted MRI scan reveals cerebral infarction in the
left middle cerebral artery territory secondary to vasculitis associated with a suprachiasmatic cyst. (c)
Coronal T1-weighted Gd-MRI scan, taken several months after stroke onset, shows a persistent focal
enhancement of the cyst and the old cerebral infarction in the ipsilateral corona radiata.
ting of parenchymal NC16. Besides, the occur- In the latter group, epilepsy and intracranial
rence of stroke is also determined by the hypertension were the most frequent present-
extent of arachnoiditis. In a study of 65 ing manifestations. Headache in association
patients with cerebrovascular complications with cerebral infarction occurred in about
of NC, Cantú and Barrinagarrementeria one-third of patients with focal arachnoiditis.
found that those with focal arachnoiditis had It is possible to predict the occurrence,
a sudden onset of the disease, implying the nature and severity of cerebrovascular involve-
occurrence of a symptomatic cerebral infarc- ment by studying the distribution of cysticercal
tion7. In comparison, only 20% of those with disease and the severity of concomitant chronic
diffuse arachnoiditis had an apoplectic onset. arachnoiditis7. When cysts are confined to a

Fig. 22.2. Mycotic aneurysm of the middle cerebral artery formed in relation to a degenerating cysticercus after
surgical removal of both. (Source: Svetlana Agapejev, São Paulo, Brazil.)
focal area and with mild or no arachnoiditis, Investigations

they involve small penetrating vessels with
ensuing lacunar infarcts and syndromes. When Angiography
focal cysticercosis is accompanied by marked
inflammatory response as evidenced by severe The first angiographic study of cerebral
abnormalities upon CSF examination, large arteritis in NC was made in 1932 by Moniz et
vessels of the circle of Willis tend to get al., who reported two patients with arteritis
involved, thereby producing large cerebral involving the intracranial portion of the inter-
infarct(s) (Fig. 22.3a and b, Fig. 22.4a and b). nal carotid artery27. More recently, we
Finally, the most severe form of arteritis affect- reported angiographic abnormalities in 15 of
ing both large and small arteries occurs when 28 patients with subarachnoid cysticercosis23.
cysticerci are widely distributed throughout A stroke syndrome was found in 80% of these
the subarachnoid space, associated with an patients. The most commonly involved ves-
intense inflammatory profile of the CSF. sels upon angiography were the middle (Figs
Fig. 22.3. (a) Coronal T1-weighted Gd-MRI scan demonstrates diffuse enhancement of the basal cisterns,
extending to the proximal portion of the Sylvian fissures; small cysticerci are evident. (b) Lateral left angiogram
discloses the common carotid artery with segmental stenosis of the middle cerebral artery (arrow and arrowhead).

Fig 22.4. (a) Coronal T1-weighted Gd-MRI scan shows numerous cysticerci in the basal cisterns and both
Sylvian fissures, with only a mild meningeal enhancement. (b) Corresponding left anteroposterior carotid artery
angiogram reveals a segmental narrowing of the trunk of the middle cerebral artery (arrow).
22.3b and 22.4b) and posterior cerebral arter- 56 (86%). The intensity of inflammation
ies. The latter were involved in more than depicted by the CSF study correlated with
half of the patients. Single artery involvement the severity and extent of arteritis and the
was noted in eight patients. However, angio- degree of meningeal enhancement upon Gd-
graphic abnormalities were noted in two MRI, so that patients with diffuse basal
arteries in four patients and three or more involvement upon Gd-MRI exhibited severe
arteries in three patients, respectively. A dif- and persistent CSF abnormalities.
fuse meningeal enhancement was observed
by gadolinium (Gd)-MRI in five out of
seven patients with involvement of more MRI (including Gd-MRI)
than one artery upon angiography.
Interestingly, we observed asymptomatic Gd-MRI outlines the presence and distribu-
cerebral arteritis in 20% of the patients with tion of cysts, character and extent of arach-
subarachnoid cysticercosis. noiditis and the number and location of
cerebral infarctions. In our series of 65
patients with cerebrovascular complications,
CSF examination MRI detected one or more cyst(s) in the sub-
arachnoid space, commonly in the basal or
CSF abnormalities correlate with the location Sylvian cisterns (Fig. 22.3a) in the neighbour-
of cysticercus and are more commonly seen hood of the ischaemic area in 54 (83%)7.
in the setting of meningeal-racemose cys- Uncommonly, Gd-MRI may not visualize
ticercosis. Therefore, as a rule the CSF study cysts but reveal only intense enhancement of
is abnormal in individuals with cysticercotic the meninges. Based on the degree and
arteritis. We noted CSF abnormalities in 58 extent of meningeal enhancement upon Gd-
(89%) of 65 patients with documented cys- MRI, chronic arachnoiditis associated with
ticercotic arteritis7. The abnormalities cysticercotic arteritis can be categorized as
included lymphocytic pleocytosis (57; 88%), focal or diffuse28. Focal arachnoiditis is iden-
increased protein levels (44; 68%) and hypo- tified by contrast enhancement restricted to a
glycorrhagia (24; 37%). CSF eosinophilia was single cerebral cistern, whereas diffuse
noted in 33 (51%) patients, while immuno- arachnoiditis is characterized by enhance-
logical tests for cysticercosis were positive in ment involving several cerebral cisterns.

Transcranial Doppler (TCD) occurred within 4–6 months. Conversely, in

three patients, serial TCD demonstrated per-
Although cerebral angiography is exquisitely sistence of occlusive and stenotic patterns,
sensitive for diagnosing cerebral arteritis, it suggesting arterial scarring or fibrosis. Thus,
has the limitations of being expensive and TCD permitted evaluation of the natural his-
invasive. Moreover, cerebral vasculitis sec- tory of cysticercotic inflammatory arteriopa-
ondary to infectious chronic arachnoiditis is thy. The role of TCD vis-à-vis cerebral
an evolving condition with variable morpho- angiography in detecting stenosing lesions
logical features. As a result, serial follow-up of the basal cerebral arteries was evaluated
studies are often required to demonstrate its in 54 patients with chronic meningitis,
presence and outcome. It is desirable to have including 27 patients with subarachnoid cys-
a non-invasive and reproducible diagnostic ticercosis33. Specificity and positive and neg-
test for cerebral vasculitis. Several recent ative predictive values were excellent
studies have suggested the utility of TCD in (95–100%). The reliability was rated as good
the setting of certain inflammatory condi- to excellent (0.64–0.86). However, the sensi-
tions of the central nervous system29–31. tivity varied from 60 to 88%.
A preliminary study explored the role of Further experience with TCD in the detec-
TCD in evaluation of cysticercotic arteritis in tion and follow-up of cysticercotic vasculitis
nine patients with subarachnoid cysticercosis is required. At this time, we can surmise that
and stroke32. Findings upon TCD were com- TCD is a useful means for the detection of a
pared with cerebral angiography in all cases. concomitant arteriopathy in subarachnoid
Cerebral vasculitis was diagnosed sono- cycticercosis. Serial TCD monitoring provides
graphically by the finding of abnormal flow insight into the temporal resolution or pro-
velocity in the main cerebral arteries, consis- gression of this arteritis and may help to clar-
tent with an occlusive or stenotic pattern. ify its prognostic implications. It may be able
Sonographic abnormalities suggestive of to recognize patients at risk of cerebral occlu-
cerebral vasculitis in major intracranial arter- sion and monitor therapeutic interventions.
ies were detected in all six patients with arte-
rial lesions recognized by cerebral
angiography. On the other hand, TCD and Conclusions
cerebral angiography were normal in three
patients, thus reflecting involvement of small Stroke is an important but under-recognized
penetrating arteries as demonstrated by the complication of subarachnoid-meningeal
MRI finding of small deep cerebral infarc- cysticercosis. Deep lacunar infarcts, with
tions. In addition, TCD was found to be an characteristic lacunar syndromes occur
excellent tool to monitor disease progression because of the endarteritis involving small
and prognosis. Five of the six patients with penetrating arteries. Large territorial infarc-
abnormal TCD at stroke onset were available tions are uncommon. Gd-MRI, CSF examina-
for long-term follow-up. Over several tion and cerebral angiography are standard
months, a gradual return of blood flow tools for the evaluation of arteritis and its
velocities towards normal was observed in related pathological processes. TCD is
two patients. Resolution of the stenotic pat- emerging as an important non-invasive tool
terns of middle cerebral and basilar arteries for diagnosing and monitoring arteritis.
References
1. Solé-Llenas, J., Pons-Tortella, E. (1978) Cerebral angiitis. Neuroradiology 18, 1–11.

2. Alarcón, F., Hidalgo, F., Moncayo, J., et al. (1992) Cerebral cysticercosis and stroke. Stroke 23,
224–228.
3. Ferris, E.J., Levine, H.L. (1973) Cerebral arteritis: classification. Radiology 109, 327–341.
4. Leeds, E.N., Goldberg, H.I. (1971) Angiographic manifestations in cerebral inflammatory disease.
Radiology 98, 595–604.

5. Escobar, A. (1983) The pathology of neurocysticercosis. In: Palacios, E., Rodríguez-Carbajal, J.,
Taveras, J.M. (eds) Cysticercosis of the Central Nervous System. Charles C. Thomas, Springfield,
Illinois, pp. 27–54.
6. Escobar, A., Nieto, D. (1972) Parasitic diseases. In: Minckler, J. (ed.) Pathology of the Nervous System.
McGraw-Hill, New York, pp. 2503-2521.
7. Cantú, C., Barinagarrementeria, F. (1996) Cerebrovascular complications of neurocysticercosis: clini-
cal and neuroimaging spectrum. Archives of Neurology 53, 233–239.
8. Nieto, D. (1982) Historical note on cysticercosis. In: Flisser, A., Willms, K., Laclete, J.P., et al. (eds)
Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp. 1–7.
9. Woo, E., Yy, Y.L., Huang, C.Y. (1988) Cerebral infarction precipitated by praziquantel in neurocys-
ticercosis – a cautionary note. Tropical and Geographical Medicine 40, 143–146.
10. Barinagarrementeria, F., Del Brutto, O.H. (1989) Lacunar syndromes due to neurocysticercosis.
11. Rodriguez-Carbajal, J., Del Brutto, O.H., Penagos, P., et al. (1989) Occlusion of the middle cerebral
12. terPenning, B., Litchman, C.D., Heier, L. (1992) Bilateral middle cerebral artery occlusions in neuro-
cysticercosis. Stroke 23, 280–283.
13. Levy, A.S., Lillehei, K.O., Rubinstein, D., et al. (1995) Subarachnoid neurocysticercosis with occlu-
sion of a major intracranial artery: case report. Neurosurgery 36, 183–188.
14. Sangla, S., De Broucker, T., Abgrall, S., et al. (1995) Cerebral infarction disclosing neurocysticercosis.
Revue Neurologique (Paris) 15, 277–280.
15. Bang, O.Y., Heo, J.H., Choi, S.A., et al. (1997) Large cerebral infarction during praziquantel therapy
in neurocysticercosis. Stroke 28, 211–213.
16. Kohli, A., Gupta, R., Kishore, J. (1997) Anterior cerebral artery territory infarction in neurocysticer-
cosis: evaluation by angiography and in vivo proton MR spectroscopy. Pediatric Neurosurgery (Basel)
26, 93–96.
20. Barinagarrementeria, F. (1990) Non-vascular etiology of lacunar syndromes. Journal of Neurology,
Neurosurgery and Psychiatry 53, 1111.
21. Monteiro, L., Almeida-Pinto, J., Leite, T., et al. (1994) Cerebral cysticercus arteritis: five angiographic
cases. Cerebrovascular Diseases 4, 125–133.
22. Rocca, E., Monteagudo, E. (1966) An angiographic study of neurocysticercosis. International Journal
of Surgery 86, 520–528.
23. Barinagarrementeria, F., Cantú, C. (1998) Frequency of cerebral arteritis in subarachnoid cysticerco-
sis. An angiographic study. Stroke 29, 123–125.
24. Barinagarrementeria, F., Del Brutto, O.H. (1988) Neurocysticercosis and pure motor hemiparesis.
Stroke 19, 1156–1158.
26. Soto-Hernandez, J.L., Gomez-Llata, S., Rojas-Echeverri, L.A., et al. (1996) Subarachnoid hemorrhage
secondary to a ruptured inflammatory aneurysm: a possible manifestation of neurocysticercosis:
case report. Neurosurgery 38, 197–200.
27. Moniz, E., Loff, R., Pacheco, I. (1932) Sur le diagnostic de la cysticercosis cérebrale. Encephale (Paris)
27, 42–53.
28. Chang, K.H., Han, M.H., Roh, J.K., et al. (1990) Gd-DTPA-enhanced MR imaging of the brain in
patients with meningitis: comparison with CT. AJNR American Journal of Neuroradiology 11, 69–76.
29. Haring, H.P., Rotzer, H.K., Reindl, H., et al. (1993) Time course of cerebral blood flow velocity in cen-
tral nervous system infections. A transcranial doppler sonography study. Archives of Neurology 50,
98–101.
30. Muller, M., Merkelbach, S., Huss, G.P., et al. (1995) Clinical relevance and frequency of transient
stenoses of the middle and anterior cerebral arteries in bacterial meningitis. Stroke 26, 1399–1403.
31. Gupta, R., Mahapatra, A.K., Bhatia, R. (1995) Serial transcranial doppler study in meningitis. Acta
Neurochirurgica (Wein) 137, 74–77.

32. Cantú, C., Villarreal, J., Soto, J.L., et al. (1998) Cerebral cysticercotic arteritis: detection and follow-up
by transcranial doppler. Cerebrovascular Diseases 8, 2–7.
33. Cantú, C., Soto, J.L., Villarreal, J., et al. (1998) Detection and follow-up of cerebral arteritis by tran-
scranial doppler in patients with chronic meningitis. Neurology 50 (Suppl. 4), A400 (Abstract).

23 Taenia solium Cysticercosis:

Uncommon Manifestations
Gagandeep Singh and Indermohan S. Sawhney
Introduction only two cases with spinal involvement in

the large series of 450 patients of Dixon and
The most common manifestations of neuro- Lipscomb6. The condition is likely to be
cysticercosis (NC) include seizures, head- over-represented in neurosurgical series as
aches and focal neurological deficits. a number of such cases end up with surgi-
However, the disorder is known for its pleo- cal treatment7. Finally, spinal involvement
morphic presentations. Medical literature is was seen in 5 of 356 cases of a radiological
replete with reports of unusual presenta- series of NC8.
tions. Knowledge of these uncommon mani- Spinal cysticercosis is classified on the
festations is important and failure to basis of anatomical localization of cysts. The
recognize them often leads to misdiagnosis disease may occur at extradural, intradural
and delay in management. Several unusual extramedullary and intramedullary loca-
manifestations are reviewed in this chapter tions. Extradural cysticercosis is extremely
with emphasis on spinal cysticercosis. rare (Fig. 23.1a and b)9–13. Canelas et al.
reviewed published literature and collected
35 cases of intradural extramedullary spinal
Spinal cysticercosis cysticercosis (IDEMSC) and seven cases of
intramedullary spinal cysticercosis (IMSC)4.
Walton first described the occurrence of a Going by their survey of literature, IDEMSC
cyst in the ventral portion of the cervical is five times more common than IMSC.
spinal cord at autopsy in 18811. Since then, Pathologically, the former condition is repre-
only a limited number of cases of spinal sented by racemose cysts in the intradural
cysticercosis have been described in litera- compartment as well as arachnoiditis.
ture, emphasizing the rarity of this condi- IDEMSC represents the downward
tion. Its incidence at autopsy is about 3%2. migration of intracranial-subarachnoid race-
Several authors consider that autopsy series mose cysts (Fig. 23.2a–c)4,10,14. Queiroz et al.
underestimate the true frequency of spinal performed elaborate calculations in order to
cysticercosis on account of the fact that the estimate the probability of location of cys-
spinal cord is not routinely examined3–5. ticerci in relation to the regional blood sup-
However, spinal cysticercosis is rare in clini- ply to various segments of the spinal cord5.
cal series of cysticercosis as well, its fre- They concluded that IMSC was acquired
quency being less than 2.5%4,6. There were through a haematogenous route and


230 G. Singh and I.S. Sawhney
Fig. 23.1. Extradural spinal cysticercosis. CT myelographic (a) and histological (b) appearances.
(Reproduced with permission from reference 11.)
Fig. 23.2. Intradural extramedullary spinal cysticercosis. T1 sagittal (a) and T2 axial (b) and sagittal (c)
MRI sections demonstrating that intradural extramedullary cysticercosis represents an extension of
cranial subarachnoid cysticercosis into the spinal canal. (Reproduced with permission from reference
27.) (Source: E. Citfci and A. Hayman, Baylor, Texas, USA.)

Uncommon Manifestations 231
explained the preference of intramedullary more, extramedullary spinal cysts are

cysts to the thoracic spinal cord on the basis mostly asymptomatic by themselves and
of increased proportion of arterial blood sup- produce symptoms and signs of spinal
ply to the latter. Canelas et al. proposed a involvement because of arachnoiditis when
ventriculoependymal route for migration of they degenerate.
cysts from the ventricles to the spinal cord4. Canelas et al. classified spinal syndromes
From a mechanistic point of view, due to IDEMSC into three varieties: spinal
myelopathy occurs as a result of direct com- cord compression syndrome, tabes dorsalis
pression. However, unattached intradural syndrome and meninigomyelitis4. We
extramedullary cysts, which have migrated reviewed available English and Latin litera-
from the cranium are probably asympto- ture on this subject and could find the fol-
matic15–18. They are soft, pliable and non- lowing clinical presentations4,8,10,14–22:
compressive. Degeneration of the cysts
1. Cauda equina – Conus syndrome: Cardinal
produces an intense inflammatory reaction
features include lumbar pain radiating to the
leading to arachnoiditis and attendant com-
lower limbs, crural paresis and sphincter dis-
plications, including vascular compromise,
turbances developing over a few weeks–
myelitis, degeneration of spinal cord and,
months. Clinical examination reveals evi-
rarely, syringomyelia4,14,19. Clinical symp-
dence of involvement of the cauda equina
toms and signs of myelopathy are discern-
and conus medullaris in varying combina-
able only during the inflammatory stage8.
tions4,14,23.
2. Cervical or thoracic myeloradiculopathy:
Intradural Extramedullary Spinal Cysts and arachnoiditis in the cervicotho-
Cysticercosis (IDEMSC) racic spinal canal produce a painful, asym-
metrical, patchy neurological deficit. The
Clinical features condition can be differentiated from other
causes of myeloradiculopathy only by its
Rocca stressed that IDEMSC was most com- association with intracranial cysticercosis.
mon in the cervical spinal canal10. He sug- 3. Posterior column syndrome: Canelas et al.
gested that the presence of septations in the described two patients with what they
cervical intradural space prevented the referred to as a tabetiform syndrome and
downward migration of cysts. However, our another presenting with subacute combined
review of published cases of this condition degeneration of the spinal cord4.
suggests that cysts can produce symptoms at Corresponding spinal imaging or pathologi-
any location, with lumbosacral and cervical cal confirmation was not available but a cys-
cord involvement being more com- ticercal aetiology was inferred from an
mon4,8,10,14–22. association with intracranial cysticercosis.
Zee et al. gave a lucid account of the clini- 4. Amyotrophic lateral sclerosis syndrome:
cal course of IDEMSC8. Their patient pre- Meyer first described the syndrome of amy-
sented with intracranial hypertension due to otrophic lateral sclerosis, i.e. severe
hydrocephalus. Cisternal racemose cysticer- bibrachial amyotrophy and spastic parapare-
cosis was diagnosed and a cyst was demon- sis, pathologically characterized by degener-
strated in the cisterna magna. It was later ation of the anterior horn cells and lateral
found to have migrated to the cervical funiculi and cysticercal arachnoiditis in the
spinal canal. The patient was asymptomatic cervical spinal cord24. Only very few clinico-
at this stage. One year later, the patient pathological reports of this condition are
rapidly developed a spinal cord syndrome. available24–26.
A number of cysts with intense arachnoiditis 5. Syringomyelia: Syringomyelia in associa-
were observed upon radiological examination with syringobulbia can occur as a
tion of the spine. The case illustrates the result of occlusion of the fourth ventricle
point that intracranial symptoms and signs outlet by cysticercal arachnoiditis and
precede myelopathy in IDEMSC. Further- meningeal fibrosis19.

Spinal imaging acteristic. The presence of intracranial cister-

nal racemose cysticercosis supports a diag-
Earlier diagnostic techniques included nosis of IDEMSC (Fig. 23.2a–c)27.
pantopaque (now banned) and metriza-
mide myelography. Multiple cysts and
irregular patchy filling defects characteris- Management and outcome
tic of arachnoiditis could be seen upon
myelography. Unattached cysts were found Unfortunately, adequately long follow-ups
located dorsal to the spinal cord, with the are not available for a number of the reported
patient in the prone position. Cysts were cases of IDEMSC. Few reports describe a lim-
also noted to migrate over a few vertebral ited follow-up, in particular, the immediate
segments with changes in body position postoperative outcome4,7,10. Unattached cysts
during myelography15–18. A fluid level in are easy to remove at surgery. In addition,
the cyst was often noted upon metrizamide irrigation of the spinal canal with physiologi-
myelography, due to diffusion of metriza- cal saline to remove additional cysts may be
mide across the cyst wall8. undertaken. Adherent degenerating cysts are
Leite et al. reported spinal MRI findings in difficult to excise and usually require
12 patients with IDEMSC and emphasized microneurosurgical procedures28. A major
upon the presence of enhancing cystic struc- determinant of the surgical outcome is the
tures and sheet-like enhancement of the extent of arachnoiditis. Limited sectors of
spinal subarachnoid space (Fig. 23.3a–c)20. arachnoiditis may be dealt by microneurosur-
Any vertebral level can be involved and gical techniques7,28. Surgical results are poor
multiple levels of involvement is most char- with more extensive and intense arachnoidi-
Fig. 23.3. T2 (a) and T1 (b) and post-gadolinium (c) sagittal MRI showing the subarachnoid space filled
with serpentine material giving a high signal on T2 and low signal on T1 images. (Reproduced with

tis. Some patients may improve partially after Spinal imaging

surgery and then deteriorate again due to
ongoing arachnoiditis. MRI is the standard investigative procedure
for diagnosis of IMSC. Upon MRI, the spinal
cord may be focally enlarged. A focal cystic
Intramedullary Spinal Cysticercosis lesion can be seen that is hyperintense on T2-
(IMSC) and hypointense on T1-weighted images (Fig.
23.4). A review of published MRI descriptions
A number of anecdotal case reports of IMSC of IMSC revealed that a scolex was visible in
are accompanied by reviews of published lit- only two out of 12 case reports20,29,31,34,37. The
erature4,5,29. We reviewed clinical and labora- scolex is isointense to the cord parenchyma in
tory features of 24 cases reported in English T1 sections and is not visible in T2 sections.
literature from 1976 onwards5,22,29–40. The cyst wall and the surrounding cord
parenchyma and meninges may enhance
after contrast, whilst the scolex is non-enhanc-
Clinical features ing. There may be surrounding oedema.
Intramedullary cysts may be multiple and
may be associated with hydromelia. In the lat-
IMSC occurs mostly in young adults. In the
ter situation, it is important to differentiate
24 case reports, that we analysed, mean
(±SD) age was 28 ±14 years (range: 10–60
years). There were 21 males and four
females. Myelopathy due to IMSC develops
over a few days–weeks. Exceptions to this
rule have been one case reported by
Holtzman et al. of a progressive myelopathy
developing over 8 years and another
reported by Sharma et al. of a patient with
radicular pains of 10 years duration29,30. An
acute spinal cord syndrome may be precipi-
tated as a result of the administration of
anticysticercal therapy for cerebral cysticer-
cosis in an individual with otherwise asymp-
tomatic IMSC34. The symptom complex of
IMSC comprises of sensorimotor paralysis
below the level of lesion with or without
bladder and bowel involvement. Local pain
is an important symptom29,31,32,35,36,38,40 but
may be absent22,30,37,39. There may be signs of
meningeal irritation32,40.
IMSC is commonly located in the thoracic
spinal cord. Exceptionally, it may involve the
cervical spinal cord1,34,36 or conus
31
medullaris . There may be more than one
intramedullary cyst or associated IDEMSC
and arachnoiditis22,31. Castillo et al. reported
the occurrence of multiple cysts in one indi-
vidual31. Two cysts, located in the conus
medullaris and thoracic spinal cord were of
cysticercal aetiology and the third cystic Fig. 23.4. Intramedullary spinal cysticercosis. T2
lesion in the cervical spinal cord was attrib- (left) and T1 (right) sagittal MRI of the cervical
utable to hydromelia resulting from obstruc- spinal cord revealing a cystic intramedullary
tion of the central canal by the former. lesion. (Source: Prakash Singh, New Delhi, India.)

between the two conditions. Hydromelia tions, while the inner surface has a smooth
appears hypointense on T2 glistening texture30. A scolex may or may not
sections because of mobility of fluid in the be discernable. Calcific knobs may be seen39.
cavity. Other cystic lesions that may be Microscopically, there is surrounding gliosis
considered in the differential diagnosis and granulation tissue consisting of plasma
of intramedullary cysticercosis include pri- cells and foamy macrophages29,30,40.
mary and secondary neoplastic cysts,
syringomyelia and hydatid cysts. Corral et al.
reported MRI appearance of IMSC in a Management and outcome
patient with multiple cerebral cysticercosis
who was administered albendazole for treat- Until recently, surgery was advocated as stan-
ment of cerebral cysts34. Spinal MRI revealed dard treatment for IMSC. It was often diag-
focal spinal cord enlargement, oedema and nosed at surgery30,31 or rarely at necropsy5
irregular enhancement with no definite cystic because myelographic appearances of this con-
lesion. The authors surmised that these dition were non-specific. Postoperative neuro-
appearances were of an inflammatory logical outcome varied. As a general rule, there
parenchymal reaction to a dead cyst. It may was partial recovery over few months with
be interesting to speculate a cysticercal aetiol- some residual permanent neurological deficit.
ogy in some of the cases of myelopathies The availability of MRI offered the unique
with clinical and MRI features of non-specific opportunity of identifying intramedullary
myelitis in cysticercus endemic areas. cysts before surgery and opened prospects for
non-surgical management. To our knowledge,
there are at least three reports of IMSC treated
Ancillary investigations with albendazole for about a month34,37. The
outcome has been extremely favourable in
In contradistinction to IDEMSC, which is terms of neurological recovery in all three
usually accompanied by intracranial involve- cases. It may be necessary to co-administer cor-
ment, it is not uncommon for IMSC to occur ticosteroids in order to manage inflammatory
as an isolated lesion with no clinical or radio- myelopathic exacerbations related to anticys-
logical evidence of cerebral involvement. ticercal treatment. In view of the rarity of the
However, the presence of cerebral cysticerco- condition, an accurate assessment of the role of
sis is a supportive feature in the preoperative non-operative management of IMSC will per-
diagnosis of IMSC. Since IMSC is an oligo- haps take time.
cystic form of disease, stool evaluations for
Taenia solium, blood eosinophilia, soft tissue
calcifications and CSF examination are rarely Sellar Cysticercosis
contributory to the diagnosis5,22,32,39,40.
The pituitary fossa and its neighbourhood
are an infrequent site for cysticercosis.
Pathology Besides a series of eight pathologically veri-
fied cases reported by Del Brutto and col-
Morphological aspects of IMSC have leagues41, there have been isolated case
been studied at necropsy and surgery. The reports of the condition in literature42–45.
cyst causes focal, smooth enlargement of the
spinal cord. There may occur thickening
and adhesions of the overlying lep- Clinical features
tomeninges5,29,31. The glistening white cap-
sule of the cyst can be seen after a vertical
Asymptomatic sellar cysts
myelotomy. The cyst is usually non-adherent
and can be dissected from the cord without On occasion, sellar cysts may be asympto-
difficulty29,30,40. The fluid contained in the matic and present with sellar enlargement on
cyst may be turbid or xanthochromic29,30. The skull radiographs2. Incidental sellar cysts
outer surface contains fine hair-like projec- have been reported at necropsy2,46.

Visual loss sion, a patient with limited sellar cysticercosis

may develop hydrocephalus or parenchymal
This occurs as a result of chiasmal compres-
cysticercosis months after initial presenta-
sion by the sellar or suprasellar cysts and
tion41. Truly intrasellar cysticercosis does not
optochiasmatic arachnoiditis. Loss of vision
cause cerbrovascular involvement. However
is usually bilateral; associated bitemporal
cysts in a suprasellar location, or intrasellar
field defects may be detectable41. It devel-
cysts which have grown in size into the
ops rapidly within 3–12 weeks in contrast
suprasellar cistern may occlude blood vessels
to other pituitary tumours, where it may
and lead to infarcts.
take months or years to manifest41,47.
Ophthalmoscopic examination discloses
optic atrophy. Papilloedema is a rare feature Radiological diagnosis
and signifies associated hydrocephalus due
to meningeal cysticercosis or raised intracra- Raised intracranial pressure may lead to sel-
nial pressure due to involuting parenchymal lar enlargement and erosion of the sella on
cysticerci41. Exophthalmos may be observed lateral skull radiographs42,45. Calcified
uncommonly, reflecting growth of the cyst parenchymal cysts may be observed41. CT is
into the cavernous sinus41. more useful in the diagnosis of sellar cys-
ticercosis. A cystic hypodense intrasellar
Endocrine disturbances mass can be seen on CT. The cyst wall may
or may not enhance following contrast
Several endocrinopathies, including panhy- administration. Calcification of the cyst wall
popituitarism, diabetes insipidus and galact- never occurs. Bone erosion is rarely evident
orrhea have been reported in one-third to in cases of sellar cysticercosis not associated
one-half of published cases41,44. with raised intracranial pressure. Coexistent
features like parenchymal cysts, subarach-
noid cysts and hydrocephalus, if noted,
Clinical manifestations due to associated
substantiate a diagnosis of cysticercal
cysticerci in other locations
pathology in the sella turcica41. The differ-
In the published literature, seizures have been ential diagnosis of a cystic mass in the sella
reported in about 40% of the patients with turcica includes adenoma with an intra-ade-
sellar cysticercosis41. The occurrence of seizures nomatous cyst, cysts of the Rathke’s cleft,
should invoke a consideration of associated arachnoid cyst, germinoma, epidermoid
parenchymal cysticercosis. By comparison, and empty sella syndrome.
seizures occur in less than 10% of all pituitary A dominant cystic component is clearly
tumours and reflect involvement of the mesial visualized and the cyst wall is easily demar-
temporal structures (Table 23.1)47. Similarly, cated on MRI. The cyst fluid may be isoin-
the occurrence of intracranial hypertension tense, hyperintense or hypointense to the
indicates an association with hydrocephalus CSF depending upon its protein content. The
or oedematous parenchymal cysts41. On occa- cyst wall usually does not enhance with con-
Table 23.1. Differentiating features between sellar cysticercosis and pituitary adenoma.
Feature Sellar cysticercus Pituitary adenoma
Visual symptoms Always present at diagnosis; May be absent; slow

rapid progression (20 days– progression (months–
8 months) years)
Seizures Approximately 40% Approximately < 10%
Radiology Cystic morphology: common Cystic morphology: rare
and inconspicuous
Recovery of visual function after surgery Poor Good

trast. Multiplanar MRI is useful in demon- boy with CT features of cerebral cysticerco-
strating the anatomical extent of the cystic sis48. The myoclonus resolved, as did the CT
lesion. Sagittal and coronal sections clarify abnormalities after two courses of praziquan-
its relationship to the optic chiasma and may tel, in addition to sodium valproate. Otero et
demonstrate arachnoiditis. al. reported the development of complex par-
tial seizures and an acquired language disor-
der in a previously normal child at age 649.
Laboratory diagnosis The child had comprehension deficits, literal
and verbal paraphasias and telegraphic spon-
CSF examination was normal in five of eight taneous speech. Electroencephalography
patients studied by Del Brutto et al. All five revealed sharp and slow waves arising from
patients had isolated sellar cysticercosis. the left centrotemporal region. MRI revealed a
Serological studies were also non-contribu- small subarachnoid cysticercus cyst situated
tory in these patients41. deep in the left Sylvian fissure. The authors
postulated that the unique location of the cyst
and the age of the patient were responsible
Management for the Landau–Kleffner-like presentation.
The patient’s condition, including seizures
Surgical resection of the cyst is the standard and the language dysfunction, improved after
management of sellar cysticercosis. A trans- a course of albendazole. Chung et al. gave an
frontal approach is usually advocated in account of chronic intractable left mesial tem-
view of suprasellar growth of the cysts and poral lobe epilepsy of 20 years’ duration, in a
the frequent association with optochiasmatic middle-aged man50. Imaging studies revealed
arachnoiditis41. However, if MRI studies rule a calcified cysticercal cyst in the left medial
out suprasellar growth and arachnoiditis, a temporal region in addition to ipsilateral hip-
transsphenoidal approach may be under- pocampal atrophy. The patient was seizure-
taken42. The prognosis for recovery of visual free after standard left temporal lobectomy.
and endocrine function is dismal. None of the Histological sections revealed degenerated
patients in the series reported by Del Brutto et cysticercus and scolex embedded in the hip-
al. showed good postoperative recovery in pocampus in addition to neuronal loss. The
visual function41. This is in contrast to the authors postulated that the calcified cysticer-
good prognosis for recovery of visual function cus cyst was responsible for the peculiar
after surgery for pituitary adenomas, where epileptological condition. Finally, there is doc-
complete recovery of vision may be noted in umentation of periodic lateralized epilepti-
up to 20% and partial recovery in 80% of form discharges in massive parenchymal
patients47. It may be surmised that optochias- cysticercosis51,52. These rare electroencephalo-
matic arachnoiditis, which often accompanies graphic abnormalities are attributed to the
sellar and suprasellar cysticercosis, is responsi- inflammatory reaction in the brain to cystic
ble for poor postoperative outcome of visual degeneration either spontaneously or as a
function. There is no evidence so far that result of anticysticercal treatment.
either praziquantel or albendazole help in res-
olution of sellar cysticercosis.
Extrapyramidal Disorders
Uncommon Epileptic Syndromes
Few of the earliest descriptions of NC in lit-
Partial or generalized tonic clonic seizures erature alluded to extrapyramidal manifesta-
are commonly seen in a majority of the cases tions. Bickerstaff recounted the case of a
with parenchymal cysticercosis. Uncommon 51-year-old housewife of an Indian soldier,
epileptic syndromes have been reported in who developed progressive choreoathetosis
few cases. Puri et al. described stimulus- along with mental impairment, a clinical pic-
sensitive generalized myoclonus in a young ture resembling Huntington’s chorea53.

Necropsy revealed cysticerci in both caudate one report of such a case, trauma from a
and lentiform nuclei. There is a paucity of vehicular accident led to rupture of cysts
reports of extrapyramidal disorders in recent and sudden death61.
literature. Nevertheless, parkinsonism, uni-
lateral tremors, chorea, facial myokymia and
blepharospasm have been described in Conclusions
NC6,53–56. Racemose cysticercosis of the pos-
terior fossa may present with ataxia57. The presenting manifestations of T. solium
Bickerstaff described the occurrence of pro- cysticercosis are primarily related to the loca-
gressive ataxia in a 50-year-old woman58. He tion of cysticerci. Therefore, when cysticerci
reported operative findings of ‘a delicate lodge in remote areas within the central ner-
elongated structure resembling a bunch of vous system, they produce uncommon mani-
grapes lying over and around the lower festations. Among the protean manifestations,
brainstem and hanging on to the upper cer- spinal cysticercosis, sellar cysticercosis and
vical region’. Ataxia may be intermittent as uncommon epileptic and extrapyramidal syn-
with cysts of the fourth ventricle, where dromes are reviewed.
intermittent obstruction (Bruns’ syndrome) Spinal cysticercosis is classified in to
is the cause of isochronal symptoms57. It may extradural spinal cysticercosis, intradural
be asymmetric, when it results from race- extramedullary (IDEMSC) (most common),
mose cysts of the cerebellopontine angle58. intramedullary (IMSC) and mixed forms.
IDEMSC is commonly accompanied by
intracranial cysticercosis; it is believed to
Lingual Cysticercosis result from the downward migration of
intracranial subarachnoid-racemose cys-
Lingual cysts are usually observed in the ticerci. When the spinal cysts degenerate,
context of disseminated cysticercosis59. they lead to the clinical syndrome of a
Rarely, cysticercosis may occur as an iso- myeloradiculopathy involving the cervical
lated tongue mass59. The differential diagno- spinal cord most commonly. Intramedullary
sis in such instances includes lingual cysticerci occur in isolation with preference
carcinoma, haemangioma, mucocoele, papil- for the thoracic spinal cord. MRI is the imag-
loma and lingual thyroid. ing modality of choice for spinal cysticerco-
sis. The treatment of IDEMSC is surgical.
Surgery is also advocated for IMSC, though
Sudden Death reports of successful medical treatment are
now accumulating.
Sudden death in otherwise asymptomatic Sellar cysticercosis of the racemose vari-
persons may occur due to massive antigenic ety presents with visual and endocrine dis-
release from ruptured cysts in the brain turbances. The diagnosis is established by
parenchyma and surrounding meninges60,61. MRI and the treatment is surgical. Several
The massive antigenic release may result in other uncommon manifestations reviewed
a severe inflammatory response in the brain here often present a diagnostic and thera-
as well as systemic anaphylactic reaction peutic challenge to the treating physician
with pulmonary and visceral oedema. In both in endemic and non-endemic regions.
References
1. Walton, G.L. (1881) A case of cysticercosis in the substance of spinal cord. Boston Medical and Surgical
Journal 105, 511–512.
2. Briceno, C.E., Biagi, F., Martinez, B. (1961) Cisticercosis: observaciones sobre 97 casos de autopsia.
Presna Medicina México 26, 193–197.
3. Guccione, A. (1919) La cisticercosi del Sisterna Nervoso Centrale Umano. Societâ Editrice Libraria,
Milan, Italy.

4. Canelas, H.M., Ricciardi-Cruz, O., Escalante, O.A.D. (1963) Cysticercosis of the nervous system: less
frequent clinical forms. III. Spinal cord forms. Arquivos de Neuropsiquiatria 21, 77–86.
5. Queiroz, L.D.S., Filho, P.J., Callegaro, D., et al. (1975) Intramedullary cysticercosis: case report, litera-
ture review and comments on pathogenesis. Journal of the Neurological Sciences 26, 61–70.
6. Dixon, H.B.F., Lipscomb, F. (1961) Cysticercosis: an analysis and follow-up of 450 cases. Medical
Research Council Special Report Series 299. Her Majesty’s Stationery Office, London, pp. 1–58.
7. Colli, B.O., Assirati, J.A., Jr, Machado, H.R., et al. (1994) Cysticercosis of the central nervous system.
II. Spinal cysticercosis. Arquivos de Neuropsiquiatria 52, 187–199.
8. Zee, C.S., Segall, H.D., Ahmadi, J., et al. (1986) CT myelography in spinal cysticercosis. Journal of
Computer Assisted Tomography 10, 195–198.
9. Gallani, N.R., Zambelli, H.J.L., Roth-Vargas, A.A., et al. (1992) Cisticercose medular. Relato de dois
casos, revisao lieraturaa e comentarios sobre a paogenia. Arquivos de Neuropsiquiatria 50, 343–350.
10. Rocca, E.D. (1959) Cisticercosis intramedular. Revista Neuropsiquiatria (Lima) 22, 166–173.
11. Mohanty, A., Das, S., Sastry Kolluri, V.R., et al. (1998) Spinal extradural cysticercosis: a case report.
Spinal Cord 36, 285–287.
12. Kurrien, F., Vickers, A.A. (1977) Cysticercosis of the spine. Annals of Tropical Medicine and Parasitology
71, 213–217.
13. Vlok, G.J., Wells, M.C. (1988) Vertebral cysticercosis. A case report. South African Medical Journal 73,
730–731.
Surgical treatment of cerebral cysticercosis. Arquivos de Neuropsiquiatria 52, 166–186.
15. Dorfsman, J. (1966) Radiological aspects of spinal cysticercosis. Acta Radiologica (Diagnostic)
(Stockholm) 5, 1003–1006.
16. Zee, C.S., Segall, H.D., Boswell, W., et al. (1988) MR imaging of neurocysticercosis. Journal of
17. Kim, K.S., Weinberg, P.E. (1985) Spinal cysticercosis. Surgical Neurology 24, 80–82.
18. Savoiardo, M., Cimino, C., Passerini, A., et al. (1986) Mobile myelographic filling defects: spinal cys-
ticercosis. Neuroradiology 28, 166–169.
19. Escobar, A., Vega, J. (1981) Syringomyelia and syringobulbia secondary to arachnoiditis and fourth
ventricle blockage due to cysticercosis. A case report. Acta Neuropathologica (Berlin) 7, 389–391.
20. Leite, C.C., Jinkins, J.R., Escobar, B.E., et al. (1997) MR imaging of intramedullary and intradural-
extramedullary spinal cysticercosis. AJR American Journal of Roentgenology 6, 1713–1717.
21. Gupta, P.K., Sridhar, R., Rao, T.N., et al. (1995) Spinal subarachnoid cysticercosis. Neurology India 43, 60–61.
22. Isidro-Llorens, A., Dachs, F., Vidal, F., et al. (1993) Spinal cysticercosis. Case report and review.
Paraplegia 31, 128–130.
23. Lau, K.Y., Roebuck, D.J., Mok, V. (1998) MRI demonstration of subarachnoid neurocysticercosis sim-
ulating metastatic disease. Neuroradiology 40, 724–726.
24. Meyer, E. (1906) Amyotrophische Lateralsklerosis combiniert mit multiplen Hirncysticerken. Archiv
Psychiatrie Nervenkrankheiten 41, 640–652. (Cited in reference 45.)
25. Guillain, G., Perisson, J., Bertrand, I., et al. (1927) Cysticercose cerebrale racemeuse. Revue
Neurologique (Paris) ii, 433–444.
26. Kahn, P. (1972) Cysticercosis of the central nervous system with amyotrophic lateral sclerosis: case
report and review of the literature. Journal of Neurology, Neurosurgery and Psychiatry 35, 81–87.
27. Citfci, E., Diaz-Marchan, P.J., Hayman, L.A. (1999) Intradural-extramedullary spinal cysticercosis:
MR imaging findings. Computer Medical Imaging Graphics 23, 161–164.
29. Sharma, B.S., Banerjee, A.K., Kak, V.K. (1987) Intramedullary spinal cysticercosis. Clinical Neurology
and Neurosurgery 89, 111–116.
30. Holtzman, R.N.N., Hughes, J.E.O., Sachdev, R.K., et al. (1986) Intramedullary cysticercosis. Surgical
31. Castillo, M., Quencer, R.M., Donovan Post, M.J., et al. (1988) MR of intramedullary spinal cysticerco-
sis. AJNR American Journal of Neuroradiology 9, 393–395.
32. Garza-Mercado, R. (1976) Intramedullary cysticercosis. Surgical Neurology 5, 331–332.
33. Mehta, D.S., Malik, G.B., Dar, J., et al. (1971) Intramedullary cysticercosis. Neurology India 19, 92–94.
34. Corral, I., Quereda, C., Moreno, A., et al. (1996) Intramedullary cysticercosis cured with drug treat-
ment. A case report. Spine 21, 2284–2287.

35. Sawhney, I.M., Singh, G., Lekhra, O.P., et al. (1998) Uncommon presentations of neurocysticercosis.
Journal of the Neurological Sciences 154, 94–100.
36. Kishore L.T., Gayatri, K., Naiad, M.R., et al. (1991) Intramedullary spinal cord cysticercosis. A case
report and literature review. Indian Journal of Pathology and Microbiology 34, 219–221.
37. Garg, R.K., Nag, D. (1998) Intramedullary spinal cysticercosis: response to albendazole: case reports
and review of literature. Spinal Cord 36, 67–70.
38. Agrawal, V., Thomas, M., Maheshwari, M.C. (1995) Intramedullary cysticerci. Journal of the
Association of Physicians of India 43, 138.
39. Singh, A., Aggarwal, N.D., Malhotra, K.C., et al. (1966) Spinal cysticercosis with paraplegia. British
Medical Journal ii, 684–685.
40. Hesketch, K.T. (1965) Cysticercosis of the dorsal cord. Journal of Neurology, Neurosurgery and
41. Del Brutto, O.H., Guevara, J., Sotelo, J. (1988) Intrasellar cysticercosis. Journal of Neurosurgery 69,
58–60.
42. Prosser, P.R., Wilson, C.B., Forsham, P.H. (1978) Intrasellar cysticercosis presenting as a pituitary
tumor: successful trans-sphenoidal cystectomy with preservation of pituitary function. American
43. Rafel, H., Gomez-Llata, S. (1985) Intrasellar cysticercosis. Case report. Journal of Neurosurgery 63,
975–976.
44. Dickenson, C.J. (1955) Cysticercosis and panhypopituitarism. Proceedings of the Royal Society of
Medicine 48, 892.
45. Argenta, G. (1956) Su di un caso di cisticercosi generalizata con sindrome di adenoma ipofisario.
Revue Neurologique (Paris) 26, 197–204.
46. Kufs, F. (1915) Über einen fall von basaler Cysticerken-meningitis mit cysticercus der Hypophysis
und schwerer depressives Psychose und über andere Faile von Hirncystcerken. Zeitschrift Germaine
Neurologie und Psychiatrie 30, 286–304.
47. McDonald, W.I. (1982) The symptomatology of tumours of the anterior visual pathways. Canadian
Journal of Neurological Sciences 9, 381–390.
48. Puri, V., Chowdhury, V., Gulati, P. (1991) Myoclonus: a manifestation of neurocysticercosis.
Postgraduate Medical Journal 67, 68–69.
49. Otero, E., Cardova, S., Diaz, F., et al. (1989) Acquired epileptic aphasia (the Landau–Kleffner syn-
drome) due to neurocysticercosis. Epilepsia 30, 569–572.
50. Chung, C.K., Lee, S.K., Chi, J.G. (1998) Temporal lobe epilepsy caused by intrahippocampal calcified
cysticercus: a case report. Journal of Korean Medical Science 13, 445–447.
51. De Carvalho-Filho, P., Arruda, O.M., De Melo-Souza, S.E. (1989) Periodic lateralized epileptiform
discharges in neurocysticercosis. Arquivos de Neuropsiquiatria 47, 94–99.
52. Vijayan, P., Suri, M.L., Sahai, B., et al. (1977) Periodic lateralized discharges in EEG in cerebral cys-
ticercosis. Neurology India 25, 38–42.
53. Bickerstaff, E.R. (1955) Cerebral cysticercosis: common but unfamiliar manifestations. British Medical
Journal i, 1055–1058.
54. Beydoun, S.R. (1994) Facial myokymia secondary to neurocysticercosis. Muscle Nerve 17, 1060–1061.
55. Jimenez-Jimenez, F.J., Molina-Arjona, J.A., Roldan-Montaud, A., et al. (1992) Blepharospasm associ-
ated with neurocysticercosis. Acta Neurologica (Napoli) 14, 56–59.
56. Assiss, J.L., Tenuto, R.A. (1948) Cisticerco racemoso intraventricular: estipaco cirurgica. Arquivos de
58. Bickerstaff, E.R., Cloake, P.C.P., Hughes, B., et al. (1952) The racemose form of cerebral cysticercosis.
Brain 75, 1–17.
59. Gupta, S.C., Gupta, S.C. (1995) Cysticercosis of the tongue. Ear Nose Throat Journal 74, 177–178.
60. Ndhlovu, C.E. (1997) An uncommon presentation of cysticercosis. Central African Journal of Medicine
43, 207–209.
61. Verma, S.K., Agarwal, B.B.L., Agarwal, G. (1998) Sudden death in neurocysticercosis by trauma.
Forensic Science International 95, 23–26.

24 The Story Behind Solitary

Cysticercus Granuloma
Vedantam Rajshekhar
Introduction Reasons for misdiagnosis as

tuberculoma
Single, small, enhancing computed tomog-
raphy lesions (SSECTLs) were noted by One or more of the following arguments
Bhargava and Tandon, in their report on the were used to support the diagnosis of tuber-
computed tomography (CT) appearance of culoma in patients with SSECTL:
‘tuberculomas’ of the brain1. They reported
1. Tuberculosis and intracranial tuberculomas
lesions that were small (<10 mm), often soli-
were believed to be highly prevalent among
tary, enhanced with contrast injection and
Indian patients, constituting up to 25% of all
were associated with surrounding oedema
intracranial space-occupying lesions.
in patients presenting predominantly with
2. There was similarity in the CT morphol-
seizures, and labelled them as ‘microtuber-
ogy of these lesions and the cerebral
culomas’ or ‘immature tuberculomas’. A
parenchymal enhancing lesions in patients
histological diagnosis was however lacking
with proven tubercular meningitis.
in any of their patients. Subsequently, sev-
3. A number of these patients had evidence
eral Indian reports on CT appearance of
of healed pulmonary focus of tuberculosis on
tuberculoma identified similar lesions2–4.
chest roentgenograms.
Wadia et al. suggested that at least a third
4. Often, there was a history of exposure to
and probably more of SSECTL were tuber-
the disease from within the family or close
culomas4. Their conclusion was based upon
neighbours.
a study of 39 patients with SSECTL, of
5. Patients often had a positive Mantoux test.
whom 10 had active pulmonary tuberculo-
6. Finally, the lesions appeared to respond
sis, two had histological evidence of tuber-
when a course of ATT was administered to
culosis and another patient developed
the patients1,2,4.
tubercular meningitis while on antiepileptic
drugs (AEDs) alone. They advocated antitu- Although the above arguments are sound
bercular therapy (ATT) for all patients with in themselves, none of them supports a
SSECTL. Van Dyk, Kumar et al., and definitive diagnosis of tuberculosis. Some of
Domingo and Peter also considered SSECTL the arguments were also founded upon out-
to be of tubercular aetiology5–7. dated data:


242 V. Rajshekhar
1. Data showing high rates of intracranial SSECTL

tuberculomas in Indians were derived from
published series of intracranial space-occu- A number of reports of patients with solitary
pying lesions in the 1960s and 1970s8,9. Their enhancing CT lesions identified the latter as
incidence has fallen considerably since then, tuberculomas, solitary cysticercus granuloma
and at present less than 5% of all patients (SCG), ‘disappearing’ or ‘vanishing’ CT
with intracranial space-occupying lesions in lesions. We felt that their identification and
our department have tuberculomas10. management might be better if patients with
2. Apparently, CT morphology of the these lesions were identified by the character-
SSECTL and parenchymal brain lesions in istics of their CT lesions namely, the single,
those with tubercular meningitis or histolog- small (contrast) enhancing, CT lesions
ically proven multiple tuberculomas are (SSECTLs)12,13. The abbreviation SSECTL
(Fig. 24.1) thus avoided attributing a defini-
quite similar. But these observations made in
patients with multiple intracranial lesions
cannot be extrapolated and applied to soli-
tary lesions. It is also well known that the so-
called typical appearance of a tuberculoma
can be mimicked by various other pathologi-
cal lesions including neoplasia.
3. Evidence of exposure to tuberculosis,
history of tuberculosis and roentgeno-
graphic evidence of healed pulmonary
tuberculosis may support but do not pro-
vide definitive proof for a diagnosis of
intracranial tuberculoma in individuals
from regions that are endemic for tubercu-
losis. Similarly, most individuals in endemic
regions will have a positive skin test,
regardless of whether or not they have
active infection.
4. Therapeutic trials are frequently applied in
medical practice to provide a diagnosis. But
while looking for a ‘response’ to a therapeutic
regimen, ATT in this case, the possibility of
spontaneous resolution was not considered.
The Disappearing CT Lesion
A fortuitous discovery by Sethi et al. chal-

lenged the diagnosis of ‘microtubercu-
loma’ for SSECTL11. They reported
spontaneous resolution of SSECTL in 11
individuals with seizures who had been
prescribed ATT for their lesions but did not
consume the medications. Thus for the first
time, it became evident that the resolution
of SSECTL was in no way linked to ATT
but was a spontaneous phenomenon. This Fig. 24.1. Initial (a) and follow-up (b) contrast-
posed the first serious challenge to the aeti- enhanced CT of patient with seizures showing
ological consideration of ‘microtubercu- complete resolution of the lesion in the follow-up
loma’ for these lesions. scan performed after 6 months.

Solitary Cysticercus Granuloma 243
tive aetiology (tuberculoma or SCG) or However, the small bit of tissue (2 × 1 × 1

implying a biological behaviour pattern (‘dis- mm) that was obtained from stereotactic
appearing’) at the time of initial presentation. biopsy turned out to be inadequate to reveal
the aetiological diagnosis. Only the inflam-
matory nature of the lesion was evident from
SSECTL: cause or effect this series of stereotactic biopsies. Studies
such as culture of the tissue for acid-fast
Some authors considered SSECTL to be the bacilli (AFB) and fungus, and staining the tis-
result of a breakdown of the blood–brain bar- sue for AFB and fungal elements were all
rier and the surrounding oedema to be vaso- negative. We concluded at that stage that the
genic in origin – after intense ictal activity lesion represented a ‘focal encephalitis’ of
that accompanied seizures14. They believed undetermined aetiology16. It became evident
that the CT abnormality was not caused by a that to obtain further insight into the aetiol-
structural lesion but was the result of the ogy of the lesion more tissue for pathological
seizure. Indeed, while few patients with pro- examination from the lesion, virtually involv-
longed seizures or status epilepticus may ing excision of this small lesion, was
exhibit transient, enhancing lesions that fol- required. This was achieved through excision
low the wavy contour of the cortical mantle, following stereotactic craniotomy where
this pattern is distinct from the CT morphol- stereotactic techniques were used to guide
ogy of the SSECTL15. Furthermore, only few the placement of a craniotomy flap and then
and not all individuals with status epilepti- localize the intracranial target after the dura
cus or prolonged or repeated focal or general- was opened. In 15 consecutive patients, who
ized seizures exhibit this abnormality even if underwent an excision of their lesion, cys-
the CT is performed soon after the ictus. On ticercus granuloma was diagnosed in seven,
the other hand, many patients with SSECTL parasitic granuloma without evidence of the
have had their CT scan examination several parasite in five, chronic inflammation in two,
days or weeks after their last seizure and it is and fibrous cicatrix in one13. Four of the five
unlikely that a physiological change linked to lesions without the parasite had been sec-
seizure activity would persist for several tioned in the operating room after excision
weeks or months. and before being placed in the fixative. It is
possible that the parasite, which occupies the
core of the granuloma, may have spilt out
Histological attributes of the SSECTL and have been lost. There were no tuberculo-
mas or neoplasia in this series. We concluded
Histological study of SSECTL would have that cysticercosis was the cause of most of
laid to rest the controversy regarding their these lesions and that empirical ATT should
aetiology and management. But this was not therefore be avoided in managing patients
easily accomplished for several reasons. The with these lesions. These histological findings
lesions were small and most of them were sit- have been subsequently confirmed in several
uated in eloquent areas of the brain such as selected patients who have undergone surgi-
the sensorimotor region. As most of these cal excision of their lesions17.
lesions do not produce any changes in the
overlying pia-arachnoid, localizing them was
not easy. Moreover, there was a fair chance of Proving that the Disappearing
producing neurological deficit with surgical SSECTL is an SCG
excision of the lesion. Finally, there was justi-
fiable reluctance in subjecting individuals We performed a study in 1987–1988, involv-
with SSECTLs to surgery given the fact that ing 30 consecutive patients presenting with
these lesions could spontaneously resolve. seizures and SSECTL12. The initial five
We initially performed closed stereotactic patients were managed conservatively with
biopsies of these lesions through a twist drill AEDs. The next ten patients underwent non-
craniostomy or a burr hole in 10 patients. excisional stereotactic biopsy. Only a tiny bit

244 V. Rajshekhar
of the lesion was sampled in the stereotactic the histological diagnoses in both groups were
biopsy and rest of the lesion was left in situ. identical, revealing a cysticercus or parasitic
These 15 patients constituted Group A and granuloma in both. There were no tuberculo-
their lesions were monitored and followed mas or neoplasia in either group. Thus it was
up upon CT. Finally, 15 consecutive patients abundantly clear that the reason for persis-
with similar clinical and imaging characteris- tence was not a difference in aetiology but a
tics (Group B) had their lesions excised. variable natural history of the SCG in different
Follow-up CT monitoring in 12 of 15 patients individuals. Thus we argued that persistent
in Group A (three were lost to follow-up) SSECTLs need not be treated any differently
revealed disappearance in six, calcific residue from those that resolved early, i.e. with AEDs,
in five and reduced size in one. This observa- provided that patients did not have new
tion confirmed the fact that the lesions in this symptoms or signs of progressive neurological
larger homogeneous group of 30 patients deficit or raised intracranial pressure.
were disappearing SSECTLs. The histology of
the 15 lesions in Group B would therefore
indicate the pathology of the disappearing SSECTLs within the Perspective
SSECTLs. The pathology of the lesions in of Neurocysticercosis
Group B has been presented above, i.e. 12 of
the 15 biopsies revealed a cysticercus or a Ideally, the cysticercus granuloma should
parasitic granuloma and the rest, residue of have been an active aetiological considera-
an inflammatory lesion. Therefore, we tion in the case of SSECTLs that resolve
believe that this provided adequate proof spontaneously. The appearance of the cys-
that the ‘disappearing’ SSECTL is an SCG. ticercus granuloma on CT was known to be
identical to that of the SSECTL. Some of the
authors who had labelled SSECTL as ‘micro-
Problem of Persistent Lesions tuberculomas’ also commented upon this
similarity1,2,19. Furthermore, spontaneous
Sethi et al. noted resolution of the CT lesion in resolution of cysticercus granulomas has
all of their patients after an interval of 6–24 been adequately documented20–22. Punctuate
weeks (with AEDs alone)11. Adopting this calcifications that are sequelae of SSECTL
time frame, several physicians managing these were known to occur in NC well before spe-
patients with AEDs alone noted that SSECTLs cific therapy for cysticercosis was intro-
often persisted upon follow-up CT, performed duced. Finally, seizures are the commonest
3 months later. Moreover, several individuals manifestation of NC23. All the above features
with persistent lesions continued to have suggest that a cysticercus granuloma is a
symptoms. The management of these persis- likely aetiology for the SSECTL. Several
tent lesions posed a challenge because it was authors, however, dismissed cysticercosis as
commonly believed that disappearing a cause for SSECTL for one or more rea-
SSECTLs that resolved within about 3 months sons2,11,14,19. The three commonly mentioned
were different in aetiology from SSECTLs that reasons included: (i) cysticercosis is uncom-
were persistent beyond this time frame. It was mon among Indians; (ii) it is rare for NC to
not uncommon for physicians to resort to ATT present as a solitary lesion; and (iii) a cys-
in individuals with persistent lesions because ticercus granuloma would not be expected to
of their belief that persistent lesions were resolve spontaneously. Counter-arguments
likely to be tuberculomas. We looked at the to these are: (i) cysticercosis is endemic in all
histology of ‘persistent’ and ‘fresh’ lesions in parts of India; (ii) the myth that solitary cys-
25 consecutive patients with SSECTL18. The ticercal lesions were rare was derived from
duration of symptoms was less than 12 weeks data from the Western hemisphere; and (iii)
(3–12 weeks) in six patients and ranged from 4 finally, cysticercosis can resolve sponta-
months to 5 years in 19 patients. Both groups neously. Several authorities exclude a cys-
were found to be essentially similar in their ticercal aetiology for the SSECTL on the
clinical and imaging attributes. Importantly, premise of a negative serological test.

However, it is worth mentioning that sero- form’ and noted that they carried a better
logical tests for cysticercosis including both prognosis than other forms of NC31.
the ELISA and enzyme-linked immunoelec-
trotransfer blot (EITB) have poor sensitivity
in patients with SCG (see Chapter 33)24,25. Diagnostic criteria for SCG
Therefore, a negative serological test has no
relevance in the diagnostic scheme of We evolved a set of diagnostic criteria for an
SSECTL. initial presumptive diagnosis of SCG upon
presentation (Table 24.1)32,33. These criteria
were derived from clinical and CT observa-
Reports of SSECTL in NC literature tions in patients with histologically proven
SCGs and solitary small tuberculomas. The
Early reports of the CT appearance of cere- criteria were evaluated and validated
bral cysticercosis did not mention solitary prospectively and proved to be extremely
granulomas26. Zee et al. first drew attention reliable in predicting the diagnosis of SCG in
to this form of NC in 198027. Byrd et al. in Indian patients with seizures. We studied
their report on CT appearances of cerebral 401 patients presenting with seizures and an
cysticercosis, described a group of lesions, SSECTL. Of these, 215 fulfilled all the criteria
which were mostly solitary and enhanced for the diagnosis of a SCG. A final diagnosis
uniformly (the so-called disc lesions)28. was considered to have been confirmed in
These lesions measured between 10 mm and 197; 16 patients were excluded due to inade-
20 mm in size and did not produce any mass quate follow-up. A false-positive diagnosis
effect. Most of patients harbouring these of SCG was made in only two patients; one
solitary lesions presented with seizures. had metastatic disease and the other had
Also, in 1983, Minguetti and Ferriera pyogenic abscess. A false-negative diagnosis
alluded to an entity of ‘single acute lesions’ was made in one patient with SCG who had
measuring less than 20 mm in size, in severe oedema causing a midline shift and
patients presenting with seizures29. In 1988, therefore underwent excision of the lesion.
Mitchell and Crawford described lesions All eight solitary tuberculomas in our study
which were obviously similar to SSECTL, in could be clearly distinguished from SCG on
children and suggested that these were a the basis of the diagnostic criteria. Overall
distinctly benign form of NC30. They the diagnostic criteria had a sensitivity of
labelled these lesions as ‘acute lesions’. 99.5%, specificity of 98.9%, positive predic-
More recently, in 1995, Del Brutto referred to tive value of 99% and negative predictive
these lesions as ‘single acute encephalitic value of 99.5%.
Table 24.1. Clinical and computed tomography (CT) criteria for diagnosis of solitary cysticercus
granuloma (SCG).*
A. Clinical criteria
1. Clinical presentation with seizures
2. Absence of any evidence of a progressive neurological deficit
3. Absence of any features of persistent raised intracranial pressure
4. No clinical evidence of any systemic disease.
B. CT criteria
1. Solitary lesion
2. The lesion should measure less than 20 mm in maximal dimension
3. The lesion should enhance after contrast injection
4. There may or may not be oedema associated with the lesion but it should not be severe enough to
produce a shift of the midline structures.
* All criteria, without exception, must be fulfilled to make a diagnosis of SCG.

246 V. Rajshekhar
Confirming an initial diagnosis of SCG intense centre. It has a ring-enhancing pat-

tern on gadolinium-enhanced images. MRI
It is extremely important that all patients does not provide any advantage over a well
with seizures initially diagnosed to have SCG performed (2–5 mm slice) contrast-enhanced
on the basis of the above listed diagnostic cri- CT scan. When a good quality CT scan
teria (Table 24.1) be carefully followed up reveals an SCG, gadolinium-enhanced MRI
clinically and radiologically to confirm the is unlikely to reveal additional lesions35.
diagnosis. On clinical follow-up, patients 3. Seizures associated with SCG will respond
with SCG do not develop focal neurological to a single AED in nearly 90% of cases34.
deficits or features of raised intracranial pres- 4. About 4% of patients with SCG have
sure. Confirmation of the diagnosis of SCG is lesions that enlarge upon follow-up (enlarg-
obtained by any one of the following events: ing SCG), but even these do not produce fea-
1. Spontaneous resolution (partial or com-
plete) of the lesion: no other pathology,
which causes a clinical-imaging syndrome
similar to that of SCG, is known to resolve
spontaneously (Figs 24.1 and 24.2).
2. Resolution of the lesion following anticys-
ticercal therapy: the resolution of the lesion
should be demonstrated within a short period
of completion of anticysticercal therapy.
3. Adverse effects (seizures, headache, vom-
iting) occurring following the administration
of anticysticercal drugs: the adverse effects
are incidental to the rapid destruction of the
parasite by the drugs and the host response
to the parasitic antigens thus released.
4. Pathological diagnosis of cysticercus or
parasitic granuloma in an excised lesion.
This method of confirming the diagnosis is
uncommon, as most patients with SCG will
not undergo surgical excision.
Further studies on the behaviour and

management of SCG
Since our early studies on the pathology of

SSECTL, we have studied various other
aspects of its biological behaviour. Our find-
ings are summarized below and elaborated
in a monograph on the subject34.
1. It became evident from a search of the lit-

erature that the SCG was not an isolated
regional phenomenon. Although more com-
monly reported from India, it has been
reported from all over the world15.
Fig. 24.2. Initial (a) and follow-up (after 6 months)
2. MRI appearance of an SCG is typically (b) contrast-enhanced CT of another patient with
seen on T2-weighted images where it seizures. No specific therapy apart from
appears as a hypointense ring with a hyper- antiepileptic drugs was administered to this patient.

tures of raised intracranial pressure or pro- Conclusions

gressive neurological deficit36.
5. Immunological tests, both the ELISA and Based on our study of the disease for over
EITB, have a poor sensitivity (<50%) in the 13 years, we have proposed a management
diagnosis of SCG24,25. algorithm for patients with seizures and
6. Patients with SCG can have early with- SSECTL (Fig. 24.3). Patients with SCG are
drawal of their AED soon after the resolution managed primarily with symptomatic ther-
of their CT lesion with only a less than 10% apy, consisting of AEDs alone. An immuno-
chance of seizure recurrence (see Chapter 25 logical test at presentation consisting of
for a detailed discussion). This is in contrast serological assay for cysticercus antibodies
to the high rates of seizure recurrence in using either the ELISA or EITB may be use-
patients with multilesional NC34. ful if it is positive. A negative test, however,
7. The duration of symptoms does not corre- does not rule out cysticercosis. Close clini-
late with the presence or absence of the para- cal monitoring focusing on the appearance
site or its parts in an excised granuloma17. of progressive neurological deficit or fea-
8. Albendazole therapy can hasten the reso- tures of raised intracranial pressure is
lution of about a third of the SCG, but about mandatory. Either of these should alert the
40% of patients on albendazole therapy will physician to the possibility of an alternative
develop some adverse effect including diagnosis and prompt an immediate CT
headache and/or seizures37,38. Steroid ther- scan and histological verification of the
apy does not appear to prevent these lesion. If the patient is asymptomatic
adverse reactions37. except for occasional seizures, a repeat CT
9. Up to 3% of SCGs may present with scan is performed only at about 6 months
episodic headache alone without any after initial presentation. A persistent lesion
seizures. This presentation of SCGs should does not mandate a change in the manage-
be recognized, as the clinical situation could ment strategy except for a possible trail of
be mistaken for that caused by subarach- anticysticercal therapy. Early withdrawal of
noid haemorrhage or acute central nervous AEDs can be undertaken following radio-
system infection39,40. logical resolution of the granuloma.
References
1. Bhargava, S., Tandon, P.N. (1980) Intracranial tuberculomas: a CT study. British Journal of Radiology
53, 935–945.
2. Tandon, P.N., Bhargava, S. (1985) Effect of medical treatment on intracranial tuberculoma – a CT
study. Tubercle 66, 85–87.
3. Vengsarkar, U.S., Pisipaty, R.P., Parekh, B., et al. (1986) Intracranial tuberculoma and the CT scan.
4. Wadia, R.S., Makhale, C.N., Kelker, A.N., et al. (1987) Focal epilepsy in India with special reference
to lesions showing ring or disc like enhancement on contrast computed tomography. Journal of
Neurology, Neurosurgery and Psychiatry 50, 1298–1301.
5. Van Dyk, A. (1988) CT of intracranial tuberculomas with specific reference to the ‘target sign’.
6. Kumar, R., Kumar, A., Kohli, N., et al. (1990) Ring or disc like enhancing lesions in partial epilepsy
in India. Journal of the Tropical Pediatrics 36, 131–134.
7. Domingo, Z., Peter, J.C. (1989) Intracranial tuberculoma. An assessment of therapeutic 4-drug trial
in children. Pediatric Neurology 15, 161–167.
8. Dastur, D.K., Lalitha, V.S., Prabhakar, V. (1968) Pathological analysis of intracranial space occupying
lesions in 1000 cases including children. Journal of the Neurological Sciences 6, 575–592.
9. Mathai, K.V., Chandy, J. (1967) Tuberculous infections of the central nervous system. Clinical

248 V. Rajshekhar
Patient with seizures

and SSECTL
Antiepileptic drug(s)
(AED(s))
Clinical monitoring
Serological assay for
cysticercus antibodies
(ELISA/EITB)
Repeat CT scan after 6 months
Lesion disappears/ Lesion same Lesion larger

calcific dot size/smaller > 2 cm
Continue AEDs
Clinical monitoring
Repeat CT scan
after 6 months
Taper AED(s) Albendazole Excisional

over weeks treatment biopsy
Lesion disappears/ Lesion same size/ Lesion larger

calcific dot smaller > 2 cm
Continue AED(s)
Taper AED(s) Clinical and CT
monitoring
Fig. 24.3. Management algorithm for patients presenting with single, small enhancing CT lesion
(SSECTL).

10. Selvapandian, S., Rajshekhar, V., Chandy, M.J., et al. (1994) Predictive value of computed tomogra-
phy-based diagnosis of intracranial tuberculomas. Neurosurgery 35, 845–850.
11. Sethi, K., Kumar, B.R., Madan, V.S., et al. (1985) Appearing and disappearing CT abnormalities and
seizures. Journal of Neurology, Neurosurgery and Psychiatry 48, 866–869.
12. Chandy, M.J., Rajshekhar, V., Ghosh, S., et al. (1991) Single small enhancing CT lesions in Indian
patients with epilepsy: clinical, radiological and pathological considerations. Journal of Neurology,
13. Chandy, M.J., Rajshekhar, V., Prakash, S., et al. (1989) Cysticercosis causing single small CT lesions in
Indian patients with epilepsy. Lancet i, 390–391 (Letter).
14. Goulatia, R.K., Verma, A., Mishra, N.K., et al. (1987) Disappearing CT lesions in epilepsy. Epilepsia
28, 523–527.
15. Rajshekhar, V. (1991) Etiology and management of single small CT lesions in patients with seizures:
understanding a controversy. Acta Neurologica Scandinavia 84, 465–470.
16. Chandy, M.J., Rajshekhar, V. (1988) Focal epilepsy in India. Journal of Neurology, Neurosurgery and
Psychiatry 51, 1234 (Letter).
17. Rajshekhar, V., Chacko, G., Haran, R.P., et al. (1995) Clinicoradiological and pathological correlations
in patients with solitary cysticercus granuloma and epilepsy: focus on presence of parasite and
oedema formation. Journal of Neurology, Neurosurgery and Psychiatry 59, 284–286.
18. Rajshekhar, V., Chandy, M.J. (1992) Solitary small CT lesions in patients with epilepsy: outstanding
issues and further observations. Progress in Clinical Neurosciences 8, 106–110.
19. Rajeswari, R., Sivasubramanian, S., Balambal, R., et al. (1995) A controlled clinical trial of short-
course chemotherapy for tuberculomas of the brain. Tubercle and Lung Diseases 76, 311–317.
20. Kramer, L.D., Locke, G.E., Byrd, S.E., et al. (1989) Cerebral cysticercosis: documentation of natural
history with CT. Radiology 171, 459–462.
21. McCormick, G.F., Zee, C., Heiden, J. (1982) Cysticercosis cerebri: review of 127 cases. Archives of
22. Miller, B., Grinell, V., Goldberg, M.A., et al. (1983) Spontaneous radiographic disappearance of cere-
bral cysticercosis. Three cases. Neurology 33, 1377–1379.
24. Rajshekhar, V., Oommen, A. (1997) Serological studies using ELISA and EITB in patients with soli-
tary cysticercus granuloma and seizures. Neurological Infections and Epidemiology 2, 177–180.
25. Singh, G., Kaushal, V., Ram, S., et al. (1999) Cysticercus immunoblot assay in patients with single,
small enhancing lesions and multilesional neurocysticercosis. Journal of the Association of Physicians of
India 47, 476–479.
26. Mervis, B., Lotz, J.W. (1980) Computed tomography in parenchymal cerebral cysticercosis. Clinical
Radiology 31, 521–528.
27. Zee, C.S., Segall, H.D., Miller, C., et al. (1980) Unusual neuroradiological features of intracranial cys-
ticercosis. Radiology 137, 397–407.
28. Byrd, S.E., Locke, G.E., Biggers, S., et al. (1982) The computed tomographic appearance of cerebral
cysticercosis in adults and children. Radiology 144, 819–823.
29. Minguetti, G., Ferriera, M.V.C. (1983) Computed tomography in neurocysticercosis. Journal of
31. Del Brutto, O.H. (1995) Single parenchymal brain cysticercus in the acute encephalitic phase: defini-
tion of a distinct form of neurocysticercosis with a benign prognosis. Journal of Neurology,
32. Rajshekhar, V., Haran, R.P., Prakash, S., et al. (1993) Differentiating solitary small cysticercus granu-
lomas and tuberculomas in patients presenting with epilepsy: clinical and computerized tomo-
graphic criteria. Journal of Neurosurgery 78, 402–407.
33. Rajshekhar, V., Chandy, M.J. (1997) Validation of diagnostic criteria for solitary cerebral cysticercus
granuloma in patients presenting with seizures. Acta Neurologica Scandinavia 96, 76–81.

250 V. Rajshekhar
34. Rajshekhar, V., Chandy, M.J. (2000) Solitary Cysticercus Granuloma: the Disappearing Lesion. Orient
Longman, Chennai, India.
35. Rajshekhar, V., Chandy, M.J. (1996) A comparative study of contrast computerized tomography and
magnetic resonance imaging in patients with solitary cysticercus granulomas and seizures.
36. Rajshekhar, V., Chandy, M.J. (1994) Enlarging solitary cysticercus granulomas. Journal of
37. Rajshekhar, V. (1993) Albendazole therapy for persistent, solitary cysticercus granulomas in patients
with seizures. Neurology 43, 1238–1240.
38. Rajshekhar, V. (1998) Incidence and significance of adverse effects of albendazole therapy in patients
with a persistent solitary cysticercus granuloma. Acta Neurologica Scandinavia 98, 121–123.
39. Rajshekhar, V. (2000) Severe episodic headache as the sole ictal presentation of solitary cysticercus
granuloma. Acta Neurologica Scandinavia 102, 44–46.
40. Garg, R.K., Kar, A.M. (1997) Episodic headache in a non-epileptic patients having disappearing sin-
gle (ring enhancing) CT lesion. Neurology India 45, 110–111.

