Advanced Laboratory Techniques in Livest

Binod Kumar, B J Thakre, B S Mathapati, V A Kalariya,
V K Singh and Tapas Kumar Patbandha

Editors
Advanced Laboratory Techniques in

Livestock Disease Investigation
Assistance to States for Control of Animal Diseases

Department of Veterinary Parasitology
College of Veterinary Science & Animal Husbandry
Junagadh Agricultural University, Junagadh-362001
Copyright: The Junagadh Argicultural University 2016
All rights reserved. No part of this publication may be

reproduced, stored in a retrieval system, or transmitted in any
form or by any means, electronic, mechanical, photocopying,
recording or otherwise without prior permission of the
copyright holder.
Applications for reproduction should be made through the

publisher.
Published in 2016
No of Copy: 35
Publication No. : 3/1-24
Published by:
Director of Extension Education
Junagadh Agricultural University, Junagadh, Gujarat, India.
www.jau.in
Printed by:
Vardhman Print Zone, 9, Madhuram Complex
Near Airtel customer care, Junagadh-362001.
Correct Citation: Binod Kumar, Thakre, BJ, Mathapati, BS, Singh

VK, Kalariya, VA, Patbandha, TK (Eds.). 2016. Advanced
Laboratory Techniques in Livestock Disease Investigation.
Department of Veterinary Parasitology, Veterinary College,
JAU, Junagadh (Guj.).p256.
Production, printing and distribution of this guide-book has

been financed by the ASCAD programme sponsored by
Department of Animal Husbandry, Gujarat state entitled,
Advanced Laboratory Techniques in Livestock Disease
Investigation.
Advanced laboratory techniques in livestock disease investigation
A Training Programme for
Field Veterinarians
(3rd to 8th October, 2016)
held at
Department of Veterinary Parasitology
College of Veterinary Science and Animal Husbandry
Junagadh Agricultural University, Junagadh-362001, Gujarat, India.
Course Director:
Dr. P. H. Tank
Principal & Dean
College of Veterinary Science & Animal Husbandry
JAU, Junagadh
Course Coordinator:
Dr. Binod Kumar
Assistant Professor & Head
Department of Veterinary Parasitology,
Veterinary College, JAU, Junagadh.
The views expressed in the articles including the contents are sole
responsibility of the respective authors. The editors bear no
responsibility with regards to source, and authenticity of the contents.
Resource Persons Dr. V. K. Singh
Assistant Professor
Course Director: Department of Veterinary Physiology
Dr. P. H. Tank & Biochemistry, Veterinary College,
Principal & Dean JAU, Junagadh
College of Veterinary Science & Dr. D. B. Barad
Animal Husbandry, JAU, Assistant Professor
Junagadh Department of Veterinary
Microbiology, Veterinary College, JAU,
Junagadh
Course Coordinator:
Dr. D. T. Fefar
Dr. Binod Kumar Assistant Professor
Assistant Professor & Head Department of Veterinary Pathology,
Department of Veterinary Veterinary College, JAU, Junagadh
Parasitology, Veterinary Dr. V A Kalaria
College, JAU, Junagadh. Assistant Professor
Department of Veterinary Pathology,
Veterinary College, JAU, Junagadh
Faculty Dr. J. B. Kathiriya
Dr. B. J. Thakre
Assistant Professor
Assistant Professor
Department of Veterinary Public
TVCC, Veterinary College,
Health and Epidemiology,
JAU, Junagadh
Dr. B. B. Javia
Dr. Vishnudeo Kumar
Department of Veterinary
Department of Veterinary Anatomy
Microbiology, Veterinary College,
and Histology,
JAU, Junagadh
Dr. B. S. Mathapati
Dr. A. R. Bhadaniya
Assistant Professor,
Department of Veterinary
Department of Veterinary Pathology,
Microbiology, Veterinary College,
JAU, Junagadh Dr. Kiran Parmar
Dr. J. S. Patel
Assistant Professor
Professor & Head
Department of Veterinary Gynecology
Department of Veterinary Medicine
& Obstetrics, Veterinary College, JAU,
and TVCC, Veterinary College,
Junagadh
JAU, Junagadh
Dr. Srikant S. Patil
Dr, Joice P Joseph
Assistant Professor
Assistant Professor
Department of Animal Nutrition,
Department of Veterinary Medicine,
Dr. Vineet Kumar
Assistant Professor
Department of Veterinary Surgery and
Radiology, Veterinary College, JAU,
Junagadh
Dr. A. M. Parakhia
MESSAGE
In India, livestock sector plays crucial role for upliftment of
rural livelihood by providing milk, egg, meat, wool etc. Since long the
livestock sector is considered as an integral part of Indian agriculture
where the crop residues are utilized for livestock feed and animal’s
excreta act as organic fertilizer, and disruption of one component
affects other. However, disease significantly affects performance and
productivity of livestock sector and could affect the rural livelihood.
Livestock diseases have also public health significance and zoonoses.
Thus, it is need of the hour to investigate and diagnose livestock
disease timely and accurately. There are several conventional
laboratory diagnostic techniques commonly used for diagnosis and
investigation of livestock diseases but such techniques are time
consuming, labour intensive and less sensitive. Recent advanced la-
boratory techniques could be the only option for accurate and timely
investigation and diagnosis of livestock diseases.
The present ASCAD training on “Advanced Laboratory
Techniques in Livestock Disease Investigation” gives insight on
present status and future scope of advanced laboratory techniques of
disease diagnosis and investigation of livestocks for controlling
diseased and improving human health.
This concise book comprised of several topics pertaining to
different recent and advanced laboratory techniques for disease
diagnosis and investigation of livestock. The book will be a useful doc-
ument and guide for further reference to the field veterinarians. I con-
gratulate the Course Director Dr. P. H. Tank, Course Coordinator Dr.
Binod Kumar and his team for taking such initiative and preparing an
important resource book. I extend my best wishes for the grand suc-
cess and fruitful outcomes from this training.
Dr. A. M. Parakhia
Junagadh Agricultural University, Junagadh
Foreword
Livestock sector is an integral part of Indian agriculture and
plays significant role in national food security by providing nutritious
protein rich products like milk, egg and meat. However, the
productivity of livestocks is compromised due to disease, causes huge
economic losses. Additionally, some diseases have public health
significance and zoonoses. Thus, early diagnosis of disease followed
by treatment could reduce the economic losses as well as the risk to
human health. The conventional laboratory diagnostic techniques used
for disease investigation are time consuming, labour intensive and less
sensitive. Moreover, recent advanced laboratory techniques are
now-a-days gaining more importance because they require less time,
few man powers and have more sensitivity for disease diagnosis.
Veterinarians plays significant role in diagnosis and controlling of
livestock diseases. Dissemination of knowledge to Veterinarians on
advanced laboratory techniques for disease diagnosis and investigation
could directly reduce the economic losses and improve the animal and
human health as well as their welfare.
The present ASCAD training on “Advanced Laboratory
Techniques in Livestock Disease Investigation” is primarily focused
on creating awareness and updating the field veterinarians with recent
trends in livestock disease diagnosis and investigation. I hope
veterinarians will be immensely benefited from the training by formal
and informal interactions with the faculties.
I congratulate Dr. Binod Kumar, Course Coordinator and his
team for taking such initiative and preparing training handbook which
comprises different recent and advanced laboratory techniques for
disease diagnosis and investigation of livestock diseases. I hope that
this training course will present a platform for interactions and
deliberations of various exports to develop a specific roadmap for
timely and accurate diagnosis and investigation followed by effective
control of livestock diseases. I wish the training will be helpful to the
field Veterinarians to meet the growing demand of livestock enterprise.
Dr. P. H. Tank
Course Director and Dean
College of Vet. Sci. & A. H.
JAU, Junagadh
Preface
The department of veterinary parasitology has well furnished
laboratory to process the clinical material in both conventional and
advanced methods. The department having good number of light
microscope, phase contrast microscope, Stereo-zoom microscope,
digital research microscope, gradient PCR machine, SDS-PAGE
system, agarose gel electrophoresis system, refrigerated centrifuge,
deep freezer, etc. The present ASCAD training on “Advanced
Laboratory Techniques in Livestock Disease Investigation”
includes all the recent diagnostic techniques which includes molecular,
serological, biochemical, histo-pathological techniques and other
related topics. This handbook has been meticulously prepared by the
Junagadh Veterinary College staff and other related expert, which I
hope will be a useful document and guide for further reference to the
field veterinarians.
I express science gratitude to Dr. A. R. Pathak, hon’ble Vice
Chancellor, Junagadh Agricultural University, Junagadh for his
continuous support and encouragement.
I also extend my sincere thanks to Dr. Hitaben Patel, Director,
Department of Animal Husbandry, Gujarat state, Gandhinagar. I am
extremely thankful to Dr. A. M. Parakhia, Director of Extension
Education, JAU, Junagadh for his kind support. I feel great pleasure to
express my sincere thanks and deep sense of gratitude to our worthy
Principal and Dean Dr. P. H. Tank, for providing full support to
conduct the above said training programme. I am very much thankful
to Dr. K S. Murthy, ASCAD Convener, Prof. & Head, Animal
Nutrition of this college for his support and suggestion. I express
sincere and heartiest thanks to departmental collogue Dr. B. J. Thakre,
and other faculty members, teaching and non-teaching staffs who have
taken the responsibility and worked tirelessly for the success of this
training programme. Last but not the least I extend heartfelt gratitude
to one and all who directly or indirectly involve in this training
programme.
Dr. Binod Kumar

Course Coordinator and
Asst. Prof. & Head
Dept. of Vet. Parasitology
College of Vet. Sci. & A. H.
JAU, Junagadh
S. Contents Page
No. No.
1 Sustainable parasite control- An Integrated 1-8
approach
2 Significance of ticks and tick-borne diseases 9-16
and ticks identification
3 Standard procedure for collection, preservation 17-26
and dispatch of clinical materials for
parasitological examination
4 Clinical Diagnosis of Regionally Important 27-39
Livestock Diseases
5 Identification of causative agents involve in 40-48
dermal lesions in bovines
6 Recent trends in clinical enzymology for 49-55
disease diagnosis of domestic animals
7 Molecular techniques in animal disease 56-73
diagnosis
8 Next generation sequencing in animal disease 74-83
investigation
9 DNA based methods for quick diagnosis of 84-87
haemorrhagic septicemia
10 Recent advances in cancer diagnosis 88-104
11 Use of different clinic-pathological test in 105-121
disease diagnosis
12 Epidemiological approaches in investigation of 122-136
zoonotic disease
13 Anatomy of various organs affected by 137-146
helminth parasite
14 Identification of etiological agents causes 147-160
abortion in bovine
S. Contents Page
No. No.
15 Herd-based laboratory tools for evaluation of 161-165
nutritional and metabolic disease in dairy
herds
16 Diagnosis of parasitic infection through faecal 166-180
examination
17 Collection, processing and identification of 181-185
ecto-parasites of animals
18 Application of radiology and surgery in 186-194
parasitic disease investigation
19 Advanced techniques used for diagnosis of 195-203
animal parasitic diseases
20 Resent advances in diagnosis of haemoparasitic 204-215
diseases of livestock
21 Importance of various staining techniques to 216-222
differentiate bacterial pathogens
22 Rapid diagnosis of haemorrhagic septicemia by 223-226
species specific PCR
23 Demonstration of advanced microscopy for 227-230
identification of pathogenic organisms
24 Rapid diagnostic techniques: a readyrecknor 231-243
clinical aid to field veterinarians
25 Histopathology techniques: an overview 244-254
1 Sustainable parasite control- An Integrated
approach
H V Manjunathachar1, Binod kumar2*, B. J. Thakre2,
N. R. Sudhakar3, B C Saravanan1 and S. S. Patil4
1
Entomology laboratory, Division of Parasitology, ICAR-IVRI,
Izatnagar-243122.
2
Dept. of Veterinary Parasitology, Veterinary College, JAU,
Junagadh.
3
Lab In-charge, Vet-lab, Meerut
4
Dept. of Animal Nutrition, Veterinary College, JAU, Junagadh.
*drkumarbinod@gmail.com; +919725560977.
L ivestock sector plays an important role in the national

economy and in the socio-economic development of the country.
According to 18th livestock census, total livestock population in
India is 529.7 million (2007). It is increasing day by day due to
its importance as an alternative source of income as well as
food. The contribution of livestock in total GDP is 3.93%,
Livestock in agricultural GDP is 22.14% and that of agriculture
in total GDP is 17.76 % (Basic Animal Husbandry Statistics,
2010). The country has made tremendous progress in terms of
animal production in the field of dairying and sheep production.
Recent survey has clearly indicated that the livestock growth at
national level is increasing under animal husbandry sector
compared to agriculture. There is a further scope of
enhancement through improved nutrition, scientific management
and strategic management of animal diseases.
Now-a-days shift in modern farming towards increased
productivity and intensification in the livestock industry
including cross breeding, importation of livestock/ germplasm
has favored the spread of diseases. The major constraint in
livestock sector is animal health problem; animal diseases are
causing huge economic losses to the farmers especially in small
ruminants in the tropics and subtropics. In India an average
>300 helminth spp. parasitize livestock, mostly with multiple
infections due to conducive environment for their development
(Singh and Srivastava, 1977). Among all the different helminths,
Sustainable parasite control- An Integrated approach
gastro-intestinal nematodes (GIN) are the major parasites drawn

attention. The GIN impact animal health and production by
number of ways viz, anorexia or reduced voluntary feed intake,
mortalities in lambs, digestive and absorptive disturbances,
reduced productive and reproductive performances, anaemia,
pathological changes in GI tract, loss of body weight and
immunological disturbances. All these factors impact on the
livelihood of farmers by economic losses.
Environmental conditions in tropical/sub-tropical
countries like India are conducive for rapid development and
long time survival of the infective stages of parasites throughout
the year and the animals are continually exposed to heavy
infections. Classically, the problem is tackled by chemical
intervention. However, due to tremendous biotic potential and
short regeneration time, the animals get reinfected within no
time. Thus repeated medication is required to keep up the animal
health by using chemical dewormers/anti-helminthtics. This will
enhance the development of resistance to all available drugs.
Almost it is difficult to accurately determine the annual cost of
the infections, it is worthwhile considering that in the late 1990s,
global sales of anthelmintics for grazing livestock alone exceeds
US$1 billion. Moreover, drug residues in food products of
animal origin affect Public and environment health. On the other
hand, there is increased demand for animal origin food, which
are free from chemical contaminants. Presently, economic
animal production further gets a jolt due to absence of very few
effective vaccines against parasites.
All these factors forced the researchers to think over
some alternative methods of management of parasites, which
will be eco-friendly and sustainable. Considerable research has
been conducted on various aspects of alternative methods, which
include exploitation of genetic resistance, nutritional
management, biological control of helminths etc. Sound
knowledge of the epidemiology of the disease, effective and
early diagnosis followed by judicious use of appropriate parasite
control method can only form an effective basis for the control
2 Advanced laboratory techniques in livestock disease investigation

of parasites. Following information need to be gathered before

developing a strategy for the control of parasitic infection:
 Nature of infection (whether sporadic, endemic or
ubiquitous).
 Type of life cycle of the parasite i.e., direct or indirect.
 Previous history of the infection in the flock.
 Geo and agro-climatic data (particularly rainfall,
temperature and humidity) of the area.
 Managemental practices being followed at the farm.
 Nutritional level of animals of the flock.
Alternative methods for control of nematodes
Control of a parasite means to minimize the intensity or to
prevent further spread of an existing infection in animals and
decreasing number of infective larvae by adopting suitable
parasite control measures. Presently, control programme is
targeted by three main principles to “break” continuity in cycle
of nematodes
1. To eliminate the worms in the host using non-conventional
anthelmintics viz, feeding copper oxide wire particles,
natural from of anthelmintics from plants, nematophagous
fungi and diatomaceous earth
2. To improve the host resistance and/or host resilience by
immune-nutrition, genetic selection and available vaccines
against parasites
3. To reduce contacts between the host and the parasite
infective stages (L3) can be achieved by diluting the
parasitic risk, exploiting the biological rates of development
or death of free living stage and increasing larval death rate.
Copper oxide wire particles (COWP)
Initially COWP were developed to treat copper deficiency in
animals but the potential interest to limit parasite infections was
noticed in treated animals. It act indirectly on adult nematodes
through the increased copper status in the host, or directly by
potentially penetrate the cuticle of Haemonchus contortus due to
increased copper in the abomasums of host. Few researchers
reported 75-96% reduction in adult H. contortus, 56% reduction
Advanced laboratory techniques in livestock disease investigation 3

in Teladorsagia circumcincta in lambs and goats after

administration of COWP. Even though, COWP showing
promising results against few nematodes, copper toxicity is the
limiting factor for the use of COWP in sheep. So, should be used
accordingly.
Nutritional management
The naturally available plants, rich in anthelmintic properties are
usually exploited by farmers. Few anti-parasitic effects in plants
contribute to slowdown the dynamics of infections and also
cause positive consequences for host resilience due to presence
of one or more plant secondary metabolites (PSM). The PSM
such as condensed tannins, cysteine proteinases are thought to
be important elements. The cysteine proteinases are present in
plants such as papaya, pineapple and figs and documented effect
in several host species against a variety of nematodes which,
causes damage to the cuticle of nematodes. The condensed
tannins are secondary metabolites, acts directly by reduction in
the development, viability, motility, and migratory ability of
parasite larvae. However, indirectly they increase protein
availability in the lower gastrointestinal tract through the
protection of dietary protein from rumenal degradation.
The sustainable integrated approach is a systemic
application of two or more technologies in environmentally
compatible and cost effective manner to control parasite
population. It aims to control multiple parasite to achieve
maximize quality, quantity and sustainability of production and
long term profitability. It includes...
 strategic and tactical use of anthelmintics
 careful management of grazing lands
Anthelmintics remain an indispensable component of worm
management programs, but they must be used in combination
with alternative approaches. Usually deworming time, doses are
most important. The time of deworming depending on the age of
animal, parasite load in animals and managemental practices
being followed.
Alternative treatment approaches to nematode parasite

control is the FAMACHA system. Hereby, the lower eyelid of

the sheep is examined and treatment administered only if signs
of anemia are present. FAMACHA© is used to determine
anthelmintic treatment in animals, depending on colour eye chart
was developed in South Africa. It was developed as a tool for
anthelmintics resistance and integrated parasite management
against the barber pole worm. It was mainly developed for
sheep, but should work with goats with slight modifications. The
tool is a simple chart that allows individuals to determine the
degree of anemia by comparing the colour of an animal's ocular
mucous membranes to colours of eyes on a chart. The level of
anemia is a key sign of the degree of parasitic infection with
H. contortus .
The FAMACHA© technique reduces the number of
treatments because only animals showing physical signs of
infection are dewormed. It identifies worm susceptible animals
for culling and slows anthelmintics resistance, as worms have
less exposure to the drugs. Only those sheep found to have pale
mucous membranes, and where subsequent determinations
showed haematocrit of 15% or below, were drenched to prevent
death. This system not only saves anthelmintic usage, but
animals could also be identified for culling. Such an approach
dramatically reduces the selection for anthelmintic resistant
parasite populations, as nearly three quarters of the flock
remained untreated, with the result that their worm populations
were not exposed to drug selection. The FAMACHA system can
be used to control H. contortus throughout its endemic region
where worm control is troubled owing to prevalence of
anthelmintic resistance.
Grazing management
To reduce the environmental contamination by parasites, pasture
management like rotational grazing, burning the grazed pasture
is widely practiced parasite control strategies. Since these
methods provides opportunity for dual livestock species parasite
control, such as with sheep/cattle interchange grazing. A pasture
grazed by cattle and/ or horses is also considered safe, since

sheep/ goats and cattle/ horses do not share the same parasites
(Barger, 1999). The alternative grazing of new born & resistant
animals of same species also reduces nematodes population on
pasture as young animals are most susceptible to parasitic
infection. In rotational grazing, pastures are sub-divided and the
animals are intensively grazed for short period but, generally
does not help to control internal parasites unless pasture rest
periods are long enough (>70 days). Similarly, in controlled
grazing permit pastures to rest and soil life to function well, so
that contamination can be reduced. Access of clean un-grazed
pasture first to young animals such as lamb, calf or kid may
reduce the risk of parasite infection. Apart from these control
strategies,
 Segregation of the clinical case and its proper treatment
by using anthelmintic drug (dewormer).
 All apparently healthy animals should be given
preventive medication.
 Vaccinate the animals against the parasites for which the
vaccines are commercially available. eg. Lung worm
vaccines (Dictol, Difil), RakshaVac-T, TickGARD etc.
 Biological control of parasites can also be tried by use of
predacious fungi, breeding of ducks and fish in ponds
infested with the snails etc.
 Breeding of genetically resistant breeds of animals
should be tried.
 Adopt suitable preventive measures to prevent further
spread of infection.
Immunological control
One of the major objective and dream of the researches is to
control the parasitic diseases or reduces the loss in productivity
by manipulating the host immune response. Immunological
control is an ideal methods to control any kind of infection/s.
But due to many inherent nature of the parasite and lake of
proper knowledge on parasite immunity, the progress was very
slow and many a times outcome was very poor. Initially, some
anti-parasite vaccines, such as lung worm vaccine, Miller’s

vaccine for dog hook worm and anti-coccidial vaccines, were

developed which is based on whole parasite, live attenuated
type, having many disadvantages like very less self-life, problem
of contamination, maintenance of cold chain, aesthetic problem,
and reversion of its virulence and most importantly generation
of parasite stage for vaccine preparation. To overcome this
problem, recombinant vaccine against parasite was first
successfully developed against Taenia ovis, but there is no
market and finally called as ‘orphan vaccine’. Later, vaccine
against Rhipicephalus (Boophilus) microplus was developed in
Australia as TickGARD and Cuba as Gavac, the first
recombinant vaccine against arthropod. Recently, subunit
vaccine against Haemonchus contortus was developed by using
native H11 antigen, an integrated parasite gut membrane
glycoprotein, in Australia. The vaccine called ‘BarberVax’ was
commercially manufactured by the Albany parasitology
laboratories, Australia since 2014. In future, we may see
progresses in this field where young researchers are well
equipped with the knowledge of bioinformatics, molecular
biology, computational biology and host-parasite relationship.
Conclusion:
The development of effective, sustainable control options for
parasite has thus far proven difficult, may be due to a lack of
fundamental knowledge on parasite biology and the
host-parasite relationship and partly due to high degree of
biological plasticity of the parasites themselves. However,
sustainable control of parasite may be achieved by an improved
understanding of the biology of the parasite and long-term
impact of parasite management strategies where each of various
methods can be combined in an integrated format. The following
strategies can be applied to prolong the life of the parasiticides,
which is a major component in IPM at present.
 Indiscriminate use of anthelminthics develops resistance
against the particular drug, so care has to be taken while
using them.
 Reduce the use of anthelminthics by adopting other control

measures viz, managemental control, nutritional control,

immunological control, genetic control etc.
 More than one method of control should be used in the
form of integrated parasite management to prolong the
shelf life of anthelmintic and to achieve proper parasite
control. Since, IPM is more efficient successful control
measure against gastro-intestinal nematodes.
Selected References
1. Alvarez-Sanchez, M.A., Perez Garcia, J., Bartley, D., Jackson, F and Rojo
Vazquez, F.A., 2005. The larval feeding inhibition assay for the diagnosis
of nematode anthelmintic resistance. Exp. Parasitol., 110, 56-61.
2. Anderson, N., 1985. The controlled release of anthelmintics for helminth
control in ruminants. In "Resistance in Nematodes to Anthelmintic
Drugs". Ed. P.1. Waller and N. Anderson, CSIRO and Australian Wool
Corporation Technical Publication, Sydney 1985. pp.127
3. Barger, A., 1999. The role of epidemiological knowledge and grazing
management for helminth control in small ruminants, Int. J Parasitol;
29: 41–47.
4. FAO, 2004. Resistance Management and Integrated Parasite Control in
Ruminants (Guidelines) CD-ROM. Animal Production and Health
Division, Rome.
5. Langston Univ. Ag. Res. And Ext. Programs. 2000. Diagnosis of Internal
Parasitism in Goats. http://www.luresext. edu/GOATS/library/fec.html.
6. Van Wyk, J.A., Bath, G.F., 2002. The FAMACHA© system for
managing haemonchosis in sheep and goats by clinically identifying
individual animals for treatment. Vet. Res. 33, 509–529.

2 Significance of Ticks and Tick-borne Diseases
(TTDB’s) and Ticks Identification
Binod kumar1*, H V Manjunathachar2, Gajanan M
Chigure2 and B. J. Thakre3
1
Dept. of Veterinary Parasitology, Veterinary College, JAU,
Junagadh-362001.
2
Entomology laboratory, Division of Parasitology, ICAR-IVRI,
Izatnagar-243122.
3
Dept. of TVCC, Veterinary College, JAU, Junagadh-362001.
*drkumarbinod@gmail.com; +919725560977.
D uring 1940-2004, more than 20% of all emerging

infectious diseases are recorded as arthropod-borne. Data
suggest the vector-borne diseases are on the increase and new
infectious agents are also emerging leading to significant public
health concerns as potential zoonotic disease threats. Amongst
other factors, climate change itself can have an adverse effect on
the distribution of ticks and tick-borne diseases. It is predicted
that more than 50% of tick species of the genus Rhipicephalus
(Boophilus) could expand its range in Africa, with more than
70% of this range expansion linked to economically important
tick species such as R. appendiculatus, R. microplus, or
R. decoloratus. On a Global basis, ticks are second to
mosquitoes as vector of infectious pathogen to human and they
form the most important group of arthropods to transfer
pathogens from one animal to another. They are capable to
transmit various pathogenic agents like virus, bacteria, protozoa
and other parasites as well to their host. Being an obligate
haematophagus arthropods, tick feeds on animal leading to
anaemia, loss in body weight, affects production and
reproduction activities of the animals. Moreover, ticks can cause
severe toxic conditions leading to irritation, allergy and paralysis
in the host. Ticks are members of the phylum Arthropoda,
subphylum Chelicerata, and class Arachnida, which contains
several subclasses. The subclass Acari (syn. Acaria, Acarina,
Significance of Ticks and tick-borne diseases
Acarida) includes ticks. A characteristic of the Acarines is the

extreme fusion of body segments, in contrast to the known three
body segments head, thorax and abdomen in insects. They
belong to the class Arachnid, subclass Acari and suborder
Ixodida. The Ixodida was further classified into 3 families. The
hard ticks (Ixodidae), the soft ticks (Argasidae), and
Nuttalliellidae represented by a single known
species, Nuttalliella namaqua. There are 705 recognized species
of hard ticks representing nearly 80% of all tick species (Burger
et al., 2014). Among these, Rhipicephalus (Boophilus)
microplus and Hyalomma anatolicum are the most ubiquitous
species in Indian subcontinent (Ghosh et al., 2007).
R. (B.) microplus is an one host hard tick spread throughout the
tropics and subtropics including Australia, East and Southern
Africa, South and Central America (Estrada-Pena et al., 2006)
and infest wide range of hosts e.g., cattle, buffalo, horses,
donkeys, goats, sheep, deer, pigs, dogs and some wild animals.
Whereas, H. anatolicum parasitize domestic and wild mammals
and are abundant in semi-arid zones of Asia,
the near and Middle East, southeastern Europe and North Africa.
Economic importance of ticks and Tick borne diseases
(TTBD’s)
The economic impact of ticks has been estimated time to time.
For example, Graham and Hourrigan (1977) reported savings of
USD $3 billion in today’s currency following eradication of
R. (B.) microplus. The annual global costs associated with
TTBDs in cattle amounted between US$ 13.9 to US$ 18.7
billion. It is estimated that on an average, each engorging female
tick is responsible for the loss of 1.37 ± 0.25 gram body weight
of Bos taurus cattle and 1.18 ± 0.21 gram in B. taurus x
B. indicus cattle. Time to time, various researchers have
estimated the cost associated with tick infestations to the
animals (Table 1). It is estimated that up to 80% of the world’s
(1,288 million) cattle population are infested with ticks,
representing $7,500 million in monetary losses for cattle alone.
In India, cattle and buffaloes are frequently heavily infested with

multi-species of ticks, which apart from transmitting diseases

such as theileriosis, babesiosis and anaplasmosis, causes
extensive damage to the livestock health and production. The
annual cost for control of TTBDs of cattle has been
conservatively estimated as US$498.7 million. Further, ticks are
major contributors for transmission of important disease causing
agents to animals (Table 2). Bovine tropical theileriosis caused
by the protozoan parasite Theileria annulata, is transmitted by
the tick species of the genus Hyalomma worldwide, putting
about 250 million cattle at risk to this important protozoan
disease. Estimated loss due to T. annulata and tick worry
worldwide and India was US$ 384.3 million and US$ 57.2
million, respectively. Recently in 2012, Karnataka, India,
outbreak of Kyasanur forest disease (KFD), a Haemaphysalis
tick borne infection has occurred despite routine vaccination,
indicating the need of strategic control of the tick vector. In
India, H. anatolicum has been incriminated as vector for
T. annulata, T. buffeli, T. lestocardi (T. hirci) in cattle, buffalo
and small ruminants and Crimean-Congo hemorrhagic fever in
humans. H. anatolicum follows a three-host life cycle under
natural conditions and two-host life cycle in laboratory
conditions (on rabbit-calf model).
Table 1. Impact of tick infestations
Currently, tick control is executed by integrated pest
Ticks Losses
Single tick >100 times suck blood of their body weight
One tick Blood loss – 0.5-2 ml
Milk loss – 8.9 ml
Body weight loss – 1g /day
105 ticks 23 % reduction in milk production/day
40 ticks 20 kg weight loss/year
Tick infested cattle Lose 18-40 kg body weight / year
Tick bite 20-30% reduction in value of hide/skin

management in which different control methods are adapted to a

geographical area. A major component of integrated tick control
method is the use of acaricides. However, application of
acaricides is not sustainable in the long run because of the
striking ability of ticks to develop resistance. Further, acaricide
residues in animal food products, undesirable effects on animal
health and ecosystem, the cost involved are other drawbacks of
the use of acaricides. Furthermore, the expenses incurred by the
pharmaceutical companies for the identification of a new
chemical, testing and marketing are in excess of US$100
million. Moreover continued overreliance on acaricides is not
sustainable. The alternative approaches include utilizing the
hosts which are naturally resistant to ticks, biological control,
herbal acaricides and vaccines.
Table: Important TTBD of human and livestock in India
Identification of ticks
Tick Borne Pathogen/ Tick vector Host
Diseases (TBD) Parasite
Kyasanur Forest KFD virus Haemophysalis spinigera Man
Disease (KFD)
Crimean Congo CCHF virus Hyalomma spp. Man
Hemorrhagic
Fever (CCHF)
Indian Tick Rickettsia conorii Rhipicephalus Man
Typhus (ITT) sanguineus ?
Bovine Tropical Theileria annulata Hyalomma anatolicum Cattle
Theileriosis
Babesiosis Babesia bigemina Rhipicephalus microplus Cattle,
Haemaphysalis spp. Buffalo
B. motasi R. Sanguineus Goat
B. canis Rhipicephalus spp. Dog
B. ovis Hyalomma spp. Sheep
B. equi Horse
Anaplasmosis Anaplasma R. (B.) microplus Catte,
marginale Buffalo
Ehrlichiosis Ehrlichia bovis, Hyalomma spp. Sheep
E. canis R. sanguineus Cattle
Dog
Ticks can be identified to the family, genus and species level

using the numerous taxonomic keys which are available for ticks
from different regions of the world. Adult male and female ticks
are the best material for identification. However, tick
identification, particularly when studing larvae, can be difficult
and may require entomological skills. Molecular methods are
currently being developed to identify ticks and in the future it is
expected that such methods will be used more widely and
particularly for the differentiation of closely related species.
Depending on the studies that are to be performed, ticks can be
kept in the laboratory. They can be kept alive in a relative
humidity of 85% and, depending on the species, at between
15-25°C. Alternatively, female engorged ticks can be kept at 0
to 5°C, in the dark and at 95% relative humidity for up to three
months. Tick can be kept in freezing condition (-80°C) for
molecular identification and pathogen detection. Ticks may also
be stored in preservative solutions like 10 % formalin or 70 %
alcohol containing 1 % chloroform and 5 % glycerol.
Two types of ticks are known and they are the Ixodid or
hard ticks and Argasid or soft ticks. Ticks have a leathery
appearance and are sac like. The mouth parts are made up of the
base called basis capitulum on which the mouth parts are held
which is inserted anteriorly into the body. It carries the other
structures i.e. the mandible behind which is the hypostome
which has re-curved teeth to hold on to the host and the palps on
either side.
Argasid or soft ticks
The Argasid ticks have a soft body and leathery cuticle and may
have small tubercle like markings on it called mammillae.
Hard Tick (Ixodidae):
Hard ticks have scutum on dorsal aspect – scutum is completely
covers the dorsal aspect in male and restricted to anterior third in
female ticks. Eyes present or absent, if present on dorsal aspect.
Spiracles behind the fourth coxae. Presence of plates, festoons.
Sexual dimorphism conspicuous.
Salient features of important hard ticks found in India are given

Argasid (soft) ticks Ixodid (hard) ticks

Mouth parts seen anteriorly in Mouth parts situated anteriorly in
larvae but ventral in nymphs and all stages and visible form dorsal
adults, not visible from dorsal aspect
aspect
Scutum and ventral plates absent Scutum present in both sexes in
in both sexes all stages
Ventral plates found in some spp.
Body is soft and mammillaed Body leathery, Ornate or Inornate
Festoons absent Festoons present
Intermittent blood suckers, noctur- Diurnal feeders, feed
nal females lay eggs after every continuously, lay only one batch
blood meal of eggs
Sexual dimorphism not marked It is marked. Females are
relatively larger than males
Palpi are leg like Palpi are relatively rigid
Eyes when present are located in Eyes when present are located on
the supracoxal folds lateral margin of scutum
More than one nymphal stage Only one nymphal stage present
present
below for identification.

Rhipicephalus (Boophilus) microplus - (Tropical cattle tick)
 Brevirostrate ticks- Short rostrum
 A pair of eyes - at the margin between first and second
coxae in male and in female at the margin of the scutum in
the region between 1st and 2nd coxae.
 1st coxa, with hump on dorsal border
 1st coxa notched ventrally
 In males presence of adanal and accessory adanal plates
 Both adanal and accessory adanal plates with median
posterior spine.
 Presence of caudal process in male
 Absence of festoons, faint anal groove
Rhipicephalus (Boophilus) annulatus - one host tick

 Salient features are similar to R. (B). microplus

 In males absence of caudal process
Haemaphysalis bispinosa - three host tick
 Brevirostrate ticks- Short rostrum
 Absence of eyes
 Lateral prolongation of the second article of the pedipalp
 First coxa with pointed spine
 Presence of festoons
 Absence of ventral plates in males
Amblyomma (three host tick)
 Size of unfed ticks is large (6 to 7mm) including
mouthparts.
 Palp articles 2 are longer than articles 1 and 3.
 Basis capituli has straight lateral margins.
 Legs usually have pale rings. Legs are slender. Pulvilli are
always present.
 Ornamentation is present on the scutum and conscutum of
many species.
 Eyes are always present and may be flat or convex
(sometimes difficult to see).
 Festoons are present in males (and in females but unclear
when females are fed).
 Ventral plates in males are indistinct (in the form of small
flat plates posterior to the anus, also the ventral surface of
the festoons have plates known as scutes).
 Coxae 1 have unequal paired spurs.
Dermacentor (usually three host tick)
 Ventral plates are absent from males.
 Coxae 4 are very large.
 Coxae 1 have large and equal paired spurs.
 Size of unfed ticks is medium (4 to 5mm)
 Palp articles 2 are broad in Dermacentor; in De. nitens palp
articles are all small.
 Basis capituli has straight lateral margins and dorsally it is
rectangular.
 Legs have no pale rings. Legs are slender. Pulvilli are

always present.
 Ornamentation is present on scutum and conscutum of most
of Dermacentor, forming a white pattern except De. nitens.
 Eyes are present and usually flat to slightly convex in
Dermacentor but indistinct in De. nitens.
 Festoons are present in males.
Hyalomma anatolicum and Hyalomma marginatum

Reference: available up on request.
Hyalomma anatolicum Hyalomma marginatum
 Hy. anatolicum is closely similar to  Hy.marginatum is a sub-species
Hy. excavatum, particularly the distinct from Hy. rufipes.
females.  Both sexes of Hy. marginatum are
 Hy. anatolicum is unusually small, easily distinguished from Hy.
thin and pale for a Hyalomma spe- rufipes by their lack of dense setae
cies. around the spiracles and their lack
 The females have shallower cervical of dense punctations.
fields with parallel sides.  The posterior lips of the female
 The males of Hy. anatolicum have a genital aperture form a very broad U
less distinctly depressed area at the shape compared to a broad V shape
posterior of the scutum and the in Hy. rufipes.
paracentral festoons are not joined  The male of Hy. marginatum has a
anteriorly to form an arch, com- caudal depression, with posterior
pared to the arch formed in Hy. grooves.
excavatum.  The characteristic light coloured
areas on the dorsal surface of the
middle segments of legs are a useful
feature to distinguish Hy. margi-
natum from most Hyalomma spe-
cies.
 The male of Hy. marginatum having
a distinct and brown coloured
central festoon.
 In female, preatrial fold of genital
opening is very convex
 Males have small paramedian
grooves

3 Standard Procedure for Collection, Pres-
ervation and Dispatch of Clinical Materi-
als for Parasitological Examination
B. J. Thakre1*, Binod kumar2, Bhupamani Das1,
K.H. Parmar1, V. L. Parmar1 and N. B. Manvar1
1
Department of Teaching Veterinary Clinical Complex, Veterinary
College, JAU, Junagadh.
2
Department of Veterinary Parasitology, Veterinary College, JAU,
Junagadh.
*drbhupendrakumarthakre@gmail.com; +917069412676.
S pecimen collection involves the sampling of tissue or fluid

for laboratory examination. The quality of the specimen received
in the laboratory can have a major impact on the subsequent
parasitological and clinical diagnosis and valid results rely on
the specimen being of the required quantity, collected in an
aseptic manner and stored appropriately prior to laboratory
examination. For effective prevention and control of parasitic
diseases and for treatment of cases, early detection and correct
diagnosis is very important. False results may occur if
specimens are kept for prolonged periods before examination in
the laboratory, as some organisms may outgrow others, whilst
other delicate organisms may not survive.
Collection and preservation of material
Correct diagnosis cannot be made if the material is not
appropriate or collection, preservation and dispatch methods are
faulty. It should be representative and should be so treated that
when it reaches to the lab it should be in good condition and fit
for examination. Preferably the material should be collected
from sick animals and birds prior to giving any treatment. At
least one or two cases may be kept under observation and
untreated if treatment of whole herd is urgently needed.
Blood smear: Prepare the smear on glass slide should be thin
and grease free with smooth edges. Blood smear should be
prepared from ear vein of animals and comb or wattle of birds.

Standard Procedure for Collection
Whole blood: Jugular vein – animals; cutting the end of tail, tip
of ear or vena cava – pig; wing vein – fowl.
Blood serum: Collect 5-10 ml blood in test tube and keep the
tube in slant position for separation of serum. Don’t tightly close
the lid of the test tube. After separation of serum from blood it is
transferred to sterile vial.
Un-clotted blood: Collect 2-3 ml blood in sterile vial with
proper anticoagulant
Anticoagulant
Sodium citrate 2.5-3% solution: 1 part anticoagulant + 9 part
blood.
Ethylene diaminetetraacetic acid (EDTA) - 1.5 to 2.0 mg/ml of
blood.
Mixture of 4 part of potassium oxalate and 6 part ammonium
oxalate (3% solution and 1 part of this solution in 9 part of
blood).
Heparin (in vivo): 20-25 IU/ml of blood.
Faeces: It should be collected directly from rectum or at the
time of defecation. Quantity of faeces should be at least 4-5 gm.
Faeces should be kept either in rubber capped vial or in
polythene bag for eggs/ova and epg count (Pfeiffer, 2010).
Culturing of larva pooled faecal sample or separate sample from
each animals is collected without adding preservative. Faeces for
oocyst of coccidia are collected in 2.5% potassium dichromate
solution (Castiglione et al., 2010).
Urine: It is collected either through catheter or at the time of
micturition in sterile container. (Schistosoma haematobium,
Dioctophyma renale, Stephanurus dentatus eggs can be seen).
Milk: It is collected directly from the teats in sterile container
(Larvae of Toxocara and Ancylostoma).
Lymph node biopsy: It is done for Theileria schizont. First inject
2-3 ml of PBS into the prescapular lymph node and after
rubbing and or massaging the fluid is sucked in the syringe and
prepare thin smear from the collected material.
Tissue for histopathological studies: At post-mortem blood is
collected from heart and tissues from organs (normal and

abnormal organs both). Small pieces of about 0.5 cm in 10%

formalin or 10% formal-saline. Tissues undergoing
decomposition or putrefaction are unfit for histopathological
examination.
Collection of parasites: Parasites should be collected
systemically. Person collecting the material should have the
knowledge of site of predilection of the parasites. At the time of
post-mortem, first external organ should be examined, then sub
cutaneous tissues and body cavities. Each organ should be
carefully examined for parasites.
Nematodes parasites after collection should be washed
in normal saline and then these should be dropped immediately
in 70% hot alcohol, which would cause them to be fixed in an
extended state. Filaroid worm are placed immediately in 10%
formalin without washing in saline. It is difficult to collect
nematode larvae or small nematode situated in tissues. Pieces of
tissues should be sent to laboratory for separation of parasites.
Trematodes and cestode parasites should be washed several
times in running water to clean and remove mucous, faecal and
other debris sticking to the worm. Finally they are washed twice
in normal saline. Most of the trematodes are fleshy. Therefore,
fleshy trematodes are flattened between two glass slides and
tightened with thread or rubber bands. Too much pressure
should be avoided to prevent damage of the parasite. The slides
with the parasite are immersed in 5-10% hot formalin or 70%
alcohol. After two days proper flattening and fixation is
achieved. Now, slides are untightened and specimen is placed in
10% or 70% alcohol (Brunsdon, 2008).
Cestodes are also collected similarly to trematodes i.e.
they are also flattened. Large tapeworm is cut into segments.
Care should be taken that scolex should not missed as it is an
important part for identification.
During post-mortem organs should be carefully examined for
the presence of parasites: Skin and hair (ticks, mites, lice,
maggots), Subcutaneous tissues and nodules on body
(Parafilaria bovicola, Onchocerca gibsoni, larva of Hypoderma

bovis), Body cavities (Setaria spp), Trachea (Syngamus

trachea), Bronchi (Lung worm), Lungs (Hydatid cysts), Liver
(Fasciola spp., Dicrocoelium spp.), Aorta (Dirofilaria immitis),
Heart muscle (Cysticercus bovis and C. cellulosae), Muscles
(Cysticercus bovis in Cattle and buffalo) and C. cellulosae in
Pig), Conjunctival sac (Thelazia spp.), Nasal cavities
(Linguatula serrata in dog, Oestrus ovis in sheep Schistosoma
nasale in cattle sometimes leach), Mesenteric vein (Schistosoma
spp.), Oesophagus (Spirocerca lupi in dog, Gongylonema
pulchrum), Rumen (Amphistome), Abomasum (Haemonchus
contortus, Trichostongylus axei), Small intestine (Immature
amphistome in duodenum, immature liver fluke, Ascaris spp,
Ancylostoma spp., Tapeworm), Large intestine
(Oesophagostomum spp., Trichuris spp), Brain (Coenurus
cerebralis in sheep and goat) (Skerman and Hillard 2007).
Organ smear: Prepared from spleen and lymph node, for
protozoan parasites. Slide is pressed on cut surface and air-dried.
It is dispatched either fixed or unfixed.
Nasal discharge: Linguatula serrata (nasal worm of dog),
Oestrus ovis (nasal bot of sheep) and Schistosoma nasale are
found in nasal cavities. Eggs S. nasale leave host along with
nasal discharge. The nasal discharge is scanty in buffaloes but
more copious in cattle. Nasal discharge along with piece of
granulomatous growth in nasal cavity is collected in 10 %
formalin.
Lacrimal discharge: Few helminth parasites i.e. Thelazia and
Oxispirura are found in eye and eggs and larva these worms get
mixed with discharge superficially at medial canthus. The
discharge should be collected with wet camel hairbrush before
drying up. It is spread on slide to observe under microscope.
Skin scrapping: It is necessary to make deep skin scrap of
mange affected area and then it is collected in rubber capped vial
containing few drops of 10% formalin or 70% alcohol so that it
should remain moist. Ticks: Care should be taken that mouth
parts of ticks should not break during collection. A drop of
chloroform is applied at the site of attachment to loose it grip

from animal. Live ticks are dropped in hot 70% alcohol to kill
them in extended position. Dipterous larva, lice and fleas: These
are collected in 5% formalin or 70% alcohol. Dipterous adult
insect: Insects having wings should not be collected in liquid
medium. They are killed in a cyanide-killing bottle and then
collected in a wide mouthed bottle. If cyanide bottle is not
available, collect these flies as such in wide mouthed bottle.
Genital discharge: Genital discharge is collected for the
presence of Tritrichomonas foetus responsible for early abortion
in cattle. It is collected either in form of preputial washing from
breeding bulls or as vaginal discharge from cow.
Bovine trichomoniasis caused by T. foetus, a flagellated
protozoan. Organism responsible for early abortion and
infertility in cattle, which is its natural host. It is pyriform, 8-19
µm long and 4-9 µm wide, with three anterior and one posterior
flagella, and an undulating membrane. Living organisms moves
with a jerky, rolling motion, and are best detected by phase
contrast / dark field microscopy. Transmission of infection
under natural condition by coitus, by artificial insemination or
by gynecological examination of cow. Infection in bull is
primarily of preputial cavity and little or no clinical
manifestations occur. Spontaneous recovery rarely occurs in bull
and it becomes a permanent source of infection.
In the bull, the organisms are present in small numbers,
with some concentration in the fornix and around the glans
penis. The chronically infected bull shows no gross lesion. In the
coq the initial lesion is vaginitis, which can be followed in
pregnant animal by invasion of cervix and uterus. Various
sequel results, including a placentitis leading to early abortion
(1-16 weeks), uterine discharge, and irregular oestrous cycles. In
some cases despite infection pregnancy is not terminated by
abortion and a normal, full term calf is born. On a herd basis,
cow exhibit an irregular oestrous cycles, uterine discharge, pyo-
metra and early abortion. The cow usually recovered and gener-
ally become immune for that breeding season after infec-
tion/abortion.