25 Seizures Due to Solitary Cysticercus

Granuloma
J.M.K. Murthy
Introduction SCG is one of the commonest forms of

NC. Its true incidence in comparison to other
A single enhancing computed tomography forms of NC is not clear. In the hospital-
(CT) lesion measuring less than 20 mm is a based studies the reported frequency of soli-
common finding upon CT of the brain of tary cyst (either granuloma alone, or SCG
patients with seizures in the developing and solitary live cysts taken together) varied
countries where Taenia solium cysticercosis is between 3.5% and 43%2. In the Ecuadorian
prevalent1,2. This lesion represents a solitary study, this lesion represented the single most
cysticercus granuloma (SCG) in the acute common form of presentation of NC,
encephalitic phase3,4. Epileptic seizures are accounting for 23% of the cases3.
by far the most common clinical manifesta- In human brain parenchyma, the larval
tion of the latter. Seizures are incidental to form of T. solium undergoes four stages of
the inflammatory response of the brain and evolution: vesicular, colloidal, granular-
can be categorized as acute symptomatic nodular, and calcific10. The term cysticercus
(provoked) seizures (see Chapter 21)1,5. granuloma is used broadly to refer to para-
While there is an over-abundance of sites in the colloidal stage or the granular-
reports of patients with solitary cysticercus nodular stage. Colloidal cysticerci are dying
granuloma (SCG) from India, these lesions (not dead) parasites, and not all the colloidal
have been reported from all over the world1,6. cysticerci die as a result of the host immuno-
The exact prevalence of this lesion in the com- logical attack. On the other hand, granular
munity has not been studied. Most reports are cysticerci are dead parasites. Histological
those of hospital-based series1. In a hospital- evaluation of SCGs seems to span the entire
based study from South India, this lesion was spectrum of pathological process that results
the cause of 26% of symptomatic localization- from the natural evolution of the parasite
related seizures7. In the regions where neuro- (see Chapter 31). Pathological studies of un-
cysticercosis (NC) is prevalent, the probability selected SCGs revealed three types of pathol-
of a patient with epileptic seizures, with no ogy: (i) cavitary lesions containing parts of
other obvious cause, harbouring this lesion an intact or degenerated cysticercus; (ii)
would be very high. In a study from South inflammatory cavitary lesions without the
India, this probability was as high as 39% parasite; and (iii) a non-cavitary hyalinized
(95%CI: 35–43%)8. This lesion was the cause of fibrous nodule with inflammation4,11.
50% of acute symptomatic seizures9. Seizures associated with SCG are consequent


252 J.M.K. Murthy
upon the inflammatory response of the where SCG is prevalent, the diagnostic predic-
brain. The slow degeneration of the cyst tive value of seizure clusters seems to be very
probably acts as a constant source of antigen high. In our study, the probability of a patient
to induce the host immune response and with seizure clusters at the initial presentation
may be an important factor responsible for or during the course, harbouring this lesion
recurrence of seizures5. was 88% (J.M.K. Murthy, Hyderabad, unpub-
lished data). Clinical and radiological criteria
for SCG have been reviewed by Rajshekhar in
Solitary Cysticercus Granuloma and Chapter 24. These criteria are specific and sen-
Seizures sitive. They have been validated in a prospec-
tive study involving 401 patients presenting
Seizures may be isolated or recurrent and with seizures and a solitary mass lesion on CT;
may occur in clusters. The reported fre- of these 215 had SCG. The criteria had a sensi-
quency of isolated seizures varies from tivity of 99.5%, specificity of 98.9%, and posi-
17.6% and 65%5,12,13 and that of a seizure tive predictive value of 99% and a negative
cluster varies between 20% and 80%5,14,15. predictive value of 99.5%.
After the initial seizure, patients may not
experience more attacks for several weeks to
months, and at times for several years, only Factors that Influence Seizure
to have a recurrence later. Breakthrough Outcome
seizures, i.e. seizures that occur after
antiepileptic drug (AED) treatment has Natural course
begun but before achieving remission, are
common in patients with SCG13,16. In the The natural history of the SCG can take one
author’s series, 37% of patients had break- of two courses: (i) it resolves entirely or (ii) it
through seizures5. Rarely, status epilepticus leaves a punctate calcification as residue. The
can be the presenting feature; its reported duration or time of resolution of the lesion is
incidence in different series varied between quite variable, from a few weeks to more
0.07% and 13%5,17,18. Seizures can be of any than a year20,21. A recent long-term follow-up
type. Simple or complex partial seizures with study of the natural history of the CT lesion
or without secondary generalization are in patients with SCG suggests that within 6
most common and have been reported in months of initial presentation over 70% of
70–88% of patients5,14,16,19. Often these lesions would show some degree of resolu-
patients present with partial onset or gener- tion and 54% of lesions would resolve com-
alized tonic–clonic motor seizures with no pletely22. The author’s experience, based on
localization. Seizure semiology depends on the interval between initial presentation and
the anatomical location of the lesion. resolution of the CT lesion, suggests that
Discordance between clinical localization these lesions can be divided into two types:
based on seizure semiology and location of (i) ‘rapid resolvers’, lesions that resolve
the lesion on neuroimaging is not uncom- within few weeks to months, and (ii) ‘persis-
mon. Patients with SCG may exhibit some ters’, lesions that resolve over several
postictal neurological deficit lasting for few months to years. Symptoms in patients with
minutes or even weeks. persistent lesions are often phasic. Seizures
may cease for several months or years, but
recur later. No characteristic CT or magnetic
When to suspect a diagnosis of SCG resonance imaging (MRI) morphological fea-
tures distinguish between the two types of
Patients with SCG present with partial or lesions. In the author’s study, a demonstra-
unlocalized tonic–clonic seizures with no ble mural nodule on CT was associated with
obvious cause. Seizure clusters at presentation high rates of seizure recurrence and longer
or during the course of illness occur in a sig- disease duration23. Histological studies cor-
nificant proportion of patients. In the regions roborate that the mural nodule on CT or MRI

Seizures Due to Solitary Cysticercus Granuloma 253
corresponds to the scolex and is a pathog- those for any other remote symptomatic
nomic sign of active cysticercosis24,25. It is epilepsy. Of the 97 patients followed by
possible that some of the lesions with this CT Murthy and Reddy23, for 7 years, 71.5%
morphology may take several months to (95%CI 53.7–85.4%) of patients achieved a 3-
degenerate. The presence of a slowly degen- year seizure remission and 66% (95%CI
erating cyst presumably acts as a constant 32.4–88.2%) achieved a 5-year remission.
source of antigen to induce host inflamma- Patients had a high rate of breakthrough
tory reaction and may be responsible for the seizures before remission and a high rate of
phasic nature of the symptoms. relapse following the withdrawal of AEDs.
Seizure relapse can be immediate or after sev-
eral months to years. It appears these patients
Single small cerebral calcific CT lesion require AEDs for long periods of time.
CT in individuals with a seizure disorder

may also reveal a single small calcific lesion Treatment
with or without contrast enhancement and
with or without surrounding oedema. It is Treatment of patients with SCG is primarily
commonly believed that these lesions repre- symptomatic and consists of treating
sent sequelae of SCG. In a study of the nat- seizures. Use of anticysticercal drugs and
ural history of SCG (V. Rajashekhar, Vellore, corticosteroids is debatable.
personal communication), punctuate calcifi-
cation was seen as a residue in 22% of
patients with SCG. This lesion was seen in Antiepileptic drugs
0.65% of brain CT scans of patients with non-
seizure disorders from North India26. In a Patients with SCG and epileptic seizures
hospital-based study from South India, this should be treated with AEDs for two rea-
lesion was the putative aetiology in 9% of sons: (i) seizures are likely to recur as long as
patients with localization related epilepsy23. the lesion persists; and (ii) the time period
In the author’s experience, a lesion is more for the resolution of the CT lesion is quite
likely to become calcified when the lesion variable. A characteristic feature of patients
persists for a long time and when there is a with SCG is the occurrence of breakthrough
demonstrable scolex on CT. However, this seizures in a significant proportion of
needs to be established in prospective fol- patients. Most often, good seizure control
low-up studies. can be achieved with a single conventional
Epileptic seizures associated with single AED (monotherapy)5. As seizures are com-
small cerebral calcific CT lesion can be of any monly partial with or without secondary
type; often these patients present with simple generalization, either carbamezapine or
or complex partial seizures, with or without phenytoin is the drug of choice.
secondary generalization or generalized Acute symptomatic seizures due to SCG
tonic–clonic seizures. History of previous are often self-limiting and do not require
unprovoked seizure may be noted in about long-term AED therapy. The latter can be
20% of patients. Neurological examination is discontinued once the underlying lesion dis-
usually normal. Discordance between clinical appears. The time duration of AED therapy
localization based on seizure semiology and in patients with seizures associated with
location of the lesion on neuroimaging may SCG has not been settled. This is partly
be observed23,26. In our study the reported related to the risk of seizure recurrence with
ictal semiology was clearly distinctive and persistence of lesion and the variable time
allowed the seizure to be localized to the site duration for spontaneous resolution5. The
of the calcific lesion on CT scan in only 26% time period for resolution of the lesion may
of the patients23. vary from a few weeks to more than a year,
Seizure remission rates in individuals some times several years1,22. In the author’s
with a single calcific lesion are similar to series, in one patient who was treated symp-

254 J.M.K. Murthy
tomatically with AED(s) alone, the lesion use of anticysticercal drugs. However, the
persisted for 73 months5. Most clinicians results of the two double-blind randomized,
treat seizures associated with SCG – for a placebo-controlled studies using albendazole
2–3 year seizure-free period – just as they are contradictory. One study involving 75
would treat any other type of epilepsy27. adult patients did not show any benefit32,
Our long-term follow-up study has shown whereas another study involving 63 children
that seizures associated with SCG have a revealed that anticysticercal therapy has-
good prognosis and AED can safely be with- tened resolution of the SCG33. In the author’s
drawn after resolution of the CT lesion5. The opinion, some parasites may involute
mean period of follow-up was 45 months rapidly over a period of weeks to few
(range 19–101 months) and only one patient months (‘rapid resolvers’), while others invo-
who had CT-demonstrable scar had recur- lute over a period of several months to years
rence of seizures. However, a recent study (‘persisters’). Anticysticercal drug trials will
suggested that gliosis visible on magnetiza- be negative if the study mostly involves
tion-transfer spin-echo MRI, 2 years after ‘rapid resolvers’. The real efficacy of anticys-
initial presentation, was positively corre- ticercal therapy can only be tested in patients
lated with the risk of seizure recurrence. The with lesions that persist for several months
authors argued that such patients should be to years (‘persisters’). In an open-label study
treated with AEDs for long periods28. Our of 43 patients with lesions that persisted
present policy is to treat patients with SCG beyond 3 months, a response to albendazole
with AEDs until such time their CT lesions was seen in 20 (46.5%) patients27. We did a
resolve. Patients in whom follow-up CT retrospective analysis of efficacy of albenda-
scan shows calcification or gliotic scars zole on the seizure-control profile. The base-
should be treated as for any remote sympto- line demographic characteristics of patients
matic epilepsy. In our series, recurrence of who did not receive albendazole and who
seizures occurred following AED with- did receive albendazole were similar. Clearly,
drawal in two patients who had a gliotic albendazole produced benefits in terms of
scar demonstrable on CT. seizure-control profile in patients with per-
sistent lesions even after 6 months of symp-
tomatic treatment with AEDs (J.M.K.
Anticysticercal drug therapy Murthy, Hyderabad, unpublished data). Our
data also suggest that there is probably a role
The role of anticysticercal drug therapy in for anticysticercal therapy in patients with
patients with SCG is not clear. The argu- SCG with a visible scolex. Lesions with this
ment against anticysticercal therapy is that CT morphology are likely to take longer to
seizures associated with this lesion are resolve and are associated with high seizure
because of the inflammatory response of the frequency5. The reader is referred to Chapter
brain and the lesions are known to resolve 38 for a detailed discussion on the role of
spontaneously1. However, earlier reports anticysticercal therapy in NC.
suggested that anticysticercal therapy influ-
enced the management of patients with
SCG in several ways. In a few studies, anti- Seizure Outcome and Prognosis
cysticercal therapy was shown to benefit
most patients with persistent seizures by Seizure outcome is good in patients with
hastening resolution of the lesion5,27,29. SCG. Breakthrough seizures before remission
Anticysticercal therapy given with AEDs has are common. Breakthrough seizures were
been shown to provide better control of seen in 37% of patients in the author’s series5
seizures29,30. The chance of remaining and in 14.5% in the series of patients studied
seizure-free after the withdrawal of AEDs by Rajashekhar and Chandy22. A recent long-
seems to be higher in patients with NC who term follow-up study suggests that epileptic
were previously treated with albendazole31. seizures associated with SCG recur as long
These findings provide a rationale for the as the lesion persists; and AEDs can safely be

Seizures Due to Solitary Cysticercus Granuloma 255
withdrawn once the follow-up CT scan Seizures are the most common manifestation
shows resolution of the lesion5. However, of SCG. Patients with this lesion develop
patients with calcific lesions should be seizures because of the inflammatory
treated as for any type of remote sympto- response of the brain and their seizures may
matic epilepsy. It appears that patients with be categorized as acute symptomatic
calcific lesions need AEDs for a long time seizures. The natural history of SCG can
and seizure relapse rates after drug with- usually take one of two forms: (i) it resolves
drawal are very high. entirely or (ii) a punctate calcification may
be left as a residue. Seizure outcome is good
even when patients are treated with AEDs
Conclusions alone. Long-term follow-up studies suggest
that epileptic seizures associated with SCG
A single enhancing CT lesion measuring less can recur as long as the lesion persists; and
than 20 mm is a common CT finding in AEDs can safely be withdrawn once the fol-
patients with seizures in countries where low-up CT scan demonstrates resolution of
NC is endemic. Pathological studies suggest the lesion. The role of anticysticercal therapy
that most of these lesions represent SCG. is not clear.
References
1. Carpio, A., Escobar, A., Hauser, W.A. (1998) Cysticercosis and epilepsy: a clinical review. Epilepsia
39, 1025–1040.
2. Rajashekhar, V., Chandy, M.J. (2000) Incidence of solitary cysticercus granuloma. In: Rajashekar, V.,
Chandy, M.J., (eds) Solitary Cysticercus Granuloma. Orient Longman, Chennai, India, pp. 12–28.
4. Rajashekhar, V., Chacko, G., Haran, R.P., et al. (1995) Clinicoradiological and pathological correlation
in patients with solitary cysticercus granuloma and epilepsy: focus on presence of the parasite and
edema formation. Journal of Neurology, Neurosurgery and Psychiatry 59, 284–286.
5. Murthy, J.M.K., Reddy, Y.V.S. (1998) Prognosis of epilepsy associated with single CT enhancing
lesion: a long-term follow-up study. Journal of the Neurological Sciences 169,151–155.
6. Rajashekhar, V. (1991) Etiology and management of single small CT lesions in patients with
seizures: understanding a controversy. Acta Neurologica Scandinavia 144, 819–823.
7. Murthy, J.M.K., Yangala, R. (1998) Etiological spectrum of symptomatic localization related epilep-
sies: a study from South India. Journal of the Neurological Sciences 158, 65–70.
8. Murthy, J.M.K., Yangala, R., Mantha, S. (1998) The syndromic classification of the International
League Against Epilepsy: a hospital based study from south India. Epilepsia 40, 48–54.
9. Murthy, J.M.K., Yangala, R. (1999) Acute symptomatic seizures – incidence and etiological spectrum:
a hospital-based study from south India. Seizure 8, 162–167.
10. Escobar, A. (1993) The pathology of neurocyticercosis. In: Palacios, E., Rodriguez-Carbajal, J. (eds)
Cysticercosis of the Central Nervous System. Charles C. Thomas, Springfield, Illinois, pp. 27–54.
11. Chacko, G., Rajashekhar, V., Chandy, M.J., et al. (2000) The calcified intracorporeal vacuole: an aid to
the pathological diagnosis of solitary cerebral cysticercus granuloma. Journal of Neurology,
12. Bhatia, S., Tandon, P.N. (1988) Solitary ‘microlesions’ in CT: a clinical study and follow-up.
Neurology India 36, 139–150.
13. Srinivas, H.V. (1992) Disappearing CT lesions – clinical features. Tropical and Geographic Medicine 2,
88–91.
14. Wadia, R.S., Makhale, C.N., Kelkar, A.V., et al. (1987) Focal epilepsy in India with special reference to
lesions showing ring or disc-like enhancement on contrast computed tomography. Journal of
15. Sethi, P.P., Wadia, R.S., Kiyawat, D.P., et al. (1994) Ring or disc enhancing lesions in epilepsy in India.

256 J.M.K. Murthy
16. Rajashekhar, V., Chandy, M.J. (2000) Clinical manifestations of solitary cysticercus granuloma. In:
Rajashekhar, V., Chandy, M.J. (eds) Solitary Cysticercus Granuloma. Orient Longman, Chennai, India,
pp. 29–39.
17. Gulatia, R.K., Verma, A.K., Mishra, N.K., et al. (1987) Disappearing lesions in epilepsy. Epilepsia 28,
523–527.
18. Rajashekhar, V. (1999) Epilepsy associated with a solitary cysticercus granuloma. In: Murthy, J.M.K.
(ed.) Epilepsy: the Indian Perspective. Care Foundation, Hyderabad, India, pp. 82–106.
19. Chopra, J.S., Sawhney, I.M.S., Suresh, N., et al. (1992) Vanishing CT lesion in epilepsy. Journal of the
Neurological Sciences 107, 40–49.
20. Byrd, S.E., Locke, G.E., Biggers, S., et al. (1982) The computed tomography appearance of cerebral
cysticercosis in adults and children. Radiology 144, 819–823.
21. Basauri, L., Zuleta, A., Loayza, P. (1983) Olivaces A. Microabscesses and presumptive inflammatory
nodules of the brain. Acta Neurochirurgica (Wein) 68, 27–32.
22. Rajashekhar, V., Chandy, M.J. (2000) Outcome in patients with solitary cysticercus granuloma. In:
Rajashekar, V., Chandy, M.J. (eds) Solitary Cysticercus Granuloma. Orient Longman, Chennai, India,
pp. 135–152.
23. Murthy, J.M.K., Reddy, V.S. (1998) Clinical characteristics, seizure spread patterns, and prognosis of
seizures associated with single small cerebral calcific CT lesion. Seizure 7, 153–157.
24. Martinez, H.R., Rangle-Guerra, R.A., Elizondo, G., et al. (1989) MR imaging in neurocysticercosis: a
study of 56 cases. AJNR American Journal of Neuroradiology 10, 1011–1019.
ment in neurocysticercosis: a magnetic resonance study of 161 cases. Journal of the Neurological
26. Singh, G., Sachdev, M.S., Tirath, A., et al. (2000) Focal cortical-subcortical calcifications and epilepsy
in the Indian sub-continent. Epilepsia 41, 718–726.
27. Rajashekhar, V., Chandy, M.J. (2000) Medical management of solitary cysticercus granuloma. In:
Rajashekar, V., Chandy, M.J. (eds) Solitary Cysticercus Granuloma. Orient Longman, Chennai, India,
pp. 112–134.
29. Del Brutto, O.H., Santibanez, R., Noba, C.A., et al. (1992) Epilepsy due to neruocysticercosis: analy-
30. Del Brutto, O.H. (1994) Prognostic factors for seizure recurrence after withdrawal of antiepileptic
drugs in patients with neurocysticercosis. Neurology 44, 1706–1709.
31. Del Brutto, O.H. (1993) The use of albendazole in patients with single lesions enhanced on contrast
CT. New England Journal of Medicine 328, 356–357.
32. Padma, M.V., Behari, M., Misra, N.K., et al. (1994) Albendazole in single CT ring lesions in epilepsy.
33. Baranwal, A.K., Singhi, P.D., Khandelwal, N., et al. (1998) Albendazole therapy in children with
focal seizures and single small enhancing computerized tomographic lesion: a randomized placebo-
controlled, double blind trial. Pediatric Infectious Diseases Journal 17, 696–700.

26 Paediatric Neurocysticercosis
Introduction intestinal geohelminthiasis indicate that the

highest prevalences are recorded in the age
Even in regions that are endemic for Taenia group 10–20 years, followed by the age
solium, childhood neurocysticercosis (NC) is group of less than 10 years4,5. In contrast,
rare. Nevertheless, NC does occur among adult Taenia infections are rare below the age
children, raising issues of its exact prevalence of 10 years. Rates of infection with Taenia sp.
in the paediatric age group, pathogenesis, typically peak from 15 to 40 years of age. The
clinical manifestations, diagnosis, treatment reasons for these age-specific patterns are not
and prevention. These issues are confounded known but may reflect an overall low fre-
by uncertainty about the modes of transmis- quency of pork consumed during childhood.
sion of cysticercosis to children. Another Epidemiological data on the seropreva-
important question that needs to be consid- lence of T. solium cysticercosis in the commu-
ered is, do clinical manifestations and labora- nity may often have the limitation of poor
tory features of NC in the paediatric age sampling rates from the paediatric population
group differ from those in adults? Are there of that community6,7. Nevertheless, popula-
any neurological manifestations that are tion data from Mexico and Peru indicate that
unique to this age group? Finally, are there enzyme-linked immunoelectrotransfer blot
special considerations in drug therapy of (EITB)-based seropositivity rates in the paedi-
paediatric cysticercosis? The authors focus on atric population are lower than the average
some of these issues in the present chapter. prevalence rates for the community and much
lower than age-specific peak prevalence
rates4–9. For instance, a survey in Peru found
Prevalence of T. solium Infection in that none of the subjects below 5 years of age
the Paediatric Population showed positive reactions in the EITB, whilst
6% of those in the age group 6–10 years were
Community-based data seropositive as against a mean seroprevalence
of 8% and a peak seroprevalence of 19% in the
Coproparasitological surveys of children in age group of over 50 years7. Seropositivity
developing countries have revealed high rates increased dramatically after 5 years of
rates of helminthiasis, primarily, intestinal age, indicating the vulnerability of this age
geohelminths (Ascaris, Trichuris)1–3. Indeed, group to environmental T. solium exposure in
analysis of age-specific prevalence rates of contrast to the relatively protected environ-


ment of children below 5 years. One study, occurred very early in life, cysticercosis
however, from Honduras found a higher would not manifest clinically until after 6
seropositivity rate in the 0–9 years age group years of age. In most series of paediatric NC,
(18%) in comparison to average seropositvity the average age of presentation was around
(16.6%)10. Here, children accounted for 28.75% 8 years17–31. However, NC has been reported
of the seropositives in the community. to manifest as early as 14 months of age32.
Differences in age-specific seroprevalence rates Those cases that occur during later child-
were however, not statistically significant. hood probably represent acquisition of T.
Interestingly, when computed tomography solium through food. Cases of cysticercosis
(CT) scans were performed on the subjects, during early childhood probably represent
two of 21 (9.5%) in the age group 0–9 years as infections acquired through caregivers,
opposed to five of 14 (35.7%) in the age group including those within the family as well as
40–49 years were found to have lesions com- housekeepers and food handlers that are
patible with NC (Ana L. Sanchez, Ontario, employed within the household33. The possi-
Canada, personal communication). These data bility of transplacental transmission has been
indicate that, while NC was less common in considered but never proven.
the paediatric population, exposure to T. solium Since children are often restricted to the
began at a very early age in the study village. confines of a well-protected home environ-
ment, their chances of exposure to T. solium
are less in comparison to adults, who may
Hospital-based data also be exposed through food and water out-
side their homes. It becomes all the more
Seropositive cases merely indicate exposure important, therefore, to screen household
to T. solium and do not necessarily imply clini- family, caregivers and food handlers, in con-
cal NC and, therefore, do not provide an esti- tact with children with NC, for adult and lar-
mate of the neurological morbidity due to val T. solium infection. Indeed, a survey of 51
paediatric cysticercosis. The results of a study household family contacts of 20 children with
of neurological outpatients with seizures in a solitary cysticercus granuloma showed that
Lima are of interest in this regard11. In this 14 (27%) had serological evidence of expo-
clinic-based population, 8% of patients with sure to T. solium34. Among the seropositive
seizures, who were above 20 years, were contacts, a history of seizures was obtained in
seropositive in comparison to 2% seroposi- five. Imaging revealed evidence of active or
tives among those below 20 years. These data, inactive NC in four. These data underscore
in common with population data indicate that the importance of screening household fam-
both exposure to T. solium and clinical NC are ily contacts of children with NC.
uncommon below the age of 20 years.
A number of published, hospital-based,
large series of NC have either not included Clinical Manifestations
paediatric cases or not described the age
structure of their cohorts12–14. For those A few of the earlier studies of cysticercosis in
series, where breakdown according to age is children suggested that whilst cysticercosis
available, data indicate that the frequency of was rare among children, its manifestations
NC below the age of 15 years is about one- were more severe. In one of the earliest
tenth as its frequency above that age15,16. reports of paediatric NC, Robles (1945) por-
trayed that the outcome in paediatric NC
was far more serious than adults35. Some 16
Modalities of Transmission Among years later, however, Dixon and Lipscomb
Children disagreed36: ‘In the present series then there
were no deaths among patients certainly or
Taenia solium cysticercosis has a long incuba- probably infected in childhood, and only one
tion period; it may be as long as 5 years. case of severe disablement… The findings
Therefore, even if exposure to T. solium suggest a prognosis far less gloomy…’.

Paediatric Neurocysticercosis 259
Some authors consider that more severe tion, hyperkinetic behaviour and cerebral
forms of NC, including cysticercotic palsy in children with definite NC31,39.
encephalitis, are common in children37–39. It is However, to date, there has been no system-
not clear whether the latter condition repre- atic study using contemporary tools of assess-
sents a true age-dependent predisposition or ment of these neurological abnormalities in
a bias in case collection. A geographical bias children with either active or inactive NC.
however does exist in the pattern of clinical There is however, anecdotal mention of age-
presentations of paediatric NC. Thus, reports specific neurological syndromes in children
of paediatric NC from developed countries with NC. Otero et al. described the occurrence
like United States emphasize benign, self-lim- of Landau–Kleffner’s syndrome in a patient
iting single lesions17–20. These lesions disap- with NC in the left Sylvian fissure40. Similarly,
pear in 6–12 months, and do not require any Morales et al. described the occurrence of
specific therapy apart from antiepileptic Lennox–Gastaut syndrome in a patient with
drugs for about 1–2 years. Patients with these NC with hydrocephalus31. Both cases, though
lesions present to the emergency department extremely rare, could represent age-related
with acute non-febrile seizures and have expressions of a severe non-specific neurolog-
been reported in several states of the United ical insult, in these cases, NC.
States21. In comparison, reports of paediatric
NC from endemic regions such as Latin
America have emphasized the occurrence of Investigations
features of intracranial hypertension in addi-
tion to seizures22–25. These are patients who Radiology, including CT and magnetic reso-
have either multiple parenchymal cysts or nance imaging (MRI), is most often
intraventricular or subarachnoid NC. employed for establishing a diagnosis of NC.
Intracranial hypertension has been reported The diagnosis is further supported by ancil-
consistently as the second most common lary tests such as eosinophil counts, stool
manifestation of NC in reports from Latin examinations for Taenia sp. ova, soft tissue
America22–25. It may be conjectured that the roentgenograms, cerebrospinal fluid (CSF)
former benign presentations arise out of studies and serological studies (both, EITB in
brief, limited exposure to T. solium, while the serum and ELISA in CSF).
later, more grave presentations in endemic There is no evidence to suggest that the
regions are the result of more severe or pattern or intensity of antibody responses in
repeated exposure to T. solium. Even in India, paediatric cases with NC are any different
several of the earlier reports emphasized the from those seen in adults. One confounding
occurrence of more severe presentations of issue in clinical as well as community-based
intracranial hypertension and meningoen- settings could be the presence of maternally
cephalitis26–28. More recent reports however, transferred antibodies in children, for it has
have described the common single, benign been demonstrated that children born to
self-limiting colloidal-granular NC very com- EITB-positive mothers are seropositive
monly in childhood29,30. (Hector H. García, Lima, Peru, personal
In general, the common manifestations of communication). However, given the low
childhood NC include seizures, headaches reproductive rate in humans it is unlikely
and focal neurological deficits. There is how- that this could be a major source of error in
ever no consensus of opinion regarding the population studies.
role of NC as an aetiology in developmental A serological study based on ELISA indi-
delay, cerebral palsy, learning disability, cated that serological responses were weaker
developmental regression and behavioural in children with malnutrition in comparison to
disorders in children in areas where T. solium nutritionally healthy children41. This has not
is endemic. Understandably, these disorders been observed in several of the recent EITB-
would be expected to occur only in the more based studies from Latin America. However,
severe cysticercotic syndromes such as cys- the effect of nutrition on the antibody status
ticercotic hydrocephalus. A few authors have may be an issue in many developing countries
described the occurrence of mental retarda- where malnutrition is common.

Treatment anticonvulsant hypersensitivity syndrome

and acute, subacute or chronic CNS toxicity
Specific treatment of NC consists of the drugs is, however, mandatory. Fosphenytoin is not
praziquantel and albendazole. Both drugs are currently available in many countries where
safe and effective in children above 1 year of T. solium is endemic. Other antiepileptic
age. The safety of praziquantel below 1 year drugs, such as carbamazepine and clobazam
of age has not been demonstrated. may also be used.
Praziquantel is administered in a dose of Corticosteroids, mannitol and furosemide
50–100 mg kg−1 day−1 in three divided doses are used for the control of intracranial hyper-
for 4 weeks. Albendazole has a shorter half- tension, if present. Surgery is rarely indicated.
life in children42. The drug may be given in Finally, screening of adults and children
three divided doses. The dose is 15 mg kg−1 within the household environment for adult
day−1 for 4 weeks. The shorter duration of and larval T. solium infection is crucial for the
treatment, for instance, a 1-week course has control of transmission of the parasite.
not been used in children43,44.
It is imperative that children presenting to
the Emergency Room with new-onset Conclusions
seizures should be subjected to a CT scan in
regions where NC is known to occur. In the Analysis of data from community and
event that CT reveals single or more enhanc- clinic-based paediatric populations indicate
ing lesions suggestive of NC, an antiepileptic that both NC and adult T. solium infections
drug with rapid onset of action should be are relatively uncommon in childhood.
instituted with a view to prevent seizure Nevertheless, NC does occur during child-
recurrence. Phenytoin sodium is a good hood. Recent data indicate that the majority
choice, because serum levels for effective of the cases of paediatric NC are those of a
anticonvulsant action are achievable with the single involuting cysticercus type, that
administration of oral or intravenous load- resolves spontaneously over a few months.
ing doses (15–20 mg kg−1). The drug is However, in highly endemic regions, compli-
administered at the rate of 50 mg min−1 by cated clinical pictures might be noted. Even
the intravenous route under electrocardio- in highly endemic regions, most cases are of
graphic guidance. Following loading, oral the benign self-limiting variety that does not
maintenance doses (5 mg kg−1 day−1) are require any treatment apart from sympto-
advised till the disappearance of the acute matic seizure prophylaxis. Screening of
encephalitic lesion(s), usually, 6–12 months. household family contacts and caregivers is
Since long-term administration is often not all the more important in the case of children
necessary, some of the side effects of longer with NC, because they are likely to have
durations of administration of phenytoin acquired the infection from within the pro-
may not be an issue. Close monitoring for tected environment of their homes.
References
1. World Health Organization. (1987) Prevention and control of intestinal parasitic infections. World
Health Organization Technical Report Series No. 749, 1–86.
2. Kang, G., Mathew, M.S., Rajan, D.P., et al. (1998) Prevalence of intestinal parasites in rural southern
Indians. Tropical Medicine and International Health 3, 70–75.
3. Sugunan, A.P., Murhekar, M.V., Sehgal, S.C., et al. (1996) Intestinal parasitic infestation among differ-
ent population groups of Andaman and Nicobar Islands. Journal of Communicable Diseases 28,
253–259.
4. Acha, P.N., Aguilar, F.J. (1964) Studies on cysticercosis in Central America and Panama. American

Paediatric Neurocysticercosis 261
sis and cysticercosis in human and pigs in a village in Morelos, Mexico. American Journal of Tropical
7. Diaz, F., García, H.H., Gilman, R.H., et al. (1992) Epidemiology of taeniasis and cysticercosis in
8. Diaz Camacho, S.P., Aurora, C.R., Ruiz, C., et al. (1991) Epidemiologic study and control of Taenia
solium infections with Praziquantel in a rural village of Mexico. American Journal of Tropical Medicine
9. Schantz, P.M., Sarti, E., Plancarte, A., et al. (1994) Community based epidemiological investigations
10. Sanchez, A.L., Lindbäck, J., Schantz, P.M., et al. (1999) A population-based case-control study for T.
solium taeniasis and cysticercosis. Annals of Tropical Medicine and Parasitology 93, 247–258.
Peru. Lancet 341, 197–200.
15. Scharff, D. (1988) Neurocysticercosis. Two hundred thirty-eight cases from a California hospital.
16. Veerendra Kumar, M. (1986) Clinico-pathological Study of Neurocysticercosis. Thesis. University of
Bangalore, Bangalore, India.
17. Mitchell, W.G. (1997) Pediatric neurocysticercosis in North America. European Neurology 37, 126–129.
18. Wendy, G., Mitchell, M.D., Thomas, O., et al. (1988) Intraparenchymal cerebral cysticercosis in chil-
dren: diagnosis and treatment. Pediatrics 82, 76–82.
19. Mitchell, W.G. (1999) Neurocysticercosis and acquired cerebral toxoplasmosis in children. Seminars
in Pediatric Neurology 6, 267–277.
20. Mitchell, W.G., Snodgrass, S.R. (1985) Intraparenchymal cerebral cysticercosis in children: a benign
prognosis. Pediatric Neurology 1, 151–156.
21. Rosenfeld, E.A., Byrd, S.E., Shulman, S.T. (1996) Neurocysticercosis among children in Chicago.
22. Antoniuk, S.A., Bruck, I., Wittig, E., et al. (1991) Neurocysticercosis in childhood. II Computed
tomography of 24 patients according to symptomatic and praziquantel treatment. Arquivos de
23. Bruck, I., Antoniuk, S.A., Wittig, E., et al. (1991) Neurocysticercosis in childhood. I. Clinical and labo-
ratory diagnosis. Arquivos de Neuropsiquiatria 49, 43–46.
24. Ferreira, M.S., Costa-Cruz, J.M., Nishioka, S.A., et al. (1994) Neurocysticercosis in Brazilian children:
report of 10 cases. Tropical Medicine and Parasitology 45, 49–50.
25. Ruiz-Garcia, M., Gonzalez-Astiazaran, A., Rueda-Franco, F. (1997) Neurocysticercosis in children.
Clinical experience in 122 patients. Childs Nervous System 13, 608–612.
26. Kalra, V., Paul, V.K., Marwah, R.K., et al. (1987) Neurocysticercosis in childhood. Transactions of the
Royal Society of Tropical Medicine and Hygiene 81, 371–373.
27. Kalra, V., Deorari, A.K., Goulatia, R.K. (1987) Praziquantel therapy in childhood neurocysticercosis.
Indian Pediatrics 24, 1095–1098.
28. Puri, V., Sharma, D.K., Kumar, S., et al. (1991) Neurocysticercosis in children. Indian Pediatrics 28,
1309–1317.
focal seizures and single small enhancing computerized tomographic lesions: a randomized,
placebo-controlled, double-blind trial. Pediatric Infectious Diseases Journal 17, 696–700.
30. Singhi, P., Ray, M., Singhi, S., et al. (2000) Clinical spectrum of 500 children with neurocysticercosis
and response to albendazole therapy. Journal of Child Neurology 15, 207–213.
31. Morales, N.M.O., Agapejev, S., Morales, R.R., et al. (1999) Clinical aspects of neurocysticercosis in
children. Pediatric Neurology 22, 287–291.
32. Manreza, M.L.G. (1982) Neurocysticercosis in childhood: clinical aspects and diagnosis. Revista do
Hospital Das Clinicas; Faculdad de Medicina da Universidade de São Paulo (São Paulo) 37, 2006–2111.

33. Schantz, P.M., Moore, A.C., Muñoz, J.L., et al. (1992) Neurocysticercosis in an Orthodox Jewish com-
34. Singh, G., Ram S., Kaushal V., et al. (2000) Risk of seizures and neurocysticercosis in household fam-
ily contacts of children with single enhancing lesions. Journal of the Neurological Sciences 176,
131–135.
35. Robles, C. (1945) Consideraciones acerea de la Cisticercosis cerebral en los ninos. Gaceta Médica
México 75, 248. (Cited in reference 36.)
Research Council Special Report. Series No. 299. Her Majesty’s Stationery Office, London, pp.1–58.
37. Rangel, R., Torres, B., Del Brutto, O., et al. (1987) Cysticercotic encephalitis: a severe form in young
38. Del Brutto, O.H., Garcia, E., Talamas, O., et al. (1988) Sex-related severity of inflammation in
parenchymal brain cysticercosis. Archives of Internal Medicine 148, 544–547.
39. Lopez-Hernandez, A., Garayzar, C. (1982) Analysis of 89 cases of infantile cerebral cysticercosis. In:
Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives.
40. Otero, E., Cardova, S., Diaz, F., et al. (1989) Acquired epileptic aphasia (the Landau–Kleffner syn-
drome) due to neurocysticercosis. Epilepsia 30, 569–572.
41. Shasha, W., Pammenter, M.D. (1991) Sero-epidemiological studies of cysticercosis in school children
from two rural areas of Transkei, South Africa. Annals of Tropical Medicine and Parasitology 85,
349–355.
42. Jung, H., Sanchez, M., González-Astiazaran, A., et al. (1997) Clinical pharmacokinetics of albenda-
zole in children with neurocysticercosis. American Journal of Therapeutics 4, 23–26.
prospective double blind trial comparing 7 versus 14 days of treatment. Neurology 48, 1421–1427.
44. Del Brutto, O.H., Campos, X., Sanchez, J., et al. (1999) A single-day praziquantel versus 1-week
albendazole for neurocysticercosis. Neurology 52, 79–81.

27 Psychiatric Manifestations of
Neurocysticercosis
Orestes V. Forlenza
Introduction Overview of Clinical Studies
Psychiatric disturbances typically present From historical findings to more recent

in the course of cerebral cysticercosis, both studies
in association with other neurological syn-
dromes, or as a dominant feature. Such Most of the psychiatric knowledge on NC
abnormalities were extensively studied by derives from studies conducted in mental
neurologists and psychiatrists at the begin- institutions in the late 1800s and early 1900s,
ning of the 20th century, yielding important from which we have inherited detailed
preliminary insights into organic mental descriptions of the patients’ psychopathol-
disease. In the second half of the century, ogy – that in many cases would mimic major
though, the concern on the subject waxed psychiatric syndromes such as schizophrenia
and waned. Cysticercosis was then and manic-depressive illness3–4. The fre-
regarded as a dying disease in Western quency of NC was presumed to be high in
Europe and North America, where it had psychiatric hospitals not only due to a causal
almost completely disappeared as a result relationship between the two conditions, but
of improvements in sanitation and meat also because severely psychotic and
inspection. Notwithstanding, the preva- demented patients were prone to become
lence of the tapeworm infection may still be secondarily infected as a consequence of
high among sub-populations of migrants poor hygiene and coprophagia.
and ethnic minorities, rendering their Several psychiatric syndromes have been
acquaintances or employers exposed to the so far attributed to NC. From early classic
risk of faecal–oral contamination1,2. It is papers on this subject, one can identify
important that patients with diagnosed descriptions indistinguishable from dementia
cerebral cysticercosis be assessed for psy- praecox, paranoia, neurosyphilis, Korsakoff’s
chiatric and neuropsychological morbidity, psychosis and dementia5–6. Chronic delu-
in addition to standard clinical and neuro- sions and hallucinations, as well as variations
logical procedures. Likewise, neurocysticer- of mood compatible with the diagnoses of
cosis (NC) should be considered in the major depression and bipolar disorder were
differential diagnosis of atypical presenta- additionally reported7–8. Because the aetiol-
tions of psychiatric cases, especially in ogy of these cases was seldom established in
endemic areas. life, clinical findings were retrospectively


264 O.V. Forlenza
correlated to neuropathological observations In Europe, further interest in the disease

of signs of the parasitic infection. Leukart was raised after the evaluation of cysticerco-
(1886), for instance, suggested that cysticerci sis in 450 British ex-servicemen who had
located in the ventricles and basal ganglia acquired the disease during military place-
were more liable to induce mental abnormali- ments in pre-1947 colonial India17. Among
ties than cortical lesions9. In the majority of these patients, 39 (8.7%) had mental disorder
such cases, neuropsychiatric findings were as a prominent feature, including cases of
compatible with major cognitive impairment, organic deterioration, affective disorders and
namely delirium and dementia9. Important schizophrenia. Except for the former cases of
contributions to this field of knowledge have unequivocal organic mental disease, medical
also been made by clinicians from Brazil, records showed divergence on the aetiologi-
Chile, Mexico, China and other countries cal relationship between the psychiatric con-
where prevalence of the disease was high dition and cysticercosis.
(Table 27.1). NC has further been claimed to A few recent studies have approached the
cause mental illness through an association psychopathology of patients with NC with
with intracranial hypertension, meningitis, the aid of contemporary psychometric
and epilepsy, in which case, mood and per- methodologies. Most of the literature on the
ceptual disorders and acute and chronic psy- subject that has been published in the last
choses have been described5–8,10–16. decade consists of small series of cases
Table 27.1. Prevalence of psychiatric manifestations according to several different studies drawn from
neurological and psychiatric samples. The far right column indicates (whenever available) an estimate of
the frequency of pure psychiatric forms*.
Prevalence of Pure
Author/s and Source of Number of psychiatric psychiatric
year of publication Country patients patients manifestations (%) forms* (%)
Küchenmeister (1857)4 Germany Psychiatry † 20 †

Brinck and Beca (1936)7 Chile Psychiatry 16 75 12.5
Pupo et al. (1946)8 Brazil Neurology 285 20 0
Arriagada and Corbalán (1961)12 Chile Neurology 145 9.4 0
Dixon and Lipscomb (1961)17 UK Neurology 450 8.7 0
Canelas (1962)13 Brazil Neurology 276 22.8 0
Lima (1966)34 Brazil Neurology 355 25 2
Lefèvre et al. (1969)35 Brazil Paediatrics 54 11.1 0
Arseni and Cristescu (1972)36 Romania Neurology 181 62 0
Yingkun et al. (1979)37 China Neurology 158 10.1 0
Manreza (1982)38 Brazil Paediatrics 100 28 0
Schenone et al. (1982)39 Chile Neurology 583 23 –
Takayanagui and Jardim (1983)40 Brazil Neurology 500 11.5 0.4
Sotelo et al. (1985)41 Mexico Neurology 753 20 4.7
Takayanagui (1987)42 Brazil Neurology 151 11.5 0
Scharf (1988)14 USA Neurology 238 3.4 –
Vianna et al. (1990)43 Brazil Neurology 67 4.5 –
Tavares Jr (1994)44 Brazil Psychiatry 188 5.3 –
Forlenza et al. (1997)26 Brazil Neurology 38 65.8 0
*There is some controversy in the literature regarding the implications of ‘pure psychiatric presentations’.
Brinck and Beca described psychiatric syndromes in 12 of their 16 patients; two of them had no other
symptoms attributable to cysticercosis7. Lima emphasized that ‘pure psychiatric forms’ were cases
without epilepsy, intracranial hypertension and meningitis, thus allowing the presence of minor
neurological symptoms34. Takayanagui and Jardim noted that psychiatric forms were usually associated
with other neurological manifestations although two ‘pure’ psychiatric cases were reported40.
†Data not available.

Psychiatric Manifestations of Neurocysticercosis 265
drawn from neurological facilities, and case dichotomy of parenchymal and ventriculo-
reports of particularly interesting or intense subarachnoid cysticercosis, there is no possi-
psychiatric syndromes14–16,18. There is a ble classification of the disease according to
paucity of reports of mild psychiatric symp- affected brain areas. Parenchymal cysts may
toms such as anxiety and dysthymia, possi- develop at any locus within the brain,
bly because such minor abnormalities of the although there is a strong propensity for
mental state may be overlooked in the gen- their location at the grey-white matter transi-
eral-hospital setting if assessment is carried tion zone tissue23. As a result of such
out without the aid of standardized psychi- anatomical heterogeneity, one would need
atric instruments16,19. In view of that, it has very large patient samples in order to corre-
not been so far possible to ascertain the late psychiatric findings and lesion location.
prevalence of psychiatric morbidity among In addition, there is also important variation
patients with NC. Estimates vary from 3.4 to in the ability of each individual cyst to
75% (Table 27.1), as a result of the varying become pathogenic, bearing in mind the long
sensitivity of diagnostic methods, sampling and unpredictable time lag between the
bias, and other methodological limitations, appearance of cysts in the brain and their
which are perhaps understandable in view degeneration and calcification17. Most prob-
of the clinical and pathological heterogeneity ably, degenerating cysts and the reactive
of the disease. inflammation within the adjacent nervous
tissue, which are strong determinants of NC-
induced epilepsy, may as well be the trigger
Brain pathology and mental symptoms of psychiatric symptoms, particularly among
predisposed individuals.
Attempts to classify the different psychiatric
syndromes and relate them to the respective
neurological conditions in which they are Prevalence of psychiatric disorders
likely to be found have also been made,
although never reaching consensus11. As a In a cross-sectional study of 38 cases at a neu-
general rule, ventricular cysticercosis and rology outpatient clinic in Brazil, depression
subarachnoid cysticercosis, which are usually syndromes were the commonest psychiatric
associated with meningitis and/or intracra- manifestation, as shown by the Present State
nial hypertension, may result in more cogni- Examination and the Schedule for Affective
tive dysfunction, with attention deficits, Disorders and Schizophrenia – Lifetime
impaired consciousness and delirium20. On Version semi-structured interviews24–26. Signs
the other hand, patients with parenchymal of psychotic disorder were observed in five
cysts and calcifications are prone to experi- patients although none had a clear-cut schiz-
ence the neuropsychiatric complications of ophrenic or manic-depressive presentation.
epilepsy, intracranial hypertension and Only 13 patients (34.2%) were presumed
space-occupying lesions. In view of that, ven- mentally healthy by the aforementioned psy-
triculosubarachnoid forms are prone to pre- chometric methods. Thirty-two patients were
sent with psychomotor agitation, sleep–wake assessed by the Mini-Mental State
cycle disturbances and other behavioural Examination and the Strub and Black’s
symptoms suggestive of acute cognitive dys- Mental Status Examination27,28. Neuro-
function. Dementia has been associated with psychological dysfunction was identified in a
massive and scattered infections of the brain majority of the cases (87.5%), although severe
parenchyma and subacute forms of intraven- cognitive abnormalities were less frequent
tricular cysticercosis21,22. (15.6%)26. Attention deficits were detected in
On the one hand, it may be acceptable all the patients assessed, being probably
that lesion location correlates with specific influenced by the effect of antiepileptic drugs
neuropsychological deficits, on the other, the (carbamazepine and barbiturates). Anyhow,
same assumption cannot be made towards 59.4% had mild to moderate and 40.6%
psychopathology. Except for the gross severe attention disturbance. Memory and

266 O.V. Forlenza
language were altered in 78% of the patients and cysticercosis were candidates for long-
and higher cognitive functions in 87.5%. term inpatient care, suggesting refractory
Other deficits included disorders of praxis disease. In the present-day context, most
and motor functions (50%). Reading and patients with NC have chronic depression
writing skills were less frequently affected and mild or moderately severe brain pathol-
(28% and 0.6% of patients, respectively). ogy (few cysts and/or calcifications). In
However, there was no clear pattern of local- such cases, psychiatric treatment is very
ization for the neuropsychological dysfunc- helpful and should follow the guidelines for
tion in the patients. the treatment of other organic mental ill-
In spite of the clinical heterogeneity of the nesses. Regarding severe forms of NC, such
test group, there was a mild correlation as massive infections with intracranial
between the occurrence of depression and lab- hypertension, space-occupying parenchymal
oratory signs of active disease (defined by the lesions, and intraventricular cysts, psychi-
presence of parenchymal cysts, not calcifica- atric treatment should follow neurological
tions only, as shown by computed tomogra- and neurosurgical procedures. Psycho-
phy (CT) and magnetic resonance imaging pharmacological treatment should be com-
(MRI) scans, and/or inflammatory cere- plementary to neurological care.
brospinal fluid (CSF)) (P = 0.04), and modest
correlation with the occurrence of intracranial
hypertension (P = 0.1). Psychosis also possibly Conclusions
correlated with intracranial hypertension (P =
0.06) but not with disease activity (P = 0.5). No The finding of mental abnormalities and
association was found between the psychiatric cognitive dysfunction in 65.8% and 87.5%,
manifestations and the occurrence of epilepsy respectively, of a cross-section of neurologi-
(P = 0.63), even when the epidemiological cal outpatients with NC is an estimate of
group of active epilepsy29 was considered (P = the high prevalence of psychiatric morbid-
0.72), nor with the current use of steroids (P = ity in such setting. Samples of psychiatric
1). Previous history of depressive disorders inpatients might provide a different profile
was strongly associated with current depres- of psychiatric findings, with more severe or
sion (P = 0.006) and psychosis (P = 0.04)26. even specific forms of mental disease, since
These findings parallel several other studies psychiatric surveys based on patients from
that have addressed the aetiology of organic mental institutions in the first half of the
mood disorders. Family history of depression 20th century reported up to 75% of severe
and history of depression before the onset of mental disease in association with cysticer-
the organic disease are regarded as risk factors cosis. Such a high rate might be explained
for developing depression in cerebrovascular by a long duration of the untreated organic
disease and multiple sclerosis, through greater disease, since many of the aforementioned
biological vulnerability30,31. Disease activity patients had previous evidence of neuro-
(which implies diffuse or localized central ner- logical syndromes before psychiatric
vous system inflammation) is temporally admission, according to their medical
related to organic mood disorders, as shown records. Thus, it is possible that mental dis-
in other medical and neurological conditions, ease represented one of the consequences
such as systemic lupus erythematosus and of the deteriorating organic illness, in the
multiple sclerosis32,33. absence of effective therapeutic strategies
for the parasitic infection at that time.
Although there is consensus that NC may
Treatment be responsible for most of the major psychi-
atric syndromes and dementia, a particu-
There is a paucity of data regarding psychi- larly interesting finding from the study of
atric treatment and outcome in NC. From outpatients is the non-specific pattern of
the earlier classical papers it was made clear psychiatric morbidity, as well as the greater
that patients with psychiatric syndromes incidence of minor psychiatric and neu-

Psychiatric Manifestations of Neurocysticercosis 267
ropsychological abnormalities. Such mani- ties were usually included. Attention and
festations were possibly underestimated by memory are also affected in a high propor-
most of the studies that did not use instru- tion of patients, which is consistent with
ments sensitive enough for an appropriate the findings of other authors in the past
assessment, so that only the most dramatic and reinforces the role played by NC as an
cases of mental or behavioural abnormali- aetiology of dementia.
References
1. Richards, F., Jr, Schantz, P.M. (1991) Laboratory diagnosis of neurocysticercosis. Clinics in Laboratory
Medicine 11, 1011–1028.
2. Schantz, P.M., Sarti-Gutierrez, E. (1989) Diagnostic methods and epidemiologic surveillance of
Taenia solium infection. Acta Leidensia 57, 153–163.
3. Griesinger, W. (1872) Cysticerken und ihre Diagnose. In: Psychiatrische und Nervenpathologishe
Abhandlungen. Gesammelte Abhandlungen. Verlag von August Hirschwald, Berlin, pp. 399–443.
4. Küchenmeister, F. (1857) On Animal and Vegetable Parasites of the Human Body. A Manual of Their
Natural History, Diagnosis and Treatment. The Syndenham Society, London.
5. Tretiakoff, C., Pacheco, E., Silva, A.C. (1924) Contribuição para o estudo da cysticercóse cerebral e em
particular das lesões cerebraes toxicas á distancia n’esta affecção. Memórias do Hospício de Juqueri 1, 37–66.
6. Ribas, J.C. (1943) Psicoses por lesões cerebrais. Revista de Medicina 27, 31–39.
7. Brinck, G., Beca, F. (1936) Contribución al estudio de la cisticercosis cerebral. Revista Medica de Chile
(Santiago) 64, 348–392.
8. Pupo, P.P., Cardoso, W., Reis, J.B., et al. (1946) Sobre a cisticercose encefálica. Estudo clínico, aná-
tomo-patológico, radiológico e do liquido céfalo-raqueano. Archivos da Assistência aos Psicopatas de
São Paulo 10–11, 3–123.
9. Leukart, R. (1886) The Parasites of Man, and The Diseases Which Proceed From Them. A Textbook for
Students and Practitioners. Young J. Pentland, Edinburgh, UK, pp. 488–551.
10. Obrador, S. (1948) Clinical aspects of cerebral cisticercosis. Archives of Neurology and Psychiatry
(Chicago) 59, 457–468.
11. Bastos, F.O. (1953) Aspectos psiquiátricos da neurocisticercose. Revista Paulista de Medicina 43,
162–164.
12. Arriagada, C., Corbalán, V. (1961) Clínica de la neurocisticercosis: manifestaciones neuropsiquiátri-
cas de la cisticercosis encefálica. Neurocirurgia 19, 232–247.
13. Canelas, H.M. (1962) Neurocisticercose: incidência, diagnóstico e formas clínicas. Arquivos de
14. Scharf, D. (1988) Neurocysticercosis: two hundred thirty-eight cases from a California hospital.
15. Signore, R.J., Lahmeyer, H.W. (1988) Acute psychosis in a patient with cerebral cysticercosis.
Psychosomatics 29, 106–108.
16. Castañeda, M.A., Torres, P., Crovetto, L., et al. (1993) Nuevos aspectos en la psicopatologia de la cis-
ticercosis cerebral. Revista de Neuro-psiquiatria 56, 3–15.
17. Dixon, H.B.F., Lipscomb, F.M. (1961) Cysticercosis: an Analysis and Follow-up of 450 Cases. F. Mildner
and Sons, London.
18. Shandera, W.X., White, A.C., Jr, Chen, J.C., et al. (1994) Neurocysticercosis in Houston, Texas. A
report of 112 cases. Medicine 73, 37–52.
19. Forlenza, O.V., Vieira, A.H.G., Machado, L.R., et al. (1998) Transtornos depressivos associados à neu-
rocisticercose. Prevalência e correlações clínicas. Arquivos de Neuropsiquiatria 56, 45–52.
20. Gang-Zhi, W., Cun-Jiang, L., Jia-Mei, M., et al. (1988) Cysticercosis of the central nervous system. A
clinical study of 1,400 cases. Chinese Medical Journal 101, 493–500.
21. Escobar, A., Aruffo, C., Cruz-Sanchez, F., et al. (1985) Hallazgos neuropatológicos en la neurocisticer-
cosis. Archivos de Neurobiología 48, 151–156.
22. Wadia, N.H., Desai, S.B., Bhatt, M.B. (1988) Disseminated cysticercosis – new observations including
23. Brown, W.J., Voge, M. (1985) Cysticercosis: a modern day plague. Pediatric Clinics of North America
32, 953–969.

268 O.V. Forlenza
24. Wing, J.K., Cooper, J.E., Sartorius, N. (1974) The Measurement and Classification of Psychiatric
Symptoms. An Instruction Manual for The Present State Examination and CATEGO Program. Cambridge
University Press, Cambridge, UK.
25. Spitzer, R.L., Endicott, J. Roteiro para distúrbios afetivos e esquizofrenia – versão para a vida toda –
SADS-L, Trad. de Valentim Gentil Filho. São Paulo: Departamento de Psiquiatria da Faculdade de
Medicina da Universidade de São Paulo, 1978–1979. [Mimeo]. Translated from: Spitzer, R.L.,
Endicott, J. Schedule for Affective Disorders and Schizophrenia (Life-time) – SADS-L. 3rd edn. Clinical
Research Branch Collaborative Program on the Psychobiology of Depression, NIMH, Bethesda,
USA. May, 1978 – September, 1979.
26. Forlenza, O.V., Vieira, A.H.G., Gouveia, M.F., et al. (1997) Psychiatric morbidity of cerebral cysticer-
cosis: a study of 38 patients from a neurology clinic in São Paulo. Journal of Neurology, Neurosurgery
and Psychiatry 62, 612–616.
27. Folstein, M.F., Folstein, S.E., Mchugh, P.R.H. (1975) Mini-Mental State: A practical method for grad-
ing the cognitive state of patients for the clinician. Journal of Psychiatric Research 12, 189–198.
28. Strub, R., Black, F.W. (1986) Mental Status Examination in Neurology, 2nd edn. FA Davis Company,
Philadelphia, USA.
29. Commission on epidemiology and prognosis of the International League Against Epilepsy (1993)
Guidelines for epidemiological studies on epilepsy. Epilepsia 34, 592–596.
30. Brumback, R.A. (1993) Is depression a neurologic disease? Behavioural Neurology 11, 79–104.
31. Popkin, M.K., Tucker, G.J. (1992) ‘Secondary’ and drug-induced mood, anxiety, psychotic, catatonic,
and personality disorders: a review of the literature. Journal of Neuropsychiatry and Clinical
Neuroscience 4, 369–385.
32. Miguel, E.C., Pereira, R.M.R., Pereira, C.A.B., et al. (1994) Psychiatric manifestations of systemic
lupus erythematosus: clinical features, symptoms, and signs of central nervous system activity in 43
patients. Medicine 73, 224 – 232.
33. Moller, A., Wiedemann, G., Rohde, U., et al. (1994) Correlates of cognitive impairment and depres-
sive mood disorders in multiple sclerosis. Acta Psychiatria Scandinavia 89, 117–121.
34. Lima, J.G.C. (1966) Cisticercose Encefálica: Aspectos Clínicos. Thesis. Escola Paulista de Medicina,
Federal University of São Paulo, São Paulo, Brasil, pp.131.
35. Lefévre, A.B., Diament, A.J., Valente, M.I. (1969) Distúrbios píquicos na neurocisticercose em cri-
anças. Arquivos de Neuropsiquiatria 27, 103–108.
36. Arseni, C., Cristescu, A. (1972) Epilepsy due to cerebral cysticercosis. Epilepsia 13, 253–258.
cysticercosis: 158 cases. Chinese Medical Journal 92, 770–786.
38. Manreza, M.L.G. (1982) Neurocisticercose na infância: aspectos clínicos e do diagnóstico. Revista do
Hospital das Clínicas Faculdade de Medicina da Universidade de São Paulo 37, 206–211.
39. Schenone, H., Villarroel, F., Rojas, A., et al. (1982) Epidemiology of human cysticercosis in Latin
America. In: Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge
and Perspectives. Academic Press, New York, pp. 25–38.
40. Takayanagui, O.M., Jardim, E. (1983) Aspectos clínicos da neurocisticercose. Análise de 500 casos.
42. Takayanagui, O.M. (1987) Neurocisticercose. Evolução Clínico-Laboratorial de 151 Casos. Doctoral
thesis, Faculty of Medicine of Ribeirão Preto, University of São Paulo, Brazil.
43. Vianna, L.G., Macedo, V., Mello, P., et al. (1990) Estudo clínico e laboratorial da neurocisticercose em
Brasília. Revista Brasileira de Neurologia 26, 35–40.
44. Tavares, A.R., Jr (1993) Psychiatric disorders in neurocysticercosis. British Journal of Psychiatry 163,
839 (Letter).

28 Taenia solium Cysticercosis:

Ophthalmic Aspects
Atul Kumar and Namrata Sharma
Introduction quency of a little more than seven in 10,000

in South America2. In another hospital study
The earliest description of a living cysticercus of all ophthalmic cases from South America,
in the human eye was made by Schott and the frequency was 30 per 100,000 cases3.
Sommering in 18291. Studies by Alfred Most reports of ocular cysticercosis have
Graefe, as early as 1877–1882, clearly estab- been made from Latin America and India4–9.
lished the role of surgical management in While in a large series reported by Junior, the
ocular cysticercosis1. Since then ocular cys- youngest patient was 6 years of age and the
ticercosis continues to be an important con- oldest was 66, most patients with ocular cys-
sideration among serious ocular disorders in ticercosis are in the first four decades of their
several endemic regions of the world, as well life1,10. Thus, Reddy and Reddy reported that
as in other non-endemic areas, owing to 90% of their patients were less than 15 years
increasing overseas travel and immigration. of age and Malik et al. reported that 68% of
Though the literature is replete with sporadic their patients were in the age group, 10–30
reports of this diverse condition, consoli- years4,5. Kumar et al. observed that the high-
dated accounts of the disorder are few. This est frequency was in the age group, 31–40
review intends to familiarize the reader with years6. A definite male preponderance has
the pleiomorphic clinical presentations, diag- been noted from India and Mexico2. Most
nostic modalities and available management patients with ocular cysticercosis are from
options of ocular and orbital cysticercosis. communities with poor hygiene
standards6,10. Junior noted that almost all his
patients with cysticercosis were labourers or
Epidemiology farm workers with primitive concepts of
hygiene and the majority came from rural
Frequency, geographical, age and sex areas1. Similarly, 70% of a series of 33
distribution patients from India were of low socio-eco-
nomic status based upon an objective rating
Ocular cysticercosis is a rare disease even in scale6. Ocular cysticerci have been found in
regions endemic for Taenia solium cysticerco- association with immune disorders such as
sis1. Only 111 cases were observed among allergic sinusitis, rheumatic fever, erythema
153,528 ophthalmic patients, giving a fre- nodosum, asthma and melanoma8.


270 A. Kumar and N. Sharma
Localization cysticercus, suggesting that the parasite trig-

gers a generalized autoimmune process
Sites of predilection for cysticercosis include directed against retinal photoreceptors31.
the central nervous system, subcutaneous Localization of the cyst to the optic disc may
tissue, skeletal and cardiac muscle, and occur through the central retinal artery. Two
eye10. Ocular involvement has been reported separate translucent, undulating cysts attached
in 13–46% of large series of patients with cys- to and obscuring the underlying optic nerve
ticercosis4,10. In a hospital-based series of 110 head have also been described32.
cases collected over 10 years, the most com- There has been disparity in the reports
mon location was the subcutaneous tissue from Latin America and India regarding the
(24.5%) followed by brain (13.6%) and eye location of the cysts in the eye. In several
(12.8%)11. Data from the authors’ institute large series from the former location, cys-
indicate that the most common extraocular ticerci were most commonly located in the
site was the brain (18%)6. vitreous, in contrast to an adnexal location
Ocular involvement is typically unilateral found by Indian workers1,6,33–37. However, in
but bilateral involvement has been reported a more recent report of 33 cases from India,
in cases of disseminated cysticercosis7,12,13. ocular cysticerci were most frequently
The left eye may be more commonly located in the vitreous (50%)6. Further, a
involved in comparison to the right, possibly higher incidence of orbital cysticercosis (in 6
because larvae may be preferentially routed out of 33 ophthalmic cases; 18%) was
to the left internal carotid artery, which observed in this series, which was in contrast
directly originates from the aorta; however, to the previous reports. The higher frequency
this has not been substantially proven14. The of detection of intraocular and intraorbital
medial side of the eye has been more com- cysticercis in this series was attributed to the
monly involved than the lateral side on use of ultrasonographic examination.
account of the anatomic course of the oph-
thalmic artery which, after giving off lacrimal
branches, runs along the medial side of the Clinical Presentation
orbit before dividing into terminal branches5.
Cysticerci can lodge in any part of the eye Lid and subconjunctival cysticercosis
or its adnexae. They have been reported in the
anterior chamber15,16, adherent to the extraocu- Involvement of the eyelids presents as a
lar muscle17, vitreous cavity18,19, subretinal painless, subcutaneous mass that may
space3,20,21 optic nerve head22,23, subconjuncti- remain unchanged over long periods of
val space4,24,25, lids26 and lacrimal gland27. time26. Conjunctival involvement is usually
Involvement of the lens has been anecdotally in the form of subconjunctival cysts (Fig.
reported4. Cysticerci have also been reported to 28.1); rarely subconjunctival abscess may
migrate within the eye28. Infestation of the ocu- occur24,25,38. A case of acute suppurative
lar adnexae is probably through the anterior dacryoadenitis due to cysticercus cellulosae
ciliary arteries27. Parasites reach the posterior is on record27. Spontaneous extrusion of a
segment through the posterior ciliary arteries, subconjunctival or extraocular muscle cyst
and lodge near the posterior pole and in the has been noted. Subconjunctival presentation
subretinal space20,29. From here, however, they could be a secondary stage in those cases in
often pass through a rent in the retina into the which the cyst may have extruded from the
vitreous. A rhegmatogenous retinal detach- primary extraocular muscle site38.
ment may develop or the perforation may be
sealed by an inflammatory reaction, leaving a
choroidoretinal scar30. Rarely, the parasite may Extraocular myocysticercosis
pass from the vitreous, through the pupil, into
the anterior chamber4. Giovannini et al. noted Cysticercus of the extraocular muscles presents
bilateral gravitational retinal epitheliopathy in with recurrent inflammation, proptosis,
response to a unilaterally located subretinal restricted ocular motility and ptosis38. Cardinal

Ophthalmic Aspects of Cysticercosis 271
28.2b). The cyst is usually well tolerated as

long as the larva is alive. However, when the
parasite dies, an intense inflammatory reac-
tion to the toxic products released from the
cyst occurs, and patient may present with a
blind, painful eye2,10. Rarely the presence of
a cysticercus larva in the anterior chamber
may manifest as unilateral iritis41.
The appearance of intravitreal live cys-
ticercosis is unmistakable particularly
when the medium is clear; the translucent,
white cyst with a dense white spot formed
by the invaginated scolex can be easily
recognized4. Its shape and undulating
movements are typical. The scolex with its
suckers and hooks can be seen returning
rapidly to the cyst when exposed to the
light of an indirect ophthalmoscope13.
In early stages, subretinal cysticercosis
can appear as an acute central retinitis with
retinal oedema and subretinal exudates. The
subretinal parasite will eventually develop
Fig. 28.1. Subconjunctival cyst. into a characteristic cyst3. The macular area
is apparently the preferred site for the sub-
retinal cysticercus to lodge, possibly because
manifestations include: (i) restricted motility in of rich vascularization of this area (Fig.
the direction of action of the involved extraoc- 28.3). The parasite and its movements can be
ular muscle; (ii) restricted motility in the direc- easily recognized through the thin macular
tion opposite to the involved extraocular tissues42. A choroidoretinal scar develops
muscle; (iii) recurrent inflammation (myositis) when the cyst migrates into the vitreous3.
with conjunctival congestion; and (iv) acquired The term, ‘communicating cysticercus’
blepharoptosis38,39. A cyst of the superior rectus refers to the situation, wherein the main
produces restricted infraduction, and a cyst of body of the cyst is located in the vitreous
the levator palpebrae superioris results in cavity, while the head remains in the supra-
acquired ptosis38. Orbital cysticercus may also choroidal space (Fig. 28.4a–c)43. Peripherally
present with proptosis40. located subretinal cysts are detected with
difficulty. A yellowish, globular mass with
poorly defined borders may be apparent
Vitreal, subretinal and anterior chamber and the movement of the parasite can be
cysticercosis obscured. Fluorescein angiography and
ultrasonography have been reported to be
Intraocular cysticercosis may be asympto- useful in delineating peripherally located
matic in the early stages when the parasite is subretinal cysts44. A diagnosis of ocular cys-
minute. As the parasite increases in size, it ticercosis becomes difficult when the para-
can cause a gradual, painless, progressive site dies and an intraocular inflammatory
loss of vision2,10. Patients may describe a response develops6. Marked circumcorneal
round or irregularly shaped, dark, mobile injection, keratic precipitates and flare in the
mass (intravitreal location) or may experi- anterior chamber and opacification of the
ence visual field defects (subretinal or optic vitreous similar to other inflammatory con-
nerve location). An intravitreal cyst may pre- ditions are observed33. A cyst in the anterior
sent per se with retinal detachment (Fig. chamber, which is rare, can excite uveal
28.2a) or overlying vitreal reaction (Fig. reaction and present as acute iridocyclitis41.

Fig. 28.2. Intravitreal cysticercus with retinal detachement (a) and overlying vitreal reaction (b).
Fig. 28.3. Subretinal cysticercus in macular location.

Fig. 28.4. Communicating cysticercus. A large (15 disc diameters) spheroid translucent cyst can be seen
in the superotemporal quadrant, attached to, and obscuring the visibilty of the retina (a, b). The dense
white structure within represents the scolex (a). This particular cyst was alive and made undulating
movements, especially on exposure to the strong illumination of the ophthalmoscope. (c) Upon B-mode
ultrasound scan, the posterior wall of the cyst was not distinguishable from the retinoscleral echo, raising
suspicion that the cyst was communicating.
Associated symptoms and signs concomitant involvement of the central ner-

vous system. Another indication of systemic
Ocular cysticercosis may be associated with involvement is the presence of multiple
neurological symptoms, such as headache, painless, subcutaneous nodules. A history
seizures, signs of hydrocephalus, or of tapeworm infection and/or travel to
increased intracranial pressure as a result of endemic areas is helpful in establishing the

diagnosis. Ocular cysticercosis should be sponding to the anterior and posterior walls
suspected in an individual who has lived in of the cyst. Low amplitude spikes that are
an endemic area and who develops uveitis, representative of the cavity of the cyst sepa-
leukocoria and/or neurological symptoms. rate the high echospikes. An additional
This diagnosis should also be suspected in 100% high spike may be observed within the
individuals with subconjunctival cysts or cyst when the beam passes through the
lid nodules. scolex, which is usually located eccentrically.
B-scan also demonstrates the complete cyst
with an eccentric high-reflective opacity
Differential diagnosis (scolex) and low-reflective, mobile opacities
filling the cyst cavity (Fig. 28.5). Upon B-
Hydatid cyst infestation may rarely occur in scan ultrasonography, the subretinal cys-
the extraocular muscles. The cysts are quite ticercus appears as a round density
large in size, the average size being 3–5 mm, connected to a curvilinear echo correspond-
and can reach up to 10 cm. In children, the ing to the scolex and the cyst wall, respec-
inflammatory response to a dying cysticer- tively. Intravitreal cysticercus gives an
cus should be differentiated from other appearance of a curvilinear cystic structure
causes of leukocoria, especially retinoblas- floating freely in the vitreous cavity.
toma and parasitic infections such as toxo- Intravitreal inflammatory reaction around
cariasis32. In the anterior chamber, the the cyst, when present, is characterized by
inflammation may be so severe that it is diffi- low-medium amplitude echoes in the vitre-
cult to differentiate a cyst from a lens dislo- ous cavity. Echography permits real-time,
cated into the anterior chamber16. dynamic evaluation with direct visualiza-
tion of the undulating movements of the
parasite. In cases of communicating cysts,
Diagnosis where the intravitreal cysticercus communi-
cates subretinally, both A- and B-scan reveal
Laboratory and immunologic tests the presence of a well defined anterior wall
of the cyst, whereas the posterior wall of the
Laboratory tests are of limited value in diag- cyst is not discernible separately from the
nosing intraocular cysticercosis. Complete retinal scleral echo (Fig. 28.4c)43. A careful
blood count, serum chemistries and erythro- ultrasonography is warranted in such cases,
cyte sedimentation rate may all be normal; since demonstration of any subretinal exten-
eosinophilia is uncommon. Repeated stool sion may alter the surgical approach and
samples may not show any proglottides or possibly the surgical outcome43.
eggs of T. solium. An anterior chamber tap Computed tomography (CT) of extraocu-
showing a high eosinophil count supports a lar myocysticercosis may reveal the presence
diagnosis of intraocular cysticercosis44. of cystic lesions in the extraocular muscle or
diffuse myositis. A cystic lesion with a scolex
on either CT scan or echography confirms a
Radiological examination diagnosis of myocysticercosis. CT evidence
of a cystic lesion without a scolex or diffuse
Orbital echography is often used to delin- myositis in the presence of a positive
eate the cystic lesions with a scolex in an immunoserological test, preferably enzyme-
enlarged extraocular muscle. Intraocular linked immunotransfer blot (EITB) for anti-
cysticercosis has characteristic echographic cysticercal antibodies, is also considered
features30,44–46. The cyst may be seen under- diagnostic47. Magnetic resonance imaging
neath the retina, in the vitreous cavity, sur- (MRI) findings of neurocysticercosis have
rounded by inflammatory membranes, or, been extensively described (see Chapter 32).
more rarely, in the anterior chamber. MRI appearances are characteristic; cysts in
Standard A-scan ultrasonography reveals the extraocular muscle with a scolex within
two equally high reflective echospikes corre- the cyst can be seen.

Fig. 28.5. B-mode ultrasound scan demonstrating the cystic nature of the lesion with an eccentric high
reflective opacity representing the scolex.
Treatment test may be of diagnostic help. If the latter is

found to be positive, albendazole with oral
Medical treatment steroids is recommended. If negative, oral cor-
ticosteroids are administered alone; a trial of
No effective anticysticercal drug is available treatment with albendazole may be consid-
for the treatment of ocular cysticercosis. The ered in persisting cysts.
lack of effective cysticidal action of prazi-
quantel is attributed to insufficient concentra-
tions of the drug in ocular tissue48,49. Two Surgical management
cases of subretinal cysticercosis that were
treated without any success are on record48. Management of ocular cysticercosis is mostly
Although the movements of the parasite surgical. The actual surgical approach
stopped temporarily after 13–18 days, they employed is determined, for the most part,
were re-established subsequently. The authors by the location of the cysticercus.
concluded that the drug produced a mild
toxic effect that was reversible. Albendazole
Lid, conjunctival and anterior segment
(200–400 mg twice daily with corticosteroids
cysticercosis
or alone) has been used in extraocular
myocysticercosis; preliminary results thereof All subconjunctival cysts should be sub-
are encouraging50. There are anecdotal reports jected to excision biopsy. The cyst can usu-
of its use in subconjunctival cysticerci; sponta- ally be easily removed from the lids,
neous extrusion of the cysts was reported conjunctiva and the anterior chamber52.
within 3–5 days in one such case51. Current When inflammation is present in the ante-
opinion favours medical management for rior chamber, corticosteriods may decrease
orbital cysticercosis. If a cystic lesion with the uveal reaction, loosen the cyst attach-
scolex is demonstrated, oral albendazole with ment, and make removal of the cyst easier16.
oral corticosteroids is recommended. If no Cysticerci that are attached to the sheath of
scolex can be identified within the cyst or dif- the extraocular muscles can be removed
fuse myositis is demonstrated, then an EITB after partly sacrificing the sheath38.

Intravitreal cysticercosis reous. Each fragment can be caught and

aspirated again. Retinal tears and haemor-
Diathermy53, photocoagulation3,12, cryoco-
rhage are mostly due to faulty technique.
agulation30, open approach with lens extrac-
Postoperative macular oedema, preretinal
tion52and pars plana vitrectomy53 have been
membranes and uveitis are usually an exac-
advocated in the management of posterior
erbation of preoperative conditions. The
segment cysts. An early intravitreal cyst can
postoperative recovery period of the patient
be removed with a hypodermic needle54.
following pars plana vitrectomy is shorter
For established intravitreal cysticercus,
and more easily managed. Systemic corti-
either a pars plana or an open sky vitrec-
costeroids are administered 1 day before
tomy has been advocated15,23,32,52,53. The
surgery, on the day of the surgery and for 1
drawback of open sky vitrectomy is that the
day after surgery.
lens must be removed, and glare or light Removal of the parasite from the macular
scatter at the anterior surface of the vitreous region poses particular difficulties. To gain
body may hamper visibility of the larva. A better access to the posterior pole of the eye-
safer and more effective method of remov- ball, lateral canthotomy and division of the
ing the cysticercus involves the pars plana recti may be undertaken20; some surgeons
approach with a bimanual technique and even resort to the Krönlein, procedure3.
use of endoillumination probes. A pars Periocular and topical corticosteroids, in
plana approach allows for clear visibility, addition to mydriatics, are often all that are
maintenance of intraocular pressure, mini- required to control the subsequent mild ocu-
mal vitreous loss and retention of the lens lar inflammation13.
during the surgical procedure13,23,48,53,55. The In case of a cysticercus attached to the
cysticercus is impacted on the probe tip and optic nerve head, the larva is dissected free
rapidly cut and aspirated from the eye. All of the optic nerve head by use of the blunt
particles, including the scolex are easily cut tip of an ocutome cutter and the endoillumi-
and removed. A complete vitrectomy nation probe32. Once free from the optic
should be performed, after aspiration of the nerve head surface, the larva is easily aspi-
cyst, to remove any toxic products released rated from the vitreous cavity by use of a
from the cyst. If the intravitreal cysticercus combination of suction and cutting action of
is associated with a posterior pole retinal the ocutome probe. It is mandatory that
break but without retinal detachment, man- before the dissection of the larva from the
agement of the break is not necessary optic nerve head, all vitreal connections to
because it is usually sealed by the strong the larva should be cut using standard vit-
inflammatory reaction previously induced rectomy cutting techniques.
by the cyst in the subretinal space30.
However, if strong vitreous traction upon
Subretinal cysticercosis
the retina is seen in the area of the break,
the tractional membranes should be If the cysticercus is subretinal, sclerotomy
removed during the closed vitrectomy pro- over the region of larva is the traditionally
cedure30. Localized vitrectomy can be per- favoured technique22. In the past, destruc-
formed in the area of the cysticercus to tion of subretinal cysts, less than 8 mm in
remove toxins it may have released. diameter has been accomplished using
Intraoperative complications during pars xenon or argon photocoagulation. Initially a
plana vitrectomy include migration and row of delimiting coagulations is placed in
fragmentation of the parasite, retinal holes the normal retina, surrounding the parasite
and haemorrhage. Migration occurs only if to prevent detachment3. Twenty shots of
a large vitrectomy is done before the xenon Green I at 3° for 1–3 s, or 80 shots of
removal of the parasite. If a cysticercus 500 µm, 500–800 mW of argon for 0.2 s are
breaks into two or three parts, each frag- recommended. The conversion of light to
ment forms a closed globular mass, often heat leads to coagulation of proteins and
with no apparent spill of contents in the vit- death of the parasite. Unlike a dead cysticer-

cus, the coagulated parasite produces only tis. Open sky and pars plana vitrectomies
localized inflammatory reaction and does have been employed to remove subretinal
not induce severe endophthalmitis. cysticerci and have several advantages over
Following photocoagulation, the patient is classic sclerotomy1,15,17,26,28,31,34,52. The visi-
given periorbital and systemic corticos- bility of the parasite during surgery is excel-
teroids for 3–6 weeks. The exudative reac- lent and the risk of subtotal cyst removal
tion clears in 1 month, usually leaving an and choroidal bleeding, as with the external
atrophic scar, with a white calcified scolex in approach, is minimal. The risks of retino-
the centre. Complications of photocoagula- tomy can be further minimized by preoper-
tion include retinal rupture, survival of the ative application of delimiting laser
parasite, macular scarring and severe photocoagulation. This also prevents preop-
uveitis3. Retinal rupture occurs when high- erative or perioperative cyst migration
energy shots are applied to the edge of the within the subretinal space. Following
parasite close to the normal retina or when three-port pars plana vitrectomy incisions,
the retina is thinned because of impending the posterior vitreous overlying the cys-
migration of the cyst into the vitreous. ticercus is exposed. Endodiathermy is used
Rupture can hasten passage into vitreous. to create a retinotomy and enter the subreti-
Survival of the parasite with return of con- nal space over the cyst. The suction catheter
tractile movements is due to insufficient is used as a cutter and is inserted through
treatment and requires further photocoagu- the retinotomy. The cyst is then removed
lation. Macular scarring is unavoidable from within the subretinal space. The scolex
when the parasite is in the macular location. is brought into the midvitreous where it is
Subretinal cysticercosis has also been examined, cut and aspirated. Internal
managed by subretinal release of the cyst. drainage of subretinal fluid is followed by
The cyst must be precisely localized by endolaser photocoagulation to surround the
indirect ophthalmoscopy and scleral retinotomy. Internal tamponade is achieved
depression. A deep, lamellar, L-shaped scle- either with silicone oil or a gas–fluid
ral dissection is made over the cyst13,29,48. exchange performed using 12% perfluoro-
Transillumination of the dissected scleral propane. After retinopexy, the cyst can also
bed delineates large choroidal vessels and be pulled into the vitreous and extracted
helps in avoiding them. The choroid is then from the eye in one piece, after enlargement
exposed through a small incision in the of the pars plana incision. The risk of
scleral bed and, after adequate diathermy spilling of cyst contents is minimal with this
to avoid bleeding, it is perforated carefully procedure as the cutting or aspiration of the
to avoid rupture of the cyst. The cyst is cyst is avoided.
then delivered through the choroidoscleral
incision. Gentle pressure on the globe can
help to release the cyst. Complications of Conclusions
the procedure include failure to remove the
parasite, retinal detachment, retinal tear, Modern imaging techniques have made the
vitreous loss and haemorrhage48. diagnosis of ophthalmic cysticercosis easy.
Removal of subretinal parasites via scle- Nevertheless, clinical suspicion of the con-
rotomy, however, carries risks. Extensive dition should be high and the diagnostic
periocular surgery may be required to gain consideration may be invoked in any
adequate exposure28,29,53,55–57. Inadequate patient in endemic areas with a cystic
localization may lead to non-removal of the lesion or uveitis, retinitis and endoph-
parasite, perioperative migration of the cyst thalmitis. This is particularly important
within the subretinal space and migration because prognosis in untreated cases of
into the vitreous cavity. Other possible com- intraocular cysticercosis is uniformly poor.
plications include retinal detachment, reti- Successful treatment lies in early and com-
nal tear with vitreous loss, vitreous plete surgical removal of ocular cysticerci.
haemorrhage and bacterial endophthalmi- When not treated, intravitreous or subreti-

nal cysticercus usually leads to blindness the eyelid and/or conjunctiva are more
within 3–5 years. Without treatment, the benign, and spontaneous extrusion of the
cysticercus increases in size and begins to subconjunctival cyst may occur. Once the
release toxins, leading to a profound infection is diagnosed, however, it is of the
inflammatory reaction with eventual utmost importance to rule out central ner-
destruction of the eye. Cysticerci located in vous system involvement.
References
1. Junior, L. (1949) Ocular cysticercosis. American Journal of Ophthalmology 32, 523–548.