Identification of organism by direct microscopy and culture

(prescribed test for International trade)
A tentative diagnosis is based on the clinical history,
sign of early abortion, repeat breeding or irregular oestrous
cycles. Confirmation is done by the demonstration of parasites
in placental fluid, stomach content of the aborted foetus, uterine
discharge, pyometral discharge and vaginal discharge. The
suitable material for diagnosis is vaginal discharge in female and
preputial washings and scrapings in bull. However, in case of
cow a serological tests i.e. vaginal mucus agglutination test has
been recommended for diagnosis (Campbell, and Rowe 2009).
The number of organism varies in different situations. They are
numerous in aborted foetus, in the uterus after several days of
abortion, in recently infected cows and at 3-7 days after
ovulation. In the infected bull the organism are presents in
highest number on the mucosa of prepuce and penis. ln case of
bulls, before samples are collected. It is desirable to allow bulls
at least one week of sexual rest in order to increase number of
organism following breeding. Prepucial smagma either by
swabbing the penis with gauze covered rod, douching the
prepucial cavity with saline or aspiration using a dried pipette
are the method for collection of material for identification of
T. foetus. Artificial insemination pipette is usually used for
collection of smagma. For each bull separate and sterile pipette
should be used. It is also important to know that during sample
collection the surface of the penis and prepuce should be
scrapped vigorously to dislodge organisms from the epithelial
crypts. Scrapping the prepuce is better that aspiration and
douching.
Samples from cows are collected by washing the vagina
or irrigating the uterus with physiological saline/ phosphate
buffer saline using a plastic or glass pipette and a long rubber
tube. It is important to avoid faecal contamination as this may
introduce intestinal protozoa that may be confused with
T. foetus. Samples should be kept and examined in warm
conditions otherwise organisms will become sluggish. Motility

of organisms is an important feature in identification of the

organisms. Where samples must be submitted to laboratory and
cannot be delivered within 24 hours, a transport medium should
be used.
Transport medium: PBS (pH 7.2) + 5% Foetal calf serum or 5%
skimmed milk + Penicillin 1000 unit/ml and streptomycin
100µg/ml.
Collected material is centrifuged and sediment is inoculated in
transport medium in ratio of one part sediment and nine to ten
part transport medium. It is transported in sterile stopper plastic
tube at temperature between 5 to 37oC avoiding extreme
temperature.
Where organisms are too few to allow accurate identification,
cultures should be prepared. Culture of the organism is usually
required because, in most cases, the number of organism is not
large enough to make a positive diagnosis by direct examination.
Several media can be used. The CPLM (cysteine/peptone/liver
infusion media) medium, BGPS (beef extrac/glucose/peptone
serum) medium. Clausen's medium (Neopeptone-Lemco-liver
extract glucose), Diamond trichomoad medium, and Oxoid's
Trichomonoas medium, are the media of choice. It is important
that especially collected samples be obtained for inoculation into
the media and this should be done as soon as possible after
collection. It is also important to make sure that the culture
media are used before their established expiry date, as many
media are not stable.
The organisms may be identified on the basis of
characteristic morphological features. Samples may be examined
with a microscope directly. Culture media may be examined
microscopically at intervals from day 1 to day 10 after
inoculation. The organism may be seen under a standard light
microscope using a magnification of 100 or more. Phase
contrast/dark field microscopy is very valuable in revealing
detail features. The pear shaped organisms have three anterior
and one posterior flagella and an undulating membrane that

extend nearly to the posterior end of the cell. They also have an
axostyle that extend beyond the posterior end of the cell.
Modified diamond's medium
Glassware used for culture should be washed in distilled water
(avoiding the use of detergent). The Modified Diamond's
Medium comprises: 2 gm trypticase peptone, 1 gm yeast extract,
0.5 gm maltose, 0.1 gm L-cycstein hydrochloride and 0.02gm
L-ascorbic acid and is made up with 90 ml distilled water con-
taining 0.08 gm each of K2HPO4 and KH2PO4, and adjust to
pH 7.2-7.4 with sodium hydroxide or hydrochloric acid.
Following the addition of 0.05 gm agar, the medium is
autoclaved for 10 min. at 121oC, allow to cool to 49oC and the
10 ml inactivated bovine serum (inactivated by heating at 56oC
for 30 minutes.) 100000 units crystalline penicillin G and 0.19
streptomycin sulphate are added aseptically. The medium is
aseptically dispensed in 10 ml aliquots into sterile screw cap
vials and refrigerated at 4oC until use. Media should be cultured
up to 7 days, samples being examined at daily intervals. The
incorporation of agar into medium confines contaminating
organism largely to the upper portion of the test tube, while
helping to maintained microaerophillic conditions at the bottom
of the test tube where the Trichomonas occurs at large number.
Trichomonas medium
Suspend 37.5 gm in 1 litter of distilled water, boil to dissolve
completely. Sterilize by autoclave at121oC for 15 min. Cool to
50oC. Add 80 ml of inactivated horse serum (at 56oC for 30
min.) to this medium and adjust pH at 6.0. For diagnostic works
add 1000 unit of Penicillin and 500µg of streptomycin per ml of
medium.
For meaningful results, the samples must have the following
qualities:
Correct sampling
Correct preservation
Correct labelling which should include:
Owner's name and address
Description of animals: animal, age, sex and breed

Clinical signs
Number of animals at risk and details of any mortalities and
post-mortem findings
A tentative diagnosis where possible
The type of sample submitted
Exact diagnosis/identification desired
Clinician’s name, address (including telephone number)
Correct packing
Post-mortem material- dead, moribund or ailing animals should
be submitted as rapidly as possible.
Preservation and preservative used
Thick: Thick blood smears are air dried and kept in distilled
water in slant position to remove haemoglobin and then again
air-dried and fixed in methanol for microfilaria.
Thin: It is fixed for 3-5 minutes in methanol or in alcohol for 15
minutes.
Blood for transfusion: On ice.
Blood tor chemical analysis: One ml10.0% solution of potas-
sium oxalate is sufficient for 3 ounces of blood.
Serum for serological test
One part of 5.0% phenol to 9 parts of serum is used as preserva-
tive.
One part of 0.5% solution of merthiolate in 9 parts of serum is
used as preservative.
Blood for haematological examination: Anticoagulants like
heparin, EDTA, sodium citrate or sodium oxalate are added
blood should send on ice.
Faeces: A 5 gm faeces is emulsified and 10% formalin (1 part
formalin + 3 parts faeces) is added to prevent the development
and hatching of eggs. Samples should be sent in polythene bags
after proper labeling (Koga et al 2011).
Faeces for coccidian: One part of 2.5% potassium dichromate is
added to three parts of faeces. Time should be noted down when
potassium dichromate is added to the faeces as Eimeria species
has its own time for its development.

Tissue for histopathology: 10% formalin is added in about 25

times of the tissue size.
Histochemistry: Cold acetone or absolute alcohol is used.
Urine: l0% formalin in equal volume of urine is used.
Selected References
1. Brunsdon, R.V. (2008). Principles of helminth control. Veterinary
Parasitology. 6: 185-215.
2. Campbell, W. C. and Rowe, R. S. (2009). Chemotherapy of Parasitic
Diseases. New York: Plenum Press, pp. 239-503.
3. Castiglione, G., Zappa, M. and Grazzini, G. (2010). “Screening for
colorectal cancer by faecal occult blood test: comparison of
immunochemical tests,” Journal of Medical Screening, vol. 7, no. 1, pp.
35–37.
4. Itzkowitz, S. H., Jandorf, L. and Brand, L. (2012) “Improved fecal DNA
test for colorectal cancer screening,”Clinical Gastroenterology and
Hepatology.vol. 5, no. 1, pp. 111–117.
5. Kahn, G. M. (2012). The Merck Veterinary Manual. Merck and Co. Inc.
White house station, N. J., USA.
6. Koga, Y., Yasunaga, M. and Katayose, S. (2011). “Improved recovery of
exfoliated colonocytes from feces using newly developed
immunomagnetic beads,” Gastroenterology Research and Practice. vol. 2.
7.
7. Morikawa, T., J. Kato, Y., Yamaji, R., Wada, T., Mitsushima and Shi-
ratori, Y. (2011). “A comparison of the immunochemical fecal occult
blood test and total colonoscopy in the asymptomatic
population,”Gastroenterology, vol. 129, no. 2, pp. 422–428.
8. Pfeiffer, D. (2010). Veterinary Epidemiology: An Introduction.
Wiley-Blackwell; pp; 37–41. World Federation for Culture Collections.
Guidelines for the establishment and operation of collections of cultures
of microorganisms, Third Edition, Revised by the WFCC Executive
Board. ISBN 92 9109 043 3.
9. Skerman, K. D. and Hillard, J. J. (2007). A Handbook for Studies of
Helminth Parasites of Ruminants. Near East Animal Health Institute,
Teheran. Handbook No. 2. Rome: Food and Agricultural Organization of
the United Nations.

4 Clinical Diagnosis of Regionally Important
Livestock Diseases
J. S. Patel* and Joice P. Joseph
Department of Veterinary Medicine, Veterinary College,
Junagadh Agricultural University, Junagadh-362 001
* drjspatel64@gmail.com; +919427393905.
T horough examination helps in proper diagnosis of disease

and better treatment can be provided to the affected. A thorough
clinical examination consists of taking proper history, evaluating
the environment and physical examination of animal. Inadequate
performance of any of these may lead to errors. Some of the
important diseases which are commonly noticed in Saurashtra
region are discussed below with reference to its clinical
diagnosis.
BACTERIAL DISEASES
Anthrax (Bacillus anthracis)
In per acute form, sudden death without clinical symptoms
occurs. In acute cases, high temperature, abdominal pain and
sudden death are noticed. Carcass will be bloated. Oozing of
blood also seenfrom natural orifices.
Black quarter (Clostridium chauvoei)
It occurs in cattle, buffalo and sheep (rarely in other animals).
Typical blackleg of cattle has a seasonal incidence, with
most cases occurring in the warm months of the year. The
highest incidence may vary from spring to autumn. In some
areas there is an increased prevalence in years of high rainfall.
The case fatality rate in blackleg approaches 100%.
Animals sometimes die without any premonitory
symptoms. Fevered animals show lameness/stiffness. Affected

Clinical Diagnosis of Regionally Important Livestock Diseases
region will show trembling and violent twitching. Crepitating

swelling in hind or fore quarters can be seen. In recently lambed
ewes, lesions develop at perineum, which becomes swollen and
dark red. In sheep, acute febrile condition develops following
injury.
Haemorrhagic septicaemia (Pasteurellamultocida)
Hemorrhagic septicemia occurs in cattle, camels, and water
buffalo. Animals of all ages are susceptible but the most
susceptible age group is 6 months to 2 years of age. Both
morbidity and case-fatality rates vary between 50% and 100%.
Outbreaks of the disease are often associated with wet humid
weather during the rainy season.
Symptoms include high temperature; drop in milk yield,
abdominal pain, diarrhoea or dysentery, rapid respiration,
mucous membrane cyanotic, oedema on neck or brisket.
Bronchopneumonia is accompanied by fever.
Mastitis
Most cases occur during the early part of the dry period and in
the first 2 months of lactation. Periparturient udder edema may
be a risk factor for clinical mastitis. Animals genetically above
average for milk yield are more susceptible to mastitis.Clinical
signs include high fever, swelling of udder and straw coloured
milk in coliform mastitis and thick yellowish milk with clot in
staphylococcal and streptococcal mastitis. Presence of clot in
watery fore milk is noticed in in S.aureus and coliforms
infection. Insubclinical mastitis, reduction in milk yield without
any apparent changes in udder and milk is seen.Skin of the
quarter and teat becomes semi- cold and bluish in gangrenous
mastitisfollowed by sloughingoff.
Brucellosis (Brucella abortus, B melitensis, B.suis, B.canis)
Cattle, goat and pig can be affected with this disease. It is
trans-missible to man also. Infection occurs in cattle of all ages
but is most common in sexually mature animals, particularly
dairy cattle. Abortions occur most commonly in outbreaks in
unvaccinated heifers after the fifth month.
In cattle abortion can occur at 7-8 months of pregnancy.

In chronic case abortion is less common but retained placenta is

seen. Unilateral orchitis, synovitis and hygroma of knee are
observed in bulls. In sheep and goat abortion at 3-4 months of
pregnancy - sometimes at full term, lameness, mastitis with
discolouration of milk with clots can occur. In acute form loss of
weight, pyrexia, diarrhoea, infertility etc. may occur.
Tuberculosis (Mycobacterium bovis)
Cattle, goats, and pigs are most susceptible and sheep shows a
high natural resistance; infection is predominantly noticed in
cattle and pigs.Symptoms depend on the organ involved.
Pulmonary infection gives rise to dry cough, which increases in
pregnancy. Animal will have loss of weight. In TB, mastitis
milk is almost normal in the beginning and finally whey like and
then milk production stops. In chronic productive type, infection
is limited to one quarter, gland becomes enlarged and indurated,
normal symmetry of udder will be lost. Supra mammary
lymphnode will be enlarged.
Para-tuberculosis (Johne’s disease)
(M.aviumsubspparatuberculosis)
The disease occurs most commonly in cattle and to a lesser
extent in sheep and goats. A distinguishing characteristic of
Johne's disease is that infection occurs in animals at an early
age, usually under 30 days of age, and clinical disease does not
occur until 3-5 years of age. Chronic diarrhea and emaciation are
the clinical signs noticed. In sheep and goat, diarrhea,
emaciation and wasting are seen.
Colibacillosis (White scour in calves) (E.coli)
Newborn calves, piglets, lambs, goat kids, foals are affected.
Risk factors include colostrum deprivation, overcrowding,
adverse climatic conditions and inferior milk replacers. The
prevalence can be as high as 50-60% in diarrheic calves under 3
days of age and only 5-10% in diarrheic calves 8 days of age.
Symptoms include scouring, weakness, and prostration. In
less acute case, calf is restless, fails to suckle and develop
diarrhea, swelling at joints and pneumonia in few cases. High
temperature initially, shows abdominal pain, faeces loose in

consistency containing mucous and blood, weakness, fall in

temperature, coma and death.
Tetanus (Clostridium tetani)
Tetanus usually occurs with a history of a wound or tissue
trauma. The portal of entry is usually through deep puncture
wounds. In young ruminants the case fatality rate is over 80%,
but the recovery rate is high in adult cattle.Symptoms are similar
in all animals: mild stiffness, unwillingness to move, last for
12-24 hours followed by general stiffness of limbs, head, neck
and tail becomes rigid, tremor with restriction of jaw movement
(locked jaw), anxious and alert expression, erect carriage of ears,
absence of movement of eye lid, staring look, dilatation of
nostril, drooling of saliva, constipation, retention of urine, bloat
is an early sign in cattle, sweating may be profuse. Prolapse of
3rd eye lid occurs in horses.
Contagious bovine pleuropneumonia (Mycoplasma mycoides
subsp. Mycoides)
CBPP occurs only in cattle; rare natural cases have been
observed in buffalo. Symptoms include fever, agalactia,
anorexia, depression, coughing, thoracic pain, back arched,
dyspnea, expiratory grunting, pleuritic friction rubs, dull areas of
lung and edema of throat and dewlap.
Contagious caprine pleuro pneumonia (CCPP) (Mycoplasma
carpricolumsubsp Capri pneumonia)
Disease of goat and sheep. Infectivity is high with a morbidity of
100%. And the illness is acute and severe with a case mortality
rate of 60-100 %. Rise in body temperature (104.50F – 1060F),
mucopurulent nasal discharge, coughing, laboured respiration,
salivation and loss of weight are noticed in affected animals.
Abortion occurs in pregnant animals. In some cases arthritis
with swelling of leg joints, lameness andoedematous swelling in
head, neck and limbs also occurs.
FUNGAL DISEASES
Dermatophytoses
Disease may be acute, chronic or sub-clinical, range from slight
erythema to highly inflammatory with folliculitis, suppurating

body lesions, extensive areas of alopecia and scarring.

Circumscribed areas of hairless skin, thick gray crumbly crusts
and heavy pityriasis can also occur. Common locations where
infection likely to contact, includes neck and sides.
VIRAL DISEASES
Foot and Mouth disease (Picorna virus)
FMD affects all cloven-footed animals. The morbidity rate in
outbreaks of FMD in susceptible animals can rapidly approach
100%. However, the case fatality is generally very low. In the
most favorable circumstances, it is now estimated that disease
can be transmitted between 250 km (156 miles). High fever,
stringy salivation, smacking of lips, vesicles on the tongue,
gums, dental pad, cheeks, around the muzzle, coronary band,
interdigital cleft and udder are the common lesions of this
disease.
PPR (Peste des petits ruminants) (Goat Plague)
This contagious disease occurs mostly in goats and sheep. Case
fatality rates are much higher in goats (55-85%) than in sheep
(less than 10%). Symptoms include fever, dry muzzle and a
serous nasal discharge later becoming mucopurulent. Marked
salivation due to the erosions on the mucous membrane of
buccal cavity, profuse diarrhoea resulting in severe dehydration
and conjunctivitis with ocular discharge are usually observed.
Viral enteritis (Rota, Corona and Astro viruses)
Viral enteritis is disease of young animals. Calves are most
susceptible to rotavirus diarrhea between 1-3 weeks of age.
Disease is more common during the winter months. Diarrhoea
occurs in young animals. Faeces may be watery, sometimes with
blood and mucus.
Infectious bovineRhinotracheitis/Infectious Pustular vulvo
vaginitis (IBR/IPV) (Bovine Herpes virus)
Respiratory symptoms, abortions, sometimes genital infections
are noticed in diseased animals. Vulvo-vaginitis in cows and
balanoposthitis in bulls may occur.

Cow pox and buffalo pox (Pox virus)

Small red papules on teat and udder, in buffalo the lesions may
be seen around the ears, ear flap, eyes, neck region and
sometimes throughout the body.
Sheep pox and Goat pox
Sheep: High rise of temperature increased respiratory rate,
swollen eye lids, dermal oedema, with marked raised circular
thickened plaques with congested borders. Lesions in wool free
areas. Generalization may occur - lesions in the oral, intestinal
and respiratory tracts. Nodules in internal organs.
Goat: Pocks on mucous membrane and skin, teat and
udder. Pox like lesions on the lips also. Proliferative type of
lesions is seen in sheep and goats.
Contagious Ecthyma
Papules, pustules, scabs covering ulceration, granulation,
proliferation and inflammation occur. Lesions begin at oral
mucocutaneous junction, oral commissures and spread to
muzzle, oral cavity. Lambs cannot suck or graze. Malignant
form occurs with invasion of alimentary tract. Severe systemic
reaction can occur and lesions on coronets, ears, anus, and
vulva. Lesions can be multifocal in goats
Rabies (Rhabdo virus)
Excitement followed by paralyses and death in 3-6 days
following the onset of clinical symptoms is noticed. Incubation
period varies from 2 weeks to several months. In cattle, paralytic
form is associated with bizarre mental behavior (yawning,
bellowing), incoordination, decreased sensation of hindquarters,
drooling of saliva, recumbency and death in 4-7 days. Furious
form is accompanied with hypersensitity then paralysis and
death as in paralytic form. In Sheep, outbreaks are common;
sexual excitement, wool pulling, attacking, incoordination, and
then paralysis are noticed.
PARASITIC DISEASES
Intestinal parasites causes diarrhea, weight loss etc. Nematodes
causes diarrhea, weight loss, and production losses. Fascioliasis
can be acute or chronic. In acute syndrome (sheep), sudden

death occurs; chronic syndrome (sheep andcattle) is associated

with weight loss, reduced milk yield, pallor and submandibular
edema. Severe enteritis and fetid diarrhea occurs in
amphistomosis. Diagnosis is by coprological examination.
PROTOZOAN DISEASES
Coccidiosis
Calves may appear unthrifty and have fecal-stained perineal
areas. In light infections, cattle appear healthy. The most
characteristic sign of clinical coccidiosis is watery feces, with
little or no blood, and animals show only slight discomfort for a
few days. Severe infections are rare. Severely affected cattle
develop thin, bloody diarrhea that may continue for >1 wk, or
thin feces with streaks or clots of blood, shreds of epithelium,
and mucus. They may develop a fever; become anorectic,
depressed, and dehydrated; and lose weight. Tenesmus is
common because the most severe enteritis is confined to the
large intestine. Nervous signs (eg, muscular tremors,
hyperesthesia, clonic-tonic convulsions with ventroflexion of the
head and neck, nystagmus) and a high mortality rate (80%–90%)
are seen in some calves with acute clinical coccidiosis.
Diagnosis of coccidiosis is by finding oocysts on fecal flotation
or direct smear or bythe McMaster's technique.
Buxtonella sulcata infection
They are similar to Balantidium coli found in the swine and
man. Increased invasion of the protozoon may result in the
acceleration of the passage of alimentary contents in the
digestive tract of dairy cows, thus causing clinical disorders such
as diarrhoea or poor condition of animals.
Trypanosoma evansi infection (Surra)
Pyrexia directly associated with parasitaemia together with a
progressive anaemia, loss of condition and lassitude are
observed. Recurrent episodes of fever and parasitaemia occur
during the course of the disease. Abortions have been reported in
buffalos and camels. Anaemia is a reliable indicator of
trypanosome infection.

Babesia infection
The first sign is fever (frequently ≥106°F [41°C]), which persists
throughout, and is accompanied later by inappetence, increased
respiratory rate, muscle tremors, anemia, jaundice, and weight
loss; hemoglobinemia and hemoglobinuria occur in the final
stages. CNS involvement due to adhesion of parasitized
erythrocytes in brain capillaries can occur with B bovis
infections. Either constipation or diarrhea may be present.
Late-term pregnant cows may abort and temporary infertility
due to transient fever may be seen in bulls. Confirmation of
diagnosis is by microscopic examination of Giemsa-stained
blood or organ smears
Theileriosis
It is characterized by high fever >1060F. Lymph node swelling
becomes pronounced and generalized. Lymphoblasts in
Giemsa-stained smears of needle aspirates from lymph nodes
contain multinuclear schizonts. Anorexia develops, and the
animal rapidly loses condition; lacrimation and nasal discharge
may also occur.
RICKETTSIAL DISEASES
Anaplasmosis
In animals below 1 yr. of age, anaplasmosis is usually
subclinical and 2-yr-olds it ismoderately severe, and in older
cattle it is severe and often fatal. Anaplasmosis is characterized
by progressive anemia due to extravascular destruction of
infected anduninfected erythrocytes. Acutely infected animals
lose condition rapidly. Milk production falls. Inappetence, loss
of coordination, breathlessness when exerted, and a
rapidbounding pulse are usually evident in the late stages. The
urine may be brown but, incontrast to babesiosis,
hemoglobinuria does not occur. A transient febrile response,
with the body temperature rarely exceeding 106°F (41°C) occurs
at about the time of peak rickettsemia. Mucous membranes
appear pale and then yellow. Pregnant cows may abort.
Diagnosis is by examination of blood smear.

MISCELLANEOUS CLINICAL DISORDERS

Simple Indigestion
The rumen is usually full, firm, and doughy; primary
contractions are decreased in rate or absent, but secondary
contractions may be present although usually decreased in
strength. Temperature, pulse, and respiration are normal. The
feces are normal to firm in consistency but reduced in amount.
Recovery usually is spontaneous within 24–48 hr.
Grain overload
Ballottement and auscultation of the left flank may elicit
fluid-splashing sounds in the rumen. The contents of the rumen,
as palpated through the left paralumbar fossa, may feel firm and
doughy in cattle that were previously on a roughage diet and
have consumed a large amount of grain. In cattle that have
become ill on smaller amounts of grain, the rumen will feel not
necessarily full, but rather resilient because of the excessive
fluid. Severely affected animals stagger and may bump into
objects; their palpebral reflex is sluggish or absent, and the
pupillary light reflex is usually present but slower than normal.
The extent ofdepression of the palpebral reflex is associated with
the plasma D-lactate concentration and provides a useful clinical
method to categorize severity of lactic acidosis and monitor
response to treatment.
Bloat
In primary pasture bloat, the rumen becomes obviously
distended suddenly, and the left flank may be so distended that
the contour of the paralumbar fossa protrudes above the
vertebral column; the entire abdomen is enlarged. As the bloat
progresses, the skin over the left flank becomes progressively
more taut and, in severe cases, cannot be “tented.” Dyspnea and
grunting are marked and are accompanied by mouth breathing,
protrusion of the tongue, extension of the head, and frequent
urination. Rumen motility does not decrease until bloat is
severe. If the tympany continues toworsen, the animal will
collapse and die. Death may occur within 1 hr after grazing
began but is more common ~3–4 hr after onset of clinical signs.

Pericarditis
Pain, avoidance of movement, abduction of elbows, arching of
back, shallow abdominal respiration are main clinical signs. Pain
on percussion or firm palpation of cardiac area, Jugular pulse is
well marked, adventitious sounds on auscultation, increased area
of cardiac dullness, tachycardia and muffled heart sounds can be
observed in affected.
Aspiration Pneumonia
High rise of temperature. Moist cough in later stages. Initially
mucopurulent but lastly purulent nasal discharge. Purified breath
smell due to necrosis and gangrene of lung-tissue. Rapid loss of
condition, anorexia, reluctance to lie down due to pain. Affected
animals stand with abducted elbows.
Nitrate poisoning
Sudden onset of severe dyspnea, brown mucosae and blood,
short course, high case of fatality rate.
Photosensitization
Occurs only in sunlight. Disappears on removal from damaging
feed and sun. Extensive edema, weeping dermatitis or skin
sloughing on white parts. It may also be signs of hepatic
insufficiency.
METABOLIC DISEASES
Disease Clinical symptoms Diagnosis
Parturient Adult high yielding Plasma calcium level less than 5
paresis (Milk dairy cows (5-10 yr mg/dl.
fever) age) in third parity and Blood glucose levels increase.
older are affected. Serum phosphorus and
Early excitement and potassium levels decrease.
tetany. Then depres- Prolongation of the ST interval
sion, coma, hypother- of electrocardiogram (ECG)
mia, flaccidity, pupil CPK increases due to
dilation, weak heart recumbency
sounds. No rumen
movements. Heart rate
increases as state wors-
ens

Downer cow Unable to stand follow- The diagnosis of downer cow

syndrome ing treatmentfor milk syndrome is made after all other
fever. Sternal recum- known causes of recumbency
bency. Normal mental have been eliminated in a cow
status, vital signs and which had milk fever and failed
alimentary tract. to stand within 24 h following
Appetite and thirst nor- two successive courses of treat-
mal. ment.
Some cases have bi- CPK, LDH, and AST increased
zarre behavior of lateral (If increased above 2330, 2225,
recumbency, abnormal and 171 U/L respectively)
position of legs, groan-
ing, anorexia, and die
in several days.
Ketosis of Occurs predominantly Hypoglycemia (<40 mg/dL),

cattle in well-conditioned ketonemia, ketonuria, or ele-
cows with high lacta- vated ketones in milk.
tion potential, princi- Plasma BHBA
pally in the first month (β hydroxybutyrate)
of lactation with a concentrations >1400 µmol/L
higher prevalence in Nitroprusside urine strip test
cows with a higher Milk strip test detecting the
lactation number. Cattle presence of BHBA
show wasting with
decrease in appetite
(cow first refuses to eat
grain, then ensilage but
may continue to eat
hay), fall in body con-
dition and milk produc-
tion. Some have short
periods of neurological
and behavioral abnor-
mality. A characteristic
odor of ketones is de-
tectable on the breath

Hypomagnesemic Occurs in those lactat- Response to

tetany ing dairy cows graze on treatment, low serum
(Lactation tetany) lush fertilized pastures. (1.2 mg/dL) or urinary
Occurs before and after magnesium
parturition in cattle. concentrations.
Suddenly cease to
graze, adopt a posture
of unusual alertness and
appear uncomfortable.
Animal shows incoor-
dination,hyperesthesia,
tetany, tonic –clonic
muscular spasms and
convulsions
Neonatal Insufficient milk inges- Hypoglycemia (Blood
hypoglycemia tion by newborn piglets glucose levels of less
in their first few days of than 50 mg/dl (2.8
life or piglets affected mmol/L))
with any disease which
interferes with milk
intake or that have en-
teropathy and are un-
able to digest milk.
Incoordination, shiver-
ing, dull, plaintive
squeal, cold periphery,
pale skin, weak, recum-
bent, terminal convul-
sions and death. Hypo-
glycemia in calves has
been recorded as a con-
current disease with
diarrhea.
Occurs at 2-4 weeks Low serum organic
Post parturient hemo- after calving. Prone in phosphorus, low PCV
globinuria copper deficient area, and hemoglobinuria
also in animals graze
on cruciferous crops.

Fatty liver of cattle Occurs in Increase in serum

well-conditioned beef hepatic enzyme levels,
cattle in late pregnancy increase in ketone
when energy intake bodies, increased fat in
suddenly decreased. liver biopsy
Inappetence to
anorexia, ruminal
atony, lethargic,
inactive, ketonuria,
fatty body condition,
weakness and
recumbency if worsens.
Recover if continue to
eat and appetite
improves.
Reference: available up on request

5 Identification of Causative Agents Involved in
Dermal Lesions of Bovine
Joice P. Joseph†*, Jayesh S. Patel, Bhavika R. Patel, V. L.
Parmar, B. J. Thakre, Manvar Nikunj and K. H. Parmar
†TVCC, Veterinary College, Junagadh Agricultural University,
Junagadh-362 001
*joicepjoseph@gmail.com; +919824928145
T he most common dermatologic problems include pruritus,

alopecia, crusting, scaling, otitis, non-healing wounds, nodules,
tumors and ulcerative disorders. Inflammation of the skin can be
produced by numerous agents, including external irritants,
burns, allergens, trauma and infection. It can be associated with
concurrent internal or systemic disease; hereditary factors may
also be involved. Allergies also form an important group of
etiologic factors.
Infectious agents include bacteria, virus (cow pox),
parasite and fungus. Trichophyton verrucosum is the usual cause
of ringworm in cattle, but T mentagrophytes, T equinum,
Microsporum gypseum, M. nanum, M canis and others also have
been isolated. Sarcoptes scabiei var bovis, Psoroptes ovis and
Demodex bovis are frequently noticed in dermal lesions of cattle.
Exudative dermatitis with scab formation is caused by bacteria,
Dermatophilus congolensis. Digital dermatitis in cattle which is
frequently noticed is polymicrobial, with a variety of bacteria,
particularly of the genus Treponema. Two species of
Hypoderma, H. bovis (common cattle grub) and H. lineatum
(northern cattle grub), are economically important and primary
pests of cattle. Stephanofilaria stilesi is a small, filarial parasite
that causes a circumscribed dermatitis along the ventral midline
of cattle. Ticks, lice and flies are also major problem to cattle.
Photosensitization is another factor causing dermal
lesions. Definitive diagnosis of the causes of various skin
diseases requires a detailed history, physical examination and
Identification of Causative Agents Involved in Dermal Lesions of
appropriate diagnostic tests. Many skin diseases look alike, and

a definitive diagnosis is made over time by including or
excluding possible causes, evaluating responses to therapy, and/
or process of elimination.
History
A careful dermatologic history is critical to interpret the physical
examination findings and choose appropriate diagnostic tests. A
complete general history should be obtained, including
information about prior illnesses, vaccinations, husbandry
(housing, feeding practices, etc), changes in attitude and food
consumption, elimination practices, exposure to other animals,
and travel within the past 6–12 months. This should be followed
by a detailed dermatologic history. Use of a preprinted history
form can be very useful for chronic or complicated cases. A
good history is important, because many skin diseases that look
similar are differentiated based on interpreting clinical signs and
historical patterns.
The following information should be obtained: 1) the
primary complaint; 2) length of time the problem has been
present; 3) age at which the skin disease started (distinct age
predilections are seen in many diseases, eg, demodicosis and
dermatophytosis in pediatric animals and signs of atopic
dermatitis in animals 1–3 yr old); 4) breed (breed predilections
include a predisposition of Cocker Spaniel dogs to primary
disorders of keratinization, and of terriers to atopic dermatitis);
5) presence and severity of pruritus (including licking, rubbing,
scratching, or chewing behaviors—owners often do not realize
licking may be a sign of pruritus); 6) how the disease started and
its progression (diseases that begin with pruritus may lead to self
-trauma and subsequent development of secondary skin lesions
[alopecia, seborrhea] or infections [bacterial or yeast pyoderma];
7) type and progression of lesions noted by the owner;
8) evidence of seasonality (suggesting fleas, allergic skin
disease, or weather-related diseases); 9) area on the body the
problem was first noticed (ie, regional patterns seen in atopic
dermatitis [typically the face and feet], cheyletiellosis [primarily

dorsal], scabies [primarily ventral], and endocrine hair loss

[usually involves the trunk and spares the head and legs]); 10)
any previous treatments and the responses to such (i.e.,
antibiotic-responsive skin diseases suggest a bacterial cause;
pruritus that responds to small doses of glucocorticoids,
antihistamines, or essential fatty acids suggests allergic
dermatitis); 11) frequency of bathing and when the last bath was
given (recent bathing may obscure or change important clinical
lesions, excessive bathing and wetting of the skin can predispose
to skin disease); 12) presence of fleas, ticks, or mites; 13) other
contact animals (i.e., evidence of contagion, which suggests
fleas, scabies, cheyletiellosis, or dermatophytosis); 14) the
environment of the animal (housing changes can influence the
development of certain skin diseases, eg, contact dermatitis,
contagious diseases); and 15) signs or reports of systemic illness
(endocrine [e.g., hypothyroidism and hyperadrenocorticism]
disorders and metabolic diseases [e.g., renal disease, liver
disease etc.] should be noted, because the skin can be the first
place, where signs of systemic illness are noted).
Physical Examination
A systematic method for the examination of the skin is
necessary to avoid misinterpretation of the lesions. Inspection of
the behavior of the animal and of the skin and hair, and
palpation and smelling of the skin are the most common
physical methods used for clinical examination of the skin. The
important prerequisites for an adequate examination of the skin
are good lighting such as natural light or day type lamps,
clipping the animal's hair when necessary to adequately
visualize lesions, magnification of the lesions with a hand lens
to improve visualization of the changes, and adequate restraint
and positioning of the animal.
Palpation can be used to assess the consistency of lesions,
the thickness and elasticity of skin, and to determine the
presence of pain associated with diseases of the skin. Close
inspection and palpation of the skin and hair coat are necessary
to identify and characterize lesions. Magnifying spectacles or an

illuminated magnifying glass may prove useful. The dorsal

aspect of the body is inspected by viewing it from the rear, as
elevated hairs and patchy alopecia may be more obvious from
that angle. All parts of the head including the nose, muzzle and
ears are examined. The lateral trunk and the extremities are then
examined. The feet of large animals need to be picked up to
examine inter digital clefts and parts of the coronary bands. The
skin of the udder and teats of cattle must be observed. The
ventral aspect of the body is carefully examined using a source
of light to illuminate the underside of adult cattle and horses.
The external and internal aspects of the ears, and the hooves and
horns must be examined by inspection and palpation. Every
centimeter of the skin needs to be examined for the presence of
lesions in different stages of development. The visual, tactile and
olfactory senses are used to see, feel and smell the lesions. The
presence or absence of some ecto-parasites can be determined by
direct inspection. For example, lice and ticks of cattle are
usually easily visible. The odor of the skin in some diseases may
be abnormal; dermatophilosis in cattle is characterized by a foul
and musty odor. Parting the hairs with the fingers or by gently
blowing them is necessary to evaluate the length of the hair
shafts. Broken hairs, changes in hair color and the accumulation
of exudative material on hair shafts are noted. The texture and
elasticity of the skin must be assessed by rolling the skin
between the fingers. Careful digital palpation of the hair coat
which appears normal on visual inspection may reveal
underlying lesions such as pustules which may be covered by
the hair coat. In some cases, tufts of hairs may be seen
protruding through an accumulation of exudate. The hair coat
should not be clipped, groomed or washed before the lesions
have been identified and characterized.
Laboratory Procedures for Skin Diseases
Skin Scrapings
Skin scrapings are part of the basic database for all skin
diseases. There are two types of skin scrapings, superficial and
deep. Superficial scrapings do not cause capillary bleeding and

provide information from the surface of the epidermis. Deep

skin scrapings collect material from within the hair follicle;
capillary bleeding indicates that the sampling was deep enough.
Deep skin scrapings are macerated in isotonic saline solution
and examined microscopically for adults of stephanofilaria or
microfilariae. Skin scrapings are used primarily to determine the
presence or absence of mites. Skin scrapings are best performed
using a skin-scraping spatula, which is a thin metal weighing
spatula commonly found in pharmacy or chemical supply
catalogs. These spatulas are reusable and will not injure patients.
Combing of the Hair Coat
This technique, commonly referred to as “flea combing” is
useful to collect large amounts of skin debris and trap cutaneous
parasites. Combings are particularly useful to find fleas, ticks,
lice, and some mites. A clean scrub brush or curry comb can be
used to collect material into a flat container (e.g., pie plate) in
large animals.
Examination of Hairs
Microscopic examination of hair shafts can be used to look for
evidence of self-trauma, dermatophyte infections (requires
clearing agents like 10% KOH and special staining), dysplastic
hairs, and, sometimes, genetic diseases of the hair coat.
Cytology
Cutaneous and auricular cytology is helpful to identify bacterial,
fungal, and, possibly, neoplastic skin diseases. At least 4–6
impression smears should be made; several slides should be
saved for examination at a reference laboratory if necessary.
When performing impression smears of the skin, the glass slide
should be placed directly over the site to be sampled. An index
finger or thumb should be placed directly over the slide and very
firm pressure exerted. Alternatively, clear acetate tape can be
used to sample the skin. Adequate sampling will produce a
“thumb print” from the surface. At least one slide should be heat
fixed with a match or lighter before staining. In most cases, a
Romanowsky-type stain is adequate. In pruritic patients,
material should be scraped from beneath nail beds and smeared

onto glass slides for heat fixing, staining, and cytologic

examination. Specimens should be examined under 4×, 10×, and
oil immersion magnification.
Fungal Cultures
Dermatophyte infections are best identified with a fungal culture
on either dermatophyte test medium or on plain Sabouraud agar.
Plates that are easily inoculated are preferred; glass,
screw-topped jars are difficult to inoculate and obtain samples
from and are best avoided. Cats are best sampled using a new
toothbrush aggressively combed over the affected lesions. Dogs
can be sampled with either a toothbrush or via a hair plucking
technique. In large animals, hairs should be gently wiped with
alcohol before collecting to minimize contaminant growth.
Intermediate and deep fungal organisms are best cultured at a
reference laboratory using a skin biopsy specimen (6–8 mm in
size).
Bacterial Cultures
Intact pustules can be cultured by rupturing the pustule with a
sterile needle and swabbing the lesion with a sterile culture
swab. Lesions should not be scrubbed before sampling. Deep
pyodermas are best cultured from a skin biopsy (6–8 mm).
Systemic and topical agents should be withheld for at least 72
hrs before sampling.
Biopsy
Skin biopsies are indicated in any case that appears severe,
unusual, or does not respond to appropriate therapy. Lesions
should not be scrubbed before biopsy, because surface pathology
is important in the diagnosis of many skin diseases. Several
samples from a variety of lesions should be submitted for
examination. Primary lesions should be sampled whenever
possible; otherwise, the report is often not very helpful in
making a diagnosis or narrowing a list of differential diagnoses.
Biopsy specimens require examination by a pathologist familiar
with skin diseases of animals. For autoimmune skin diseases;
routine histopathology is the test of choice.
Routine Blood and Urine Tests

In most dermatologic cases, these tests do not help to

make a definitive diagnosis. If systemic signs of an illness are
present, then a CBC, serum chemistry panel, and urinalysis may
be helpful to identify the cause. In dogs with recurrent
infections, these tests may identify an underlying subclinical
disease.
Intradermal Skin Testing
This test is not necessarily required to make a diagnosis of
atopic dermatitis. A positive intradermal skin test reaction
indicates past exposure to a particular allergen. Inhalant allergies
are best diagnosed based on a compatible history, physical
examination findings, and judicious use of intradermal skin
testing or in vitro testing for allergies. Intradermal skin testing is
recommended for animals in which immunotherapy is indicated
because of the severity or duration of allergic signs. Potential
drug interactions that can interfere with testing should be
considered before intradermal skin testing is performed.
The most common causes of atopic dermatitis are
inhaled or percutaneously absorbed allergens including weed,
grass and tree pollens; moulds; house dust or house dust mites;
animal dander as well as many other miscellaneous allergens. It
is very common to have multiple causes and this must be taken
into consideration when undertaking diagnostic testing and
subsequent treatment.
Prior to skin testing, it is recommended to withhold food
for 4-6 hours prior to the test. Sedative can be administered for
relaxinganimals to perform the test. A rectangular shaped area
(approximately 4"x 8") should be shaved and allergensinjections
are given just underneath the surface of the skin. The first two
injections are the positive (histamine) and negative (saline)
controls and the remaining injections are all of the common
allergens seen in surrounding areas. After several minutes
positive reactions will appear as red hives. The strength of the
reactions is graded against the positive and negative controls.
The positive reactions are recorded and used to formulate allergy
vaccine. Following the completion of the test the sedative is

reversed and a topical steroid ointment is placed over the testing

site.
Fig. 1. Intradermal skin testing

In Vitro Diagnostic Tests
Synthesis of IgE after exposure to allergen is the instigator of
the allergic process. While IgE exerts its effect after binding
strongly to mast cell Fc receptors, the presence of free IgE in the
serum can be used to quantify and determine the allergen
specificity of the allergic disease.
In vitro diagnostic tests (ELISA or RAST tests) are an
alternative to intradermal skin testing. These tests are considered
less reliable because of the large number of false-positive
reactions. Like intradermal skin tests, in vitro tests reflect
exposure and must be interpreted in light of the patient's clinical
signs and history.
Identifying etiological agents will help for providing
better treatment to animals and also will help to prevent
recurrent infection. This will avoid administration of unwanted
drugs to the diseased.

Selected References
1. Cynthia, M. K. (2005). The Merck Veterinary Manual, 9thedn. Merck &
Co., USA.
2. Radostits, O. M., Gay, C.C., Hinchcliff, K. W. and Constable, P. D.
(2007). Veterinary Medicine; A textbook of the diseases of cattle, horses,
sheep, pigs and goats, 10thEdn. Saunders, Edinburgh.
3. Egerton, J. R. (1964).Mycoticdermatitis of cattle. Australian Veterinary
Journal., 40(4): 144-47.
4. Palmer, M. A. and O’Connell (2015). Digital dermatitis in dairy cows: A
review of risk factors and potential sources of between-Animal Variation
in susceptibility.Animals., 5:512-35.

6 Recent trends in Clinical Enzymology for
Disease Diagnosis of Domestic Animals
V. K. Singh1*, P. Parasar2, R. J. Padodara1 and
A. B. Odedara1
1
Department of Veterinary Physiology & Biochemistry, Veterinary
College, JAU, Junagadh, Gujarat, India
2
Research Fellow, Boston Children’s hospital, Harvard Medical
School, Boston, MA, 02115 USA
*drvivek_biochem@yahoo.com, +918306857587.
C linical Enzymology is a growing field in veterinary

medicine. Measurement of the activity of certain
enzymes in plasma indicates certain organ affection hence it is a
potent tool for diagnosis and management of a wide variety of
diseases. Most enzymes measured in plasma for disease
diagnosis are primarily intracellular and they are released into
the blood when there is damage to cell membranes. However,
small amounts of intracellular enzymes are always present in the
blood as a result of normal cell turnover. Whenever there is
damage to cell membrane due to disease or inflammation
increased amounts of enzymes is leached in the blood resulting
in increased plasma concentration of the respective enzyme. The
distribution of enzymes is organ or cell specific hence increased
amount of certain enzymes indicate specific affection of a
specific organ. However, such increases are not always due to
tissue damage. Serum enzyme levels may enhance due to
increased cell turnover, cellular proliferation (e.g. neoplasia),
increased enzyme synthesis (enzyme induction), obstruction to
secretion or decreased clearance. Their normal levels in blood
are very low; but are drastically increased during cell death
(necrosis) or disease. Therefore assays of these enzymes are
very useful in diagnosis diseases often before any clinical sign
or symptom is evident. Hence, clinical enzymology is the
discipline that studies enzyme activity in body fluids like serum,

Recent trends in clinical enzymology ————- animals
plasma, urine, or other body fluids for the diagnosis and

prognosis of disease and to screen organ abnormality.
The era of clinical enzymology began since 1908 with
the introduction of a serum amylase assay for a reliable test for
pancreatic disorders. Later, in 1927, alkaline phosphatase (ALP)
was discovered in bone and serum alkaline phosphatase activity
was established as a diagnostic test for bone affection. Since
then, a number of enzyme assays have been developed and
associated with different organ function and disease diagnosis
not just for human but also for domestic animals. Heavy demand
and utility of such early detection assays in veterinary medicine
has resulted in the automation of enzyme assays. The success of
the serum chemistry profile in veterinary medicine has given the
opportunity to conduct retrospective studies and allowed the
veterinarian to critically evaluate the diagnostic function of the
common assays in a large number of animals on a regular basis.
A major disadvantage of clinical enzymology for the
diagnosis of tissue damage is their lack of specificity to a
particular tissue or cell type. Many enzymes are common to
more than one tissue, with the result that an increase in the
plasma activity of a particular enzyme could reflect damage to
any one of these tissues. Hence, it is highly recommended that a
set of enzymes must be evaluated to reach a conclusion rather
than relying on just one enzyme assay. It is critical to understand
the factors affecting an enzyme action to understand its
importance in disease diagnosis. An enzyme activity can be
altered by physiological, biochemical and anatomical factors.
The organ mass and enzyme tissue concentration play straight
forward role in enzyme activity. For example, alanine
aminotranferase (ALT) is 100,000 fold higher in cytoplasm of
hepatocytes than extracelluar fluid. Liver is a large organ hence,
any damage to hepatocytes result in sudden and higher changes
in serum enzyme activity. Similarly, cellular enzyme location
relative to the blood, urine or other body fluids determines the
change in enzyme activity in case of tissue damage. For
example, Gamma glutamyltransferase (GGT) is located on the

luminal surface of renal tubular epithelial cells and injury to

these cells result in release of GGT in to urine but not blood.
Also, it is worth noting that the enzyme activity largely depends
on the rate of clearance of enzyme from the blood, often called
as half life and it varies from minutes to hours to days. The rate
of clearance of enzymes from blood can be affected by the
disease process and may complicate the correct interpretation of
the assay. For example, pancreatic amylase activity, which is
normally cleared by the kidneys, will increase in patients with
renal failure because of the altered glomerular filtration rate. In
this case there could be a false positive interpretation of
pancreatitis. Some times change in enzyme activity could be
simply by change in its production rather than cellular injury.
Enzymes exist in multiple forms in the animal body. These
multiple molecular forms of the enzymes, referred to as the
isoenzymes or isozymes, can be distinguished from each other
on the basis of differences in various physical properties, such as
electrophoretic mobility or resistance to chemical or thermal
inactivation. However, all isoenzymes retain the ability to
catalyze the basic reaction unique to that particular enzyme. The
various isoenzymes of ALP provide us with a good xample of
such variations. For example bone Alkaline phosphatase (bALP)
is found to be increased in growing children and such increase in
the bALP is also observed during an increased osteoblastic
activity in bone diseases. Similarly, placental ALP (pALP)
production starts towards the end of a normal pregnancy. An
increase in ALP production is seen by the liver during biliary
obstruction. Hence, a clinician should be very cautious and keen
in selection of enzyme assay and interpretation of its result to
reach any conclusion.
Following are few specific enzymes commonly used for
disease diagnosis in veterinary practice.
Alanine Aminotransferase
Alanine aminotransferase (ALT), also known as serum glutamic
pyruvate transaminase (SGPT), catalyzes the reversible
transamination of L-alanine and 2-oxoglutarate to pyruvate and

L-glutamate. ALT activity is found in several body organs, but

highest magnitude is found in liver followed by heart and
skeletal muscles. The concentration of ALT in liver does not
differ when compared to muscles in horse, cattle and swine.
Hence, increased serum ALT activity is specific to hepatic
injuries in dogs and cats but not in horse cattle, swine sheep, and
goats. However, relatively mild increases in serum ALT activity
occur in biliary obstructive diseases that cause increase in serum
ALP activity remarkably. Increased serum ALT activity occurs
with a wide range of other disorders including hypoxia
secondary to anemia, metabolic diseases such as lipidosis,
nutritional disorders such as copper toxicosis, inflammatory or
infectious diseases, neoplastic diseases, and traumatic liver
injury. Increased serum ALT activity has also been associated
with numerous drugs; in many cases, these are likely
idiosyncratic reactions causing hepatocellular toxicity.
Aspartate Aminotransferase
Aspartate aminotransferase (AST) formerly known as serum
glutamic oxaloacetic transaminase (SGOT) catalyzes the
transamination of L-aspartate and 2-oxoglutatarate to
oxaloacetate and glutamate. AST activity is relatively similar
amounts in liver and in skeletal and cardiac muscle, hence it is
not specific for hepatic injuries as compared to ALT. The
activity of AST is also found in erythrocytes, and the addition of
erythrocyte lysate to serum increases the apparent AST activity.
Serum AST is increased following myocyte injury as well as
hepatocellular injury and it cannot differentiate between these
two. Hence, further testing is often required using organ specific
enzymes like sorbitol dehydrogenase (for liver) or creatine
kinase (for muscle). Longer serum half life of AST makes it
important in disease diagnosis.
Sorbitol Dehydrogenase
Sorbitol dehydrogenase (SDH) catalyzes the following reac-
tion:
Sorbitol + NAD+ ↔ fructose + NADH
To estimate SDH activity one should always collect serum or

heparinised blood because the active sites of SDH contain Zn2+.