2. Cano, M.R. Ocular cysticercosis. In: Ryan, S.J. (ed.) Retina, Vol. 2. CV Mosby, St Louis, Missouri, pp.
583–587.
3. Santos, R., Dalma, A., Ortiz, E., et al. (1979) Management of subretinal and vitreous cysticercosis:
role of photocoagulation and surgery. Ophthalmology 86, 1501–1507.
4. Reddy, P.S., Reddy, D.B. (1957) Ocular cysticercosis. Current Medical Practitioner 1, 642.
5. Malik, S.R.K., Gupta, A.K., Choudhry, S. (1968) Ocular cysticercosis. American Journal of
6. Kumar, A., Tewari, H.K., Goyal, H., et al. (1995) Socio-demographic trends in ocular cysticercosis.
Acta Ophthalmologica Scandinavica 73, 438–441.
7. Balakrishnan, E. (1961) Bilateral intra-ocular cysticerci. British Journal of Ophthalmology 45, 150–151.
8. Cardenas, F., Quiroz, H., Plancarte, A., et al. (1999) Taenia solium ocular cysticercosis: findings in 30
cases. Annals of Ophthalmology 24, 25–28.
9. Mais, F.A. (1969) Criocirugia na cisticercose ocular. Revista Brasileira de Ophthalmologia 28, 99–106.
10. Katz, M., Despommier, D.D., Gwadz, R.W. (1982) Parasitic Diseases. Springer-Verlag, New York.
11. Nhan, N.T. (1981) Norew experience dans le diagnostic et dans le traitment chirugical de la cysticer-
cose intraoculaire. Journal Francais d’Ophthalmologie 4, 387–392.
12. Rocha, H., Galvao, P.G. (1963) Case de cisticerco subretiniano yuxtapapilar treatade pela fotocoagu-
lacao. Revista Brasileira de Ophthalmologia 22, 41–49.
13. Teekhasaenee, C., Ritch, R., Kanchanaranya, C. (1986) Ocular parasitic infection in Thailand. Review
of Infectious Diseases 8, 350–356.
14. Bhaskaran, C.Y., Reddy, R.M., Venkatamuni, M., et al. (1978) Ocular cysticercosis. Indian Journal of
15. Kapoor, S., Kapoor, M.S. (1978) Ocular cysticercosis. Journal of Pediatric Ophthalmology and Strabismus
(Thorofare) 15, 170–173.
16. Kapoor, S., Sood, G.C., Aurora, A.L., et al. (1977) Ocular cysticercosis: report of a free floating cys-
ticercus in the anterior chamber. Acta Ophthalmologica (Copenhagen) 55, 927–930.
17. DiLoreto, D.A., Kennedy, R.A., Neigel, J.M., et al. (1990) Infestation of extraocular muscle by cys-
ticercus cellulosae. British Journal of Ophthalmology 74, 751–752.
18. Mandell, L.A., Ralp, E.D. (1985) Essentials of Infectious Diseases: Serology and Skin Testing. Scientific
Publications, Boston, Massachusetts.
19. Danis, P. (1974) Intraocular cysticercus. Archives of Ophthalmology 91, 238–239.
20. Bartholomew, R.S. (1975) Subretinal cysticercosis. American Journal of Ophthalmology 79, 670–673.
21. Sabti, K., Chow, D., Wani, V. (2001) Resolution of bilateral multifocal subretinal cysticercosis without
significant inflammatory sequelae. Canadian Journal of Ophthalmology 36, 408–413.
22. Bawa, Y.S., Wahi, P.L. (1962) Cysticercosis cellulosae of the optic disc with generalized cysticercosis.
23. Wood, R.R., Binder, P.S. (1979) Intravitreal and intracameral cysticercosis. Annals of Ophthalmology
11, 1033–1036.
24. Sen, D.K., Thomas, A. (1969) Cysticercus cellulosae causing subconjunctival abscess. American
Journal of Ophthalmology 68, 714–715.
25. Sen, D.K., Thomas, A. (1969) Incidence of conjuctival cysticercosis. Acta Ophthalmologica 47,
359–399.
26. Jampol, L.M., Caldwell, J.B.H., Albert, D.M. (1973) Cysticercus cellulosae in the eyelid. Archives of

27. Sen, D.K. (1982) Acute suppurative dacryoadenitis caused by a cysticercus cellulosa. Journal of
Pediatric Ophthalmology and Strabismus (Thorofare) 19, 100–102.
28. Fishman, M., Kerman, B., Foxman, S. (1987) Intraocular cysticercosis: migratory. In: Ossoing, K.C.
(ed.) Ophthalmic Echography. Proceedings of the 10th SIDUO Congress. Martinus Nijhoff, Dordrecht.
29. Aracena, T., Perez-Roca, F. (1981) Macular and peripheral subretinal cysticercosis. Annals of
30. Kruger-Leite, E., Jalkh, A.E., Quiroz, H., et al. (1985) Intraocular cysticercosis. American Journal of
31. Giovannini, A., Chillemi, P., Coccia, L., et al. (1985) Ocular cysticercosis. Apropos of a clinical case of
presumed ocular cysticercosis. Journal Francais d’ Ophthalmologie 8, 789–795.
32. Zinn, K.M., Guillory, S.L., Friedman, A.H. (1980) Removal of intravitreous cysticerci from the sur-
face of the optic nerve head: a pars plana approach. Archives of Ophthalmology 98, 714–716.
33. Sen, D.K., Mathur, R.N., Thomas, A. (1967) Ocular cysticercosis in India. British Jounal of
Opthalmology 51, 630–632.
34. Kapoor, S. (1978) Ocular cysticercosis in India. Tropical and Geographical Medicine 30, 253–256.
35. Krishna, D., Mohan, H. (1978) Ocular cysticercosis in India. Journal of Pediatric Ophthalmology and
Strabismus (Thorofare) 15, 96–102.
36. Reddy, P.S., Satyendran, O.M. (1964) Ocular cysticercosis. American Journal of Ophthalmology 57, 664–666.
37. Rao, A.V.M., Satayandran, O.M., Shiva Reddy (1967) Cysticercosis of the eye. Oriental Archives of
38. Shekhar, G.C., Lemke, B.N. (1997) Orbital cysticercosis. Ophthalmology 104, 1599–1604.
39. Menon, V., Kumar, G., Prakash, P. (1994) Cysticercosis of extraocular muscle. Journal of Pediatric
Ophthalmology and Strabismus (Thorofare) 31, 126–129.
40. Madan, N., Chopra, K., Popli, V. (1995) Proptosis as a manifestation of cysticercosis. Indian Pediatrics
32, 914–918.
41. Schmidt, U., Klauss, V., Stefani, F.H. (1990) Unilateral iritis by cysticercal larva in the anterior cham-
ber. Ophthalmologica (Basil) 200, 210–215.
42. Segal, P., Mrzygold, S., Smolarz Dudarewicz, J. (1964) Subretinal cysticersosis in the macular region.
American Journal of Ophthalmology 57, 655–664.
43. Kumar, A., Verma, L., Khosla, P.K., et al. (1989) Communicating intravitreal cysticercosis. Ophthalmic
Surgery 20, 424.
44. Manschot, W.A. (1968) Intraocular cysticercus. Archives of Ophthalmology 80, 772–774.
45. Murthy, H., Kumar, A., Verma, L. (1990) Orbital cysticercosis – an ultrasonic diagnosis. Acta
Ophthalmologica 68, 612–614.
46. Meyerson, L., Pienaar, B.T. (1961) Intra-ocular cysticercus. British Journal of Ophthalmology 45, 148–149.
47. Stewart, C.R., Salman, J.F., Murry, A.D., et al. (1993) Cysticercosis as a cause of severe medial rectus
myositis. American Journal of Ophthalmology 116, 510–516.
48. Santos, R., Chavarria, M., Aguirre, A.E. (1984) Failure of medical treatment in two cases of intraocu-
lar cysticercosis. American Journal of Ophthalmology 97, 249–250.
49. Kestelyn, P., Taelman, H. (1985) Effect of praziquantel on intraocular cysticercosis: a case report.
50. Sihota, R., Honavar, S.G. (1994) Oral albendazole in the management of extraocular cysticercosis.
51. Raina, U.K., Taneja, S., Lamba, P.A., et al. (1996) Spontaneous extrusion of extraocular cysticercosis
cysts. American Journal of Ophthalmology 121, 438–441.
52. Barraquer, J. (1963) Lens Extraction and Extraction of Cysticercus. American Academy of
Ophthalmology and Otolaryngology Meeting, New York (Film presentation).
53. Hutton, W.L., Vaiser, A., Snyder, W.B. (1976) Pars plana vitrectomy for removal of intravitreal cys-
ticercus. American Journal of Ophthalmology 81, 571–573.
54. Patnaik, B., Kalsi, R. (1983) Intraocular cysticercosis and its surgical management. In: Henkind, P.
(ed.) Acta XXIV International Congress of Ophthalmology. JB Lippincott, Philadelphia, pp. 152–159.
55. Verdaguer, T.J., Lechuga, M., Ibanez, S. (1977) Tratamiento quirurgico da la cisticercosis intravitrea.
Archivos de Chilian del Ophthalmologia 34, 49–54.
56. Gemolotto, G. (1955) Contributo alla terapia chirurgica del cisticerco andocular. Archives of
57. Jain, I.S., Dhir, S.P., Chattopadhiya, P.R., et al. (1979) Ocular cysticercosis in North India. Indian
Journal of Ophthalmology 27, 54–58.

29 Neurocysticercosis: Diagnosis and

Treatment in Special Situations
Ravindra Kumar Garg and Alok Mohan Kar
Introduction human immunodeficiency virus (HIV) infec-

tion worldwide. A few other organisms
Neurocysticercosis (NC) is not only rampant could also potentially interact with HIV
in developing countries, but its frequency is infection in their respective regions of
also increasing in developed countries, due endemicity. One such emerging example is
to increasing immigration and more frequent the occurrence of NC in AIDS. Thornton et al.
travel to endemic regions. In endemic and reported such an association for the first time
even in non-endemic regions’ cysticercosis is in four African patients1. In three patients,
likely to occur with several other medical the occurrence of seizures, a symptom
conditions. Concomitant illnesses may affect related to NC, brought the patients to med-
natural history and clinical behaviour of cys- ical attention and eventually a diagnosis of
ticercosis and consequently its management HIV infection was made. White et al. later
and prognosis. In addition, Taenia solium reported asymptomatic NC in a patient with
infection, along with several other parasitic HIV infection; this patient also had crypto-
infections, has been causally implicated in coccal meningitis2. Soto Hernandez recently
certain systemic and central nervous system reported two more such patients3. One
(CNS) malignancies. In this chapter, we shall patient presented with intracranial hyperten-
be reviewing the available literature on such sion. Neuroimaging revealed a solitary giant
associations with an emphasis on their clini- intracranial cyst, which was surgically
cal implications. removed. The second patient had brain toxo-
plasmosis and incidental NC. A summary of
all these patients and one patient in whom
Neurocysticercosis in Acquired NC was diagnosed at autopsy4 appears in
Immunodeficiency Syndrome (AIDS) Table 29.1.
AIDS is frequently complicated by oppor-

tunistic infections. There are geographic vari- Clinical implications of concomitant NC
ations in the pattern of opportunistic and HIV infection
infections depending upon the prevalence of
microorganisms in the environment. The association between NC and AIDS is a
Pneumocystis, Toxoplasma and Cryptosporidium cause for several concerns. Firstly, there may
are the main organisms associated with be the possibility of the occurrence of NC in


282 R.K. Garg and A.M. Kar
Table 29.1. Summary of published experience of eight cases of neurocysticercosis in AIDS.
Case Ref. Clinical Associated MRI/CT

No. No. Age/Sex presentation condition scan Treatment Outcome
1. 4 22/F NA; diagnosis was Toxoplasmosis, NA NA Died

made incidentally tuberculous
on autopsy abscess
2. 1 40/M Headache, partial Generalized Numerous Abendazole + Slight
seizures, obtundation, lymphadenopathy intra- corticosteroids improvement
papilloedema, hemianopia, parenchymal
hemiparesis cystic lesions
3. 1 36/M Partial seizures, brachial Generalized Multiple Praziquantel + Improved
monoparesis, hand lymphadenopathy, parenchymal phenytoin
incoordination oral candidiasis cysts
4. 1 30/M Headache, left hemi- Generalized Numerous Praziquantel + Improved
paresis, left optic atrophy, lymphadenopathy parenchymal corticosteroids
visual field defect cysts
5. 1 25/M Generalized tonic–clonic Generalized Multiple – Died
seizure lymphadenopathy, cortical cysts
thrombocytopenia,
cryptococcal
meningitis
6. 2 29/M Asymptomatic Single cystic Improved
lesion
7. 3 29/M Headache, raised <200 CD4 cells Single giant Surgery + Impoved
intracranial pressure cyst albendazole
8. 3 41/F Raised intracranial Toxoplasmosis, Racemose None NA
pressure, decreased Herpes zoster cyst in
attention, hemiparesis Sylvian fissure
NA: data not available.
other immunocompromised states as well. and causes cysts in the subcutaneous tissue
The alterations in the immune system of the and viscera of rodents. It may, however, be
host described in patients with NC may be in added to the list of opportunistic infections
some cases a predisposition to, rather than a that occur in AIDS.
consequence of, HIV infection1. Second, the
therapeutic response to anticysticercal drugs
(praziquantel and albendazole) may differ in Differential diagnosis of NC in AIDS
HIV-infected patients since successful anti-
cysticercal treatment requires a simultaneous Intracranial mass lesions are frequent in
drug effect on both the parasite and host AIDS. The nature of these mass lesions can
immune system. Third, clinical and serologi- be broadly divided into three distinct
cal manifestations of NC might be modified groups: opportunistic infections, neoplasms
by HIV infection. and cerebrovascular disease7. Toxoplasmosis,
a common cause of intracranial mass lesions
in AIDS, can frequently be confused with NC
Taenia crassiceps cysticercosis in AIDS because of similar clinical and imaging pre-
sentations. A point of difference upon imag-
Klinker et al., in 1992, first reported the ing studies is that toxoplasma lesions
occurrence of subcutaneous cysticercosis due involve subcortical structures such as basal
to T. crassiceps in AIDS5. Subsequently, ganglia, thalamus and cerebellum in com-
Francois et al. described the development of parison to NC, which is characteristically
a fluctuant painful subcutaneous and intra- located at the cortical–subcortical interface.
muscular tumour of the forearm due to T. A reliable non-invasive diagnosis of toxo-
crassiceps cysticercosis in AIDS6. Taenia crassi- plasmosis is made with the help of positive
ceps is ordinarily non-pathogenic to humans antitoxoplasma serology and a good thera-

Diagnosis and Treatment in Special Situations 283
peutic response as confirmed by serial CT immunosupressive drugs used in the man-

scans8–10. Primary CNS lymphoma is easily agement of renal transplant. A point to note,
distinguishable from NC upon imaging however, is that some antiepileptic drugs
studies by involvement of, and extension (AEDs) used for the treatment of seizure dis-
across the corpus callosum, exclusive order due to cerebral cysticercosis, including
involvement of the white matter, periventric- phenobarbitol, phenytoin and carbamazeap-
ular location and sub-ependymal spread8–10. ine induce the hepatic CYP3A4 enzyme sys-
tem. This can result in increased clearance
and reduced blood levels of cyclosporin and
Treatment of NC in AIDS FK 506 and, thereby, renal allograft rejec-
tion12,13. Therefore, blood levels of
All reported cases of NC so far have been cyclosporin should be measured during AED
found in advanced HIV disease, frequently co-administration and appropriate dose
coexisting with other opportunistic infec- modifications be made.
tions, generalized lymphadenopathy or pro-
found CD4 lymphoytopaenia. Reported
experience from a limited number of cases of Leukaemia
AIDS with NC suggests that the latter
responds to treatment with albendazole or Mauad et al. reported an unusual case of
praziquantel in a manner similar to non- massive cardiopulmonary cysticercosis in
HIV-related NC. Surgery may also be consid- acute leukaemia14. As pulmonary cysticerco-
ered in cases of solitary giant parenchymal sis is extremely rare, the authors suggested
cysts or racemose cysticercosis. However, that profound immunosuppression, pro-
greater emphasis should be given to treat- duced by acute leukaemia, was responsible
ment of coexisting diseases1–3. for this unusual presentation.
Neurocysticercosis in Other Concomitant CNS Infections with NC

Immunocompromised States
In endemic regions, NC is likely to occur co-
A few reports of NC in other immunocompro- incidentally with other CNS infections that
mised conditions are available, however, due are common and peculiar to that region, with
to lack of sufficient data it is difficult to ascer- the possibility of mutually altering respective
tain the significance of such associations. pathological and clinical courses of both the
diseases. One such example is that of associa-
tion of NC with Japanese B encephalitis.
Renal transplantation
Some parasitic diseases such as strongyloi- Japanese B encephalitis

dosis and schistosomiasis uncommonly
occur in the post-transplant immunocompro- An unusually high frequency of NC has
mised state. Gordillo-Paniagua et al. been reported in at least two autopsy series
described the occurrence of cysticercotic of brains studied for Japanese B encephalitis
encephalitis in a cadaveric renal transplant from India and China15,16. Shankar et al.
recipient11. Complete resolution of clinical found cerebral cysticercosis in 11 of 26 con-
and CT abnormalities were achieved follow- secutive brain specimens examined for
ing praziquantel therapy. More importantly, Japanese B encephalitis16. Fang et al. noted
the complicating illness did not affect renal NC in eight of 26 brains with Japanese B
allograft function or in any way alter encephalitis17. Other authors have
immunosuppressive drug action. The described the association in living subjects
reported individual did not receive using imaging and serological studies (Fig.
cyclosporin or FK 506, both standard 29.1a and b)17,18. From the point of view of

Fig. 29.1. Magnetic resonance image (fluid attenuation recovery sequence) showing solitary cysticercus
granuloma (a) with a scolex and surrounding oedema and thalamic and sub-thalamic lesions (b)
characteristic of Japanese B encephalitis.
diagnosis and treatment, it is important to mosis may produce clinical and imaging mani-
differentiate this condition from cysticer- festations similar to that of NC. Toxoplasmosis
cotic encephalitis19. Several authors have is rare in immunocompetent hosts, while NC
tried to explain this association on the basis occurs rarely in immunosuppressed hosts20. A
of anatomical derangements in the variety of investigative techniques including
blood–brain barrier during the inflamma- neuroimaging, thallium-201 single photon
tory phase of cerebral cysticercosis that emission computed tomography, polymerase
facilitate viral entry15–18. Furthermore, T. chain reaction analysis of CSF and special
solium larvae are also thought to sensitize histopathological methods may be required to
the brain to more severe injury by Japanese reliably differentiate acquired toxoplasmosis
B encephalitis. Indeed, it has been surmised from cerebral cysticercosis20.
that concomitant cerebral cysticercosis Wallus and Young reported the rapid
adversely determines the outcome of the development of a large cystic parenchymal
encephalitis16,18. In our view, the swine pop- lesion in a young woman, which was surgi-
ulation is an important reservoir for cally removed and found to contain pus
Japanese B encephalitis and also constitutes rather than clear fluid21. The pus was cul-
the intermediate host population for T. tured and grew Brucella melitensis. The case
solium. Therefore, there is a likelihood of a allegorizes bacterial superinfection of cere-
chance association to occur in areas where bral cysticercosis and as well as the point
free-ranging pigs are common. that clinicians should be aware of multiple
simultaneous infections.
Other CNS infections

Neurocysticercosis in Pregnancy
Another CNS infection that has been reported
to occur in patients with NC is cerebral toxo- Like several other neurological disorders,
plasmosis3,4. As mentioned earlier, toxoplas- NC may manifest for the first time during

pregnancy and the latter may occur in a milk and its effects on neonates and infants
woman with pre-existing NC22–24. Our are not yet known22.
experience on this association is largely
based on anecdotal case reports22–24. NC
can be responsible for new-onset seizures Neurocysticercosis and Malignancies
during pregnancy. However, seizures
have a different connotation in pregnancy Systemic malignancies
than otherwise. First, seizures are more
commonly a manifestation of eclampsia Herrera et al. investigated the possibility of
and NC must be differentiated from this an association between NC and systemic
condition24. Second, both mother and cancer26. The authors reviewed 1271
fetus are at risk of death during and after autopsy files and selected those with malig-
a major seizure. Hypoxia and acidosis nancy cases. Autopsies revealing any non-
caused by convulsions, though, well toler- malignant disease served as controls. NC
ated by the mother, can be fatal to the was significantly more frequent in haema-
fetus. Unsuspected NC may also pose tological malignancies in comparison to
diagnostic problems during pregnancy. controls. It was concluded that since
The investigation of choice for the diagno- human cancer arises from interaction of
sis of NC in pregnant women is magnetic several factors including xenobiotics and
resonance imaging (MRI); computed endogenous constituents, it is difficult to
tomography (CT) scanning should be establish NC as a causal agent of haemato-
avoided as far as possible, especially dur- logical malignancies; however, it should be
ing early part of pregnancy. considered as a potential risk factor for
Data is insufficient about safety of anti- haematological malignancies in endemic
cysticercal drugs during pregnancy. countries. Mutagenic abnormalities includ-
Praziquantel does not cause teratogenicity in ing chromosomal aberrations and HPRT-
mammalian assays or reproductive impair- locus mutations have been reported with
ment in rats, mice or rabbits. There are no increased frequency in individuals with
available data on human reproductive ill NC27,28. Although some authors relate these
effects from this agent25. Anecdotal use in abnormalities to the administration of prazi-
pregnant individuals who were not yet quantel, the prevailing view is that these
aware that they were pregnant, so were in abnormalities are caused by NC itself and
very early pregnancy (at the time of maximal that they revert back with praziquantel
teratogenic potential), have not revealed any administration27–29. Some authorities believe
congenital anomalies25. Use in later gestation that T. solium infestation causes depression
has not been associated with an increase in of cell-mediated immunity, in particular cer-
fetal or neonatal mortality or morbidity22. tain aspects of T-cell function30,31. Since the
Though human data are lacking, albendazole latter is involved in surveillance against can-
has been found to be embryotoxic and ter- cer, it may be surmised that the parasite-
atogenic to laboratory animals; therefore its induced immunosuppression underlies the
use during pregnancy, especially the first predisposition to malignancies.
trimester, is not recommended.
We recommend that if the patient is preg-
nant and seizures are in good control on Central nervous system malignancies
antiepileptic drugs (AEDs) then definitive
treatment with anticysticercal drugs can be In non-endemic regions where incidence of
delayed till after delivery. On the contrary, if NC is very low, it is not surprising that
the disease is progressive or seizures are not lesions of NC are mistaken as cerebral
well controlled, then anticysticercal treat- tumour. Silver et al. reported one such exam-
ment should be considered during preg- ple; a 9-year old girl presented with severe
nancy22. Finally, note should be made of the acute headache, vomiting and convulsions –
fact that praziquantel is secreted in breast imaging revealed a ring-enhancing CT

lesion32. On the basis of radiological impres- Conclusions

sion and report of stereotactic needle biopsy,
the lesion was diagnosed as malignant Neurocysticercosis is likely to be associated
glioma. However, subsequently, the excised with other common medical conditions in
mass revealed cysticercus granuloma. endemic regions. Though data is limited, there
More importantly, there are reports of a is no evidence that associated immunological
causal association between NC and CNS disorders such as AIDS and renal transplanta-
malignancies33,34. A systematic case–control tion or physiological conditions such as preg-
evaluation found an increased frequency of nancy affect the natural course of cysticercosis.
NC among patients with cerebral glioma34. Such patients need the usual forms of treatment
In this series, six out of eight individuals and there is a good outcome in the majority. In
who demonstrated the association had calci- endemic regions, new-onset seizures in preg-
fied cysts in and around the neoplasm; sug- nancy should raise the consideration of NC as
gesting that the severe inflammatory an aetiological possibility. If NC is diagnosed,
response to degenerating transitional cys- anticysticercal treatment is preferably delayed
ticerci that lead to calcification was responsi- till the postpartum period. Preliminary reports
ble for a neoplastic transformation35. Several from Latin America indicate that NC may pre-
mechanisms have been put forward for the dispose to certain haematological and CNS
causal association between NC and cerebral malignancies. Further research effort is
gliomas (Box 29.1)33–35. required to clarify this relationship.
Box 29.1. Suggested oncogenic mechanisms in neurocysticercosis
1. Immunological changes resulting in loss of regulatory mechanisms responsible for immune

surveillance against cancer.
2. Transfer of genetic material from parasite to the host, causing DNA damage and malignant
transformation of host cells.
3. Chronic inflammation with liberation of nitric oxide and inhibition of tumour suppressor genes.
4. Chromosomal aberrations in peripheral blood cells.
5. Intense gliosis around cysticercal calcified lesions may stimulate uncontrolled proliferation
of glial cells.
6. Interaction with other unidentified oncogenic factors (e.g. environmental, genetic).
References
1. Thornton, C.A., Houston, S., Latif, A.S. (1992) Neurocysticercosis and human immunodeficiency
virus infection. A possible association. Archives of Neurology 49, 963–965.
2. White, A.C. Jr, Dakik, H., Diaz, P. (1995) Asymptomatic neurocysticercosis in a patient with AIDS
and cryptococcal meningitis. American Journal of Medicine 99, 101–102.
3. Soto Hernandez, J.L., Ostrosky Zeichner, L., Tavera, G., et al. (1996) Neurocysticercosis and HIV
infection: report of two cases and review. Surgical Neurology 45, 57–61.
4. Mosowitz, L.B., Hensley, G.T., Chan, J.C., et al. (1984) The neuropathology of acquired immune defi-
ciency syndrome. Archives of Pathology and Laboratory Medicine 108, 867–872.
5. Klinker, H., Tintelnot, K., Joeres, R., et al. (1992) Taenia crassiceps infection in AIDS. Deutsche
Medizinische Wochenschrift 117, 133–138.
6. Francois, A., Favennec, L., Cambon-Michot, C., et al. (1998) Taenia crassiceps invasive cysticercosis: a
new human pathogen in acquired immunodeficiency syndrome. American Journal of Surgical
Pathology 22, 488–492.

7. Report of the quality standards subcommittee of American Academy of Neurology (1998)

Evaluation and management of intracranial mass lesions in AIDS. Neurology 50, 21–26.
8. Price, R.W. (1996) Neurological complications of HIV infection. Lancet 348, 445–452.
9. Garg, R.K. (1999) HIV infections and seizures. Postgraduate Medical Journal 75, 317–390.
10. Jinkins, J.R., Provenzale, J.M. (1997) Brain and spine imaging findings in AIDS patients. Radiology
Clinics of North America 35, 1127–1166.
11. Gordillo-Paniagua, G., Munoz-Arizpe, R., Ponsa-Molina, R., et al. (1987) Unusual complication in a
patient with renal transplantation: cerebral cysticercosis. Nephron 45, 65–67.
12. Fahr, A. (1993) Cyclosporin: clinical pharamacokinetics. Clinical Pharmacokinetics 24, 472–495.
13. Andersen, G.D. (1998) A mechanistic approach to antiepileptic drug interactions. Annals of
Pharmacotherapy 32, 554–563.
14. Mauaud, T., Battlehner, C.N., Bedrikow, C.L., et al. (1997) Case report: massive cardiopulmonary
cysticercosis in a leukemic patient. Pathology, Research and Practice (Stuttgart) 193, 527–529.
15. Das, S.K., Nityanand, S., Sood, K., et al. (1991) Japanese B encephalitis with neurocysticercosis.
Journal of the Association of the Physicians of India 39, 643–644.
16. Shanker, S.K., Rao, T.V., Mruthyunjayanna, B.P., et al. (1983) Autopsy study of brain during an epi-
demic of Japanese encephalitis in Karnataka. Indian Journal of Medical Research 78, 431–440.
17. Fang, L.Y., Lung, T.C., Kai, L. (1957) Cerebral cysticercosis as a factor aggravating Japanese
encephalitis. Chinese Medical Journal 75, 101.
18. Desai, A., Shankar, S.K., Jayakumar, P.N., et al. (1997) Co-existence of cerebral cysticercosis with
Japanese encephalitis: a prognostic modulator. Epidemiology and Infection 118, 165–171.
19. Rangel, R., Torres, B., Del Bruto, O.H. (1987) Cysticercotic encephalitis: a severe form in young
20. Mitchell, W.G. (1999) Neurocysticercosis and acquired cerebral toxoplasmosis in children. Seminars
in Pediatric Neurology 6, 267–277.
21. Walus, M.A., Young, E.J. (1990) Concomitant neurocysticercosis and brucellosis. American Journal of
Clinical Pathology 94, 790–792.
22. Kurl, R., Montella, K.R. (1994) Cysticercosis as a cause of seizure disorder in pregnancy: case report
and review of literature. American Journal of Perinatology 11, 409–411.
23. Paparone, P.W., Menghetti, R.A. (1996) Case report: neurocysticercosis in pregnancy. New Jersey
Medicine (Lawrenceville, NJ) 93, 362–367.
24. Suarez, V.R., Iannucci, T.A. (1999) Neurocysticercosis in pregnancy: a case initially diagnosed as
eclampsia. Obstetrics and Gynecology 93, 816–818.
25. Machemer, L., Lorke, D. (1978) Mutagenicity studies with praziquaentel, a new antihelminthic drug,
in mammalian systems. Archives of Toxicology 39, 187–197.
26. Herrera, L.A., Benita-Bordes, A., Sotelo, J., et al. (1999) Possible relationship between neurocysticer-
cosis and hematological malignancies. Archives of Medical Research (Mexico) 30, 154–158.
27. Herrera, L.A., Ramirez, T., Rodriguez, U., et al. (2000) Possible association between Taenia solium cys-
28. Montero, R., Flisser, A., Madrazo, I., et al. (1994) Mutation at the HPRT locus in patients with neuro-
cysticercosis treated with praziquantel. Mutation Research 305, 181–188.
29. Flisser, A., Gonzalez, D., Plancarte, A., et al. (1990) Praziquantel treatment of brain and muscle porcine
Taenia solium cysticercosis. 2. Immunological and cytogenic studies. Parasitology Research 76, 640–642.
30. Molinari, J.L., Tato, P., Reynosa, O.A. (1990) Depressive effect of a Taenia solium cysticercus factor on
cultured human lymphocytes stimulated with phytohaemagglutinin. Annals of Tropical Medicine and
31. Thussu, A., Sehgal, S., Sharma, M., et al. (1997) Comparison of cellular responses in single- and mul-
tiple-lesion neurocysticercosis. Annals of Tropical Medicine and Parasitology 91, 627–632.
32. Silver, S.A., Erozan, Y.S., Hruban, R.H. (1996) Cerebral cysticercosis mimicking malignant glioma: a
case report. Acta Cytclologica 40, 351–357.
33. Agapejev, S., Alves, A., Zanini, M.A., et al. (1992) Cystic oligodendroglioma and positivity of reac-
tions for cysticercosis: report of a case. Arquivos de Neuropsiquiatria 50, 234–238.
34. Del Brutto, O.H., Castillo, P.R., Mena, I.X., et al. (1997) Neurocysticercosis among patients of cerebral
glioma. Archives of Neurology 54, 1125–1128.
35. Del Brutto, O.H., Dolezal, M., Castillo, P.R., et al. (2000) Neurocysticercosis and oncogenesis.
Archives of Medical Research (Mexico) 31, 151–155.

30 The Pathology of Neurocysticercosis
Alfonso Escobar and Karen M. Weidenheim
Introduction tions. For instance, it is often believed that

the severity of the clinical features and
The pathological spectrum of neurocysticer- pathological reaction to cysticerci is related
cosis (NC) is as wide as the range of its clini- to the number of parasites, their location
cal manifestations. A thorough description of and age in the central nervous system. An
its pathology and morbid anatomy is impor- interpretation of the pathology of NC
tant for an understanding of the clinical involves careful consideration of all factors
expressions and natural history, and requires mentioned above. One may, however, be
a wide variety of clinical material, studied misled to believe that the clinical picture is
with several diagnostic protocols1,2. The likely to be more severe with larger number
basic approaches to the study of the pathol- of, and older age of the parasites8–11.
ogy of NC, the pathological stages of evolu- However, this is not necessarily true. It is
tion of cysticerci and the host tissue common to note incidental cerebral cysticer-
responses are discussed in this chapter. cosis in routine autopsies performed in gen-
eral hospitals in Mexico (Fig. 30.1)12. These
are those cases that have remained asymp-
The Contribution of Autopsy tomatic with specific regard to neurological
symptoms during their lifetime. In our
Necropsy has contributed immensely to our autopsy experience, cysticerci located in
knowledge of Taenia solium cysticercosis. eloquent cortical zones such as the motor
Some of the earliest insights into the disor- cortex have an equal chance of either mani-
der were based purely on autopsy, since at festing with clinical symptoms and signs,
that time sophisticated neuroradiological for instance, partial motor seizures, or
investigations were not available3–5. Pooled remaining asymptomatic13. Conversely, in a
autopsy data from general hospitals have case of fatal intracranial hypertension,
also been used as a parameter in the study autopsy may disclose hydrocephalus that
of the epidemiology of the disease, in par- has developed due to a single cyst lodged in
ticular the burden of disease in given popu- the fourth ventricle or cerebral aqueduct
lations (see Chapter 11, also)1,6,7. Moreover, (see Chapter 20). This underscores the sig-
autopsy studies have helped to clarify nificance of the location of the parasite as
issues regarding clinical behaviour and well as the nature of the host immune
variables associated with disease manifesta- response upon the clinical outcome.


290 A. Escobar and K.M. Weidenheim
Fig. 30.1. Parenchymal cysticercosis. Coronal section of the brain with multiple cysts lodged in cortical
grey and subcortical white matter and leptomeningeal space. Some of the cysts display a characteristic
larva inside the vesicle. Notice also that the parasites in the right putamen, and at the tip of third frontal
and first temporal convolution in the left hemisphere, have lost their vesicular morphology and
transformed into homogenous colloidal/granular nodular structures. This is an example of cysticerci in
different stages of resolution at one time.
Identification of the Parasite microscopic examination with a scanning

lens permits identification of rudimentary
The identification of cysticerci in brain biop- strobila and scolex formed by a rostellum
sies is crucial to the pathological diagnosis of with four suckers and 20 pairs of hooks
NC. The material sent to the pathology labo- arranged in the form of a crown (Fig. 30.3).
ratory is usually a well-preserved cyst or When the available pathological material
may consist of clumps of membranous struc- comprises membranous structures alone, his-
tures (Fig. 30.2a and b). In the former case, tological examination reveals its three-lay-
an unwary pathologist may erroneously ered structure. The external, cuticular layer
diagnose a colloid cyst instead of cysticerco- appears as a festooned syncytium covered
sis if s/he has been told that the specimen by microtriches. It is lined by glycocalyx giv-
came from the third ventricle. Microscopic ing the appearance of a homogeneous
examination, however, establishes the correct eosinophilic layer. Beneath lies the middle or
diagnosis. At the laboratory of one of the cellular layer. Here, lymphocyte-like ele-
authors in Mexico City, it is routine to open ments accumulate in single, double, or some-
any vesicular structure in order to expose the times triple rows. The innermost or reticular
larva, which may be lying within. The larva layer is most prominent and exhibits fibril-
is then separated from the membranous lary aspect with multiple excretory canaliculi
structure, placed between two glass slides, similar to capillaries (Fig. 30.4a and b). In
and pressed until it is completely flattened. addition, small, oval or round calcareous
Pressure is maintained by applying masking corpuscles may be identified within this
tape at both ends of the two slides. Light- layer. The latter represent the calcified stage

The Pathology of Neurocysticercosis 291
Fig. 30.2. (a) Vesicular stage of a cyst found in the fourth ventricle. The C-shaped larva protrudes from
the previously opened vesicular membrane. (b) Two meningeal cysticerci with hyaline change within their
vesicular membranes.
of intracorporeal vacuoles, which are some- Evolutionary Stages of Human

times present in the reticular layer during Cysticercosis: Pathological
the early, viable stages of the cysticercus (Fig. Correlates
30.4c). In order to be able to identify the
scolex, serial sections are often required. The Human NC offers the possibility of observ-
scolex appears as a more compact structure ing, in autopsy or biopsy material, the sev-
very similar to the membrane in which eral stages through which the parasites
infoldings of the spiral canal and the suckers evolve during their lifetime in the brain.
may be identified. If the hooklets are present, Four stages are described below14–18. Their
they appear as a cornified semitransparent corresponding features upon imaging stud-
structure (Fig. 30.5a). ies are reviewed in Chapter 32.

Fig. 30.3. Rostellum, suckers and crown of hooklets identify a cysticercus cellulosae. Fresh specimen
prepared according to the technique for rapid diagnosis, as described in the text (scale bar: 330 m).
Vesicular stage 30.5b), with concomitant breakdown of the

blood–brain barrier. If the location is subarach-
In the vesicular stage the metacestode has a noid, there is an exudative inflammatory reac-
thin, friable, translucent whitish membrane. tion eventually leading to meningeal fibrosis.
Inside, a round curled and invaginated larva, It is at this stage that the earliest signs of angi-
4–5 mm in length, and bathed in a transpar- itis begin to develop, usually affecting the
ent fluid, is visible (Figs 30.5a and 30.6). small pial vessels, and sometimes the medium
There is minimal, if any, surrounding inflam- to large arteries. The resulting vascular throm-
matory response. bosis and occlusion may eventually produce
distal infarction.
Colloidal stage
Granular nodular stage
The colloidal stage is characterized by degen-
erative changes in the aging parasite conse- In the granular nodular stage, there occurs
quent upon host immunological response. The retractional involution of cyst/s. Its contents
transparent fluid within the cyst is replaced by are mineralized and tend to appear granular.
jelly-like whitish material. The larva is still The larva becomes fragmented, but careful
identifiable, but it exhibits hyaline degenera- histological examination still permits identifi-
tion and early mineralization. Due to the cation of the remaining parts of the festooned
microscopic resemblance to a colloid cyst, this membrane and scolex (Fig. 30.7). Both struc-
stage has been named the ‘colloidal stage of tures are difficult to identify; however, the use
the vesicular form’ of cysticercosis. In a more of Masson’s trichrome technique may permit
advanced stage, the cyst begins to decrease in identification. With this stain, the membrane
size, its walls become thicker, and its contents appears bright red, while the scolex has a red
undergo mineralization with calcium salts, and blue tint because of collagen tissue. The
and are transformed into coarse granules. If collagen capsule around the cysts is thick,
the cyst is located in the parenchyma, granula- stains heavily blue, and is infiltrated and sur-
tion tissue appears around the lesion (Fig. rounded by a decaying inflammatory reaction.

Fig. 30.4. (a) The vesicle of a live cysticercus cellulosae displays the characteristic three-layered
structure; notice the microtriches covering the festooned surface of the cuticle (haematoxylin and eosin;
scale bar: 35 m). (b) Advanced hyaline change and disappearance of the three layers in the vesicular
membrane of a dead meningeal cysticercus. Concomitant intense inflammatory infiltrate and
multinucleated giant cells cover the surface of the membrane (haematoxylin and eosin; scale bar: 90 m).
(c) Calcareous corpuscles in the reticular layer of the vesicular membrane of a viable cysticercus
(haematoxylin and eosin; scale bar: 90 m).

Fig. 30.5. Parenchymal cysticercosis. (a) Cysticercus in the vesicular stage. The histological section
displays the spiral canal, hooklets and the well preserved vesicular membrane. (b) Parenchymal
cysticercus showing a marked inflammatory infiltrate both inside the locus and outside it in the adjacent
parenchyma. (c) Dead parenchymal cysticercus with a hyalinized vesicular membrane is completely
surrounded by an intense inflammatory exudate both inside the locus and outside it into the adjacent
parenchyma. There are multiple foci of perivascular cuffing (haematoxylin and eosin; scale bar: 225 m).

Fig. 30.6. Parenchymal cysticercosis. A live vesicular stage cysticercus appears lodged in the right
dorsomedial thalamic nucleus. The larva can be seen through the translucent vesicle. Another parasite is
partially exposed in the dorsal portion of the internal capsule on the opposite side (scale bar: 5 mm).
Fig. 30.7. Meningeal cysticercus in an advanced colloidal to granular nodular stage. A thick collagen
membrane encases the parasite and its vesicular membrane; notice the total loss of the structure of the
strobila (Masson’s trichrome technique; scale bar: 2.5 mm).

Nodular-calcified stage most severe inflammation can be found in the

vicinity of a cysticercus in the colloidal stage,
The granular material seen in the previous whilst only scattered foci of inflammatory cells
stage gets completely mineralized. The remain in the nodular-calcified stage.
nodular-calcified cysticercus is small, about However, on occasion, a dead cysticercus may
one-half to one-quarter the size of the vesicu- evoke strong inflammatory reaction in the
lar cysticercus. It is of hard consistency on adjacent brain parenchyma (Fig. 30.5c) or the
account of its collagenous capsule. When meninges. The inflammatory reaction itself is
sectioned, the exposed surface appears composed of round mononuclear lymphocytic
whitish but may also be heterogenous and of and plasma cells clumped within the collage-
yellow-brown colour. The surrounding nous strands that constitute the capsule sur-
inflammatory infiltrate is minimal or absent. rounding the cystic membrane (Fig. 30.8).
Inflammatory cells, primarily lymphocytes
and plasma cells and a variable number of
Histological Study of Host Reaction eosinophils, are also found in the perivascular
to the Cysticercus spaces in the adjacent nervous tissue. The
intensity of the tissue eosinophilic reaction is
Inflammatory reaction 9,14–16 variable and unpredictable. It occurs in most
cases but may be absent in the case of
The nature and intensity of the inflammatory parenchymal cysticercosis. Foreign body,
reaction around the cysticercus in the human multinucleated giant cells are invariably pre-
nervous system is extremely variable. The sent in the surrounding inflammatory zone
inflammatory response primarily depends (Figs 30.4b and 30.9d). These cells may be
upon the evolutionary stage of the cysticercus. identified through all successive evolutionary
Though some degree of inflammatory reaction stages of the cysticerci, including the nodular-
can be found around all stages of the cysticer- calcified stage, when the inflammatory
cus, its intensity generally declines through response in general has faded away. Giant
the successive stages of evolution. Thus, the cells are derived from macrophages.
Fig. 30.8. High power photomicrograph of the inflammatory parenchymal infiltrate and reactive
astrocytic gliosis in the acute encephalitic phase of parenchymal cysticercosis. The vesicular membrane
lies next to the parenchymal wall of the locus (haematoxylin and eosin; scale bar: 90 m).

Fig. 30.9. Basal cysticercotic meningitis. (a) Photomicrograph displaying hyalinized membranes of
cysticercus and an arterial branch with partial destruction of the lamina elastica. There is partial occlusion
of the lumen due to an atheromatoid plaque, a common finding in the vicinity of the parasites
(haematoxylin and eosin). (b) An arteriole with intense inflammatory periarteritis and endarteritis
associated with collagen proliferation (Masson’s trichrome stain; scale bar: 22 m). (c) Hyalinized
membranes of cysticercus and abundant debris adherent to the markedly fibrotic leptomeninges
(Masson’s trichrome stain). (d) Intense inflammatory infiltrate and multinucleated macrophages that
surround debris of the cysticercus membranes (Masson’s trichrome stain; scale bar: 90 m).
Vascular reaction14,19–21 Finally, the elastica of the artery splits and

breaks up. In severe cases it is common to
Significant histological reactions occur in find areas of hyaline fibrinoid necrosis15.
arteries, arterioles, and venules and these Occasionally, the vessels may be completely
have important clinical consequences, pri- necrotic in a manner akin to that seen in
marily stroke, which is discussed in detail in immunoallergic reactions. With time how-
Chapter 22. Histological aspects of cysticer- ever, the occluded vessels become recanal-
cal vasculitis are therefore of interest14,19–21. ized14,19–21. In large arteries, for example, the
Vasculitis or angiitis is a common finding. basilar artery, atheroma-like deposits appear
Vessel walls show thickening of the adventi- in the endothelium. These may partially
tia with medial fibrosis and endothelial occlude the vessel lumen (Fig. 30.9a). The
hyperplasia. In smaller arteries and arteri- above changes are invariably associated with
oles, a fibrotic reaction may completely an inflammatory cell infiltrate that may
replace the media that proliferates towards involve all three layers of the vessel wall/s
the endothelial layer in a concentric fashion (Fig. 30.9b). The intensity of inflammatory
leading to complete occlusion of the vessel response varies, and is not related to the
lumen. The adventitia also thickens some- intensity of changes in the vessel wall/s. The
times to the extent that it may be difficult to inflammatory infiltrate in the vessel walls is
recognize different layers of the vessel wall. particularly severe in cases of basal cysticer-

cotic meningitis. Venules are generally times, the astrocytic proliferation is so

spared, but in severe cases, as in the basal marked that it could be mistaken for an
cysticercotic leptomeningitis, they are also astrocytoma. Gliosis is particularly marked
affected; in such situations, their walls in fourth ventricular cysticercosis that leads
thicken, but the lumen is rarely occluded. to obstruction of cerebrospinal fluid (CSF)
Features of angiitis are usually restricted to circulation. When the cysticercus does not
vessels located in the vicinity of the para- obstruct CSF flow, gliosis is less intense and
sites. When a single cysticercus is found in appears intermingled with loose irregular
the leptomeninges or in the parenchyma, the strands of connective tissue that tend to form
vascular changes, as well as the granuloma- part of the capsule surrounding the parasite.
tous inflammatory reaction, remain localized The ependymal lining commonly displays a
emphasizing the point that the parasite usu- granular ependymitis (Fig. 30.10a and b). It
ally triggers a local vascular reaction. exhibits disruptions by proliferating
subependymal glial cells. Small clumps of
these subependymal glial cells can be seen
Tissue reaction 9,14–16,19,22,23 protruding into the ventricular cavity.
Granular ependymitis is usually restricted to
In the case of subarachnoid cysticercosis, par- the area in the vicinity of the parasite,
asites commonly lodge in the sulci on the although at times it may extend farther (Fig.
convexity of the brain, and tend to displace 30.10c)15,19. The choroid plexuses may be
the adjacent cerebral cortex. The adjacent involved by the granulomatous reaction. In
parenchymal tissue has a beehive appearance our experience, it is common to find a patho-
due to the presence of oedema. Secondary logical reaction composed of inflammatory
reactive astrocytic gliosis can usually be cells, proliferating fibroblasts and hyaline
noted around the capsule. Some rod-shaped changes in blood vessels of the choroid
hypertrophic microglial cells may be seen. A plexus in fourth ventricular cysticercosis.
variable degree of neuronal degeneration is
discernible. Uncommonly, some neurons may
be shrunken and ferruginated. A few vessels Regional Pathology
may display perivascular cuffing with
mononuclear inflammatory cells. The above Depending upon anatomical location, NC is
mentioned changes are usually well circum- classified into meningeal (subarachnoid),
scribed in the area around the parasite. ventricular, parenchymal and mixed
Tissue reactions around parenchymal cys- forms10,15,19. In our experience, meningeal
ticerci are essentially similar to those and ventricular forms predominate, but the
described above. The inflammatory reaction incidence of individual forms will vary
around parenchymal cysticerci is of variable according to the source of data.
intensity; however, it tends to be more locally
circumscribed. However, in some cases, the
host inflammatory reaction is severe in inten- Meningeal cysticercosis 4,14–16,20,25
sity, and this reaction is termed the acute
encephalitic phase of NC24. Astrocytic gliosis Three types of pathological syndromes due
may also be of variable intensity. A small rim to meningeal cysticercosis are recognized.
of demyelination may be identified in the
vicinity of the parasite. In a significant num-
Convexity-meningeal cysticercosis
ber of instances there may be no inflamma-
tory reaction around the parasite. In this condition, cysticerci are lodged in the
It is common for intraventricular cysticer- depth of sulci over the cerebral convexity. Half
cal cysts to be attached to the ependymal lin- of the autopsy-confirmed cases of cysticercosis
ing of the ventricles. Subependymal correspond to this type. Cysticerci may lie free
astrocytic glial proliferation engulfing the on the surface or float in the subarachnoid
parasite is commonly noted in such cases. At space, but are mostly firmly attached to the

Fig. 30.10. Intraventricular cysticercosis. (a) Vesicular cysticercus in the temporal horn of the right lateral
ventricle. There is granular ependymitis on the walls of the ventricle (scale bar: 5 mm). (b) The fourth
ventricle is occluded by a cysticercus in the granular-nodular stage (scale bar: 5 mm). (c)
Photomicrograph of the aqueduct blocked by the membrane of a cysticercus partially hyalinized. Note
the marked fibrosis, inflammatory infiltrate and gliosis around the parasite (Masson’s trichrome
technique; scale bar: 300 m).

leptomeninges (Fig. 30.7). The parasites may Basal racemose cysticercosis

even burrow a complete cavity into the corti- (Traubenhydatiden)1,4,15,19,25
cal grey matter. The parasites may either be in
the vesicular stage with a slight thickening of When the parasites are located at the base of
the leptomeninges or in the granular-nodular the brain, in the cisterns around the brain
stage. Occasionally a large meningeal cysticer- stem and cerebellum (Fig. 30.12a), or inside
cus may become totally surrounded by a thick the Sylvian fissure, the vesicles tend to be
collagenized capsule, which in neuroimaging multilobulated and joined together to form
studies may be wrongly interpreted as pri- conglomerates, that constitute the so-called
mary or metastatic brain tumour; precise iden- ‘racemose form of cysticercosis’. Sometimes
tification can be achieved by histological there is a large multilobulated vesicle with a
examination (Fig. 30.11a and b). single cavity. Most of the time, however, the
Fig. 30.11. Encapsulated cysticercus. (a) An ovoid structure wrongly interpreted as a brain tumour upon
magnetic resonance imaging. Gross examination of the specimen displayed coarse granular fragments
and amorphous homogenous structures. (b) Histological section of (a) shows hyaline membranes, debris
and the scolex and hooklets of the cysticercus inside a thick collagen capsule with the use of Masson’s
trichrome technique (scale bar: 30 mm).

Fig. 30.12. Basal subarachnoid-cisternal cysticercosis. (a) Racemose cysticercosis. A clump of vesicular
cysticerci lie under the base of the cerebellum at the cisterna magna. (Reproduced with permission from
reference 25.) (b) Basal cysticercotic meningitis: Close up view of the base of the brain showing marked
fibrosis of the leptomeninges over the ventral wall of the diencephalon and the brain stem, obscuring the
vascular structures and cranial nerves. It is possible to identify a few cysticerci partially buried within the
gummatous arachnoiditis. (c) Thickening of the basal leptomeninges in this coronal section at the level of
the optic chiasma extending into both sylvian fissures (white solid arrow) and a large empty vesicle on
the left. Notice also the increased thickness of the vessels trapped in the meningitis and the granular
ependymitis on the walls of the third ventricle.

racemose forms appear to be made up of foramina at the outlet of the fourth ventricle
multiple vesicles, some of them multilobu- or CSF cisternal pathways.
lated, of variable size and shapes giving the
peculiar aspect that led Virchow to name
them ‘Traubenhydatiden’5. A racemose cyst Intraventricular cysticercosis 19,26,27
does not contain a scolex. However, careful
examination of cystic contents sometimes The fourth ventricle is the most common
leads to the identification of hooklets; this location of intraventricular cysticercosis.
appears to indicate that a scolex was present More often than not, the cyst is single (Fig.
initially but underwent hydropic degenera- 30.10a). When the cysts lodge at the foramen
tion subsequently. On rare occasions a com- of Monro, the aqueduct of Sylvius or the
plete larva may be identified. fourth ventricle cavity (Fig. 30.10b and c), the
result is an obstructive symmetrical hydro-
cephalus19,26,27. Secondary syringomyelia and
Basal cysticercotic meningitis 9,14,15,19,22,25 syringobulbia28 may rarely develop as a com-
In endemic regions, the pathologist may on plication of the chronic obstructive hydro-
occasion be confronted by a specimen dis- cephalus due to fourth ventricular
playing marked thickening of the lep- cysticercosis. This is incidental to sustained
tomeninges. The appearance is one of a thick increased intraventricular pressure and to the
layer of fibrous granulomatous tissue cover- disruption of the ependymal lining with
ing the entire basal surface of the brain from marked subependymal glial proliferation.
the optochiasmatic region to the caudal por-
tion of the medulla and extending over the
sides to the dorsal mesencephalon and cere- Parenchymal cysticercosis
bellopontine angle (Fig. 30.13a and b, Fig.
30.12b and c). When examined with the Cysticerci are usually located in the grey
naked eye, no cystic parasites are seen and, matter owing to its rich blood supply.
in their absence, pathological appearances Parasites are mostly located in the cortex,
are indistinguishable from tubercular menin- though a few may be found in deep grey
gitis. Examination of multiple sections structures. It is also possible to find cysts in
through the leptomeningeal thickening may the subcortical white matter. The number of
discern cysts. Often a diagnosis of cysticercal parasites may reach several hundred, but
basal meningitis is based upon the histologi- commonly one finds only a scattered few.
cal demonstration of cysts or cystic remnants Parenchymal cysts are mostly homogenous
(Fig. 30.14a and b). A good example of the and less than 10 mm in size. They are round
latter situation is the identification of degen- or ovoid (Figs 30.1 and 30.6). The inflamma-
erative festooned membranes surrounded by tory reaction around parenchymal cysts is
granulomatous reaction with the aid of well circumscribed and less intense in com-
Masson’s trichrome technique (Fig. 30.9c and parison to leptomeningeal cysticerci.
d). Vascular reactions of angiitis including However, in the acute encephalitic type of
endarteritis and periarteritis, endothelial NC, the host immune response is intense,
proliferation, and hyaline and fibrinoid leading to diffuse inflammatory reaction and
necrosis are usually conspicuous in cysticer- oedema16,24,29.
cotic basal meningitis (Fig. 30.9a and b).
Cranial nerves also become encased in the
leptomeningeal fibrosis and display intersti- Mixed forms
tial and perineural inflammation. The under-
lying parenchyma shows marginal gliosis, Most often, there occurs a combination of the
inflammatory infiltrates, perivascular cuffing different types of cysticerci. In our pathologi-
and multiple ischaemic infarcts. Finally, cal material, we commonly encounter a com-
basal cysticercotic meningitis may lead to bination of meningeal and ventricular forms.
ventricular dilation due to obstruction of the However, any combination is possible.

Fig. 30.13. Basal cysticercotic meningitis. (a) Axial section of lower brain stem showing intense thickening
of the leptomeninges over the ventral surface of the upper medulla. The fourth ventricle appears enlarged
due to blockage of the draining foramina and there is granular ependymitis. (b) Two axial sections of the
midbrain. There are fibrotic leptomeninges and occlusion of the aqueduct. The latter was due to a
cysticercus identified on histological examination (see Fig. 30.10). The substantia nigra appears pale.
Conclusions pathological features is important for

pathologists in both endemic and non-
The pathological spectrum of NC is as endemic areas, keeping in mind the
wide as its clinical spectrum. A good increasing recognition given to NC in
knowledge of usual as well as uncommon developed countries.

Fig. 30.14. Basal cysticercotic meningitis. Macrophotographs of histological slides of sections (a)
through the middle pons, and (b) upper medullary level. The hyalinized membranes of cysticerci are
encased by the fibrotic leptomeninges. There is also granular ependymitis (Masson’s trichrome
technique; scale bar: 2 mm).
References
1. Aluja, A., Escobar, A., Escobedo, F., et al. (1987) Cisticercosis. Una recopilación actualizada de los
conocimientos básicos para el manejo y control de la cisticercosis causada por Taenia solium. Fondo de
Cultura Económica, México DF, México, pp. 115.
2. Richards, F.O., Schantz, P.M., Ruiz-Tiben, E., et al. (1985) Cysticercosis in Los Angeles County.

4. Henneberg, R. (1936) Die tierischen Parasiten des Zentralnervensystems. In: Bumke, O., Foerster, O.
(eds) Handbuch der Neurologie, Vol. 14. Springer Bd, Berlin, pp. 286–322.
5. Virchow, R. (1860) Traubenhydatiden der weichen Hirnhaut. Archiv für pathologische Anatomie und
Physiologie und für klinische Medizin pp. 528 – 536.
6. Zenteno-Alanís, G.H. (1965) Diagnósticos neuroquirúrgicos en 2000 pacientes estudiados en la
unidad de neurología y neurocirugía del hospital general de la ciudad de México. Revista Médica de
Hospital General (México) 28, 515–528.
7. Villagrán-Uribe, J., Olvera-Rabiela, J.E. (1988) Cisticercosis humana. Estudio clínico y patológico de
481 casos de autopsia. Patología (México) 26, 149–156.
8. Costero, I. (1946) Tratado de Anatomía Patológica, Vol. 2. Atlante, México, pp. 1485–1495.
9. Escobar, A. (1952–53) Cisticercosis cerebral con el estudio de 20 casos. Archivos Mexicanos de
Neurología y Psiquiatría 1, 145–167.
10. Fuentes, M. (1948) Formas anatomoclínicas de la cisticercosis cerebral. Gaceta Médica de México 78,
155–173.
11. Pitella, J.E.H. (1997) Neurocysticercosis. Brain Pathology 7, 681–693.
12. Shenone, H., Villarroel, F., Rojas, A. (1982) Epidemiology of human cysticercosis in Latin America.
In: Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and
1025–1040.
14. Escobar, A. (1991) Pathology of neurocysticercosis. Neuropathology (Japan) (Suppl. 4), 348–351.
15. Escobar, A. (1983) The pathology of neurocysticercosis. In: Palacios, E., Rodríguez-Carbajal, J.,
Taveras, J.M. (eds) Cysticercosis of the Central Nervous System. Charles Thomas, Springfield, Illinois,
pp. 27–54.
16. Silva, P., Escobar, A. (1996) Cysticercosis, other parasites and tuberculosis. American Society of
Neuroradiology, Core Curriculum in Neuroradiology. Part II. Neoplasms and Infectious Diseases,
pp. 193–200.
17. Zee, C.S., Destian, S., Colletti, P., et al. (1990) Gadolinium enhanced MR imaging in neurocysticerco-
sis. Radiology 177, 232.
19. Escobar, A., Nieto, D. (1972) Parasitic disease. In: Minckler, J. (ed) Pathology of the Nervous System,
Vol. 3. McGraw-Hill, New York, pp. 2507–2515.
20. Redalie, L. (1921) Deux cas de cysticercose cérébrospinale avec méningite chronique et endartérite
oblitérante cérébrale. Revue Neurologique (Paris) 28, 241–266.
21. Rodríguez-Carbajal, J., Del Bruto, O.H., Penagos, P., et al. (1989) Occlusion of the middle cerebral
22. Escobar, A. (1960) Cisticercosis cerebral. Acta Politécnica (México) 2, 275–284.
23. Escobar, A. (1978) Cerebral cysticercosis. New England Journal of Medicine 298, 403–404.
24. Rodríguez-Carbajal, J., Salgado, P., Gutiérrez-Alvarado, R., et al. (1983) The acute encephalitic phase
of neurocysticercosis: computed tomographic manifestations. American Journal of Neuroradiology 4,
51–55.
25. Escobar, A. (2000) Enfermedades parasitarias. Infecciones por metazoarios. In: Cruz-Sánchez, F.F.
(ed.) Neuropathologia: Diagnóstica y Clínica. Editores Médicos SA, Madrid, Spain, pp. 315–337.
26. Nieto, D. (1956) Cysticercosis of the nervous system. Diagnosis by means of the spinal fluid comple-
ment fixation test. Neurology 6, 725–737.
27. Escobar, A., Vega, R., Herrera, M.P., et al. (1998) Neurocisticercosis de localización en el cuarto ven-
trículo. Gaceta Médica de México 134, 359–361.
28. Escobar, A., Vega, J.G. (1981) Syringomyelia and syringobulbia secondary to arachnoiditis and
fourth ventricle blockage due to cysticercosis. Acta Neuropathologica (Berlin) (Suppl. 7), 389–391.
29. Salgado, P., Rojas, R., Sotelo, J. (1997) Cysticercosis. Clinical classification based on imaging studies.
Archives of Internal Medicine 157, 1991–1997.

31 Single Small Enhancing Computed

Tomography Lesions – Pathological
Correlates
Geeta Chacko
Introduction fast and birefringent hooklets. The cyst has

three distinct layers: an outer cuticular layer,
The aetiology of single small enhancing middle or cellular layer and an inner or retic-
computed tomography lesions (SSECTLs) ular layer. The inner or reticular layer has a
in patients presenting with seizures loose stroma containing fluid-filled spaces,
remained controversial despite several thin-walled vacuoles, excretory canaliculi
radiological and immunological tests and calcareous corpuscles. These calcified
(reviewed by Rajshekhar in Chapter 24). concretions or calcareous corpuscles proba-
The issue was resolved with the biopsy evi- bly represent calcification of the intracorpo-
dence that the majority of these lesions are real vacuoles (see Escobar and Weidenheim,
caused by cysticercus1–4. Chapter 30). Four stages are recognized in
Before considering the pathological cor- the development and regression of cysticer-
relates of SSECTL, it is recommended that cus in the central nervous system, namely
the reader should review the morphological the vesicular, colloidal, granular–nodular
appearance and stages of development and and fibrocalcified stages. These are reviewed
regression of a cysticercus given in the pre- in detail in the previous chapter.
vious chapter (Escobar and Weidenheim,
Chapter 30).
SSECTL: Pathology
Morphology and Evolution of Cysticercus cellulosae is the form of cysticer-

Cysticercus cus observed in SSECTLs. As these lesions
are by definition less than 2 cm in diameter,
Briefly, cysticerci are round or oval milky the racemose form, which is larger (4–12
white cysts of varied size, usually in the cm), is not encountered. The macroscopic
range of 5–15 mm, with a translucent wall. appearance of an SSECTL could vary from
Each cyst is filled with clear fluid and con- the typical thin-walled cyst to a well-circum-
tains a pearly-white, invaginated scolex (pro- scribed firm nodule. On microscopic exami-
toscolex). The protoscolex is attached to the nation however, the cavitary nature of the
cyst by means of a neck and has a spiral lesion is apparent accounting for the typical
canal, four large suckers and a rostellum radiological appearance of a ring-enhancing
with a double row of large and small acid- lesion. A minority of cases appear as hyalin-


308 G. Chacko
ized nodules (nodular or fibro-calcified In cases of SSECTL, where the parasite is

stage). The wall of the cavity is typically not detected at biopsy further steps need to
lined by palisaded epithelioid histiocytes, be taken to arrive at a final diagnosis6:
surrounded by dense infiltrates of inflam-
1. Ensure that all the tissue submitted has
matory cells, chiefly, lymphocytes, plasma
been processed.
cells and eosinophils. Neutrophil poly-
2. Sections at multiple levels to look for the
morphs and multinucleated giant cells may
parasite.
also be present. The severity of the inflam-
3. Special stains for fungal elements and
matory reaction is highly variable. The
Mycobacterium tuberculosis.
adjoining cerebral parenchyma is often gli-
otic with perivascular chronic inflammation
and variable amounts of fibrosis. Histological Differential Diagnosis
Chacko et al.5 noted viable (cystic or vesic-
ular stage) or degenerate (colloidal or granu- The histological differential diagnosis in the
lar stage) forms of the cysticercus in about absence of the cysticercus includes parasitic
50% of the cases of SSECTLs. When viable, granuloma of unestablished aetiology, tubercu-
although the morphology of the parasite is loma, fungal granuloma and microabscess6. The
well discerned, one often encounters only salient features of each of these are as follows.
parts of the parasite. The degenerate form is
seen as an eosinophilic structure in which
parts of the scolex and bladder are identifi- Parasitic granuloma
able in various stages of degeneration (Fig.
31.1). The calcareous corpuscles or calcified The dominant features are a cavitary lesion
intracorporeal vacuoles described in the with an inner lining of palisaded histiocytes
reticular layer of cysticercus cellulosae stand and the presence of eosinophils in the
out prominently in the degenerate forms and inflammatory infiltrate. Furthermore, there
may on occasion be the sole parasitic rem- should be no caseous necrosis, acid-fast
nant seen in a biopsy (Fig. 31.2)5. bacilli or fungal elements.
Fig. 31.1. Degenerated cysticercus outlined by calcified intracorporeal vacuoles (haematoxylin and
eosin; 200).

Single Small Enhancing CT Lesions 309
Fig. 31.2. Calcified bodies in amorphous debris without any typical cysticercus parts (haematoxylin
and eosin; 200).
Tuberculoma and a wall composed of non-specific inflam-

matory granulation tissue. However,
Pathologically, a caseating granuloma com- microabscesses, in the clinical and radiolog-
posed of epithelioid histiocytes, lymphocytes ical setting of a typical SSECTL, with nega-
and Langhans’ multi-nucleated giant cells is tive cultures, and no extracranial focus of
noted. Acid-fast bacilli may be identified infection may represent acute degeneration
with the Ziehl-Neelsen stain. of the parasite6.
Fungal granuloma
Conclusions
A granuloma containing multinucleated
In conclusion, an SSECTL may be seen at
giant cells, lymphocytes and plasma cells is
any stage in the natural evolution of
visible. Fungal elements can be demon-
Cysticercus cellulosae. At one end of the
strated with special stains.
spectrum the entire parasite might be identi-
fied while at the other end calcareous
Microabscess residues might be the only evidence of a cys-
ticercal aetiology of the granuloma. The vast
This is a non-granulomatous cavitary lesion majority are seen as cavitary lesions while a
with inflammatory exudate in the cavity minority shows a fibrous cicatrix.
References
1. Rajshekhar, V. (1991) Etiology and management of single small enhancing CT lesions in patients
with seizures: understanding a controversy. Acta Neurologica Scandinavica 84, 465–470.
2. Chandy, M.J., Rajshekhar, V., Ghosh, S., et al. (1991) Single, small, enhancing CT lesions in Indian

310 G. Chacko
3. Rajshekhar, V., Haran, R.P., Prakash, S.G., et al. (1993) Differentiating solitary small cysticercus gran-
ulomas and tuberculomas in patients with epilepsy: clinical and computerized tomographic criteria.
4. Rajshekhar, V., Chacko, G., Haran, R.P., et al. (1995) Clinicoradiological and pathological correlations
in patients with solitary cysticercus granuloma and epilepsy: focus on presence of parasite and
edema formation. Journal of Neurology, Neurosurgery and Psychiatry 59, 284–286.
5. Chacko, G., Rajshekhar, V., Chandy, M.J., et al. (2000) The calcified intracorporeal vacuole: an aid to
the pathological diagnosis of solitary cerebral cysticercus granulomas. Journal of Neurology,
6. Chacko, G. (2000) Pathogenesis and pathology of neurocysticercosis. In: Rajshekhar, V., Chandy, M.J.
(eds) Solitary Cysticercus Granuloma – the Disappearing Lesion. Orient Longman, Chennai, India,
pp. 96–111.

32 Imaging and Spectroscopy of

Neurocysticercosis
Deepshikha Sharda, Sanjeev Chawla and Rakesh K. Gupta
Introduction cus in the CNS are recognized1,5.These form

the basis of the understanding of imaging
Neurocysticercosis (NC) can be classified into findings in NC (see Chapter 30).
cranial (parenchymal, ventricular, subarach- 1. Cystic or vesicular stage: The cyst is viable
noid-cisternal), spinal and mixed, depending and has a well-defined, fluid-filled mem-
upon the site of involvement. Parenchymal brane, which unlike the hydatid cyst con-
NC is characterized by one or several tains only one scolex. It is surrounded by a
rounded or oval cyst/s measuring from 5 discrete fibrillary astrocytosis.
mm to 15 mm in diameter, with a thin, 2. Colloid stage: This is the earliest stage in
translucent, membranous wall1. Each cyst is the involution of the cyst. The fluid contents
filled with clear fluid and contains a pearly of the cyst become more turbid and the
white invaginated scolex2. Larger cysts, 2–4 scolex begins to degenerate.
cm in diameter, are rare2. Racemose forms of 3. Necrotic, granular stage: This stage is char-
cysticercosis are less frequent. Racemose acterized by parasite necrosis and surround-
cysts are 4–12 cm and are devoid of a scolex. ing inflammation. The cyst gives an
The coexistence of cellulose and racemose appearance of an eosinophilic structure in
forms of cysticercosis is observed in about which the bladder and scolex are in various
10% cases1. The number and location of para- stages of disintegration. The adjacent neural
sites vary widely. Solitary cysticerci are found tissue shows moderate to intense fibrillary
in 2–53% of the cases3. When multiple, the astrocytosis. Oedema and/or necrosis of the
cysticerci are usually few in number; the surrounding neural tissue may be present in
finding of hundreds of parasites, characteriz- some cases.
ing the disseminated form, is rare4. 4. Fibro-calcified nodule: With time, fibrosis
Neurocysticercosis is a disorder with a develops, progressively occupying the entire
prolonged and variable course. Not infre- lesion. This stage can be macroscopically
quently, it may remain asymptomatic, being recognized as a nodule of a smaller size than
detected only upon imaging or autopsy. the bladder in the preceding stage, with a
Cysts may remain viable in the central ner- whitish, white-greyish or greyish central
vous system (CNS) for several years (usually area surrounded by a thin capsule of greyish
1–3 years), depending on the host immune or somewhat whitish colour, corresponding
tolerance. Morphologically, four stages of to the necrotic cysticercus and fibrosis,
development and regression of the cysticer- respectively. A residual cellular infiltrate

312 D. Sharda et al.
may be seen in some instances. The fibrous views7. The small (2–3 mm) rounded shape
nodule frequently calcifies, as seen in of cerebral cysticercosis is distinguishable
57–64% of cases on computed tomography from the larger oat-shaped calcification in
(CT)3,6. Calcification as noted upon CT may muscle (Fig. 32.1b). Cyst calcification is less
represent partial dystrophic calcification of a frequent in the neuraxis than in muscle.
necrotic larva or the calcareous corpuscles1,2. Also, NC frequently coexists with muscle
Dystrophic calcification is a long process cysticercosis. Therefore, in the past, soft-tis-
and may take from 2 to 10 years to be sue radiography would often establish a
detected on roentgenographs. diagnosis of cysticercosis when skull
roentgenograms were normal8.
When multiple, lesions are often at differ-
ent stages of their development, a phenome-
non that could reflect different infectious
Cranial Conventional Angiography
episodes. The sequence of events for any sin-
gle lesion is from an innocuous cyst to gran-
In the pre-cross-sectional imaging era, con-
uloma and then to a calcified nodule.
ventional angiography was used to demon-
However, a cysticercus may move from one
strate mass effect. Displacement of the
stage to another stage by skipping the regu-
vessels and early venous drainage due to
lar sequences of stages or may disappear
soft-tissue masses produced by live
completely with or without undergoing any parenchymal larvae have been described
sequence of degeneration. This may take (Fig. 32.2)9. Angiography is also useful in
several years in untreated lesions and several demonstrating vasculitis in association with
months for treated lesions. meningeal racemose cysticercosis. Findings
range from mild arterial narrowing to com-
plete occlusion along with distortion of
Plain Skull Roentgenograms carotid and/or vertebral arteries (see
Chapter 22)10. Abnormalities are most severe
Parenchymal lesions are characterized by in the immediate vicinity of racemose cysts.
either mass effect or intracranial calcifica- On occasion, an angiogram may reveal an
tion. Signs of raised intracranial tension inflammatory aneurysm in the vicinity of a
such as sutural diastasis, enlargement of racemose cyst11. In the present-day context,
sella turcica and erosion of anterior and however, conventional angiography is rarely
posterior clinoid processes may be seen required and has been replaced by CT and
upon skull roentgenograms. Calcification is magnetic resonance imaging (MRI).
representative of dead larva(e). However,
the presence of calcification does not
exclude the presence of live larvae; active Negative and Positive Contrast
cysts have been demonstrated concomi- Ventriculography
tantly with calcified lesions. Typically, the
calcified cysticercus gives the appearance of Negative contrast (air) studies are haz-
slightly off-centre spherical calcification of ardous and of historical importance only.
1–2 mm in diameter representing the dead One finds ample illustrations of hydro-
scolex. It may be surrounded by a 7–12 mm, cephalus, asymmetry of the lateral ventri-
partially or totally calcified sphere repre- cles and atrophy of the brain parenchyma
senting the body of the cystic larva (Fig. as well as large ventricular cysts in older
32.1a)7. Old shrunken (5–7 mm) cysts may literature (Fig. 32.3a)7,12. Positive contrast
lose their spherical shape, yet maintain a cisternography and ventriculography with
recognizable morphology. One often finds the aid of intraventricular metrizamide out-
that innumerable calcified cysts are distrib- lines cisternal and ventricular cysts (Fig.
uted in the brain in a pattern perfectly com- 32.3b). Ependymitis and ventricular
patible with the proportion of blood supply synechiae may be visualized as septate
as judged on stereoscopic frontal and lateral ventricular loculations7.

Imaging and Spectroscopy of Neurocysticercosis 313
(a) (b)
Fig. 32.1. (a) Calcified intracranial cysticercosis.

Lateral view of skull radiograph showing
innumerable calcified cysts scattered in the brain.
Few of them (arrows) show an off-centre spherical
calcification of 1–2 mm representing the scolex.
(b) Calcified cysticercosis of the skeletal muscles.
Radiograph of the lower limb showing multiple
oblong calcified densities along the plane of the
muscle fibres.
Computed Tomography Vesicular stage (living larvae)
Parenchymal neurocysticercosis On non-contrast CT, vesicular cysticercus

gives an appearance of a round cyst of
Computed tomography is useful in studying 5–20 mm size, with density similar or
the natural course of disease, identifying evo- slightly higher (10–20 HU) than cere-
lutionary stages of cysticercosis with an brospinal fluid (CSF) (0–10 HU) (HU =
intention of determining therapeutic strategy Hounsfield unit). A 2–4 mm, mural nodule
and prognosis as well as monitoring response representing its scolex may be
to anticysticercal drugs. Machado et al. stud- identified14,15. The latter is partially or com-
ied the profile of evolution of NC based on pletely calcified and placed eccentrically
CT13. Cysts were intact in consecutive CT within the cyst (Fig. 32.4a and b). The
scans up to 11 months and exhibited signs of blood–brain barrier remains intact during
degeneration by about 18 months after prazi- this stage. Therefore, as a rule, the cyst wall
quantel drug therapy. Nodular calcifications and scolex do not enhance following
appeared by about 25 months. Therefore, the administration of contrast. Cysticercus cysts
entire life history of a cyst discovered in the in the vesicular stage need to be differenti-
brain upon CT spanned at least 36 months. ated from arachnoid cysts, porencephalic

Fig. 32.2. Conventional cranial angiogram (lateral view). The mass effect on the distal branches of the
middle cerebral artery secondary to the cluster of intraparenchymal cysts in the left parietal region is noted.
Fig. 32.3. (a) Air-contrast study demonstrating dilatation of the right lateral ventricle owing to obstruction
of the right foramen of Monro. The obstructing cyst is not clearly made out. (b) Metrizamide
ventriculogram followed by introduction of air through lumbar puncture demonstrating the dilated lateral
ventricles and the outline of a cyst within.
cysts and cystic astrocytoma14. Vesicular multiple cysticercosis, other lesions at dif-
cysticercus does not produce symptoms; ferent stages of evolution may be seen; the
when single it is detected as an incidental latter are responsible for bringing the
finding upon imaging studies. In the case of patient to attendance.