If blood is collected with EDTA as anticoagulant, SDH activity
is inhibited. The highest concentration of SDH activity is present
in liver followed by kidney and to much lower amounts in other
tissues. However, the SDH is organ specific but it is not
preferred for diagnostic purpose because of its short half-life and
the labile nature. It is very useful when done along with ALT in
case of traumatic muscle injury. Serum SDH activity is of
greater value than serum AST activity in large animals because
of its increased specificity for hepatocellular injury.
Glutamate Dehydrogenase
Glutamate dehydrogenase (GDH) is a mitochondrial enzyme
that catalyzes the removal of hydrogen from L-glutamate to
form the corresponding ketimine acid that then undergoes
spontaneous hydrolysis to 2-osoglutarate. The liver has the
highest concentration of GDH activity followed by kidney and
small intestine. The GDH activity of non hepatic tissues is
relatively small compared to that found in liver, where GDH is
concentrated in the central areas of the lobule. In all species,
increases in serum GDH activity are considered liver specific.
As a result, there has been little or no interest in investigating
isoenzymes of GDH in serum for diagnostic purposes. GDH is a
zinc-containing enzyme whose activity
can be inhibited by EDTA. Hence, only serum or heparinised
blood should be used for estimation of GDH activity. Because of
its location within mitochondria, GDH should be released only
with irreversible cell injury.
Gamma Glutamyltransferase
Gamma glutamyltransferase (GGT) catalyzes the transfer of
gamma glutamyl groups from gamma glutamyl peptides such as
the tripeptide glutathione to other peptides, amino acids, and
water. GGT is located on the luminal surface of the proximal
tubular cells of the kidney and pancreas where it is shed into
urine and pancreatic duct respectively. Increases of serum GGT
activity are thus mostly associated with injury to liver. In liver,
GGT activity is primarily associated with the biliary epithelial
53 Advanced laboratory techniques in livestock disease

cells. Hence, serum GGT activity is a useful clinical indicator of

cholestasis in horses and cattle.
Alkaline Phosphatase
The alkaline phosphatases (ALP) are involved in hydrolysis of
monophosphates or pyrophosphates at alkaline pH. Although
many tissues or cell types have some ALP activity, cells from
liver, bone, kidney, intestinal mucosa, and placenta have the
greatest ALP activity on a per gram of tissue basis with
intestinal mucosa having the most. However serum ALP
concentration is only dependent on liver ALP. Hence, ALP is
used in cholestasis diagnosis.
Amylase
Alpha-amylase is pancreas associated enzyme that cleaves starch
and glycogen. It has been in use as a diagnostic enzyme longer
than any of the other enzymes. Highest concentration is present
in the pancreas of dogs and cats. Amylase is also produced in
the small intestines and liver, both of which may contribute to
normal serum amylase activity. Serum amylase is routinely used
as a screening test for acute pancreatitis. But renal insufficiency
also increases serum amylase activity. An increase of serum
amylase activity of two-fold or greater above the reference
interval, in the absence of renal disease, is generally considered
suggestive of pancreatitis. Therapeutic use of dexamethasone
results in a decreased serum amylase activity.
been demonstrated.
Creatine Kinase
Creatine kinase (CK) catalyzes the transfer of the high-energy
phosphate from creatine phosphate to ADP to form ATP. It has
high activity in myocardial and skeletal muscle and allows
energy storage as creatine phosphate. To a lesser amount CK
activity is also present in diaphragm and smooth muscle, and
brain. There are two distinct subunits of CK, referred to as the M
(muscle) and B (brain) subunits. These combine randomly to
form three isoenzymes of CK: CK-MM, CK-BB, and CK-MB.
Although CK isoenzyme analysis is of great importance in
human medicine as an indicator of myocardial infarction, the

need for CK isoenzyme analysis in veterinary species has not

been demonstrated.
Conclusion
Several other enzymes have been explored for use in diagnosis
and prognosis of disease and organ dysfunction in domestic
animals. Some of these have been dropped altogether or receive
limited use due to lack of specificity or accuracy. For example,
lactic acid dehydrogenase, 5’nucleotidase, glutathione
S-transferase, leucine aminopeptidase, arginase, aldolase, and
acid phosphatase, among others have limited use in veterinary
diagnosis. Numerous other enzymes are under investigation to
be used as diagnosis and prognosis for Veterinary use. Many
companies are developing reliable, quick, cheaper and easy to
use kits for estimating activity of already developed serum
enzymes to meet the increased demand of disease monitoring
and call for early diagnosis. Now in the era of molecular biology
researchers are overcoming limitations of classical enzymology
and searching new biomarker for early diagnosis of disease and
diseased condition. Many immunoassays and protein biomarkers
are under investigation. The fields or serum enzymology and
serum protein markers have been merged in human medicine. It
is the high time when veterinary medicine steps forward to meet
the demand and challenges of early and accurate disease
diagnosis of domestic animals.

7 Molecular Techniques in Animal Disease
Diagnosis
B. S. Mathapati*, B. B. Javia, D.B. Barad, B. J. Kathiriya,
G. N. Ghodasara, V. R. Nimavat, H. M. Jivani
Department of Veterinary Microbiology, College of Veterinary Sci
& A.H., JAU, Junagadh
*basavaraj.mathapati@gmail.com Mob: 9712829005
M an has been dependent upon animals to cater to the needs

of nutrition, protection and recreation since the dawn of
civilization. The benefits accrued to humanity through its
association with animals are unequivocal. From the
pre-historic times to the present, animals have always been a
prime source of food and have had a huge impact on human
health. Global livestock production is one of the fastest growing
sectors, and by 2020 it is predicted to become the most
important agricultural sector in terms of added value and
business potential, a scenario referred to as the ‘livestock
revolution’. To realize this development, the protection of
animal health plays an important role.
Animal diseases are a major and increasingly
important factor reducing livestock productivity in developing
countries in particular. The most promising applications of
biotechnology to livestock systems lies in the improvement of
animal health and production, in areas such as assisted
reproduction, increased disease resistance, nano-based and
refined diagnostic techniques, and increasingly improved
vaccines with effective delivery systems. Use of DNA
biotechnology in animal health may contribute significantly to
improved animal disease control, thereby stimulating both food
production and livestock trade. Application of advanced
diagnostics and monitoring systems will only add the much
needed impetus to this sector and hence augur well in the rapid
development.
Molecular Techniques in Animal Disease
The sharing of ecological niches by the human beings

and animals has also precipitated in the promulgation of an array
of disease problems. Multiple venues encourage or permit the
public to come in contact with animals, resulting in millions of
human-animal contacts each year, thus paving way for the
transmission of many high-risk pathogens to man through
various ways. These infections not only have devastating impact
on animal and human health but also severely affect the national
and international trade, which makes the matter of animal health
a priority issue across boundaries, thus contributing to
considerable medical, public health, legal, and economic effects.
Over the past century, microbiologists have searched for more
rapid and efficient means of microbial identification to aid in
better diagnosis and control of deadly diseases. The
identification and differentiation of microorganisms has
principally relied on microbial morphology and growth
variables. Pathogens circulating in animal populations can
threaten both animal and human health, and thus both the animal
and human heath sectors have a responsibility for their control
and eradication, which is possible by use of swift and efficient
diagnostic methods.
Anton van Leeuwenhoek first observed living
microorganisms using his simple microscope in 1676, a
discovery largely considered as the first milestone in the history
of diagnostic microbiology. The role of microorganisms in
diseases was clearly recognized 200 years after Leeuwenhoek
found his little “animalcules”, when Robert Koch established his
famous “Koch’s postulates” establishing the relationship
between pathogen and disease. In 1869, Johann Friedrich Mi-
escher, discovered a weakly acidic substance of unknown func-
tion which was later named, deoxyribonucleic acid, or DNA.
Loeffler and Frosch discovered the first animal virus in 1898
when they described the foot and mouth disease virus. James
Watson and Francis Crick discovered the molecular structure
of DNA in 1953. Walter Gilbert and Frederick Sanger, in 1977,
developed new techniques for rapid DNA sequencing, which

made it possible to read the nucleotide sequence for entire genes,

a discovery which revolutionized molecular diagnostics. The
1970s saw the use of nucleic acid hybridization and DNA probe,
which were deemed powerful tools in molecular biology, micro-
biology, virology, genetics, and forensics etc. Kary Mullis con-
ceived and developed polymerase chain reaction (PCR) in 1983,
a technology for rapidly multiplying fragments of DNA, which
has led to huge advances in the field of molecular diagnos-
tics in the past 20 years. The nucleic acid amplification technol-
ogy has opened a new century for microbial detection and iden-
tification.
Advances in molecular biology over the past 10 years have
opened new avenues for microbial identification and
characterization. With the emergence of present scientific and
advanced molecular biology tools, the scenario and perspectives
of disease diagnosis has taken a rapid leap towards advancement
in identification of many disease agents. In this respect,
molecular methods have superseded many traditional methods
owing to their high specificity and sensitivity along with the
ability to deliver rapid results. In many cases, post-mortem
necropsy and histopathology have been the primary methods for
the diagnosis of diseases that affect animal’s health. However,
these methods often lack specificity and many pathogens are
difficult to detect when present in low numbers or when there
are no clinical signs of disease. Direct culture of pathogens is
also widely used. However, these methods are time-consuming
and costly. Efforts to overcome these problems have led to the
development of DNA-based diagnostic methods including
polymerase chain reaction (PCR) amplification techniques. The
techniques offer high sensitivity and specificity, and diagnostics
kits allowing rapid screening for the presence of pathogen DNA.
The molecular diagnostic methods can be broadly classed into
three categories: PCR-based, identification/characterization of
amplicon and the genotyping methods. The emergence and
re-emergence of diseases strongly indicate the need for the
development of powerful and robust new diagnostic methods. A

brief description of the methods and their application in animal

health is given hereunder.
Nucleic acid amplification/analysis
The development of polymerase chain reaction (PCR) in the
early 1980s has revolutionized the field of molecular biology.
The technique consists basically of the enzymatic synthesis of
millions of copies of a target DNA sequence using a
thermostable DNA polymerase and a succession of cycles that
includes denaturation of the template DNA, hybridization of
specific DNA primers to the template and extension of the
primers. Thus, PCR provides a method for obtaining large
quantities of specific DNA sequences from small amounts of
DNA, including degraded DNA samples. Although PCR is
widely used in an increasing number of applications, those in the
area of microbiology and diagnosis of infectious diseases have
undergone outstanding advances in recent years.
Specific assay/ conventional PCR
PCR has proved to be a boon for the diagnosis of bacteria
implicated in causing animal diseases, when compared to the
tedious cultural and isolation methods followed. In many cases
the clinical samples are subjected directly to PCR and have the
advantage of bypassing the isolation and culturing procedures
entirely, thus quickening the whole process of diagnosis, with
the added advantage of higher accuracy and sensitivity. The
technique has been employed in the detection of brucellosis,
leptospirosis, tuberculosis, campylobacteriosis and related
bacteria which have fastidious growth requirements. Others
include pneumococcosis, meningococcal diseases, Johne’s
disease, Burkholderia, Bartonella, Listeria, Salmonella and E
coli infections, etc. The advantage of this method is evident in
the diagnosis of Mycobacterium infections when culture results
are not available.
Conventional PCR has also been used for studying viral
pathogenesis and epidemiological work, besides diagnosis.
Rabies virus can be detected at very low counts and even from
decomposed tissues, a scenario where FAT can fail. Other major

canine viral diseases where PCR based detection has been used
include canine parvovirus, canine distemper and feline
infectious peritonitis. The technique has been successfully
applied in the diagnosis of poultry viral affections like Marek's
disease, reticuloendotheliosis virus, infectious bronchitis virus,
Newcastle disease virus, lymphoproliferative disease virus and
infectious bursal disease virus. PCR based detection has been
harnessed to diagnose many equine viral agents too: equine
herpes virus (EHV) 1 and 4 in aborted equine fetuses and
nasopharyngeal swab specimens, equine infectious anaemia
and African horse sickness virus, to name a few. Others include,
foot and mouth disease, bovine viral diarrhea, blue tongue,
louping ill, rinderpest, bovine luekaemia, maedi-visna viral
disease and rotaviral infection among the ruminant viral
diseases; porcine respiratory and reproductive syndrome, pseudo
rabies, hog cholera among the swine diseases.
The technique has been successfully used for the detection of
animal parasites ranging from blood flukes, malarial parasites to
nematodes. PCR methods have been applied to differentiate
eggs, larvae within vectors and organisms from clinical and
tissue samples.
Multiplex PCR (mPCR)
The technique has been useful in detection of many pathogens.
Multiplex PCR in combination with a heteroduplex mobility
shift assay has proved to be a valuable tool for monitoring the
emergence of new subtypes of influenza viruses arising through
the phenomena of antigenic drift and shift. The subtypes of
influenza viruses A, B and influenza virus C have been
identified and differentiated in a single reaction. Multiplex PCR
has been used for the detection of Brucella spp. and Leptospira
spp. from aborted bovine fetus, thus detecting and differentiating
two organisms causing abortions in bovines at similar time of
pregnancy. Other applications include the diagnosis of
salmonellosis, campylobacteriosis, brucellosis, listerisosis, arco-
bacteriosis, pasteurellosis, leptospirosis and other bacterial
60 Advanced laboratory techniques in livestock disease

diseases wherein various genes have been targeted to

differentiate the causative organisms to the species level.
The diagnosis of helminth infections can be complicated by the
sympatry of several species in endemic areas often resulting in
poly-parasitism of hosts. The assays to differentiate up to eight
different species have been developed targeting hookworms.
Similar techniques have been developed for Diphyllobothrium
infecting animals and humans, since it is difficult to discriminate
among individual species by morphological criteria alone.
Multiplex PCR assays have also been developed for the
differential diagnosis of Taenia spp. In co-endemic areas, mPCR
can simplify diagnostics by replacing several individual tests
with one molecular assay.
Nested PCR
Nested PCR is deemed as a rapid alternative to time-consuming
cultural protocols, especially for bacteria like C. burnetii from
clinical samples (blood, buffy coat, etc.) with increased
specificity and sensitivity. Campylobacter, the most common
cause of acute bacterial gastroenteritis in the developed world,
has been detected from meat through nested PCR. Semi nested
PCR methods have been developed for the detection of Shigella
and toxigenic Vibrio cholera from environmental water samples
by an enrichment broth followed by semi-nested PCR
procedure. The technique has also been used to screen samples
from sea water and organic material to detect Vibrio
parahaemolyticus, and is preferred over the conventional most
probable number (MPN) culture technique. Several nested PCR
methods for detecting Salmonella have also been developed
utilizing primers based on specific gene sequences. Nested PCR
for detection of Cl. perfringens in feces and meat has been
reported to be 103 times more sensitive than single PCR. A
two-step PCR can increase the speed of identification of
parasitic eggs from different species and genera, a concern
particularly in endemic areas where multiple infections exist.
Molecular techniques based on genomic sequence detection like
nested PCR is assumed to be significant for the rapid diagnosis

and identification of the Filoviridae group of viruses and their

serotypes. These techniques have been gradually accepted as
new standards over virus isolation for detection of these viruses
in acute-phase serum samples. Among these, the two-step nested
RT-PCR approach is routinely practiced in almost all
laboratories worldwide.
Real-time PCR
The development of real-time (RTi-) PCR represents a
significant advancement in many molecular techniques
involving nucleic acid analysis. Real-time PCR assays have
been directed at bacterial pathogens such as E. coli O157,
Campylobacter, Listeria monocytogenes and Salmonella
Enteritidis, Yersinia pestis, Bacillus anthraces, Coxiella burnetii
and for the detection and differentiation of MAP from other
mycobacteria, all of which are zoonotic pathogens. The
quantification of Salmonella on chicken egg shell surface has
also been done through the application of this technique.
Standard laboratory protocols have also been developed for an
early detection of foodborne zoonotic in animal origin food
products and for the cross-border monitoring of livestock.
A simple multiplex real time PCR system was designed recently
for the general and simultaneous detection of inﬂuenza A, B and
C viruses, members of the Orthomyxoviridae family, originating
from both animals and humans. Similar tests are available for
the differentiation of various serotypes of foot-and-mouth
disease and classical swine fever. Real time PCR has also been
devised for the differentiation of various members of the family
Filoviridae.
In the diagnosis of various fungal diseases, testing using
real-time PCR offers several advantages over conventional
methods. The combining of target amplification and detection in
a single, closed-reaction vessel, reduces the possibility for
environmental contamination with amplified nucleic acids. This
is particularly important for fungal diagnostics owing to their
ubiquitous presence in the environmental. Methods have been
standardized for the diagnosis and differentiation of Candidia,

Aspergillus and dermatophyte infections, which remain among

the most common communicable diseases worldwide. Further,
the quantitation of fungal nucleic acid by using real-time PCR
testing may have important applications in predicting clinical
progression in transplant patients, differentiating colonization
and disease, and monitoring the efficacy of antifungal therapy.
Reverse transcription-polymerase chain reaction (RT-PCR)
RT-PCR is mostly used to detect viruses and the viability of
microbial cells through examination of microbial mRNA.
Several workers have used RT-PCR for diagnosis of Japanese
Encephalitis (JE) and other related flaviviruses, frequently and
successfully targeting genes and/or segments of genes, from
clinical samples (blood/CSF) of human, swine and horses. Some
modifications of RT-PCR RFLP analysis are successfully used
to distinguishing West Nile virus and JEV from experimentally
infected animal brain, spleen and serum sample. A range of
RT-PCR assays targeting several regions of the genome have
been used for the differentiation of the various genotypes of
norovirus and Chikungunya virus. In case of environmental
samples, RT-PCR has been increasingly applied to detect a
range of rotaviruses in water and shellfish. The RT-PCR based
tests allow rabies diagnosis even in the situation that
precludes virus isolation. The technique also finds application
in detection of specific target protein in the CSF of bovine
spongiform encephalopathy affected animal.
Microarrays
The method has been used to compare interstrain, intraspecific
variations in bacteria at the genomic level. Technique has been
used for the detection and differentiation of Campylobacter spp.
directly from fecal and cloacal swabs. Other organisms include
Salmonella, L. monocytogenes, E. coli, P. multocida,
M. hyopneumoniae, M. avium paratuberculosis, H. parasuis, R.
equi, B. anthracis, etc., wherein variants of the assay have been
applied.
DNA microarrays have been used to rapidly identify reassorted
influenza A virus strains of swine origin. A cDNA microarray

detection device for porcine reproductive and respiratory

syndrome virus (PRRS), Group A Rotaviruses, ND virus and
foot and mouth disease virus (FMD) has been developed. Based
on microarray hybridization, a diagnostic test for coronavirus
infection has been developed using eight coronavirus strains:
canine coronavirus, feline infectious peritonitis virus, feline
coronavirus, bovine coronavirus, porcine respiratory
coronavirus, turkey enteritis coronavirus, transmissible
gastroenteritis virus, and human respiratory coronavirus .
Nucleic Acid Sequence Based Amplification (NASBA)
NASBA-based detection methods have been used for detection
of pathogens in food and water including, Campylobacter spp.
(Cools et al., 2006), Escherichia coli, Salmonella Enteritidis,
Listeria monocytogenes, Cryptosporidium parvum, etc. The
NASBA technique has been used to develop rapid diagnostic
tests for several pathogenic viruses with single-stranded RNA
genomes, like influenza A, foot-and-mouth disease, severe acute
respiratory syndrome (SARS)-associated coronavirus,
Newcastle disease virus, classical swine fever virus, and porcine
reproductive and respiratory syndrome virus. Even as the
cross-species viral infections are becoming more common, there
is an imperative need for detecting animal viruses to control
potential infection in livestock. With the high sensitivity and
specificity offered by the NASBA technology, various agents
have been successfully detected and differentiated.
Loop-mediated isothermal amplification (LAMP):
The technique has been applied in the diagnosis of many
important animal diseases. LAMP assays have been developed
to detect Salmonella, Campylobacter, L. monocytogenes,
Y. pseudotuberculosis, Bacillus cereus, E. coli from meat and
clinical samples. Also, the test has been employed in the
detection of B. anthracis spores in tests using blood specimens.
LAMP offers a good diagnostic value in the detection of surra
infections. The sensitivity of the assay has been determined for
the detection of Theileria equi, Babesia and Trypanosoma
congolense in field-derived bovine blood samples. The tech-

nique has found application as a useful diagnostic tool for

examination of Cryptosporidium spp. in samples for clinical
laboratories as well as for water industries. The assay is
available for the diagnosis of Fasciola hepatica, Fasciola
gigantica, Clonorchis sinensis, Opisthorchis
viverrini, Schistosoma mansoni, and Schistosoma japonicum
from animal samples and is found to be specific.
A rapid and sensitive reverse transcriptase loop-mediated
isothermal amplification (RT-LAMP) is useful for H5N1 highly
pathogenic avian influenza (HPAI) virus, and Filoviruses like JE
and Chickungunya.
Characterization/ identification of amplicon
Automated sequence analysis -
The technique is being routinely used for the detection and
identification of bacteria, virus, fungi and parasites alike, thus
helping to combat infectious animal diseases. The sequence
databases include GenBank, RefSeq and KEGG among others.
The sequences of any microbe can be accessed from these
databases and subjected to comparison for determining the
similarity or heterogeneity with the standard sequences.
Sequencing finds application in genotyping and phylogenetic
studies can be used to determine the origin/source of the strain
responsible of introducing the disease within a country. The
recent pandemic outbreaks of HPAI and swine flu; E. coli
O104:H4 panic in Europe, are illustrations of application of this
technique for effective diagnosis and containment of animal and
foodborne diseases.
Polymerase Chain Reaction – Enzyme linked Immunosorbant
assays (PCR-ELISA)
PCR-ELISAs have been in use since the late 1980s and have
developed into an assay for detecting specific sequences within
polymerase chain reaction products. Though many methods are
available for detecting specific sequences, PCR-ELISAs are
useful for detecting and differentiating between multiple targets.
PCR-enzyme immunoassay has been applied for the detection of
Streptococcus pneumoniae, E. coli, Salmonella, Mycoplasma, C.