Fig. 32.4. Vesicular (a) and calcified (b) stage of neurocysticercosis. Non-contrast computed tomography
scan at supraventricular level showing multiple cysts each with an eccentrically placed nodule
representing the scolex (a). The cysticerci are not surrounded by oedema. Calcified cysticerci can be
made out in addition to the vesicular cysticerci (b).
Colloidal stage (degenerating larvae) ment may simulate metastasis. In the

absence of demonstration of scolex, imaging
Contrast-enhanced (CE) CT reveals a cystic
features are non-specific. Similar findings
lesion with enhancing walls surrounded by
may be seen in tubercular, sarcoid and fun-
irregular hypodensity representing perile-
gal granulomas, metastasis, multiple sclero-
sional oedema. In the early stages of the
sis, glioblastoma multiforme and other
degeneration, an eccentrically placed scolex
neoplastic lesions.
may be seen.
Nodular-calcified stage
Granular–nodular stage
Non-contrast CT reveals an isodense cyst This stage is represented by a small
with a hyperdense-calcified scolex and sur- (7–11 mm), round, punctate or oval, high-
rounding oedema. The walls of the granu- attenuation areas (80–360 HU)14–16. Rarely cal-
loma may be hyperdense because of calcium cifications may be reasonably large. Calcified
deposition16. Granulomas are of variable granulomas are not associated with mass
sizes, but even if quite small, they usually effect and do not enhance after contrast
have a definite ring or disc pattern of con- administration. However, perifocal oedema
trast enhancement around a low-density cen- may be present, particularly if CT is under-
tre (Fig. 32.5a and b). The ring is of variable taken within 24–72 hours of a seizure (Fig.
thickness, but usually thicker than that in 32.6a–c)14. Calcified cysticerci may be single or
pyogenic abscess17. The evolutionary stages multiple. They are usually located within the
form a continuous spectrum. Hence, the cyst grey matter or at grey–white matter junctions.
wall and scolex may be identifiable even Rarely, they may be seen in basal ganglia and
during the granular–nodular stage. Multiple deep white matter. The differential diagnosis
homogeneously hypodense nodules with of multiple, dispersed calcifications includes
surrounding oedema and contrast enhance- toxoplasmosis and tuberous sclerosis14.

Fig. 32.5. Granulomatous stage of neurocysticercosis. Non-contrast computed tomography (a) at

supraventricular level showing a hypodense lesion. Contrast-enhanced computed tomography (b) at
same level revealing a ring-enhancing lesion with surrounding oedema.
Acute encephalitic parenchymal Monro, aqueduct or fourth ventricle may

cysticercosis result in focal or asymmetrical dilatation of
the ventricular system. A cyst may also
This serious and occasionally fatal condition
cause displacement of the choroid plexus.
is characterized by non-calcified high-den-
Ventricular obstruction and hydrocephalus
sity nodules that enhance upon CECT9,18,19.
may be intermittent since the cyst is freely
Cysts may be multiple or diffuse (85%) or,
movable. The possibility of relocation of an
less commonly, localized12. Lesions vary in
intraventricular cyst between initial imag-
sizes and are located in the cerebral cortex;
ing and surgery should be kept in mind and
but may also be seen in the white matter and
imaging should be repeated immediately
basal ganglia. They are associated with florid
before planned surgery.
oedema, which, in the absence of contrast,
Positive contrast (metrizamide) CT ven-
appears as a diffuse, low-density area with
triculography is useful in demonstrating
irregular contour. The description of throt-
intraventricular cysts (Fig. 32.7a and b).
tled ventricles with or without high attenuat-
ing sago-grain lesions is typical20. The Delayed CT scans may divulge fluid levels
encephalitic phase lasts from 2 to 6 months, within the cysts because of diffusion of
with oedema persisting for some time after metrizamide across the cyst wall17,21.
resolution of pathological enhancement13. Intraventricular cysts can be confused
CT may detect small calcifications as early as with intraventricular tumours such as col-
8 months after the acute phase19. loid cyst, ependymal cyst, choroid plexus
cyst and intraventricular epidermoid10.
Intraventricular cysticercosis
Subarachnoid-racemose cysticercosis
Intraventricular cysticercosis may not be
identified upon CT because of a thin wall, Visualization of subarachnoid-racemose
approximate CSF-equivalent content and cysts on CT scan depends upon their size
lack of contrast enhancement. Therefore, and location. Cysts have a density identi-
evidence for intraventricular cysticercosis is cal to the CSF. Furthermore, cyst walls are
often indirect. For instance, an expanding too thin to be identified. Therefore, their
cyst or obstruction of the foramen of recognition depends upon deformity of

Fig. 32.6. Calcified stage of neurocysticercosis. Non-contrast computed tomography (a) and T2-
weighted axial magnetic resonance imaging (b) showing a calcified lesion. One year later, after the
patient had a seizure, a post-gadolinium T1-weighted image revealed a ring-like enhancement and
surrounding oedema (c).
the normal configuration of cisterns. and conform to the shape of the cisterns in
Relatively large cysts are required to which they lie. Despite this, chronic pres-
deform the quadrigeminal, cerebellopon- sure effects with bone remodelling may be
tine and suprasellar cisterns. Smaller cysts noted. CECT scan may show lep-
are readily detected in the Sylvian fissure tomeningial enhancement in the basal cis-
and cortical sulci. Cysts are usually pliable terns around cysts or more diffusely. The

(a) (b)
Fig. 32.7. Intraventricular neurocysticercosis. T1-weighted magnetic resonance imaging (a) showing
asymmetric dilatation of the lateral ventricles with no discernable intraventricular lesion. Metrizamide
computed tomography ventriculography (b) clearly depicting two intraventricular cysticerci. (Source:
Svetlana Agapejev, São Paulo, Brazil.)
ensuing fibrosis may obliterate portions of Early pre-vesicular stage

cisterns. If more diffuse, meningeal fibrosis
At a very early stage, soon after invading the
leads to communicating hydocephalus.
brain parenchyma, the embryo is non-cystic;
When cysticercal meningitis causes vasculi-
MRI does not show any abnormality. During
tis, CT manifestations include luxury perfu-
its initial development into a larva, focal
sion and/or infarction, typically in the
non-enhancing areas of oedema may be seen,
vicinity of racemose cysts (Fig. 32.8a and b).
that may progress to a small homogeneously
Positive contrast CT cisternography is use-
enhancing lesion in a few months28,30. These
ful in outlining subarachnoid-racemose
abnormalities are incidental to the immature
cysts. Intrathecal metrizamide (4–5 ml at a
blood–brain barrier during this stage.
maximal concentration of 250 mg ml1)
opacifies the basal cisterns, permitting
demonstration of subarachnoid cysts20. Vesicular stage
After 3–12 months, the cysticercus is fully-
grown with a bladder containing clear fluid.
Magnetic Resonance Imaging This is the vesicular stage, which gives an
appearance of a round cyst with a mural nod-
Parenchymal neurocysticercosis ule representing the scolex23–29. The cyst is
hyperintense on T2-weighted images and
Magnetic resonance imaging is superior to hypointense on proton density (PD)- and T1-
CT for the study of parenchymal NC. It may weighted images, whilst the scolex is seen as
reveal multiple cysticerci in individuals an eccentrically placed nodule, hypointense on
with normal appearing CT22. MRI findings T2-weighted images and hyperintense on PD-
of parenchymal cysticercosis are protean, and T1-weighted images (Fig. 32.9a). There is
due to the various evolutionary stages of no perifocal oedema. Post-contrast study does
the cysts23–29. not reveal enhancement (Fig. 32.9b)30.

Fig. 32.8. Racemose cysticercosis with cerebrovascular manifestations. Contrast-enhanced computed

tomography (a) and corresponding post mortem pathological study (b) depicting multiple racemose cysts
(arrows) in the right Sylvian cistern, left cistern and the interhemispheric fissure and area of infarction
(Inf). (Source: Svetlana Agapejev, São Paulo, Brazil.)
Fig. 32.9. Vesicular neurocysticercosis. T1-weighted axial (a) and post-gadolinium T1-weighted coronal
magnetic resonance imaging (b) showing the clear cystic contents, the eccentric scolex and the lack of
enhancement or surrounding oedema. (Source: Eric Kossof, Baltimore, USA.)

Colloidal stage hypointense on T2-weighted images.

Hypointensity in T2-weighted images could
As the larva begins to degenerate, cystic
be incidental to fibrosis or calcification.
fluid becomes turbid, the surrounding cap-
Demonstration of susceptibility on T2* imag-
sule thickens and an intense inflammatory
ing can differentiate calcified from non-min-
cell response appears around the cyst. The eralized, fibrosed larvae.
increased signal intensity of cystic fluid,
thickening of cyst wall, surrounding
oedema and contrast enhancement are evi-
Intraventricular cysticercosis
dent upon MRI (Fig. 32.10a, b and d)23–30.
The signal intensity of cystic fluid is higher
Magnetic resonance imaging permits visual-
than that of CSF on T1- and PD-weighted
ization of scolex, rim of the cyst wall and
images owing to a higher protein content.
subependymal tissue reaction. The different
At times the cystic fluid may appear bright
intensities between cystic contents and CSF
on T1 images31,32. On T2-weighted images,
are readily appreciable on MRI28,34. Cyst
the cystic fluid and surrounding oedema
contents are hyperintense, relative to CSF on
appear hyperintense, whereas the cyst wall
and the scolex appear isointense or T1- and PD-weighted images due to higher
hypointense relative to brain parenchyma. protein content and cellular debris35. In the
Contrast enhancement is usually ring healing stages, the cyst wall may be adher-
shaped. A fluid level may be seen within the ent to the ventricular wall, with ensuing
cyst32. During or early after institution of ependymal and subependymal inflamma-
anticysticercal treatment, degenerative tion that is reflected by subependymal rim
changes are accelerated, which is reflected of high intensity on PD- and T2-weighted
by an increase in surrounding oedema, images28,35. In general, T1- and PD-weighted
increased intensity of cystic fluid on T1- and images are better than T2-weighted images
PD-weighted images and more marked con- because the high signal intensity of cystic
trast enhancement28,33. fluid is indistinguishable from CSF and
subependymal oedema on T2-weighted
images. Sagittal T1 sections are particularly
Nodular–granular stage useful for evaluation of aqueductal stenosis
In this stage, the larva retracts and its fluid that may occur as a result of fibrotic adhe-
content is absorbed. Its inflammatory cap- sions secondary to ependymal inflamma-
sule becomes thick and collagenous. The tion. It is also useful for differentiating
lesion appears isointense to the normal fourth ventricular cysticercosis from a
brain parenchyma on T1-weighted images dilated fourth ventricle. However, the two
and isointense to hypointense with or with- conditions may be indistinguishable on con-
out a central hyperintense signal on T2- ventional MRI at times28.
weighted images (Fig. 32.11a–c). On
contrast-enhanced T1-weighted images, it
appears as a homogeneously enhancing or Subarachnoid racemose cysticercosis
ring-shaped enhancing nodule with or with-
out surrounding oedema. These appear- Cisternal cysticercosis is readily identifiable
ances are in common with tuberculoma, on MRI as multiple cystic masses within
basal cisterns28. Racemose cysts may be
other granulomatous conditions, small
large and lobulated causing compression of
abscess and metastatic tumours23–29. adjacent structures. The signal intensity of
cyst contents usually parallels that of CSF
Nodular-calcified stage on all MRI pulse sequences. The cyst walls
may be seen as septum-like curved lines on
The shrunken mineralized larva appears T1-weighted images but are usually masked
iso–hypointense on T1-weighted images and by high intensity of CSF on T2-weighted

Fig. 32.10. T2-weighted axial image (a) at the level of midbrain shows multiple hyperintense areas
bilaterally with perifocal oedema in some. T1-weighted image (b) shows hypointense nature of these
lesions. On magnetization transfer-T1-weighted image (c), peripheral hyperintensity is seen in some of
the lesions. Post-contrast T1-weighted image (d) shows ring-enhancement of the lesions in the left frontal
and right occipital region.

Fig. 32.11. T2 hypointense cysticerci. T2-weighted

axial image (a) through the level of midbrain/pons
shows evidence of T2 hypointense areas in the
cerebellar hemispheres, bilateral temporal lobes
and in the left crus cerebri. A hyperintense lesion
is also seen in the right temporal lobe. On
magnetization-transfer T1-weighted image
(b) visualization of these lesions is difficult and
the magnetization-transfer ratio from the T2
hypointense areas was more than 35%. Only T2
hyperintense areas are seen on T1-weighted
image (c) and rest of the lesions are isointense
and not visible.
images28. The scolex cannot be seen as it Chronic granulomatous meningitis and

has already degenerated in racemose cysts. fibrosis in the basal cisterns may result in
There is no appreciable enhancement of the communicating hydrocephalus. Contrast-
cyst wall after contrast administration. The enhanced MRI may reveal various degrees of
visualization of a large multilobulated leptomeningeal enhancement in the basal
cyst(s), lacking a mural nodule in specific cisterns. Proliferative endarteritis either due
cisternal location with surrounding lep- to basal exudates or due to the presence of a
tomeningeal enhancement strongly points cyst close to the vessel wall may cause lacu-
towards a diagnosis of racemose cysticerco- nar infarction or, rarely, infarction in the ter-
sis, especially in endemic areas. ritory of a major artery36.

Table 32.1. Correlation of histopathological and computed tomography (CT) and magnetic resonance imaging (MRI) features of various stages of neurocysticercosis.
Singh - Chap 32
MRI
Pathological Proton Post-

Stage characteristics NCCT CECT T1 T2 density contrast Scolex Oedema
4/9/02
Prevesicular Initially solid, Normal Normal / ? Isointense / Isointense – May Not seen No
later cystic hyperdense hypointense enhance
developing specs very early
larva
4:45 pm
Vesicular Cystic with Isodense / ? Usually no Hypointense Hyperintense Hypointense Non-enhancing Present Usually not,
fluid-filled hypodense contrast except in
thin enhancement early
membrane, except in degenerating
single scolex, early stages stage
no inflammatory of degeneration
Page 323
response ( 3 months)
Colloidal Cystic with Hypodense, Ring or disc Intensity Hyperintense Intensity Enhances after May be Always
hyaline surrounding shaped CSF CSF contrast present (T1 present
degeneration, oedema contrast isointense,
cyst fluid thicker may be enhancement T2 iso-/
and protein- present hypointense)
aceous, breach
in blood–brain
barrier and
surrounding
inflammation
Granular- Retracted- Hypodense Ring- or disc- Isointense Iso-/hypointense – Ring-/nodule- Occasion- Usually
nodular involuted larva with shaped contrast with central like enhancement ally present present
Imaging and Spectroscopy of Neurocysticercosis
with fragemented surrounding enhancement hyperintensity

contents oedema
(including scolex)
thick capsule,
inflammation less
Fibro- Mineralized May be May be Isointense/ Hypointense Iso-/ May be Not usually May be
calcified larva, normal or enhancing hypointense hypointense enhancing seen present
inflammation reveal
may or may calcification
not be seen
323
NCCT: Non-contrast CT; CECT: Contrast-enhanced CT; CSF: Cerebrospinal fluid.
Novel Imaging Techniques has been reported in the former45. We per-

formed ex vivo and in vitro magnetic reso-
Magnetization transfer MRI has been nance spectroscopy in cysticercus
recently applied to the differentiation of cys- granulomas and did not find any NAA in
ticercus granuloma from tuberculoma37. these lesions. Therefore, it is possible that
Magnetization transfer ratios in T2 hypo- NAA signal is a result of partial volume
intense portions of cysticercus granulomas effect of the voxel. On the contrary, we
are significantly lower in comparison to have observed succinate and lactate in
those in tuberculoma as well as normal grey our in vivo studies (Fig. 32.12a–d).
and white matter.37 This is because of higher Contamination of the voxel from the sur-
protein and amino acid content of cysticer- rounding oedematous brain parenchyma
cus granulomas in comparison to tuberculo- may be responsible for this signal46.
mas (Fig. 32.11a–c)37. Lately, we have Anecdotal experience of positron emis-
demonstrated the relationship between the sion tomography (PET) in NC revealed areas
perilesional gliosis as observed on magneti- of decreased cerebral uptake of [18F] 2-flu-
zation transfer MRI and epileptogenic poten- oro-2-deoxyglucose corresponding in loca-
tial of healed cysticercus granulomas (Fig. tion to resolving cysticercus granuloma47.
32.10c)38,39. Identification of perilesional glio-
sis on magnetization transfer MRI may pre-
dict late onset seizures, i.e. seizures after the Conclusions
cysticercus granuloma has healed. The iden-
tification of such individuals is important, In conclusion, the radiological manifesta-
because there is a subset, however small in tions of NC are as varied as its clinical pre-
number, that are prone to seizure recurrence
sentations. Critical appreciation of the stages
after the granuloma has healed40.
of evolution of the cysticercus is important
Calcified larvae are difficult to differenti-
and forms the basis of the understanding of
ate from occult vascular malformation or
its neuroimaging features. Each stage in the
cavernous haemangioma on T2-weighted
involution of the cysticercus has characteris-
images. Use of phase imaging utilizing the
tic imaging attributes. Conventional cross-
difference in phase of these two conditions
sectional imaging has few limitations,
permits this41. Calcification exhibits positive
phase while occult vascular malformations especially with regard to extraparenchymal
demonstrate negative phase. Three-dimen- NC. Research is currently focusing on the
sional constructive interference in steady- development of improved techniques for
state MRI sequences are able to demonstrate identification of atypical and uncommon
intraventricular cysticercosis better than con- forms and their differentiation from other
ventional techniques42,43. This modality may infectious disorders. Contrast CT ventricu-
be potentially useful in distinguishing intra- lography and the newer MRI technique of
ventricular cysticercosis from a dilated- three-dimensional constructive interference
trapped ventricle. in steady-state imaging are useful in delin-
In vivo proton magnetic resonance spec- eating intraventricular cysticercosis. In vivo
troscopy has been anecdotally used to proton magnetic resonance spectroscopy and
study NC44,45. Lactate, succinate, acetate, the magnetization transfer ratios of the T2
alanine and an unassigned resonance at 3.3 hyperintense portions of the cysticercus
ppm were among the metabolites detected. granuloma are useful in differentiating it
A few of these have also been observed in from other granulomatous disorders. The
hydatid cysts and brain abscesses. identification of perilesional gliosis upon
Cysticercus and tubercular granulomas can magnetization transfer MRI is predictive of
also be differentiated on the basis of late seizure recurrence in patients with NC.
NAA/Cho, NAA/Cr and Cr/Cho ratios Finally, phase-contrast imaging and T2*
(Cho, choline; Cr, creatine; NAA, N-acetyl- imaging are useful in the identification of the
aspartate)45. A high NAA and Cr content calcified stage of NC.

Fig. 32.12. T2-weighted image (a) through the supraventricular region shows a hyperintense mass with
hypointense rim and associated perifocal oedema. The lesion appears hypointense on T1-weighted
image (b). In vivo proton-MRS done using spin echo shows a prominent resonance at 2.4 ppm consistent
with succinate (S) and a small resonance of lactate at 1.33 ppm (L). The resonances at 2.02, 3.02 and
3.22 ppm are seen as contaminant from the parenchyma around the cyst assigned to N-acetylaspartate
(NAA; 1), creatine (Cr; 2), and choline (Cho; 3) respectively (c). Ex vivo proton-MRS confirmed the
assignments seen in vivo (d).

References
1. Rabiela Cervantes, M.T., Rivas-Hernandez, A., Rodrigues-Ibarra, J., et al. (1982)

Anatomopathological aspects of human brain cysticercosis. In: Flisser, A., Willms, K., Laclette, J.P., et
al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp.
179–200.
2. Orihel, T.C., Ash, L.R. (1995) Parasites in Human Tissues. American Society of Clinical Pathologists,
Chicago, Illinois.
3. McCormick, G.F., Zee, C.S., Heiden, J. (1982) Cysticercosis cerebri. Review of 127 cases. Archives of
4. Wadia, N., Desai, S., Bhatt, M. (1988) Disseminated cysticercosis. New observations, including CT
5. Ahuja, G.K., Roy, S., Kamla, G., et al. (1978) Cerebral cysticercosis. Journal of the Neurological Sciences
35, 365–374.
7. Santin, G., Vargas, J. (1966) Roentgen study of cysticercosis of central nervous system. Radiology 86,
520–527.
8. Sutton, D. (1990) Infection T. In: Young, J.W.R., Sutton, D. (eds) A Short Textbook of Clinical Imaging.
Springer Verlag, London, pp. 774.
9. Carabajal, J.R., Palacious, E., Azar-Kia, B., et al. (1977) Radiology of cysticercosis of the central ner-
vous system including computed tomography. Radiology 125, 127–131.
10. Gonzalez, C.F., Palaci, E. (1985) Infections and inflammatory diseases. In: Gonzalez, C.F., Grossman,
C.B., Masdeu, J.C. (eds) Head and Spine Imaging. John Wiley & Sons, New York, pp. 397–431.
11. Soto, H.J.L., Gomez, L.A.S., Rojas, E.L.A., et al. (1996) Subarachnoid hemorrhage secondary to a rup-
tured inflammatory aneurysm: possible manifestation of neurocysticercosis: case report.
12. Bhargava, S. (1983) Radiology – including computed tomography – of parasitic diseases of the cen-
tral nervous system. Neurosurgical Review 6, 129–137.
13. Machado, L.R., Nobrega, J.P., Barros, N.G., et al. (1990) Computed tomography in neurocysticerco-
sis: a 10-year long evolution analysis of 100 patients with an appraisal of a new classification.
14. Noujaim, S.E., Rossi, M.D., Rao, S.K., et al. (1999) CT and MR imaging of neurocysticercosis.
American Journal of Roentgenology 173, 1485–1490.
15. Enzmann, D.R. (1994) Central nervous system infections. In: Putman, C.E., Ravin, C.E., Bowie, J.D.,
et al. (1988) Textbook of Diagnostic Imaging. WB Saunders, Pennsylvania, pp. 241–242.
16. Silva, J.E., Diefenthaler, A.P., Palma, J.K. (2000) Frequency of suspected cases of neurocysticercosis
detected by computed skull tomography in Santa Maria, R.S., Brazil. Revista do Instituto de Medicina
Tropical de Sao Paulo 42, 57–58.
17. Enzmann, D.R. (1984) Cysts. In: Imaging of Infections and Inflammations of the Central Nervous System:
Computed Tomography, Ultrasound and Nuclear Magnetic Resonance. Raven Press, New York, pp. 103–119.
18. Carabajal, J.R., Palacious, E., Azar, K.B., et al. (1977) Radiology of cysticercosis of the central nervous
system including computed tomography. Radiology 125, 127–131.
19. Rodriguez, C.J., Salgado, P., Gutierrez, A., et al. (1983) The acute encephalitic phase of neurocysticer-
cosis: computed tomographic manifestations. AJNR American Journal of Neuroradiology 4, 51–55.
20. Carabajal, J.R., Duran, B.B., Dorfsman, J., et al. (1987) The role of computed tomography (CT) in the
diagnosis of neurocysticercosis. Child’s Nervous System 3, 199–202.
21. Zee, C.S., Tasi, F.Y., Segall, H.D., et al. (1981) Entrance of metrizamide into an intraventricular cys-
ticercosis cyst. American Journal of Neuroradiology 2, 189–191.
22. Sharma, K., Gupta, R.K. (1993) Negative scan in neurocysticercosis. Pediatric Neurosurgery 19,
206–207.
23. Teitelbaum, G.P., Otto, R.J., Lin, M., et al. (1989) MR imaging of neurocysticercosis. American Journal
of Neuroradiology 153, 857–866.
25. Suss, R.A., Maravilla, K.R., Thompson, J. (1986) MR imaging of intracranial cysticercosis: compari-
son with CT and anatomopathologic features. American Journal of Neuroradiology 7, 235–242.

26. Jena, A., Sanchetee, P.C., Gupta, R.K., et al. (1988) Cysticercosis of brain shown by magnetic reso-
nance imaging. Clinical Radiology 39, 542–546.
27. Creasy, J., Alacron, J. (1994) Magnetic resonance imaging of neurocysticercosis. Topics in Magnetic
Resonance Imaging 6, 59–68.
28. Chang, K.H., Cho, S.Y., Hesselink, J.R., et al. (1991) Parasitic diseases of the central nervous system.
29. Chang, K.H., Lee, J.H., Han, M.H., et al. (1991) The role of contrast enhanced MR imaging in the
diagnosis of neurocysticercosis. American Journal of Neuroradiology 12, 501–513.
30. Rajshekhar, V., Chandy, M.J. (1996) Comparative study of CT and MRI in patients with seizures and
a solitary cerebral cysticercus granuloma. Neuroradiology 38, 542–546.
31. Spickler, E.M., Lufkin, R.B., Teresi, L., et al. (1989) High-signal intraventricular cysticercosis on T1-
weighted MR imaging. American Journal of Neuroradiology 10, S64 (Case Report).
32. Suh, D.C., Chang, K.H., Han, M.H., et al. (1989) Unusual MR manifestations of neurocysticercosis.
33. Jena, A., Sanchetee, P., Tripathi, R., et al. (1992) MR observations on the effects of praziquantel in
neurocysticercosis. Magnetic Resonance Imaging 10, 77–80.
34. Rhee, R.S., Kumasaki, D.Y., Sarwar, M., et al. (1988) MR imaging of intraventricular cysticercosis.
Journal of Computer Assisted Tomography 11, 598–601.
35. Gupta, R.K., Jain, V.K., Kumar, S., et al. (1993) Unusual MRI appearance of cysticercus within the
fourth ventricle. Neuroradiology 35, 457–458.
37. Gupta, R.K., Kathuria, M.K., Pradhan, S. (1999) Magnetization transfer MR imaging in central ner-
vous system tuberculosis. American Journal of Neuroradiology 20, 867–875.
38. Gupta, R.K., Kathuria, M.K., Pradhan, S. (1999) Magnetization transfer MR imaging demonstration
of perilesional gliosis: its relationship with epilepsy in treated or healed neurocysticercosis. Lancet
354, 41–42.
40. Del Brutto, O.H., Santibanez, R., Noboa, C.A., et al. (1992) Epilepsy due to neurocysticercosis: analy-
41. Yamada, N., Imakita, S., Sakuma, R.T., et al. (1996) Intracranial calcification on gradient-echo phase
image depiction of diamagnetic susceptibility. Radiology 198, 171–178.
42. Yang, D., Korogi, Y., Ushio, Y., et al. (2000) Increased conspicuity of intraventricular lesions revealed
by three-dimensional constructive interference in steady state sequences. American Journal of
43. Govindappa, S.S., Narayanan, J.P., Krishnamoorthy, V.M., et al. (2000) Improved detection of intra-
ventricular cysticercal cysts with the use of three-dimensional constructive interface interference in
steady state MR sequences. American Journal of Neuroradiology 21, 679–684.
44. Chang, K.H., Song, I.C., Kim, S.H., et al. (1998) In vivo single voxel proton MR spectroscopy in
intracranial cystic masses. American Journal of Neuroradiology 19, 401–405.
45. Jayasundar, R., Singh, V.P., Raghunathan, P., et al. (1999) Inflammatory granulomas: evaluation with
proton MRS. Nuclear Magnetic Resonance in Biomedicine 12, 139–144.
46. Garg, M., Chawla, S., Prasad, K.N., et al. (2002) Differentiation of hydatid cyst from cysticercus cyst
by proton MR spectroscopy. NMR in Biomedicine (in press).
47. Nagayama, M., Sbinohara, Y., Nagakura, K., et al. (1996) Distinctive serial magnetic resonance
changes in a young woman with rapidly evolved neurocysticercosis, with positron emission tomog-
raphy results. Neuroimaging 6, 198–201

Sing - Chap 33 4/9/02 4:45 pm Page 329
33
Taenia solium Cysticercosis:
Immunodiagnosis of Neurocysticercosis
and Taeniasis
Patricia P. Wilkins, Marianna Wilson, James C. Allan and

Victor C.W. Tsang
Introduction known as taeniasis, is so crucial to controlling

NC, we will also discuss immunodiagnostic
Clinical diagnosis of neurocysticercosis (NC) methods for detection of taeniasis cases.
is complicated by the wide spectrum of clini- The antibody-detection assays available
cal presentations associated with the dis- today provide a reliable and useful adjunct to
ease1,2. Definitive diagnosis of NC is made by the diagnosis of NC. However, that has not
direct demonstration of the parasite in tis- always been the case and a variety of tests
sues, either by histological demonstration of were developed before the invention of the
the parasite in brain tissue or radiological enzyme-linked immunoelectrotransfer blot
demonstration of the taeniid scolex in cystic (EITB*) had varying degrees of usefulness in
lesions using computed tomography (CT) or diagnosing NC. Complement fixation, indi-
magnetic resonance imaging (MRI). rect haemagglutination, ELISA and EITB tests
Neuroimaging studies are the most com- are among the types of immunodiagnostic
monly used techniques for diagnosing NC, assays that have been developed5–7. Today,
but these techniques are expensive and gen- the EITB and ELISA are the antibody-detec-
erally not available in areas where the disease tion test formats that are most frequently
is most prevalent. Immunodiagnosis is a used for diagnosis of NC. Our discussion will
valuable method for confirmation of disease, focus on these two assays and on studies that
but highly sensitive and specific tests were have directly compared the two assays.
not available before 19893. Methodologies
exist today to detect both antibodies, which
indicate present or past infection, and circu- EITB for Diagnosis of
lating antigens, which indicate current infec- Neurocysticercosis
tion4. For the sake of our review here, we will
limit our discussion to the most commonly The EITB, which was developed at the
used antibody-detection methods. Antigen Centers for Disease Control (CDC), Atlanta,
detection methods for identifying NC will be Georgia, USA has had a profound impact on
discussed in Chapter 34 in this book. Because the diagnosis of cysticercosis6,7. Because of
detection of the adult worm infections, its excellent performance, EITB has been
*In this text and elsewhere in the book, EITB will refer specifically to the enzyme-linked immuno-
electrotransfer blot, developed at the CDC5; immunoblot refers to other blot assays, in general.

Sing - Chap 33 4/9/02 4:45 pm Page 330
330 P.P. Wilkins et al.
included in a proposed algorithm for the and GP13, based on relative molecular
diagnosis of NC8. Of the antibody-detection weight determinations using SDS-PAGE. In
tests available today, it performs best, with cases where two or more cysts are present,
exquisite specificity and excellent sensitivity. this assay is very sensitive, 100% and 95%,
Briefly, cysts, collected from naturally using serum or cerebrospinal fluid (CSF),
infected pigs, are homogenized and proteins respectively, and is 99% specific for either
are solubilized in urea. The resultant extract sample6. Mainly because of its ease of collec-
is eventually purified using lentil lectin affin- tion for epidemiological studies, saliva was
ity chromatography. The lentil lectin-bound also evaluated as a source of anticysticercal
glycoproteins (LLGP) are separated using antibodies using EITB. However, saliva was
sodium dodecyl sulphate polyacrylamide gel inferior to serum as an antibody source; of
electrophoresis (SDS-PAGE) and then elec- the cases that were detected using serum,
trophoretically transferred to nitrocellulose only 70% were positive using saliva9.
membranes. The EITB detects antibodies to EITB is highly sensitive in patients
any one of seven cyst-derived glycoproteins with multiple, enhancing intracranial
(Fig. 33.1). These proteins are designated as lesions1,2,10,11. The original description and
GP50, GP39–42, GP24, GP21, GP18, GP14 evaluation of the EITB was performed using
sera from biopsy proven cases of NC, typi-
cally with multiple lesions as detected by
skeletal radiographs6. Continued monitoring
of the test performance, compared with clini-
cal findings using newer imaging tech-
niques, such as CT and MRI, suggested that
the sensitivity of the assay was lower in
cases with single lesions or calcified cysts
(see Chapter 36)12. Several studies demon-
strated that the test is less sensitive, between
60% and 80%, using sera from patients with
a single parenchymal cyst or only calcified
lesions11–13, perhaps because of insufficient
gp 50 immune stimulation11,14. In these situations,
the test sensitivity using CSF also drops con-
gp 42
siderably, to approximately 35%13.
Intraventricular cysticercosis occurs much
gp 24 less frequently than parenchymal NC10.
While MRI is very efficient in revealing the
gp 21
presence of intraventricular cysts, CT is not,
gp 18
yet access to MRI is generally not available
gp 14 in developing countries. Consequently, there
gp 13 is very little published data on the usefulness
of the EITB in intraventricular cysticercosis.
A study of four patients with intraventricu-
Fig. 33.1. Enzyme-linked immunoelectrotransfer lar cysts from Texas found that all four were
blot (EITB) for immunodiagnosis of cysticercosis. EITB positive15. It is our experience, using
Individual sera from persons with possible
results that have been accumulated over
cysticercosis were analysed by the EITB assay;
more than a decade in the Parasitic Diseases
lane 1: negative control sera; lane 2: positive control
sera; lanes 3–11 patient specimens. Sera in lanes Reference Diagnostic Laboratory at CDC
3–6 and 8–9 demonstrate positive antibody from patients with intraventricular cysticer-
reactivities to Taenia solium cyst lentil lectin-purified cosis, that the great majority of these patients
antigens, lane 8 is a weak positive; sera in lanes 7, are EITB positive (Table 33.1). In patients
10 and 11 are negative. Positions of the defined with intraventricular cysts, as opposed to
LLGPs are marked on the left side of the blot. those with parenchymal cysts, it appears that

Sing - Chap 33 4/9/02 4:45 pm Page 331
Immunodiagnosis of Neurocysticercosis and Taeniasis 331
Table 33.1. Enzyme-linked immunoelectrotransfer blot (EITB) results in serum or

cerebrospinal fluid (CSF) samples from patients with pathologically proven
intraventricular neurocysticercosis.
Cysticercosis patients detected
Single cyst Two or more cysts*
Cyst classification n EITB+ (%) n EITB+ (%)
Active 13 12 (92) 9 8 (89)

Calcified 1 1 2 2 (100)
Mixed 9 9 (100)
Totals 14† 13 (93) 20† 19 (95)
*Patients had two or more intraventricular cysts, or had both one or more
intraventricular cysts and one or more parenchymal cysts.
†Thirteen of the 34 patients with intraventricular cysts had paired serum and CSF
samples; 10 of 13 pairs were EITB positive, one of 13 pairs was serum positive
but CSF negative, and two pairs were EITB negative (one pair from a patient with
a single active cyst, one pair from a patient with two active cysts).
the antibody response is influenced more by and 12% showed a decrease in the number of
the location of cysts than by the number of proteins recognized in the EITB 1 year after
cysts. Intraventricular cysts are constantly treatment. These data suggest that antibody
bathed in CSF allowing easy access of persistence is proportional to the intensity of
immune cells and mediators, which may be the initial immune response.
involved in initiating the humoral response. The diagnostic utility of EITB vis-à-vis CT
The presence of antibodies to any of was evaluated in a cohort of 383 individuals
seven glycoprotein antigens is considered undergoing CT16. When non-specific CT
diagnostic for NC using the EITB. Over 98% abnormalities such as single lesions and iso-
of the time, sera from infected individuals lated hydrocephalus were excluded, CT
contain antibodies that react with one or scans revealed abnormalities diagnostic of
more of the seven immunodiagnostic pro- NC in 44% of the EITB-positive individuals.
teins6. In a recent hospital-based study in Several explanations may be offered for posi-
Peru, about half of NC patients had serum tive EITB results in individuals with normal
antibodies that reacted to all seven diagnos- CT, such as the presence of extra-neural cys-
tic proteins16. The proteins most frequently ticercosis, or past resolved cerebral cysticer-
recognized are the GP39–42 complex (95%) cosis with persisting antibodies. It is
and GP24 (94%); the lower molecular important to note that serological results
weight proteins, GP14 and GP13, are recog- should be used in conjunction with neu-
nized the least6. roimaging studies, clinical manifestations
A recent study examined the presence of and exposure history for consistent, accurate
anticysticercal antibodies in serum of NC diagnosis of NC8,13.
patients before and after anticysticercal treat-
ment11. At admission, approximately half of
the patients had antibodies that recognized ELISA for Diagnosis of NC
all seven diagnostic proteins. Of these per-
sons, those who were successfully treated Although EITB is accepted as the best diag-
still had antibodies that reacted to all seven nostic test available today, ELISA continues
proteins 1 year after treatment. Of the to be used extensively for both epidemiologi-
patients with antibodies to fewer than seven cal surveys17 and for clinical diagnosis,
proteins, 7% were seronegative after 1 year mainly because of its technical simplicity as

Sing - Chap 33 4/9/02 4:45 pm Page 332
compared to EITB. There is extensive litera- control sera. In contrast, ELISA gave presum-
ture describing the usefulness of ELISA as a ably false positive results with sera from
method for diagnosing NC; much of that patients with several other cestode infec-
work has been reviewed elsewhere18. ELISA tions, including those caused by Taenia sagi-
has been shown to be a useful adjunct for nata, H. nana and Echinococcus granulosus.
diagnosing NC if CSF, not serum, is tested. However, the heterologous infection sera
In one study, an ELISA, which detected anti- used in this study were collected in a region
gen-specific immunoglobulin M (IgM), in Peru known to be endemic for diseases
demonstrated a sensitivity of 87% and speci- caused by all of these parasites; therefore, it
ficity of 95% in CSF specimens from patients is possible that these samples were collected
with active or inactive NC19. However, many from persons with subclinical cysticercosis or
ELISA tests have high false positive and false prior exposure to T. solium. A similar study
negative rates, so results should be inter- compared the ability of both ELISA and EITB
preted with caution3. Most ELISAs detect to detect anticysticercal antibodies in paired
antibodies to antigens that are present in serum and saliva samples from clinically
crude cyst extracts or cyst vesicular fluid. defined NC patients9. In this study, the sensi-
Because the parasite antigens used in these tivity using serum samples was 100% with
assays are not typically purified, ELISA has EITB and 74% with ELISA. However, in
historically demonstrated a lower specificity saliva samples, the sensitivity was 70% using
and sensitivity than EITB. For this review, EITB and 82% with ELISA. These data sug-
we have elected to discuss the ELISA in the gest that ELISA with saliva may be a useful
context of the EITB and examine studies screening test for cysticercosis in the epi-
where the two tests were compared directly; demiological setting. However, its sensitivity
when the ELISA was directly compared with does not equal that of EITB in serum and
the EITB, the EITB has always outperformed specificity remains an issue. In yet another
the ELISA (Table 33.2). study, comparing a commercially available
In one study, sera and CSF from patients ELISA (LMD Laboratories, Carlsbad, CA,
with parasite-confirmed NC were tested USA) with EITB, the latter performed with
using both ELISA and EITB20. Using EITB, higher sensitivity and specificity than
94% and 86% of all confirmed cases were ELISA21. Although there was a good level of
detected using serum and CSF, respectively. concordance between the two tests (85%),
ELISA detected 65% and 62% of cases, this study demonstrated the lack of speci-
respectively, using the same samples. In this ficity often seen with ELISA; 9% of sera were
particular study EITB proved to be 99% positive that were collected from persons
(1/83) specific, possibly falsely detecting one with no clinical or epidemiological evidence
case of Hymenolepis nana infection among 59 of cysticercosis.
Table 33.2. Studies comparing the ELISA and enzyme-linked immunoelectrotransfer blot (EITB) for
diagnosis of neurocysticercosis (NC).
Cysticercosis cases detected
Clinical NC cases (sensitivity) Non-NC cases (specificity)
Reference Sample EITB+ (%) ELISA+ (%) EITB+ (%) ELISA+ (%)
20 Serum 32/34 (94) 22/34 (65) 1/83 (99) 16/83 (81)

20 CSF 18/21 (86) 13/21 (62) NT NT
21 Serum 25/28 (89) 26/28 (93) 1/69 (99) 9/258 (97)
9 Serum 21/21 (100) 20/27 (74) 0/55 (100) NT
9 Saliva 19/27 (70) 23/28 (82) 0/27 (100) NT
NT, not tested.

Sing - Chap 33 4/9/02 4:45 pm Page 333
The sensitivity of ELISA for detecting of the EITB, but also utilize a simpler assay
cases of NC characterized by single lesions format, such as that of the ELISA. Some
has not been discussed in the literature. investigators have focused on less complex
Consequently, using data accumulated in the sources of parasite material, such as T. solium
Parasitic Diseases Reference Diagnostic cyst fluid22,23. Other scientists have focused
Laboratory at the CDC, we compared the on purification and characterization of the
sensitivity of EITB with that of LMD ELISA seven individual glycoprotein antigens that
by testing 31 samples from persons with are components of the LLGP fraction used in
either pathologically proven or clinically EITB24–26. Still others have opted for using a
documented cases of NC with single lesions more available source of parasite material
(Table 33.3). EITB was positive in 55% of the present in heterologous rodent Taenia
cases, while ELISA was positive in 29%. species, T. crassiceps, as an antigen source27.
These data indicate that the ELISA is less Virtually simultaneously, several labora-
effective than EITB for detecting NC cases tories reported purification of individual
with single lesions. antigens, cloning of complementary DNA
EITB and ELISA were compared in one (cDNAs) and incorporation of corresponding
community-based study in Mexico to identify recombinant or synthetic antigens in new
NC cases and risk factors associated with the immunodiagnostic assays for NC28–30. Many,
disease17. Positive results in each test were but not all, of the recombinant antigens
correlated with epidemiological and clinical reported are components of the LLGP frac-
data. Twelve of 42 persons, reporting a history tion28 and others, although not directly puri-
of seizures, were identified using EITB, but fied from the LLGP fraction29,30, appear to be
none were detected using ELISA. These data closely related to the protein antigens found
demonstrate the superiority of EITB, even in in the LLGP fraction. One of the primary
the community setting, as an important epi- research goals in this field is development of
demiological tool for identifying NC. simpler assays for immunodiagnosis of NC;
therefore, these findings merit a more exten-
sive discussion, presented below.
Recent Advances in Utilizing the LLGP fraction employed in
Immunodiagnosis of EITB, several investigators identified native
Neurocysticercosis 10-, 14- and 18-kDa antigens that are similar
(Fig. 33.2a)25,26. Using amino-terminal amino
Because of the technical difficulties associ- acid sequencing, these three native proteins
ated with EITB procedures, researchers are share identity in 13 of 19 amino acid cycles for
attempting to develop novel tests that would which meaningful sequence was obtained,
not only retain the sensitivity and specificity and similarity at remaining positions. Both
Table 33.3. Comparison of ELISA and enzyme-linked immunoelectrotransfer

blot (EITB) for detection of neurocysticercosis (NC) cases with single lesions.
Clinical classification n EITB+ (%) ELISA+ (%)
Biopsy proven, single lesion
Enhancing 10 3 2
Calcified 2 0 0
Total 12 3 (25) 2 (17)
Clinically consistent with NC
Enhancing 13 10 5
Calcified 6 4 2
Total 19 14 (74) 7 (37)
Total 31 17 (55) 9 (29)*
*All ELISA positives were also EITB positive.

Sing - Chap 33 4/9/02 4:45 pm Page 334
Fig. 33.2. Alignment of cloned diagnostic antigens of neurocysticercosis (NC). CLUSTAL_ alignment
of the deduced amino acid sequences of some recombinant polypeptides reported to have value as
diagnostic antigens for detection of NC65. (a) Sequences 1–4, 6 and 8 represent deduced polypeptides
reported by Greene et al.28; sequences 5, 7 and 9–10 are reported in Sako et al.30; (b) sequence 11 was
reported in Chung et al.29.
groups used native purified proteins in EITB of both the 24- and 39–42-kDa components of
assays and showed these proteins to be sensi- the LLGP fraction and, upon reduction,
tive and highly specific for detecting anticys- yielded two similar, but not identical, 10-kDa
ticercal antibodies, although the 10- and proteins25. The 14- and 18-kDa antigens were
14-kDa antigens appeared more sensitive than purified following reduction of larger LLGPs,
the 18-kDa antigen26. These three antigens, the which ranged in size from 25 kDa to 45 kDa26.
10-, 14- and 18-kDa proteins were all shown to Polyclonal antibodies were generated by both
be components of the larger diagnostic anti- groups that further indicated that these anti-
gens present in the LLGP fraction. The 10-kDa gens are components of larger protein anti-
antigen was identified by separate purification gens. Plancarte et al. generated polyclonal

Sing - Chap 33 4/9/02 4:45 pm Page 335
antibodies against purified GP24 or GP39–42 related cDNAs were cloned that predicted
that reacted with the 10-kDa antigen25. polypeptides ranging in size from 9.6 kDa to
Conversely, Greene et al. produced polyclonal 13 kDa. Escherichia coli-expressed, thiore-
antibodies to the 14-kDa protein that reacted doxin-fusion proteins were evaluated for
with six distinct moieties, co-migrating with specificity and sensitivity. A chimeric con-
GP14, GP18, GP21, GP24, and GP42 antigens struct was created using the cDNA
in the LLGP fraction28. sequences from the two most promising
The cDNAs for the 14- and 18-kDa anti- recombinants, expressed in E. coli, and the
gens were subsequently cloned and resultant recombinant chimeric protein was
sequenced. During the process of cloning, a evaluated in an ELISA. Although a limited
total of five distinct cDNA clones were iden- number of sera (53 NC sera) were evaluated,
tified and all were closely related at both the the chimeric protein demonstrated remark-
nucleic acid and predicted amino acid levels. able sensitivity (100%) and specificity (90%).
Polypeptides that represent the mature pro- Another 10-kDa antigen has been isolated
teins were chemically synthesized (synthetic from cyst fluid that has been evaluated for its
Taenia solium, sTS) 14 and sTS18), and evalu- utility as a diagnostic antigen for detection of
ated as diagnostic antigens using an ELISA. NC cases. This antigen is a subunit compo-
sTS14 demonstrated greater utility than nent of a 150-kDa complex. When the native
sTS18 and was recognized in a disease-spe- 10-kDa antigen was evaluated in the
cific manner using defined sera from persons immunoblot format, the assay had a sensitiv-
with cysticercosis or other helminthic infec- ity of 85%; and only sera from persons with
tions. However, only 53% of sera from per- echinococcosis showed low-level cross-reac-
sons with cysticercosis reacted with this tivity (~10% of these particular sera reacted)22.
synthetic version of TS1428 although 76% of A full-length cDNA encoding this 10-kDa
sera reacted with the native 14-kDa molecule antigen has been cloned and a glutathione-S-
in an immunoblot format26. transferase (GST)-fusion protein was
When all of the data pertaining to the expressed and evaluated in an ELISA. The
purified LLGP antigens are evaluated, sev- overall sensitivity, using 200 sera from per-
eral things become apparent. One, all of the sons with NC, was 88% and was 97% in
proteins in the 10–42-kDa range appear to be detecting active cases of NC. Using approxi-
antigenically and structurally related. And mately 200 sera from persons with other
two, the 24-kDa and larger antigens appear helminthic infections, this assay demon-
to be comprised of subunits of at least two strated a specificity of 98%. The cDNA
smaller (10–14-kDa) proteins28. The precise sequence of this protein revealed that it, too,
manner in which these subunits are assem- is related to the other cDNAs and proteins
bled to form larger proteins remains a sub- encoding cyst fluid antigens, described
ject of intense investigation. above29,30. However, this cDNA and amino
Other significant advances towards devel- acid sequence appears to be the most distinct
oping simplified immunodiagnostic meth- of the sequences described to date (Fig. 33.2b).
ods for NC have been made using purified T. The five cDNA clones encoding the anti-
solium cyst fluid. The soluble antigens pre- gens in cyst fluid are not only all related to
sent in cyst fluid were further purified using one another, but are also related to the cDNA
isoelectric focusing (pH 9.2–9.6) for use in clones, which encode the LLGP antigens
ELISA or immunoblot formats. Three cys- (Fig. 33.2b). All polypeptides encoded by
ticercosis-specific antigens were identified by these cDNAs have similar structural charac-
immunoblotting: a 10-kDa and a 26-kDa teristics: N-terminal hydrophobic regions,
antigen, and a third antigen between 10 kDa which are predicted to be signal sequences
and 26 kDa23. The high level of specificity with signal sequence cleavage sites; all
and sensitivity seen in both the ELISA and encode polypeptides with predicted sizes of
immunoblot led to cDNA cloning and 7.6 kDa to 12.9 kDa; all have similar amino
expression of the recombinant proteins rep- acid compositions with isoelectric points
resenting the native cyst antigens30. Four between 8.0 and 9.6; and 10 of the 11 cloned

Sing - Chap 33 4/9/02 4:45 pm Page 336
antigens contain a conserved IAQLAK pling pots between family members in field
amino acid sequence near the middle of the studies has occurred in the past (James C.
polypeptide. Clearly these proteins are mem- Allan, Sandwich, UK, personal observation).
bers of a larger family of antigenic Taenia
proteins that are expressed in the metaces-
tode stage of the parasite. Detection of coproantigens
The principle behind coproantigen detection

Diagnosis of Taeniasis is the immunological detection of parasite
material in the faeces of the host.
Accurate diagnosis of adult Taenia tapeworm Coproantigens may include products shed as
infections is a critical element of any strategy a result of turnover of the parasite’s surface
to control or eliminate cysticercosis. Definitive or products that are excreted or secreted by
diagnosis of tapeworm carriers is accom- the tapeworm. Products, associated with
plished by demonstration of ova and/or parasite metabolism should be present in
proglottides in stool samples. However, faeces independently of parasite reproduc-
because of the intermittent nature of egg tive material, such as eggs or proglottides.
excretion, this method underestimates the Unlike tests based on the detection of host
prevalence of taeniasis31,32. Direct parasitologi- antibody, however, they should be present
cal examination of stool samples is the only only if the parasite is present.
diagnostic method that is considered unequiv- Detection of taeniid coproantigens in fae-
ocal. The diagnosis of taeniasis is made when ces was first demonstrated by Babos and
eggs, gravid proglottides, or both are present Nemeth in the 1960s35. Using sera from rab-
in the sample. However, eggs of T. solium and bits hyperimmunized with cyst fluid from E.
T. saginata cannot be distinguished from each granulosus metacestodes, parasite antigens
other, therefore, speciation of the taeniid can were demonstrated by double diffusion in the
be determined only if gravid proglottides are faeces of dogs infected with E. granulosus.
present. Gravid proglottides from T. solium Antigen was detected before patency but
bear ten or fewer uterine branches on each side cross-reactions were seen with antigens pre-
of the central uterus; proglottides of T. saginata sent in faeces from individuals infected with
have 12 or more branches33. In very rare cases, Taenia. Subsequently, antigens were detected
a scolex may be present in the sample. If so, in the faeces of a variety of hosts infected with
then definitive species diagnosis of T. solium or intestinal cestodes36–47. These assays used
T. saginata can be made by the presence of an polyclonal antibodies from rabbits hyperim-
armed (with hooks) or unarmed (without munized with adult worm products; others
hooks) scolex, respectively34. Taenia solium and used both rabbit polyclonal and murine mon-
T. saginata are sometimes present within the oclonal antibodies48,49. These assays are
same geographic area, making speciation par- highly specific and sensitive and are able to
ticularly critical for epidemiological studies. detect antigens before patency and in samples
Although microscopic-based parasitological that have been frozen or collected in formalin.
techniques are simple and relatively inexpen-
sive, these techniques lack both sensitivity and
specificity. Furthermore, there are cultural Coproantigen detection in human
problems associated with the collection of fae- taeniasis
cal samples in some areas. There is the biohaz-
ard the material itself presents; collection of To date, all assays for taeniid coproantigen
faecal samples carries with it the potential for in humans have been based on polyclonal
exposure to, and infection with Taenia eggs, rabbit antibodies, either to adult worm
which may be present in the sample. From a somatic38, excretory–secretory (ES)43 or sur-
practical viewpoint, it can often be difficult to face antigens44,46. These tests have been
ensure unambiguous patient–sample associa- shown to be genus specific; samples from
tion in field settings. Indeed confusion of sam- both T. solium and T. saginata infections are

Sing - Chap 33 4/9/02 4:45 pm Page 337
positive in assays using antibodies against improvements to these assays, especially the
one species or the other38. Levels of speci- capability to differentiate T. solium and T.
ficity with faeces from infections other than saginata, would broaden their applicability.
Taenia sp. have been demonstrated to be
greater than 99%39–41, resulting in a high
positive predictive value in most T. solium Immunodiagnosis of intestinal Taenia
endemic areas. No cross-reactions have infection
been shown with faeces from other
helminth infections, including H. nana, H. A number of immunodiagnostic techniques
diminuta, Ascaris lumbricoides, Trichuris and have been applied to the diagnosis of human
hookworm39–41. In a field study where all of T. solium and T. saginata taeniasis. Early stud-
the Taenia tapeworms identified to the ies involved the application of intradermal
species level were shown to be T. solium, a tests but these were shown to have high
microtitre plate-based coproantigen assay false-positive and false-negative rates50–54. In
detected 2.6 times more tapeworm carriers particular, the tests were shown to remain
than microscopic detection of Taenia eggs in positive for long periods following treatment
faeces (55 cases diagnosed versus 21)41. The of the infection53. In some cases, reactions
coproantigen test diagnosed 98% of all cases were detected only after treatment or became
detected in the study while microscopy stronger after treatment53. Intradermal test-
diagnosed 38% (55/56 cases and 21/56 ing for T. solium gave false-positive rates of
cases, respectively). Coproantigen tests for 3–7% and a sensitivity of approximately
human taeniasis become negative within 76%54, however, 12% of individuals treated
approximately 1 week after successful for this parasite continued to give positive
treatment of intestinal infection38,43. In results for long periods after treatment, some
canine Taenia infections they are positive patients remaining positive for up to 18
several weeks before patency and give months. These techniques have never been
results independently of egg output39,42. applied on a large scale.
Indeed, the possible detection of at least Serum antibody detection in T. saginata
one pre-patent case of human intestinal T. infection by use of the indirect haemagglutina-
solium has been reported in a field study32. tion technique was also demonstrated55.
A visually interpreted dipstick assay has Prolonged persistence of antibodies after treat-
been used for detection of Taenia coproanti- ment, between 5 and 19 months in some
gens in faeces directly after collection in patients, was reported. Another study reported
rural communities in both Guatemala and that test sensitivity was 56%, with a false-
Mexico40. In a total of 41 cases of taeniasis, positive rate of 1.35%, leading to the conclusion
diagnosed by either coproantigen testing, that this approach was of limited applicability56.
microscopy, or questioning, the dipstick In contrast to the situation with human tae-
test detected 31 (76%) of all cases. This niasis, serum antibody detection has been
compared to 23 cases diagnosed by more thoroughly investigated in canine taeni-
microscopy (56%) and five by questioning asis. Studies in this area indicated both the
(12%). The dipstick format is known to be presence and diagnostic applicability of serum
less sensitive than the microtitre-based antibodies for the diagnosis of a number of
ELISA, but can be performed with minimal different taeniid species in dogs. A variety of
facilities, making it an extremely attractive antigenic preparations have been used includ-
option for epidemiological studies. ing adult worm somatic and ES products and
The results from studies that employed oncosphere antigens57–60. These studies
coproantigen detection assays for the identi- demonstrated that antibody could be detected
fication of Taenia carriers have indicated that before patency and with high levels of speci-
these assays are considerably more sensitive ficity, although cross-reactions occurred
than microscopy and have working charac- between sera from dogs infected with different
teristics suitable for practical application in taeniid species. Tests for antibodies took some
the field in T. solium endemic areas. Further time to become negative after treatment; those

Sing - Chap 33 4/9/02 4:45 pm Page 338
for antibodies to oncosphere products becom- This serological assay for T. solium taeniasis
ing negative within a few weeks after treat- is a valuable method for identifying T. solium
ment. The ability to test for antibody in saliva tapeworm carriers which overcomes many
was also demonstrated61. of the obstacles associated with ova and par-
asite examination or coproantigen detection.
EITB-T for detection of T. solium taeniasis

Conclusions
In an effort to develop a serological assay for
detection of human taeniasis carriers, an Remarkable advances have been made in the
immunoblot assay, EITB-T, using ES antigens immunodiagnosis of NC in the past two
of adult T. solium tapeworms was developed. decades. A disease that was once diagnosed
ES proteins were collected following in vitro only after surgery, can now be accurately
culture of T. solium tapeworms, which were diagnosed using non-invasive techniques.
harvested from immunosuppressed ham- The EITB for NC has not only revolutionized
sters approximately 30 days after infection diagnosis of NC; it has also been crucial in
with porcine cysts37,38. Proteins that reacted defining the magnitude of the disease world-
with antibodies in the taeniasis positive wide7,63. Future prospects for development of
serum pool, but not antibodies in the cys- simpler tests that would retain the exquisite
ticercosis pool were identified as potential sensitivity and specificity of EITB for diagno-
diagnostic targets. Antigens, ranging in size sis of NC are bright. Advances in immunodi-
from 32.7 kDa to 42.1 kDa, appeared to be agnosis of NC and taeniasis engender
specific for taeniasis infections. Individual promise, not only for better and more rapid
sera from patients with confirmed taeniasis diagnosis of NC, but also for better under-
or cysticercosis were analysed and 95% standing of the pathogenesis of the disease
(69/73) of sera tested from parasitologically and the factors associated with transmission
confirmed T. solium carriers contained anti- dynamics. New methods such as the
bodies to these proteins. Antibodies in sera coproantigen assays and the EITB-T are tools
from persons with other helminthic diseases, that permit sensitive identification of tape-
such as those caused by H. nana, worm carriers. Furthermore, these assays
Echinococcus, Ascaris, Trichuris and other par- may ultimately help identify important epi-
asites, did not cross-react with the ES pro- demiological variables such as the relation-
teins, demonstrating an assay specificity of ship between taeniasis and NC64; the
100%. Furthermore, using sera from a lim- prevalence of taeniasis in a given community;
ited number of parasitologically confirmed the lifespan of the adult tapeworm; and other
taeniasis cases, the EITB-T detected only T. parameters necessary to develop meaningful
solium taeniasis and not T. saginata cases62. strategies for controlling or eliminating NC2.
References
1. García, H.H., Del Brutto, O.H. (2000) Taenia solium cysticercosis. Infectious Diseases Clinics of North
America 14, 97–119.
2. White, A.C., Jr. (2000) Neurocysticercosis: update on epidemiology, pathogenesis, diagnosis and
management. Annual Review of Medicine 51, 187–206.
3. Ramos-Kuri, M., Montoya, R.M., Padilla, A., et al. (1992) Immunodiagnosis of neurocysticercosis.
Disappointing performance of serology (eynzyme-linked immunosorbent assay) in an unbiased
sample of neurological patients. Archives of Neurology 49, 633–636.
4. Flisser, A., Plancarte, A., Correa, D., et al. (1990) New approaches in the diagnosis of Taenia solium
cysticercosis and taeniasis. Annals of Human and Comparative Parasitology 65, 95–98.
5. Rydzewski, A.K., Chisholm, E.S., Kagan, I.G. (1975) Comparison of serologic tests for human cys-
ticercosis by indirect hemagglutination, indirect immunofluorescent antibody, and agar gel precip-
itin tests. Journal of Parasitology 61, 154–155.

Sing - Chap 33 4/9/02 4:45 pm Page 339
6. Tsang, V.C., Brand, J.A., Boyer, A.E. (1989) An enzyme-linked immunoelectrotransfer blot assay and
glycoprotein antigens for diagnosing human cysticercosis (Taenia solium). Journal of Infectious
7. Tsang, V.C.W., García, H.H. (1999) Immunoblot diagnostic test (EITB) for Taenia solium cysticercosis
and its contribution to the definition of this underrecognized but serious public health problem. In:
García, H.H., Martinez, S.M. (eds.) Taenia solium Taeniasis/Cysticercosis. Editorial Universo, Lima,
Peru, pp. 245–256.
cysticercosis and neurocysticercosis. Journal of the Neurological Sciences 142, 1–6.
9. Feldman, M., Plancarte, A., Sandoval, M., et al. (1990) Comparison of two assays (EIA and EITB) and
two samples (saliva and serum) for the diagnosis of neurocysticercosis. Transactions of Royal Society
10. White, A.C., Jr, Robinson, P., Kuhn, R. (1997) Taenia solium cysticercosis: host–parasite interactions
and the immune response. Chemical Immunology 66, 209–230.
11. García, H.H., Gilman, R.H., Catacora, M., et al. (1997) Serologic evolution of neurocysticercosis
patients after antiparasitic therapy. Journal of Infectious Diseases 175, 486–489.
12. Rawlings, D., Ferriero, D.M., Messing, R.O. (1989) Early CT re-evaluation after empiric praziquantel
therapy in neurocysticercosis. Neurology 39, 739–741.
13. White, A.C., García, H.H. (1999) Recent developments in the epidemiology, diagnosis, treatment,
and prevention of neurocysticercosis. Current Infectious Diseases Report 1, 434–440.
14. Wilson, M., Bryan, R.T., Fried, J.A., et al. (1991) Clinical evaluation of the cysticercosis enzyme
linked immunoelectrotransfer blot in patients with neurocysticercosis. Journal of Infectious Diseases
164, 1007–1009.
16. García, H.H., Herrera, G., Gilman, R.H., et al. (1994) Discrepancies between cerebral computed
tomography and Western blot in the diagnosis of neurocysticercosis. American Journal of Tropical
17. Schantz, P.M., Sarti, E., Plancarte, A., et al. (1994) Community based epidemiological investigations
18. Flisser, A. (1994) Taeniasis and cysticercosis due to Taenia solium. Progress in Clinical Parasitology 4,
77–116.
20. Diaz, J.F., Verastegui, M., Gilman, R.H., et al. (1992) Immunodiagnosis of human cysticercosis (Taenia
solium): a field comparison of an antibody-enzyme-linked immunosorbent assay (ELISA), and anti-
gen-ELISA, and an enzyme-linked immunoelectrotransfer blot (EITB) assay in Peru. American
21. Sloan, L., Schnieider, S., Rosenblatt, J. (1995) Evaluation of enzyme-linked immunoassay for serolog-
ical diagnosis of cysticercosis. Journal of Clinical Microbiology 33, 3124–3128.
22. Yang, H.J., Chung, Y.K., Yun, D., et al. (1998) Immunoblot analysis of a 10 kDa antigen in cyst fluid
of Taenia solium metacestodes. Parasite Immunology 20, 483–488.
24. Plancarte, A., Fexas, M., Flisser, A. (1994) Reactivity in ELISA and dot blot of purified GP24, an
immunodominant antigen of Taenia solium, for the diagnosis of human neurocysticercosis.
25. Plancarte, A., Hirota, C., Martinez-Ocana, J., et al. (1999) Characterization of GP39–42 and GP24
antigens from Taenia solium cysticerci and of their antigenic GP10 subunit. Parasitology Research 85,
680–684.
26. Greene, R.M., Wilkins, P.P., Tsang, V.C. (1999) Diagnostic glycoproteins of Taenia solium cysts share
homologous 14- and 18-kDa subunits. Molecular Biochemistry and Parasitology 99, 257–261.
27. Bueno, E.C., Vaz, A.J., Machado, L.D., et al. (2000) Specific Taenia crassiceps and Taenia solium anti-
genic peptides for neurocysticercosis immunodiagnosis using serum samples. Journal of Clinical
Microbiology 38, 146–151.

Sing - Chap 33 4/9/02 4:45 pm Page 340
28. Greene, R.M., Hancock, K., Wilkins, P.P., et al. (2000) Taenia solium: molecular cloning and serologic
evaluation of 14- and 18-kDa related, diagnostic antigens. Journal of Parasitology 86, 1001–1007.
29. Chung, J.Y., Bahk, Y.Y., Huh, S., et al. (1999) A recombinant 10-kDa protein of Taenia solium metaces-
todes specific to active neurocysticercosis. Journal of Infectious Diseases 180, 1307–1315.
30. Sako, Y., Nakao, M., Ikejima, T., et al. (2000) Molecular characterization and diagnostic value of
Taenia solium low-molecular-weight antigen genes. Journal of Clinical Microbiology 38, 4439–4444.
31. Hall, A., Lathman, M.C., Cromton, D.W., et al. (1981) Taenia saginata (Cestoda) in western Kenya: the
reliability of faecal examinations in diagnosis. Parasitology 83, 91–101.
32. Allan, J.C., Velasquez-Tohom, M., Garcia-Noval, J., et al. (1996) Epidemiology of intestinal taeniasis
in four rural, Guatemalan communities. Annals of Tropical Medicine and Parasitology 90, 157–165.
33. Proctor, E.M. (1972) Identification of tapeworms. South African Medical Journal 46, 234–238.
34. Eldson-Dew, R., Proctor, E.M. (1965) Distinction between Taeniarhynchus saginata and Taenia solium.
South African Journal of Science 61, 215–217.
35. Babos, S., Nemeth, I. (1962) Az echinococcis szerodiagnoztikajanak kerderehez. Magyar Allatorvosok
Lapja 17, 58–60.
36. Machnicka, B., Krawczuk, S. (1988) Hymenolepis diminuta antigen: detection in faeces of rats. Bulletin
of Polish Academy of Science and Biological Science 36, 103–106.
37. Allan, J.C., Craig, P.S. (1989) Coproantigens in gut tapeworm infections: Hymenolepis diminuta in
rats. Parasitology Research 76, 68–73.
38. Allan, J.C., Avila, G., Garcia-Noval, J., et al. (1990) Immunodiagnosis of taeniasis by coproantigen
detection. Parasitology 101, 473–477.
39. Allan, J.C., Craig, P.S., Garcia-Noval, J., et al. (1992) Coproantigen detection for immunodiagnosis of
echinococcossis and taeniasis in dogs and humans. Parasitology 104, 347–356.
40. Allan, J.C., Mencos, F., Garcia-Noval, J., et al. (1993) Dipstick dot ELISA for the detection of Taenia
coproantigens in human. Parasitology 107, 79–85.
41. Allan, J.C., Velasquez-Tohom, M., Torres-Alvarez, R., et al. (1996) Field trial of the coproantigen-
based diagnosis of Taenia solium taeniasis by enzyme-linked immunosorbent assay. Amercian Journal
42. Deplazes, P., Gottstein, B., Stingelin, Y., et al. (1990) Detection of Taenia hydatigena coproantigens by
ELISA in dogs. Veterinary Parasitology 36, 91–103.
43. Deplazes, P., Exkert, J., Pawlowski, Z.S., et al. (1991) An enzyme-linked immunosorbent assay for
diagnostic detection of Taenia saginata copro-antigens in humans. Transactions of the Royal Society of
44. Maass, M., Delgado, E., Knobloch, J. (1991) Detection of Taenia solium antigens in merthiolate-form
preserved stool samples. Tropical Medicine and Parasitology 42, 112–114.
45. Maass, M., Delgado, E., Knobloch, J. (1992) Isolation of an immunodiagnostic Taenia solium
coproantigen. Tropical Medicine and Parasitology 43, 201–202.
46. Machnicka, B., Dziemian, E., Zwierz, C. (1996) Detection of Taenia saginata antigens in faeces by
ELISA. Applied Parasitology 37, 106–110.
47. Machnicka, B., Dziemaian, E., Zwierz, C. (1996) Factors conditioning detection of Taenia saginata
antigens in faeces. Applied Parasitology 37, 99–105.
48. Sakai, H., Furusawa, R., Oku, Y., et al. (1996) Echinococcus multilocularis copro-antigen detection in
golden hamster, an alternative definitive host. Experimental Animals 45, 275–278.
49. Malgor, R., Nonaka, N., Basmadjian, I., et al. (1997) Copro-antigen detection in dogs experimentally
and naturally infected with Echinococcus granulosus by a monoclonal antibody-based enzyme-linked
immunosorbent assay. International Journal of Parasitology 27, 1605–1612.
50. Ramsdell, S. (1927) A note on the skin reaction in Taenia infestation. Journal of Parasitology 14, 102–105.
51. Brunner, M. (1928) Immunological studies in human parastic infestation. Journal of Immunology 15,
83–101.
52. Podyapolskaya, V.P., Kamalova, A.G. (1942) Cutaneous test as a method of diagnosis of taeniasis
and cysticercosis. Meditsinskaia Parazitologiia I Parazitarnye (Bolezni) 11, 99–105.
53. Machinicka Roguska, B., Zweirz, C. (1970) Intradermal test with antigenic fractions in Taenia sagi-
nata infection. Acta de Parasitologica Polonica 18, 293–299.
54. Slusarski, W., Zapart, W. (1971) Diagnostic value of intradermal test with acid-soluble protein frac-
tions in Taenia infections in man. Acta de Parasitologica Polonica 19, 445–455.
55. Machinicka Roguska, B., Zweirz, C. (1971) Hemagglutination reaction in people with Taenia saginata
invasion. Wiadomosci Parazytologiczne (Warsaw) 14, 27–33.

Sing - Chap 33 4/9/02 4:45 pm Page 341
56. Flentje, B., Padelt, H. (1981) Value of a serologic diagnosis of Taenia saginata infestation in the
human. Angew Parasitology 22, 65–68.
57. Jenkins, D.J., Rickard, M.D. (1985) Specific antibody responses to Taenia hydatigena, Taenia pisiformis
and Echinococcus granulosus infection in dogs. Australian Veterinary Journal 62, 72–78.
58. Heath, D.D., Lawrence, S.B., Glennie, A., et al. (1985) The use of excretory and secretory antigens of
the scolex of Taenia ovis for the serodiagnosis of infection in dogs. Journal of Parasitology 71, 192–199.
59. Jenkins, D.J., Rickard, M.D. (1986) Specific antibody responses in dogs experimentally infected with
Echinococcus granulosus. American Journal of Tropical Medicine and Hygiene 35, 345–349.
60. Gasser, R.B., Lightowlers, M.W., Obendorf, D.L., et al. (1988) Evaluation of a serological test system
for the diagnosis of natural Echinococcus granulosus infection in dogs using E. granulosus protoscolex
and oncosphere antigens. Australian Veterinary Journal 65, 369–373.
61. Kinder, A., Carter, S.D., Allan, J., et al. (1992) Salivary and serum antibodies in experimental canine
taeniasis. Veterinary Parasitology 41, 321–327.
62. Wilkins, P.P., Allan, J.C., Verastegui, M., et al. (1999) Development of serologic assay to detect Taenia
solium taeniasis. American Journal of Tropical Medicine and Hygiene 60, 199–204.
63. Tsang, V.C.W., Wilson, M. (1995) Taenia solium: an underrecognized but serious public health prob-
lem. Parasitology Today 11, 124–126.
64. Gilman, R.H., Del Brutto, O.H., García, H.H., et al. (2000) Prevalence of taeniosis among patients
with neurocysticercosis is related to severity of infection. Neurology 55, 1062.
65. Thompson, J.D., Gibson, T.J., Plewniak, F., et al. (1997) The CLUSTAL_X windows interface: flexible
strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25,
4876–4882.

34 Antigen-based Immunoassays in the

Diagnosis of Taenia solium Cysticercosis
Dolores Correa, Raquel Tapia-Romero, Antonio Meza-Lucas and

Olga Mata-Ruiz
Introduction review literature related to polyclonal and

monoclonal antibody (PoAb and MoAb)-
Establishing a diagnosis of Taenia solium based antigen detection assays, and their role
cysticercosis usually involves several inves- in clinical and epidemiological studies.
tigations including immunological tests
principally based upon antibody detection in
cerebrospinal fluid (CSF) or serum (reviewed Overview of Studies on Antigens in
in Chapter 33). In general, the presence of Human Fluids
antibodies in symptomatic cases in associa-
tion with computed tomography (CT) or Taenia solium metacestode antigens were first
magnetic resonance imaging (MRI) compati- studied in the CSF by latex agglutination
ble with neurocysticercosis (NC) is considered using PoAb7. A sensitivity and specificity of
diagnostic. Antibody-based immunoassays 77% and 97% respectively were reported.
have also been used in epidemiological stud- Subsequently, two PoAb-based direct
ies of T. solium cysticercosis1–3. They permit ELISAs were described wherein CSF sam-
the detection of transmission ‘hot spots’ and ples were directly used to coat the ELISA
the identification of risk factors. plates, as antigen source, and developed
One limitation of antibody-based tests is with rabbit PoAbs8,9. These methods were
that antibodies may be detected in a certain able to detect 59–77% of cases of NC.
proportion of individuals who do not have Following these initial studies, several direct
active disease, for instance, those with calci- or capture ELISA and high pressure liquid
fied lesions4. In addition, two-thirds of chromatography-ELISA (HPLC-ELISA) for-
seropositive individuals have no lesion iden- mats employing MoAbs or PoAbs have been
tifiable upon CT scans5. Thus, the presence of developed (Table 34.1)7–10,12–14,16–19. Their
antibodies does not constitute direct evidence reported sensitivity varied between 0 and
of a living parasite within the host. In order 93%. Most studies have focused upon the
to overcome the limitations of antibody- presence of antigens in CSF, while only a few
based immunoassays, several attempts have have perused their presence in serum20–22.
been made to develop antigen-based assays So far, most of the studies have found an
in the belief that the detection of antigens antigen or a group of antigens of molecular
would correlate with presence of live and weight of around 200 kDa, both in CSF and
active cysticerci6–19. In the present chapter we serum. Estrada et al. detected two antigens of


Table 34.1. Overview of studies of antigen detection in human cysticercosis.
344
Singh - Chap 34
Antibody Antigens:
(capture molecular No. of No. of Sensitivity Specificity
Method Sample system) weight (kDa) patients controls (%) (%) Reference
Agglutination CSF Anti-CE ND 215 31 77 97 7
4/9/02
PoAb
ELISA/direct CSF Anti-CE ND 17 48 77 100 8,9
Dot-ELISA/direct PoAb 59 100

EITB CSF Anti-CE 190, 230 18 18 78 100 10
4:45 pm
PoAb
HP10 200 – – 72 100 13
MoAb
ELISA/homologous capture CSF HP12 12,14
MoAb ND – – 72 100
Porcine anti-CE
Page 344
Porcine anti-AgB ND 31 24 48 100

100 – – 48 100
ELISA/homologous capture CSF ND 52
H7 MoAb 200 25 ND 14
Serum ND 44
D. Correa et al.
HPLC-ELISA/direct Fraction 75 5 29 100

CSF Anti-CE 400 16
Fraction – – 56 100
33–240
ELISA/heterologous capture CSF 212 13
Anti-CE
PoAb/ 150 ND ND 17
Serum MoAb 255 0

ELISA/direct CSF 1F11 MoAb ND 16 40 82 100 18
ELISA/homologous capture CSF 4F8 MoAb ND 231 ND 77 (NC) / 97 ND 19
(subcutaneous
cysticercosis)
anti-CE: Anti-crude extract. MoAb: Monoclonal antibody.

anti-AgB: Anti-antigen B. CSF: Cerebrospinal fluid.
ND: Not determined. EITB: Enzyme-linked immunoelectrotransfer blot.
PoAb: Polyclonal antibody. HPLC-ELISA: High pressure liquid chromatography-ELISA.
Antigen-based Immunoassays in Diagnosis 345
molecular weight 230 kDa and 190 kDa, in 14 blot (EITB)20,23,24. In contrast, antigens are
of 18 CSF samples using an immunoblot uncommonly detected. One reason for this
assay10. Similarly, a sensitivity of 75–86% observation could be the rapid sequestration
was obtained when CSF of patients with NC of antigens. Several findings support this
were evaluated with the HP10 MoAb11–13. notion. We detected antigen B, a component
The latter is specific for a 200-kDa glycopro- of the excretory–secretory products of cys-
tein. A molecule of similar molecular weight ticercus, in only 14% of the CSF samples of
was also detected by another MoAb (H7) in patients with NC12,25,26. This particular anti-
more than 50% of cases in CSF and serum of gen is immunodominant, i.e. it elicits a
patients with NC14. We have found five dif- strong antibody response23,27. It binds to col-
ferent antigens using an immunoblot assay lagen with high affinity, as well as to the C1q
in multilesional cysticercosis. A 200-kDa component of the complement cascade28,29.
band was most frequent among the five anti- We surmise that soon after secretion by the
gens, both in CSF and serum14,15. parasite, the antigen is sequestered in the
The 200-kDa antigen that has been identi- host tissues or serum. In a similar manner,
fied in most studies is best recognized by a other antigens that elicit antibody responses
capture assay using the HP10 MoAb in a can either be sequestered in host tissues adja-
homologous system12,13. It is a glycoprotein, cent to the parasite, ingested by phagocytes
having a repetitive epitope11. However, it is or transported to lymphoid tissues, where
not species-specific and this might interfere they may thus escape detection.
with its diagnostic role in extracerebral cys-
ticercosis in areas where other cestode infec-
tions are also prevalent. Among other Evidence of immune complexes in
molecules that have been found in CSF or neurocysticercosis
serum of patients with NC, a fraction larger
than 400 kDa was detected in 29% of patients’ Immune complex formation may be one of
CSF16. Studies by our group and Cho et al., the mechanisms by which antigens disap-
using PoAb and MoAb respectively, have pear and evade detection. There is evidence
revealed the presence of a 150-kDa molecule for the presence of immune complexes in
in 13% of CSF samples from NC cases6,15,17. cysticercosis. Community-based epidemio-
Besides, bands of 183 kDa and 50 kDa have logical studies have attempted to detect both
been found in the serum and the CSF respec- antibodies and antigens in sera of individu-
tively of NC patients in very few instances15. als21,22,30. However, it is extremely rare to
Two MoAb-based methods reported high sen- find antigens and antibodies concurrently in
sitivities (77–97%), but the antigens recognized a given serum sample. In two different stud-
were not identified18,19. An interesting finding ies of epileptics in rural communities of
from one of these studies was that individuals Mexico21 and Brazil (I. Gomes, A. Meza-
with subcutaneous cysticercosis presented Lucas, M. Veiga, et al., Universidade Federal
with antigens in CSF more frequently than da Bahia, Brazil, unpublished observations)
those with intracranial involvement alone19. respectively, the relation between age and
prevalence of antibodies was found to be
inverse to that between age and antigens.
Limitations of Antigen Detection The inability to detect antigens and antibod-
ies in concurrent samples is likely to be
Lack of antigens or sequestration? related to the formation of immune com-
plexes. Indirect evidence for the existence of
A variety of antibody responses in sera and immune complexes also came from a report
CSF of patients with NC have been demon- of nephrotic syndrome complicating cys-
strated with low-resolution procedures like ticercosis31. Renal biopsy revealed membra-
immunoelectrophoresis as well as by more nous glomerulonephritis, implicating the
contemporary and highly sensitive tests such production of immune complexes, surmised
as enzyme-linked immunoelectrotransfer to occur in response to cysticercal infection.

346 D. Correa et al.
Swine antibodies against a crude cysticer- mising the sensitivity of the assay.
cus extract detected antigens in 48% of Accordingly, a balanced dilution needs to
human CSF samples, but gave negative be determined in order to optimize perfor-
results with sera of cysticercotic pigs12,32. mance of the assay.
The observed discrepancy between human
CSF and pig sera could be explained by the
similarity between native antibodies in Potential Applications of Antigen
infected pigs and the experimentally gener- Detection in the Study of T. solium
ated antibodies. Antigen epitopes may be Infection
blocked by native antibodies leading to
immune complex formation; the failure of Species specific antigens
experimentally generated antibodies to
detect antigens in pig sera may be related to PoAbs against crude preparations of
this immune complex formation. metacestodes cross-react with antigens of
other cestodes as well. This holds true for
MoAbs that have been developed for T.
Absence of antigens or technical solium antigen detection. Indeed, certain
problems? MoAbs that detect T. solium antigens were
raised against T. saginata antigens12,13,32.
The low yield of antigen detection assays Antigen detection assays are therefore only
could be related to several of the technical genus-specific, and their use is limited in
problems described below. In the capture areas where hydatidosis and cysticercosis
assays, PoAbs produce high backgrounds, are co-endemic. Recently, we developed a
confounding discrimination between posi- MoAb against the adult T. solium which
tive and negative samples. On the other reacts much less strongly or not at all with
hand, when MoAbs are used, small quanti- T. saginata and other parasitic antigens (Y.
ties of antigen may escape detection. Medina-Flores, R. García-Rodea, D. Correa,
Furthermore, in homologous-antibody cap- Instituto de Diagnóstico y Referencia
ture systems, it is necessary to have anti- Epidemiológicos & Instituto Nacional de
bodies that react with repetitive epitopes of Pediatría, Ministry of Health, México City,
the antigenic molecule. The latter problem México, unpublished observations). Its use
is overcome in direct capture assays since for antigen detection in cysticercosis
the sample is directly adsorbed. Estrada deserves further investigation.
and Khun developed an ELISA where CSF
antigens were directly bound to polystyrene
wells8. All four confirmed cases and one out Stage specific antigens
of seven patients with a strong clinical sus-
picion of NC were positive by this assay. Positive antigen seroassays do not neces-
Likewise, the sensitivity of a similar assay sarily imply a diagnosis of T. solium cys-
in a larger group of patients was 75%9. ticercosis because of sharing of antigens
While direct capture systems preclude the between the metacestode and adult stages
need for repetitive epitopes, they require of T. solium. We found circulating antigens
large antigen concentrations and therefore in sera of almost 20% of cases with taenia-
give positive results only in those individu- sis in an endemic community of Mexico21.
als with a large cyst load. Another technical In the hamster model of taeniasis, adult
point that has bearing on the positive yield antigens have been demonstrated to cross
is that concentrated serum samples inhibit the intestinal epithelium and enter the cir-
the signal obtained due to antigen. Dilution culation (G. Avila, M. Benitez,
improves this signal but may reduce anti- L. Aguilar, et al., Universidad Nacional
gen concentration as well, thereby compro- Autónoma de México, México DF, México,

unpublished observations). The elaboration Antigen Detection Assays:

of stage-specific antigens may turn out to Community-based Epidemiological
be useful in the differentiation of infection Applications
due to the adult and metacestode forms of
T. solium. The application of antigen detection assays
in community based serosurveys has been
limited on account of their poor yield in the
Antigens of live and degenerating serum in comparison to CSF. A survey of an
cysticerci endemic community in Mexico indicated an
antigen positivity rate of 1%20. In this study,
It is desirable to have serological test(s) that 16% of individuals with late-onset epilepsy
differentiate between live-viable and dying- presented antigens in their sera. In a similar
degenerating cysticerci. In experimental T. study in another endemic region of Mexico,
saginata cysticercosis, antigens appear within 19% of individuals with late-onset epilepsy
4 weeks of infection, and disappear rapidly were positive by antigen-based assays in
when the parasites are eradicated by treat- their sera21. However, no association
ment11. Conceivably, the detection of these between the antigen positivity and late-
antigens may indicate the presence of live onset epilepsy was found in a survey in
parasite. With specific reference to T. solium, Burundi30. Further studies are needed to
the HP10 MoAb was found to be specific for establish the utility of antigen-detection
a surface component of the metacestode, assays for epidemiological studies and con-
while another (HP12) reacted against a vesic- trol programme surveillance.
ular fluid component11. A capture assay
employing the former was 72–86% sensitive
in CSF of humans with NC12,13. In contrast, Conclusions
the HP12 MoAb gave comparatively lower
sensitivity; it failed to detect massive infec- Antigen-detection assays have been used
tion in pigs, and was able to detect antigens infrequently in comparison to antibody
in only half of the human cases12,32. Another based serodiagnosis in clinical and epidemi-
MoAb developed by Cho et al. against an ological studies of T. solium cysticercosis.
antigen of vesicular fluid produced positive There are several potential advantages of
antigen bands in 11% cases; out of these, a systems that employ antigens for serodiag-
number of instances became positive only nosis. The detection of antigens correlates
after praziquantel treatment17. The discrepant with the presence of live cysticerci. Studies of
results obtained with MoAbs against surface antigens thereof may be useful in monitoring
and vesicular fluid components could be disease progression and response to anticys-
related to the evolutionary stage of cysticerci. ticercal therapy. Preliminary evidence sug-
Therefore, CSF or sera of individuals with gests that it might be possible to differentiate
live, viable cysticerci are likely to be surface between T. solium infection due to adult and
antigen-positive and vesicular fluid antigen- metacestode forms and also between live
negative, while those with dying-degenerat- and dying-degenerating stages of cysticerco-
ing cysticerci are expected to be both surface sis. A major limitation of antigen-detection
and vesicular fluid antigen positive. A caveat systems however, is the lack of sensitive
of this principle is that in actual clinical situa- assays that would be able to pick up oligole-
tions, live and dying cysticerci often coexist sional disease. The challenge is to improve
at any given time. Nevertheless, antigen their diagnostic yield by the use of standard-
studies may be useful in follow-up and moni- ized, low-background specific monoclonal
toring disease progression and response to antibody cocktails and of amplifying sys-
anticysticercal treatment33. tems such as the polymerase chain reaction.

348 D. Correa et al.
References
1. García, H.H., Del Bruto, O.H. (2000) Taenia solium cysticercosis. Infectious Disease Clinics of North
America 14, 97–119.
2. Antoniuk, S. (1999) Epidemiology of neurocysticercosis. Revue Neurologique 29, 331–334.
4. Tsang, V.C.W., Brand, J.A., Boyer, A.E. (1989) An enzyme linked immunoelectrotransfer blot assay
and glycoprotein antigens for diagnosis of human cysticercosis (Taenia solium). Journal of Infectious
5. Schantz, P.M., Sarti, E., Plancarte, A., et al. (1994) Community-based epidemiological investigations
6. Correa, D. (1998) Los Antígenos del Cisticerco de Taenia solium: Aspectos Básicos y Aplicación en el
Diagnóstico Clínico y en Estudios Epidemiológicos. PhD thesis, Instituto de Investigaciones
Biomédicas, UNAM, México.
7. Velasco, O.C., Guzmán, B.C., Gutiérrez, Q.M., et al. (1983) Comparación de una técnica de detección
de antígenos solubles de Cysticercus cellulosae. Salud Pública de México 25, 205–208.
8. Estrada, J.J., Kuhn, E.R. (1985) Immunochemical detection of antigens of larval Taenia solium and
anti-larval antibodies in the cerebrospinal fluid of patients with neurocysticercosis. Journal of the
9. Tellez-Girón, E., Ramos, M., Dufour, L., et al. (1987) Detection of Cysticercus celullosae antigens in
the cerebrospinal fluid by dot enzyme-linked immunosorbent assay (Dot-ELISA) and standard
ELISA. American Journal of Tropical Medicine and Hygiene 37, 169–173.
10. Estrada, J.J., Estrada, A.J., Kuhn, E.R. (1989) Identification of Taenia solium antigens in cerebrospinal
fluid and larval antigens from patients with neurocysticercosis. American Journal of Tropical Medicine
11. Harrison, L.J.S., Joshua, G.W.P., Wright, S.H., et al. (1989) Specific detection of circulating
surface/secreted glycoproteins of viable cysticerci in Taenia saginata cysticercosis. Parasite
12. Correa, D., Sandoval, M.A., Harrison, L.J., et al. (1989) Human neurocysticercosis: comparison of
enzyme immunoassay capture techniques based on monoclonal and polyclonal antibodies for the
detection of parasite products in cerebrospinal fluid. Transactions of the Royal Society of Tropical
13. García, H.H., Harrison, L.J., Parkhouse, R.M., et al. (1998) A specific antigen-detection ELISA for the
diagnosis of human neurocysticercosis. Transactions of the Royal Society of Tropical Medicine and
Hygiene 92, 411–414.
14. Correa-Beltrán, M.D., Proaño-Narvaez, J., Allan, J.C., et al. (1997) Immunodiagnóstico de neurocis-
ticercosis mediante la determinación de anticuerpos y antígenos en líquido cefalorraquídeo y suero.
In: Arraigada, C., Nogales-Gaete, J., Apt, W. (eds) Neurocisticercosis. Aspectos Epidemiológicos,
Patológicos, Immunológicos, Clínicos, Imagenológicos y Terapéuticos. Arrynog ediciones, Santiago de
Chile, pp. 279–286.
15. Mata-Ruiz, O. (1996) Caracterización de los Antígenos de la Larva de Taenia solium Presentes en el
Suero y el Liquido Cefalorraquídeo de Pacientes Cisticercosos. Thesis, Facultad de Estudios
Superiores, Cuautitlán, UNAM, México.
16. Choromanski, L., Estrada, J.J., Kuhn, R.E. (1990) Detection of antigens of larval Taenia solium in the
cerebrospinal fluid of patients with the use HPLC and ELISA. Journal of Parasitology 76, 69–73.
17. Cho, S.Y., Kong, Y., Kim, S.I., et al. (1992) Measurement of 150 kDa protein of Taenia solium metaces-
todes by antibody-sandwich ELISA in cerebrospinal fluid of neurocysticercosis patients.
Kisaengchunghak Chapchi 30, 299–307.
18. Wang, C.Y., Zhang, H.H., Ge, L.Y. (1992) A MAb-based ELISA for detecting circulating antigen in
CSF of patients with neurocysticercosis. Hybridoma 11, 825–827.
19. Wang, C.Y., Li, Q.S., Zhang, H.H., et al. (1993) Detection of cAg in CSF of 231 cerebral cysticercosis
patients. Chung kuo Chi Sheng Chung Hsueh Yu Chi Shang Chaung Ping Tsa Chih 11, 276–278.

20. Aranda-Alvarez, J.G., Tapia-Romero, R., Alcántara-Anguiano, I., et al. (1995) Human cysticercosis:
risk factors associated with circulating serum antigens in an open community of San Luis Potosí,
México. Annals of Tropical Medicine and Parasitology 89, 689–692.
21. Correa, D., Sarti, E., Tapia-Romero, R., et al. (1999) Antigens and antibodies in sera from human
cases of epilepsy or taeniosis from an area of Mexico where Taenia solium cysticercosis is endemic.
Annals of Tropical Medicine and Parasitology 93, 69–74.
22. García-García, L., Torres, M., Correa, D., et al. (1999) Prevalence and risk factors for cysticercosis and
taeniosis in an urban population represented by soldiers and their relatives. American Journal of
23. Flisser, A., Woodhouse, E., Larralde, C. (1980) Human cysticercosis: antigens, antibodies and non-
responders. Clinical and Experimental Immunology 39, 27–37.
24. Larralde, C., Montoya, R.M., Scuitto, E., et al. (1989) Deciphering Western blots of tapeworm in anti-
gens of Taenia solium, Echinococcus granulosus and Taenia crassiceps resolving with sera from neuro-
cysticercosis and hydatid disease patients. American Journal of Tropical Medicine and Hygiene 40,
282–290.
25. Laclette, J.P., Merchant, M.T., Willms, K. (1987) Histological and ultrastructural localization of anti-
gen B in the metacestode of Taenia solium. Journal of Parasitology 73, 121–125.
26. Laclette, J.P., Rodríguez, A., Landa, A., et al. (1989) The coexistence of Taenia solium cysticerci and the
pig: role of antigen B. Acta Leidensia 57, 115–122.
27. Espinoza, B., Ruiz-Palavios, G., Tovar, A., et al. (1986) Characterization by enzyme linked
immunosorbent assay of the humoral immune response in patients of neurocysticercosis and its
application in immunodiagnosis. Journal of Clinical Microbiology 24, 536–541.
28. Plancarte, A., Flisser, A., Larralde, C. (1983) Fibronectin-like properties in antigen B from the cys-
ticercus of Taenia solium. Cytobios 36, 83–93.
29. Laclette, J.P., Shoemaker, C., Richter, D., et al. (1992) Paramyosin inhibits complement C1. Journal of
30. Newell, E., Vyungimana, F., Geerts, S., et al. (1997) Prevalence of cysticercosis in epileptics and mem-
bers of their families in Burundi. Transactions of the Royal Society of Tropical Medicine and Hygiene 91,
389–391.
31. Rabenantoandro, R., Rasoloarijaona, L., Raharivelina, C., et al. (1996) Extramembranous glomeru-
lonephritis and cysticercosis. Santé (Montrouge, France) 6, 254–257.
32. Rodriguez-del-Rosal, E., Correa, D., Flisser, A. (1989) Swine cysticercosis: detection of parasite prod-
ucts in serum. Veterinary Record 124, 488.
33. Yonghao, Z., Junping, L., Minru, Z., et al. (1995) Observations on circulating antigen from patients
with cysticercosis before and after treatment. Chung kuo Chi Sheng Chung Hsueh Yu Chi Shang Chaung
Ping Tsa Chih 13, 224–227.

35
Polymerase Chain Reaction in the
Diagnosis of Taenia solium Cysticercosis
Taru Meri and Seppo Meri
Introduction specific diagnosis, sequencing can give infor-

mation on virulence factors and mutations and
In general, molecular methods offer faster, help in the identification of ‘new’ pathogens1.
more sensitive and/or more specific diagnosis With specific reference to parasitology,
of microbial infections than traditional meth- molecular methods can be used for distin-
ods (e.g. cultivation, serology or microscopic guishing between morphologically or anti-
analysis). Detection of microbes from their vir- genically similar parasites and their variants.
ulence factors, for example from the produc- More importantly, they allow detection of an
tion of toxins or from the presence of organism from a very small parasitic load,
antimicrobial resistance genes, is possible with which could sometimes be difficult with tra-
molecular methods. This allows rapid identifi- ditional methods. The results of PCR assays
cation decreasing overall patient care costs, are independent of the patient’s immunocom-
avoiding unnecessary treatments and guiding petence and previous clinical history. Also,
more accurate medical care. Techniques in PCR results are positive regardless of the state
molecular diagnostics usually incorporate of infection, for example whether it is acute or
nucleic-acid-based assays to detect pathogens latent. The organisms detected need not be
or products of pathogens, like toxins. A alive or viable. There are only a few nucleic-
reporter DNA or RNA molecule called a probe acid-based radioisotopic assays described for
or a primer, is used to either amplify (in poly- the diagnosis of flukes (Trematoda), which are
merase chain reaction or PCR) or detect (by traditionally diagnosed by the presence of
hybridization) DNA or RNA sequences of worm eggs in patients’ samples2. Nematodes,
pathogens. In the hybridization assay, target on the other hand, are usually smaller in size,
nucleic acids are immobilized on a solid phase and the number of species infecting humans
and detected using labelled nucleic acid is larger. A PCR-based analysis of trichinel-
probes. When a target DNA is digested, elec- losis was able to differentiate domestic iso-
trophoretically separated and detected with a lates from the sylvatic ones3. In particular,
probe, the procedure is called Southern blot- since the infective microfilariae of most nema-
ting. When the target molecule is RNA, the todes are small in size and the number can
procedure is called Northern blotting. Nucleic vary considerably during infection, species
acid amplification using the PCR, nowadays a identification with traditional methods is
rapid and automated procedure, will be dis- laborious and difficult. Also, in some species
cussed in detail in the next section of this chap- the presence of microfilariae in the peripheral
ter. In addition to providing an accurate and blood varies periodically and in a species-


352 T. Meri and S. Meri
specific manner. PCR-based amplification should be specific for the target organism.
assays specific for e.g., Wuchereria bancrofti, The process consists of three steps. The first
Loa loa, Onchocerca volvulus, Setaria digitata and involves heating of the double-stranded
Dirofilaria sp., have been developed for use in sample DNA to denature it into two single-
research and diagnostics4–8. New PCR-based stranded DNA templates. In the second step,
methods for the diagnoses of multicellular the sample is cooled down for primers to
parasites are now being developed. anneal to the single-stranded DNA targets.
The annealing temperature is important for
the specificity and function of the PCR. The
Overview of PCR Technique final step entails amplification, during
which a thermostable DNA-polymerase syn-
Polymerase chain reaction is based on thesizes new DNA strands to the unfinished
amplification of a known sequence from the single strands from the nucleotides pro-
target DNA with two oligonucleotide vided in the mixture so that both strands are
primers. The sequence to be amplified fully built (Fig. 35.1). These amplification
5 3
Target double-stranded DNA
3 5
Heating of the reaction mixture →
Double strand is denatured,
Primers anneal to target binding sites
5 3
Primer A
Cycle 1
Primer B
3 5
Elongation of target DNA leading to
formation of two double-stranded
DNA with strands of variable lengths
Annealing, binding of primers and elongation
Cycle 2
Annealing, binding of primers and elongation
Cycle 3
Fig. 35.1. Polymerase chain reaction. The template DNA, primers, nucleotides and DNA polymerase are
mixed in the presence of a suitable salt concentration. One reaction cycle consists of three steps:
denaturation, annealing and elongation. During each cycle, the amount of DNA is duplicated.

PCR in the Diagnosis of Cysticercosis 353
cycles are usually repeated 25–35 times to DNA polymerases

produce a detectable amount of the ampli-
fied target DNA. In each cycle the amount of The discovery of a thermostable DNA poly-
DNA is duplicated. PCR is a very effective merase, which is able to catalyse polymer-
and sensitive method; under optimized cir- ization at high temperatures, has allowed
cumstances as little as 1 pg of a template is the automation of the PCR and improved
enough to produce 1 g of the target DNA the method in more specific and sensitive
after 30–35 cycles. direction. The most widely used ther-
mostable DNA polymerase (Taq poly-
merase) comes from the bacterium, Thermus
Template aquaticus. It is used by most of the PCR pro-
tocols for diagnostic work. Nowadays, a
The total genomic DNA from the target number of themostable DNA polymerases
organism can be used as a starting material are commercially available. Their enzymatic
for a diagnostic PCR. Steps involved in the properties have been reviewed elsewhere10.
extraction of DNA from cyst, biopsy or tis- Taq polymerase is suitable, for example, in
sue samples are explained in the Appendix. the Taenia PCR. The amount of Taq poly-
In normal laboratory experiments, less than merase used is usually 2–2.5 units per
1 g of total genomic DNA is sufficient for 100 l reaction.
PCR analysis. The amount of template is
important in the reaction. If the DNA sam-
ple is too dilute, for instance, if it is taken Polymerase Chain Reaction in
from individual cell or paraffin-embedded T. solium Cysticercosis
tissues, the probability of collision between
the template and the primers is reduced in In cysticercosis, the number, location and
the reaction leading to formation of morphology of the cysts is not always opti-
primer–dimers and other artefacts9. The mal for diagnosis with traditional methods.
amount of sample DNA can be determined
Computed tomography (CT) and magnetic
either by agarose gel electrophoresis or more
resonance imaging (MRI) are very useful in
accurately by measuring the absorbance of
establishing a diagnosis of NC in routine
the sample (at 260 nm) before performing
clinical practice. Indirect evidence for cys-
the PCR analysis.
ticercosis may be provided by demonstra-
tion of intestinal taeniasis by microscopic
detection of eggs in faecal specimens or by a
Primer design
somewhat more sensitive analysis of
coproantigens11. However, at times the
Primers are usually 15–30 bases long and
results of imaging, serology and faecal
their concentrations in the reaction mixture
vary from 0.05 mol to 0.5 mol. Primers examination are ambiguous and inadequate
should be exact matches to the desired target for firm diagnosis. Thus, additional tools,
sequence and should not have homology to e.g. histology and/or PCR of a removed
any other sequence in the template mixture. cyst-like structure, are needed. DNA probes
When selecting a primer for PCR, its CG- specific for various Taenia sp. have been
content, which also determines the annealing used to detect eggs, and proglottides from
temperature, should be similar to that of the human faecal samples as well as adult
fragment being amplified. Primers should worms or cysts12–16. They have also been
not contain major secondary structures or be used in the diagnosis of cysticercosis with
complementary to each other to avoid self- atypical presentations17. The sample for PCR
annealing. Computer programs can be used analysis of cysticercosis can be an entire or
to design primers. The use of previously part of a suspicious cyst. A simultaneous
published and established primers is recom- histopathological examination of the sample
mended for routine diagnostic work. is advisable to corroborate PCR results.

DNA extraction specific probes from the genomic DNA

libraries of T. solium and T. saginata and
Extraction of DNA should be performed used them in hybridization assays for
from the sample before using it in the PCR Taenia eggs with high sensitivity and speci-
and the amount of DNA extracted should ficity13. A 158-bp DNA sequence consti-
be checked. The sample should not be tuted the T. solium specific DNA probe
fixed with formalin, because this might while another DNA segment encoding
affect the composition and behaviour of cytochrome c oxidase 1 gene was recog-
the DNA. If the sample has to be stored, nized by the T. saginata specific probe. The
for example, during transport, either 70% probes reliably differentiated between T.
ethanol or freezing are preferred options. saginata and T. solium eggs. In addition the
Different modifications of DNA isolation probes did not significantly hybridize to
methods have been published, but these genomic DNA of E. granulosus and other
are mostly based on extraction of the DNA Taenia sp. We used primers designed to
with phenol-chloroform. The tissue sam- amplify the 18S ribosomal RNA gene of T.
ples are first homogenized, and subse- solium (forward primer: 5–GGTGGCGGT-
quently, cells are lysed in the presence of GAGGATGATGGTG–3; reverse primer:
proteinase K, sodium dodecyl sulphate 5–TGCTCTATTTCGTGCGCGGCTTCTCC
(SDS) and ethylenediamine tetra-acetic acid –3) in a PCR assay for neurocysticercosis17.
(EDTA). The nucleic acids are extracted Oligonucleotides for the diagnosis of both
with phenol–chloroform–isoamyl alcohol, T. solium and T. saginata in a multiplex
precipitated with ethanol in the presence PCR were designed from the sequence of
of high salt concentration and harvested by 3954 bp (HDP2). Three oligonucleotides,
centrifugation. The basic protocol has been (PTs7S35F1 5–CAGTGGCATAGCAGAG-
reviewed in Sambrook et al.18. GAGGAA–3, PTs7S35F2 5–CTTCTCAATTC-
TAGTCGCTGTGGT–3 and PTS7s35r1 5–
GGACGAAGAATGGAGTTGAAGGT–3)
Selection of DNA probes for the detection used in the assay produced two bands sized
of Taenia sp. 600 bp and 170 bp for T. saginata and one band
of 170 bp for T. solium from 1 ng of genomic
Flisser and colleagues used a DNA DNA. When the same primers were used for
hybridization assay involving total amplification of an E. granulosus sample, two
genomic radioactive-labelled/biotinylated bands of 900 bp and 550 bp were seen16.
DNA for detecting T. saginata eggs12. In
similar experiments, two DNA probes,
HDP1 and HDP2 were hybridized to
genomic DNA from T. solium, T. saginata as Controls and contamination risks
well as other Taenia sp.14. The first probe
hybridized with both T. solium and T. sagi- Quality controls are extremely important
nata, while the other identified T. saginata when performing a diagnostic PCR. First,
genomic DNA. Gottstein and Mowatt the amplification cycle itself should always
reported that primers for the PCR diagno- have a positive (T. solium DNA) and a neg-
sis of Echinococcus multilocularis, BG1 ative control (the sample volume of dis-
(5–TCAGTCTATTCTCCTCTCAATGCC–3 tilled water added to the reaction mixture)
) and BG2 (5-GCAGTCTATTCTCCTCT- to ensure that the DNA polymerase and
CAACTGCC-3), were able to detect T. sagi- other reagents in the mixture are function-
nata and T. taeniaeformis producing 0.55-kb ing. When tissue sample is used for diag-
and 0.6-bp fragments, respectively19. nosis, the PCR may be negative. To check
However, with E. multilocularis, the same that the extraction of the DNA from the
primers produced a 2.6-kb fragment from sample has succeeded, primers amplifying
the genomic DNA that was used as a sam- a human gene (e.g. human actin gene)
ple19. Chapman et al. developed Taenia sp. should be used as a control. If the sample

cyst is from pig tissue, primers amplifying Conclusions

a pig gene are needed as control.
Contamination of the reaction mixtures Several PCR based assays for the detection of
with parasite DNA from positive controls T. solium eggs, proglottides and larval mater-
or from previous amplifications gives ial from human and porcine tissues have
false-positive results. The working areas been described. Preliminary evaluation has
should be arranged so that the samples are shown these assays to be reliable, sensitive
not in contact with other reagents. More and specific. A major limitation of this excit-
information about preventing laboratory ing technology is the lack of its widespread
contamination and quality control of PCR availability. These methods still need to be
is available20. Details of the arrangements evaluated in comparison with conventional
of a PCR working laboratory have also parasitological methods in both clinical and
been reviewed elsewhere21. epidemiological settings.
References
1. Dumler, J.S., Valsamakis, A. (1999) Molecular diagnostics for existing and emerging infections.
Complementary tools for a new era of clinical microbiology. American Journal of Clinical Pathology
112 (Suppl), 33–39.
2. Weiss, J. (1995) DNA probes and PCR for diagnosis of parasite infections. Clinical Microbiology
Reviews 8, 113–130.
3. Dick, T.A., Lu, M.C., deVos, T., et al. (1992) The use of the polymerase chain reaction to identify
porcine isolates of Trichinella. Journal of Parasitology 78, 145–148.
4. Dissanayak, S., Min, X., Piessens, W.F. (1991) Detection of amplified Wuchereria bancrofti DNA in
mosquitoes with a non-radioactive probe. Molecular Biochemistry and Parasitology 45, 49–56.
5. Klion, A.D., Raghavan, N., Brindley, P.J., et al. (1991) Cloning and characterization of a species-spe-
cific repetitive DNA sequence from Loa loa. Molecular Biochemistry and Parasitology 45, 297–305.
(Published erratum appears in Molecular Biochemistry and Parasitology 47, 265)
6. Meredith, S.E., Lando, G., Gbakima, A.A., et al. (1991) Onchocerca volvulus: application of the
poymerase chain reaction to identification and strain differentiation of the parasite. Experimental
7. Wijesundera, W.S., Chandrasekharan, N.V., Karunanayake, E.H. (1999) A sensitive polymerase chain
reaction based assay for the detection of Setaria digitata: the causative organism of cerebrospinal
nematodiasis in goats, sheep and horses. Veterinary Parasitology 91, 225–233.
8. Favia, G., Lanfraqncotti, A., della Torre, A., et al. (1997) Advances in the identification of Dirofilaria
repens and Dirofilaria immitis by a PCR- based approach. Parasitology 39, 401–402.
9. Kidd, K.K., Ruano, G. (1994) Optimizing PCR. In: McPherson, M., Hames, B., Taylor, R. (eds) PCR 2:
a Practical Approach. Oxford University Press, Oxford, UK, pp. 1–21.
10. Abramson, R. (1995) Thermostable DNA polymerases. In: Innis, M., Gelfand, D., Sninsky, J. (eds).
PCR Applications. Academic Press, San Diego, pp. 33–47.
based diagnosis of Taenia solium taeniasis by enzyme-linked immunosorbent assay. American Journal
12. Flisser, A., Reid, A., Gracia-Zepeda, E., et al. (1988) Specific detection of Taenia saginata eggs by DNA
hybridisation. Lancet ii, 1429–1430 (Letter).
13. Chapman, A., Vallejo, V., Mossie, K., et al. (1995) Isolation and characterization of species-specific
Clinical Microbiology 33, 1283–1288.
14. Harrison, L.J., Delgado, J., Parkhouse, R.M. (1990) Differential diagnosis of Taenia saginata and Taenia
solium with DNA probes. Parasitology 100, 459–461.
15. Rishi, A.K., McManus, D.P. (1988) Molecular cloning of Taenia solium genomic DNA and characteri-
zation of taeniid cestodes by DNA analysis. Parasitology 97, 161–176.
16. Gonzalez, L.M., Montero, E., Harrison, L.J., et al. (2000) Differential diagnosis of Taenia saginata and
Taenia solium infection by PCR. Journal of Clinical Microbiology 38, 737–744.

17. Meri, T., Jokiranta, T.S., Granat, S., et al. (1999) Diagnosis of atypical neurocysticercosis by poly-
merase chain reaction analysis: a case report. Clinical Infectious Diseases 28, 1331–1332.
18. Sambrook, J., Fritsch, E.F., Maniatis, T. (2000) Molecular Cloning: a Laboratory Manual, 3rd edn. Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
19. Gottstein, B., Mowatt, M.R. (1991) Sequencing and characterization of an Echinococcus multilocularis
DNA probe and its use in the polymerase chain reaction. Molecular Biochemistry and Parasitology 44,
183–193.
20. Dragon, E.A., Spadoro, J.P., Madej, R. (1993) Quality control of polymerase chain reaction. In:
Persing, D., Smith, T., Tenover, F., et al. (eds) Diagnostic Molecular Microbiology: Principles and
Applications. American Society for Microbiology, Washington, DC, pp. 160–168.
21. McCreedy, B.J., Callaway, T.H. (1993) Laboratory design and work flow. In: Persing, D., Smith, T.,
Tenover, F., et al. (eds) Diagnostic Molecular Microbiology: Principles and Applications. American Society
for Microbiology, Washington, DC, pp. 149–159.

Appendix • SeaKem agarose (Sigma Chemical, St

Louis, MO, USA);
This is a general overview of the methods • PCR marker (e.g. Promega, Madison, WI,
needed for PCR analysis of T. solium cysticer- USA);
cosis. The selection of primers for the sample • Gel-loading buffer (10 buffer): 5 mg
and for the controls is different for different ml1 bromophenol blue, 5 mg ml1 cylene
laboratories, but we recommend the selection cyanol.
of primers from among those published for T.
solium PCR diagnosis. Annealing tempera-
ture of the PCR cycle is dependent on the Sample preparation from cysts
primer selected. A positive (T. solium DNA)
and negative control are mandatory. If eggs, Samples of cysts are placed in 0.9% sodium
proglottides or worms are used as a sample, chloride (NaCl) immediately after removal
primers for both T. solium and T. saginata are and frozen as soon as possible (preferably to
needed. To control DNA extraction from 70°C) before PCR analysis.
human samples, primers amplifying human
DNA need to be used, for example, primers
for the human actin gene. It is recommended DNA extraction
that the products of the PCR analyses be
purified and sequenced, particularly when 1. Grind the frozen sample to a fine powder;
the method is being introduced to a new lab- suspend it in DNA extraction buffer and heat
oratory. A positive PCR assay should be cor- at 55°C for 1 h.
roborated by other means of diagnosis. 2. The sample is extracted twice (or until no
protein is visible at the interface) with
phenol :chloroform :isoamyl alcohol (25 : 24 :1).
Buffers and other reagents 3. DNA is harvested with ice-cold 100%
ethanol and one-tenth of the sample volume,
• DNA extraction buffer: 50 mM Tris- 3 M sodium acetate (pH 6.) is added. Keep
hydrochloric acid (Tris-HCl), pH 7.5, the tube at 20°C for 1 h and centrifuge for
50 mM EDTA, pH 8.0, 0.5% sodium 30 min (full speed) in a microcentrifuge. The
dodecyl sulphate (SDS), proteinase K 200 pellet is washed with 70% ethanol and
g ml1; recovered by centrifugation (12,000 g for 10
• Proteinase K; min at 4°C). The nucleic acids are then re-
• Tris/EDTA-buffer: 10 mM Tris-HCl, suspended in the TE-buffer.
0.1 mM EDTA (pH 8.0); 4. The amount of DNA in the sample is mea-
• Phenol (must be equilibrated to a pH sured, e.g. with a spectrophotometer. DNA is
>7.8); diluted with distilled water (dH2O) and
• Chloroform; absorbance in the wavelength of 260 nm is
measured. In double-stranded DNA the
• Isoamyl alcohol;
OD260 of 1.0 equals 50 g DNA ml1.
• Ethanol;
• 3 M sodium acetate (pH: 6.0);
• For PCR: deoxynucleotide triphosphates
PCR amplification
(dATP, dGTP, dCTP, dTTP), reaction
buffer (500 mM potassium chloride (KCl),
PCR reactions are performed in a volume of
15 mM magnesium chloride (MgCl2)
100 l.
100 mM Tris-HCl (pH: 9.0 at room tem-
perature)), Taq DNA-polymerase (Perkin 1. The PCR master mix/reaction contains:
Elmer, Foster, CA, USA); (i) 10 pmol of each primer;
• 5 Tris/borate buffer: 450 mM Tris base, (ii) 12.5 mM of each nucleotide (dATP,
450 mM boric acid, 10 mM EDTA (pH 8.0); dGTP, dCTP, dTTP);
• Ethidium bromide (stock solution 10 (iii) one vol. reaction buffer containing
mg ml1); 50 mM potassium chloride, 1.5 mM

MgCl2, and 10 mM Tris-HCl. Make up the 72°C for 1 min (extension) and 72°C for 10
volume with dH2O. min (final extension).
2. The PCR master mix is prepared for all 4. Electrophoretic analysis of reaction products:
samples and controls. Add the sample DNA (i) Prepare an agarose gel into 1 TBE
(approximately 500 ng per reaction), buffer (the percentage of the gel depends on
taking care to prevent contamination. the size of the target product; 3% for the tar-
Subsequently, prepare the Taq polymerase (2 get DNA 500 bp, 2% for the target DNA
U per reaction). sized 500–1000 bp and 1.5% for 1000–2000
3. The amplification is performed in a pro- bp). Add ethidium bromide stock solution
grammable thermal cycler. This is a sug- to the gel (3 l per 100 ml);
gested protocol if primers from reference 17 (ii) Add 3 l of 10 loading dye to each
are used, otherwise the amplification proto- sample, remember to have the PCR marker
col is chosen according to the primers in one lane;
selected; 94°C, 10 min (initial denaturation) (iii) Electrophorese the gels;
followed by 35 cycles of 94°C for 1 min (iv) Analyse the results of PCR under
(denaturation), 58oC for 1 min (annealing), ultraviolet light.

36 Immunodiagnosis in Solitary
Cysticercus Granulomas
Anna Oommen
Introduction studies is not a true reflection of the disease

status in the community. Indeed the incidence
Hospital-based studies indicate that over 60% and prevalence of NC in India are not known
cases of neurocysticerosis (NC) in India are and there is need to determine and under-
solitary granulomas1. This is based on evi- stand the burden of the disease in the popula-
dence from imaging studies that show that tion. It is therefore evident that although
solitary cysts can be viable, dying or calcified imaging is an excellent investigation for NC,
and varied in their location. Solitary cysticer- diagnostics for the disease must incorporate
cal granulomas (SCG) are also reported from tests that are inexpensive and which can be
other parts of the world – the disease not carried out in laboratories with minimal infra-
being peculiar to the Indian sub-continent2,3. A structure. This is true for most countries where
serodiagnostic test for the disease should NC is prevalent. This needs focused work on
therefore be capable of detecting a low anti- the serodiagnosis of NC. Although several
genic stimulus from a spectrum of the disease. serodiagnostic approaches have been tried,
It is pertinent to pathophysiology to delin- including passive haemagglutination4 and
eate events that limit Taenia solium egg inges- complement fixation5,6, enzyme linked immu-
tion to a solitary cyst in the brain or to multiple noelectrotransfer blot (EITB) and ELISA have
cysts. Is SCG accompanied by taeniasis and/or proved to be the most useful in both diagnosis
subcutaneous cysticercus infestation? What and epidemiological studies7–9.
cellular interactions and immune responses are
elicited in the infection of the central nervous
system (CNS) by a solitary cysticercus? How Overview of Serodiagnosis In
early in the disease is the immune response Neurocysticercosis
manifested and for how long does it persist?
Which T. solium metacestode antigens are The EITB using lentil lectin-specific cyst
immunodominant and what is their molecular glycoproteins is 100% specific and up to
composition? Are excretory–secretory proteins 98% sensitive in detecting anticysticercus
of the larva more antigenic? Answers to these antibodies in serum of NC patients with
questions may be helpful in the rational design two or more cysts7. ELISA estimating
of immunodiagnostic tests for SCG. serum IgG antibodies against cyst fluid
The number of solitary to multiple cys- proteins or antigens extracted from whole
ticercus granulomas cited in hospital-based cysts report sensitivity and specificity of


360 A. Oommen
60–90% for multiple NC10. Cerebrospinal disappointing. A low antibody response

fluid (CSF) IgM is more sensitive and spe- arising from an antigen challenge of only a
cific for NC (90% in ELISA)11 but as most single (few) cyst(s) in these patients may
patients with NC do not require a lumbar explain poor serodiagnostic performance18.
puncture for other investigations, serum is The poor serodiagnostic yield is also
the preferred fluid for testing. IgG antibod- observed in larger series of SCG. Singh et al.
ies have been detected in all phases of the demonstrated a sensitivity of 57% for ELISA
disease in CSF, serum and saliva while IgA in 37 patients with single, small enhancing
and IgE are more frequently seen in the computed tomography lesions19. In 205
inactive form of NC12. patients with radiologically diagnosed SCG
Taenia solium cyst glycoprotein purifica- that were both viable and calcified, we
tion by Tsang et al.7 for the EITB is laborious found that an ELISA to detect serum IgG
and cyst antigens requiring simpler methods antibodies using cyst fluid antigens from
of purification have been investigated. locally acquired cysts was 46% and 54%
Recent work by Ito et al.13 to purify cyst gly- sensitive and specific. The patients were
coprotein antigens of 10–26 kDa by isoelec- from different regions of India. Using a
tric focusing, is highly specific and sensitive commercial ELISA (not made in India) the
for NC in ELISA and immunoblots. These test was 31% and 50% sensitive and specific
antigens, obtained in the range of pH 9.2–9.6, for SCG. This demonstrates the advantage
perform well in ELISA and do not exhibit the of using antigens from the local parasite in
usual cross-reactivity of anticysticercus anti- immunodiagnosis, for their enhanced per-
bodies with Echinococcus. In contrast to the formance in detecting diseases of the
seven cyst glycoproteins purified over lentil region. The common cross-reactivity of
lectin, which give rise to a high background tuberculomas reported with T. solium anti-
in ELISA, hence restricting their use to gens in commercial kits was not observed in
immunoblots, the use of these antigens is the in-house ELISA. The largest source of
comparatively simple13. Recombinant 10 cross-reactivity in this study was seen in
kDa protein prepared and purified by patients with astrocytomas.
Chung et al.14,15 and used in immunoblots is The EITB for SCG retains high specificity
claimed to distinguish active NC from the but sensitivity falls to 50% among hospital
inactive disease. Patients with chronic calci- patients. This is seen in studies from differ-
fied cysts exhibit weak reactivity against the ent centres and indicates that as for ELISA,
10-kDa protein while a strong reaction is the test underestimates the prevalence of dis-
seen in patients with active NC. ease19,20. However Singh et al.21 have also
Serodiagnostic tests for NC should benefit shown the EITB to be 85% sensitive in chil-
from ongoing studies elucidating carbohy- dren with a recent history of seizures and
drate structures of antigenic glycoproteins radiologically detected to have SCG. The test
of T. solium metacestodes as well as from the was 80% sensitive in family contacts of SCG
use of synthetic immunodominant pep- patients who had a history of seizures.
tides16,17(reviewed in Chapter 33). Healthy controls with no seizures and radio-
logically clear but EITB-positive were con-
sidered to be infected with T. solium
Serodiagnostic Studies in Solitary extraneurally. Their study validates EITB as
Cysticercus Granulomas a specific and sensitive test for SCG in per-
sons with seizures in India. Although it is
All serodiagnostic tests for NC established not clear why these results are so different
to date are with reference to multiple cyst from others on SCG in India or from most
conditions. In studies where cases of SCG reports of EITB and SCG in literature, they
have been included, the tests are invariably offer promise in using the test for SCG.

Immunodiagnosis in Solitary Cysticercus Granulomas 361
Conclusions immune response to T. solium in different

populations and of antigen characteriza-
Currently, there are no serodiagnostic tests tion, as well as high amplification detection
that can unequivocally be recommended systems for immunological reactions now
for routine diagnosis for SCG. However, available, argue that reliable serodiagnosis
our increased understanding of the of SCG is possible.
REFERENCES
1. Rajshekhar, V., Chandy, M.J. (2000) Incidence of solitary cysticercus granulomas. In: Rajshekhar, V.,
Chandy, M.J. (eds) Solitary Cysticercus Granuloma. The Disappearing Lesion. Orient Longman,
Chennai, India, pp. 12–28.
2. Wadley, J.P., Shakir, R.A., Rice, E.J.M. (2000) Experience with neurocysticercosis in the UK: correct
diagnosis and neurosurgical management of small enhancing brain lesion. British Journal of
4. Ferreira, A.P., Vaz, A.J., Nakamura, P.M., et al. (1997) Hemagglutination test for the diagnosis of
human neurocysticercosis: development of a stable reagent using homologous and heterologous
antigens. Revista do Instituto de Medicina Tropical de São Paulo 39, 29–30.
5. Mahajan, R.C., Chopra, J.S., Chitkara, N.L. (1975) Comparative evaluation of indirect hemagglutina-
tion and complement fixation tests in serodiagnosis of cysticercosis. Indian Journal of Medical Research
62, 1310–1313.
6. Garcia, E., Ordonez, G., Sotelo, J. (1995) Antigens from Taenia crassiceps cysticerci used in comple-
ment fixation, enzyme-linked immunosorbent assay, and Western blot (immunoblot) for diagnosis
of neurocysticercosis. Journal of Clinical Microbiology 33, 3324–3325.
7. Tsang, V.C.W., Brand, J.A., Boyen, A.E. (1989) An enzyme-linked immunoelectrotransfer blot assay
and glycoprotein antigens for diagnosing human cysticercosis (Taenia solium). Journal of Infectious
8. Da Silva, A.D., Quagliato, E.M., Rossi, C.L. (2000) A quantitative enzyme-linked immunosorbent
assay (ELISA) for the immunodiagnosis of neurocysticercosis using a purified from Taenia solium
cysticerci. Diagnostic Microbiology and Infectious Disease 37, 87–92.
9. García, H.H., Harrison, L.J.S., Parkhouse, R.M.E., et al. (1988) A specific antigen detection ELISA for
the diagnosis of human neurocysticercosis. Transactions of the Royal Society of Tropical Medicine and
Hygiene 92, 411–414.
10. Shinguekawa, K.Y.M., Mineo, J.K., Pajuaba de Moura, L., et al. (2000) ELISA and Western blotting
tests in the detection of IgG antibodies to Taenia solium metacestodes in serum samples in human
neurocysticercosis. Tropical Medicine and International Health 5, 443–449.
12. Bueno, E.C., Vaz, A.J., Machado, L.D., et al. (2000) Neurocysticercosis: detection of IgG, IgA and IgE
antibodies in cerebrospinal fluid, serum and saliva samples by ELISA with Taenia solium and Taenia
crassiceps antigens. Arquivos de Neuropsiquiatria 58, 18–24.
13. Ito, A., Plancarte, A., Ma, L., et al. (1998) Novel antigens for neurocysticercosis: simple method for
preparation and evaluation for serodiagnosis. American Journal of Tropical Medicine and Hygiene 59,
291–294.
14. Chung, J.Y., Bahk, Y.Y., Huh, S., et al. (1999) A recombinant 10 kDa protein of Taenia solium metaces-
todes specific to active neurocysticercosis. Journal of Infectious Diseases 180, 1307–1315.

362 A. Oommen
15. Plancarte, A., Hirota, C., Martinez-Ocana, J., et al. (1999) Characterization of GP 39–42 and GP 24
antigens from Taenia solium cysticerci and of their antigenic GP10 subunit. Parasitology Research 85,
680–684.
16. Restrepo, B.I., Obregon-Henao, A., Mesa, M., et al. (2000) Characterization of carbohydrate compo-
nents of Taenia solium metacestode glycoprotein antigens. International Journal of Parasitology 30,
689–696.
17. Hernandez, M., Beltran, C., Garcia, E., et al. (2000) Cysticercosis: towards the design of a diagnostic
kit based on synthetic peptides. Immunology Letters 71, 13–17.
18. Ohsaki, Y., Matsumoto, A., Miyamoto, K., et al. (1999) Neurocysticercosis without detectable specific
antibody. Internal Medicine 38, 67–70.
19. Singh, G., Kaushal, V., Ram, S., et al. (1999) Cysticercus immunoblot assay in patients with single
small enhancing lesions and multilesional cysticercosis. Journal of the Association of Physicians of India
47, 476–479.
20. Rajshekhar, V., Oommen, A. (1997) Serological studies using ELISA and EITB in patients with soli-
tary cysticercus granulomas and seizures. Neurological Infections and Epidemiology 2, 177–180.
131–135.

37 Pharmacology of Anticysticercal
Therapy
Helgi Jung and Dinora F. González-Esquivel
Introduction of therapy could be shortened to one week

without compromising the efficacy of the
Until recent years ago, there was no specific drug. Other reports have confirmed the effi-
pharmacological treatment for neurocysticer- cacy of albendazole for the treatment of
cosis (NC) and surgery and steroids were the parenchymal NC8,9. Albendazole also
only available options. The era of specific destroys subarachnoid and ventricular cysts,
anticysticercal therapy began in 1979 when because of its better penetration of cere-
Robles and Chavarría described a patient brospinal fluid (CSF), as also giant cysts and
with parenchymal NC who was successfully large clumps of cysts10. This chapter covers
treated with praziquantel1. Uncontrolled the pharmacokinetic and pharmacodynamic
studies, isolated case reports, and medical aspects of the two drugs that are currently
letters stressing the utility of praziquantel in used for the treatment of NC.
NC followed2–4. However, most of these ini-
tial studies were uncontrolled and included
a variety of forms of NC; therefore precise Praziquantel
evaluation of the effectiveness of praziquan-
tel was difficult. In 1984, a controlled study Clinical chemistry
examined the effects of praziquantel (25 mg
kg1 day for 2 weeks) in 26 patients with Praziquantel (2 cyclohexylcarboyl -(1,2,3,6,7
active parenchymal NC; more than 90% of 11b)-hexahydro 4,11 pyrazino (2,1 a) iso-
the patients improved5. One year later, the quinoline) (Fig. 37.1) was identified in 1972,
same authors confirmed the efficacy of prazi- from a group of heterocyclic pyrazinoiso-
quantel in a long-term follow-up of 35 quinoline derivatives and found to have
patients with parenchymal NC6. unusually broad anthelmintic activity. It was
Albendazole was first tested for human later jointly developed by E. Merck and
NC in 1987, when Escobedo and co-workers Bayer. With its broad spectrum of activity
demonstrated its efficacy in patients with and excellent tolerance, it became the drug of
parenchymal brain cysts in whom an 86% choice for the treatment of a range of human
reduction in the number of lesions was docu- and animal helminths including trematodes
mented7. The initial regimen for albendazole (Schistosoma japonicum and Clonorchis
was 15 mg kg1 for 30 days; nevertheless sinensis) and adult and larval cestodes
additional studies showed that the duration (Echinococcus granulosus and Taenia solium)11.


364 H. Jung and D.F. González-Esquivel
Therefore, drug concentrations in the CSF

and brain tissue should be much higher than
minimal effective concentration14.
Pharmacokinetics: absorption,
distribution, metabolism, elimination and
bioavailability
After oral administration, praziquantel is

rapidly absorbed from gastrointestinal tract.
Peak plasma concentrations are attained
Fig. 37.1. Chemical structure of praziquantel.
1.5–2 h after administration of doses of
6.25–50 mg kg1. Serum concentrations show
considerable inter-individual variability,
The chemical is crystalline, almost colourless probably due to differences in metabolism.
with a distinctly bitter taste; it is practically Praziquantel undergoes extensive first pass
insoluble in water and freely soluble in biotransformation to a series of metabolites
organic solvents. that lack anthelminthic activity in humans15.
The predominant metabolite is 4-hydroxy-
cyclohexylcarbonyl analogue of praziquan-
Mechanism of action tel16. Most of this metabolic conversion
occurs in cytochromes P450 2B1 and 3A17.
In vitro studies have revealed that prazi- Praziquantel is rapidly distributed to
quantel penetrates the tegument and rapidly body tissues. Approximately 80% of the drug
moves through helminthic tissues. A diverse is bound to plasma proteins18. Drug concen-
range of actions has been described. Primary tration in breast milk is about 25% of plasma
effects include muscle contraction or paraly- concentration19. The elimination half-life of
sis and tegumental damage. Other (sec- praziquantel is 1.7–2.7 h and for its metabo-
ondary) effects include changes in lite is 4–5 h20. Cumulative renal excretion of
carbohydrate metabolism, decrease in enzy- praziquantel and its metabolites is 80%.
matic activities and changes in the proper- Pharmacokinetics of praziquantel are dose-
ties of surface membranes. Molecular dependent. Leopold et al. observed that at
mechanisms underlying the effect of prazi- doses of 5, 10, 20 and 50 mg kg1, serum con-
quantel on parasite tegument are not fully centrations were 0.15, 0.25, 0.8 and 4.22 mol
understood. At concentrations of 3.2 107 l1 respectively and that the areas under the
M to 3.2 104 M, the drug produced vac- curve (AUC) increased 20-fold with a tenfold
uolization at the base of the syncytial layer increase in dose, indicating saturation of the
of the tegument of susceptible trematodes metabolic capacity of liver21. Praziquantel
and cestodes12. These vacuoles then increase permeates the blood–brain barrier, thus
in size forming blebs on the surface that explaining its effectiveness in parenchymal
finally burst. It is believed that the vac- NC. It enters CSF more readily than subcuta-
uolization is triggered by changes in the flux neous cysts22. High concentrations can be
of divalent cations, particularly calcium, expected in brain parenchyma on account of
which follow drug-induced increase in the high lipid solubility and pH of the drug.
membrane permeability13. The minimal In 11 patients with parenchymal NC, who
effective concentration of praziquantel that received praziquantel (50 mg kg1 day1 in
inflicts severe damage to the strobilocerci in three separate doses), mean drug concentra-
vitro is 0.03 M l1. In human nervous tis- tion in CSF was 24% of the plasma concen-
sue, the surrounding granulomatous infil- tration at steady state23. Effective
trate and cyst wall pose barriers to anticysticercal action was observed at the
penetration of drug in to the larval tissue. given CSF concentration.

Pharmacology of Anticysticercal Therapy 365
Bioavailability with moderate liver disease and four times

higher in patients with severe liver disease
Given the lack of parenteral formulation, the
when compared with either normal volun-
absolute bioavailability of praziquantel can
teers or patients with schistosomiasis who
not be determined in humans. Animal stud-
ies indicate an extensive first-pass metabo- had no detectable liver involvement. An
lism so that only a small proportion of the increased likelihood of side effects in indi-
active drug reaches the systemic viduals with liver disease has been sug-
circulation19. Mandour et al. investigated the gested; whether the dose in such patients
pharmacokinetics of a new formulation of should be reduced is not clear.
praziquantel (Distocide) in comparison to
the reference product (Biltricide) in a
crossover study24. Healthy volunteers Food and drug interactions
received single oral doses of 40 mg kg1 of
both preparations. Significant differences Co-administration with food enhances
were found in the maximal concentration bioavailability of praziquantel in comparison
(Cmax) of the two products. However, the to the fasting state24,26. Castro et al. demon-
AUCs of the two formulations were not sig- strated significantly higher Cmax level, mean
nificantly different. plasma concentration and AUC upon con-
current administration with diet with high
lipid as well as high carbohydrate content
Pharmacokinetics in hepatic disease
(Fig. 37.2)26. Cmax and AUC were higher and
A study evaluated pharmacokinetics of praz- larger respectively with the carbohydrate
iquantel in 30 patients with S. japonicum diet in comparison with the lipid diet.
infection, in whom liver disease was care- Considering this, it was proposed that carbo-
fully assessed25. The Cmax and bioavailability hydrates were responsible for the increased
were more than twice as high in patients bioavailability of praziquantel26.
1500
Plasma concentration (ng ml–1)
Fasting
Lipid diet
Carbohydrate diet
1000
500
0 2 4 6 8
Time (h)
Fig. 37.2. Mean plasma concentration (± SEM) of praziquantel in healthy volunteers administered a
single oral dose of 1800 mg (three tablets of 600 mg) during fasting () or immediately after high fat ()
or high-carbohydrate () meal. (Reproduced with permission from reference 26.)

It is often necessary to co-administer dex- comitant treatment with enzyme-inducing

amethasone along with praziquantel in order antiepileptic drugs in contrast to a lower
to manage immunological reactions associ- dose of 25 mg kg1 in those not on
ated with praziquantel mediated parasite antiepileptic drugs. Co-administration of
destruction. A cross-over study in eight cimetidine increases plasma level, the AUC
patients who received praziquantel alone or and half-life of praziquantel in healthy vol-
with dexamethasone showed that plasma unteers (Fig. 37.4)29. This suggests that
levels of praziquantel were lowered by 50% addition of cimetidine to a single day regi-
with concurrent administration of dexam- men of praziquantel increases plasma level
ethasone (Fig. 37.3)27. Therefore, the routine of the latter with a possibility of improved
administration of corticosteroids, particu- efficacy in the treatment of NC.
larly dexamethasone, throughout a course of
treatment with praziquantel is discouraged;
rather tailored intermittent treatment only to
Adverse reactions
manage inflammatory adverse reactions that
may develop, is recommended.
Praziquantel is well tolerated by patients
Bittencourt et al. studied the influence of
antiepileptic drug (carbamazapine and with a wide variety of parasitic disorders.
phenytoin, both potent hepatic enzyme Most adverse events are manifestations of
inducers) administration on praziquantel inflammatory exacerbations resulting from
metabolism28. Both were found to reduce drug-induced parasite destruction in the
the oral bioavailability of praziquantel, central nervous system30. Frequent but
although the mechanism of this effect was minor side effects include drowsiness,
not clear. The magnitude of drug interaction headache, mild abdominal pain, dizziness,
was found to be significant enough to nausea and skin rash22. No hepatotoxicity,
account for failure of therapeutic response nephrotoxicity and bone marrow toxicity
to praziquantel. The authors recommended has been reported31. Furthermore, prazi-
a minimum dose of praziquantel of 50 mg quantel is not genotoxic, mutagenic or ter-
kg1 in those individuals receiving con- atogenic at usual therapeutic doses32,33.
6
Plasma concentration (g ml–1)
5
PZQ
PZQ + Dexamethasor
4
0
0 2 4 6 8
Time (h)
Fig. 37.3. Plasma levels of praziquantel when administered alone () and during dexamethasone
therapy () (n = 8). (Reproduced with permission from reference 27.)

PZQ + Cimetidine
PZQ
4
Plasma concentration (g ml–1)
0
0 2 4 6 8 10 12
Time (h)
Fig. 37.4. Mean plasma levels of praziquantel in eight healthy volunteers after three oral doses of 25 mg
kg1 administered every 2 hours when given alone () and with cimetidine (). (Reproduced with
Therapeutic regimens promises to be an adequate alternative to

currently used protocols with the advantage
A single dose of praziquantel (10 mg kg1) of reducing time and cost of treatment36.
eradicates intestinal taeniasis (see Chapter
41) and regimens of 3–6 days (25–50 mg kg1
day1) eradicate subcutaneous cysticerci34. Dosage forms
The dosage regimen currently used for the
treatment of NC is 50–100 mg kg1 day1 Praziquantel is available in tablets contain-
divided into three doses every 8 hours for 15 ing 150, 500 and 600 mg. Some commonly
days. With this schedule, the percentage of used brand names are: Cesol, Cisticid,
disappearance of parenchymal brain cys- Distocide and Biltricide.
ticerci is 60–70%35. A novel regimen consist-
ing of the administration of three doses of
praziquantel (25 mg kg1, each), 2 hours Albendazole
apart on a single day has been evaluated.
The rationale for this regimen is based on the Clinical chemistry
pharmacokinetic principle that plasma con-
centration of the drug peaks 1–2 h after Albendazole (methyl (5-[propylthio]-1H-
administration and declines rapidly there- benzimidazol-2-yl) carbamic acid methyl
after29. With this regimen, it would be possi- ester) (Fig. 37.5) is a broad-spectrum
ble to maintain higher concentrations of the anthelminthic benzimidazole, active against
drug for a longer period. The schedule has liver flukes, tapeworms, lung and gastroin-
been evaluated in a clinical trial, and testinal round worms37. It is also very

S N
CH3 — CH2 — CH2
NH — CO — OCH3
N
H
Albendazole
S N
CH3 — CH2 — CH2
NH — CO — OCH3
N
H
Albendazole sulphoxide
S
CH3 — CH2 — CH2 N
NH — CO — OCH3
O
N
H
Albendazole sulphone
Fig. 37.5. Chemical structure of albendazole, albendazole sulphoxide, the main active metabolite, and of
albendazole sulphone.
effective against the larval form of T. bioavailability. They cause selective degen-
solium30,38,39. It is widely used in human and eration of parasitic cytoplasmic micro-
veterinary medicine. Albendazole is a tubules. This eventually leads to a decrease
colourless powder, insoluble in water, solu- in adenosine triphosphate levels and
ble in strongly acid solutions and slightly energy depletion. The antimitotic activity
soluble in some organic solvents. The solu- of albendazole is the result of binding to -
bility of its metabolite, albendazole sulphox- tubulin molecules, which causes inhibition
ide (ALBSO) is comparatively less40,41. of the formation of microtubules resulting
in disruption of cell division37. In addition,
there occurs loss of transport of secretory
Mechanism of action vesicles and failure of intestinal cells to
take up glucose, leading to starvation of the
All benzimidazoles are thought to have a parasite. Considering these mechanisms of
similar mode of action, and differences in action, the onset of anthelmintic action is
efficacy of the drugs against different para- slower than that of drugs that act directly
sites probably reflect variations in their on ion channels42,43.

Pharmacokinetics: absorption, This enantioselective disposition of ALBSO

metabolism and elimination has also been observed in individuals with
NC. When a multiple dose regimen of
Albendazole is extensively metabolized in albendazole (5 mg kg1 every 8 h for 8
the liver to its active metabolite, ALBSO44,45. days) was administered, differences in
The latter is further sulphonated to alben- pharmacokinetics of (+) ALBSO and ()
dazole sulphone, one among seven other ALBSO were found. For (+) ALBSO, the
inactive metabolites40,45. The parent com- mean Cmax, AUC and apparent plasma
pound is undetectable while the active clearance were 301.6 ng ml1, 1719.2 ng
metabolite, ALBSO, is readily recovered in ml1 h1 and 5.8 l h1 kg1, respectively,
the plasma of rat, cattle and sheep. In while the corresponding values for ()
humans, the first-pass metabolism to ALBSO were 54.9 ng ml1, 261.4 ng ml1 h1
ALBSO is rapid and apparently complete45. and 54.0 l h1 kg1, respectively. The mean
Two distinct microsomal enzymatic path- proportion of (+) ALBSO to () ALBSO
ways are responsible for the sequential with the AUC was 8.0, indicating plasma
sulphoxidation of albendazole. The first, a accumulation of (+) enantiomer51.
flavin-containing mono-oxygenase system In vitro studies indicate differences in
(FMO), is involved in the oxidation of protein binding by albendazole and
albendazole to ALBSO through an NADPH- ALBSO. While albendazole is 89–91% pro-
dependent reaction (NADPH = nicotin- tein bound, ALBSO is 63–65% protein
amide-adenine dinucleotide phosphate bound at a concentration range of
(reduced form))46. The other, cytochrome 0.5–4.0 g ml1. The high protein binding
P450 is involved in oxidation of ALBSO to of albendazole is of no clinical significance
albendazole sulphone. Involvement of both as it is rapidly and completely converted to
systems, FMO and cytochrome P-450, in ALBSO41. ALBSO has been demonstrated in
albendazole metabolism have been demon- CSF after oral administration of albenda-
strated in rat, sheep, cattle and pig liver zole. The mean ALBSO concentration in
microsomes, as well as in a differentiated CSF was found to be 43% of mean plasma
human hepatoma cell line47. level in one study23. Although drug concen-
The kinetic disposition of ALBSO in trations in CSF were found to be variable,
humans is characterized by marked inter- these were not related to age, sex or the
subject variability45,48. This has been attrib- presence of inflammation in the subarach-
uted to poor absorption of albendazole due noid space. In addition, therapeutic effec-
to the low solubility of the drug. In different tiveness was confirmed for the wide range
pharmacokinetic studies, the concentrations of observed concentrations. Peak plasma
of ALBSO in plasma were found to be quite levels of ALBSO are lower in children in
variable, however the clinical efficacy of the comparison to adults administered similar
parent compound was consistently demon- doses according to body weight52. In addi-
strated40,45,48. The Cmax of ALBSO varied tion, elimination half-life is short (2.3–8.3 h)
between 0.45 g ml1 and 2.96 g ml1 and in children (Fig. 37.6). Available data, there-
elimination half-life was found to vary fore, argue for thrice-daily dosages schedule
between 14 h and 20 h after an oral dose of and dose calculation based upon body sur-
the parent compound of 15 mg kg1 in cys- face area rather than body weight in chil-
ticercotic individuals48. In healthy volun- dren.
teers, mean Cmax of 0.24 g ml1 and mean
half-life of 8 h was noted40.
The chiral behaviour of ALBSO has been Food and drug interactions
investigated in man as well as experimental
animals49,50. In healthy volunteers, adminis- Considering that oral absorption of albenda-
tered albendazole (10 mg kg1), the ratio of zole is relatively poor, the drug should be
(+) ALBSO to () ALBSO was found to be taken with meals. Marriner et al. observed a
80(+) : 20() within the AUC of ALBSO49. 3.5-fold increase in ALBSO availability, in

1.6
Age
1.4 < 2 years
6 –15 years
1.2 33 – 68 years
1.0
Cp (g ml–1)
0.8
0.6
0.4
0.2
0
0 2 4 6 8 12 24 48
Time (h)
Fig. 37.6. Comparison of mean plasma levels of albendazole sulphoxide in patients of different ages
after single oral dose of 15 mg albendazole per kg body weight. (Reproduced with permission from
reference 52.)
one subject when administered albendazole sone (8 mg day1) for 8 days54. The plasma
with olive oil in milk (20 ml per 100 ml); levels of ALBSO increased by 50%, an effect
however, in three other subjects, there was that was attributed to impaired elimina-
little change in plasma levels45. In another tion. This finding has been exploited to
study, co-administration with a fatty meal the advantage of albendazole since simul-
(fat content: 40 g) increased ALBSO concen- taneous corticosteroid therapy is often
trations fivefold; Cmax values increased from required during anticysticercal treatment55.
0.45 mol l1 to 1.60 mol l1 during fasting Homeida et al. evaluated pharmacokinetic
state to 2.0–9.0 mol l1 after food, while interactions between praziquantel (40 mg
AUC increased from 2.0–9.0 mol l1 h1 to kg1) and albendazole (400 mg) in healthy
9.6–29.5 mol l1 h1, respectively53. The volunteers56. The authors found that the
facilitation of albendazole absorption by AUC of ALBSO increased 4.5-fold and Cmax
fatty meal presumably results from an values increased from 126 ±15 to 350 ±51
increased bile acid flow in response to neu- ng ml1. Despite high plasma concentration
tral fat in the duodenum. of ALBSO, no adverse systemic, haemato-
Several drug interactions can be logical or hepatic effect was noted.
expected as albendazole and ALBSO share Although the mechanism of this interaction
common hepatic metabolic pathways with is not clear, the finding is significant con-
several pharmacological agents. Their sidering that trials of combination
interaction with dexamethasone is of inter- chemotherapy are in consideration in the
est, primarily on account of the necessity of future. In human cystic echinococcosis,
co-administering the two to forestall or cimetidine was found to increase mean
manage inflammatory reactions to albenda- ALBSO concentrations in samples of bile
zole’s parasiticidal action. Jung et al. inves- and hydatid cyst fluid by about two-
tigated the nature of this interaction in times57. Combined administration of the
eight patients who were treated with alben- two drugs was recommended with a view to
dazole (15 mg kg1 day1) and dexametha- improve therapeutic efficacy of albendazole.

Therapeutic dosage regimens lar, hepatoxicity can occur at any time dur-
ing the course of treatment and does not
Albendazole was initially administered at appear to be related to ALBSO levels47. Liver
doses of 15 mg kg1 day1 for 1 month, based function tests and white blood cell counts
upon previous regimens used for treatment should be performed at baseline and every 2
of human hydatidosis7, 58. Subsequent clinical weeks during therapy. Albendazole has not
experience showed that the length of therapy been studied in pregnant women. However,
could be shortened from 30 to 8 days without studies in animals have shown that it is
compromising drug efficacy55,59–61. Dosage embryotoxic and teratogenic37,62.
intervals for albendazole have been estab-
lished on empirical grounds. Considering
that the average half-life of ALBSO is 11 h in Dosage forms
patients with NC, a twice-daily regimen is
recommended59. In order to compare the reg- Albendazole is approved in several
imen currently used for albendazole (5 mg European and most Third World countries.
kg1, three times a day) versus a regimen of In 1996, albendazole received marketing
7.5 mg kg1 twice a day, a randomized approval from Food and Drug
crossover pharmacokinetic study was per- Administration, USA for use against
formed in ten patients with parenchymal NC. parenchymal NC. The drug is available in
Results showed that in spite of an inter- oral suspension and in tablets containing
individual variability observed, no statistically 200 and 400 mg, each. Some commonly
significant differences were found in several used brand names are Zentel, Eskazole and
pharmacokinetic parameters between both reg- Albenza.
imens59. This suggested that a dosage regimen
of 7.5 mg kg1 every 12 h could favourably
replace the regimen of 5 mg every 8 h. Conclusions
Albendazole appears to be as effective in
paediatric and geriatric populations as in Praziquantel is a heterocyclic pyrazino-iso-
others and no drug-related problems have quinoline derivative. It causes an influx of
been observed in patients as young as 1 year calcium ions leading to muscle contraction
or older than 65 years. However, there is no
and paralysis. The drug is well absorbed
specific information comparing use of alben-
after oral administration, has an extensive
dazole in the elderly with other age groups.
first-pass metabolism, is 80% protein bound
and has an elimination half-life of 1.7–2.7 h.
It crosses the blood–brain barrier. Food
Adverse reactions
increases and antiepileptic drugs decrease its
Albendazole has a high therapeutic index. Its bioavailability. Plasma levels of praziquantel
low solubility may prevent absorption of are reduced to one-half upon dexametha-
quantities necessary to produce toxicity and sone co-administration. The recommended
hence account for the low toxicity profile. dosage regimen is 50 mg kg1 day1 for 2
Clinical experience indicates that albenda- weeks.
zole is well tolerated. Headache, nausea and Albendazole, a benzimidazole com-
vomiting occur in 6–11% of patients and are pound, causes selective degeneration of par-
the most common adverse effects. These are asitic microtubules. It is metabolized in the
related to acute inflammation secondary to liver to an active compound, ALBSO. High
sudden destruction of cysticerci30,39. When levels of both albendazole and ALBSO have
administered in high doses (600–800 mg been demonstrated in the CSF. Of interest, is
day1) over longer periods of time (1 their interaction with dexamethasone; the
month), elevated liver enzymes, headache, latter increases ALBSO levels by 50%.
hair loss, neutropenia, fever, rash and acute Recommended dosage regimens of albenda-
renal failure have been reported62. In particu- zole are 15 mg kg1 day1 for 8–15 weeks.

References
1. Robles, C., Chavarría, M. (1979) Presentación de un caso clínico de cisticercosis cerebral tratado
médicamente con un nuevo fármaco: Praziquantel. Salud Pública de Mexico 21, 603–618.
2. Gómez, J.G., Peña, G., Patiño, R., et al. (1981) Neurocysticercosis treated with praziquantel.
Neurología en Colombia 5, 665–670.
3. Spina Franca, A., Nobrega, J.P., Livramento, J.A. (1982) Administration of praziquantel in neurocys-
ticercosis. Tropical Medicine and Parasitology 33, 1–4.
4. Markvalder, K., Hess, K., Valvanis, A. (1984) Cerebral cysticercosis: treatment with praziquantel:
report of two cases. American Journal of Tropical Medicine and Hygiene 33, 273–280.
5. Sotelo, J., Escobedo, F., Rodriguez Carbajal, J., et al. (1984) Therapy of parenchymal brain cysticerco-
sis with praziquantel. New England Journal of Medicine 310, 1001–1007.
6. Sotelo, J., Torres, B., Rubio-Donnadieu, F. (1985) Praziquantel in the treatment of neurocysticercosis:
long term follow-up. Neurology 35, 752–755.
7. Escobedo, F., Penagos, P., Rodríguez, J., et al. (1987) Albendazole therapy for neurocysticercosis.
8. Sotelo, J., Escobedo, F., Penagos, P. (1992) Albendazole vs. praziquantel for therapy of neurocysticer-
cosis. A controlled trial. Archives of Neurology 49, 290–294.
9. Alarcón, F., Escalante, L., Dueñas, G., et al. (1989) Neurocysticercosis: short course of treatment with
albendazole. Archives of Neurology 46, 1231–1236.
11. Groll, E. (1984) Praziquantel. Advances in Pharmacology and Chemotherapy 20, 219–238.
12. Harnett, W. (1988) The anthelminthic action of praziquantel. Parasitology Today 4, 144–146.
13. Pearson, R., Guerrant, R. (1983) Praziquantel: a major advance in anthelminthic therapy. Annals of
Internal Medicine 99, 195–198.
14. Overbosch, D., Van des Nes, J.C.M., Groll, E., et al. (1987) Penetration of praziquantel into cerebrospinal
fluid and cysticerci in human cysticercosis. European Journal of Clinical Phamacology 33, 287–292.
15. Buhring, K., Diekman, H., Muller, H., et al. (1978) Metabolism of praziquantel in man. European
Journal of Drug Metabolism and Pharmacokinetics 3, 179–190.
16. Andrews, P., Thomas, H., Pohlke, R., et al. (1983) Praziquantel. Medicinal Research Reviews 3, 147–200.
17. Masimerembwa, C., Hasler, J. (1994) Characterization of praziquantel metabolism in rat liver micro-
somes using cytochrome P450 inhibitors. Biochemical Pharmacology 48, 1779–1783.
18. Spina Franca, A., Machado, L.R., Nobrega, J.P.S., et al. (1985) Praziquantel in the cerebrospinal fluid
in neurocysticercosis. Arquivos de Neuropsiquiatria 43, 244–259.
19. Steiner, K., Garbe, A., Diekman, H., et al. (1976) The fate of praziquantel in the organism.
Pharmacokinetics in animals. European Journal of Drug Metabolism and Pharmacokinetics 1, 86–95.
20. Patzchke, K., Putter, J., Wegner, L.A., et al. (1979) Serum concentrations and renal excretion of prazi-
quantel after oral administration in humans. Results of three determination methods. European
Journal of Drug Metabolism and Pharmacokinetics 3, 149–156.
21. Leopold, G., Ungenthum, W., Groll, E., et al. (1978) Clinical pharmacology in normal volunteers of
praziquantel, a new drug against schistosomes and cestodes. European Journal of Clinical
Pharmacology 14, 281–291.
22. Bittencourt, P.R.M., Gracia, C.M., Gorz, A.M., et al. (1990) High-dose praziquantel for neurocysticer-
cosis: serum and CSF concentrations. Acta Neurologica Scandinavica 82, 28–33.
23. Jung, H., Hurtado, M., Medina, M., et al. (1990) Plasma and CSF levels of albendazole and prazi-
quantel in patients with neurocysticercosis. Clinical Neuropharmacology 13, 559–564.
24. Mandour, M., Turabit, E., Homeida, M., et al. (1990) Pharmacokinetics of praziquantel in healthy
volunteers and patients with schistosomiasis. Transactions of Royal Society of Tropical Medicine and
Hygiene 84, 389–393.
25. Watt, G., White, N., Padre, L., et al. (1987) Pharmacokinetics and side effects of praziquante in
Schistosoma japonicum infected patients with liver disease. European Journal of Clinical Pharmacology
33, 287–292.
26. Castro, N., Medina, R., Sotelo, J., et al. (2000) Bioavailability of praziquantel increases with concomi-
tant administration of food. Antimicrobial Agents and Chemotherapy 44, 2903–2904.
27. Vázquez, M.L., Jung, H., Sotelo, J. (1987) Plasma levels of praziquantel decrease when dexametha-
sone is given simultaneously. Neurology 37, 1561–1562.
28. Bittencourt, P.R.M., Gracia, C.M., Martins, R., et al. (1992) Phenytoin and carbamezapine decrease
oral bioavailability of praziquantel. Neurology 42, 492– 496.

29. Jung, H., Medina, R., Castro, N., et al. (1997) Pharmacokinetic study of praziquantel administered
alone and in combination with cimetidine in a single day therapeutic regimen. Antimicrobial Agents
and Chemotherapy 41, 1256–1259.
30. Sotelo, J. (1995) Neurocysticercosis. Clinical, prognostic and therapeutic aspects. In: Rose, C. (ed.)
Recent Advances in Tropical Neurology. Elsevier Science, Oxford, UK, pp. 87–97.
31. Gracia, C.M., Gorz, A.M., et al. (1990) High dose praziquantel for neurocysticercosis: efficacy and
tolerability. European Neurology 30, 229–234.
32. Herrera, L., Ramírez, T., Rodríguez, U., et al. (2000) Possible association between Taenia solium cys-
33. Bartsch, H., Kuroku, T., Malanett, T. (1978) Absence of mutagenicity of praziquantel, a new effective
antischistosomal drug in bacteria, yeasts, insects and mamalian cells. Mutation Research 58, 229–234.
34. Groll, E.W. (1982) Chemotherapy of human cysticercosis with praziquantel. In: Flisser, A., Willms,
K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press,
35. Del Brutto, O.H., Sotelo, J., Roman, G. (1993) Therapy of neurocysticercosis: a reappraisal. Clinics in
Infectious Diseases 17, 730–735.
36. Corona, T., Lugo, R., Medina, R., et al. (1996) Single day praziquantel therapy for neurocysticercosis.
New England Journal of Medicine 334, 125.
37. McKellar, Q.A., Scott, E.W. (1990) Benzimidazole anthelminthic agents. Journal of Veterinary
Pharmacology and Therapeutics 13, 223–247.
38. Del Brutto, O.H. (1995) Medical treatment of cysticercosis – effective. Archives of Neurology 52,
102–104.
39. Sotelo, J. (1997) Neurocysticercosis. In: Roos, K.L. (ed.) Central Nervous System Infectious Diseases and
Therapy. Marcel Dekker, New York, pp. 545–572.
40. Penicaut, B., Maugein, P.H., Maisonneuve, H., et al. (1983) Pharmacocinétique et métabolisme uri-
naire de l’albendazole chez l’homme. Bulletin de la Societe de Pathologie Exotique (Paris) 76, 698–708.
41. Jung, H., Medina, L., García, L., et al. (1998) Absorption studies of albendazole and some physico-
chemical properties of the drug and its metabolite albendazole sulphoxide. Journal of Pharmacy and
Pharmacology 50, 43–48.
42. Lacey, E. (1990) Mode of action of benzimidazoles. Parasitology Today 6, 112–115.
43. Martin, R.J., Robertson, A.P., Bjorn, H. (1997) Target site of anthelminthics. Parasitology 114,
S111–124.
44. Gyurik, R.J., Chow, A.W., Zaber, B., et al. (1981) Metabolism of albendazole in cattle, sheep, rats and
mice. Drug Metabolism and Disposition 19, 503–508.
45. Marriner, S.E., Morris, D.L., Dickson, B., et al. (1986) Pharmacokinethics of albendazole in man.
European Journal of Clinical Pharmacology 30, 705–708.
46. Villaverde, C., Alvarez, A.I., Redondo, P., et al. (1995) Small intestinal sulphoxidation of albendazole.
Xenobiotica 25, 433–441.
47. Steiger, U., Cotting, J., Reichen, J. (1990) Albendazole treatment of echinococcosis in humans: effects
on microsomal metabolism and drug tolerance. Clinical Pharmacology and Therapeutics 47, 347–353.
48. Jung, H., Hurtado, M., Sanchez, M., et al. (1992) Clinical pharmacokinetics of albendazole in patients
with brain cysticercosis. Journal of Clinical Pharmacology 32, 28–31.
49. Delatour, P., Benoit, E., Besse, S., et al. (1991) Comparative enantioselectivity in the sulphoxidation of
albendazole in man, dogs and rats. Xenobiotica 21, 217–221.
50. Benoit, E., Besse, S., Delatour, P. (1992) Effect of repeated doses of albendazole on enantiomerism of
its sulfoxide metabolite in goats. American Journal of Veterinary Research 53, 1663–1665.
51. Marques, M.P., Takayanagui, O.M., Bonato, P.S., et al. (1999) Enantioselective kinetic disposition of
albendazole sulfoxide in patients with neurocysticercosis. Chirality 11, 218–223.
52. Jung, H., Sanchez, M., González-Astiazaran, A., et al. (1997) Clinical pharmacokinetics of albenda-
zole in children with neurocysticercosis. American Journal of Therapeutics 4, 23–26.
53. Lange, H., Eggers, R., Bircher, J. (1988) Increased systemic availability of albendazole when taken
with a fatty meal. European Journal of Clinical Pharmacology 34, 315–317.
54. Jung, H., Hurtado, M., Medina, M.T., et al. (1990) Dexamethasone increases plasma levels of alben-
dazole. Journal of Neurology 237, 279–280.