jejuni, L. monocytogenes and Mycobacterium tuberculosis. The

method has been validated for the detection of infectious
pancreatic necrosis virus, Peste des petits ruminants (PPR),
FMD and for the detection and subtyping (H5 and H7) of avian
type A influenza virus. The technique finds application in
detection of Leishmania infantum, Schistosoma and the malaria
parasite from both clinical and field samples.
Nucleic acid hybridization assay
Commercially available nucleic acid hybridization probes, under
the brand name AccuProbes, were introduced in 1992 by
Gen-Probe, Inc. for use with a limited number of fungi. Initially,
AccuProbes were available for Histoplasma capsulatum,
Blastomyces dermatitidis, Coccidioides immitis and
Cryptococcus neoformans. A DNA-DNA hybridization method,
developed using probes consisting of radiolabelled DNA
fragments of Salmonella Typhimurium for detection in foods
has been in use.
Single-strand conformation polymorphism (SSCP)
The bacterial 16S rDNA primers conservative region has been
used as a universal primer in order to establish a detection
method for identification of pathogenic bacteria including
E. coli, Salmonella, S. aureus, Bacillus cereus,
L. monocytogenes and Bacillus licheniformis.
Direct SSCP analysis of amplicons from seven taxa, including,
Toxocara vitulorum, T. cati, T. canis, T. leonina, Baylisascaris
procyonis, Ascaris suum and Parascaris equorum indicates the
usefulness of the SSCP-based approaches for the identification
of ascaridoid nematodes to species.
Genotyping or molecular epidemiology studies
It refers to the carrying out of epidemiological investigations to
determine the primary sources of infection with the ultimate aim
of improving public health. Multiple methods are available for
etiological source tracking and to determine the distribution of
pathogens. Some of the tools that are essential for these studies
are typing technologies that can be used to link the affected
population to the sources of bacterial contamination. Equally

important is the ability to rule out non-related isolates from a

particular outbreak, which would likely confound the
epidemiological investigation of an outbreak.
AFLP
AFLP analysis combines the beneficial traits of restriction digest
analysis and PCR amplification for genotyping. It has been
successfully used in typing schemes for E. coli O157:H7,
Salmonella, Shigella, Borrelia and Yersinia, allowing
researchers to separate isolates within specific serogroups.
AFLP is also useful for species differentiation, as in C. jejuni
and C. coli isolates and to distinguish isolates within each
species. AFLP has not yet found broad utility to parasites, and a
few reports are available on its applications to parasitic
nematodes and to protozoa, including members of the genera
Trypanosoma, Cryptosporidium, Eimeria and Plasmodium.
Arbitrarily Primed-Polymerase Chain Reaction (AP-PCR)
This method has been applied to differentiate Brucella abortus,
B. melitensis, B. canis and B. suis targeting the 16S rRNA gene.
Typing methods employing this technique have also been used
in Staphylococcus, Streptococcus and Leptospira. AP-PCR has
been used for typing isolates of Cryptosporidium parvum and
Eimeria spp. The identification of differentially expressed genes
in ileal Peyer's Patch of scrapie-infected sheep has been done
using RNA AP-PCR.
Multi Locus sequence typing (MLST)
MLST studies of bacteria involve stretches of nucleotide
sequence of ~500bp from seven loci of what are known as the
housekeeping genes. Sequence data are readily compared among
laboratories and lend themselves to electronic storage and
distribution. Furthermore, MLST can reduce the need to trans-
port live bacteria, since nucleotide sequence determination from
PCR products can be achieved from killed-cell sus-
pensions, purified DNA, or clinical material. A web site for the
storage and exchange of data and protocols for been
established (http://mlst.zoo.ox.ac.uk). While MLST is
particularly suited to long-term and global epidemiology, as it

identifies variation which is accumulating slowly within a

population, the data can be used in the investigation of
individual outbreaks. A number of studies have focused on the
development of MLST methods for foodborne pathogens and
comparison of results of MLST to more established methods.
The methods has been used and validated for a number of
organisms including B. cereus, B. henselae, C. albicans,
Salmonella spp., C. jejuni, C. neoformans, E. coli, E. faecalis, E.
faecium, H. influenza, H. pylori, Leptospira spp.,
N. meningitides, S. agalactiae, S. aureus, S. dysgalactiae,
S. enteric, S. epidermidis, S. pneumoniae, S. pyogenes, S. suis
and V.vulnificus (http://www.mlst.net/databases/default.asp).
MLST has also been applied in case of filarial parasites,
Coccidioides immitis, Leishmania spp., Cryptosporidium
hominis, Ehrlichia ruminantium, T. evansi and Giardia lamblia.
PFGE
Currently, PFGE is often considered the ‘‘gold standard’’ of
molecular typing methods for bacterial foodborne pathogens,
such as Salmonella, Shigella, E. coli, Campylobacter, Listeria,
Yersinia and Vibrio. The method has also been used in case of
Borrelia spp. It is used by the PulseNet program to identify
widespread outbreaks of bacterial foodborne illness. The most
common enzymes used for the different foodborne pathogens
include XbaI, BlnI, SpeI, AscI, NotI, SmaI or KpnI. Further, the
standardized PFGE protocols can be used to achieve high
inter-laboratory reproducibility, which in turn can be useful in
developing, maintaining and sharing data among national and
international databases. Electronic database libraries of the
different PFGE profiles of Salmonella enterica,
L. monocytogenes, and STEC strains have been created in
different countries. In these libraries, the PFGE profiles can
be compared with each other much more quickly than by
just the naked eye. Under the aegis of Indo-German
Collaborative project, a web based database, Indian Listeria
Culture Collection (ILCD) of characterized strains of Listeria
has been created. The database (http://www.icargoa.res.in/ilcd)

contains geographical source of the strain, source of isolation

(animal/human), phenotypic and genotypic characteristics, and
DNA fingerprint. This is an interactive web based database and
the data can be exchanged between laboratories electronically.
Random Amplified Polymorphic DNA (RAPD)
The simplest method for defining the heterogeneity among
isolates with no molecular insight in the genome lies in the
use of RAPD. This technique has been used successfully in
the detection and differentiation of a number of pathogenic
strains of bacteria and also for determining the mode of
transmission of a given organism. Studies have shown that
RAPD markers can be useful for the identification and
differentiation of species and strains of a range of parasite
groups, including protozoa and helminths. The technique has
been applied to differentiate the seven species of Eimeria
infecting the domestic fowl. The foodborne bacteria have wide
application of this technique as evident by its use across various
genera of bacteria like Salmonella, Campylobacter, Listeria,
E. coli, Vibrio, Aeromonas, etc. DNA amplification fingerprint-
ing (DAF), a modification of RAPD has been attempted to
determine heterogeneity in case of noroviruses, rotaviruses and
adenoviruses (http://www.biology-online.org/biology-forum/
about14156.html?hilit=STH).
RFLP
Microbes can be compared by digesting their chromosomal
DNA with a restriction endonuclease and separating the DNA
fragments by gel electrophoresis. PCR-RFLP has been widely
used in typing Campylobacter, Salmonella, E. coli, Brucella
abortus isolates, Birna viruses, infectious laryngo trachitis virus
and infectious bursal disease virus. PCR-RFLP assays have been
used successfully ito characterize species and strain differences
in the Echinococcus spp. and to differentiate Taenia saginata,
T.solium and T. asiatica with high specificity.
ERIC and Rep-PCR
Many investigators have examined the potential value of two
classes of small DNA repeats dispersed throughout the chromo-

somes in a variety of bacteria. Primers targeted against ERIC

(enterobacterial repetitive intergenic consensus) and Rep
(repetitive extragenic palindromic) sequences produce different
band patterns depending on the location of repeats within an
isolate. Both techniques have been applied to Brucella,
V. parahaemolyticus, E. coli and Listeria. The techniques have
also been used in case of M. tuberculosis and M. ulcerans, the
profiles produced wherein have been useful to categorize the
strains into three subgroups related to their endemic region.
Ribotyping
Ribotyping is a form of RFLP analysis that relies on differences
in the location and number of ribosomal RNA (rRNA) gene
sequences present in the bacterial genome for genotyping.
Differences in the number of rRNA genes and genetic variability
in the regions ﬂankingi the rRNA genes leads to the production
of distinct restriction fragment band profiles that can be used to
discriminate between bacterial strains. In previous studies,
Salmonella genomic DNA has been digested with restriction
enzymes, such as PvuII, PstI or SphI, and hybridized with
probes specific for either the 16S or 23S rRNA genes.
Ribotyping has been used to differentiate Clostridium difficle,
Staphylococcus aureus, C. diphtheria, Bacillus subtilis. E. coli,
Yersinia spp. and Shigella isolates. More recently automated
ribotyping systems, such as the Riboprinter Microbial
Characterization System, have been used for typing
Campylobacter, Salmonella and E. coli. The technique has also
been used to differentiate Giardia, Toxocara
canis and Ancylostoma. The method is highly reproducible and
allows for easier analysis due to the lack of inter-user variability.
Variable number of tandem repeat (VNTR) analysis and multi-
ple locus VNTR analysis (MLVA)
Over the past 15 years there have been major advances in the
sequencing of bacterial genomes. Through these sequencing
projects, it was discovered that many bacterial genomes contain
regions with directly repeated DNA motifs. VNTR analysis
utilizes differences in the number of repeated copies at specific

loci among strains to carry out the genotyping analysis. The

single region of repeated motif is often referred to as an array.
When using VNTR for genotyping, it is typically necessary to
look at multiple array regions to gain increased discrimination.
The approach of using multiple VNTR loci for typing is referred
to as multiple locus VNTR analysis (MLVA. To design a
VNTR/MLVA protocol, the genome sequence data for the
bacterial strain of interest are screened for likely repeat arrays.
Once the regions are identified, PCR primers are designed based
on the regions flanking the repeat array that will allow
amplification of the repeat array. Following amplification, PCR
products are separated and the product sizes are determined to
detect the number of repeats in the array. Differences in the
number of repeats present are used to distinguish different
strains. With MLVA, multiple repeat arrays are examined to
give an overall genotypic profile. One of the prime pathogens
for which MLVA methods were developed is E. coli O157:H7.
Methods have also been developed for various Salmonella
serotypes, Shigella, B. anthraces, Yersinia pestis and
Mycobacterium tuberculosis. The approach has been used to
differentiate B. abortus, B. ovis, B. melitensis, B. neotomae B.
suis and B. abortus sequence.
Conclusion:
Molecular diagnostic methods which are specific and sensitive
have been described to detect microbes in animals and vectors
and for genotyping studies. These techniques are valuable
research tools in their present form and have the ability to
replace conventional methods when a suitable method, which is
simple, rapid, specific, sensitive and inexpensive, is applied.
PCR-based diagnostics have all the potential to become the stan-
dard diagnostic test in situations where either the micro-
organism level is low, differentiation between
morphologically identical organisms is required, or whether
the immune response to the infection is uninformative. The
strong demand for improved diagnostic methods will surely lead
to the development of PCR-based test kits suitable for field

application in the next decades. The molecular tools for

epidemiological studies will provide information on the role of
polymorphisms in interactions between pathogens, hosts and
vectors. Consequently, this will lead to a greater understanding
of the aetiology and epidemiology of diseases. These
DNA-based tests have had a transformational impact upon
research into disease problems in both the veterinary and
medical sciences. Although many systems have been developed,
few have proceeded towards field trials or large-scale clinical
evaluation, with PCR application to the routine analysis of
biological samples, still a major diagnostic challenge. In order
for molecular biology to fulfill the promise of improved
diagnosis and to be adopted by regulatory authorities, thorough
trials of new methods are required and the results of these must
be disseminated. In recent years, the development of new
molecular techniques or methods has increased significantly.
However, reports of application of these techniques on a routine
basis in diagnostic laboratories are few. Moreover, there have
been little or no attempts made to standardize and harmonize
protocols between laboratories at a local, national and
international level. The disadvantage of not employing such
standardized methods may lead to anomalies in the diagnosis
and interpretation of epidemiological data, which may yield
biased results and hence question the validity of reporting of a
variety of infectious disease states.
Advanced genomic, genetic and proteomic technologies offer
huge scope for research in the veterinary field. There is also a
range of ‘‘emerging’’ technologies, such as specific and
universal microarrays, mass spectrophotometric approaches,
biosensors and ‘‘laboratory-on-a-chip’’, nano-technological
systems, some of which could have a significant impact in the
future. Clearly, there is an urgent need for improved and
practical molecular-diagnostic techniques and their critical
validation for the accredited laboratory to assist in the
monitoring and control of diseases in companion animals and
livestock.

In conclusion, molecular diagnostic techniques have a

significant role to play in clinical set-up, although their adoption
will never replace conventional methodologies, which continue
to be the cornerstone of modern bacteriological methods.
Adoption of advanced molecular diagnostic methods in
veterinary medicine and health has accelerated the growth of the
sector by way of better preventive methods and improved
production.
Reference:
1. Atkins SD and Clark IM (2004). Fungal molecular diagnostics: a mini
review. J. Appl. Genet. 45: 3-15.
2. Delgado C, Rosegrant MW and Meijer S (2002). Livestock to 2020 - the
revolution continues. In: Microarray-based detection and genotyping of
viral pathogens.
3. Espy MJ, Uhl JR, Sloan LM, Buckwalter SP, Jones EA, Vetter EA,
Yao, JDC, Wengenack NL, Rosenblatt JE, Cockerill FR and Smith TF
(2006) Real-Time PCR in clinical microbiology: Applications for routine
laboratory testing. Clin. Microbiol. Rev. 19: 165– 256.
4. Hoffmann B, Beer M, Scott M, Reid, Mertens P, Chris AL, Brown IH,
Dennis JA and King DP (2009). A review of RT-PCR technologies used
in veterinary virology and disease control: Sensitive and specific
diagnosis of five livestock diseases notifiable to the World Organization
for Animal Health. Vet Microbiol. 139: 1–23.

8 Next Generation Sequencing in Animal
Disease Investigation
B. S. Mathapati*, B. B. Javia, D.B. Barad, B. J. Kathiriya,
G. N. Ghodasara, V. R. Nimavat, H. M. Jivani
Department of Veterinary Microbiology, College of Veterinary
Sci& A.H., JAU, Junagadh
*basavaraj.mathapati@gmail.com; +919712829005
S equencing methods have improved rapidly since the first

versions of the Sanger techniques, facilitating the development
of very powerful tools for detecting and identifying various
pathogens, such as viruses, bacteria and other microbes. The
ongoing development of high-throughput sequencing (HTS; also
known as next-generation sequencing) technologies has resulted
in a dramatic reduction in DNA sequencing costs, making the
technology more accessible to the average laboratory. The
importance of nucleotide sequencing was fully realised after the
establishment of the Sanger method. For the past 35 years, this
technology has been the dominant approach for DNA
sequencing. It enabled the first viral genomes to be sequenced,
and also laid the foundation for the development of polymerase
chain reaction (PCR), which is the best-known and most
successfully implemented diagnostic molecular technology to
date. Since the first versions of the Sanger techniques,
sequencing methods have rapidly improved, generating very
powerful tools for detecting and identifying various pathogens,
such as viruses, bacteria and other microbes. An important step
in this development was the introduction of automated
multicapillary-based instruments, using fluorophore labelling
with multi-spectral imaging, later referred to as ‘first-generation
sequencing’ platforms. This type of Sanger sequencing is still
extensively used in laboratories around the world and is a

Next Generation Sequencing in Animal Disease Investigation
front-line diagnostic tool for virus characterisation, including

pathotyping and phylogenetic analysis.The ‘first-generation
sequencing’ approaches have opened up new pathways for the
detection and identification of various pathogens host
pathogen interactions and the evolution of infectious agents.
However, attempts to sequence larger genomes, such as the
whole genomes of various animal species, using multicapillary
sequencing, have encountered considerable bottlenecks in
throughput, scalability, speed and resolution. This has spurred
the development of new sequencing technologies. The
subsequent major technological advances in cyclic-array
sequencing gave rise to what is known as ‘second-generation
sequencing’ (SGS) or ‘next-generation sequencing’ (NGS).
These technologies involve iterative cycles during which the
sequences of DNA features, which have been immobilised to
constant locations on a solid substrate, are determined, one base
position at a time, using enzymatic manipulation and
imaging-based data collection. Today, there are several different
NGS platforms with tailored protocols and approaches to
template preparation and sequencing that determine the type of
data produced.
NGS- platforms
Most existing HTS platforms require the viral genomic
sequences (directly as DNA or reverse-transcribed RNA) in the
samples to be converted into sequencing libraries suitable for
subsequent cluster generation and sequencing. This process
usually consists of four main steps: 1. fragmentation of DNA,
performed by mechanical or enzymatic shearing 2. end-repair,
modification and ligation of adapters, which enable
amplification of the sheared DNA by adapter-specific primers
3.size selection of DNA molecules with a certain optimal length
for the current application or instrument 4.enrichment of adapter
-ligated DNA by PCR.The prepared sequencing library
fragments are then usually immobilised on a solid support for
clonal amplification in a platform-dependent manner to generate
separate clusters of DNA copies. The distinctive sequencing

strategies of the main commercial HTS platforms currently

available, as well as their application areas, are described briefly
below and are also summarised in Table I, together with other
properties of interest, such as running time and sequence data
output.
Table I
Current high-throughput sequencing platforms and their
Library Average Instru-

prepa- Run read Throughput ment Run Main biological
Platform ration length applications
time time (bp) per run cost cost
Roche/454
GS FLX
Titanium Up to De novo genome sequenc-
XL+ 2 h to 6 h 23 h 1,000 700 Mb ~$500k ~$6k ing and
resequencing, targeted amplicon
GS Junior 2 h to 6 h 10 h ~400 35 Mb $125k ~$1k sequencing,
genotyping, transcriptomics,
metagenomics
Illumina
HiSeq 2500 Genome resequencing,

(rapid) 3 h to 5 h 27 h 2 × 100 180 Gb $740k ~$23k targeted amplicon
HiSeq 2500 sequencing, genotyping,

(max) 3 h to 5 h 11 days 2 × 100 600 Gb $740k ~$23k transcriptomics,
7.5–8.5 metagenomics
90 min ~24 hours 2 × 250 Gb $125k $965
SOLiD
Genome resequencing,
5500 xl ~8 h 6 days 75 95 Gb $595k ~$10k genotyping,
5500 xl
Wildfire 2h 10 days 75 240 Gb $70k ~$5k transcriptomics
upgrade
Ion Torrent De novo microbial genome
PGM 4 h to 6 h $50k sequencing and
10–40 resequencing, targeted amplicon
314 Chip 2 h to 3 h ~400 Mb $350 sequencing,
characteristics

10–40 resequencing, targeted amplicon

314 Chip 2 h to 3 h ~400 Mb $350 sequencing,
genotyping, RNA-seq on
low-complexity
316 Chip 2 h to 3 h ~400 100–400 Mb $550
transcriptome, metagenomics
318 Chip 2 h to 3 h ~400 ~1 Gb $750
Ion Torrent
Proton 4 h to 6 h $149k De novo genome sequencing and
resequencing, targeted amplicon
Chip I 2 h to 4 h ~200 ~10 Gb ~$1k sequencing,
genotyping, transcriptomics,
metagenomics
Chip II 2h4h ~20 ~100 Gb ~$1k

Pacific Biosci-
ences
Not
applica- ~1,500 Microbial genome sequencing,
PacBio RS ble 2h (C1 100 Mb $700k $100 targeted
chemis- amplicon sequencing, aids
try) full-length
transcriptomics, discovery of large
structural
variants and haplotypes
base k
bp: pair :thousand
gigabase M
(1,000 b
Gb: Mb) :megabase (1,000,000 bp)
454 pyrosequencing (Roche)

The 454 pyrosequencing technology is based on
emulsion PCR (emPCR), for clonal amplification of single
library fragments on beads inside aqueous reaction bubbles, in
combination with a sequencing-by-synthesis approach. The
DNA-containing beads are loaded into individual wells on a
PicoTiterPlate, which is subjected to a cyclic flow of
sequentially added nucleotide reagents. When a
polymerase-mediated incorporation event occurs, a

chemiluminescent enzyme generates an observable light signal

that is recorded by a charge-coupled device (CCD) camera.
There are currently two platforms on the market using this
technology, the GS FLX system and the GS Junior system.
While the latest GS FLX system can now generate around 700
megabases (Mb) of sequence data with read lengths of up to
1,000 base pairs (bp) in a day, it is still associated with high
running costs and is most commonly used by larger sequencing
facilities. The GS Junior, on the other hand, is essentially a
smaller benchtop version with lower set-up and running costs
aimed at research laboratories. However, although 454
pyrosequencing has been the most commonly used technology
for HTS to date, it has a high error rate in homopolymer regions
(i.e. three or more consecutive, identical DNA bases), caused by
accumulated light intensity variance.
SOLiD (Life Technologies)
The sequencing by oligonucleotide ligation and detection
(SOLiD) technology also uses emPCR to generate clonal DNA
fragments on beads. The enriched beads are then deposited into
separate ‘pico-wells’ on a glass slide to allow sequencing by
ligation. This involves iterative rounds of oligonucleotide liga-
tion extension, during which every base is scored at least twice
by using fluorescently labelled di- or tri-base probes, with data
translated into ‘colour space’ rather than conventional base
space. While this approach provides very high accuracy, the
maximum read length is relatively short (75 bp). The SOLiD
platforms have therefore been used mainly for applications not
requiring de novo assembly of reads, such as transcriptomics,
epigenomics and resequencing of large mammalian genomes.
There are currently two SOLiD platforms available, the 5500
and the 5500xl. In addition, the Wildfire upgrade, with improved
library construction, was recently released.
Illumina (Illumina Inc.)
Illumina uses a process known as bridge-PCR to generate
clusters of amplified sequencing library fragments directly on
the surface of a glass flowcell. Immobilised amplification

primers are used in the process. The unique feature of the

sequencing-by-synthesis approach applied by Illumina is the use
of a proprietary reversible terminator technology that enables the
detection of single bases asthey are incorporated into growing
DNA strands. Briefly, a fluorescently labelled terminator is
imaged as each deoxyribonucleotide is incorporated and then
cleaved to allow addition of the next. The two most recent HTS
platforms introduced by Illumina are the HiSeq 2500, which is
available as either a new instrument or an upgrade for the HiSeq
2000, and the MiSeq. While the design and capacity of the
HiSeq 2500 make it most suitable for sequencing centres, the
MiSeq benchtop, equipped with a smaller flow cell, reduced
imaging time and faster microfluidics, is aimed at a wider range
of laboratories and the clinical diagnostic market. Illumina is
recognised to be the dominant HTS technology and also claims
to generate the industry’s most accurate data.
Ion Torrent (Life Technologies)
Contrary to other sequencing-by-synthesis methods that also use
emPCR, Ion Torrent does not rely on the detection of
fluorescence or chemiluminescence signals. Instead, it uses
ion-sensitive, field-effect transistor-based sensors to measure
hydrogen ions released during polymerase-mediated
incorporation events in individual microwells. As the
sequencing chips are produced in the same way as
semiconductors, it has been possible to increase capacity by
constructing chips with a higher density of sensors and
microwells. There are currently three different chips available
for the Personal Genome Machine (PGM), the first platform for
Ion Torrent sequencing, which range in capacity from 10 Mb to
1 gigabase (Gb). With a short run time and flexible capacity, the
PGM represents an affordable and rapid benchtop system
designed for small projects, such as identifying and sequencing
microbial pathogens.To enable even higher throughput with the
Ion Torrent technology, the Proton platform was recently
released with two different chips, aimed at sequencing exomes
and large eukaryotic genomes.

PacBio RS (Pacific Biosciences)

The PacBio RS is the first commercially available TGS platform
that is able to sequence single DNA molecules in real time
without the need for clonal amplification. This is achieved by
using a nanophotonic confinement structure, referred to as a zero
-mode waveguide (ZMW), as a window to monitor the activity
of a single DNA polymerase molecule attached to the bottom
surface. During complementary strand synthesis, each
incorporation event is recorded as it causes the release of a
nucleotide-specific fluorescent dye. Because a single-molecule
real-time sequencing chip contains thousands of ZMWs, the
PacBIO RS can handle a large number of sequences
simultaneously. Even though its throughput is lower than most
HTS platforms on the market, the PacBIO RS still has several
advantages that make it attractive for clinical laboratories and
microbiology research. Sample preparation is fast, there is no
introduction of amplification artefacts, run times are relatively
short (finished within 1 h or 2 h), and read length is the greatest
currently available (around 1,500 bp). However, in a comparison
with other sequencing platforms, the PacBio RS has been
reported to have the highest raw error rate (7% to 13%).
Future sequencing technologies
An interesting emerging technology which holds the promise of
taking HTS to the next level is offered by Oxford Nanopore
Technologies Ltd. By successfully feeding a DNA strand
through an engineered nanopore protein immobilised on a solid
surface, and thereby obtaining its sequence , this approach
finally realises a concept first pioneered during the technology
race to complete the human genome . A small-scale
implementation of the technology, termed the MinION, for
single-molecule sequencing, is currently being developed. This
sequencing device is aimed at pen-side applications, requiring
only a standard computer. A considerably larger technology
platform is also in development for large-scale studies (e.g. plant
genomes, cooperative genomics and metagenomics), called the
GridION. Both systems are scheduled for early access in spring

2013 and commercial release during late 2013. However, even

though the Oxford Nanopore systems are, it seems, those closest
to commercial release, a number of competitors have also
developed new sequencing technologies. These include
companies such as Genia, with a biological nanopore system,
and the Cambridge-based GnuBio, which is developing a
microfluidics-based sequencing system.
High-throughput sequencing as a diagnostic tool
As demonstrated by several peer-reviewed articles, HTS has
shown great potential in the detection and discovery of novel
pathogens. In this regard, it is common to distinguish between
the spread of known infections to new areas and/or the
emergence of completely novel, ‘unknown’ pathogens. Contrary
to earlier techniques, HTS is unbiased and reports all nucleotide
sequences present in the original sample. However, as with
earlier techniques, the lower limit for detection is still ultimately
determined by the abundance of pathogens in relation to host
background material. By enabling deeper sequencing to be
performed more quickly and cheaply, the continuing
development of HTS techniques is also continuing to improve
the likelihood of detecting low copy-number pathogens.
In addition, sampling, sample preparation and enrichment
protocols have all been demonstrated to have dramatic effects on
the outcome of HTS-based diagnostics, and thus should each be
considered as integral steps in the overall detection scheme.
High-throughput sequencing to unravel host-pathogen
interactions
High-throughput sequencing has the capacity not only to
discover novel pathogens and provide a detailed picture of the
virome, but also to contribute to understanding of the host
responses to various viral infections, thereby achieving a greater
knowledge of infection pathology. In this respect, HTS can
substitute for high-density arrays. Thus, when used to study
altered gene expression in viral disease, HTS could potentially
provide a better understanding of pathogenesis and aid in the
development of antiviral therapies and the identification of

genetic markers for resistance.