56. Homeida, M., Copeland, W.L.S., Ali, M.M.M., et al. (1994) Pharmacokinetic interaction between
praziquantel and albendazole in a Sudanese man. Annals of Tropical Medicine and Parasitology 88,
551–559.
57. Wen, H., Zhang, W., Muhmut, M., et al. (1994) Initial observations on albendazole in combination
with cimetidine for the treatment of human cystic echinococcosis. Annals of Tropical Medicine and
58. Saimot, A.G., Cremieux, A.C., Hay, J.M., et al. (1983) Albendazole as a potential treatment for human
hydatidosis. Lancet ii, 652–656.
59. Sánchez, M., Suásteguí, R., González-Esquivel, D., et al. (1993) Pharmacokinetic comparison of two
albendazole dosage regimens in patients with neurocysticercosis. Clinical Neuropharmacology 16,
77–82.
prospective double-blind trial comparing 7 versus 14 days of treatment. Neurology 48, 1421–1427.
61. Botero, D., Uribe, C.S., Sanchez, J.L., et al. (1993) Short course of albendazole treatment for neurocys-
ticercosis in Colombia. Transactions of the Royal Society of Tropical Medicine and Hygiene 87, 576–577.
62. Rossignol, J.F., Maisonneuve, H. (1984) Albendazole: a new concept in the control of intestinal
helminthiasis. Gastroenterologique Clinique et Biologique (Paris) 8, 569–576.

38 Controversies in the Drug Treatment

of Neurocysticercosis
Bhim S. Singhal and Rodrigo A. Salinas
Introduction parenchyma, manifesting clinically with

seizures, headaches and focal neurological
Therapy for Taenia solium cysticercosis aims deficits. Degeneration of cysts may occur
at clearance of cysts in the brain and ame- spontaneously, or as a consequence of the
lioration of immediate and delayed symp- administration of anticysticercal drugs. This
toms and signs. Despite the known propensity of these agents to produce
anticysticercal effect of at least two pharma- inflammatory adverse events that may occa-
cological agents (praziquantel and albenda- sionally be serious and fatal has excited the
zole), controversies persist regarding their viewpoint that anticysticercal drugs may be
usage for several reasons outlined below1–5. potentially harmful and should preferably
One is the spontaneous resolution of the be avoided10,11. Even today, there are several
cyst(s). In the landmark papers of cysticer- controversies with regard to the medical
cosis occurring in British troops stationed in treatment of cysticercosis. Most importantly,
India, Dixon and Hargreaves6 and Dixon debate continues over the usefulness of
and Lipscomb7 observed that ‘many anticysticercal drugs. Other issues where
patients improved spontaneously and that opinion varies include the specific drug
the prognosis is much better than has hith- (praziquantel versus albendazole) to be
erto been thought’. Another reason is the used; the drug dosage and duration of treat-
uncertainty of long-term benefits such as ment; the specific role, indications and
improved seizure control following the duration of corticosteroid co-medication
administration of anticysticercal drugs8,9. and antiepileptic drugs (AEDs).
Finally, the need for anticysticercal drugs
depends on the risk–benefit ratio. Viable liv-
ing cysticerci (seen as non-enhancing cysts Parenchymal Neurocysticercosis
with a scolex on imaging studies) in the and Drug Therapy
brain parenchyma are usually asympto-
matic. Symptoms such as seizures, Parenchymal neurocysticercosis (NC) occurs
headache and focal neurological deficits are as a single cyst, two or three cysts forming
related to degeneration of cysticerci (transi- clumps (conglomerate lesions), multiple
tional forms). Degeneration of cysticerci cysts (which can be counted) or dissemi-
evokes inflammatory reaction in the nated (miliary) forms, where the brain is
surrounding host tissue such as brain studded with innumerable cysts.


376 B.S. Singhal and R.A. Salinas
Multiple cysts of neurocysticercosis NC14. All three patients reported by the

authors died; two of them died soon after
In this form of NC, imaging studies disclose praziquantel was administered. This was
scattered cysts, which can be counted. Cysts possibly due to severe inflammatory reaction
may be in the same or different stages of and oedema resulting from death of the cysts
development (live cysts, dying cysts and cal- and release of antigens. The muscles also
cified cysts). They may or may not be associ- swelled up. The poor prognosis was recog-
ated with subcutaneous or muscular nized as early as in 1933 by MacArthur, who
cysticercosis. Some lesions, especially the stated, ‘…the destruction of large numbers of
degenerating ones, may resolve sponta- these parasites at the same time – supposing
neously. Ever since the seminal description that some chemical of lethal power were
of the use of praziquantel in parenchymal forthcoming – might only make matters
NC by Robles and Chavarría in 1979, several worse for the sufferer…’15. Gupta et al.
workers have recommended use of anticys- reported worsening or death in two such
ticercal drugs1–3,12. Sotelo et al. demonstrated patients treated with albendazole whereas
clinical improvement with reduction in the four such patients treated with corticos-
number of cysts in 26 patients treated with teroids alone improved16. It stands to reason
praziquantel for 15 days as opposed to no that if anticysticercal drugs are to be given to
change or worsening in 17 untreated ‘histori- such patients, they should be carefully moni-
cal’ controls followed over a period of 9 tored and preferably pre-administered
months2. Subsequently, Robles et al. reported corticosteroids and AEDs. Contrariwise,
on the beneficial results of a large but uncon- some Chinese authors have reported the
trolled trial of praziquantel (50 mg kg1 successful use of praziquantel (Biltricide,
day1 for 15 days with or without corticos- 100 mg kg1 day1 for periods ranging
teroids) in 141 patients with NC3. Perceived from 1 week to 1 month) in patients with
benefits included resolution of symptoms disseminated cysticercosis17,18. An improve-
after 5 years of observation and of imaging ment in both neurological and non-neuro-
abnormalities. Escobedo et al. used albenda- logical symptoms, including resolution of
zole, the other available anticysticercal drug, pseudohypertrophy has been recorded in
in a dose of 15 mg kg1 day1 for 30 days in these Chinese reports. The reasons for the
seven patients with parenchymal NC and difference in outcome between the Indian
reported an 86% reduction in the total num- and Chinese studies are not clear.
ber of cysts4. However, Padma et al. in the García and Del Brutto described 11 Latin-
only randomized controlled trial (albenda- American patients with massive brain infes-
zole, 15 mg kg1 day1 for 7 days in 16 tation with viable cysticerci19. The number of
patients and placebo in 13 patients) con- cysts was in hundreds as opposed to much
ducted on this presentation of disease, found larger cyst loads in the disseminated variety.
no statistically significant difference in the Their patients tolerated the anticysticercal
number of cysts that disappeared upon com- treatment and showed considerable clinical
puted tomography (CT) at 1 week and 3 and radiological improvement.
months after the beginning of treatment13.
Disseminated neurocysticercosis Cysticercotic encephalitis
In this variety the brain, subcutaneous tissue Patients with cysticercotic encephalitis (usu-
and muscles are riddled with innumerable ally children and adolescents) will require
cysticerci. Patients may present with high-dose corticosteroids with or without
seizures, features of raised intracranial pres- osmotic diuretics or rarely decompressive
sure, focal deficits or dementia. Wadia et al. surgery, depending on their clinical sta-
have cautioned against the use of anticys- tus20,21. In the series of patients reported by
ticercal drugs in this disseminated variety of Rangel et al. only one patient was adminis-

Controversies in Drug Treatment of Neurocysticercosis 377
tered praziquantel; others were treated only There are however, other workers who
symptomatically for intracranial hyperten- advocate the use of anticysticercal agents. In
sion21. The prognosis in terms of outcome a recent double blind, placebo-controlled
was uniformly dismal in this series. Some study, Baranwal et al. observed significant
workers have treated severe forms of NC benefit in terms of disappearance of lesions
with albendazole and demonstrated in children who received albendazole ther-
favourable outcome in such patients22,23. apy9. In this study, 65 paediatric patients
Nevertheless, we recommend that the use of with SCG on CT scan were randomly
anticysticercal drugs is best avoided. If used, assigned to receive either albendazole (15
they should be given with caution and in mg kg1 day1) or placebo for 4 weeks.
conjunction with corticosteroids. Follow-up CT scans were performed, 1 and 3
months after beginning of albendazole ther-
apy. After 3 months, 23 of 31 patients who
Solitary cysticercus granuloma received albendazole and only 15 of 32 of
placebo-treated patients showed complete
Solitary cysticercus granuloma (SCG) is a resolution of CT lesions. We have to con-
common form of parenchymal NC24,25. sider, however, that 12.5% of the patients
Controversy regarding the use of anticys- were lost to follow-up in this trial, and that
ticercal drugs in this form of the disease when the results of this study were pooled,
stems from the fact that during the follow- in a meta-analysis, with those obtained by
up, many of these lesions resolve sponta- Padma et al.26 they are not statistically signif-
neously (see Chapter 24). Padma et al. icant any more.
performed a double blind, randomized con- It has been suggested that the empirical
trolled trial of albendazole in 75 patients use of anticysticercal drugs facilitates the
with seizures and SCG26. Albendazole (15 diagnosis of SCG in doubtful cases by hasten-
mg kg1 day1) or placebo was adminis- ing the resolution of these lesions28. Del
tered for 7 days and serial CT scans Brutto administered albendazole (15 mg kg1
obtained at the end of 1 week, 1 month and day1) for 8 days to 20 patients with SCG29.
3 months after beginning of treatment. A CT undertaken after 2 weeks showed disap-
group of 40 patients received albendazole pearance of lesion in 11 patients, partial reso-
and 35 patients received placebo. A total of lution in five and no change in four patients.
35 patients given albendazole and 33 The favourable response to albendazole in 16
patients given placebo demonstrated reso- of 20 patients was construed as supportive of
lution of the CT abnormality at 3 months. a diagnosis of NC. In three out of the four
The difference between the two groups was who had not responded to albendazole, the
not statistically significant. In an open study diagnoses were ultimately revised upon fol-
reported by Singhal and Ladiwala, clinical low-up; two were ultimately diagnosed to
and radiological follow-up of patients with have gliomas and another one, tuberculoma.
SCG showed no significant difference in In a later study, albendazole was used in 39
seizure control and resolution of the lesion patients with seizures and a single lesion
in patients treated with AEDs alone and upon CT30. Overall 32 (82%) patients
those treated with AEDs and anticysticercal responded to the drug and showed reduction
drugs24. Chopra et al. reported that of the 78 in the size of the lesion after 2–4 weeks of
patients with SCG (treated with AEDs therapy. Further investigations in the non-
alone), there was complete disappearance of responders revealed tuberculomas (two),
CT lesions in 47 patients and significant astrocytoma (one), metastatic tumour (one),
reduction in the size of the lesion and sur- granulomatous lesion of unknown aetiology
rounding oedema in another 24 patients (one) and cysticercus (one). The author rec-
upon follow-up CT in 6–12 weeks27. These ommended the use of albendazole not only
and other workers found no advantage in for clearance of cysts but also as a diagnostic
giving anticysticercal drugs in patients with tool to support the diagnosis of NC as the
SCG. cause of the lesion. Rajshekar suggested that

patients with SCG may be treated with symp- Occult neurocysticercosis

tomatic therapy (AEDs) alone initially and
neuroimaging studies repeated after 8–12 In endemic regions, the administration of
weeks31. In patients with persistent SCG after praziquantel or albendazole for treatment of
12 weeks, anticysticercal drugs may be used intestinal taeniasis or other helminthiasis, in
to hasten the resolution. In an open trial of doses that are considerably small in compari-
the use of albendazole (15 mg kg1 day1 for son to doses used for anticysticercal effect in
14 days) in patients with persistent SCG the brain, are also known to induce inflam-
(defined as persistence beyond 12 weeks of matory reaction and trigger degeneration of
symptomatic therapy), repeat CT scan asymptomatic cysticerci in brain. Flisser et al.
showed total resolution in two and more recorded an unusually high frequency of
than 50% resolution in another two of a total headaches as an adverse event, when prazi-
of 11 patients. In the extension of this study quantel was administered in doses of 5 mg
in 43 patients, a favourable response to alben- kg1 for community treatment of intestinal
dazole was demonstrated in 20 patients32. taeniasis34. The authors conjectured that in
Murthy and Reddy suggested the use of some of the individuals, headaches might be
albendazole therapy in patients whose SCG linked to inflammatory degeneration of cys-
revealed a scolex on the CT scan (ring with ticerci in the brain. They were able to
dot pattern)33. They surmised that the pres- demonstrate this phenomenon in at least one
ence of a scolex corresponded to a more individual. The possibility of unmasking of
active stage of the parasite as compared to symptoms of NC as a result of the adminis-
SCG without a scolex and that patients with tration of anthelmintic drugs should be kept
this imaging attribute might benefit from in mind in endemic areas.
anticysticercal therapy.
Role of anticysticercal drugs in relation to

Two or three cysts in clumps stage of neurocysticercosis
(conglomerate lesions)
Some authors recommend an expectant pol-
It is not uncommon to see two or three cysts icy with symptomatic therapy alone in those
clumped together upon brain imaging of in whom imaging reveals a predominance of
individuals presenting with seizures. transitional cysticerci on the premise that the
Possibly, two or three larvae have reached parasite in these lesions has probably
the same site in the brain at the same time. died24,35. An Ecuadorian trial studied the
They can be seen as two or three ring- effect of anticysticercal drugs (praziquantel,
enhancing or disc-enhancing lesions on CT 50 mg kg1 day1 for 15 days and albenda-
and magnetic resonance imaging (MRI). The zole, 15 mg kg1 day1 for 8 days in addition
inflammatory reaction and oedema is more to prednisolone) in comparison with no anti-
than that with a single cysticercus. Besides cysticercal treatment in 175 patients with live
seizures, the patients may also experience active parenchymal NC8. There were no dif-
headache. It is necessary to identify different ferences in the proportion of patients that
types of parenchymal forms of NC and eval- were free of NC lesions at 6 and 12 months.
uate the results of therapy in these different Furthermore, there were no differences in the
subsets. The conglomerate form is more proportion of patients who were seizure-free
likely to take longer time to resolve and per- at 24 months. In clinical practice, one often
haps heal by leaving a bigger scar or gliotic encounters an intermixture of live-active,
area or heal by calcification (Bhim S. Singhal, transitional and inactive cysticerci upon
Mumbai, India, unpublished observations). brain imaging studies. Here, the clinician
In such cases it might be preferable to use should exercise his judgement based upon
anticysticercal drugs with anti-inflammatory the stage of most cysticerci, the number of
agents (like corticosteroids) at an early stage lesions and the risk of inflammatory exacer-
and continue AEDs for longer periods. bation. Finally, a patient presenting with

seizure and healed calcified lesion(s) on CT anticysticercal drugs is inflammatory exacer-

(healed cysticercus cyst(s)) will require only bations provoked by anticysticercal therapy
symptomatic therapy (AEDs). leading to sequelae, which are more serious
in the case of extraparenchymal NC in com-
parison to parenchymal NC. These sequelae
Does anticysticercal therapy improve are mainly in the form of meningitis, arach-
seizure control? noiditis, stroke and hydrocephalus. Recently,
albendazole has been suggested to be effec-
Besides the resolution of the lesion on CT tive for subarachnoid forms with resolution
scan, outcome measures should also relate of even giant racemose subarachnoid
to clinical benefit. In the case of SCG, it cysts40,41. Martinez et al. reported total resolu-
should relate to improved seizure control. tion of subarachnoid cysticercosis in three out
Only two randomized, controlled trials have of four patients treated with praziquantel
addressed the question of seizure relapse and in all 41 patients treated with albenda-
after anticysticercal therapy8,9. They found zole42. Del Brutto reported significant benefit
no statistically significant difference in with the use of albendazole in 17 patients
seizure relapse rates between the groups with subarachnoid NC43. There was total res-
treated or not treated with anticysticercal olution of cysts in 14 patients when CT scan
therapy. The pooled odds ratio for seizure was repeated after 3 months. Recently,
relapse with anticysticercal treatment versus Proano et al. described their experience with
no anticysticercal treatment was 0.92 (CI95%: medical treatment of 33 patients with giant
0.47–1.81). Kramer wondered whether the (5 cm) subarachnoid NC with intracranial
good radiological outcome reported with hypertension44. Patients were administered
anticysticercal drugs is also reflected upon multiple courses of albendazole (15 mg kg1
seizure outcome10. He and others, have sug- day1 for 4 weeks) and 10 of them were given
gested that the enhanced inflammatory an additional course of praziquantel (100 mg
response following therapy may produce a kg1 day1 for 4 weeks). After a median fol-
more profound cerebral cicatrix, thereby low-up of 59 weeks, cysts had either disap-
adversely affecting seizure outcome11,36. This peared or calcified in all patients. The study
hypothesis, however, has never been tested. was however, uncontrolled; therefore the
On the other hand, use of anticysticercal possibility of spontaneous resolution can not
drugs in such patients was claimed to permit be excluded. Nevertheless, the report empha-
better control of seizures with AEDs29,37. sized the safety of medical treatment as well
Besides, the likelihood of remaining seizure- as the need for longer duration and multiple
free after withdrawal of AEDs was reported courses of treatment in such situations. There
to be greater in patients who were previ- are also isolated reports of the effectiveness
ously treated with albendazole38,39. In the of anticysticercal drugs in intraventricular
study reported by Singhal and Ladiwala NC40, 42, 45. Proano et al. used a 2-week course
from Mumbai, India, seizures were equally of albendazole in ten patients of fourth ven-
well controlled in patients treated either with tricular cysticercosis with an additional praz-
AEDs alone (92%) or with AED plus anticys- iquantel course in two patients46. There was
ticercal drugs (93%)24. complete disappearance of the cyst in eight
patients, decrease in size in one patient and
failure of response in one patient. The
Extraparenchymal Neurocysticercosis authors recommended ventriculoperitoneal
shunt before anticysticercal therapy. Such a
While for parenchymal NC, the unresolved decision however, should be taken on an
issue remains whether to administer anticys- individual basis. For detailed consideration
ticercal treatment or not, in extraparenchymal of the specific role, merits and demerits of
NC, there is controversy on the role of med- anticysticercal treatment in relation to other
ical therapy as against surgical treatment. A modalities of therapy, the reader is referred to
major apprehension regarding the use of Chapters 18, 20 and 22.

Esoteric Forms of Cysticercosis NC. Side effects such as headache, vomiting

and seizures resulting from an increase in
Although uncommon, an occasional inflammation and oedema around dying
patient may present with features of spinal cyst(s) can be seen with either of the drugs,
cord compression. The cyst may be even though they have different mecha-
intramedullary or leptomeningeal in loca- nisms of action.
tion. MRI helps to clarify such a lesion. One
cannot always be certain about the nature of
the lesion and it might be prudent to remove What should be the duration of the
the lesion using microneurosurgical tech- therapy?
niques47. However, there are isolated case
reports of the benefit with anticysticercal The duration of therapy with praziquantel
agents, which should preferably be com- and albendazole remains a somewhat con-
bined with steroids to reduce the inflamma- tentious issue. Earlier, praziquantel was rec-
tory reaction48,49. The reader is referred to ommended at a dose of 50 mg kg1 day1
Chapters 23 and 28 for an overview of the for 15 days2,3. Corona et al. have reported
management of spinal cysticercosis and ocu- beneficial effects with an ultra-short course
lar cysticercosis respectively. of praziquantel52. Praziquantel was adminis-
tered in a single day with a total dose of 75
mg kg1 divided into three 25 mg kg1
Anticysticercal Treatment: Drug, doses with each dose being given at 2-
Duration and Dosage Considerations hourly intervals. Four hours later, 10 mg of
intramuscular dexamethasone or 80 mg of
Which drug should be preferred as an prednisolone (orally) was administered. The
anticysticercal agent – albendazole or phamacokinetic principles behind and ratio-
praziquantel? nale for this approach have been described
in Chapter 37. Recently, the single-day regi-
Praziquantel was the first drug used for NC men was used in 26 patients with single
and albendazole was introduced later. Both enhancing brain lesions53. In 14 treated
have been used extensively for the treat- patients, the lesions resolved completely in
ment of NC. Takayanagui and Jardim com- 11 and partially in two while in the
pared their efficacy in a non-randomized untreated group of 12 patients, the lesion
trial of 22 patients treated with praziquan- persisted in six patients. Adverse events
tel, 21 with albendazole and 16 given only were noted in only one patient in the treated
symptomatic treatment50. Both, praziquan- group. The authors recommended single-
tel and albendazole were found to be effec- day praziquantel as the treatment of choice,
tive as compared to the control. in view of its demonstrated efficacy, and
Albendazole was found to be more effective reduced duration and costs of treatment. In
in reducing the number of cysts as com- another study, however, the authors demon-
pared to praziquantel (80% versus 50%, strated resolution of imaging abnormalities
respectively). Cruz et al. also reported simi- in patients with single enhancing brain
lar benefits of albendazole over praziquan- lesions but not in those with multiple NC,
tel51. Albendazole is generally preferred implying a poor efficacy of the single-day
because it is cheaper and as effective, if not praziquantel regimen in multiple NC54.
more so, than praziquantel. Besides, the co- The duration and dosage schedule of
administered drugs like dexamethasone albendazole was initially based upon
reduce the plasma levels of praziquantel extrapolation of regimens used for the
whereas dexamethasone increases the con- treatment of hydatidosis. Escobedo et al.
centration of albendazole in the CSF (see reported excellent results (reduction of
Chapter 37). This may offer albendazole an cysts by 86%) with albendazole adminis-
advantage over praziquantel especially in tered at the dosage of 15 mg kg1 day1 for
the treatment of subarachnoid variety of 30 days in seven patients with parenchymal

NC4. Cruz et al. noted similar effectiveness mation and oedema (responsible for symp-
when 800 mg of albendazole was given to toms) around dying cyst(s)60. However, the
patients with parenchymal NC for a vari- dose, duration, form, mode and, most sig-
able period (8 days for 19 patients, 15 days nificantly, timing of administration of corti-
for 23 patients and 30 days for 11 costeroids are not clear. In most cases the
patients)55. Garcia et al. compared the effi- clinicians use their own judgement to
cacy of 1 week versus 2 weeks of albenda- decide whether or not to use corticos-
zole therapy and noted no significant teroids. Corticosteroids are recommended
difference56. Current opinion favours a 1- as an important part of therapy for cysticer-
week course of albendazole therapy57. cotic encephalitis in children and dissemi-
Finally, Del Brutto et al. compared a single- nated NC. They are also recommended for
day praziquantel therapy with 1 week of treatment of acute neurological deficit
albendazole for NC and found similar resulting from oedema, vasculitis and large
favourable results58. Clearly, more double subarachnoid cysts. The use of corticos-
blind controlled studies are needed to teroids may modify the plasma levels of
assess the efficacy of praziquantel and anticysticercal drugs and affect the efficacy
albendazole using different dosage and of these drugs. Concomitant administration
duration schedules. of corticosteroids reduces the plasma level of
praziquantel (see Chapter 37). Shandera
et al. observed that patients treated with
Should patients with non-responding or praziquantel and corticosteroids were more
partially responding lesions receive a likely to require a second course of prazi-
second course of anticysticercal agents? quantel than those treated with praziquan-
tel alone61. It has been suggested that as the
It is well known that not all patients will half-life of praziquantel is 2–3 h, corticos-
show complete resolution of cysts with anti- teroids should be given 4 hours after the
dose of praziquantel to have optimal anti-
cysticercal drugs. Chong et al. reported a
cysticercal and anti-inflammatory effects.
patient with multiple parenchymal NC, in
Plasma levels of albendazole increase when
whom cysts persisted even after repeated
given concurrently with dexamethasone
courses of albendazole and praziquantel59.
and therefore many recommend the use of
In clinical experience, it is not uncommon to
albendazole in preference to praziquantel
see patients with a partial response upon
as an anticysticercal agent. The administra-
brain imaging in terms of the number and tion of intermittent long-term treatment
size of cysts that have resolved after anti- with corticosteroids has been demonstrated
cysticercal treatment. It is not clear whether to improve chances of ventriculoperitoneal
such individuals should be offered a second shunt patency in patients with hydro-
course of anticysticercal treatment. It is also cephalus due to NC. An open controlled
not clear as to what would be the appropri- study evaluated clinical status, incidence of
ate time to repeat the anticysticercal drug shunt malfunction and CSF abnormalities
and if a different drug or the same drug for up to 2 years in patients in whom a ven-
should be used for the repeat course of anti- triculoperitoneal shunt had been inserted
cysticercal therapy. for cysticercotic hydrocephalus62. Two of
the 13 patients given prednisolone (50 mg,
three times a week) required shunt revi-
Symptomatic Therapy of sion, while 18 of 30 patients in the control
Neurocysticercosis group required shunt revision when fol-
lowed up for 2 years. The difference was
Corticosteroids statistically significant; better shunt func-
tion in the prednisolone-treated group was
Corticosteroids are often administered in related to improvement in cerebrospinal
NC on the premise that they reduce inflam- fluid abnormalities.

Non-steroidal anti-inflammatory agents vival, cyst persistence (defined as incomplete

resolution on radiographic studies), subse-
Some authors recommend the use of anti- quent seizures and hydrocephalus. They
histamines, such as chlorpheniramine (chlor- included randomized or quasi-randomized
phenamine) or anti-inflammatory agents trials comparing an anticysticercal drug with
such as ketoprofen as an alternative to corti- a placebo or a control group receiving symp-
costeroids22,23. They recommend the routine tomatic therapy in patients with NC. Only
pre-administration with anti-histaminic four studies involving 305 people met the
agents and for 4–6 months after a course of inclusion criteria8,9,13,26. A difference just
albendazole. We have no personal experi- approaching significance was detected
ence with these agents but believe that between anticysticercal therapy and placebo
severe inflammatory exacerbations are often in relation to cyst persistence at 6 months
life-threatening and should be better man- (relative risk: 0.83; 95%CI: 0.70–0.99). Two tri-
aged with high potency corticosteroids. als reported on seizure rates after 1–2 years
follow-up and found no difference (relative
risk: 0.95; 95%CI: 0.59–1.51)8,9. In the study by
Anti-cerebral oedema measures Carpio et al., there was no difference detected
in rates for development for hydrocephalus
If raised intracranial pressure is a feature (relative risk: 2.19; 95%CI: 0.29–16.55)8. The
(seen mostly with multiple NC or dissemi- authors concluded that there was insufficient
nated NC), judicious use of intravenous evidence to determine whether anticysticer-
mannitol, furosemide, oral glycerol along cal therapy is associated with beneficial
with intravenous dexamethesone is justified. results in NC63. They emphasized that:
Neurosurgical intervention should be sought
for consideration of ventriculoperitoneal the clinicians should be aware of the lack of
evidence to either support or refute the use of
shunt if there is hydrocephalus, or decom-
anticysticercal therapy in NC. This lack of
pression by craniotomy if there is risk of her-
evidence, added to the potential harm
niation. Suitable analgesics should be given
recognized with treatment, means that the
for symptomatic relief of headache. clinicians have to weigh the benefits and risks
of anticysticercal therapy very carefully in each
individual patient.
Antiepileptic drugs
The Cysticercosis Working Group in Peru is
AEDs constitute standard therapy for conducting a randomized double blind,
parenchymal NC. A discussion on the con- placebo-controlled trial of albendazole and
troversies regarding the optimal duration of dexamethasone in 120 patients with
AEDs can be found in Chapter 21. parenchymal NC (Hector H. García, Lima,
Peru, personal communication). The num-
ber of seizures on follow-up, before and
Conclusions after withdrawal of AEDs and number of
lesions upon MRI at 6 months and CT at 12
Despite advances in the diagnosis (using and 24 months will be evaluated. Results
imaging and immunological methods) and were expected after breaking the code in
availability of anticysticercal drugs (prazi- September 2002. Another multicentre, ran-
quantel and albendazole) the treatment of domized, placebo-controlled double blind
NC still remains controversial. Outcome clinical trial is currently underway in
measures should include resolution of cysts Ecuador to determine whether anticysticer-
on imaging studies and immediate and long- cal therapy added to symptomatic treat-
term relief from the symptoms. Salinas and ment influences resolution of lesions and
Prasad reviewed the drug therapy for NC63. long-term outcome. Patients with active or
The objective was to assess the effect of drug transitional cysts will be randomized to
treatment in human NC in relation to sur- symptomatic treatment alone (cortico-

steroids and AEDs) or to symptomatic treat- will include the persistence of seizures and
ment with albendazole. Patients with both the late development of hydrocephalus
intraparenchymal and extraparenchymal (Arturo R. Carpio, Cuenca, Ecuador, per-
cysts will be included but randomized inde- sonal communication). The results of these
pendently. The primary outcome measure two randomized, double blind placebo-con-
will be reduction of cysts at 1 year after trolled trials of anticysticercal therapy in
treatment. Secondary outcome measures NC are keenly awaited.
References
1. Robles, C., Chavarría, M. (1979) Presentaction de un caso clinico de cisticercosis cerebral curado
medicamente con un nuevo formaco: Praziquantel. Salud Publica de Mexico 21, 603–618.
2. Sotelo, J., Escobedo, F., Rodriguez-Carabajal, J., et al. (1984) Therapy of parenchymal brain cysticer-
cosis with praziquantel. New England Journal of Medicine 310, 1001–1007.
3. Robles, C., Sedano, A.M., Vargas-Tentori, N., et al. (1987) Long-term results of praziquantel therapy
in neurocysticercosis. Journal of Neurosurgery 66, 359–363.
4. Escobedo, F., Penagos, P., Rodriguez, J., et al. (1987) Albendazole therapy for neurocysticercosis.
5. Sotelo, J., Escobedo, F., Penagos, P. (1988) Albendazole vs. praziquantel for therapy for neurocys-
ticercosis. A controlled trial. Archives of Neurology 45, 532–534.
6. Dixon, H.B.F., Hargreaves, W.H. (1944) Cysticercosis (Taenia solium). A further 10 year study cover-
ing 284 cases. Quarterly Journal of Medicine 13, 107–121.
Research Council Special Report Series No. 299. Her Majesty’s Stationery Office, London, pp. 1–58.
focal seizures and single small enhancing computerized tomographic lesions: a randomized,
placebo-controlled, double-blind trial. Pediatric Infectious Diseases Journal 17, 696–700.
10. Kramer, L.D. (1990) Anthelminthic therapy for neurocysticercosis. Archives of Neurology 47, 1059.
11. Kramer, L.D. (1995) Medical treatment of cysticercosis – ineffective. Archives of Neurology 52,
101–102.
12. Vasconcelos, D., Cruz-Segura, H., Methos-Gomez, H., et al. (1987) Selective indications for the use of
praziquantel in the treatment of brain cysticercosis. Journal of Neurology, Neurosurgery and Psychiatry
66, 383–388.
13. Padma, M.V., Behari, M., Misra, N.K., et al. (1995) Albendazole in neurocysticercosis. National
Medical Journal of India 8, 255–258.
14. Wadia, N.H., Desai, S., Bhatt, M. (1988) Disseminated cysticercosis: new observations including CT
16. Gupta, P.M., Kalita, J., Misra, U.K. (1998) Should patients with numerous cysticerci be treated with
corticosteroids only? Annals of the Indian Academy of Neurology 1, 25–28.
17. Zhu, D., Xu, W. (1983) Effect of biltricide on cysticercosis cellulosae with muscular pseudohypertro-
phy: a report of three cases. Chi Sheng Chung Hsueh Chi Sheng Chung Ping Tsa Chi 1, 185–186.
18. Xu, Z., Chen, W., Zong, H., et al. (1985) Praziquantel in the treatment of cysticercosis cellulosae.
Report of 200 cases. Chinese Medical Journal 98, 489–494.
19. García, H.H., Del Brutto, O.H. (1999) Heavy nonencephalitic cerebral cysticercosis in tapeworm car-
riers. Neurology 53, 1582–1584.
20. Del Brutto, O.H., Sotelo, J. (1988) Neurocysticercosis: an update. Review of Infectious Diseases 10,
1075–1087.
21. Rangel, R., Torres, B., Del Bruto, O., et al. (1987) Cysticercotic encephalitis: a severe form in young
22. Agapejev, S., Meira, D.A., Barraviera, B., et al. (1989) Neurocysticercosis: treatment with albendazole and
dextrochlorophenirimine. Transactions of the Royal Society of Tropical Medicine and Hygiene 83, 377–383.

23. Agapejev, S., Da Silva, M.D., Ueda, A.K. (1996) Severe forms of neurocysticercosis. Treatment with
albendazole. Arquivos de Neuropsiquiatria 54, 82–93.
24. Singhal, B.S., Ladiwala, U. (1995) Neurocysticercosis in India. In: Rose, F.C. (ed.) Recent Advances in
Tropical Neurology. Elsevier Amsterdam, Netherlands, pp. 99–109.
26. Padma, M.V., Behari, M., Misra, N.K., et al. (1994) Albendazole in single CT lesions in epilepsy.
Neurology 44, 1344–1346.
27. Chopra, J.S., Sawhney, I.M.S., Suresh, N., et al. (1992) Vanishing CT lesions in epilepsy. Journal of the
28. Rawlings, D., Ferriero, D.M., Messing, R.O. (1989) Early CT reevaluation after empiric praziquantel
therapy in neurocysticercosis. Neurology 39, 739–741.
29. Del Brutto, O.H. (1993) The use of albendazole in patients with single lesions enhanced on contrast
CT. New England Journal of Medicine 328, 356–357.
30. Del Brutto, O.H. (2000) Solitary cysticercus granuloma in Latin America. In: Rajshekhar, V., Chandy,
M.J. (eds) Solitary Cysticercus Granuloma – The Disappearing Lesion. Orient Longman, Hyderabad,
India, pp. 153–166.
31. Rajshekhar, V., Chandy, M.J. (2000) Outcome in patients with solitary cysticercus granuloma. In:
Rajshekhar, V., Chandy, M.J. (eds) Solitary Cysticercus Granuloma – The Disappearing Lesion. Orient
Longman, Hyderabad, India, pp. 135–152.
understanding a controversy. Acta Neurologica Scandinavica 84, 465–470.
33. Murthy, J.M.K., Reddy, Y.V.S. (1998) Prognosis of epilepsy associated with single CT enhancing
lesion: a long term follow up study. Journal of the Neurological Sciences 159, 151–155.
sis after single taeniacidal dose of praziquantel. Lancet 342, 748 (Letter).
36. Vazquez, V., Sotelo, J. (1992) The course of seizure after treatment of cerebral cysticercosis. New
England Journal of Medicine 327, 696–701.
37. Del Brutto, O.H., Santibanez, R., Noboa, C.A., et al. (1992) Epilepsy due to neurocysticercosis: analy-
38. Del Brutto, O.H. (1994) Prognostic factors for seizure recurrence after withdrawal of antiepileptic
drugs in patients with neurocysticercosis. Neurology 44, 1706–1709.
39. Sotelo, J., Del Brutto, O.H., Roman, G.C. (1996) Cysticercosis. In: Remington, J.S., Schwartz, M.N.
(eds) Current Clinical Topics in Infectious Diseases, Vol. 16. Blackwell Science, Cambridge,
Massachusetts, pp. 240–259.
40. Del Brutto, O.H., Sotelo, J. (1990) Albendazole therapy for subarachnoid and ventricular cysticerco-
sis: case report. Journal of Neurosurgery 72, 816–817.
41. Del Brutto, O.H., Sotelo, J., Aguirre, R., et al. (1992) Albendazole therapy for giant subarachnoid cys-
ticerci. Archives of Neurology 49, 535–538.
42. Martinez, H.R., Rangel-Guerra, R., Arredondo-Estrado, J.H., et al. (1995) Medical and surgical treat-
43. Del Brutto, O.H. (1997) Albendazole therapy for subarachnoid cysticercosis: clinical and neuroimag-
ing analysis of 17 patients. Journal of Neurology, Neurosurgery and Psychiatry 62, 659–661.
44. Proano, J.V., Madazo, I., Avelar, F., et al. (2001) Medical treatment for neurocysticercosis character-
ized by giant subarachnoid cysts. New England Journal of Medicine 20, 879–885.
46. Proano, J.V., Madrazo, I., Garcia, L., et al. (1997) Albendazole and praziquantel treatment in neuro-
cysticercosis of the fourth ventricle. Journal of Neurosurgery 87, 29–33.
47. Aghakhani, N., Comoy, J., Tadie, M., et al. (1998) Isolated intramedullary cysticercosis. Case report.
Neurochirurgie 44, 127–131.
48. Corral, I., Quereda, C., Moreno, A., et al. (1996) Intramedullary cysticercosis cured with drug treat-
ment: a case report. Spine 21, 2284–2287.

49. Garg, R.K., Nag, D. (1998) Intramedullary spinal cysticercosis: response to albendazole: case reports
and review of literature. Spinal Cord 36, 67–70.
50. Takayanagui, O.M., Jardim, E. (1992) Therapy for neurocysticercosis: comparison between albenda-
zole and praziquantel. Archives of Neurology 49, 290–294.
51. Cruz, M., Cruz, I., Horton, J. (1991) Albendazole versus praziquantel in the treatment of cerebral
cysticercosis: clinical evaluation. Transactions of the Royal Society of Tropical Medicine and Hygiene 85,
244–247.
52. Corona, T., Lugo, R., Medina, R., et al. (1996) Single-day praziquantel therapy for neurocysticercosis.
New England Journal of Medicine 334, 125.
53. Pretell, E.J., García, H.H., Custodio, N., et al. (2000) Short regimen of praziquantel in the treatment
of single enhancing brain lesions. Clinical Neurology and Neurosurgery 102, 215–218.
54. Pretell, E.J., García, H.H., Gilman, R.H., et al. (2001) Failure of one-day praziquantel treatment in
patients with multiple neurocysticercosis lesions. Clinical Neurology and Neurosurgery 103, 175–177.
55. Cruz, I., Cruz, M.E., Carrasco, F., et al. (1995) Neurocysticercosis: optimal dose treatment with alben-
dazole. Journal of the Neurological Sciences 133, 152–154.
prospective double blind trial comparing 7 versus 14 days of treatment. Neurology 48, 1421–1427.
58. Del Brutto, O.H., Campos, X., Sanchez, J., et al. (1999) A single-day praziquantel versus 1-week
albendazole for neurocysticercosis. Neurology 52, 79–81.
59. Chong, M.S., Howkins, C.P., Cook, C.G., et al. (1991) A resistant case of neurocysticercosis.
Postgraduate Medical Journal 6, 577–578.
60. Minguetti, G., Ferreira, M.V. (1982) Effect of corticoids in the acute phase of neurocysticercosis: pre-
liminary note. Arquivos de Neuropsiquiatria 40, 77–85.
61. Shandera, W.X., White, A.C., Jr, Chen, J.C., et al. (1994) Cysticercosis in Houston, Texas: a report of
112 patients. Medicine 73, 37–51.
62. Roman, R.A.S., Soto-Hernandez, J.L., Sotelo, J. (1996) Effects of prednisone on ventriculoperitoneal
shunt function in hydrocephalus secondary to cysticercosis: a preliminary study. Journal of
63. Salinas, R., Prasad, K. (2000) Drugs for treating neurocysticercosis (tapeworm infection of the brain).
In: Cochrane Review, The Cochrane Library, Issue 3, Oxford, UK.

39 Neurocysticercosis: Neurosurgical
Perspective
Bhaiwani S. Sharma and P. Sarat Chandra
Introduction with or without corticosteroids do not pre-

vent occurrence of complications such as
The management of neurocysticercus (NC) hydrocephalus. Prompt surgical excision of
includes both medical and surgical treat- the cyst may prevent chronic inflammation
ments. These are complementary to each and granuloma formation (focus of epilepsy)7
other in a number of cases. Medical treat- around the cyst(s) in parenchymal locations,
ment consists of control of seizures with and ependymitis and ventricular entrapment
antiepileptic drugs and cerebral oedema due to intraventricular cysticercosis.
with decongestants in addition to anticys- Therefore, some patients with NC benefit
ticercal drugs. from neurosurgical intervention. The latter is
usually palliative and at times curative. The
indication for neurosurgical approach to man-
Rationale for surgical treatment agement is usually based on the presence of
specific clinical manifestations with explicit
Anticysticercal drugs, namely, albendazole underlying pathophysiological mechanisms,
and praziquantel, trigger cyst degeneration often posing a threat to life or vision by local
and are more effective against active cysts in compression or raised ICP8,9.
the brain parenchyma. Though reported to be
effective in other forms of NC, there is still no
consensus about their efficacy in extra- Preoperative Selection and Work-up
parenchymal locations1–5. Giant cysticerci
(parenchymal, ventricular or cisternal) are Indications for surgery
most often of the racemose form and do not
In general, neurosurgical intervention is
appear to respond well to anticysticercal
required when:
drugs. The possibility of decompensation of
intracranial pressure (ICP) and transtentorial 1. Hydrocephalus is present.
herniation, caused by increase in oedema and 2. A cyst exhibits tumour-like effect.
inflammatory reaction provoked by cyst 3. Viable intraventricular NC is diagnosed.
degeneration, cautioned against the use of 4. Abrupt or rapid rise of ICP refractory to
anticysticercal drugs in individuals with giant medical treatment is noted.
cysts with mass effect or disseminated cys- 5. Diagnosis is in doubt (for instance, single
ticercosis6. Furthermore, these medications small enhancing lesions upon CT).


388 B.S. Sharma and P.S. Chandra
Choice of surgical procedure for instance in the optochiasmatic, cerebel-

lopontine or quadrigeminal cisterns or in
A range of surgical procedures has been the fourth ventricle; and those due to raised
described (Table 39.1). Appropriate surgical ICP10. The latter group was further sub-clas-
intervention is tailored according to patho- sified into three subgroups:
physiological mechanisms underlying spe-
1. Raised ICP owing to hydrocephalus
cific clinical manifestations. In other words,
resulting from:
clinical presentations primarily determine
● mechanical obstruction of ventricles/basal
the need for, and choice of, neurosurgical
cisterns by cysticercal cysts;
approach8,10–12. Indeed, earlier attempts at
● inflammatory reaction (ependymitis or
surgical management relied solely upon
arachnoiditis);
clinical manifestations. Accordingly, clinical
● impairment of CSF absorption due to
classifications were evolved to determine
parasagittal arachnoiditis and involve-
the nature of surgical intervention. Thus,
ment of arachnoid villi.
Stepien and Chorobski described a classifi-
2. Raised ICP owing to tumour-like syn-
cation, which was used to decide the
drome (space occupancy; tumoral form).
requirement for, and prognosis after,
3. Raised ICP owing to diffuse cerebral
surgery11. They classified patients who
oedema (encephalitic; pseudotumoral form).
required operation into three groups: group
I included those with focal tumour-like pre- At present, neuroradiological studies
sentation with focal neurological deficits form the cornerstone of the preoperative
with or without raised ICP; group II evaluation of candidates being considered
included those with profuse multiple cys- for neurosurgical intervention. Plain and
ticerci giving rise to a pseudotumoral form; contrast computed tomography (CT) pro-
and group III comprised patients with vides rough guidelines for neurosurgical
raised ICP due to hydrocephalus. Colli et al. treatment. However, it alone does not form
classified their surgical series into two main the basis for intervention. In general, CT is
groups, i.e. those with local compression, not adequate for the evaluation of ventric-
Table 39.1. Surgical options for neurocysticercosis.
1. Cerebrospinal fluid diversion procedures:

(a) Ventriculoperitoneal/ventriculoatrial shunt
(b) Third ventriculostomy
(c) Torkildsen’s operation
(d) Ventricular reservoir implantation
2. Lesion excision:
(a) Open craniotomy and excision
(i) Infratentorial
● Midline suboccipital craniotomy for cysts in the fourth ventricle, cisterna magna and
quadrigeminal cistern
● Unilateral suboccipital craniotomy for cysts in the cerebellopontine angle cistern
(ii) Supratentorial
● Lateral/third ventricle cysts – transcortical/transcallosal approach
● Optochiasmatic/sylvian/suprasellar cysts – pterional craniotomy
● Pseudotumour form – bitemporal decompressive/unilateral frontal or temporal lobectomy
● Prepontine/perimesencephalic cisternal cysts – subtemporal approach
● Giant parenchymal/cisternal cysts – according to location – frontal, temporal, parietal or
occipital craniotomy and excision.
(b) Minimally invasive procedures:
(i) Stereotactic surgery in deep-seated and periventricular cysts and for localization purpose
(ii) Endoscopic surgery for intraventricular neurocysticercosis

Neurocysticercosis: Neurosurgical Perspective 389
ular and cisternal NC. At best, CT Operative Strategies

provides strong suspicion of ventricular or
cisternal cysts in individuals at risk. Hydrocephalus resulting from
Magnetic resonance imaging (MRI) includ- inflammatory impediment to CSF flow
ing contrast enhanced and fluid attenua-
tion inversion recovery (FLAIR) studies As a rule, in all instances of hydrocephalus,
are more useful than CT but these may where preoperative evaluation discerns the
also be equivocal at times, particularly, for presence of inflammation associated with the
instance in the case of fourth ventricle cysticerci, for instance, ependymitis in associa-
cysts (see Chapter 20)13. Contrast- tion with intraventricular cysticercosis and
enhanced MRI is expressly useful in the meningitis and arachnoiditis surrounding cis-
identification of arachnoiditis and ternal cysts, it is best to proceed directly to
meningeal inflammation around cisternal ventriculoperitoneal shunt (VPS) (Fig. 39.1). In
cysts and ependymitis in the case of intra- the particular case of communicating hydro-
ventricular NC. In general, the presence of cephalus due to cisternal cysts, exeresis is not
contrast enhancement of the pericystic an effective procedure as they are usually mul-
meninges or the ventricular lining consti- tiple and adherent to cranial nerves, vessels
tutes a contraindication for definitive and neural tissue owing to arachnoiditis14,15.
exeresis of the cyst. CT cisternography Surgery may have disastrous consequences
after administration of intrathecal contrast and removal of a cyst does not prevent the
permits accurate delineation of cisternal progression of inflammatory reaction that is
cysts and, if the contrast permeates the already underway. Obstruction by an inflam-
foramina of Luschka and Magendie, of matory process is also frequent at the fourth
intraventricular cysts as well. For the ventricular outlet. Such patients are best
preoperative evaluation of intraventricular treated with insertion of VPS since they do not
NC, a ventriculo-CT, after contrast adminis- benefit from direct posterior fossa exploration
tered through a ventriculostomy or a ven- and lysis of inflammatory adhesions, which
tricular reservoir, is ideal. invariably recur within a short time.
Magnetic resonance imaging

or computed tomography ventriculography
Obstruction by Communicating Inflammatory Inflammatory

free cyst hydrocephalus obstruction obstruction +
cyst
Surgical excision Ventriculoperitoneal Ventriculoperitoneal shunt +

shunt partial excision
Fig. 39.1. Management of hydrocephalus due to neurocysticercosis.

When CT ventriculography or MRI do year15. In order to improve and optimize

not allow differentiation between obstruction shunt function and minimize post-shunt
due to inflammatory or free cysts, surgery is morbidity, several efforts have been made to
indicated. It is easy to differentiate between modify shunt design. Sotelo et al. have
viable, active and inflamed cysts at opera- devised a new shunt device that operates
tion. The former have a translucent mem- upon the principle of drainage according to
brane and contain colourless fluid. On the CSF production rather than pressure16–18.
other hand, inflamed cysts are characterized Structurally, it is characterized by the absence
by a thick opaque membrane and their con- of a valve mechanism and a long (9 cm) peri-
tents are hazy. Such cysts are often adherent toneal end of the catheter of diameter 0.017
and it is difficult to remove them. If at poste- inches (Fig. 39.2). Functionally, it is specified
rior fossa exploration, ependymitis or arach- by a constant rate of drainage under the bal-
noiditis is found or a cyst is found adherent anced influence of the gravitational effect and
to the ependyma, partial excision of the free ventricular pressure (Fig. 39.3a and b). The
portion of the cyst may be performed. device prevents overdrainage. More signifi-
Ventriculoperitoneal shunt insertion is indi- cantly, with regard to cysticercotic hydro-
cated immediately after partial cyst removal cephalus, the constant flow through it
as these patients develop inflammatory prevents clogging and obstruction by inflam-
blockade of cerebrospinal fluid (CSF) circula- matory and cystic debris.
tion and rise in ICP within a few weeks. Several other operative procedures have
Corticosteroids are used when inflamma- been undertaken for the management of cys-
tion (ependymitis, arachnoiditis or basal ticercotic hydrocephalus. Third ventricu-
meningitis) is observed at surgery, CSF stud- lostomy involves the establishment of a
ies reveal evidence of inflammation, the cyst communication between the third ventricle
is only partially excised and intraoperative and the interpeduncular cistern10,19. The
rupture is noted. Shunt complications include communication may be made by open
blockade and infection. Shunt obstruction surgery, endoscopically or under stereotactic
rates approach 50% within the first 4 months guidance. The procedure is effective in
and more than half of the patients require selected cases with aqueductal stenosis due
revision of shunt during first postoperative to cysticercotic arachnoiditis in the interpe-
Fig. 39.2. Illustration of an unassembled ventriculoperitoneal shunt designed by Sotelo et al. (see text
for explanation). The ventricular catheter (above) and the peritoneal catheter (below) are shown. Scale
shows centimetres. (Reproduced with permission from reference 16.)

New shunt Differential pressure valves

0 550 0 100 200 400 550
200 200
Ventricular pressure
Gravity effect (mm)

100 100
0 0
–100 –100
0 200 400 600 800 0 10,000 20,000 30,000
Daily drainage (ml)

Fig. 39.3. Comparison of functional characteristics of shunt devised by Sotelo et al. (left) and conventional
shunts (right). Hatched area represents the combination of ventricular pressure and gravity effect at which
conventional shunts remain non-functional. (Reproduced with permission from reference 16.)
duncular and perimesencephalic cisterns. A ricle. However, the fourth ventricle dilates and
major limitation is that it will fail if the sub- balloons out, often leading to the complica-
arachnoid spaces in the CSF pathway distal tion of posterior fossa mass with transforam-
to the interpeduncular cistern are occluded inal or reverse herniation. It is important to
because of cysticercotic arachnoiditis. distinguish this condition from a fourth ven-
Torlkidsen’s operation involves the creation tricle cyst because the surgical approaches to
of a communication between the third ven- the two conditions are different. A trapped
tricle and the cisterna magna20. This proce- fourth ventricle may require the insertion of
dure is useful in cases of third or fourth a separate shunt in the fourth ventricle21.
ventricle obstruction. In the case of a unilat-
eral hydrocephalus due to obstruction at the
foramen of Monro, a septum pellucidotomy Hydrocephalus in association with viable,
may be undertaken either after open cran- free intraventricular or cisternal cysts
iotomy, stereotactic localization or endoscop-
ically (see Chapter 40)10. In the absence of evidence of inflammation
An uncommon situation is the occurrence associated with intraventricular and cisternal
of a trapped fourth ventricle21,22. This occurs cysts, in the form of ependymitis and menin-
in the event of dual obstruction; aqueductal gitis/arachnoiditis respectively, a primary
stenosis due to perimesencephalic arach- removal of the cyst can be recommended
noiditis or ependymitis causes hydrocephalus (Figs 39.1 and 39.4)23,24. This often obviates
and fourth ventricle outlet obstruction the need for VPS. Surgical excision of the cyst
because of intraventricular cysticercosis or needs to be accomplished for several reasons.
arachnoiditis obliterates the foramina of First, the role of medical treatment in intra-
Luschka and Magendie. In such an event, the ventricular and cisternal NC is controversial.
lateral ventricles and the third ventricles are There is a theoretical risk of inflammatory
decompressed by a VPS in the lateral vent- exacerbation of symptoms with anticysticer-

Neurocysticercosis
Active parenchymal Cisternal Spinal cyst(s) Intraventricular

cyst(s) cyst(s) cyst(s)
Small Giant or Small Large Intramedullary Subarachnoid Free Adherent

cyst(s) large cyst(s) cyst(s) cyst(s) cyst(s) cyst(s) cyst(s)
(> 4 cm)
cyst(s)
Trial with
anticysticercal
drugs/
Anticysticercal Asymptomatic Focal corticosteroids
therapy compression
Follow-up
Ventriculoperitoneal
shunt + partial
excision
Increase in
size
Excision
Fig. 39.4. Flow chart showing management protocol for neurocysticercosis.
cal drugs. Second, free-floating intraventricu- ratory arrest. Finally, free and viable intra-
lar cysts are at risk of obstructing the CSF ventricular as well as viable cisternal cysts
flow across several points, including the fora- are at risk of inflammatory degeneration dur-
men of Monro, aqueduct and the fourth vet- ing the natural course of their evolution. This
ricular outlet, by a ball-valve phenomenon. elicits an inflammatory reaction in the ven-
This can lead to acute hydrocephalus with tricular walls leading on to ependymitis and
rise in ICP, manifesting clinically with altered meningitis in the case of intraventricular NC,
sensorium, leading to coma and cardiorespi- and meningitis and arachnoiditis in the case

of cisternal cysticercosis. Therefore intraven- defects. A cyst located within the fourth ven-
tricular and cisternal cysts should be ideally tricle is approached via posterior fossa cran-
removed in order to prevent the above men- iotomy. The free cyst may protrude
tioned complications. Cysts may be removed spontaneously through the foramen of
by open surgical intervention in the case of Magendie towards the cisterna magna or it
cisternal forms and by either open cran- may be gently pulled out of the fourth ven-
iotomy using microsurgical technique or tricle (Fig. 39.5a–c). When the cyst is adher-
endoscopically in the case of intraventricular ent to the wall of the ventricle or if the
NC. Stereotactic localization may be per- foramen of Magendie is stenosed or
formed before craniotomy in case of diffi- obstructed, it needs to be opened or widened
culty. Free cysts located in the lateral or third with section of the inferior portion of the
ventricle are operated using anterior inter- vermis to facilitate visualization of the inner
hemispheric transcallosal or transcortical part of the ventricle. Madrazo et al. proposed
approach through the middle frontal pipette suction technique for atraumatic
gyrus23,24. extraction24,25. They devised a special long
Intraventricular cysts are more commonly pipette, which attaches to the cyst by suction
located in the occipital horns of the lateral and permits removal without rupture. They
ventricles and these might be approached by considered intraoperative cyst rupture as a
an occipital incision with occipital lobec- dangerous event24. Others, however, do not
tomy. A complication that must be endured share this view15,23. However, in all cases of
in such event is the occurrence of visual field intraoperative rupture of cyst, intraventricu-
Fig. 39.5. Surgical exposure of fourth ventricle cysticercosis. An active cyst is seen protruding from the
foramen of Magendie (a, b). A degenerating cyst with thick opaque walls that was delivered by section of
the inferior portion of the vermis (c). (Source: B.O. Colli, São Paulo, Brazil.)

lar lavage with Ringer’s lactate solution at been tried but experience with this procedure
body temperature is advocated in addition is limited and not favourable31.
to the systemic administration of high
potency corticosteroids. Endoscopic excision
has been advocated both for supratentorial Diffuse cerebral oedema (encephalitic or
and infratentorial intraventricular cysts26–28. pseudotumoral form)
Endoscopic third ventricular cyst removal
may be carried out very effectively using a Miliary infestation with diffuse inflamma-
rigid rod lens endoscope through a frontal tory reaction and oedema in the brain
burr hole. The foramen of Monro may be parenchyma, constitutes the clinical syn-
identified upon entering the lateral ventricle drome of cysticercotic encephalitis. Intra-
by noting the presence of the choroid plexus cranial pressure is raised and a major
and the thalamostriate vein. It is not uncom- determinant of the poor outcome in this con-
mon in long-standing hydrocephalus, to dition. There is increase in parenchymal vol-
find multiple perforations within the sep- ume with corresponding reduction in
tum, hence it is important to identify the ventricular and cisternal volumes. The pri-
correct portal of entry into the third ventri- mary treatment of this form is with deconges-
cle. It is usually not possible to remove the tants and corticosteroids. The latter prevent
cyst in toto, and the cyst usually gets secondary inflammatory reaction triggered
ruptured during removal. Intraventricular by acute destruction of the parasites23. In
injection of corticosteroids to prevent ana- exceptional cases, where intracranial hyper-
phylactic reaction remains controversial27,28. tension is refractory to medical treatment and
Endoscopic removal is reviewed in detail in threatens life or vision, decompressive bitem-
Chapter 40. poral craniotomy, or unilateral temporal or
frontal craniotomy and lobectomy may be
considered (Fig. 39.6)29,30,32.
Tumour-like syndrome (space occupancy
or tumoral form)
Local compression
Cysticercal cyst(s) may grow in size in the
parenchyma, cistern(s) or ventricle(s) and may All forms of NC may produce symptoms
produce mass effect and intracranial hyperten- and signs of compression of neural tissue
sion. Such cases are best treated by direct sur- when cysts grow to large or giant propor-
gical excision. Active cysts adhere weakly to tions. The location of the pathology dictates
neural tissue and can easily be excised com- the surgical approach (Table 39.1; Figs 39.5
pletely (Fig. 39.4). In the degenerative phase, and 39.7a and b).
intense inflammatory reaction around the
cyst(s) makes them firmly adherent to nervous
tissue or blood vessels and their complete
excision carries a risk of producing neurologi-
cal deficit. Such cysts are treated by cyst
decompression or partial resection via a
direct/stereotactic/endoscopic approach.
Cyst puncture is a relatively simple proce-
dure for decompressing giant cysts. However,
it rarely produces lasting results because cysts
are often multiple and the possibility of cysts
refilling29,30. The establishment of a shunt
between the cyst and the subarachnoid space
is not recommended because of its proclivity
to cause cysticercotic meningitis and arach- Fig. 39.6. Surgical specimen of frontal lobectomy
noiditis10. Cystoperitoneal drainage has also for disseminated neurocysticercosis.

Fig. 39.7. (a and b) Exposure for cysts in the suprasellar region showing surgical anatomy of the
region. c, Cysticercus cyst; IC, internal carotid artery; ON, optic nerve. (Reproduced with permission
from reference 10.)
Cisternal cysts Parenchymal cyst(s) may grow in size to

produce a tumour-like syndrome. Cysts
Well-defined cysts within the cisterns are
excised irrespective of their size when they larger than 4 cm produce local compres-
cause local compression. Cysts located in the sion of brain paranchyma and focal
optochiasmatic region may be approached neurological deficits. Stereotactic/open
via a transcranial route, preferably the pteri- craniotomy and cyst removal is advocated
onal or the fronto-temporo-orbital route (Fig. in cases of a single giant cortical cyst or
39.7a and b). Cysts in the cerebellopontine large clumps exhibiting tumour-like
angle cistern may be approached through a behaviour, when located in a surgically
unilateral suboccipital craniotomy. accessible area. The other indications for
excision include progressive focal neuro-
Parenchymal form logical deficit, lack of response to anticys-
ticercal therapy and uncertainty in
Cysticerci may lodge within the brain
diagnosis. Deep-seated (thalamic, basal
parenchyma as a single cyst, two or three cysts
forming clumps, countable multiple or innu- ganglia) cysticerci are uncommon but
merable cysts. Seizures are the most common difficult to manage surgically. They may
clinical manifestation. Tubercular granuloma, be approached using a transcortical or
microabscess, focal encephalitis, postictal transylvian route. Minimally invasive
enhancement, vascular lesions and neoplasms techniques such as stereotactic or image-
need to be considered in the differential diag- guided system for neuronavigation may
nosis. Surgery (excisional biopsy) may be be used to accurately localize the cyst for
required for confirmation of diagnosis33,34. biopsy or excision10,30,35.

Surgical Outcome and Postoperative Sotelo et al. reported excellent results with
Management their new shunt device that has been
described in an earlier section of this chapter.
The high postoperative mortality and mor- Their shunt was reported to be functional for
bidity observed in the past has been reduced a mean period of 9 ±2 months in 25 patients;
to a minimum by the following. only one patient required shunt revision16.
However, while the new device took care of
1. Better identification of patients with free shunt occlusion, inadequate drainage became
intraventricular cysts with ventriculo-CT or a problem17. Clinicoradiological follow-up of
MRI. the patients revealed conversion of a hyper-
2. Use of microsurgical techniques. tensive hydrocephalus to normotensive
3. Satisfactory control of aseptic meningitis hydrocephalus17. Thus the clinical picture
with perioperative and postoperative corti- changed from one of intracranial hyperten-
costeroids. sion to that of a frontal lobe gait disorder,
4. Availability of better functioning shunt dementia and incontinence. Radiological
devices. studies revealed inadequate resolution of
ventricular size. In order to obviate this com-
plication, the authors increased the cross-sec-
tional area of the peritoneal catheter from
Hydrocephalus
0.126 mm2 to 0.146 mm2. Further experience
with the revised shunt device including long-
Cysticercotic hydrocephalus constituted
term follow-up is awaited.
group III of Stepien and Chorobski’s classifi-
cation of clinical presentations requiring neu-
rosurgical intervention11. Individuals with
Tumoral form
this presentation were treated with total or
partial cyst exeresis or, in cases where this
The prognosis is far better than other forms.
was not possible, by decompression.
Out of 55 patients with this presentation in
Understandably, results were poor and post-
Stepien’s series, 35% recovered, 40% showed
operative mortality was high. The use of VPS
improvement, 2% showed no improvement
improved outcome of cysticercotic hydro- and 24% died in the postoperative period12.
cephalus. However, as experience with VPS This led him to conclude: ‘It is tempting to con-
accumulated, it was realized that this proce- clude, therefore, that in every case in which a
dure was associated with a high rate of shunt diagnosis of localized cerebral cysticercosis is
malfunction particularly due to occlusion made, operation should be performed’.
within the first 2 years after its insertion. Thus Colli et al. operated on 12 patients with
Colli et al. noted that 54% of 144 patients who giant intracranial cysticercosis and observed
were submitted to shunting, required reoper- good postoperative outcome in all 1210.
ation, mostly in the first 2 years10. Others have
similarly reported high incidence of shunt
malfunction14. The frequency of shunt mal- Pseudotumoral form
function correlates with the degree of abnor-
mality in CSF cell count and protein. In Surgery is rarely required and advocated in
general, mortality in cysticercotic hydro- this form of cerebral cysticercosis. The out-
cephalus is as high as 50% within the first come after surgery is not good. Thus, in 34
year. Those who survive and do not develop patients who were operated on for pseudo-
complications in the initial 1 or 2 years gener- tumoral cerebral cysticercosis in Stepien’s
ally do well. Intermittent long-term pred- series, about half had partial improvement,
nisolone therapy after VPS reduces shunt 14% had no change in their clinical status
malfunction and improves functional status and 32% died after surgery12. Colli et al. per-
of the patient36. In these cases, prednisolone is formed bitemporal decompressive surgery in
started within the first postoperative week at five patients. Three patients improved, while
a dose of 50 mg three times a week. two died a few days later10.

Compressive form cysts, hydrocephalus, tumour-like effect,

diffuse disseminated form refractory to
The surgical outcome is dependent upon the medical treatment and doubt in diagno-
presence of inflammation and its sequelae. sis. The choice of surgical procedure is
When cysts in the fourth ventricle, cerebello- dictated by the pathophysiological mech-
pontine angle cisterns and the optochias- anism producing the clinical manifesta-
matic region are free and not associated with tion. Hydrocephalus due to obstruction
either ependymitis or meningitis/arach- by a free intraventricular cyst is best
noiditis, there is improvement in the neuro-
treated by direct open/endoscopic exci-
logical deficit10. The improvement in ICP is
sion of the cyst. Communicating hydro-
sustained in such cases. Those individuals
cephalus or hydrocephalus due to
with inflammatory cysts in any of the above
locations demonstrate transient improve- inflammatory intraventricular obstruction
ment in ICP but ultimately require VPS, if are treated with VPS. Large parenchymal
the latter has not been already undertaken. cisternal, ventricular or spinal cysts pro-
ducing local compression are excised. The
pseudotumoral form resistant to medical
Conclusions treatment may rarely need decompressive
craniotomy. Anticysticercal treatment
In conclusion, surgery for NC is required may be required for residual or addi-
in the presence of free intraventricular tional cysts.
References
1. Proano, J.V., Madrazo, I., Garcia, L, et al. (1997) Albendazole and praziquantel treatment in neuro-
cysticercosis of fourth ventricle. Journal of Neurosurgery 87, 29–33.
2. Del Brutto, O.H., Quintero, L.A. (1995) Cysticercosis mimicking brain tumour: the role of albenda-
zole as a diagnostic tool. Clinical Neurology and Neurosurgery 97, 256–258.
5. Sotelo, J., Del Brutto, O.H., Penagoes, P., et al. (1990) Comparison of therapeutic regimen of anticys-
ticercal drugs for parenchymal brain cysticercosis. Journal of Neurology 237, 69–72.
6. Wadia, N.H., Desai, S., Bhatt, M. (1988) Disseminated cysticercosis. New observations including CT
7. Del Brutto, O.H., Santibanez, R., Nobla, C.A., et al. (1992) Epilepsy due to neurocysticercosis: analy-
9. Sharma, B.S., Gupta, S.K., Khosla, V.K. (1998) Neurocysticercosis: surgical considerations. Neurology
India 46, 177–182.
Surgical treatment of cerebral cysticercosis. Arquivos de Neuropsiquitria 52, 166–186.
11. Stepien, L., Chorobski, J. (1949) Cysticercosis cerebri and its operative treatment. Archives of
12. Stepien, L. (1962) Cerebral cysticercosis in Poland. Clinical symptoms and operative results in 132
cases. Journal of Neurosurgery 19, 505–513.
13. Salazar, A., Sotelo, J., Martinez, H., et al. (1983) Differential diagnosis between ventriculitis and a
fourth ventricle cyst in neurocysticercosis. Journal of Neurosurgery 59, 660–663.
15. Lobato, R.D., Lamas, E., Portillo, J.M. (1981) Hydrocephalus in cerebral cysticercosis. Pathogenic
and therapeutic considerations. Journal of Neurosurgery 55, 786–793.

16. Sotelo, J., Rubalcava, M.A., Gormez-Llata, S. (1995) A new shunt for hydrocephalus that relies on
CSF production rather than on ventricular pressure. Initial clinical experiences. Surgical Neurology
43, 324–332.
17. Sotelo, J. (1996) Update: the new ventriculoperitoneal shunt at the Institute of Neurology at Mexico.
Surgical Neurology 46, 19–20.
18. Sotelo, J. (1993) A new ventriculoperitoneal shunt for treatment of hydrocephalus. Experimental
results. European Journal of Biomedical Engineering 15, 257–262.
19. Darlymple, S.J., Kelly, P.J. (1992) Computer assisted stereotactic third ventriculostomy in the man-
agement of non-communicating hydrocephalus. Stereotactic and Functional Neurosurgery 59, 105–110.
20. Tolkidsen, A. (1939) A new palliative operation in cases of inoperable occlusion of the Sylvian aque-
duct. Acta Chirurgica Scandinavica 82, 117–130.
21. DeFeo, D.R., Foltz, E.L., Hamilton, E. (1975) Double compartment hydrocephalus in a patient with
cysticercotic meningitis. Surgical Neurology 4, 247–251.
22. Colli, B.O., Pereira, C.U., Assirati, J.A., et al. (1993) Isolated fourth ventricle in neurocysticercosis:
pathophysiology, diagnosis and treatment. Surgical Neurology 39, 305–310.
23. Apuzzo, M.L.J., Dobkin, W.R., Zee, C.S., et al. (1984) Surgical considerations in treatment of intra-
ventricular cysticercosis: an analysis of 45 cases. Journal of Neurosurgery 60, 400–407.
24. Madrazo, I., Gracia, J.A., Sondoval, M., et al. (1983) Intraventricular cysticercosis. Neurosurgery 12,
148–152.
25. Madrazo, I., Sanchez Cebreza, J.M., Maidonado Leon, J.A. (1979) Pipette suction for atraumatic
extraction of intraventricular neurocysticercus cysts. Technical note. Journal of Neurosurgery 50,
531–532.
26. Culdip, S.A., Wilkins, P.R., Marsh, H.T. (1998) Endoscopic removal of a third ventricular cyst. British
27. Bergsneider, M., Hooloy, L.T., Lee, J.H., et al. (2000) Endoscopic management of cysticercal cysts
within the lateral and third ventricles. Journal of Neurosurgery 92, 14–23.
28. Bergsneider, M. (1999) Endoscopic removal of cysticercal cysts within the fourth ventricle. Technical
note. Journal of Neurosurgery 91, 340–345.
29. Couldwell, W.T., Zee, C.S., Apuzzo, M. (1991) Definition of the role of contemporary surgical man-
agement in cisternal and parenchymatous cysticercosis cerebri. Neurosurgery 28, 231–237.
30. Stern, W.E., (1981) Neurosurgical considerations in cysticercosis of the central nervous system.
31. Araujo, L.P., Martelli, N., Marquez, J.O. (1982) Forma gigante da neurocisticercose. Relato de caso.
Arquivos de Brasilla Neurocirurgica 3, 119–123.
32. Colli, B.O., Matelli, N., Assirati, J.A., et al. (1986) Results of surgical treatment of neurocysticercosis
in 69 cases. Journal of Neurosurgery 65, 309–315.
33. Chandy, M.J., Rajshekhar, V., Ghosh, S., et al. (1991) Single small enhancing CT lesions in Indian
understanding a controversy. Acta Neurologica Scandinavica 84, 465–470.
35. Ramina, R., Hynhevicz, S.C. (1986) Cerebral cysticercosis presenting as mass lesion. Surgical
36. Suastegui Roman, R.A., Soto-Hernández, J.L., Sotelo, J. (1996) Effects of prednisone on ventricu-
loperitoneal shunt function in hydrocephalus secondary to cysticercosis: a preliminary study.

40 Endoscopic Management of
Intraventricular Cysticercosis
Marvin Bergsneider and Jaime H. Nieto
Introduction Rationale for an endoscopic approach
Intraventricular cysticercosis can be a chal- Clinical presentations of intraventricular cys-

lenging clinical disorder owing to its unpre- ticercosis are reviewed in Chapter 20. Briefly,
dictable nature and potentially devastating clinical symptomatology is related to three
consequences. These lesions typically come phenomena1. First, free-floating cysts within
to clinical attention as a result of hydro- the lateral or third ventricles can suddenly
cephalus and therefore require therapeutic obstruct the aqueduct of Sylvius or less com-
intervention. In general, three treatment monly one foramen of Monro. This ‘ball-
options are available: anticysticercal agents, valve’ phenomenon can be responsible for
cerebrospinal fluid (CSF) diversion, and/or drop attacks, transtentorial herniation, and
surgical extirpation of the cyst. The removal even sudden death2. Second, fourth ventricu-
of cysts can either be accomplished via an lar cysts tend to enlarge progressively giving
open craniotomy or endoscopically. To date, rise to considerable mass effect. Finally, once
there is no consensus as to which treatment intraventricular cysts begin to degenerate, a
is superior because all of the reported expe- delayed communicating hydrocephalus can
rience in the literature is anecdotal. In our develop as a result of a chronic ependymitis
opinion, the ideal management for intra- and arachnoiditis3–7. This immunological
ventricular cysticercosis should reverse reaction does not occur in all patients, but if
hydrocephalus (if present), immediately severe and advanced, carries a grave progno-
eliminate the risk of acute obstructive sis regardless of treatment8,9. Given these
hydrocephalus, reduce the risk of delayed considerations, the ideal management of
postinflammatory ependymitis and arach- intraventricular cysticercosis should be
noiditis, and have a low treatment-related removal of the cyst from the ventricle,
morbidity. Here, we will argue that the thereby eliminating the risk of acute obstruc-
endoscopic removal of intraventricular tive hydrocephalus and the formation of
cysts best satisfies these treatment require- delayed postinflammatory communicating
ments and therefore is the preferred treat- hydrocephalus. In this regard, only the
ment for most patients. surgical extirpation of intraventricular cysts


400 M. Bergsneider and J.H. Nieto
meets these goals. The other two options, Historically, the surgical removal of
anticysticercal drugs and CSF shunt diver- fourth ventricular cysts has generally been
sion, each have significant drawbacks that considered to require a standard suboccipital
have been considered in detail Chapters 20 craniectomy for direct visualization of the
and 39. fourth ventricle10,20,29–34. The endoscopic
The definitive removal of the cysticercal approach to the fourth ventricle is techni-
cyst from the ventricle requires a surgical pro- cally more difficult compared with that of
cedure. Primary removal of intraventricular the lateral and third ventricles especially
cysticercal cysts has been advocated by many when arachnoid adhesions are present. In
authors2,3,6,8,10–18. Classically, these lesions have appropriately selected patients, however, the
been approached as if they were neoplasms endoscopic approach to the fourth ventricle
that required a wide surgical exposure for (described below) is safe, effective and asso-
direct visualization and removed2,8,10,15,16,19,20. ciated with decreased operative time, less
For cysts located in the lateral or third ventri- blood loss and less postoperative pain com-
cles, the interhemispheric–transcallosal or pared with the suboccipital craniotomy35.
transcortical approaches via a craniotomy
have been the standard procedures21. The
potential morbidity associated with these Patient Selection and Preoperative
procedures, especially the third-ventricle Management
approach, is dependent upon surgical experi-
ence and can be devastating22–24. For cysts At our institution, every patient with docu-
within the lateral and third ventricles, a surgi- mented intraventricular cysticercal cysts is con-
cal approach using a flexible neuroendoscope sidered for endoscopic removal of the cysts. In
through a burr hole–transcortical approach is our experience, only a few of these cysts are
significantly easier, safer, and comparably incidental findings – testifying to the high pro-
effective compared with the classic open cran- clivity of intraventricular cysts to cause clinical
iotomy approach. In addition, an endoscopic problems. Whereas, magnetic resonance imag-
approach has several important advantages ing (MRI) including contrast, proton density
over craniotomy. One disadvantage of the and fluid attenuated inversion recovery
open craniotomy approach is that intraven- (FLAIR) imaging constitute the standard inves-
tricular cysts can migrate within the ventricu- tigative approach to intraventricular cysticer-
lar system25,26. This is especially true of lateral cosis, the most definitive neuroimaging study
ventricle cysts that frequently settle in the is the ventricular contrast computed tomogra-
occipital horn if the patient is in the supine phy (CT) scan (Fig. 40.1). This study, however,
position. In cases of cysts located in both lat- requires access to the CSF system (most often
eral ventricles, open craniotomy approaches via a ventriculostomy catheter placed for acute
become increasingly destructive in order to hydrocephalus) and a suitable anatomic situa-
gain access to both occipital horns. An easily tion. For example, a study showing only one
performed septum pellucidotomy with an compartment of a multiloculated hydro-
endoscope allows near complete access to the cephalus may fail to show cysts in other com-
entirety of both lateral ventricles and the third partments. When the diagnosis is suspected
ventricle. Compared with an open cran- and the MRI study is inconclusive or not
iotomy approach, access to the third ventricle obtainable, we instill 5 ml of CSF-compatible
with a flexible neuroendoscope is nearly non-ionic contrast via a ventriculostomy and
effortless. The posterior third ventricle can be obtain a CT scan approximately 20–30 min
explored without manipulating the fornices later. The results of this study can also be help-
or structures within the velum interpositum. ful in assessing the need for septum pellucido-
Lastly, compartmentalized hydrocephalus can tomy or third ventriculostomy.
be effectively and easily treated using the There are several relative contraindica-
endoscopic approach since it allows the sur- tions to endoscopic resection of intraventric-
geon to perform a third ventriculostomy ular cysts. First, the presence of ependymal
and/or a septum pellucidotomy27,28. enhancement immediately adjacent to an

Endoscopic Management of Intraventricular Cysticercosis 401
Fig. 40.1. Coronal gadolinium-enhanced T1-weighted magnetic resonance imaging (left) demonstrating
mild hydrocephalus and ependymitis in the fourth ventricle (arrowhead). The study was suspicious but
not definitive for a fourth ventricular cyst. Axial computed tomography contrast ventriculogram (right)
showing a multilobulated filling defect confirming a fourth ventricle cysticercal cyst in this patient (see Fig.
40.4). The degree of hydrocephalus had increased between the two studies.
intraventricular cyst increases the chances tomy in order to have enough room to
that the cyst may be adherent to the ventric- remove the cyst and nodule.
ular wall (Fig. 40.2). We have found that Symptomatic patients who have acute
many of these cysts, which are degenerating hydrocephalus should be treated emergently
and causing inflammation, can be safely with a ventriculostomy catheter. It is impor-
removed using a judicious endoscopic tech- tant not to overdrain and collapse the ventri-
nique (see below). An endoscopic explo- cles since this will make endoscopy much
ration is not attempted in cases when there is more difficult or even impossible. All
extensive enhancement of the ependymal patients are given dexamethasone 4–10 mg
surfaces (Fig. 40.2) and subarachnoid spaces. intravenously just before surgery and every
In such cases, even open craniotomy 6 h thereafter for 24 h. Standard periopera-
approaches may not be effective9,36. Careful tive antibiotics are given as well.
attention must be paid to the fourth ventric-
ular outlet since an enhancement pattern in
this area may signify a technically difficult, if Endoscopic Technique
not impossible, endoscopic approach to the
Lateral and third ventricle cysts
fourth ventricle. A second relative con-
traindication to the neuroendoscopic
Instrumentation
approach is the lack of hydrocephalus. With
slit ventricles, the endoscopic retrieval of the Anecdotal reports of endoscopic approaches
cyst may be technically difficult and there- to the lateral and third ventricles for cysticer-
fore riskier. In our limited experience we cosis have used a variety of techniques and
have not come across such a situation since instruments2,3,25,30,33,37,38. To maximize surgi-
all of our patients have had some degree of cal possibilities and effectiveness, we prefer
ventricular enlargement. In rare cases, very a flexible endoscope such as the Codman 4-
large cysts containing solid components that mm steerable flexible neuroendoscope
are larger than the peel-away sheath may (Johnson & Johnson Professional, Inc.,
require an open craniotomy and corticec- Raynham, MA, USA). A rigid-lens endo-

scope can be used in selected cases but does

not offer a significant advantage in our opin-
ion. A separate cannula, such as a No. 14
French peel-away sheath, is required since
the flexible endoscope may need to be rein-
serted several times. A transendoscopic
grasping instrument of some type is
required39. This may be a toothed grasper or
a snare device (Figs 40.3 and 40.4). We use
gravity-fed Plasma-Lyte (Baxter, Deerfield,
IL, USA) or lactated-Ringer’s solution for
irrigation which matches with the pH of CSF.
The irrigation tubing is connected to the
endoscope using an irrigation adapter
(Codman Neuroglide, Johnson & Johnson
Professional, Inc., Raynham, MA, USA). The
endoscope is secured by a moveable holding
system such as a Bookwalter set-up26,27.
Operating room set-up and patient

Fig. 40.2. Axial gadolinium-enhanced T1-weighted positioning
MRI demonstrating severe ependymitis. With this
degree of ependymitis, the retrieval of We prefer to position the patient so that there
intraventricular cysts, if present, may not be will be a minimum amount of subdural and
possible with any surgical approach. intraventricular air after surgery. The patient
Fig. 40.3. Video image-captures demonstrating the removal of a third ventricle cyst via a right precoronal
burr hole. (a) The free-floating cyst is identified in the posterior aspect of the third ventricle. (b) A
transendoscopic snare grasping instrument is used to capture the cyst. (c) The cyst is secured with the
instrument and maintained just distal to the tip of the endoscope. (d) Delivering the cyst through the
foramen of Monro into the right lateral ventricle.