Conclusion:
This briefly summarised analysis of recent applications of HTS/
NGS, it can be concluded that these techniques have opened up
new possibilities:
 for the rapid and powerful detection and identification of
both known and ‘unknown’ emerging, new, infectious
agents
 to determine the complicated infection biology of disease
complexes, such as PMWS or enteric disease complexes in
young animals
 to obtain information about the entire genomic structures
of infectious agents, which can provide insights into
functions such as genomic recombination, genomic stability,
viral evolution, viral phylogeny, pathogenicity markers and
other properties of viral genomes
 to study and elucidate the processes of pathogen–host
interactions
 to study the populations and population dynamics of various
viruses and to support predictive calculations and
forecasts in viral infection biology and control
 to facilitate the development of specific diagnostic tools,
such as new PCR panels based on the results of HTS
 to support vaccine development by studying viral
populations, population dynamics, escape from vaccine
pressure and the emergence of new viral variants, which
must be included in the new vaccines
 to facilitate the effective control of infectious diseases by
supporting the development of approaches to differentiate
infected from vaccinated animals (DIVA) in vaccinology
and by supporting the control and predictive measures taken
by veterinary epizootiology and epidemiology.
It is very important to note that HTS is becoming more
and more affordable. Many HTS-based studies performed within
the field of veterinary medicine were unimaginable a few years
ago. Development has been rapid and, with the recent

introduction of affordable and fast benchtop sequencers, HTS is

more accessible than ever. Their variety of features makes it
likely that multiple HTS platforms will continue to coexist in the
marketplace, with some having clear advantages over others in
particular applications. As a consequence, it is unlikely that the
concept of ‘a general HTS’ will be validated as a diagnostic tool;
it is more plausiblethat separate platforms will be applied for
various specific purposes. However, it is not only the
sequencing platform that is important, since the whole chain of
processes from sample collection to final results after
bioinformatics analysis should be considered. We should also be
aware of, and not underestimate, the need for a structured
storage system before introducing HTS-based methods into
routine diagnostics operations. The HTS field also currently
lacks clear diagnostic standards for analysis and the comparison
of results.
Selected Reference:
1. Nie Q., Sandford E.E., Zhang X., Nolan L.K. & Lamont S.J. (2012). –
Deep sequencing-based transcriptome analysis of chicken spleen in
response to avian pathogenic Escherichia coli (APEC) infection.
PLoS ONE, 7 (7), e41645.
2. Dunne W.M. Jr, Westblade L.F. & Ford B. (2012). Next-generation and
whole-genome sequencing in the diagnostic clinical microbiology
laboratory. Eur. J. clin. Microbiol. infect. Dis., 31 (8), 1719–1726.
3. Lee S.W., Markham P.F., Coppo M.J., Legione A.R., Markham J.F.,
Noormohammadi A.H., Browning G.F., Ficorilli N., Hartley C.A. & Dev-
lin J.M. (2012). – Attenuated vaccines can recombine to form virulent
field viruses. Science, 337 (6091), 188.
4. Ramakrishnan M.A., Tu Z.J., Singh S., Chockalingam A.K., Gramer
M.R., Wang P., Goyal S.M., Yang M., Halvorson D.A. &Sreevatsan S.
(2009). –The feasibility of using high resolution genome
sequencing of influenza A viruses to detect mixed infections and
quasispecies. PLoS ONE, 4 (9), e7105. doi:10.1371/
journal.pone.0007105.

9 DNA Based Methods for Quick Diagnosis
of Haemorrhagic Septicaemia
D. B. Barad*, B. B. Javia, B. S. Mathapati and S. N.
Ghodasara
Department of Veterinary Microbiology, College of Veterinary
Science & Animal Husbandry
Junagadh Agricultural University, Junagadh-362001.
*dr.dbbarad@rediffmail.com; +919428441994
H aemorrhagic septicaemia is caused by Pasteurella

multocida type B:2, B:2,5 and B:5 in Asian countries and type
E:2 in African countries. Pasteurella multocida have five types
of capsular serotype i.e. type A, B, D, E and F. Pasteurella
multocida type A produce cholera in fowl; pneumonia in cattle,
sheep, and pig. Capsular type D of Pasteurella multocida pro-
duces atrophic rhinitis in pig and snuffles in rabbits.
Two typing systems for serotyping of Pasteurella
multocida isolates are adopted. One for capsular typing by
Carter’s IHA system and other somatic typing by the method of
Namioka and Murata or Heddleston. Diagnosis of the disease is
mainly based on the clinical sign and symptom, post mortem
findings. Confirmatory diagnosis is done by the isolation and
identification of causative agent. A variety of laboratory
diagnostic techniques have been developed over the years for
pasteurellosis and used routinely in the laboratory. The organism
is identified directly through examination of blood smear from
affected animal and can be isolated in suitable culture medium
in the laboratory. Various biochemical and serological tests are
used for the identification and serotyping of the organism. Rapid
slide agglutination test is performed on slide for rapid diagnosis;
in which floccular agglutination appear within 30 seconds in the
positive cases. Indirect haemagglutination test is carried out for
the determination of capsular types of Pasteurella multocida.
With development in biotechnological techniques for the detection of
nucleic acid, the identification and characterization of etiological

DNA Based Methods for Quick Diagnosis of Haemorrhagic Septi-
agents has become quick, easy and accurate.

1. PCR based diagnosis and typing: Numerous studies for diagnosis
and characterization of Pasteurella multocida have been carried out
with variable results. The phenotypic characterization systems by
means of morphology, biochemical typing, serotyping etc. are very
much laborious and time cconsuming. The PCR based techniques have
provided the alternative methods of characterization to overcoming the
limitations of phenotyping.
a. Pasteurella multocida specific PCR assay: The species specific
PCR assay can be applied for detection of Pasteurella multocida by
using template as either genomic DNA or bacterial colony or by using
the direct field samples such as nasal swab, morbid materials like
spleen, one marrow, and heart blood. The Pasteurella multocida can
identify all subspecies of Pasteurella multocida. The sensitivity and
specificity of this PCR offer the most compelling argument for the use
of PCR technology in laboratory to investigate the suspected HS cases
using the primer set as
KMT1T7- 5’-ATC CGC TAT TTA CCC AGT GG-3’and KMT1SP6
5’-GCTGTAAAC GAACTC GCCAC-3’ (Townsend et al1998,) by the
amplification of a 460bp fragment of DNA. This technique has re-
duced the time for diagnosis of the disease and also it is specific than
traditional one.
b. HS causing type B specific PCR assay: The PCR amplification can
also detect the serotype B specific Pasteurella multocida directly HS
causing type B specific PCR is 100 % specific for type B serotypes of
Pasteurella multocida isolates. Serotype B cultures with the any
combination of somatic antigen are identified by the amplification of a
620 bp fragment with the KT SP61: 5’- ATC CGC TAA CAC ACT
CTC- 3’ and KTT72: 5’- AGG CTC GTT TGG ATT ATG AAG-
3’primers (Townsend et al., 1998).
c. Pasteurella multocida type A specific PCR:
Primers for typing of serogroup A strains which causing number of
infection in livestock and poultry with several somatic types have been
reported to be useful in specific identification of isolates. The primers
RGPMA5: 5’- AATGTTTG CGATAG YCC GTTAGA- 3’and
RGPMA6: 5’- ATT TGG CGC CAT ATC ACAGTC- 3’gives PCR
amplicon size of 564 bp which confirms the presence of Pasteurella
multocida serotype A.
d. Multiplex PCR for Pasteurella multocida Capsular typing
Alternative to the conventional capsular serotyping system and used

for capsular types determination. The serogroup specific primers used

in this assay were designed following identification, sequence
determination and analysis of the capsular biosynthetic loci of each
capsular group. The multiplex capsular PCR assay is highly specific
and its result correlated well with conventional serotyping results with
the exception of those for some serogroup F strains.
The capsular typing of all the isolates were determined by multiplex
PCR using capsular types A,
B, D, E and F specific primers as mentioned below:
1.CAPA- F 5’- 3’TGCCAAAATCGCAGTCAG
2.CAPA- R 5’- 3’TTGCCATCATTGTCAGTG
3.CAP B- F 5’- 3’CATTTATCCAAGCTCCACC
4.CAP B- R 5’- 3’GCCCGAGAGTTTCAATCC
5.CAP D- F 5’- 3’TTACAAAAGAAAGACTAGGAGCCC
6.CAP D- R 5’- 3’CATCTACCCACTCAACCATATCAG
7.CAP E- F 5’- 3’TCCGCAGAAAATTATTGACTC
8.CAP E- R 5’- 3’GCTTGCTTGATTTTGTC
9.CAP F- F 5’- 3’AATCGGAGAACGCAGAAATCA
10. CAP F- R 5’- 3’TTCCGCCGTCAATTACTCTG
Sizes of the multiplex PCR amplicons are as follows:
Amplicon size Capsular type
1044 bp A
760 bp B
657 bp D
511 bp E
851 bp F
e. REP- PCR and ERIC- PCR: Recently Repetitice Extragenic
Palindromic (REP) and Enterobacterial Repetitive Insertion Consensus
(ERIC) PCR have been developed for the characterization of
Pasteurella multocida isolates. REP elements (33 to 40 base pair
repeats) are present in 500- 1000 copies accounting for upto 1% of the
genome (Stern et al., 1984) and are present in a wide range of bacteria
(Olive and Bean, 1999). As the REP elements are distributed widely
across the genome, it produces a multiple banding pattern. ERIC- PCR
has been successfully used to differentiate strains of Pasteurella
multocida. The visual analyses of banding pattern were in range of 100
-900 bp. The band patterns provide DNA fingerprints which allows
distinction between species and between strains within species.
f. Detection of toxigenic Pasteurella multocida: The Pasteurella
multocida capsular type D strain has been identified as causative agent
of atrophic rhinitis in pigs and snuffles in rabbits. The toxA gene of
Pasteurella multocida encodes the dermanecrotic toxin responsible for
atrophic rhinitis. The toxA gene based PCR can be used for direct

analysis of toxigenic capsular typing: A multiplex PCR assay is a rapid

Pasteurella multocida without additional hybridization.
2. Restriction endonuclease analysis (REA): Restriction
endonucleases cleave the DNAat specific nucleotide sequences and
produce a set of DNA fragments which, upon electrophoresis separate
into a characteristic banding pattern or fingerprint of the respective
genome. Restriction endonuclease analysis has been successfully used
as a tool for differentiation of strains in a variety of bacterial infections
including that cause by Pasteurella multocida. Restriction enzymes
(HhaI, HpaII, SmaI BglII, PstI, EcoRI) have been used for
characterization the different isolates of Pasteurella multocida.
3. Ribotyping: Ribotyping in conjunction with REA has been widely
used to characterize and differentiate the Pasteurella multocida
isolates. REA followed by additional hybridization with a labeled
DNA probe made easy to read the banding pattern and give the
necessary interpretation. The probe may be labeled either by radio
active or non radioactive materials.
4. Colony hybridization assay: A colony lift hybridization assay
using a commercially available multicolour detection kit was recently
developed for rapid and simultaneous detection of toxigenic
Pasteurella multocida and Bordetella bronchiseptica. The major
advantage of this assay is the ability to screen the suspect colonies in
primary isolation plate.
5. Filed alternation gel electrophoresis (FAGE):
This technique is also known as ‘Pulsed Field Gel
Electrophoresis’ (PAGE) and it is a method of fingerprinting with high
specificity and precision. PFGE analysis has consistently shown the
greater discrimination in identification of bacterial species than
ribotyping but, it has limited application in the typing of Pasteurella
multocida isolates.The major drawbacks of this technique are the
requirements of highly purified intact DNA and specialized and
expensive electrophoresis equipment, which is generally not available
in normal diagnostic laboratories (Dutta et al., 2005).
6. Detection of Pasteurella multocida by Real Time PCR: This latest
method for detection of Pasteurella multocida in field sample. This
highly sensitive and specific test than PM PCR and Multiplex PCR.
References: available up on request.

10 Recent Advances in Cancer Diagnosis
Fefar, D. T.1*, Kalaria V. A.2 and Bhadaniya, A. R.2
1
Assistant Research Scientist (IT), Office of the Registrar, JAU,
Junagadh
2
Assistant Professor, Dept of Vety. Pathology, Veterinary College,
JAU, Junagadh
*fdhaval@gmail.com; +919725632840
C ancer prevention and early detection are central to the

control of neoplasms. Application of advances in standard
diagnostic and therapeutic modalities together with a broad
interest in the development of novel translational therapeutic
strategies in animals has resulted in clinically relevant
improvements in outcome for many cancer patients. Modern
diagnostic aids are potential armament in the hands of expert
clinicians for detecting various tumors in animals in a
non-invasive way. The modality should be accepted as an aid in
the diagnosis of cancer. Cancer screening and surveillance
methods include ultrasound, mammography, digital
mammography, magnetic resonance imaging, computed
tomography, positron emission tomography and magnetic
resonance spectroscopy. Other techniques such as
immunohistochemistry, in situ hybridization (FISH, CSH), PCR,
RT-PCR (real time- PCR), flow cytometry, microarray and
micro-RNAs are used nowadays for diagnosis. The use of
enzyme histochemistry and electron microscopy expanded the
primary micro-anatomic evaluation to include biochemical and
sub-cellular ultra-structural features. This lecture highlights the
recent developments in cancer diagnostic technologies and
describes the eventual use of these technologies for clinical and
research applications.
Introduction
Neoplasm is a new growth of cells, which is formed as a result
of abnormal, excessive, uncoordinated, autonomous and

Recent Advances in Cancer Diagnosis
purposeless proliferation of cells. The neoplastic cells bear a

considerable resemblance to healthy cells from which they arise,
but serve no useful function. Cancer is the term normally used
by general public for neoplasm. The study of neoplasm is known
as oncology. Neoplasms are mainly two types- Benign and
Malignant. The neoplasm may be benign, when they are slow
growing and localized without causing much difficulty to the
patient or malignant when they proliferate rapidly, spread
throughout body, grow by invasion and destroy whatever is in
its path and may eventually cause death of patient.
Neoplasm is a chronic disease condition, which begins
many months before appearance of clinical signs. The clinical
phase of disease represents only a fraction of pathogenic
process. Cancer still remains a lethal disease of animals,
especially pet animals, despite the significant progress made in
its diagnosis and treatment in recent years. Neoplasms are
considered as the second most frequent cause of death in
humans and the first one in canines and felines. The most
common neoplasms affecting canines are mammary tumours,
mast cell tumour, lymphosarcoma, lipoma and venereal
granuloma. In-case of bovines, especially draught animals often
suffer from horn cancer, melanoma and eye cancer.
Causes of Neoplasm
There are various causes of neoplasm which include intrinsic
and extrinsic causes. The intrinsic causes include pigmentation,
species, heredity, age and sex. The dark skin coloured animals
have less skin neoplasms than light coloured animals. e.g. in
white horses melanosarcoma is common, whereas in Herford
cattle, squamous cell carcinoma occurs frequently. Some
neoplasms are found mainly in particular species like venereal
granuloma in dogs and horn cancer in cattle. Some chickens are
susceptible to leucosis while some are resistant to it. Generally,
neoplasm occurs in older animals than young ones. It is either
due to longer exposure or due to decrease ability of the host
immune response. Few tumours are peculiar to each sex, but
most of neoplasms are common in males and females.

Neoplasms are more common in males except neoplasms of

breast, uterus, gall bladder and thyroid.
The extrinsic causes are physical, chemical, biological
agents and hormones. The physical agents like X-rays, UV-rays,
α, β and γ, rays, radioactive isotopes and chronic irritation like
scars of burns and trauma, implants of plastic and glass in
prosthesis, stones of urinary tract and chronic irritation. The
chemical agents are direct acting which doesn’t require
metabolic activation and includes mainly anticancer drugs, e.g.
ethyl amine, cyclophosphamide, chlorambucil and nitrosourea;
indirect acting that require metabolic activation for development
of neoplasm e.g. Aflatoxins, vinyl chloride, benzopyrene,
2-nephthylemine, dimethyl nitrosamine, phenol and inorganic
agents, e.g., Nickel, chromium etc. The biological agents are
viruses (A) DNA virus – Papova virus, Herpes virus, Adeno
virus, Pox virus, Hepadna virus (B) RNA Virus: Retrovirus and
parasites are Spirocerca lupi causes oesphogeal tumour in dogs.
In hormones, high doses of oestrogen causes breast tumour,
steroid hormones increase the risk of benign and malignant
tumour of gonads.
Diagnosis of Neoplasms
The diagnosis of neoplasms involves the analysis of tissue and
cytology specimens obtained through several procedures,
including surgical biopsy, core or aspirational needle biopsy,
venipuncture, pleural or ascitic tap, scraping of tissue surfaces
and collection of exfoliated cells from urine and sputum.
Conventional histopathology based on assessing morphology
has remained the standard diagnostic method for many years
however, the development of advanced sophisticated
technologies like mass spectrometry, microarray and automated
DNA sequencing have opened new avenues in neoplasm
diagnosis and therapeutics. The use of enzyme histochemistry
and electron microscopy expanded the primary micro-anatomic
evaluation to include biochemical and sub-cellular
ultra-structural features.
1. Clinical Symptoms

Clinical symptoms of neoplasms vary according to the type and

nature of the neoplasm and its location in different organs. These
include gastrointestinal obstruction which may be accompanied
by bleeding which is presented as diarrhea and vomiting
(commonly associated with tumors invading the stomach, small
intestine, large intestine, or colon), hematuria (in tumors of the
kidney or bladder), Cushing’s disease, hypoglycemia, etc. (in
hormone-producing tumors such as some pancreatic, thymic and
hepatic tumors), hematological disturbances as anemia,
polycythemia, granulocytosis etc. and neurologic symptoms
such as loss of coordination or seizures (in tumors of the brain or
spinal cord). Neoplasms producing non-specific symptoms are
extremely difficult to be diagnosed for their location, referred to
as paraneoplastic disorders. These include weight loss,
low-grade fever, seizures, lethargy, loss of appetite, diarrhea,
skin rash, hair loss and general arthritic-like symptoms. These
types of neoplasms require specialized diagnostic techniques
such as laboratory screening tests, X-rays, CT scan, MRI etc.
which can provide a means for earlier diagnosis and perhaps
better long-term prognosis.
2. Imaging
A diagnosis of ‘malignancy’ is frequently suspected based on
imaging information, later confirmed on the basis of histology.
Until now, exploratory surgery or limited radiologic evaluations
are most commonly used techniques for neoplasms diagnosis
and staging. With the advent of computed tomography (CT) and
magnetic resonance imaging (MRI), it became possible to obtain
important structural and anatomic information. Molecular
imaging with magnetic resonance spectroscopy (MRS) and
positron emission tomography (PET) is currently possible in
clinical practice. These modalities permit functional,
biochemical and physiologic assessment of important aspects of
malignancy. Sites in which imaging plays a key role for the
diagnosis include brain, breast, lung and mediastinum, the
tumors arising from the abdominal organs, retro-peritoneum and
bones. Conventional radiography provides the easiest way to

diagnose the tumours of gastro intestinal tract, lungs, brain,

liver, urinary bladder, breast, bone, joints etc. in the pet and
domestic animals.
Ultrasound:
Ultrasonography uses high frequency broadband sound waves in
the megahertz range that are reflected by tissue to varying
degrees to produce images (up to 3D). It used in the diagnosis of
neoplasms of abdominal organs, heart, breast, muscles, tendons,
arteries and veins. It is useful in aiding the characterization of
lesions (shape, size, density) found on screening mammograms
in bitches having mammary tumours. While it may provide less
anatomical detail than techniques such as CT or MRI, it has
several advantages which make it ideal in numerous situations,
in particular that it studies the function of moving structures in
real-time, emits no ionizing radiation, and contains speckle that
can be used in elastography. Ultrasound has also been used for
the diagnosis of the tumorous conditions of the abdominal
organs of domestic and wild animals as well as Tumours of the
hollow organs. e.g. urinary bladder This imaging technique also
used in ultrasound guided biopsies (USGB) and ultrasound
guided fine needle aspiration biopsies (USGFNAB) to diagnose
various other pathological conditions of important visceral
organ.
Computed Tomography (CT):
Recent innovations include spiral (helical) CT, multiphase
imaging and multi detector scanning. Potential patient benefits
include rapid data acquisition and improved detection and
characterization of lesions. Spiral CT currently is the preferred
technique for detecting cancerous lesions in pulmonary organs
and liver prior to metastasectomy and for surgical planning of
pancreatic and renal cancer treatment. Cases of nasal tumours in
dogs and horses can be diagnosed and evaluated on the basis of
the CT scan. New roles for spiral CT include the detection of
pulmonary emboli, CT angiography and endoscopic viewing of
hollow organs. Dogs and cats are prone to brain and spinal
tumours which are life threatening and need to be diagnosed as

early as possible before they attain incurable stage. Brain

tumours includes the tumours of pituitary, cerebrum,
cerebellum, hypothalamus etc. and tumours of spine divide as
extradural, intradural extramedullary, or intramedullary. It is
certain that CT scan can play an important role in the diagnosis
of tumours of brain and spine in dogs and cats.
Magnetic Resonance Imaging (MRI):
In this technique powerful magnets are used to polarize and
excite hydrogen nuclei in water molecules in tissue, producing a
detectable signal which is spatially encoded, resulting in images
of the body. MRI has a number of imaging benefits including
superb soft tissue contrast, multi-planar and 3D image
acquisition, freedom from ionizing radiation and bony artifacts,
and ability to acquire biological and physiological information.
Recent advances with the use of supercoils have resulted in an
increase in sensitivity and specificity. Contrast agents used in it
are chelates of gadolinium, a lanthanide with three unpaired
electrons, which has a very strong magnetic field. MRI is the
imaging technique of choice for evaluating tumors in brain, head
and neck, spine, breast (when mammography is technically
difficult owing to dense breast, silicone implants and scarring
due to surgery/trauma), liver and adrenal glands. Recent
advances include increased speed of data acquisition and the
ability to visualize function superimposed on anatomical
changes. In veterinary field MRI has been used frequently for
detecting macro tumours of brain and spine in dogs. Dynamic
contrast-enhanced magnetic resonance imaging (DCE-MRI) is a
newer technique by which one can evaluate the kinetic
parameters such as blood flow, perfusion, vascular permeability,
and the fraction of interstitial space within a tumour. These
parameters derived from DCE-MRI present information which
is appropriate to noninvasively differentiate canine brain tumors.
Metabolic and Functional Imaging:
Functional imaging is a recent tool used in oncology and its uses
include characterization of indeterminate lesions on
conventional imaging, neoplasm staging and monitoring

response to treatment.
Positron Emission Tomography (PET):
PET can detect biologic changes in vivo using radiolabeled
tracers. It represents the metabolic activity of underlying tissue
processes such as glucose, oxygen and amino acid metabolism
or measures receptor density status. Fluorine-18
fluorodeoxyglucose (18FFDG) is used most commonly, and
closely mimics endogenous molecules. FDG enters cells and is
phosphorylated to FDG-6-phosphate, which becomes trapped
within malignant tumor cells with high glucose metabolism.
PET is the most accurate non-invasive technique for detecting
and staging lung cancer. It is superior to CT arterial portography
in detecting intrahepatic metastases in colorectal cancers and can
identify metastatic deposits in lymph nodes that are still<1 cm in
size and considered benign by CT. In contrast, PET may
recognize large masses, such as post therapy fibrotic tissue, as
benign if minimal FDG uptake is demonstrated. Limitation with
PET to tumor detection is that increased FDG uptake can also be
demonstrated in inflammatory tissue.
Magnetic Resonance Spectroscopy (MRS):
MRS is a non-invasive method for studying tumor biochemistry
and physiology. It measures signals from chemical compounds
within tissues; P31 MRS provides information on tissue
energetics and pH while H1- MRS conveys information on cell
membrane synthesis and degradation, reflecting cellular
proliferation and necrosis. MRS resonances can provide
diagnostic information on tumor grade and are used to monitor
tumor response to therapy.
3. Cytologic and Histopathological Technique
Histopathology is still a gold standard for diagnosis of tumours
but it alone does not provide sufficient details of the cellular
changes which could predict the clinical behaviour of the
tumour. Even then histopathological examination of the tumour
cells by any expert oncologist can give an accurate diagnosis
about the type of tumour and possible malignancy status. Serous
effusions from pleural, peritoneal or pelvic cavity can act as