Fig. 40.4. Video image-captures of an endoscopic removal of fourth ventricular cysts. (a) Extradural view
as the endoscope approaches the small dural opening. The dura is retracted with a suture on either side
of the opening. No bone has been removed as noted by the intact opisthion. (b) The endoscope has
entered the cisterna magna and is navigated cephalad. The cysticercal cysts are seen protruding from
the foramen of Magendie. An incidental choroid plexus cyst is present (possibly a migrating
transchoroidal cysticercal cyst). (c) The transendoscopic grasping is oriented so that the jaws open
horizontally, thereby decreasing the risk of injuring the brainstem. (d) The cysts are retrieved keeping the
tip of the grasping instrument just beyond the endoscope. (e) The cyst and the endoscope are withdrawn
simultaneously. (f, g) Inspection of the fourth ventricle reveals another large cyst that is retrieved in a
similar manner. (h) Note the ependymitis of the floor of the fourth ventricle. (i) Final inspection of the
ventricle showing the aqueduct of Sylvius. The subependymal haemorrhage present likely occurred when
the cyst passed from the third to the fourth ventricle before the surgical procedure.
is positioned in a semi-recumbent position irrigation bag is positioned about 60 cm

with the head on a horseshoe head-holder to above the patient’s head level. Usually, the
assure that the precoronal suture is the high- preparation and draping of the patient for a
est point (Fig. 40.5). Since the head is usually ventriculoperitoneal shunt are planned in the
quite elevated, it is necessary to build a plat- event that it is determined intraoperatively
form with metal standing steps at the head of that the endoscopic procedure will not allevi-
the bed where the surgeon will stand. The ate the hydrocephalus. A frontal, precoronal
assistant surgeon stands directly above the semicircular skin incision is marked out with
patient’s head. The primary surgeon stands the idea that it could be used for a shunt if
on the operating side of the head. The televi- needed. Approaches to the right lateral and
sion monitor and endoscopy trolley are third ventricles are usually done from the
placed in front of the surgeon on the opposite right side. A solitary left-lateral ventricle cyst
side of the bed where the anaesthetist is. The is approached via a left frontal burr hole.

Fig. 40.5. Intraoperative set-up for an endoscopic approach to the lateral and/or third ventricle. The
patient is positioned semi-recumbent with the head further flexed and resting on a horseshoe apparatus.
This enables the burr hole to be the most superior point of the head and therefore minimizes the amount
of postoperative intracranial air. The primary surgeon stands to the right looking directly at the video
monitor. The body of the flexible endoscope is suspended via a fixed Bookwalter mount.
Surgical technique made to remove the cyst and the patient

should be shunted and treated with corticos-
A No. 14 French, blunt-tipped, peel-away teroids if necessary.
catheter is inserted into the lateral ventricle To remove a cyst, the transendoscopic
aiming towards the ipsilateral foramen of grasping instrument is advanced down the
Monro. The surgeon has to be careful to working channel of the endoscope (Fig.
avoid plunging or pulling the peel-away 40.3). After grasping the cyst wall, the grasp-
sheath out of the ventricle when manipulating instrument is retracted to the point at
ing the peel-away mechanism. Once the lat- which the cyst is approximately 5 mm from
eral ventricle is entered, the flexible the distal tip of the endoscope. No attempt is
endoscope is navigated to locate the cyst. An made to withdraw the cyst through the
assessment is made to establish the safety of working channel of the endoscope because
the cyst removal. At times the entire ependy- this channel is too small to accommodate the
mal surface appears to be carpeted with a entire cyst. The endoscope is slowly with-
fine fibrinous material indicative of ongoing drawn just to the point distal to the peel-
ependymitis not visible upon neuroimaging away catheter. The anaesthetist is asked to
studies. If the cyst is not freely floating in the perform a gentle and sustained Valsalva
ventricle, continuous irrigation and the manoeuvre (to approximately 30 mmHg air-
mechanical presence of the endoscope is way pressure) while the endoscope is slowly
used in an attempt to separate the cyst from pulled back through the peel-away sheath
the ependymal wall and choroid plexus. with the cyst in tow. If a ventriculostomy
Non-extractable cysts will appear highly catheter is present, the ventricular system
opaque and there will be no identifiable can be gently pressurized by a hand-held
interface between the cyst and ependymal syringe in lieu of a Valsalva manoeuvre as
wall. In such cases, no attempt should be the cyst is being removed through the peel-

away cannula. The cyst is retained just the interpeduncular cistern to confirm the
beyond the distal end of the endoscope and fenestration of the membrane of Liliequist.
delivered to the specimen cup. If the cyst
wall tears, the fragmented piece is delivered
and the capture and withdrawal technique Fourth ventricular approach
repeated until the entire cyst is removed. The
endoscope is navigated back into the ventri- Instrumentation
cle and additional cysts, if present, removed
The below-described approach requires a
using the aforementioned technique. Once
flexible neuroendoscope such as a Codman
all cysts are removed, irrigation is continued
4-mm flexible neuroendoscope (Johnson &
until cloudiness and particulate material
Johnson Professional, Inc., Raynham, MA,
within the ventricular fluid has cleared. For
USA). A rigid or semi-flexible endoscope
the wound closure, we prefer to leave a piece
cannot be used owing to the risk of injuring
of Gelfoam in the burr hole to prevent run-
the brainstem. A separate cannula (such as a
down bleeding into the ventricle and use a
peel-away sheath) is not used, nor required.
titanium (or equivalent) burr hole cover. The
A transendoscopic grasping instrument is
scalp is closed in a routine watertight fash-
needed. We use gravity-fed Plasma-Lyte or
ion. For patients who have a ventricu-
lostomy catheter placed preoperatively, this lactated-Ringer’s solution for irrigation. The
catheter is left in place for 24 h to monitor irrigation tubing is connected to the endo-
intracranial pressure (ICP) and discontinued scope using an irrigation adapter (Codman
if ICP is normal. Neuroglide, Johnson & Johnson Professional,
Inc., Raynham, MA, USA). The endoscope is
secured by a moveable holding system such
Septum pellucidotomy as a Bookwalter set-up28,35.
A septum pellucidotomy is performed if there
is need to inspect and remove other cysts in Operating room set-up and patient
the contralateral ventricle or if the ependymal positioning
irritation is marked and there is potential for
unilateral hydrocephalus. The perforation is The patient is placed prone in the so-called
made using a monopolar cautery wire ‘Concorde’ position with the head secured in a
(Codman ME2, Johnson & Johnson three-point rigid skull fixation device (Fig.
Professional, Inc., Raynham, MA, USA) or by 40.6). The neck is flexed to the same degree
using the neodymium:yttrium aluminium- that is used for a standard suboccipital craniec-
garnet (Nd:YAG) laser. The fenestration can tomy. The ventriculostomy catheter, if present
be mechanically enlarged by the endoscope. before surgery, is kept open to drainage during
induction of anaesthesia, but afterwards is
closed and used for monitoring of ICP only.
Third ventriculostomy The endoscope is set up and secured to
A third ventriculostomy can be performed the accompanying endoscope holder and
when hydrocephalus is associated with secured to a Bookwalter mount. The primary
aqueductal stenosis and the obstruction can- endoscopist stands at the patient’s left side
not be alleviated by removal of the cyst. We and the assistant stands at the right side. The
identify the standard anatomic landmarks television monitor is situated at the patient’s
and then puncture the tuber cinereum, just right side, next to the anaesthetist. A gravity-
posterior to the vascular discoloration fed irrigation solution similar in pH and
imparted by the infundibular recess, using osmolarity to CSF, such Plasma-Lyte (Baxter,
the straight end of a vascular guide wire Deerfield, IL, USA), is preferable to 0.9 M
(diameter: 0.81 mm/0.032 inch). A No. 3 saline because the low pH of the latter may
French Fogarty or Cook elliptical balloon interfere with the respiratory drive centres
catheter is used to expand the perforation adjacent to the fourth ventricle while the
and the flexible endoscope is navigated into patient recovers from anaesthesia.

Fig. 40.6. Intraoperative set-up for an endoscopic approach to the fourth ventricle. The patient is
positioned prone with the head further flexed and immobilized with a Mayfield three-point holder
(‘Concorde’ position). The primary surgeon stands to the patient’s left looking directly at the video
monitor. The body of the flexible endoscope is suspended via a fixed Bookwalter mount.
Surgical technique arachnoid space is entered (Fig. 40.7).

Navigating the flexible endoscope toward
A vertical linear, 2.5-cm incision is marked
the fourth ventricle sometimes necessitates
on the skin directly overlying the midline that the endoscope lightly slides directly on
aspect of the posterior arch of the first cervi- the upper cervical cord and brainstem. For a
cal vertebra (C1). If a ventriculostomy is not right-handed endoscopist the amount of
already in place, the scalp is shaved in the force applied by the endoscope to the spinal
right occipital area so that an emergency cord and to the brainstem is limited by the
ventriculostomy can be placed if needed. left hand. Resting the hypothenar eminence
The muscle and the soft-tissue dissection are of this hand on the neck of the patient, com-
limited to an exposure of the posterior arch bined with rigidly supporting the base of the
of C1 and less that 10 mm of the opisthion. endoscope, provides excellent tactile feed-
Either a Cloward cervical retractor (Cloward back and prevents inadvertent plunging of
Instrument Corp., Honolulu, HI, USA) or an the endoscope. Using this method, the
Adson cerebellar retractor works well in pro- orthogonal vector force applied to the spinal
viding exposure for this small skin and mus- cord and/or brainstem is negligible.
cle opening. If the craniocaudal exposure of The endoscopic landmarks that must be
the dura between the opisthion and C1 is identified include the brainstem and cervical
less than 10 mm, a Kerrison rongeur is used spinal cord ventrally and the tonsils of the
to remove the inferior 2–5 mm of the cerebellum laterally (Fig. 40.4). The tonsillar
opisthion. A vertical, midline incision is branches of each posterior inferior cerebellar
made in the dura to within 1 mm of the bone artery are landmarks identifying the midline
exposure, and the dural edges are tented and tonsillar vallecula. The endoscope is
back with sutures. The arachnoid is opened gently advanced toward the foramen of
under direct visualization. Magendie by using minute back-and-forth
Under direct visualization, the tip of the motions and continuous irrigation to dissect
endoscope is positioned at the dural open- the fine arachnoid bands that are normally
ing. While using continuous irrigation, the present. Often the cyst may be visibly pro-
endoscope tip is flexed upward as the sub- truding out of the foramen of Magendie.

Once in the fourth ventricle, the cysticercal

cyst is easily recognized. The endoscope is then
used to inspect the relation of the entire cyst
with the ependymal wall and the choroid
plexus. The continuous irrigation and the
mechanical presence of the endoscope help to
separate the cyst wall from the ependymal
wall and the choroid plexus. Once it is con-
firmed that the cyst is not inseparably adherent
to an ependymal surface, the transendoscopic-
grasping instrument is advanced down the
working channel of the endoscope. After
grasping the cyst wall, the grasping instrument
is pulled back until the cyst is approximately
5 mm from the distal tip of the endoscope. It is
important to retain visualization of the sur-
rounding fourth ventricular surfaces. No
attempt is made to withdraw the cyst through
the working channel of the endoscope. The
anaesthetist is asked to perform a gentle and
sustained Valsalva manoeuvre (to approxi-
mately 30 mmHg airway pressure) while the
endoscope is carefully backed out and with-
drawn from the dural opening. The cyst is
maintained just beyond the distal end of the
endoscope and placed into a specimen cup. If
the cyst wall tears, some spillage of the con-
tents of the cyst into the fourth ventricle or the
subarachnoid space may occur. In such cases,
Fig. 40.7. Artist’s illustration showing the surgical the grasper is reapplied and the withdrawal
corridor and endoscopic route for removal of a technique repeated until the entire cyst is
fourth ventricle cysticercal cyst. A midline removed. The endoscope is navigated back
durotomy is made between the opisthion and the into the fourth ventricle, and additional cysts,
posterior arch of C1. A flexible endoscope if present, are removed using the aforemen-
traverses the foramen of Magendie so that a tioned technique. Once all cysts are removed,
transendoscopic grasping instrument can be used the fourth ventricle is inspected a final time
to retrieve the cyst. (Fig. 40.4), and irrigation is continued until any
cloudiness of the ventricular fluid has cleared.
The endoscope is advanced slowly by The dural opening is closed using inter-
using the same dissection technique until rupted No. 4-0 nylon sutures in a watertight
the floor of the fourth ventricle is seen. fashion. The wound is closed in layers using
The degree of arachnoidal scarring may absorbable synthetic suture in a routine man-
vary from minor to near complete occlu- ner. A course of prophylactic antibiotics and
sion of the fourth ventricular outlet. If low dose dexamethasone (4 mg every 6 h) is
a thickened arachnoid membrane is continued for 24 h.
encountered, it can be fenestrated using
the straight end of a vascular guide wire
(diameter: 0.81mm/0.032 inch) passed down Results
the working channel of the endoscope. A
No. 3 French embolectomy balloon catheter Success in removal of cysts
can then be used to expand the small per-
foration made by the guide wire and, In our experience of 17 patients, we have had
thereby, gain access to the fourth ventricle. a 94% success rate in removing cysticercal

cysts endoscopically. In one case, a cyst in Complications

lateral ventricle could not be removed owing
to ependymal adhesions. One fourth ventric- Neuroendoscopy is a very safe procedure pro-
ular approach had to be aborted due to vided that appropriate techniques and equip-
excessive arachnoidal scarring at the fora- ment are used. In our experience of 17 patients,
men of Magendie that did not allow entry two have suffered an increased neurological
into the fourth ventricle with the endoscope. deficit after surgery. The first patient had mild,
In this case, conversion to a standard micro- temporary left pronator drift following a bipor-
scopic suboccipital craniectomy was tal endoscopic approach to a cysticercal cyst in
required. Despite this exposure, the fourth the roof of the third ventricle. The aetiology of
ventricle cysts found were too adherent to be the hemiparesis was not apparent upon neu-
removed. One exploration of the third ven- roimaging studies. A second patient had a
tricle was negative. In retrospect, the MRI waxing and waning mental status after multi-
proton density abnormality was reinter- ple surgeries to remove a total of 156 cysts
preted as a flow artefact. from all of the ventricles26. He had had multi-
ple bouts of hydrocephalus from shunt fail-
ures, each one prompting an endoscopic
Success in avoiding a CSF shunt exploration. One patient had a deep venous
thrombosis 2 weeks after the endoscopic proce-
In one study by the senior author, seven out dure26. Pneumocephalus has been an infre-
of ten (70%) patients that underwent endo- quent occurrence following the endoscopic
scopic resection of lateral and third ventric- approach to the fourth ventricle. In our experi-
ular cysts did not require a CSF shunt after ence, even though rupture of the cyst is not
surgery26. In this study, 30% of the patients uncommon, we have not experienced a com-
underwent a third ventriculostomy in addi- plication secondary to rupture of cysts during
tion to cyst removal to treat an acquired removal. The use of copious amounts of irriga-
aqueductal stenosis. Four patients had a tion and intravenous corticosteroids appears to
septum pellucidotomy to evaluate the obviate this complication.
opposite lateral ventricle for the presence of
cysts. In one of these four patients, the sep-
tum pellucidotomy was performed to alle- Conclusions
viate unilateral hydrocephalus.
For patients who had fourth ventricular The neuroendoscopic management of intra-
cysts removed, avoidance of a CSF shunt ventricular cysticercosis should be considered
depended upon the degree of arachnoiditis as the primary treatment whenever possible
in the basal cisterns. To date, four out of since it is safe, effective and provides a defi-
seven patients with fourth ventricular cysts nitive treatment for this disorder. In addition
have required CSF shunt. One of the four to avoiding a CSF shunt in many cases,
patients had a shunt placed at a different removal of the cyst(s) offers a reduced risk of
hospital before the endoscopic procedure. inflammatory sequelae. Neurosurgeons with
The other three needed a CSF shunt after the familiarity and experience with flexible
endoscopic removal of the cyst failed to alle- neuroendoscopes should find these cases
viate the hydrocephalus. straightforward and highly gratifying.
References
1. Zee, C.S., Segall, H.D., Apuzzo, M.L., et al. (1984) Intraventricular cysticercal cysts: further neurora-
diologic observations and neurosurgical implications. American Journal of Neuroradiology 5, 727–730.
2. Apuzzo, M.L., Dobkin, W.R., Zee, C.S., et al. (1984) Surgical considerations in treatment of intraven-
tricular cysticercosis. An analysis of 45 cases. Journal of Neurosurgery 60, 400–407.
3. Del Brutto, O.H., Sotelo, J., Roman, G.C. (1993) Therapy for neurocysticercosis: a reappraisal.

4. Del Brutto, O.H., Sotelo, J. (1988) Neurocysticercosis: an update. Reviews of Infectious Diseases 10,
1075–1087.
5. Colli, B.O., Martelli, N., Assirati Junior, J.A., et al. (1994) Cysticercosis of the central nervous system.
I. Surgical treatment of cerebral cysticercosis: a 23 years experience in the Hospital das Clinicas of
Ribeirao Preto Medical School. Arquivos de Neuropsiquiatria 52, 166–186.
7. Pittella, K.E. (1977) Neurocysticercosis. Brain Pathology 7, 681–693.
8. Estanol, B., Kleriga, E., Loyo, M., et al. (1983) Mechanisms of hydrocephalus in cerebral cysticercosis:
10. Colli, B.O., Martelli, N., Assirati, J.A., Jr, et al. (1986) Results of surgical treatment of neurocysticerco-
sis in 69 cases. Journal of Neurosurgery 65, 309–315.
12. Sandoval, M., Madrazo, I., Garcia-Renteria, J.A., et al. (1990) Obstruction on the ventricular catheter
of a CSF shunt system due to the own cyst of Taenia solium. Archivos de Investigation Medica 21, 95–98.
13. Couldwell, W.T., Zee, C.S., Apuzzo, M.L. (1991) Definition of the role of contemporary surgical
management in cisternal and parenchymatous cysticercosis cerebri. Neurosurgery 28, 231–237.
14. Duplessis, E., Dorwling-Carter, D., Vidaillet, M., et al. (1988) Intraventricular neurocysticercosis.
Apropos of 3 cases. Neurochirurgie 34, 275–279.
15. Madrazo, I., Sanchez Cabrera, J.M., Leon, J.A. (1979) Pipette suction for atraumatic extraction of
intraventricular cysticercosis cysts. Technical note. Journal of Neurosurgery 50, 531–532.
16. Madrazo, I., Garcia-Renteria, J.A., Sandoval, M., et al. (1983) Intraventricular cysticercosis.
17. Loyo, M., Klergia, E., Estanol, B. (1980) Fourth ventricular cysticercosis. Neurosurgery 7, 456–458.
19. King, J.S., Hosobuchi, Y. (1977) Cysticercus cyst of the lateral ventricle. Surgical Neurology 7, 125–129.
20. Stern, W.E. (1981) Neurosurgical considerations of cysticercosis of the central nervous system.
21. Apuzzo, M.L., Chikovani, O.K., Gott, P.S., et al. (1982) Transcallosal, interfornicial approaches for lesions
affecting the third ventricle: surgical considerations and consequences. Neurosurgery 10, 547–554.
22. Apuzzo, M.L.J. (1987) Surgery of the Third Ventricle. Williams & Wilkins, Baltimore, Maryland, pp.
369–389.
23. Jeeves, M.A., Simpson, D.A., Geffen, G. (1979) Functional consequences of the transcallosal removal
of intraventricular tumours. Journal of Neurology, Neurosurgery and Psychiatry 42, 134–142.
24. Apuzzo, M.L.J. (1993) Brain Surgery: Complication Avoidance and Management. Churchill Livingstone,
25. Neal, J.H. (1995) An endoscopic approach to cysticercosis cysts of the posterior third ventricle.
26. Bergsneider, M., Holly, L.T., Lee, J.H., et al. (2000) Endoscopic management of cysticercal cysts
within the lateral and third ventricles. Journal of Neurosurgery 92, 14–23.
27. Bergsneider, M., Holly, L.T., Lee, J.H., et al. (1999) Endoscopic management of cysticercal cysts
within the lateral and third ventricles. Neurosurgery Focus 6: Article 7.
28. Bergsneider, M. (1999) Endoscopic removal of cysticercal cysts within the fourth ventricle. Technical
note. Journal of Neurosurgery 91, 340–345.
29. Colli, B.O., Pereira, C.U., Assirati, J.A., Jr, et al. (1993) Isolated fourth ventricle in neurocysticercosis:
pathophysiology, diagnosis and treatment. Surgical Neurology 39, 305–310.
30. Couldwell, W.T., Apuzzo, M.L.J. (1989) Management of cysticercosis cerebri. Contemporary
31. De, Morais-Rego, S.F., Latuf, N.L. (1978) Cysticercosis of the fourth ventricle simulating a posterior
fossa neoplasm in cerebral scintillography. Report of a case. Aquivos de Neuropsiquiatria 36, 371–374.
32. Koziarski, A., Kroh, H., Olszeqski, E. (1992) A case of cysticercosis of the IV cerebral ventricle.
Neurologia i Neurochirurgia Polska 26, 115–120.

33. Loyo-Varela, M., del Valle-Robles, R., Guinto-Balanzar, G., et al. (1996) Infestations and the fourth
ventricle: Cysticercosis. In: Cohen, A.R. (ed) Surgical Disorders of the Fourth Ventricle. Blackwell
Science, Cambridge, Massachusetts, pp. 397–411.
34. Madrazo, I., Flisser, A. (1993) Cysticercosis. In: Apuzzo, M.L.J. (ed.) Brain Surgery: Complication
Avoidance and Management, Vol. 2. Churchill Livingstone, New York, pp. 1419–1430.
35. Bergsneider, M. (1999) Endoscopic removal of cysticercal cysts within the fourth ventricle: technique
and results. Neurosurgery Focus 6: Article 8.
36. Estanol, B., Corona, T., Abad, P. (1986) A prognostic classification of cerebral cysticercosis: therapeu-
tic implications. Journal of Neurology, Neurosurgery and Psychiatry 49, 1131–1134.
37. Couldwell, W.T., Chandrasoma, P., Apuzzo, M.L., et al. (1995) Third ventricular cysticercal cyst
mimicking a colloid cyst: case report. Neurosurgery 37, 1200–1203.
38. Loyo-Verela, M. (1997) Surgical treatment of cerebral cysticercosis. European Neurology 37, 129–130.
39. Bergsneider, M. (1997) Transendoscopic instrumentation and techniques. In: King, W.A., Frazee,
J.G., De Salles, A.A.F. (eds) Endoscopy of the Central and Peripheral Nervous System. Thieme, New York,
pp. 16–22.

41Control of Taenia solium with

Emphasis on Treatment of Taeniasis
James C. Allan, Philip S. Craig and Zbiginew S. Pawlowski
Introduction such as meat inspection, have in contrast

been demonstrated to be failing in much of
Taenia solium is susceptible to control at sev- the current endemic area3. Moreover, move-
eral points in its life cycle (reviewed in ment of T. solium tapeworm carriers or
Chapter 1)1. Although other hosts can be infected swine have been shown to have
infected with one stage or the other, either spread the disease from endemic to non-
experimentally or naturally, man is the sole endemic areas causing either periodic local-
natural definitive host and domesticated ized outbreaks of cysticercosis or
swine represent the main intermediate host establishment of the parasite in new areas
for this cestode. In comparison with many such as Irian Jaya, Indonesia4–6.
other parasitic zoonoses, this theoretically A number of developments mean that
leaves the parasite particularly amenable to new or improved tools can be used in the
control1. Indeed, having formerly been much control of this parasite to supplement more
more widespread, the parasite has disap- traditional approaches. These include wider
peared from much of Europe2. This elimina- public access to news media for the transmis-
tion has been achieved horizontally over sion of public health messages; developments
several decades through a number of means in vaccine technology that could result in a
that included general improvements in sani- safe and effective porcine vaccine and the
tation and hygiene, as well as changes in pig availability of a number of drugs that are
husbandry practices and elimination of highly efficacious against either the cystic
infected swine carcasses from the human stage in pigs or the adult tapeworm in
food chain by rigorous meat inspection. man7–11. These approaches are reviewed more
However, the parasite remains endemic extensively elsewhere in this book (Chapters
throughout much of the developing world 42–44) and a synopsis is provided in Table
where sanitary conditions are poor and the 41.1. In this chapter we will focus on the pos-
economy weak. As described elsewhere in sibility of controlling T. solium through mass
this book this imposes a huge health and or focus-oriented treatment of the intestinal
socio-economic burden on the developing tapeworm in humans. This approach should
countries. Methods that have been impli- be viewed in the context of one of several
cated in the reduction or elimination of this potential options that can be used in concert
parasite from the majority of countries in to control parasite transmission; its role may
Western Europe and in the United States, vary according to the local situation.


412
Singh - Chap 41
Table 41.1. Synopsis of intervention strategies available for Taenia solium taeniasis–cysticercosis.
Intervention strategy Advantages Disadvantages
Elimination of infected pig

4/9/02
● Known contribution to elimination of parasite from ● Pigs in many endemic countries do not go to formal
carcasses (meat inspection) several developed countries slaughter
● Relatively easy to integrate with meat inspection for ● Infected pigs can be diagnosed ante mortem (tongue
several other important diseases inspection) and slaughtered outside regulated system to
avoid condemnation of carcasses
4:47 pm
Improved sanitation, hygiene and ● Known contribution to elimination of parasite from ● Economically difficult in many existing endemic areas
pig husbandry several developed countries
● Provides benefits beyond control of T. solium
Health education ● Provides benefits beyond control of T. solium ● Improved knowledge does not always result in change
of practices
Page 412
● New media now widely available

● Inefficient as sole strategy
Treatment of intestinal taeniasis ● Highly efficacious drugs available now (some generically ● Would require repeated interventions for long-term
produced niclosamide may have low efficacy) control
● Demonstrated short-term benefits ● Requires specific infrastructure; not self-sustainable
● Removes known significant transmission risk ● Praziquantel should be used with caution in cases of
J.C. Allan et al.
cysticercosis
Vaccination of swine ● Long-term protection ● Many existing producers in endemic areas do not
● Possible to integrate with existing veterinary and/or currently vaccinate against other diseases with high
pig husbandry practices economic impact on swine production
● Provides economic benefit to end user (avoidance of ● Vaccines not available now (other than at experimental
carcass condemnation) level)
● Compliance monitoring possible (serological testing)
Chemotherapy of infected swine ● Drugs available now ● Producers often do not treat for other economically
● Highly effective important parasites despite economic benefits
● Producers have economic motivation (avoidance of ● Existing systems of avoiding meat inspection reduce
carcass condemnation) economic advantages
● Other production benefits: can affect other economically
important parasites of swine
Control of T. solium via Treatment of Taeniasis 413
Epidemiological Characteristics of worm carriers within the household or

T. solium Infection immediate environment17–22. The epidemiol-
ogy of porcine infection is complicated, being
Since humans constitute the sole natural strongly affected by husbandry practices,
definitive host of the parasite, reduction of specifically the degree of access to human
the numbers of intestinal infections to a faeces, within endemic communities23–25.
level at which the parasite population is no Intestinal T. solium prevalence is generally
longer self-sustaining (i.e. the basic repro- low ( 5%), even in communities considered
ductive rate falls below one) will lead over highly endemic. Some, but not all, studies
time to extinction of the parasite within its have indicated that females carry a slightly
host population. Reduction of this parasite greater risk of infection than males26–28 and
population in humans through chemother- overall prevalence can vary greatly within
apy is a realistic option, especially as effec- relatively small areas28. Surprisingly, little
tive, safe and inexpensive taeniacidal drugs information is available on the age preva-
are readily available. lence of the intestinal stage, and although
Identification of ‘hot spots’ of human or some age groups may be at higher risk than
porcine cysticercosis and of intestinal T. others, the effect is not particularly pro-
solium taeniasis can point to areas or popula- nounced. For instance, Guatemalan and
tions of high disease risk12. The treatment of Ecuadorian studies both indicate that chil-
T. solium taeniasis cases detected in relation dren of 4 years of age or less have the lowest
to these foci provides an opportunity to rates of infection while adults have the high-
interrupt localized transmission of the para- est rates27,28. There is an increased occupa-
site where most of the cases exist13. The kind tional risk amongst certain groups such as
of data necessary to identify T. solium foci pork vendors29. Although taeniasis infection
can be obtained either through passive or appears to cluster within families, the degree
active surveillance12. The approach taken of clustering is such that risk in family mem-
will vary depending on the existing epi- bers of indicator cases may only be slightly
demiological and epizootiological situation higher than that of the general popula-
and the medical or veterinary health infra- tion27,28. Furthermore, although both porcine
structure present. and human cysticercosis may cluster within
Targeting treatment specifically at individ- households or localities, the degree of clus-
ual cases of taeniasis is, however, not easy. T. tering means that there remains a substan-
solium infected individuals are not easy to tial number of intestinal infections outside
diagnose, symptomatology is non-specific, such clusters. Targeting of clusters alone
and a large number of infected individuals may therefore leave significant numbers of
may be unaware of their infection14. As dis- cases untreated. From the viewpoint of pop-
cussed elsewhere in this book (Chapter 33), ulation-level control, the epidemiology of
traditional parasitological methods for diag- the intestinal stage indicates that, although
nosis lack sensitivity. More modern immuno- it may be possible to identify risk groups
logical or molecular approaches, while within a population, it may be difficult to
overcoming some of the drawbacks of tradi- identify all individuals within those popula-
tional methods, have not been applied on a tions that can be targeted for treatment. This
large scale and are expensive14–16. The epi- is distinct from some of the intestinal geo-
demiological characteristics of taeniasis–cys- helminths such as Ascaris, where school-age
ticercosis also present some issues with children are known to be at high risk of
respect to the targeting of treatment. infection and where targeted treatment, of
Identification of foci of taeniasis– this relatively accessible population, has
cysticercosis may be easier than finding indi- been shown to significantly influence overall
vidual cases. Risk of infection with human transmission within the entire population30,31.
cysticercosis has been shown both in endemic To detect sufficient taeniasis cases would
and in non-endemic areas, to be closely asso- require the application of a large-scale, active
ciated with the presence of T. solium tape- surveillance system and this would be rela-

414 J.C. Allan et al.
tively expensive if manageable at all. Work tered nature of these infections means that
of this nature has been undertaken in there is an increased likelihood of detecting
China, where T. solium taeniasis–cysticerco- another case of T. solium within the contact
sis is highly endemic throughout most of group. Such cases, particularly tapeworm
the country12. Several interventions that carriers, are clearly important to treat from a
have included mass targeted treatment have disease management and transmission
been undertaken there, but the results have standpoint. A number of studies have
not been formally published outside the demonstrated that the presence of a case of
local prefectural public health bureaus. For taeniasis within the household is a signifi-
example, a T. solium ‘elimination pro- cant risk factor for cysticercosis17,19–22.
gramme’ was undertaken by the Anti- Similarly cases of taeniasis are significantly
Epidemic Station of Wujiang County, more likely to have cysticercosis; data even
Zhangye Prefecture in north-central Gansu suggest that they will tend to have higher
Province in 1978 when the baseline rate of cyst loads22,33. There is, therefore, value in
human taeniasis was 1512 per 100,000 for determining whether a case of NC also has
the county. A total of 312 T. solium carriers taeniasis. Studies in populations with no
were identified after purgative treatment immediately apparent risk for T. solium have
using the traditional medicines of areca nut also indicated that trace-back of contacts of
and pumpkin seed extract. The porcine cys- NC cases can result in detection of taeniasis
ticercosis rate was 7.7%. Following bi- cases4,5. The long latency period from initial
annual targeted treatment of carriers infection with NC to the onset of symptoms
(including use of praziquantel from 1983) in may reduce the chances of detecting the case
conjunction with emphasis on confining or of taeniasis that caused the NC infection but,
restraining pigs by tying and health educa- given the clustered nature of NC, trace-back
tion propaganda in the media, the incidence may also allow diagnosis of other NC cases
of human taeniasis was officially reported that may benefit from case management34,35.
to have reduced to 21 per 100,000, and the For these reasons, from the standpoints of
porcine rate to 0.27%, by 1988 (X. Lie, preventive medicine and that of improved
Y. Zhang, Zhanyi, Gansu, China, and P.S. case management, there is value in following
Craig, unpublished observations). up contacts of T. solium cases diagnosed in
Since the above outlined approach the clinical setting.
requires a great deal of effort in the identifi-
cation of T. solium carriers, control through
mass untargeted treatment of entire high- Chemotherapeutic Agents
risk populations has been promoted and
undertaken on an experimental basis. Two anthelminthics, praziquantel and
These studies have used low-cost, yet niclosamide, are currently both indicated
highly efficacious drugs, where the cost of and widely available for treatment of human
population-based treatment is lower than intestinal taeniasis. Both are recommended
the cost of diagnosis and treatment follow- for treatment of intestinal T. solium infection
up of carriers. It should be noted that this as a single oral dose with efficacy greater
approach might also be applicable outside than 90%9,36.
endemic areas in relation to the treatment
of high-risk groups such as immigrant pop-
ulations moving from endemic areas to Praziquantel
non-endemic areas32.
From a public health standpoint, how- Praziquantel is an acylated isoquinoline-
ever, there is the opportunity to reduce trans- pyrazine discovered jointly by E. Merck and
mission of T. solium at a local level through Bayer AG in 19729. This molecule has a wide
trace-back of cases of taeniasis and neurocys- spectrum, being active in man against both
ticercosis (NC) diagnosed clinically to their trematodes and cestodes, including both larval
family and immediate contacts. The clus- and adult T. solium. The approved therapeutic

dose for intestinal T. solium is 5–10 mg kg1 Suitability of anthelminthic agents for
bodyweight. It should be noted that with the mass chemotherapy
available 150 mg tablets the given doses are
approximate mg kg1 values. The molecule Of the two main drugs dealt with here, prazi-
has a half-life of only a few hours in man and quantel may be cheaper than niclosamide (by
thus does not have any prophylactic effect. a factor of five times or more). The efficacy of
The molecule increases calcium permeability this molecule at its indicated dose also
in cestodes and flukes leading to muscle con- appears to be somewhat higher than that of
traction, paralysis and death. The drug is very niclosamide and it is becoming easier to
bitter and can cause gagging if bitten or obtain. An early report indicated that prazi-
chewed during administration. Praziquantel is quantel could be effective against Taenia sp.
very well tolerated in humans and cheap (as taeniasis in doses of 2.5 mg kg1 for purposes
little as US$0.20 per treatment)9. of control programmes where cost may be an
issue39. Indeed, earlier work on the therapeu-
tic efficacy of the molecule suggested that this
Niclosamide dose was highly effective against the parasite9.
Recently it has, however, been recommended
Niclosamide is a halogenated salicylanilide that the drug be used at a higher recom-
first patented by Bayer AG in 195936. This mended dose of 10 mg kg1 40. In addition
drug has activity against a variety of intesti- there is a possibility that praziquantel, even at
nal cestodes of man including T. solium. The the low dose used to treat taeniasis, may occa-
molecule is not absorbed after oral adminis- sionally cause complications, such as cerebral
tration. Its anthelminthic action is either inflammation in individuals with NC, through
through inhibition of oxidative phosphoryla- its anticysticercal properties. Such a possibility,
tion or by stimulating ATPase. The recom- which was not linked to praziquantel treat-
mended dose is 2 g in adults, 1 g in children ment with absolute certainty, has been
of 11–34 kg and 1.5 g in children over 34 kg. reported in a female, subsequently shown to
The tablet should be chewed36. As with any harbour numerous intracerebral cysticerci,
drug, the recommended storage conditions who developed severe headache within 24 h
and shelf-life should be carefully adhered to. of treatment with 5 mg kg1 praziquantel, a
It is known that polymerization occurring condition that lasted for approximately 10
through long-term storage can lower drug days41. Indeed the manufacturer’s label for
efficacy. This has been seen with some gener- praziquantel frequently includes warnings
ically produced niclosamide. with respect to the drug use in individuals
with T. solium cysticercosis, especially ocular
cysticercosis. Niclosamide does not act against
Benzimidazoles the cystic stage and thus would not cause such
potential complications. Safety of niclosamide
A number of other older drugs are known to has, however, not been tested during preg-
be efficacious against cestodes but, generally nancy and the drug is contraindicated with
because of poorer efficacy or adverse side alcohol. With both drugs, control intervention
effects, they are not now widely used36. programmes should consider the possibility of
Further to this, some of the benzimidazoles, adverse drug reactions occurring and have
including albendazole, are known to be effi- mechanisms in place for monitoring for their
cacious against cestodes but generally require occurrence and dealing with any that occur.
administration over 3 consecutive days and Therefore, there are a number of factors
appear to have lower efficacy against intesti- including cost, ease of administration, avail-
nal taeniids than either niclosamide or prazi- ability, efficacy, stability and possible con-
quantel37,38. The benzimidazoles are, traindications that should be considered when
however, also active against a broad spec- a decision is being made as to which molecule
trum of gastrointestinal helminths including is appropriate in the circumstances of particu-
hookworm, Trichuris and Ascaris. lar mass treatment programmes.

Experimental Control Interventions Others, such as changes in knowledge, atti-

tudes and practices for T. solium
A relatively small number of trials have been taeniasis–cysticercosis may be indirect conse-
carried out using mass chemotherapy as quences of the work carried out during the
a control intervention against T. solium. intervention. In both cases, these will alter
The majority have involved the use of prazi- the risk of infection. This should be taken
quantel although one has involved into account when the results are inter-
niclosamide18,27,40,42,43. These trials have varied preted. Other changes can occur that, while
in size, from a few hundred individuals up to not associated with the studies themselves,
several thousand. Although most have indi- can have significant implications for the
cated beneficial effects on levels of T. solium interpretation of their results. Indeed, in
infection following the intervention18,27,40,42 Mexico, long-term (42 month) follow-up
this has not always been the case43. Most of evaluation of a chemotherapeutic interven-
these studies have involved follow-up assess- tion with praziquantel indicated that the per-
ments of within approximately 1 year after the centage of individuals in the target
intervention, but one study involved assess- community with access to a latrine had
ment at 42 months after the intervention40. approximately doubled over the period and
A variety of measures have been used to the rate of outdoor defecation declined by
assess the outcome of these mass treatment around 25%. Additionally the proportion of
studies. These have included analysis of rates pigs with access to human faeces declined
of human taeniasis, serological rates of from 26% to 7%42. Access of pigs to human
human cysticercosis, incident cases of late faeces has been shown to be a substantial
onset epilepsy and rates of porcine cysticer- risk factor for infection24,25. These changes
cosis. It is generally agreed that rates of swine are likely therefore to have considerably
cysticercosis are the most sensitive indicator altered taeniasis–cysticercosis transmission
of environmental contamination with T. patterns independent of the chemotherapeu-
solium and hence the presence of tapeworm tic intervention. Clearly, collection of reliable
carriers in the locality27,44. The relatively baseline data in relation to both parasitologi-
short lifespan of pigs in rural communities cal and socio-economic factors is vital prior
also means that they act as good indicators of to embarking on a control intervention.
recent levels of infection and are useful for Bearing the above outlined points in mind,
the follow-up of interventions27,44. This con- however, as stated previously, a beneficial out-
trasts with the situation with human cysticer- come has been indicated in the majority of
cosis where, at any one time during mass chemotherapeutic control interventions
short-term follow-up of an intervention, most in Latin America. A large study in Ecuador,
cases in a community are probably existing involving treatment of over 10,000 people in
long-term cases, infected before the interven- two provinces with praziquantel at approxi-
tion. Although comparison of recent incident mately 5 mg kg1 led to a significant short-
cases of late-onset epilepsy has been shown term decline in the prevalence of intestinal
to be a useful variable in the analysis of the taeniasis and porcine cysticercosis (the latter
effects of control interventions, the rates of from 11.4% before the intervention to 2.6%
this are comparably low and the costs after 1 year)27. Another study in Mexico indi-
involved in detecting cases are comparatively cated a 100% reduction in the number of taeni-
high40. Detection of new cases of human tae- asis cases 1 year after an intervention involving
niasis has, however, proved useful in assess- treatment of 339 people with 10 mg kg1 prazi-
ing the effects of intervention19,27,29,40,42. quantel18. In this case, however, the initial
A difficulty that is faced in the assessment prevalence of taeniasis had been 1.32% and the
of mass treatment interventions is that there small sample size meant that the reduction in
have often been substantial changes in other taeniasis rate following chemotherapy was not
factors that influence infection levels. Some significant. In contrast, a different study
of these, such as health education, have actu- involving approximately 1500 people in
ally been part of the study protocol28,42. another area of Mexico actually detected an

approximate doubling in the rate of infection Remaining Issues and Sustainability

in pigs, 1 year after chemotherapy (from 6.6%
to 11%)43. This study, which had also involved Chemotherapy of T. solium taeniasis either
health education, did, however, show good on a mass or a targeted basis is clearly an
levels of knowledge about the parasite among option to be considered in short-term strate-
school-age children 2 years after the interven- gies designed at controlling this parasite.
tion43. A longer term Mexican study, designed The elimination of taeniasis–cysticercosis is
to test the effects of mass treatment alone, a long-term process, which cannot be based
without health education or other strategies, on chemotherapy alone. Mass chemothera-
indicated significant improvements in several peutic treatment of tapeworm carriers, com-
indicators for infection over both short term (6 bined with health education, has been
months) and long-term (42 months) postinter- successfully applied in the control of other
vention periods. The longer term results in that zoonotic cestodes, such as Echinococcus
study may, as discussed previously, have been granulosus (where dogs were treated)45.
due to concomitant socio-economic changes in Whether the approach is cost-effective with
the community. The study also indicated that regard to T. solium remains open to ques-
use of a 5 mg kg1 dose of praziquantel may tion. Only a small number of studies have
not be suitably efficacious in such interven- been carried out and, although most report
tions (having achieved only 67% efficacy) and a reduction in transmission situation fol-
recommended a higher dose of 10 mg kg1 40. lowing the intervention, they still leave a
Furthermore, this study also suggested that a number of questions to be answered. Unlike
case of, previously undiagnosed, NC might
the situation with canine taeniids (such as
have had neurological symptoms induced by
E. granulosus), the behaviour and practices
the praziquantel treatment41.
of both the definitive host (man) and inter-
Only one Taenia mass treatment study has
mediate host (pig) of T. solium are highly
been carried out using niclosamide. This
variable12. For instance, rates of open-air
study, carried out in two Guatemalan com- defecation and pig husbandry practices
munities and involving treatment of over both vary within endemic areas at any one
1500 people, indicated that both tapeworm time and often change over time.
prevalence (from 3.5% to 1%) and the rate of Alterations in these have implications not
cysticercosis seroprevalence in pigs (from 55% only for T. solium infection rates but also for
to 7%) were substantially reduced 10 months other infectious diseases. Thus strategies
after intervention. The incidence of new cases involving improved health education,
of taeniasis detected over the 10 months of the hygiene and pig husbandry have public
study indicated that it would probably take health and socio-economic implications
several years for the rate of taeniasis to return beyond T. solium.
to baseline. No specific health education was The tools for monitoring the success of
given during the study period42. intervention are now increasingly becoming
In none of these mass treatment studies available. For instance, a variety of diagnos-
was treatment coverage complete. Typically, tic tools for baseline and surveillance use in
between 75% and 87% of the target popula- both humans and pigs have become avail-
tions were treated. The practicalities of treat- able over recent years14,46,47. These make
ing 100% of a population are very difficult. determining the rates of infection in a popu-
Besides a rate of treatment refusal within the lation easier than before. Epidemiological
target communities, there are other problems, studies have improved our knowledge of T.
for example, niclosamide is not indicated for solium and its transmission within endemic
use during pregnancy. Furthermore, prob- communities. Taking all these factors into
lems of contacting all individuals at the time account, therefore we are now in an
of an intervention will occur as studies have improved situation with respect to being
indicated that there are significant levels of able to assess the need for and implications
travel out of endemic communities27,28. of a control programme.

Conclusions to changes in practices that could have sig-

nificant impact on T. solium transmission.
The long-term sustainability of an interven- There is the possibility of further integra-
tion programme is important if it is to be tion with other prevention and control
successful. The chemotherapeutic interven- strategies, such as vaccination or
tion studies described here have tended to chemotherapy of swine, which could poten-
indicate short-term improvements in taenia- tially have direct economic benefits within
sis–cysticercosis indicators. Integration of the target communities and thus may be
this approach with others, such as health self-sustainable. No comprehensive studies
education, may make these interventions looking at the sustainability of various
more sustainable. Health education will intervention strategies or their cost–benefit
also help to make such interventions more ratio and cost-effectiveness have, however,
acceptable to target communities and lead been reported.
References
1. Centers for Disease Control and Prevention. (1993) Recommendations of the International Task
Force for Disease Eradication. Morbidity Mortality Weekly Report 42, 1–27.
2. Schantz, P.M., Cruz, M., Sarti, E., et al. (1993) Potential eradicability of taeniasis and cysticercosis.
3. Cysticercosis Working Group in Peru (1993) The marketing of cysticercotic pigs in the sierra of Peru.
4. Schantz, P.M., Moore, A.C., Munoz, J.L., et al. (1992) Neurocysticercosis in an Orthodox Jewish com-
7. Sarti, E., Flisser, A., Schantz, P.M. (1997) Development and evaluation of a health education inter-
vention against Taenia solium in a rural community in Mexico. American Journal of Tropical Medicine
8. Lightowlers, M.W. (1999) Eradication of Taenia solium cysticercosis: a role for vaccination of pig.
9. Andrews, P., Thomas, H., Pohlke, R., et al. (1983) Praziquantel. Medical Research Reviews 3, 147–200.
11. Kramer, L.D. (1990) Anthelminthic therapy for neurocysticercosis. Archives of Neurology 47, 1059–1160.
12. Craig, P.S., Rogan, M., Allan, J.C. (1996) Detection, screening and community epidemiology of
taeniid zoonoses: cystic echinococcosis, alveolar echinococcosis and neurocysticercosis. Advances in
13. Pawlowski, Z.S. (1991) Control of Taenia solium taeniasis and cysticercosis by focus-oriented
chemotherapy of taeniasis. Southeast Asian Journal of Tropical Medicine and Public Health 22, 284–286.
14. Allan, J.C., Velasquez Tohom, M., Torres Alvarez, R., et al. (1996) Field trial of diagnosis of Taenia
solium taeniasis by coproantigen enzyme linked immunosorbent assay. American Journal of Tropical
15. Wilkins, P.P., Allan, J.C., Verastegui, M., et al. (1999) Development of a serologic assay to detect
Taenia solium taeniasis. American Journal of Tropical Medicine and Hygiene 60, 199–204.
16. Chapman, A., Vallejo, V., Mossie, K.G., et al. (1995) Isolation and characterization of species-specific
Clinical Microbiology 33,1283–1288.
17. Diaz Camacho, S., Candil Ruiz, A., Uribe Beltran, M., et al. (1990) Serology as an indicator of Taenia
solium tapeworm infections in a rural community in Mexico. Transactions of the Royal Society of

18. Diaz Camacho, S.P., Candil Ruiz, A., Suate Peraza, V., et al. (1991) Epidemiologic study and control
of Taenia solium infections with praziquantel in a rural village of Mexico. American Journal of Tropical
19. Sarti-Gutierrez, E.J., Schantz, P.M., Lara-Aguilera, R., et al. (1988) Taenia solium taeniasis and cysticer-
cosis in a Mexican village. Tropical Medicine and Parasitology 39, 194–198.
sis and cysticercosis in humans and pigs in a village in Morelos, Mexico. American Journal of Tropical
55, 282–289.
23. Sarti, E., Schantz, P., Aguilera, J., et al. (1992) Epidemiologic observations on porcine cysticercosis in
a rural community of Michoacan State, Mexico. Veterinary Parasitology 41, 195–201.
24. Rodriguez-Canul, R., Allan, J.C., Dominguez, J.L., et al. (1998) Application of an immunoassay to
determine risk factors associated with porcine cysticercosis in a rural area of Yucatan, Mexico.
25. Widdowson, M.A., Cook, A.J., Williams, J.J., et al. (2000) Investigation of risk factors for porcine
Taenia solium cysticercosis: a multiple regression analysis of a cross-sectional study in the Yucatan
Peninsula, Mexico. Transactions of the Royal Society of Tropical Medicine and Hygiene 94, 620–624.
26. Richards, F.O., Jr, Schantz, P.M., Ruiz-Tiben, E., et al. (1985) Cysticercosis in Los Angeles County.
28. Allan, J.C., Velasquez Tohom, M., Garcia Noval, J., et al. (1996) Epidemiology of intestinal taeniasis
in four rural Guatemalan communities. Annals of Tropical Medicine and Parasitology 90, 157–165.
29. García, H.H., Araoz, R., Gilman, R.H., et al. (1998) Increased prevalence of cysticercosis and taeniasis
30. Bundy, D.A., Wong, M.S., Lewis, L.L., et al. (1990) Control of geohelminths by delivery of targeted
chemotherapy through schools. Transactions of the Royal Society of Tropical Medicine and Hygiene 84,
115–120.
31. Chan, L., Kan, S.P., Bundy, D.A. (1992) The effect of repeated chemotherapy on age-related predis-
position to Ascaris lumbricoides and Trichuris trichura. Parasitology 104, 371–377.
32. Schantz, P.M., Wilkins, P.P., Tsang, V.C.W. (1998) Immigrants, imaging and immunoblots: the emer-
Hughes, J.M. (eds) Emerging Infections, Vol. 2. ASM Press, Washington, DC, pp. 213–242.
33. Gilman R.H., Del Brutto, O.H., García H.H., et al. (2000) Prevalence of taeniasis among patients with
neurocysticercosis is related to severity of infection. Neurology 55, 1062.
34. Gracia, F., Chavarria, R., Archbold C., et al. (1990) Neurocysticercosis in Panama: preliminary epi-
demiologic study in the Azuero region. American Journal of Tropical Medicine and Hygiene 42, 67–69.
131–135.
36. Campbell, W.C. (1986) The chemotherapy of parasitic infections. Journal of Parasitology 72, 45–61.
37. de Kaminsky, R.G. (1991) Albendazole treatment in human taeniasis. Transactions of the Royal Society
38. Chung, W.C., Fan, P.C., Lin, C.Y., et al. (1991) Poor efficacy of albendazole for the treatment of
human taeniasis. International Journal of Parasitology 21, 269–270.
39. Pawlowski, Z.S. (1990) Efficacy of low doses of praziquantel in taeniasis. Acta Tropica 48, 83–88.
sis after single taeniacidal dose of praziquantel. Lancet 342, 748.

42. Allan, J.C., Velasquez-Tohom, M., Fletes, C., et al. (1997) Mass chemotherapy for intestinal Taenia
solium taeniasis: effect on prevalence in humans and pigs. Transactions of the Royal Society of Tropical
43. Keilbach, N.M., de Aluja, A.S., Sarti, E. (1989) A programme to control taeniasis–cysticercosis (Taenia
solium): experiences in a Mexican village. Acta Leidensia 57, 181–189.
45. Lawson, J.R., Roberts, M.G., Gemmell, M.A., et al. (1988) Population dynamics in echinococcosis and
cysticercosis: economic assessment of control strategies for Echinococcus granulosus, Taenia ovis and T.
hydatigena. Parasitology 97, 177–191.
46. Tsang, V., Brand, A.J., Boyer, A.E. (1989) An enzyme imunoelectrotransfer blot assay and glycopro-
tein antigens for diagnosing human Taenia solium cysticercosis. Journal of Infectious Diseases 159,
50–59.

42 Taenia solium Vaccination: Present

Status and Future Prospects
Carlton A.W. Evans
Introduction tapeworm carriers are an appealing target

for the control of T. solium1. There is evi-
Infection of pig tissues with Taenia solium lar- dence in experimental animal models that
vae, and of the human bowel with adult the immune response in the definitive host
tapeworms, constitute the natural life cycle can reject tapeworms or cause them to
that is essential for the continuing existence destrobilate2. Furthermore, epidemiological
of the parasite. This propagation depends studies have confirmed that tapeworm
upon evasion or modulation of host immu- reinfection occurs, but human taeniasis
nity ensuring that the adult and larval para- invariably involves only a single worm,
sites survive without being overwhelmingly implying that the presence of one intestinal
lethal to their hosts and without being pork tapeworm may induce immune
destroyed by host immunity. Therefore, the responses that allow continuing infection
evolution of the parasite would be expected while protecting against super-infection3.
to select parasites that cause minimal inter- However, in common with other human
ference to host survival and reproduction cestodes, protective immunity against the
while maintaining viable infection of human adult tapeworm has not been demonstrated
intestines and pig tissues. Similarly, many and adult tapeworm carriage does not
parasites have evolved mechanisms to pro- appear to protect against cysticercosis.
tect their hosts from acquiring dangerously In addition to the immunological obsta-
heavy parasite loads. The complex immunol- cles to developing a vaccine against taenia-
ogy of this host–parasite relationship may be sis, the occult nature of this infection, which
modifiable with vaccination, potentially makes tapeworm carriers difficult to detect,
facilitating control of the parasite. and the minimal morbidity associated with
this intestinal infection, make taeniasis a
poor candidate for human vaccine develop-
Taeniasis: Immunology and ment. Vaccination against taeniasis does
Prospects for Protective Vaccination not, therefore, appear to be immunologi-
cally or logistically feasible at present. The
Because a small number of individuals introduction of oral vaccines derived from
with tapeworms may infect vast numbers transgenic plants may, possibly, modify this
of pigs with cysticercosis over many years, situation in the future.


422 C.A.W. Evans
Overview of the Immune Response Overview of Cysticercosis Prevention

To T. solium Cysticercosis and Control
Immunological tolerance to cysticerci Cysticercosis is a disease of poverty and

social underdevelopment. Human cysticer-
The immunopathogenesis of neurocysticercosis may be controlled by provision of
cosis is highly relevant to vaccine design sanitation and treatment of tapeworm car-
because the immune response to this para- riers. The parasite life cycle may also be
site may be protective, curative or patho- broken by preventing human taeniasis by
genic. Taenia solium larvae commonly live as enforcing meat inspection, and adequately
‘accidental’ intermediate hosts for many freezing or cooking pork. Porcine cysticer-
years without causing symptoms or signifi- cosis may be prevented by corralling pigs
cant inflammation in humans. Symptomatic or by large-scale commercial pig rearing
disease usually results from failure of this that denies pigs access to human faeces.
immune tolerance when one or more cys- Such improvements in public health and
ticerci degenerate within the brain. This animal husbandry have led to the virtual
association between cysticercal degeneration eradication of human and porcine cysticer-
and the onset of symptoms is suggested by: cosis in wealthy countries, but these mea-
(i) the contrasting appearances of morpho- sures are not currently practicable in many
logically intact asymptomatic and degenerat- developing regions. Indeed, their use in tri-
ing symptomatic intracerebral lesions in
als in several Latin American countries has
radioimaging, biopsy or autopsy studies; (ii)
produced only transient reductions in cys-
the time-course of human infections (disease
ticercosis prevalence. There is, therefore, a
often occurring years after infection); and
great need for ‘short-cuts’ to economic
(iii) the transient adverse effects that may
development, i.e. inexpensive strategies
occur as a result of anticysticercal therapy.
that will interrupt the life cycle of the para-
The pig is the natural intermediate host
site in the absence of socio-economic devel-
for T. solium larvae and the usual absence of
illness in infected pigs is remarkable consid- opment. There is economic incentive for
ering that thousands of cysticerci are often people rearing pigs to utilize cysticercosis
scattered throughout neural and other tis- control strategies because cysticercotic pigs
sues at autopsy. The absence of seizures or are of considerably reduced value. It is
other neurological signs in cysticercotic pigs, hoped that an inexpensive vaccine that
in contrast to humans with cysticercosis, effectively protects pigs against cysticerco-
may be explained by the fact that pigs are sis would be sought after and used by sub-
slaughtered in their first year of life, before sistence as well as commercial farmers in
cysticerci degenerate and cause inflamma- endemic areas, because of resultant eco-
tion. Alternatively, T. solium larvae may be nomic benefits. However, the failure of
able to evade immune recognition more implementation of the swine cholera vac-
effectively in pigs when compared with cine programme in developing countries,
humans. Taenia solium larvae therefore usu- including Peru, suggests that considerable
ally survive within pig and human tissues publicity, government funding or compul-
without causing symptomatic inflammation, sory vaccination would be required for
despite the presence of circulating widespread vaccination by subsistence
antibodies4. Our understanding of the com- farmers. An alternative to conventional pro-
plex mechanisms involved is central to vac- tective vaccination, which must be adminis-
cine design and involves parasite tered before exposure to infection, is
sequestration, concomitant immunity, anti- therapeutic vaccination, which aims to cure
genic masking and active modulation of host or modify the course of established infec-
immunity. These processes are reviewed in tion as well as strengthening protection
detail in Chapter 2. against further challenge in the future.

Vaccination: Present Status and Future Prospects 423
Vaccination Against Human Cysticerci may be destroyed by immuno-

Cysticercosis logical intervention. Herbert and Oberg
infected nine pigs with cysticercosis at the
Human protective or therapeutic vaccination age of 2 months and reinfected four of these
to prevent cysticercosis has not been widely pigs 2 months later9. Paradoxically, autopsy
considered as an appropriate intervention in revealed significantly fewer cysticerci in the
endemic regions because little is known about pigs that had been infected twice, suggesting
the immunology of human cysticercosis and that reinfection accelerated cysticercus
cysticercosis is generally not considered a pub- degeneration and absorption. Similarly, rein-
lic health priority, perhaps because of under- fection of cows infected with T. saginata and
diagnosis. It has been suggested that of sheep infected with T. hydatigena caused
cysticercosis occurs with greater than expected degeneration of established cysticerci.
frequency in immunologically deficient chil- Deliberate reinfection is clearly not a sus-
dren, but this uncontrolled observation may tainable intervention, but therapeutic vacci-
reflect a chance association or diagnostic bias nation with cysticercal extracts similarly
rather than an effect of immunodeficiency on caused the resolution of cysticercosis in two
susceptibility5. Cysticercosis has not been pigs10. This therapeutic vaccination was then
noted to be common in immunosuppressed or evaluated in a field trial in which the preva-
immunodeficient adults6. There is, therefore, lence of porcine cysticercosis fell significantly
no evidence of protective immunity against in two villages when pigs were vaccinated
cysticercosis in humans and little prospect of repeatedly11. However, there was no control
human vaccination against this parasite in the group and cysticercosis was diagnosed by
foreseeable future. tongue palpation only. Seven cysticercotic
pigs given therapeutic vaccination were stud-
ied in more detail and 73% of cysts excised
Therapeutic Vaccination for Porcine from them failed to evaginate, compared
Cysticercosis with 5% in seven untreated cysticercotic pigs.
In a subsequent randomized, controlled and
Therapeutic vaccination is an appealing blinded study, pigs naturally infected with T.
alternative to protective vaccination for use solium cysticercosis were inoculated with cys-
in endemic areas where cysticercosis is rou- ticercal antigen, resulting in a significant
tinely diagnosed ante mortem in pigs by reduction in cysticercal viability12. The pro-
tongue palpation. If therapeutic vaccination portion of cyst that showed no evidence of
led to the disappearance of cysticerci and viability was more than doubled in the group
effective conversion of measly (low-value) of pigs given crude cysticercal extract and
pork to normal meat before slaughter, then most of these animals developed new
this intervention would be widely used. The enzyme-linked immunoelectrotransfer blot
incentive for use would be economic, (EITB) bands, confirming an antibody
increasing the financial reward for the pig response to the intervention. However, more
owner; in addition, parasite transmission highly purified cysticercal antigens were less
would also be interrupted. Therapeutic vac- effective and despite treatment with antigen,
cination may also overcome the problem of all pigs remained macroscopically heavily
free-roaming pigs often being infected in the infected and most of the cysticerci in the
first few days of life, so protective vaccina- majority of the treated animals remained
tion before infection occurs may not be feasi- viable for causing human disease. The statis-
ble7. This is a particularly important concern tically significant effect of therapeutic vacci-
because there is some evidence that protec- nation on parasite viability illustrates the
tive vaccination is less effective in young active nature of the host–parasite interaction
pigs, making it less likely that pigs could be and the potential for manipulating this rela-
protected from cysticercosis before they tionship in the treatment of this infection.
become naturally infected8. However, therapeutic vaccines reported so

424 C.A.W. Evans
far have been insufficiently effective to eradi- Crude vaccines against porcine
cate cysticercosis and protection against rein- cysticercosis
fection has not been studied.
In laboratory and field studies, a variety of
antigens have demonstrated effective partial
Protective Vaccination Against protection against T. solium challenge and
Porcine Cysticercosis these results are summarized in Fig. 42.1.
Molinari et al. showed that vaccination of
Vaccination of pigs to prevent porcine cys- healthy pigs with antigens derived from
ticercosis is an appealing strategy to improve whole T. solium cysticerci caused partial pro-
animal health, meat yield and to break the tection against the subsequent development
parasite life cycle, preventing taeniasis and of porcine cysticercosis10. A similar (65–75%)
consequently preventing human cysticerco- degree of protection was achieved in
sis. Considerable progress has been made in Yorkshire pigs immunized with antigens
this endeavour, which is reviewed below. extracted from the scolices of T. solium cys-
ticerci20. Greater than 99% protection was
achieved with chromatographically purified
Historical background antigens from T. solium scolices, with tenfold
greater protection from the first Sephadex
The complex host–parasite interaction in par- peak than the second21.
asitic infections has traditionally hampered There is considerable antigenic similarity
vaccine development, but great progress has between various Taenia species. A crude anti-
been made with immunization against experi- genic extract from murine T. crassiceps cysts
mental infection with metacestode parasites13. administered to pigs induced 50% protection
These studies have used a variety of antigens;
against subsequent T. solium egg chal-
and among crude parasitic antigens, those
lenge22,23. Approximately 96% protection was
derived from the infecting oncosphere stage
achieved with purified protein extracts from
have generally been the most effective14. The
T. crassiceps cyst fluid22. As discussed above,
best example of an effective metacestode vac-
many parasites exhibit stage-specific antigens
cine is that developed for the prevention of T.
ovis15. This recombinant antigen is produced and some studies have utilized T. solium
entirely in the laboratory without the need for oncosphere antigens to specifically induce an
parasite material and similar vaccines based immune response against the infecting stage.
on the 45W, 45WB/X, 16K and 18K antigens The only published study of immunization
have proved to be 90–100% effective16. with oncosphere extracts reported 83–89%
Vaccination against infection of cattle protective efficacy with oncosphere
with larvae of the beef tapeworm has been extracts19. Likewise, immunization of pigs
attempted with partial success using hatched with excretory–secretory products of T.
ova, but limited antigen supply has necessi- solium oncospheres caused a decrease in the
tated the use of recombinant DNA technol- number of cysticerci that developed from
ogy for sustainable vaccine production17. subsequent challenge infection24.
Unfortunately, the T. ovis vaccine was not
effective against bovine infection with T. sag-
inata, so genes were cloned from T. saginata Field studies of vaccines against porcine
that express proteins homologous to the cysticercosis
host-protective T. ovis antigens. This strategy
led to the development of a recombinant Immune response to vaccination in con-
vaccine (combined TSA-9 and TSA-18 anti- trolled laboratory experiments is likely to
gens) that induced up to 99.8% protection differ considerably from rural field use
against infection with T. saginata eggs18. A where malnutrition, simultaneous antigenic
similar recombinant T. ovis antigen vaccine challenges and co-infections are frequent.
has been used successfully to protect pigs The above experiments that demonstrated
from T. solium, as described below19. the efficacy of T. crassiceps antigen vaccine

10,000
Cyst extract (Molinari et al., 1983)10
T. crassiceps cyst extract (Huerta et al., 2000)8
1,000
Encystment rate (cysticerci per 100,000 eggs)
T. crassiceps cyst extract (Huerta et al., 2000)8
T. crassiceps cyst fluid (Manoutcharian et al., 1996)22
100
T. crassiceps cyst fluid extract (Manoutcharian et al., 1996)22
Scolex extract (Nascimento et al., 1995)20
10
Scolex extract (Kumar et al., 1987)21
Scolex extract (Kumar et al., 1987)21
1
Oncosphere secretions (Pathak and Gaur,1990)24
Oncosphere extract (Plancarte et al.,1999)19
0
Controls Vaccinated Recombinant T. ovis antigen (Plancarte et al., 1999)19
Fig. 42.1. Overview of Taenia solium vaccination trials involving experimental challenge infections. The
number of cysticerci per 100,000 T. solium eggs administered is shown for control and vaccinated pigs. Each
line represents a published experiment involving several pigs. Details of each experiment, including the dose
of parasites used for the challenge infection, are given in the text. The viability of cysticerci is not shown.
were performed with well-nourished, adult of cysticercosis by tongue palpation from

York-Landrace pigs22,23. In an attempt to 2.4% to 0.45%25. Despite limitations of the
mimic typical rural conditions for subsis- monitoring of concurrent controls in these
tence pig rearing in Mexico, vaccination and studies and the insensitive method of diag-
subsequent T. solium challenge were per- nosing cysticercosis, the results of this large-
formed in outbred, malnourished younger scale operational study were encouraging
pigs8. Under these conditions, vaccination no because they suggested that a laboratory-
longer affected the number of cysticerci, developed vaccine could have significant
although the degree of histological degenera- efficacy in the field setting.
tion was greater in vaccinated animals. This
illustrates the difficulty in extrapolating
results of laboratory experiments to the field. Parasite supply for testing porcine
In a Mexican field trial, cysticercosis was cysticercosis vaccines
found to disappear from several endemic
communities following repeated administra- One of the major problems that hampers the
tion of crude T. solium cysticercal antigens to development of a vaccine to protect against
pigs11. In a subsequent, improved, controlled cysticercosis is the difficulty in obtaining sup-
study, vaccination with the same antigen plies of T. solium eggs from tapeworm carri-
was associated with a fall in the prevalence ers. It is ethically necessary to treat any

426 C.A.W. Evans
tapeworm carrier upon diagnosis, because of DNA vaccines

their risk of developing cysticercosis.
Successful Taenia propagation in immunosup- The inoculation of DNA elicits both humoral
pressed chinchillas has recently been reported and cellular immune responses against the
and gravid segments from the tapeworms antigens coded for by that DNA. Although this
grown in this animal model caused cysticer- strategy appears to have considerable potential
cosis infection in pigs, raising the hope that for inducing protective immune responses in
this may allow a constant laboratory supply laboratory experiments, initial enthusiasm has
of Taenia eggs (reviewed in Chapter 4)26. been tempered by concerns about the safety of
introducing viral vectors containing patho-
genic DNA into the food chain. Furthermore,
Recombinant antigens administration of 45W, 18K and 16K DNA vac-
cines caused little or no antibody response to
An additional difficulty is the supply of T. these T. ovis antigens, in contrast to the corre-
solium antigens for vaccine production. While sponding protein vaccines30. Indeed, nucleic
cysticerci and their scolices are currently acid vaccination against T. ovis had only mod-
plentiful in endemic areas, oncospheres est efficacy even in combination with a con-
remain difficult to obtain and the standard- ventional protein vaccine31. In contrast, direct
ization of antigens extracted from any para- inoculation of a DNA vaccine against T. crassi-
site stage is problematic. These problems in ceps into mouse spleens in vivo elicited protec-
antigen supply and standardization may be tive cellular immune responses against this
overcome with recombinant DNA technol- parasite32. A reduction in T. crassiceps parasite
ogy. cDNA libraries have been produced for load also occurred after the administration of
T. solium, but there have been no published macrophages pulsed ex vivo with a cDNA
porcine trials of recombinant vaccines expression library containing several antigenic
derived from T. solium DNA. However, a clones33. Of more relevance to possible field
combination of the 45WB/X, 16K and 18K use, protective responses were obtained after
recombinant T. ovis antigens caused 74–93% intradermal and intramuscular inoculation of a
protection against porcine cysticercosis. KETc7 DNA vaccine for murine cysticercosis34.
These recombinant antigens are completely It remains to be seen whether DNA vaccina-
standardized and are easier to produce on an tion will protect pigs and whether this technol-
industrial scale than those purified from par- ogy will be acceptable for vaccinating animals
asite material. Importantly, a protective T. that are to be consumed by humans.
ovis antigen with homology to a T. solium
antigen has recently been cloned, and experi-
ments are in progress to establish whether Comparative Evaluation of Protective
this fulfils its potential for high levels of pro- Vaccine Trials
tection against porcine cysticercosis27.
Similarly, vaccination with the KETc1 and Methodological considerations are critical to
KETc12 recombinant T. crassiceps antigens is the comparison of different vaccine studies
highly protective against this murine parasite and the potential utility of vaccines for use in
and sequence analysis reveals considerable the field setting. For example, three vaccine
homology with T. solium antigens28,29. This subcutaneous injections at 20-day intervals
family of antigens is therefore a strong candi- had far greater efficacy than vaccination with
date for testing as T. solium vaccines, possibly a single dose, but a vaccine that required
in combination with other recombinant anti- multiple doses would be of limited practical
gens. Recombinant DNA technology also value in the resource-poor settings where
allows the inclusion of parasite antigens in porcine cysticercosis is most common8,20. The
vectors or organisms that may increase majority of authors regard the proportion of
immunogenicity or, most importantly, allow infection challenge eggs that successfully
oral administration. Oral vaccination against form cysticerci, in vaccinated and unvacci-
T. solium has not yet been reported. nated (or adjuvant treated) pigs, as a measure

of the efficacy of vaccination. Where the nec- efficacy would reinforce the financial incen-
essary raw data have been published, this is tive for farmers to protect their livelihood
the approach used for calculating efficacy from this infection, which at least halves the
rates in this review and it yielded results sim- value of pigs in many endemic areas.
ilar to those presented by the original authors However, it is noteworthy that the least
(Fig. 42.1). Clearly, the wide range of vaccine effective study presented here observed no
efficacy and infection efficacy shown is likely effect on cyst numbers but did report a
to result from differences in the proportion of marked effect of vaccination on cyst
Taenia eggs obtained from gravid versus histopathology8. The actual viability of cys-
immature proglottides and differences in ticerci for causing human taeniasis is tradi-
autopsy procedures that may leave many tionally assessed by evagination assays, but
cysticerci undiscovered. Besides, variation in these are infrequently used12. No cysticerco-
the adjuvants used may also contribute to sis vaccines have yet been reported to be
discrepant results because the latter may 100% effective and it is desirable that future
cause cysticercal degeneration in control ani- studies should assess the ability of cysticerci
mals. For example, saponin adjuvant is much to evaginate, as well as their absolute num-
less likely to cause cysticercal degeneration bers19. It may be that the few parasites that
than incomplete Freund’s adjuvant or encyst despite previous vaccination are
Corynebacterium parvum8,20,22,23. Although immunologically damaged and unable to
these issues do not negate the clear effect of evaginate and cause human taeniasis.
some vaccines compared with controls
within individual, blinded experiments, they
do hamper comparison of results between Conclusions
different experiments. There has also been no
standardization of the size of the infection Vaccines derived from cysticercal extracts
challenge used to test cysticercosis vaccines. have already proved their utility in field tri-
The number of T. solium eggs administered als and recombinant vaccines are now suffi-
has varied from 8400 eggs in one experiment, ciently effective under controlled conditions
to 10,000 eggs, 15,000 eggs, 25,000 eggs, and to warrant widespread evaluation of this
as many as 100,000 eggs in the study with the sustainable intervention. Rapid recent
least effective results8,10,19–22,24. These progress with the sequencing and compari-
methodological differences are important son of antigens from T. solium and related
because the natural infecting dose in the field parasites makes it likely that more effective
is likely to vary over an even greater range. T. solium vaccines will be developed soon.
Only one group has formally tested the Although the effect of malnutrition, constant
effect of pig age on vaccine efficacy8. exposure to antigens, and the transfer of
Although their vaccine administered to mal- immunity from pregnant sows await investi-
nourished outbred pigs did not have any gation, this progress in the transfer of molec-
effect on cyst numbers, a significant effect on ular biology from the laboratory to the field
cyst viability was greater in older than has provided a powerful new tool for the
young pigs. Furthermore, there was no control of cysticercosis. Combined with treat-
detectable antibody response to vaccination ment of human tapeworm carriers, the immi-
in pigs inoculated at 40 (rather than 70) days nent expectation of an effective recombinant
of age. It is interesting to note that immu- vaccine against porcine cysticercosis makes
nization caused cysticerci to degenerate, eradication of cysticercosis a feasible goal.
compared with control animals, despite the
absence of a detectable antibody response,
implicating a cellular immune response to Acknowledgement
vaccination in this process8.
The goal of effective vaccination must be The author is funded by the Wellcome Trust
prevention of infection and absence of cys- as a Career Development Fellow in Clinical
ticerci from pig tissues at autopsy. Such total Tropical Medicine.

428 C.A.W. Evans
References
1. Lightowlers, M.W. (1996) Vaccination against cestode parasites. International Journal of Parasitology
26, 819–824.
2. Andreassen, J. (1991) Immunity to adult cestodes: basic knowledge and vaccination problems. A
review. Parasitologia 33, 45–53.
based diagnosis of Taenia solium taeniasis by enzyme-linked immunosorbent assay. American Journal
4. White, A.C., Jr, Robinson, P., Kuhn, R. (1997) Taenia solium cysticercosis: host–parasite interactions
and the immune response. Chemical Immunology 66, 209–230.
5. Flisser, A., Willms, K., Laclette, J.P., et al. (1982) Discussion. In: Flisser, A., Willms, K., Laclette, J.P., et
al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp. 611.
6. SotoHernandez, J.L., Ostrosky-Zeichner, L., Tavera, G., et al. (1996) Neurocysticercosis and HIV
infection: report of two cases and review. Surgical Neurology 45, 57–61.
7. Aluja, A.S., de Martinez, J.J., Villalobos, A. (1998) Taenia solium cysticercosis in young pigs: age at
first infection and histological characteristics. Veterinary Parasitology 76, 71–79.
8. Huerta, M., Sciutto, E., Garcia, G., et al. (2000) Vaccination against Taenia solium cysticercosis in
underfed rustic pigs of Mexico: roles of age, genetic background and antibody response. Veterinary
9. Herbert, I., Oberg, C. (1974) Cysticercosis in pigs due to infection with Taenia solium Linneaus 1758.
In: Soulsby, E.J.L. (ed.) Parasitic Zoonoses: Clinical and Experimental Studies. Academic Press, London,
pp. 187–195.
10. Molinari, J.L., Meza, R., Tato, P. (1983) Taenia solium: cell reactions to the larva (Cysticercus cellu-
losae) in naturally parasitized, immunized hogs. Experimental Parasitology 56, 327–338.
11. Molinari, J.L., Soto, R., Tato, P., et al. (1993) Immunization against porcine cysticercosis in an
endemic area in Mexico: a field and laboratory study. American Journal of Tropical Medicine and
Hygiene 49, 502–512.
12. Evans, C.A., Gonzalez, A.E., Gilman, R.H., et al. (1997) Immunotherapy for porcine cysticercosis:
implications for prevention of human disease. American Journal of Tropical Medicine and Hygiene 56,
33–37.
13. Lightowlers, M.W., Rickard, M.D. (1993) Vaccination against cestode parasites. Immunology and Cell
Biology 71, 443–451.
14. Lightowlers, M.W. (1994) Vaccination against animal parasites. Veterinary Parasitology 54, 177–204.
15. Johnson, K.S., Harrison, G.B., Lightowlers, M.W., et al. (1989) Vaccination against ovine cysticercosis
using a defined recombinant antigen. Nature 338, 585–587.
16. Lightowlers, M.W. (1999) Eradication of Taenia solium cysticercosis: a role for vaccination of pigs.
17. Babiker, H.A., Eldin, E.S. (1987) Preliminary observations on vaccination against bovine cysticerco-
sis in the Sudan. Veterinary Parasitology 24, 297–300.
18. Lighowlers, M.W., Rolfe, R., Gauci, C.G. (1996) Taenia saginata: vaccination against cysticercosis in
cattle with recombinant oncosphere antigens. Experimental Parasitology 84, 330–338.
19. Plancarte, A., Flisser, A., Gauci, C.G., et al. (1999) Vaccination against Taenia solium cysticercosis in
pigs using native and recombinant oncosphere antigens. International Journal of Parasitology 29,
643–647.
20. Nascimento, E., Costa, J.O., Guimaraes, M.P., et al. (1995) Effective immune protection of pigs
against cysticercosis. Veterinary Immunology and Immunopathology 45, 127–137.
21. Kumar, D., Gaur, S.N.S., Pathak, M.L. (1987) Immunization of pigs against the cysticercus of Taenia
solium using fractionated first and second peaks of Cysticercus cellulosae scolex antigens. Indian
Journal of Animal Sciences 57, 932–935.
22. Manoutcharian, K., Rosas, G., Hernandez, M., et al. (1996) Cysticercosis: identification and cloning
of protective recombinant antigens. Journal of Parasitology 82, 250–254.
23. Sciutto, E., Fragoso, G., Trueba, L., et al. (1990) Cysticercosis vaccine: cross protecting with Taenia
solium antigens against experimental murine T. crassiceps cysticercosis. Parasite Immunology 12,
687–696.
24. Pathak, K.M.L., Gaur, S.N.S. (1990) Immunization of pigs with culture antigens of Taenia solium.

25. Molinari, J.L., Rodriguez, D., Tato, P., et al. (1997) Field trial for reducing porcine Taenia solium cys-
ticercosis in Mexico by systematic vaccination of pigs. Veterinary Parasitology 69, 55–63.
26. Flisser, A., Lightowlers, M.W. (2001) Vaccination against Taenia solium cysticercosis. Memorias do
Instituto Oswaldo Cruz (Rio de Janeiro) 96, 353–356.
27. Lightowlers, M.W., Flisser, A., Gauci, C.G., et al. (2000) Vaccination against cysticercosis and hydatid
disease. Parasitology Today 16, 191–196.
28. Toledo, A., Fragoso, G., Rosas, G., et al. (2001) Two epitopes shared by Taenia crassiceps and Taenia
solium confer protection against murine T. crassiceps cysticercosis along with a prominent T1
response. Infections and Immunology 69, 1766–1773.
29. Toledo, A., Larralde, C., Fragoso, G., et al. (1999) Towards a Taenia solium cysticercosis vaccine: an
epitope shared by Taenia crassiceps and Taenia solium protects mice against experimental cysticerco-
sis. Infections and Immunology 67, 2522–2530.
30. Drew, D.R., Lightowlers, M.W., Strugnell, R.A. (2000) A comparison of DNA vaccine expressing the
45W, 18k and 16k host-protective antigens of Taenia ovis in mice and sheep. Veterinary Immunology
and Immunopathology 76, 171–181.
31. Rothel, J.S., Waterkeyn, J.G., Strugnell, R.A., et al. (1997) Nucleic acid vaccination of sheep: use in
combination with a conventional adjuvanted vaccine against Taenia ovis. Immunology and Cell Biology
75, 41–46.
32. Cano, A., Fragoso, G., Gevorkian, G., et al. (2001) Intraspleen DNA inoculation elicits protective cel-
lular immune responses. DNA Cell Biology 20, 215–221.
33. Manoutcharian, K., Terrazas, L.I., Gevorkian, G., et al. (1999) DNA pulsed macrophage-mediated
cDNA expression library immunization in vaccine development. Vaccine 18, 389–391.
34. Cruz-Revilla, C., Ross, G., Fragoso, G., et al. (2000) Taenia crassiceps cysticercosis: protective effect
and immune response elicited by DNA immunization. Journal of Parasitology 86, 67–74.

43 Control of Taenia solium with Porcine

Chemotherapy
Armando E. Gonzalez
Introduction Therefore, while the strategy brought

about significant changes in knowledge
Control or eradication of Taenia solium cys- about T. solium, it was not successful in
ticercosis has been achieved to date only in controlling levels of T. solium endemicity in
Europe and North America. Significant the population. Other interventional strate-
improvements in sanitary conditions and gies employing mass cestocidal treatment
developing functional slaughterhouse con- have proved successful in the short term,
trol systems were primarily responsible for though (reviewed in Chapter 41).
control in these regions (see Chapter 7). In Theoretically, strategies for control of T.
endemic areas of developing countries, the solium in humans would be ineffective
life cycle of T. solium is sustained because because transmission could subsequently
pigs have access to infected faeces, and occur from infected pigs. Therefore, eradi-
cysticercosis-infested pork is available for cation of T. solium from a disease-endemic
consumption. Moreover, control in devel- area by employing human treatment alone
oping countries is limited by economic and would require consecutive interventions,
sanitary conditions. Interventional trials for at least the average life span of the
with massive human taeniacidal chemo- porcine reproductive stock. Furthermore,
therapy (reviewed in Chapter 41), the interval between interventions should
immunotherapy (reviewed in Chapter 42) not exceed the pre-patent period, so that if
and health education (reviewed in Chapter new adult tapeworm infections occur, they
41) have not proved to be sustainable in would not have enough time to infect more
the long-term to date. For instance, a study pigs. This holds true also, if the porcine
in rural Mexico evaluated the effects of population alone is targeted by the inter-
health education through discourses and ventional strategy. Such interventions
demonstrations given to primary and would have to be made for the entire life
secondary grade school children and span of the tapeworm, implying that the
taeniacidal treatment of the human pig population has to be treated within the
population1. Two years later, 78% of the interval required for cyst maturation. In
children and 2% of the adults successfully order to obviate the problems associated
answered a questionnaire on the life cycle with treatment of either human or pig pop-
of the parasite; however, porcine infection ulation alone, concurrent treatment of both
rates were found to have increased twofold. human and porcine populations has been


432 A.E. Gonzalez
proposed. It has been suggested that tar- Porcine Chemotherapy

geting both hosts would reduce the time
required to eradication and thereby Praziquantel
increase the likelihood of success. Finally,
the inspection and condemnation of pork Several chemotherapeutic agents have been
in abattoirs, which is advocated by the Pan evaluated for the treatment of porcine cysticer-
American Health Organization and the cosis. Early efforts with flubendazole3 were
World Health Organization as an impor- followed by evaluation of praziquantel
tant control measure, paradoxically administered in a dose of 50 mg kg1 day1
encourages high rates of infection by fail- for 15 days4,5. A variable efficacy was noted in
ing to cover the informal pork markets that these initial studies and not all the cysts disap-
are major circuits for the sale of pork in peared upon computed tomography by day-
developing countries2. 47 after treatment4. Later, 1 day treatment with
While the benefits of various interven- praziquantel (in three different doses of 100
tions described above should not be under- mg kg1, 50 mg kg1 and 25 mg kg1) in three
estimated, results of a community divided doses was reported to kill all cysts in
intervention in Peru (described below) 16 of 18 pigs (88.9%)5. The highest dose was
indicated that a practical approach most efficacious in causing degeneration of
towards eradication of porcine cysticerco- the cysts. This study, however, did not evaluate
sis should incorporate economic incentives the disappearance of cysts from the carcasses,
in order to be successful2. In explicit terms, since pigs were killed 1 month after treatment.
since porcine cysticercosis reduces the eco-
nomic value of pork in the market, a
chemotherapeutic intervention that targets Albendazole
swine and eliminates cysticerci in pork
should not only interrupt the transmission The successful treatment of porcine cysticer-
cycle of T. solium but also improve the eco- cosis with albendazole at a dose of 15 mg
nomic value of pork sold in the market. kg1 daily for 30 days was first reported in
However, in order to improve the commer- 19956. However, the need for multiple doses
cial value of pork, the cysticerci need to be made this regimen impractical for use in field
visually and palpably eliminated. Any control programmes. At about the same time,
chemotherapeutic intervention should con- a randomized trial evaluated the efficacy of
sider this aspect for success in the field. two different schemes of administration of
Indeed, the economic benefits of selling albendazole for the treatment of porcine cys-
ticercosis7. Seventeen naturally infected pigs
clean meat rather than the accrued health
were divided into three groups and treated
benefits may drive farmers to volunteer
by mouth with albendazole (50 mg kg1 sin-
their pigs for chemotherapy. Better market
gle dose), albendazole (30 mg kg1 day1 for
prices for treated pork and access to the
3 days) or placebo, respectively. All animals
formal marketing system will be strong treated with the single dose of albendazole
incentives for farmers to treat their pigs, exhibited side effects (extreme prostration,
and community cooperation will be complete anorexia and reluctance to move),
ensured. Any disease eradication pro- and one of the pigs died 3 days after treat-
gramme that considers the economic factor ment. Those treated for 3 days (30 mg kg1
is more likely to be successful and sustain- day1) also exhibited side effects (lethargy
able, and also to result in the acceptance of and anorexia). No side effects were noted in
health education campaigns. In the present the placebo group. Importantly, single-dose
chapter, the author has focused on control albendazole therapy left some viable cysts
of T. solium through chemotherapy of remaining in the meat, while 3-day albenda-
infected pigs, drawing particular attention zole therapy killed all but one cysts. The 3-
to its major advantage of providing eco- day regimen was found to be effective as a
nomic incentives to pork-producing farm- strategy that targeted the porcine population.
ers through the sale of clean carcasses. The meat, however, remained measly with

Control of T. solium with Porcine Chemotherapy 433
dead and degenerating cysts – leaving it dazole and may over-estimate the amount of
unsightly as a food product. drug needed for treatment of porcine cysticer-
cosis. Consequently, an experiment was
designed to establish the minimal effective
Oxfendazole single dose of oxfendazole that would kill all
cysticerci in pigs10. Three doses of oxfendazole
Oxfendazole (methyl [5-(phenylsulphinyl)-1H were tested: 10 mg kg1, 20 mg kg1 and 30
benzimidazole- 2-yl] carbamate; SynanthicTM) mg kg1. After treatment, more than 75% of
was first identified as having anthelminthic cysts in pigs from the control group (not
properties against larval and adult gastroin- treated) were viable, irrespective of their
testinal cestodes and nematodes in various anatomical location. Four animals among
animal species by Syntex Research, Palo Alto, those administered a dose of 10 mg kg1
California. Structurally, it comprises of a ben- exhibited viable cysts; the latter were present
zimidazole carbamate that is characteristic of in the muscle (three pigs), the tongue (two
this group of drugs (which includes albenda- pigs), and the brain (two pigs). Viable cysts
zole), with a phenylsulphinyl substituent in were also found in four animals in the 20 mg
position-58. The efficacy of single-dose kg1 group, although they were present only
oxfendazole alone, praziquantel alone, and in the muscle (one pig) and the brain (three
oxfendazole and praziquantel in combination, pigs). The number of viable cysts recovered
in the treatment of porcine cysticercosis were
from the treated animals was very low: 18 of
compared in a randomized, placebo-con-
216 (8%) animals that were administered the
trolled study. Oxfendazole, used in a single
10 mg kg1 dose, and 11 out of 198 (6%) given
dose of 30 mg kg1, was found to be highly
the 20 mg kg1 dose. No viable cysts were
effective for the treatment of porcine cysticer-
recovered from animals that were adminis-
cosis9. Both oxfendazole alone and in combi-
tered 30 mg kg1 oxfendazole. Carcasses of
nation with praziquantel killed all the
parasites, leaving behind only microcalcifica- pigs treated with 30 mg kg1 oxfendazole had
tions and minuscule scars in the meat, giving a normal appearance, and were considered
it a clean appearance. The appearance of the suitable for human consumption.
meat was suitable for marketing, and no
apparent differences in taste were found by
organoleptic experts from the pork sold in Time response of anticysticercal effect
markets of Lima. In contrast, a single dose of
praziquantel alone (50 mg kg1) showed no The time for cysts to die and disappear after
benefit when compared with the controls. oxfendazole administration is critical to the
Cysts appeared clearly visible in the carcasses determination of the specific timing of treat-
of the praziquantel and control groups. No ment of live infected pigs. A controlled
detectable side effects were seen in any of the study was designed to determine the time
groups. This study demonstrated the safety period between treatment and death of cys-
and efficacy of a single dose (30 mg kg1) of ticerci11. A clear decrease in viability and
oxfendazole in the treatment of porcine cys- number of cysts was noted after the first
ticercosis. All other regimens were either inef- week following treatment with oxfendazole,
fective, needed multiple dosing, had side though few live cysticerci were found in
effects or left the meat unsuitable for sale3–7,9. many tissues even at 4 weeks. Twelve weeks
after oxfendazole treatment, the meat exam-
ined was clear and only minuscule scars
Overview of Laboratory and Field were observed, except in one animal that
Trials with Oxfendazole had viable cysts in the brain. The predicted
time to total decay depended on the organ.
Dose considerations The time to zero viability in muscle and
heart were 4 and 3 weeks, respectively.
The dose of oxfendazole (30 mg kg1) was cal- Interestingly, the time to cyst disappearance
culated from previous experience with alben- in the tongue, a voluntary muscle was 5

434 A.E. Gonzalez
weeks. This study demonstrated that imme- Protection of successful treatment with
diate pre-slaughter treatment of pigs with oxfendazole
oxfendazole does not result in death and
disappearance of cyticerci. Since treated pigs can theoretically acquire
new infections, the estimation of the duration
of protective effect conferred by oxfendazole
Field trial with oxfendazole treatment is critical to the understanding of
the development of pig chemotherapy-based
The availability and documented success of control interventions. Another controlled
oxfendazole led to its use in a field trial for study was designed to determine if cysticerco-
control of T. solium through porcine sis-infected pigs could acquire new infections
chemotherapy; such approaches were con- after having been treated with oxfendazole12.
sidered impractical primarily due to the A group of 20 cysticercotic pigs were treated
duration of treatment, and found expensive with oxfendazole and later matched with 41
before the use of oxfendazole. The naive (unexposed to T. solium eggs) pigs. Both
Cysticercosis Working Group in Peru carried groups were then exposed to a natural chal-
out an interventional study that evaluated lenge of T. solium eggs in a hyperendemic area.
the effect of combined mass therapy target- Seroprevalence of cysticercosis among native
ing both human and porcine populations in pigs at the field site at the time of the experi-
the Peruvian highlands (Hector H. García, ment was 75% (73/97 animals). From the orig-
Lima, Peru, unpublished data). Eight highly inal 61 pigs, 51 (84%) were recovered at the
endemic villages located in the Mantaro val- end of the study, 19/20 in the treatment group
ley were selected for the study. The selected (95%), and 32/41 (78%) in the control group.
population underwent a cysticercosis control New infections were demonstrated in 15/32
programme that included mass treatment of (47%) using EITB serology and in 12/32
human and porcine populations. All pigs (38%) by tongue palpation in the control
were treated twice with oxfendazole (single group. At necropsy, viable cysts were found
dose, 30 mg kg1) at the beginning of the in the carcasses of seven pigs (viable only:
experiment (month 0 and month 4). three; viable and degenerated: four) while
Following baseline sampling and 30 days degenerated cysts alone were noted in
after treating the pigs, the villagers in the another five animals. The numbers of cysts in
treatment branch of the study received prazi- these newly infected animals ranged between
quantel in taeniacidal doses. The strategy five and 30 per pig. Conversely, no viable
was shown to be successful in the short term. cysts were found in the carcasses of any of
Benefits of the intervention as measured by the 19 treated pigs.
incident cases of porcine cysticercosis In field conditions, most pigs live for
remained statistically significant up to 16 around 9 months (see Chapter 15). Cysts take
months (P = 0.04). However, within 2 years, about 2 months to develop, so it is reasonable
the prevalence of the porcine cysticercosis to assume that pigs will be infective only
rose to its original levels. Sentinel pig trials after 3–4 months of age. Therefore, if treated
corroborated that environmental contamina- at 3–4 months of age, cured pigs are unlikely
tion returned to baseline levels 18 months to be re-infected at least until 7 months of
after intervention. The biotic potential of age, and it is very probable that this protec-
T. solium ultimately recovered to steady-state tion will extend for longer periods and thus
baseline values. The study demonstrated cover the remaining lifetime of the pig. This
that information regarding variables affect- means that oxfendazole is potentially an
ing the biotic potential were important; these effective control agent because once treated,
were used to calculate the number of inter- pigs are refractory to re-infection even in the
ventions and the minimum treatment cover- event of ongoing exposure to the source of T.
age required for a strategy using either solium eggs. Obviously, other concomitant
common sense or mathematical approaches measures are still needed since seronegative
(reviewed in Chapter 44). pigs still remain susceptible to infection.

Control of T. solium with Porcine Chemotherapy 435
Conclusions demonstrated to cause complete disappear-

ance of cysts at 12 weeks after treatment.
Porcine chemotherapy, previously impracti- More importantly, the pork meat is rendered
cal and expensive, is now an important clean with no residual cysts or scars, thereby
option in the short-term control of T. solium. increasing its economic value in the pork
Several drugs including flubendazole, prazi- market. Mass porcine chemotherapy with
quantel, albendazole and oxfendazole have oxfendazole could, therefore, be a useful
been used as chemotherapeutic agents in strategy against T. solium, by providing
experimental and field conditions. Most health as well as economic benefits. Until a
drugs, like albendazole and praziquantel, vaccine for porcine cysticercosis is available,
have to be administered over several days; treatment of infected pigs is a logical
this is a major limitation to their use in field approach for controlling transmission of T.
conditions. Oxfendazole, however, has the solium, and should therefore be considered
advantage that that it can be administered in an important, cost-effective measure to con-
single doses (30 mg kg1). The drug has been trol cysticercosis.
References
1. Keilbach, N.M., De Aluja, A.S., Sarti, E. (1989) A programme to control taeniasis–cysticercosis (Taenia
solium): experiences in a Mexican village. Acta Leiden 57, 181–189.
Bulletin of World Health Organization 71, 223–228.
3. Tellez-Giron, E., Ramos, M., Montante, M. (1981) Effect of flubendazole on cysticercus cellulosae in
pigs. American Journal of Tropical Medicine and Hygiene 30, 135–138.
4. Flisser, A., Gonzalez, D., Shkurovich, M., et al. (1990) Praziquantel treatment of porcine brain and
muscle Taenia solium cysticercosis. 1. Radiological, physiological and histopathological studies.
5. Torres, A., Plancarte, A., Villabos, A., et al. (1992) Praziquantel treatment of porcine brain and muscle
cysticercosis. 3. Effect of 1-day treatment. Parasitology Research 25, 1443–1450.
6. Kaur, M., Joshi, K., Ganguly, N.K., et al. (1995) Evaluation of the efficacy of albendazole against the
larvae of Taenia solium in experimentally infected pigs, and kinetics of the immune response.
7. Gonzalez, A.E., García, H.H., Gilman, R.H., et al. (1995) Treatment of porcine cysticercosis with
albendazole. American Journal of Tropical Medicine and Hygiene 53, 571–574.
8. Marriner, S.E., Bogan, J.A. (1981) Pharmacokinetics of oxfendazole in sheep. American Journal of
Veterinary Research 42, 1143–1145.
10. Gonzalez, A.E., Falcon, N., Gavidia, C., et al. (1997) Treatment of swine cysticercosis with oxfenda-
zole: a dose–response trial. Veterinary Record 141, 420–422.
12. Gonzalez, A.E., Gavidia, C., Falcon, N., et al. (2001) Cysticercosis pigs treated with oxfendazole are
protected from further infection. American Journal of Tropical Medicine and Hygiene 65, 15–18.

44 Use of a Simulation Model to Evaluate

Control Programmes Against Taenia
solium Cysticercosis
Armando E. Gonzalez, Robert H. Gilman, Hector H. García

and Teresa Lopez
Introduction a number of proposed control strategies in

terms of changes in both the adult and inter-
Taenia solium produces widespread livestock mediate populations of T. solium. An eco-
production losses caused by the intermediate nomic component was also included to
stage of cysticercosis infecting the pig1. The calculate the net financial benefit of proposed
rates of porcine infection are variable, but in control strategies. An important objective was
endemic regions, over 20–30% of pigs may be to simulate pig population dynamics, infec-
infected2. An improved understanding of the tion in both human and porcine populations,
relationship between T. solium and the pig the effect of different control strategies on T.
production systems in endemic areas is cru- solium and the financial benefit of control
cial. McLeod suggested that a simulation strategies. The model comprised a set of algo-
model that included a disease component rithms that uncovered various aspects of the
over a herd structure dynamic assisted in this disease, identified functional relationships
goal3. Thus, it was possible to relate the pres- between host and its environment, estab-
ence of T. solium to pig production activities. lished measures of effectiveness and con-
A dynamic–stochastic model that simulates straints and calculated economic indicators.
pig and T. solium populations over time was The model used stochastic processes to simu-
developed to produce estimates of the eco- late variable outputs4. The element of stochas-
nomic impact of disease, and to quantify the tic variation enabled the model to predict the
costs of control measures through financial likelihood of discrete events and to determine
analyses*. The model was designed to assess the value from a relevant distribution for an
*A number of strategies evaluate the effect of disease in a population. When a disease outbreak is modelled
directly, an epidemic curve can be drawn which depicts changes in disease prevalence. If some economic
variables are considered, the economic changes during the epidemic curve can be assessed. Another strategy
is to model the population but not the disease. By running the model with and without disease parameters,
the cost of disease can be calculated. A third and more flexible approach is to combine population and
disease parameters in a single model and evaluate the effect of disease and control strategies from the final
output3. Development of a simulation model is the process of building a mathematical and/or logical model
of a system or a decision problem, and experimenting with the model to obtain insight into the system’s
behaviour or to assist in making decisions concerning the problem. Simulation models are designed so that
they mimic the system under study as closely as possible in order to achieve a substantial degree of
epidemiological realism. Thus, building the model is making use of information about a disease in the form of
algorithms and equations4,5. Continued on next page

individual in the population3. The model The latter in turn were organized in compo-
combined population and disease models into nents according to overall objectives. Calls to
an epidemiological model. specific components came from modules and
sub-modules. The program was structured in
three modules, namely: ‘input’, ‘simulation’
General Description of the and ‘output’. Obviously, the core of the pro-
Simulation Model gram lay in the simulation module, which
contained two sub-modules, ‘baseline’, and
Assumptions ‘intervention’. The former ran a simulation
without any disease control while the latter
It was assumed that the effective reproductive simulated the selected control strategy.
rate of the adult tapeworm (R) is equal to one6. The model was developed using Visual
This assumption considers that each adult Basic 4.0 (Fig. 44.1). The model considers
tapeworm produces one adult tapeworm as input, simulation and output forms. Three
an offspring. Therefore, the average number of forms were designed to set values to input
tapeworms remains constant through time. variables. Briefly, the first two consider input
Also, that the infection rates for humans were values for the simulation model itself; swine
the same for each individual in the popula- and human population, disease parameters,
tion. This assumption need not hold true in financial parameters and seasonality factors.
actual conditions; however, there are no data The third input form was designed to select
to support a more plausible assumption the choice of output presentation. Two out-
regarding T. solium egg contamination pat- put forms present results in either economic
terns. Regarding porcine cysticercosis, it was evaluations or disease evolution graphs.
assumed that the infection rate is the same for
all pigs, and that in highly endemic areas, if a
pig is exposed at birth to a contaminated envi- Main procedures
ronment, it will become infected during the
first 6 months of life. Assumptions were also Changes in tapeworm population
made for human infection. The number of
new cases of human and swine cysticercosis There are three disease states for a tapeworm
depends on the number of adult tapeworms carrier: infected with an immature tape-
present, the number of new cases of tapeworm worm, infected with a mature tapeworm,
infection depends on the number of infected and postinfection contamination. The latter
pigs consumed in that day and finally, that the is very important because, even though the
number of exposed humans remains constant human host no longer harbours the tape-
throughout the simulation. worm, a number of the produced eggs still
remain infective in the environment. The
routine deals with environmental contami-
Basic structure of the model nation and assigns a number of infective
days after the tapeworm is eliminated. This
The simulation of related events was pro- value varies from place to place, according to
grammed in routines and algorithms that climactic and hygiene conditions, and is
represent the basic units of the programme. required in the input form. The routine
Continued from previous page

A stochastic process is a system of countable events, where the events occur according to some well-defined
random process5. Stochastic simulation modelling encompasses a range of techniques to mathematically
describe the impact of uncertainty on a problem. Each uncertain parameter within the model is represented by a
probability function. The shape and size of these distributions defines the range of values that the parameter may
take and their relative probabilities. Following hypothesis testing and investigation of the effect of a range of
control measures, through a series of time steps they can show the changes that take place in a population
between the present and some future time.

Simulation Model Evaluation of Control Programmes 439
Input frame
Choice form: average number of infective pigs
Enter value Calculate value
Set repetitions
Pre-simulation
Seed value to the programme
Input of control strategy
SIMULATION
Output choice
Economic output Disease graphs
Fig. 44.1. Form flow of the Taenia solium simulation program.
assigns the infection status of the host disease status and counts the number of
according to the length of each period (also infective tapeworms for the simulated day.
required as input). The routine adds 1 day to Two infective forms are considered to calcu-
tapeworm age and modifies the host disease late the infection potential for the simulated
status according to age limits. This algorithm day: the number of adult tapeworms and the
does not include a random process to deter- number of hosts with residual environmen-
mine the daily outcome. It only changes the tal contamination.

Porcine population component hence, there is a period of time during which

the infected pig remains negative to the EITB
The number of farrowings per day is a ran-
assay. Once a pig is infected, another lapse of
dom number drawn from a Poisson distribu-
time (90 days) is considered to allow the
tion. The input is the number of expected
cysts to develop to fully infective forms.
farrowings per day and the output is the
Finally, once treatment is administered, cysts
number of farrowings on the simulated day.
may remain viable for 28 days. If a pig with
Once the number of farrowings for the day is immature cysts is treated, the pig can be con-
set, the routine determines litter sizes with sidered free of infective forms immediately.
successive calls to the Poisson–Monte Carlo Change from one category to the other
algorithm. The routine then sets values to the depends on infection and/or time.
age and disease status of the piglet. Finally,
the routine assigns a sex to each piglet.
The mortality routine is called for every Human cysticercosis component
simulation day. The routine determines the The human cysticercosis component deter-
sex and age groups of each pig from the mines the number of new human cases. The
pig–age and pig–sex arrays respectively. component does not simulate evolution of the
Subsequently, the program assigns a daily disease, nor does it assign symptoms or any
mortality probability according to the age other related variable. The main objective of
and sex groups of the pig. The mortality or this component is to calculate the expected
survival outcome for each pig is then deter- number of new cases to assess the control
mined by a Monte Carlo procedure. strategy in terms of its impact on this variable.
The input for the routine, the expected num-
Swine cysticercosis component ber of cases per day, is calculated from the
number of exposed humans and the age
The swine cysticercosis component has two range of the exposed group. The number of
routines: one that simulates the number of new cases during the exposure period is equal
new cases, and another that simulates dis- to the human cysticercosis prevalence. The
ease evolution. The former simulates new routine uses the daily number of new cases as
infections using a Monte Carlo algorithm. the input for the Poisson routine, which
The simulation determines whether a pig is returns the number of cases for the day.
infected or not during the simulation day.
The disease evolution routine verifies the
Financial component
infection status of each pig and then changes
its variable values according to the period The financial component calculates the net
limits set in the input sub-module. There are financial benefit for the simulation. This
five infection states, depending on the infec- component is nested in the mortality routine.
tion and the presence of acquired or mater- The mortality routine identifies the age and
nally transferred antibodies (Fig. 44.2). sex of each pig and assigns the
Piglets become blot positive or negative mortality/offtake probability from a proba-
according to their mother’s serological stability array. Prices of pigs are organized in an
tus. If the sow is positive, the piglet will be array that has the same structure as the mor-
positive to antibody tests for a period of 8 tality/offtake array, therefore, the pig price
months (Armando E. Gonzalez, unpublished can be determined in the same algorithm. An
data). In this case, the enzyme-linked immu- additional line of code verifies if the pig that
noelectrotransfer blot (EITB) test detects anti- is about to leave is infected with visible cysts
bodies, regardless of whether the piglet is or not. Thus, every time that a pig leaves the
actually infected or not. Piglets, either with cohort, the routine is able to assign a gain
or without maternal antibodies, can be according to the age, sex and infection status
infected during the first 6 months of life. of the pig. Also, part of the financial compo-
Following acquired infection, it takes 15 days nent is nested in the control algorithm. Every
to produce detectable amounts of antibody7, time that a control procedure is simulated,

Positive sow Negative sow

Newborn pig
Uninfected pig 8 months

Uninfected pig
Blot positive (maternal Blot negative
antibodies)
Infection
Infected pig
Infection Blot negative
Immature cysts
15 days
Infected pig
Treatment Blot positive
Immature cysts
75 days
Treated pig Infected pig

Blot positive Blot positive
not infective Mature cysts
Treatment
Treated pig
28 days Blot positive
viable cysts
Status change due to event

Status change due to time
Fig. 44.2. Graphical description of the changes among disease status compartments.
the routine assigns a cost to the human or them. The objective of this particular vari-
porcine treatment. Costs and benefits are able is to coordinate human and porcine
added for every day of the simulation. At the strategies. Briefly, the component is run start-
end of the simulation period, a small routine ing from the date of the first intervention for
performs a net benefit analysis. the given number of human mass treat-
ments. The interval between interventions is
set to a default value, which can be modified.
Intervention component
The objective of the intervention component TAENIASIS CONTROL. The human control simu-
is to simulate mass taeniacidal treatment of lation component uses a Monte Carlo algo-
humans and/or anticysticercal treatment of rithm to simulate the outcome of the
pigs. This strategy is defined by the number intervention on an individual basis. Two key
of interventions and the interval between probability values can be identified in field

conditions. First, the likelihood of receiving Use of the Simulation Model

treatment, and second, the probability of
killing the tapeworm. For practical purposes, Input
the routine combines these two probabilities
in a single value, i.e., the probability of being Values used for biological parameters were
successfully treated on the intervention day. taken from available scientific literature. The
variables included, among others, incubation
SWINE CYSTICERCOSIS CONTROL. The routine periods, life span of the parasite and duration
used for swine cysticercosis control is similar of passive immunity. Population dynamics
to the one described for tapeworms and is and field-related variables were estimated
run for each pig in the village. If the pig is from a participatory rural appraisal (PRA)
treated, then the programme changes the exercise and a follow-up study (Armando E.
disease status and sets the appropriate vari- Gonzalez, unpublished data).
able values to treated pig values. Among
these variables, the one that counts the num-
Human population input
ber of days since the treatment is crucial.
Death of cysts does not occur immediately; it The number of humans considered as
takes 4 weeks to make the cyst viability exposed to cysticercosis was obtained from a
equal to zero8. The disease evolution compo- follow-up study whose data were used to
nent takes this fact into account, identifying validate the model. It was estimated that
the pig as treated and simulating the treat- approximately 2000 individuals were
ment effect over a period of time. exposed. Also, it was calculated that humans
are exposed to the disease for an average of
SEASONALITY. The effect of seasonality is con- 45 years (Hector H. García, Lima, Peru, per-
sidered for a number of events. It was con- sonal communication).
sidered that mortality, infection, price of pigs
and farrowing were affected by seasonal
Adult tapeworm and human taeniasis
variations. Seasonality input was entered in
variable arrays with 12 values, one for each A prevalence figure of 3% was used as input
month. A seasonality factor was then calcu- for human taeniasis. The pre-patent period
lated for each variable. was assumed to be 90 days and the average
life span of the adult tapeworm was
assumed to be 3 years. Strictly speaking,
Output module time to egg production follows a normal dis-
tribution, consequently, the use of a point
The graphical output presents the daily estimate may not accurately handle this vari-
gains, the number of tapeworms, rate of truly able. According to Allan9, human taeniasis
infected pigs (excluding maternally trans- incidence in a year was around one third of
ferred antibodies; called true cysticercosis total prevalence, thereby suggesting that the
prevalence), antibody prevalence, number of adult tapeworm had a shorter life span.
new porcine cysticercosis cases and total eco-
nomic gains for the day. The program stores
Porcine cysticercosis input
the values of these variables in memory
arrays and then plots them in different com- The porcine population input considered the
binations. The output combinations are age and sex of the pig. The number of piglets
selected in an output choice form. Steady- per litter used was estimated from PRA
state values for each day are also available, interviews. Swine cysticercosis prevalence
and can be plotted with simulation values. figure used as an input for the model was
The numerical output presents the results of 45%. The number of days to cyst maturity
the financial component. It also shows the was assumed to be 60 days10. The period of
final result for the number of new cases of time from treatment to zero-viability of cysts
human cysticercosis for the simulated period. was 28 days8.

Financial input Output

The discount rate used was 10%. The cost of
Output without intervention
treating a human against the adult tape-
worm with praziquantel entered was When no interventions were applied, there
US$1.6011,12. The cost of treating a pig with were small changes due to seasonal effects
oxfendazole entered was US$1.608. The price but otherwise the number of tapeworms and
of pigs by sex and age was estimated from cysticercosis prevalence remained more or
the PRA interviews and from previously less constant over time.
published literature13.
Mass treatment of human population
Seasonality factors Several mass human treatment protocols
Seasonality factors were determined from with different numbers of, and intervals
the follow-up study, PRA interviews and between, interventions were evaluated. For
from a pork marketing study in Huancayo, practical purposes, the number of interven-
Peru13. Seasonality effects were considered tions was limited to a maximum of 17 con-
for porcine mortality/offtake rate, infection secutive treatments. The model was then run
probability, prices of pigs and farrowing. for every period and number of interven-
tions. The input for both treatment coverage
and efficacy was set at 100%. The main out-
Control strategies puts evaluated were the numbers of adult
A set of control strategies was tested after tapeworms and the prevalence of actively
optimizing their effects against the parasite. infected pigs. Mass human chemotherapy
resulted in T. solium extinction in popula-
First, the effect of mass treatment of
tions when at least 11 interventions were
humans in controlling T. solium with sev-
made. The 90-days interval was the most
eral schemes using different coverage and
efficient strategy because it took less time to
interintervention periods was evaluated.
eradicate both forms of the cycle (Table 44.1;
The best approach was then further
Fig. 44.3a and b). Mass human chemother-
improved by adding intervention/s against
apy resulted in T. solium extinction in popu-
porcine cysticercosis.
lations when at least 11 interventions were
made. The 90-days interval was the most
Simulation input efficient strategy because it took less time to
eradicate both, adult and larval forms of the
The time period for simulation depended cycle (Table 44.1; Fig. 44.3a).
upon its objective. It was considered that Not surprisingly, the efficacy of mass treat-
simulating more than 67 months was less ment of humans depended upon the maxi-
likely to provide information that could be mum life expectancy of pigs. The control
used to design or evaluate a control pro- strategy blocked the transmission at the tape-
gramme. The simulation was run for a total worm level, not considering the intermediate
of 2000 days. The simulation model was host. Consequently, as long as there was the
designed to test the effect of different strate- small possibility of survival of an infected pig,
gies on T. solium populations. Therefore, the the disease could always be re-established.
main output of the model was devoted to The second variable evaluated for the human
document changes in adult and larval forms intervention was the human treatment cover-
over time in a graphical manner. This con- age. When human coverage was reduced
stitutes a limitation of the model since the from 100% to 90%, T. solium could not be
output does not allow direct quantitative eradicated from the area even after 17 inter-
comparison of two strategies. The final ventions. At 90% treatment coverage, 18 inter-
graph was made after averaging the daily ventions with 90-day intervals were required,
results of a number of repetitions. implying a total treatment period of 4.4 years.

Table 44.1. Results of different intervention schedules in humans, considering a treatment coverage of 100%.
Number of interventions until parasite extinction

Intervention
interval 8 9 10 11 12 13 14 15
40 No No No No No No No No
50 No No No No No No No No
60 No No No No No No No Yes
70 No No No No Yes
80 No No No No Yes
90 No No No Yes
100 No No No Yes
Mass treatment of human and porcine porcine population. The latter strategy
population required nine interventions in humans to
eliminate the parasite from both human and
It was observed that treating the human
porcine populations.
population alone was insufficient; the strat-
Evaluating control programmes based on
egy required 800 days, and involved a large
human and porcine populations with less
number of interventions and considerable
than 90% coverage gave disappointing results
cost and effort. Therefore, the effect of
adding pig treatment to human mass in terms of eradication of the parasite. The
chemotherapy was evaluated systematically. success of the different schemes was attrib-
Briefly, the starting point considered was 11 uted to the high coverage rates in either or
consecutive interventions in the human pop- both populations. However, a target coverage
ulation with a 90-day interval and a 100% of 100% is unrealistic since not all humans
human coverage. Then, a number of inter- accept the treatment and it is very difficult to
ventions in pigs were added, also assuming treat all the pigs. Besides, it is dangerous and
100% coverage and an interval of 90 days. culturally unacceptable to handle and treat
The addition of one intervention in the sows in the later weeks of pregnancy.
porcine population did not decrease the
number of human interventions (Fig.
Financial analysis
44.3c). However, the addition of two inter-
ventions in the porcine population reduced A partial financial analysis was made for the
the number of human interventions to simulated strategies. This financial analysis
three (Fig. 44.3d). Further increase in the was made considering two variables, sale of
number of porcine interventions did not pigs and cost of intervention. The analysis
improve T. solium control. took no account of financial or economic
Evaluation of the strategies that consid- costs of human cases. The present value, at
ered 100% coverage in the porcine popula- the first day of intervention, of pig sales and
tion and 90% in the human population cost was calculated. Table 44.3 presents the
demonstrated that intervening in both discounted benefit for the control strategies
humans and pigs decreased the total number over the 2000 days of the simulation. Only
of interventions in the human population. the most successful strategy, with three inter-
Table 44.2 presents the results of evaluating a ventions in humans and two interventions in
range of strategies to control T. solium. It was pigs resulted in a discounted benefit greater
found that intervening twice in the porcine than no intervention. One of the arguments
population with an interval of 180 days used to promote cysticercosis control was
decreased the required number of interven- that it would result in economic benefits for
tions in humans from 18 to 12 mass treat- the peasants. The results of the simulation
ments. This effect could be further enhanced, experiment contradict this argument, limit-
if five interventions were considered in the ing its scope to those strategies that success-

(a) 61 0.5
49 0.4
37 0.3
24 0.2
12 0.1
May 96 May 97 May 98 May 99 May 00

Simulation date
(b) 61 0.5
49 0.4
37 0.3
24 0.2
12 0.1
(c) 61 Simulation date 0.5
49 0.4
37 0.3
24 0.2
12 0.1

(d) 61 Simulation date 0.5
49 0.4
37 0.3
Number of 24 0.2
tapeworms
Cysticercosis 12 0.1
prevalence

Simulation date
Fig. 44.3. (a) Evolution of Taenia solium population after 11 interventions in humans (90-day interval;
100% treatment coverage). Simulation starts November 1995. (b) Evolution of T. solium population after
15 interventions in humans (50-day interval; 100% treatment coverage). Simulation starts November
1995. (c) Evolution of T. solium population after ten interventions in humans (90-day interval; 100%
treatment coverage) and one intervention in pigs (100% treatment coverage). Simulation starts
November 1995. (d) Evolution of T. solium population after three interventions in humans (90-day
interval; 100% treatment coverage) and two interventions in pigs (90-day interval; 100% treatment
coverage). Simulation starts November 1995.

Table 44.2. Effect of control strategies that considered mass treatment of human and porcine populations.
Human population treatment Porcine population treatment

(90% coverage) (90% coverage)
Number of Intervention Number of Intervention Success

interventions interval interventions interval in control
14 90 2 90 No
10 90 2 180 No
11 90 2 180 No
12 90 2 180 Yes
9 90 3 180 Yes
9 90 5 90 Yes
Table 44.3. Financial analysis of control strategies.
Interventions in the human population Interventions in the porcine population

Discounted
Coverage Number of Intervention Coverage Number of Intervention benefit
(%) interventions interval (%) interventions interval (UK£)
100 15 60 0 0 0 9,147.00
100 12 70 0 0 0 28,422.00
100 12 80 0 0 0 28,965.00
100 11 90 0 0 0 35,885.00
100 11 100 0 0 0 35,381.00
90 18 90 0 0 0 –1,160.00
100 3 90 100 2 90 91,720.00
90 12 90 100 2 180 53,834.00
90 9 90 100 3 180 54,245.00
90 9 90 100 5 90 54,595.00
No intervention 83,090.00
fully eliminate the parasite in the short-term. considered. Table 44.4 presents the estimated
Results of the benefit analysis also call into number of new infections of human cysticer-
question control programmes that depend cosis with different control strategies.
on the sustainability of the strategy. Although human neurocysticercosis repre-
Apparently, there were no benefits in the sents a severe disease, the symptoms depend
short and mid term, unless the strategy erad- not only on the infection burden, but also on
icated the disease within 6 months. the location of the cysts in the brain.
Consequently, control programmes that are Therefore, it would be difficult to simulate
unlikely to produce financial gains may severity of illness and ultimately, the effect of
result in failure to retain the confidence of disease on other economic variables that
the producers. It is recognized that this would be relevant to the economic appraisal
analysis disregards the long-term benefits of different control strategies.
(after 2000 days) that would accrue from par-
asite elimination from the pig population.
However, it is argued that possible benefits Limitations
more than 5 years in the future would be of
little interest to the people concerned. The most important finding of the use of the
A major disadvantage of using financial simulation model was that treating both
analysis to determine economical feasibility human and porcine populations had a
is that, their impact upon public health is not greater impact upon control of the parasite

Table 44.4. Expected number of new cases of human cysticercosis during the simulation period (2000 days).
Interventions in the Interventions in the

human population porcine population Number of
new cases
Coverage Number of Intervention Coverage Number of Intervention of human
(%) interventions interval (%) interventions interval cysticercosis
100 15 60 0 0 0 26.36
100 12 70 0 0 0 26.50
100 12 80 0 0 0 25.47
100 11 90 0 0 0 26.48
100 11 100 0 0 0 27.20
90 18 90 0 0 0 25.10
100 3 90 100 2 90 27.65
90 12 90 100 2 180 28.63
90 9 90 100 3 180 27.80
90 9 90 100 5 90 26.63
No intervention 27.60
than treating one population alone. The key age in order to treat effectively all infected
variables were treatment coverage and num- hosts. Another limitation of the simulation
ber of interventions. It was clear that lower model is that it does not consider additional
treatment coverage required more interven- measures that could have an impact on
tions and, therefore, demanded more time T. solium populations. Simulating the effect
and financial resources. A cut-off point of of additional measures against T. solium also
80% coverage for human and porcine popu- requires quantitative estimates of the impact
lations was therefore established. The omis- of such measures. The direct and indirect
sion of human and pig movements into the effect of other measures, such as education
population excluded the possibility of rein- or vaccination, is still in debate. Assuming a-
troduction of parasite during an eradication priori parameter values and event proce-
programme. However, in practice, it would dures to simulate the effect of any measure
be pointless to attempt the elimination of without previous knowledge could jeopar-
parasites from a single community that is dize the focus of the model. In addition, the
surrounded by more infected communities. simulation model was designed to provide
Therefore, the model is appropriate for the information of control strategies in the short
evaluation of parasite elimination strategies and medium term. Although measures such
at the community level, only in the context as health education and improvement of
of a wider programme of control involving sanitary infrastructure have an important
multiple communities. effect on T. solium, these measures are more
The presence of clusters of T. solium infec- likely to be implemented within a long-term
tions has been documented in the past14,15. integral development plan for rural com-
However, simulating the events that deter- munities rather than as specific actions
mine these clusters may obstruct rather than against T. solium.
assist the interpretation of the simulation
output. The main factors that determine the
presence and nature of infection clusters are Conclusions
human behaviour and the management of
pigs. The simulation of activities related to A description of the major factors that regu-
those factors is beyond the scope of this late T. solium and its relationship to porcine
model. Infection clusters represent the productions systems is crucial to an under-
worst-case scenario for control programmes, standing of the transmission dynamics and
because they require high treatment cover- thus to the planning of control programmes.

A simulation model that includes porcine, but also to define the benefits and costs for
human and tapeworm populations will the institution or community applying the
assist in this goal. An economic component control16. A number of schedules with vari-
in this model can produce estimates of the ous combinations and durations of human
financial impact of the disease, and help to and porcine treatment were evaluated in a
quantify the costs of control measures simulation model. Mass human chemother-
through cost–benefit analyses, considering apy alone proved insufficient to eradicate T.
not only effects on human and animal solium. Concurrent human and porcine treat-
health, but also economic optimization. ment was more effective in terms of control
When predicting the impact of any control of T. solium. None of the interventions was
intervention on cestode populations, there is economically more advantageous than no
a need not only to consider how effective the intervention, emphasizing that the core
measure will be in epidemiological terms, problem is economic.
References
1. Murrel, K.D. (1991) Economic losses resulting from food-borne parasitic zoonosis. Southeast Asian
3. McLeod, A. (1993) A model for infectious diseases of livestock. PhD thesis. University of Reading,
Reading, UK.
4. Vose, D. (2000) Risk Analysis. A Quantitative Guide, 2nd edn. John Wiley & Sons, New York, 417 pp.
5. Evans, J.R., Olson, D.L. (1998) Introduction to Simulation and Risk Analysis. Prentice Hall, Englewood
Cliffs, New Jersey, pp. 279.
6. Gemmell, M. (1996) Current knowledge of the epidemiology of the family Taeniidae: operational
research needs in planning control of Taenia solium. In: García, H.H., Martínez, M. (eds)
Taeniasis/Cisticercosis por T. solium. Editorial Universo, Lima, Peru, pp. 231–258.
7. Roth, J.A. (1992) Immune system. In: Leman, A.D., Straw, B.E., Mengeling, W.L., et al. (eds) Diseases
of Swine. Iowa State University Press, Ames, Iowa, pp. 21–39.
9. Allan, J.C. (1996) Detection of Taenia solium antigens in faeces. In: García, H.H., Martínez, M. (eds)
Taeniasis/Cisticercosis por T. solium. Editorial Universo, Lima, Peru, pp. 327–340.
10. Craig, P., Rogan, M., Allan, J. (1996) Detection, screening and community epidemiology of taeniid
cestode zoonoses: cystic echinococcosis, alveolar echinococcosis and neurocysticercosis. Advances in
11. Gilman, R.H., García, H.H., Gonzalez, A.E., et al. (1999) Shortcuts to development: methods to con-
trol the transmission of cysticercosis in developing countries. In: García, H.H., Martínez, M. (eds)
Taenia solium Taeniasis/Cysticercosis. Editorial Universo, Lima, Peru, pp. 313–326.
12. Gilman, R.H., García, H.H., Gonzalez, A.E., et al. (1996) Métodos para controlar la transmision de la
cisticercosis. In: García, H.H., Martínez, M. (eds) Taeniasis/Cisticercosis por T. solium. Editorial
Universo, Lima, Peru, pp. 327–340.
13. Cysticercosis Working Group in Peru. (1993) The marketing of cysticercotic pigs in the Sierra of
15. García, H.H., Gilman, R., Gonzalez, A.E., et al. (1996) Epidemiología de la cisticercosis en el Perú. In:
García, H.H., Martínez, M. (eds) Taeniasis/Cisticercosis por T. solium. Editorial Universo, Lima, Peru,
pp. 313–226.
16. Roberts, M.G. (1994) Modeling of parasitic populations: cestodes. Veterinary Parasitology 54, 145–160.
17. Dijkhuizen, A.A., Stelwagen, J., Renkema, J.A. (1986) A stochastic model for the simulation of man-
agement decisions in dairy herds, with special reference to production, reproduction, culling and
income. Preventive Veterinary Medicine 4, 273–289.

Singh - Index 17/9/02 12:02 pm Page 449
Index
Acacia nilotica 165 Albendazole sulphone

Acquired immune deficiency syndrome 105, metabolism 369
281–283 structure 368
Adnexal cysticercosis 270 Albendazole sulphoxide
Albendazole chiral behaviour 369
absorption 369 elimination 369
administration in half-life 369
active neurocysticercosis 378 in children 369
cysticercal clumps 378 metabolism 369
cysticercotic encephalitis 190 structure 368
extraocular myocysticercosis 275 Amyotrophic lateral sclerosis 231
giant racemose cysticercosis 184, 379 Angiography 182, 221–222, 224–225, 312, 314
heavy multilesional neurocysticercosis 191, Animal models
376 adult T. solium 35–36
intraventricular neurocysticercosis 184, intramuscular oncosphere assay 79, 153–154
205–206, 379 T. solium cysticercosis
meningeal cysticercosis 205–206, 379 in mice 27–29
multiple parenchymal cysticercosis 376 natural infection 36
paediatric neurocysticercosis 260 in pigs 36
porcine cysticercosis 432–433 T. crassiceps cysticercosis 36–38
pregnancy 285, 371 establishment of 38–39
single small enhancing CT lesions 247, 248, hereditary factors in 59–60
254, 377–378 immune responses in 18–19, 37–38,
solitary cysticercus granuloma see single 40–42
small enhancing CT lesions in Qa-2 transgenic mice 59–60
spinal cysticercosis 234 intracranial 38–42
taeniasis 415 intraocular 36–37
adverse reactions 371 intraperitoneal 38
dosage 371, 380, 381 major histocompatibility complex in
interactions with 59–60
cimetidine 370 sex hormone interactions 38
dexamethasone 370, 380, 381 Mesocestoides corti cysticercosis
food 369–370 hosts 38
praziquantel 370 immune responses in 40–42
mechanism of action 368 neurocysticercosis
structure 367–368 immune responses in 40–42
449

450 Index
Animal models continued Canine cysticercosis 113

T. saginata asiatica Canine tapeworm 2
in NOD SCID mice 48 see also T. hydatigena, T. ovis, T. pisiformis
Anterior chamber ocular cysticercosis 271, 275 Carbon tetrachloride 165
Anticysticercal drugs see Albendazole, Praziquantel Cauda equina syndrome 181, 231
Antibodies CD4+ cells 16–18, 26, 31–32
to metacestode factor 29 CD8+ cells 16–18, 31–32
to metacestode proteases 31–32 Cellular layer 290
monoclonal, to diagnostic antigens 343–347 Cerebral palsy 259
polyclonal, to diagnostic antigens 343–347 Cestocidal therapy see Albendazole, Niclosamide,
transplacental transfer of 79, 146
Oxfendazole, Praziquantel
see also immunoglobulins, 324–338, 343, 440
Cestodaria 1
Antigens
Charaka Samihita 158
antigen B see Paramyosin
Childhood neurocysticercosis see Paediatric neuro-
in diagnostic use
adult Taenia see Coproantigen detection cysticercosis
glycoproteins 330–331 Chinchillas 36, 426
in antigen ELISA 343–347 Chlorpheniramine 382
crude extract 344 Choreoathetosis 236–237
HP10 345 Colloidal stage
H7 344 CT 315, 323
1F11 344 MRI 320, 321, 323
4F8 344 pathology 292, 294, 295, 307, 308, 311, 323
HP12 347 Communicating cysticercosis 271, 273, 274
in porcine cysticercosis 147–148 Complement 20, 26
synthetic 333–335 Compulsory notification 107
surface 336–337, 347 Computed tomography (CT) 313–318, 323
from T. crassiceps 333 cysticercotic encephalitis 190, 316
excretory–secretory 2, 25, 147, 336, 337–338 disseminated cysticercosis 193–194
for vaccination extradural spinal cysticercosis 230
from T. ovis 424, 426 heavy non-encephalitic neurocysticercosis 191
from T. crassiceps 424, 425, 426 intraventricular neurocysticercosis 202, 316,
from T. saginata 424 318
recombinant 426 meningeal cysticercosis 181–182, 316–318, 319
Antigen ELISA see Antigens ocular cysticercosis 274
Arachnoiditis see Meningeal cysticercosis
pseudomuscular hypertrophy 193–194
Areca catecho 165
racemose cysticercosis see Meningeal cysticer-
Arteritis 179, 180, 201, 222, 224, 292, 297–298, 302,
cosis
312
sellar cysticercosis 235
Asian Taenia see T. saginata asiatica
Astrocytes see Astrocytosis single small enhancing CT lesions 252–25
Astrocytosis 298 Control
Asymptomatic cysticercosis 15, 18, 25, 105, 378, with health education see Health education
415 with human taeniacidal therapy 11, 88,
Atarabine 165 411–417, 431, 443–446
Ataxia 201, 236–237 with porcine chemotherapy 412, 432–434,
Atheroma 297 444–446
Attention deficit 265 simulation of 438–446
with vaccination see Vaccination, 411, 412
Conus medullaris syndrome 231, 233
B lymphocytes 40 Coproantigen detection 336–337
see also Plasma cells Coproparasitological examination see Stool exami-
Blasenwürmer 160
nation
Blepharospasm 237
Corticosteroids
Brucella militensis 284
interactions with anticysticercal drugs 366,
Brun’s syndrome 237
370, 380, 381
administration in
Calcareous corpuscles 290, 308, 309, 312 cysticercotic encephalitis 190, 376–377, 381
Calcified cysticercus 105, 312, 313 disseminated cysticercosis 195

Index 451
heavy multilesional neurocysticercosis 191 330, 333, 360–361

hydrocephalus 184–185, 381, 390 vaccination, effect of 423
intraventricular cysticercosis 184 Enzyme-linked immunoelectrotransfer blot-
ocular cysticercosis 275, 276, 277 taeniasis (EITB-T) 338
spinal cysticercosis 232, 234 ELISA 331–333, 359–360
Cranial nerve palsies 169, 178, 181, 190, 302 in cerebrospinal fluid 332, 343–345, 359–360
Cucurbitini 157–158 in children 259
Cuticular layer 290 in community surveys 107–108, 113, 333,
Cysticercotic encephalitis 173, 189–190, 302, 316, see also Epidemiology
376, 394, 396 comparison with EITB 87, 332–333, 359–360
Cysticercus bovis 2 in intraventricular neurocysticercosis 202
Cysticercus cellulosae in meningeal cysticercosis 183
development 2, 5, 9–10, 25–26 in porcine cysticercosis 145–146
morphology 2–3, 9–10, 177–178, 290–291, 307 in saliva 332
Cysticercus tenuicollis 147–148 in serum 121, 332
Cysticercus racemosus see Meningeal cysticercosis in single small enhancing CT lesions 247, 333,
360–361
soluble antigens in 335
Delirium 265 Encapsulated cysticercosis 300
Dementia 169, 170, 175, 192–193, 263, 264, 265–266 Endoscopic approach 400–408,
Dendritic cell 40 see also 204–205, 388, 390, 394
Dexamethasone see Corticosteroids Eosinophil 15, 18, 27, 37, 178, 296, 308
Diabetes insipidus 235 Eotaxin 18
Disseminated cysticercosis 192–195, 376–377 Ependymitis 201, 204, 298, 299, 302, 312, 389, 390,
DNA extraction see Polymerase chain reaction 391
DNA probes 354 Epidemiology
DNA vaccines 426 human cysticercosis
Dog cysticercosis see Canine cysticercosis in Africa 134–135
Dot blot assay 5 in Argentina 65, 69
Dryopteris filix 165 in Bali 113
in Benin 65, 131, 133
in Bolivia 64, 67
Echinococcus granulosus 332, 417 in Brazil 107–108
Economics in Burundi 131, 133–134, 347
of porcine cysticercosis 9, 150–151, 440–441, in Cambodia 114
444–446 in Cameroon 131, 133
Eggs in Central African Republic 131, 133
environmental distribution 75–76, 148, 416, in Cheju Island 120
438–439 in China 65, 118
morphology 5, 8–9, 336 in Ecuador 64, 67, 416
survival 9 in Europe 66
Enzyme-linked immunoelectrotransfer blot (EITB) in Guatemala 64, 67, 94, 95, 96, 417
anticysticercal treatment, effect of 331
in Honduras 64, 67, 94, 95, 96, 258
in calcified cysticercosis 330, 333, 359–361
in India 116–117
in cerebrospinal fluid 330
in Irian Jaya 65, 70, 113–114, 411
glycoproteins in 330
in Japan 65
in family contacts 117, 258, 360–361
in intraventricular neurocysticercosis 202, in Jewish community of New York
330–331 130–131, 141–142
in meningeal cysticercosis 183 in Kenya 131
prevalence in children 257–258 in Korea 65, 121
prevalence in CT unit 78, 212, 331 in Laos 114
prevalence in community 333, in Madagascar 65, 131, 133–134
see also Epidemiology in Mexico 66–67, 85–87, 89, 347, 416
in porcine cysticercosis 76, 79, 85, 148–150 in Nicaragua 96
in saliva 332 in Norway 69
sensitivity of 16, 330–331 in Pakistan 65
in single small enhancing CT lesions 16, 247, in Panama 64, 96

452 Index
Epidemiology continued Glia see Astrocytosis

human cysticercosis continued Gliosis see Astrocystosis
in Papua New Guinea 70, 113–114 Granular nodular stage
in Peru 64, 67, 76–77, 94, 213, 257–258 CT 315, 316, 323
in Philippines 65, 113 MRI 320, 322, 323
in Senegal 65 pathology 292, 294, 295, 307, 308, 311, 323
in South Africa 65, 131, 133, 134 Granuloma 296, 302
in Spain 69
in Togo 131, 132–133
in Uruguay 65 Headache 107, 132, 169, 190, 200–201, 223, 247
in United States 69, 70 Health education 88, 411, 412, 417, 431
in Vietnam 65, 113 Heat shock protein 42
porcine cysticercosis Heavy non-encephalitic cysticercosis 191
in Bali 113 Histology of
in Brazil 102 calcified cysticercus 312
in Burundi 134 cysticercus 290–296, 307
in Guatemala 97 inflammatory reaction 27–29, 294, 296, 297
in Honduras 97 parenchymal cysticercosis 302
in Indonesia 113 Historical contribution of
in Irian Jaya 113 Aristophanes 157
Aristotle 63, 157
in Korea 121
Carl Linnaeus 139, 158
in Mexico 85, 87
Freidrich Küchenmeister 63, 160
in Philippines 114
Johann Goeze 139, 158–159
in Peru 70, 75–77, 79
Hamilton Fairley 160, 165
in Tanzania 65–66
Henry B.F. Dixon 160, 162–164, 165–166
in Togo 134
Rudolph Leuckart 158–159
seizures 211–213, 259
Rudolph Virchow 160–16, 177, 302
taeniasis
van Benden 158
in Bolivia 67
Verster 2
in Central American immigrants 92, 142
Vosgien 160
in China 118, 414 William P. MacArthur 160, 162–164, 165–166
in Ecuador 67 Yoshino 8, 9
in Guatemala 67, 69, 91–92 Hooklets 291
in Honduras 67, 92 Human immunodeficiency virus 281–283
in Brazil 102 Human leucocyte antigens
in Burundi 133–134 in human neurocysticercosis 59
in Indonesia 112–113 in single small enhancing CT lesions 57–59
in Irian Jaya 112–113 Hyaline degeneration 291, 297
in Latin America 67 Hydrocephalus
in Korea 118, 120 corticosteroids in 184–185, 381, 390
in Mexico 67, 69, 83–85, 87 incidence 169
in Papua New Guinea 112 in intraventricular neurocysticercosis 200–202,
in Peru 69–70, 76–77 207, 302, 316, 387, 388, 393–394
in Togo 134 in meningeal racemose cysticercosis 179, 181,
Excretory–secretory products see Antigens 184–185, 387
Exophthalmos 235 medical treatment of 185, 390
Extradural spinal cysticercosis 229–230 outcome 396
Extraocular myocysticercosis 270–271 septum pellucidotomy in 405
treatment of 275 shunt occlusion in 185, 390, 396
Extrapyramidal syndrome 236–237 surgical treatment of 184–185, 204–205, 389–394
Torlkidsen’s procedure for 388, 391
ventriculography in see Ventriculography
Foreign body giant cells 296, 308
ventriculoperitoneal shunts for 184–185,
204–205, 389–394
Gamma-delta T cells 40–42 ventriculostomy for 204, 388, 390, 400, 405
Geographic information system (GIS) 151–152 Hymenolepis nana 19, 25, 332, 337

Index 453
Iridocyclitis 271 GP 13 330–331

Immunity GP 14 330–331
cellular 16–18 GP 18 330–331
humoral 16–17 GP 21 330–331
concomitant 19 GP 24 330–331
evasion of 19–20, 25–32 GP 39–42 complex 330–331
molecular mimicry in 20 Leukaemia see Neoplasia
suppression of 20 Lid cysticercosis 270, 275
in taeniasis 421 treatment of 275
vaccination, role in 20, 422 Lingual cysticercosis 170, 237
Immunoblot 53, 113, 335, 343–345, 360 Lymphocyte 15, 26–27, 29, 178, 290, 296, 308
Immunoelectrophoresis 16, 87
Immunoglobulins 16, 17, 19, 20
Immunologically privileged sites 19 Macrophage 15, 17, 29, 296, 308
Indirect haemagglutination assay 87, 107, 337 Magnetic resonance imaging (MRI) 318–324
Interferon-gamma 16–18, 29, 37, 40–41 cysticercotic encephalitis 190
Interleukins 16–18, 20, 29, 37, 40–41 heavy non-encephalitic neurocysticercosis 191
Intracorporeal vacuoles 291, 308 intradural extramedullary spinal cysticercosis
Intracranial hypertension 232
in cysticercotic encephalitis 189–190 intramedullary spinal cysticercosis 233–234
in heavy non-encephalitic cysticercosis 191 intraventricular neurocysticercosis 202, 204,
320
incidence in 105, 132, 169, 170, 175, 179, 259
meningeal cysticercosis 181–182, 320, 322
in intraventricular neurocysticercosis 201
ocular cysticercosis 274
in meningeal cysticercosis 179, 180
racemose cysticercosis see Meningeal cysticer-
surgical treatment of 387–394
cosis
Intradermal test 337
sellar cysticercosis 235–236
Intradural extramedullary spinal cysticercosis
single small enhancing CT lesion 246, 252–253
229–233, see also 181, 182, 233, 302
stroke 182, 225
Intramedullary spinal cysticercosis 229, 232–234
Magnetic resonance spectroscopy 324–325
Intramuscular oncosphere assay see Animal models
Magnetization transfer MRI 321, 322, 324
Intraventricular neurocysticercosis 199–206
Major histocompatibility complex
CT in 316, 318 in single small enhancing CT lesions see
EITB in 330–331 Human leucocyte antigen
ELISA in 202 in human neurocysticercosis see Human leuco-
endoscopic treatment see Endoscopic approach cyte antigen
MRI in 320 in experimental T. crassiceps cysticercosis 59–50
pathology 302 Mast cell 40
pipette suction in 393–394 Meat inspection 146, 412, 422
surgical treatment of 389–394 in Africa 148
Intravitreal cysticercosis 271–272 in Brazil 102
treatment of 276–277 in Central America 68, 96–97
in Korea 121
in Mexico 68, 85
Japanese B encephalitis 283–284 in Peru 68, 151–153
Meningeal cysticercosis 177–185
arachnoiditis 223, 232, 389, 390, 391
Ketoprofen 382 ataxia in 236–237
basal meningeal cysticercosis 300–301
cortical meningeal cysticercosis 295, 298, 300
Lacunar syndromes 180, 221, 222 CT in 316–318
Landau Kleffner’s syndrome 236 meningitis in 297, 301–303
Latex agglutination 343 MRI in 319–320, 322
Lennox Gastaut syndrome 259 pathology 295, 298–304
Lentil lectin bound-glycoproteins 330–331, 335, surgical treatment of 388–395
359 Meningitis see Meningeal cysticercosis
cDNA to 333–334 Mental retardation 259

454 Index
Mesocestoides corti see Animal models Ova see Eggs

Metacestode factor 26–29, 30 Ovary (of Taenia sp.) 2–5
Metacestode proteases 29, 31–32 Oxfendazole
Metacestodes dosage 433
development see Cysticercus cellulosae in porcine cysticercosis 433–435, 444, 446
morphology see Cysticercus cellulosae structure 433
of T. saginata 2–3
of T. saginata asiatica 2–3
Paediatric neurocysticercosis 257–260
of T. solium 2–3
Panhypopituitarism 235
Mini-mental state examination 265–266
Paramyosin 20, 26
Mitochondrial genome Pars plana vitrectomy 276–277
cestodes 49–53 Persisting lesions 244, 252–253, 254
platyhelminthes 49–53 Phase MRI 324
T. solium 49–53 Photocoagulation 276–277
polymorphisms in 50–51 Phylogeny
specimen collection for 52 of cestodes 1–2, 47–48
Mood disorder 263, 265–266 T. saginata asiatica 1–2, 47–48
Mycotic aneurysm see Subarachnoid haemorrhage T. solium 1–2, 47, 49–52, 158–160
Myelography 182, 232 Pig husbandry 411, 412, 422, 440
Myoclonus 236 Pig population
in Brazil 102
in China 117
National Epidemiological Surveillance (in Mexico) in India 116
83–85, 85–86, 88 Plasma cells 15, 17, 27, 308
Neoplasia Polymerase chain reaction 351–355, 357–358
central nervous system 285–286 Pork markets
haematological 20, 283, 285 in Peru 151–152, 433, 440–441
Neurocysticercosis Pork tapeworm see T. solium
active 172, 199 Post-ictal lesions 243
anatomical classification 172 Positron emission tomography 324
diagnostic criteria 170–171 Praziquantel
evolutionary classification 172–173, 199, absorption 364
291–295, 311–312, 313–315, 318–320, 323 adverse reactions 366
geographic variations in 174 administration in
inactive 172–173, 199 active neurocysticercosis 378
surgical classification 171–172, 388, 396 cysticercotic encephalitis 190, 376–377
transitional 172, 199 disseminated cysticercosis 194, 376
Neutrophils 27, 37, 308 giant racemose cysticercosis 184, 379
intraventricular neurocysticercosis 205
NK cells 40
meningeal cysticercosis 379
Niclosamide
ocular cysticercosis 275
dosage 415
occult neurocysticercosis 15, 18, 25, 105,
for mass chemotherapy 415, 417
378, 415
structure 415
paediatric neurocysticercosis 260
Nodular calcified stage
porcine cysticercosis 432
CT 312, 315, 317, 323
taeniasis 88, 378, 414, 415–418, 431, 443–446
MRI 320, 323 bioavailability 365
pathology 296, 307, 311, 323 distribution 364–365
dosage 367
duration of treatment 367, 380–381
Ocular cysticercosis 132, 139, 170, 269–278 elimination 364–365
experimental see Animal models interactions with
Omphalia lapidescens 165 albendazole 370
Onchocerciasis 132 carbamazepine 366
Oncosphere cimetidine 366–367
morphology 2–5, 9 dexamethasone 366, 380, 381
penetration of 25 food 365
Optochiasmatic cysticercosis 178, 180 phenytoin 366

Index 455
mechanism of action 364 Schizophrenia 263

metabolism 364–365 Scolex
pharmacokinetics 364–365 T. saginata 2–5, 290–291
in liver disease 365 T. saginata asiatica 2–5
range of action 363–364 T. solium 2–5, 290–291, 336
structure 363–364 Seizures 211–218, 251–255
single day treatment 367, 380 antiepileptic drugs in 216–217, 241, 246, 247,
therapeutic regimens 367 253–254, 260, 283, 285
use in children 260, 367 electroencephalography in 214–215
use in pregnancy 285, 366 effect of anticysticercal treatment 215–217, 247,
Prednisolone see Corticosteroids 254, 379
Pregnancy 284–285 EITB in 211–212, 213
Prevalence epidemiology of 211–213, 259
human cysticercosis hippocampal atrophy in 215, 236
at autopsy 66, 85, 93–94, 96–97, 103–105, in meningeal cysticercosis 181
116, 130, 289 incidence 107, 113, 131, 169, 175, 192, 212, 251
CT based 78, 93, 95–96, 103, 107, 113, 117, 331 in intraventricular neurocysticercosis 200
in epilepsy see Seizure disorder mesial temporal sclerosis in 215, 236
gender, effect of 92 outcome 216–219, 246, 247, 254–255
hospital based 66, 77–78, 130, 213 Sellar cysticercosis 234–236
longitudinal study of 77 Sentinel pig model 149–150
in neurological disorders 77–78, 79, 121, Seroprevalence see Epidemiology
132
Single small enhancing CT lesions 241–248
in seizure disorders 67–68, 78, 96, 113, 121,
aetiology 174
131–132, 213
antiepileptic drugs in 241, 248, 252, 253–254,
serological see Epidemiology
377–378
taeniasis
albendazole in 247, 248, 254, 377–378
age, effect of 69, 91, 93, 257
CT in 252–253
with antigen assays 147
gender, effect of 69, 83, 93 calcified 253
at necropsy 66, 67 in children 259
in neurocysticercosis 79, 142, 191, 192 diagnostic criteria 252
see also Epidemiology EITB in 247, 330, 333, 360–361
porcine cysticercosis ELISA in 247, 333, 360–361
age, effect of 79 enlarging 246–247, 248
at necropsy see Meat inspection genetic factors in 57–60
serological 67, 70, 75–77, 79, 85, 87, 148, headache in 247
see also Epidemiology hereditary factors in see Genetic factors in
by tongue examination 66, 67, 79, 85, 87, human leucocyte antigen in see Human leuco-
145, 148, 423 cyte antigen
Proglottides incidence 251, 311
structure in international literature 245, 251
T. saginata 2–5, 336 MRI in 246, 252–253
T. saginata asiatica 2–5 outcome 254–255
T. solium 2–5, 336 pathology 243, 251–252, 307–309
Pseudomuscular hypertrophy 192–195 persisting lesions 244, 252–253, 254
Psychiatric disorders post-ictal 243
incidence 264 prognosis 254–255
treatment of 265 seizures in 246, 252–253
tuberculoma as 241–242, 309
Single small enhancing lesions see Single small
Queen Alexandria Military Hospital 160–166
enhancing CT lesions
Skull roentgenogram 162–163, 312, 313
Racemose cysticercosis see Meningeal cysticercosis Slaughterhouse inspection see Meat inspection
Raigan 165 Soft tissue roentgenogram 162–163, 193, 195,
Renal transplant 283 312–313
Reticular layer 290 Solitary cysticercus granuloma see Single small
Rodent tapeworm see T. crassiceps enhancing CT lesions

456 Index
Spinal cysticercosis natural 5

incidence 175, 229 life cycle of 5–10
in meningeal cysticercosis 181 life span 8
see also Extradural cysticercosis, Intradural morphology 2–5, 336
extramedullary cysticercosis, mitochondrial genome 49–53
Intramedullary cysticercosis phylogeny of 1–2, 41, 49–52
Stereotactic approach 243, 393 reproductive potential 9, 10, 413, 438
Stool examination 2–4, 336 reproductive system 7–8
Strobila 5–7 taeniacidal therapy 414–417, 431, 443, 445
Stroke 221–226 treatment see above
angiography in 182, 312, 314 vaccination 421
arteritis in 179, 180, 201, 292, 297–298, 302, 312 T. taeniaeformis 2
in meningeal cysticercosis 180 Taeniaestatin 8, 26
incidence in 175 Taeniidae 1, 2
Subarachnoid cysticercosis see Meningeal cysticer- Taxonomic status
cosis of T. saginata asiatica see Phylogeny
Subarachnoid haemorrhage 180, 222, 224 of T. solium see Phylogeny
Subconjunctival cysticercosis 270, 271, 274, 275 of Taeniidae see Phylogeny
Subcutaneous nodules 65, 117, 121, 132, 192–193 Testes 7
Subretinal cysticercosis 271–272 Thalamomesencephalic syndrome 180, 222
treatment of 276–277 Th1 response 16–19, 37, 40–42
Sudden death 237 Th2 response 16–19, 37, 40–42
Synthetic TS 14 (sTS14) 335 The Cysticercosis Working Group in Peru 75–80,
Synthetic TS 18 (sTS18) 335 382–38
Syringomyelia 231, 302 Three-dimensional constructive interference MRI
324
Thymol 165
T lymphocytes 16–18, 37, 40–42, Toxoplasmosis 281, 284
see also CD4+ cells, CD8+ cells Transcranial Doppler 226
T2* MRI 320 Transmission
T. crassiceps 2, 36–42, 59–60, 282, 333, 424, 425, 426 of cysticercosis 9, 68–70, 130, 162
T. hydatigena 2, 148, 160 imported disease 69–70, 121–122, 140, 141
T. saginata introduced disease 69, 70, 111–114
antigens 424 risk factors 68–70, 87–88, 102, 112, 130,
coproantigen detection in 336–337 211–212, 413–414
differences from T. solium 2–5 through flies 87–88
morphology 2–5 through fruits 87–88
speciation 2 through household contacts 141–142, 258,
T. saginata asiatica 414
differences from T. solium 2–5 through immigrants 51, 69–70
in NOD SCID mice 48 through water 9, 130
morphology 2–5 Trapped ventricle 324, 391
speciation 2, 47–48 Traubenhydatiden 160, 177, 300, 302
T. pisiformis 2, 160 Tuberculoma 241–242, 309
T. multiceps 2 Tumour necrosis factor-alpha 18, 29
T. ovis 2, 424, 426 Tumour necrosis factor-beta 16, 17
T. solium
antigens 424–426
coproantigen detection in 336–337 Ultrasound 273, 274, 275
developmental stages 5–10
EITB-T 338
immune responses in 15, 21, 421 Vaccination
immunodiagnosis 336–338 cysticercosis 20, 411, 412, 422–427
intradermal test in 337 DNA 426
hosts in field studies 424–427
experimental 5 preparation of 424, 425–426

Index 457
protective 422, 424, 426–427 Vesicular stage

recombinant antigens in 426 CT 311, 314, 315, 323
therapeutic 422, 423–424 MRI 318, 319, 323
taeniasis 421 pathology 291, 292, 294, 295, 307, 333
Vagina 2–4, 7
Vasculitis see Arteritis Wandtafeln 158–159
Ventriculography 312, 314, 316, 318, 389, 390


2002 Null

Uploaded by

Copyright:

Available Formats

You might also like

2002 Null

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

2002 Null

Uploaded by

Copyright:

Available Formats

Singh - Prelims 17/9/02 12:00 pm Page i

Taenia solium Cysticercosis

From Basic to Clinical Science

Downloaded from https://cabidigitallibrary.org by 223.255.231.132, on 03/21/24.

Taenia solium Cysticercosis

From Basic to Clinical Science

Dayanand Medical College & Hospital Ludhiana

Downloaded from https://cabidigitallibrary.org by 223.255.231.132, on 03/21/24.

CABI Publishing is a division of CAB International

CABI Publishing CABI Publishing

Tel: +44 (0)1491 832111 Tel: +1 212 481 7018

© CAB International 2002. All rights reserved. No part of

Library of Congress Cataloging-in-Publication Data

ISBN 0 85199 628 0

Typeset in Palatino by Columns Design Ltd, Reading, UK

Downloaded from https://cabidigitallibrary.org by 223.255.231.132, on 03/21/24.

1. Taenia solium: Basic Biology and Transmission 1

7. Taenia solium Cysticercosis: an Overview of Global Distribution and

9. Epidemiology of Taenia solium Taeniasis and Cysticercosis in Mexico 83

17. Neurocysticercosis: an Overview of Clinical Presentations 169

Downloaded from https://cabidigitallibrary.org by 223.255.231.132, on 03/21/24.

29. Neurocysticercosis: Diagnosis and Treatment in Special Situations 281

30. The Pathology of Neurocysticercosis 289

32. Imaging and Spectroscopy of Neurocysticercosis 311

37. Pharmacology of Anticysticercal Therapy 363

Downloaded from https://cabidigitallibrary.org by 223.255.231.132, on 03/21/24.

Svetlana Agapejev, Department of Neurology and Psychiatry, PO Box 540, School of

Downloaded from https://cabidigitallibrary.org by 223.255.231.132, on 03/21/24.

Downloaded from https://cabidigitallibrary.org by 223.255.231.132, on 03/21/24.

Seppo Meri, Department of Bacteriology and Immunology, Haartman Insitute, PO Box 21

Downloaded from https://cabidigitallibrary.org by 223.255.231.132, on 03/21/24.

Downloaded from https://cabidigitallibrary.org by 223.255.231.132, on 03/21/24.

© CAB International 2002. Taenia solium Cysticercosis

AED antiepileptic drug

Downloaded from https://cabidigitallibrary.org by 223.255.231.132, on 03/21/24.

Downloaded from https://cabidigitallibrary.org by 223.255.231.132, on 03/21/24.

1 Taenia solium: Basic Biology and

Introduction would take time in several developing coun-

Downloaded from https://cabidigitallibrary.org by 223.255.231.132, on 03/21/24.

Downloaded from https://cabidigitallibrary.org by 223.255.231.132, on 03/21/24.

Characteristic T. solium T. saginata T. saginata asiatica

Site Brain, skin, muscle Muscle, viscera Liver (exclusively)

Number of proglottides 700–1000 c. 2000 260–1016

(h) (i) (j)

Downloaded from https://cabidigitallibrary.org by 223.255.231.132, on 03/21/24.

Basic Biology and Transmission 5

support speciation of T. saginata asiatica as a Stages in Development of T. solium

Downloaded from https://cabidigitallibrary.org by 223.255.231.132, on 03/21/24.

Stages Habitat Number Time

**Human cysticercosis around a carrier

1. Preadult Gut One 2 months

2. Adult Gut One In years

3. Eggs Soil, water, 300,000 per day One year

Transmission of human cysticercosis

4. Oncosphere Gut / tissue One–several 2 days

5. Post-oncosphere Muscle, brain, One–several 10–12 weeks

6. Cysticercus Muscle, brain, One–several <1 year