biopsy material for diagnosis of tumours of those regions as

these may consist of the cancerous cells. Presence of
hyperchromatic nuclei, more nucleus to cytoplasm ratio,
disorientation of the cells, etc. are the cellular changes observed
in neoplastic cell. Special staining procedures can differentiate
the different types of tumours and thus help in diagnosis such as
toluidine blue stain differentiate mast cell tumour from other
tumours as it stains the metachromatic granules present in mast
cells.
4. Tumor Markers
Tumor markers are biologic or biochemical substances produced
by tumors and secreted into body fluids or present on body
tissues in higher than normal amounts. Gold and Freeman
(1965) isolated a glycoprotein molecule from specimens of
human colonic cancer and thus discovered the first “tumor
antigen”, later identified as carcino-embryonic antigen (CEA).
Tumor markers can be detected by various methods including
antigen-antibody based techniques (ELISA – enzyme linked
immunosorbent assay, radio-immunoassay, precipitin tests, flow
-cytometry, immunohistochemistry, immune-scintigraphy) and
molecular genetic methods. Measurement of the levels of tumor
marker, when used along with other diagnostic tests, can be
useful in the detection and diagnosis of some type of cancers.
However, in most instances tumor marker levels alone are not
sufficient to diagnose cancer; for example, in patients with
cirrhosis or viral hepatitis may have abnormal
Alpha-Fetoprotein (AFP) values, although usually less than 500
ng per mL but pregnancy also associated with elevated AFP
levels, particularly if the pregnancy is complicated by a spinal
cord defect or other abnormality. No single tests are yet
available with sufficient sensitivity and specificity to detect the
presence of a cancer. The field of tumor markers is ever
expanding with many new candidate markers either in clinical
use or under active evaluation. New tumour markers are
identified by the researchers from oncology from time to time to
improve the prognosis and to evaluate the behaviour of the

tumours. SC6- Ag is a new tumour marker in GIT tumours

which is considered as a valuable marker for the diagnosis of
pancreatic cancer before and after surgery. Similarly, a range of
new potential tumour markers is evolving such as
Y-Box-binding Protein-1 for neuroblastoma, adhesion molecule
L1 in oesophageal adenocarcinoma, M2 pyruvate kinase etc.
5. Serological Methods
Serological methods used in estimation of serum tumour
markers with ELISA and RIA. The ELISA is typically used to
detect and quantify antigen within biological fluids, in which the
Dual-Antibody Sandwich ELISA is being used for measuring
the concentration of 80% of tumor markers in blood or serum.
RIA is one of the most sensitive techniques for detecting antigen
or principle involves competitive binding of radio-labeled
antigen and unlabelled antigen to a high- affinity antibody.
Gamma emitting isotope such as Iodine and beta emitting
isotope such as tritium are also routinely used as labels. The
presence of CEA, AFP, PSA and other markers in the serum of
the cancer patients can be detected with the help of ELFA
(Enzyme linked florescent assay).
6. Immunohistochemistry (IHC)
IHC is based on detection of specific antigenic determinants
present in the cells of the tissues by use of polyclonal or
monoclonal antibodies. IHC has a major assistance in defining
metastatic tumors of unknown primary site. Moreover, it is of
great value in the diagnosis of undifferentiated tumors where
light microscopy is unable to discern diagnostic features such as
poorly differentiated carcinoma, anaplastic large cell lymphoma,
amelanotic melanoma or, less commonly sarcoma. For example,
expression of leukocyte common antigen (LCA) is evidence of
lymphoid origin, cytokeratins suggests an epithelial origin while
expression of S 100 protein and HMB 45 is characteristic of
malignant melanoma. This technique has been utilized
extensively to determine estrogen, progesterone and Her-2
(c-erbB2) receptor status in breast cancer in predicting response
to therapy. Detection of overexpression of c-erbB2 oncoprotein

by IHC also reported in canine mammary tumours and in

chemically induced rat mammary tumours. Yet other antibodies
directed against proteins involved in the regulation of cell cycle
like cyclin D1 and E have been reported to be of prognostic
significance in breast cancer and squamous cell carcinoma of
head and neck. Expression of other oncoproteins such as p53,
c-Myc, c-Met, LKB1 etc. is readily detected in human lung
cancer, bladder cancer and head and neck cancers. Animal
cancers such as ovine pulmonary adenocarcinoma, canine
mammary tumours, canine skin tumours, buffalo cutaneous
histocytoma and chemically induced rat tumours have been
found positive for different oncoprotein expression and tumour
proliferative markers (PCNA, Ki67) by various researchers
using IHC technique. Presence of neural markers like neuron
specific enolase (NSE) and synaptophysin are suggestive of
neuroectodermal tumors, and the markers of skeletal muscle
differentiation, desmin and myoglobin, are indicative of
rhabdomyosarcoma. Rodrigues et al. (2010) found that COX-2
and TGF-beta proteins may cooperate in the process of prostate
tumorigenesis in dog as their expression in neoplastic and
preneoplastic lesions were much higher.
7. Flow Cytometry
Over the decade, flow cytometry has evolved as an
indispensable tool in the diagnosis of hematologic malignancies.
Many new antibodies, improved gating strategies, and routine
use of multi-parameter techniques have dramatically improved
the diagnostic utility of flow cytometry. Typically, light scatter
is combined with staining for tumor-specific antigen
combinations. With the addition of technologies to fix cells for
permeabilization, intracellular antigens can also be detected by
flow cytometry. For example TdT only expressed in T cells that
reside in the thymus and a limited number of bone marrow cells.
The majority of cases of ALL and lymphoblastic lymphoma
express TdT. Therefore, if TdT cells are found in the peripheral
blood or cerebrospinal fluid, one can identify them as malignant
cells. The majority of B-lineage ALL cells expresses TdT, CD19

and CD10 with a smaller number expressing CD34. Any

combination of these markers (all of which are found on normal
cells in the bone marrow) with the addition of certain aberrant
markers such as CD13, CD33, or CD15 may uniquely identify
the ALL cells from normal bone marrow or peripheral blood
cells. CLL can also be identified in the peripheral blood and
bone marrow by flow cytometry. Coexpression of CD5 with
either CD20 or CD19 or CD5 with kappa and lambda light chain
may detect minimal residual disease to less than 5% sensitivity.
Three-color flow analysis using CD5, CD20, or CD19 with
kappa and lambda may increase this sensitivity to less than 1%.
The use of flow cytometry in the veterinary clinical laboratory
for the diagnosis of blood malignancies had increased
considerably during the past decade. The most common
applications of flow cytometry in small animal oncology are
measurement of DNA content in tumours and immune-
phenotyping of haematopoietic malignancies.
8. Fluorescence In Situ Hybridization (FISH) Technique
This technique involved the specific hybridization of a labeled
nucleic acid probe to complementary gene sequence and
subsequent visualization by autoradiographic or immune-
cytochemical method in tissue section, smears or
cytocentrifuged cell suspensions. Chromosome abnormalities
are frequently found in malignant cells. Chromosome
rearrangements can be duplications (addition of chromosome),
deletions (loss of whole or parts of chromosomes), segmental
amplifications (random reiteration of segments or extra
fragments), translocations (exchange between chromosomes)
and inversions (reversal of orientation). It is applicable to
interphase cells and is more sensitive compared to conventional
cytogenetic methods. Comparative genomic hybridization
(CGH) is a newly described method developed in 1992 and used
globally for studies of chromosomal gains and losses in genomic
complement. In CGH, test and reference genomic DNA are first
differentially labeled with different fluorescent dyes and co
hybridized to normal metaphase chromosomes. Then,

fluorescent signals along each chromosome are examined and

analyzed to provide a cytogenetic pattern of gains and losses.
Several investigators have found this method to be useful in
cancer studies, suggesting that different tumor types or different
stages of tumor progression have distinct CGH patterns. These
quantitative changes are related to modification in expression
level of genes located in the target region. Authors found a
substantial degree of correlation between the two levels of
information. To increase resolution, several groups have adapted
array technology to CGH, leading to so called array-CGH. Array
-CGH has now been established as a new method for molecular
characterization of cancers. Moreover, it can serve as a starting
point for further screening investigations, such as genome-wide
gene expression profiling.
9. Polymerase Chain Reaction (PCR)
Molecular oncology studies the alterations in genetic and
biochemical processes at the molecular level. It helps in
establishing a definitive diagnosis and classification of tumors
based on the recognition of complex profiles (‘finger-prints’) or
unique molecular alteration that occur in specific tumor types.
The changes can be studied on chromosomes, DNA or RNA.
Microsatellite markers, also known as simple sequence repeats
or SSRs are scattered widely within the biological genomes and
closely linked with many important genes. In carcinogenesis,
microsatellites often display loss of heterozygosity (LOH) as
tumour suppressor genes. These are highly polymorphic
repetitive DNA sequences that are randomly distributed
throughout eukaryotic genomes displaying high levels of
variation and are having high mutation rates (1-4 per
generation). PCR allows early diagnosis of malignant diseases
such as leukemia and lymphomas, which is currently the highest
developed in cancer research and is already being used
routinely. PCR assays can be performed directly on genomic
DNA samples to detect translocation-specific malignant cells at
a sensitivity which is at least 10,000 fold higher than other
methods. Quantitative PCR methods allow the estimation of the

amount of a given sequence present in a sample a technique

often applied to quantitatively determine levels of gene
expression. Real-time PCR is an established tool for DNA
quantification that measures the accumulation of DNA product
after each round of PCR amplification. Real-time PCR has
engendered wider acceptance of the PCR due to its improved
rapidity, sensitivity, reproducibility and the reduced risk of carry
-over contamination. There are currently five main chemistries
used for the detection of PCR product during real-time PCR.
PCR act as an important tool for the diagnosis of the virus
induced tumours of the animals such as cutaneous
papillomatosis in cattle, urinary bladder tumours of cattle and
buffaloes, equine sarcoids, papillomatosis in dogs.
10. Microarray
Microarray has emerged as a powerful tool to increase the
potential of standard methods through genome wide biology
studies. Carcinogenesis is a multistep process that is the
outcome of the accumulation of several genetic and epigenetic
events. DNA array is a powerful and effective tool for detecting
specific mutations, small insertions and deletions in
non-repetitive sequences. DNA microarray technology is a
promising approach that allows both qualitative and quantitative
screening for sequence variations in the genomic DNA of cancer
cells. Relevance of cancer markers identified by genomic or
proteomic analysis in the diagnostic, prognostic and therapeutic
of cancer can be evaluated with tissue microarrays or tissue
chips. Sequencing by hybridization is conceptually based on the
construction of unknown sequences from hybridization data.
Labeled DNA for analysis binds strongly only to those targets
that are fully complementary to one of its subsequences.
Specific binding profile is further checked by a computational
algorithm to deduce the whole original sequence.
Mutational Analysis:
Detection of mutations in cancer is of major importance for both
basic understanding of the disease process and clinical practice.
High-density oligonucleotide arrays are commonly used to

achieve this purpose. Many early applications of this method

concerned breast cancer–associated genes BRCA1 and BRCA2.
From this initial success, one can easily predict the impact of
specific “mutation arrays” which test for a variety of known
mutations innumerous oncogenes, tumor suppressors, and other
genes shown to be of interest in cancer.
Polymorphism Genotyping
Microarray is an appropriate tool to understand how sequence
polymorphism may impact biologic functions and be associated
with heritable phenotypes. Single nucleotide polymorphisms
(SNPs) are the most abundant form of DNA polymorphisms.
SNP microarray is an oligo array in which SNPs are screened by
a set of oligonucleotide probes. In a first approach, different
oligonucleotides can be used to identify several thousand SNPs
and then specific oligonucleotides can be used to genotype these
SNPs in various samples. SNP microarrays have potential
applications in loss-of heterozygosity (LOH) analysis in disease
susceptibility and pharmaco-toxicogenetic studies.
Screening of Genomic Imbalance
Among genetic changes occurring during carcinogenesis,
chromosomal rearrangements with gene copy number
fluctuations (including gains and losses of nucleic material)
occur frequently. Amplification of oncogene and/or deletion of
tumor suppressor gene is a key event in several kinds of cancer.
In array-CGH, targets are cloned DNA (bacterial artificial
chromosome, yeast artificial chromosome, cosmid, or cDNA)
arrayed onto microscopic glass slides. They allow locus-by-
locus screening of copy number changes.
Evaluation of Gene Expression:
Microarray-based expression comparison indicates a panel of up
or down regulated genes that are considered as molecular
markers for cancer. Expression of genes differs in different types
of tumours and may explain some traits, e.g. iodothyronine
deiodinase mRNA was overexpressed in a human hemangioma
conferring severe hypothyroidism to the young patient bearing
this tumor. From complex changes accompanied by human

B-cell chronic lymphocytic leukemia progression, Stratowa et

al. (2001) proposed a panel of cancer markers significantly
associated with disease staging and patient survival as decreases
in expression of interleukin (IL)-1-beta, IL-8, and early growth
response protein-1 (EGR1) indicate late stage and combination
of decreased expression of L-selectin, integrin beta-2, IL-1-beta,
IL-8, and EGR1 and high expression of the TCL1 gene is
indicative of low survival. Another example, cDNA microarray
screening has identified 176 genes that share a distinct
expression pattern between mutated BRCA1 and BRCA2
hereditary breast cancers.
Tissue Array:
Relevance of cancer markers identified by genomic or proteomic
analysis in the diagnostic, prognostic and therapeutic of cancer
can be evaluated with tissue microarrays or tissue chips. This
consist of a set of small cylindrical sections (600 ìm in diameter,
5 ìm thick) acquired from formalin-fixed tissues and arrayed on
a glass slide. Typical tissue microarrays contain 500 to 1,000
sections. They are used in large-scale screening of tissue
specimens for in situ detection of DNA, RNA, and protein
targets or to survey gene amplification. IHC of arrayed tissue
allows measurement of protein levels and has become a
mainstay in a two-phase strategy with microarray based gene
expression profiling. Indeed, tissue arrays may become a
validation tool used in a second analysis to focus on individual
targets differentially expressed in cancer by global methods.
11. Micro RNA (mi-RNA) based diagnosis
Micro-RNAs (miRs) are important regulators of mRNA and
protein expression which play important yet complex roles in
neoplasms. Multiple mechanisms can mediate miR
dysregulations in human cancers, including chromosomal gains
or losses, mutations of miR located loci or epigenetic
aberrations. Any misstep in miR biogenesis can also affect miR
expression, exemplified by the down-regulation of Drosha and
Dicer being associated with worse survival in ovarian, lung, and
breast cancers. MiRs can be either over- or under-expressed,

functioning as tumour suppressors or oncogenes, depending on

their downstream target genes. MiR-15a and miR-16-1 are two
of the first described down-regulated miRs in chronic
lymphocytic leukemia, both targetsBcl-2; thus their absence
inhibits apoptosis. Alternatively, miR-21, one of the most
commonly over-expressed miRs in solid malignancies, targets
PTEN and proapoptotic genes; hence pro-survival signals
dominate.
Conclusion
There is increasing interest in the development of new and
sensitive techniques to screen and diagnose the neoplasm as
early as possible, especially in high-risk groups where
conventional technology falls short. Although histopathology
remains the standard conventional method for cancer diagnosis
but recent techniques such as imaging (MRI, CT and MRS),
IHC, PCR, flow cytometry, FISH, CSH and microarray
contribute a major breakthrough in diagnosis, prognosis and
treatment of neoplasms. IHC enables to detect the expression of
tumour markers and oncoproteins. Ultrasonography is also
limited in resolution and its diagnostic application is as an
adjunct to mammography in mammary tumours. Currently MRI
is the next most widely used imaging modality, has been
demonstrated to have efficacy in local staging, in evaluating
extent of disease and, more importantly, in using architectural
enhancement to differentiate benign from malignant lesions.
Similarly molecular techniques used to detect cellular DNA
mutations, genetic alterations, abnormal expression of certain
genes are Polymerase Chain Reaction (PCR), reverse
transcription-PCR (RT-PCR) and in situ hybridization. The most
exciting application of this modality is, perhaps, for screening
and early detection in high-risk populations. It is likely that, as
our understanding of functional and molecular characteristics of
tumors improves, a multimodal imaging approach will evolve,
enhancing diagnostic accuracy and lowering the current
threshold for detection, thus minimizing the loss of lives due to
neoplasms.

Selected References
1. Culmsee K. and Nolte I. 2002. Flow cytometry and its application in
small animal oncology. Methods Cell Sci., 24(1-3): 49-54.
2. Forozan F., Karhu R. and Kononen J. 1997. Genome screening by
comparative genomic hybridization. Trends Genet., 13:405-409.
3. Garzon R., Calin G.A. and Croce C.M. 2009. MicroRNAs in cancer.
Annu. Rev. Med.,60:167- 179.
4. Gold P. and Freeman S.O. 1965. Demonstration of tumor specific
antigens in human colonic carcinomata by immunological tolerance and
absorptions techniques. J. Exp. Med. 121: 439-62.
5. Horn Y., Beal S.L. and Walach N. 1982. Further evidence for the use of
polyamines as biochemical markers for malignant tumors. Canc. Res., 42:
3248-51.
6. Johnson P.J. 2001. The role of serum alpha-fetoprotein estimation in the
diagnosis and management of hepatocellular carcinoma. Clin. Liver Dis.,
5: 145-159.
7. Katz-Brull R., Lavin P.T. and Lenkinski R.E. 2002. Clinical utility of
proton magnetic resonance spectroscopy in characterizing breast lesions.
J. Natl. Cancer Inst., 94: 1197–1203.
8. Misdrop W. 2002. In: Tumors of domestic animals, ed. Meuten D.J., 4th
ed., Iowa State press, Ames IA. pp. 575-606.
9. Pawaiya R.V.S. 2005. Pathology of chemically induced neoplasms and
evaluation of molecular markers in diagnosis of animal tumours. Indian
J. Vet. Pathol., 29(1): 63.
10. Pollard R.E., Reilly C.M., Uerling M.R., Wood F.D. and Feldman E.C.
2010. Cross-sectional imaging characteristics of pituitary adenomas,
invasive adenomas and adenocarcinomas in dogs: 33 cases (1988-2006).
Vet. Intern. Med., 24:160-165.
11. Sapolsky R.J., Hsie L. and Berno A. 1999. Highthroughput polymorphism
screening and genotyping with high-density Oligonucleotide arrays.
Genet. Anal., 14: 187-192.
12. Stratowa C., Loffler G. and Lichter P. 2001. CDNA microarray gene
expression analysis of B cell chronic lymphocytic leukemia proposes
potential new prognostic markers.

11 Use of Different Clinico-Pathological Tests in
Disease Diagnosis
Fefar, D. T.1*, Kalaria V. A.2 and Bhadaniya, A. R.2
1
Assistant Professor (IT), Office of the Registrar, JAU, Junagadh
2
Assistant Professor, Dept of Vety. Pathology, Veterinary
College, JAU, Junagadh
*fdhaval@gmail.com; +9197256 32840
T his lecture is only confined to use of important organ

function test to determine the diagnosis of disease in animal. It
includes Kidney function test, Liver function test and other
important organ like pancreas. These are number of test which
can help in diagnose the condition but at the field level as per the
Indian scenario, these are some test which becomes more useful
to determine the condition of animal.
Kidney Function Test
The kidneys are part of the urinary system and perform many
different functions for the body. They include filtration and
elimination of metabolic wastes, regulation of water and
electrolyte balance and conservation of nutrients such as glucose
and amino acids.
The kidney has many roles, including
 Elimination of metabolic waste: Urea, creatinine
 Fluid, electrolyte and acid-base balance: Balance of Sodium,
Chloride, Potassium, Calcium, Phospurus etc
 Conservation of nutrients: Glucose, amino acids
 Endocrine function: Erythropoietin, Vitamin D,
Prostaglandins, Renin
Types of renal disease
Pathology of the kidney can be generally classified as acute or
chronic. It leads to a loss of ability to concentrate or dilute
tubular filtrate, to eliminate nitrogenous wastes and to maintain
acid-base status.
Acute renal injury

Use of Different Clinico-Pathological Tests in Disease Diagnosis
Acute renal injury is characterized by a deterioration in renal

function over hours to days, resulting in a failure of the kidney
to excrete nitrogenous waste and maintain fluid, electrolyte and
acid-base status. Acute renal injury can be corrected, however it
may progress to chronic renal disease. Acute renal injury can
result from the following causes:
Decreased renal perfusion from prerenal causes (e.g.
hypovolemia due to dehydration).
Intrinsic renal disease. This can be due to acute tubular
necrosis (nephrosis) or inflammation (nephritis).
Nephrosis: Acute tubular necrosis is usually due to traumatic,
ischemic or toxic injury. Ischemia is the most common
cause of acute renal failure in animals and can be primarily
due to prerenal causes. Most cases of ischemic renal tubule
injury are reversible if the underlying cause is corrected,
unless there has been extensive necrosis or vessel injury.
Examples of nephrotoxins that produce acute renal failure
are aminoglycosides (all species), acorns (large animals) and
ethylene glycol (companion animals).
Nephritis: Renal failure in nephritis probably results from
vasculitis or vascular compression secondary to interstitial
infiltrates. Causes include leptospirosis, Rocky Mountain
Spotted Fever, ehrlichiosis and bacteremia.
Post-renal causes. This is usually due to outflow obstruction or
rupture.
Chronic renal disease
Chronic renal disease is due to slowly progressive, chronic
deterioration of kidney function and may be preceded by acute
renal injury in some (but not all) cases. Chronic kidney disease
progresses through four stages.
Stage 1 – Decreased renal reserve
During this period, there may be an upward trend in urea and
creatinine, but are still within reference intervals. There are no
clinical signs, but the kidneys are less able to compensate for
dehydration or decreased perfusion.
Stage 2 – Chronic renal insufficiency

Additional loss of renal function will lead to decreased urine

concentrating ability and polyuria, eventually accompanied by
azotemia. However, other clinical signs of uremia are not yet
present.
Stage 3 – Chronic renal failure
Clinical signs of uremia accompanied by worsening azotemia
develop as the kidney disease progresses. At this stage, the
animal is considered to be in stage 3, or chronic renal failure.
These animals may also develop additional laboratory
abnormalities such as metabolic acidosis.
Stage 4 – End-stage renal disease
The kidney can no longer produce much urine and the animal
becomes oliguric and severely uremic, with very severe changes
on serum chemistry. The oliguria and severe lab changes can be
similar to the presentation of animals with acute renal injury, but
animals in the end stage of chronic kidney disease will have a
longer time course of disease that included a period of polyuria.
An acute exacerbation of renal disease may occur in
some patients with chronic renal failure (“acute on chronic”
renal failure). The most common cause of chronic renal failure
in large animals is glomerulonephritis. In small animals, both
glomerulonephritis and amyloidosis can produce chronic renal
failure. Some breeds are predisposed to amyloidosis, e.g.
Sharpei, Beagles, Oriental and Siamese cats. In addition, many
breeds suffer from inherited renal dysplasias which result in
chronic renal failure, e.g. Samoyeds, Bull Terriers and
Soft-coated Wheaten Terriers. Often proteinuria is the first sign
of renal disease in breeds with inherited renal disease. Both
acute and chronic renal failure have similar laboratory features,
including azotemia, hyperphosphatemia, and metabolic acidosis
with a high anion gap. Differentiation of acute renal injury from
chronic renal disease can be difficult but can be accomplished
by assessment of clinical signs, laboratory features and history.
Azotemia
Azotemia is a laboratory abnormality and is defined as an
increase in urea nitrogen and creatinine. It can result from a

variety of disorders including, but not limited to, renal failure.

Uremia is the term for the clinical syndrome of renal failure with
azotemia and multisystemic problems such as polyuria,
polydipsia, vomiting, weight loss, depression, and other
sequelae of inadequate renal function (alterations in electrolyte
and acid-base balance and water homeostasis).
Azotemia can be due to prerenal, renal or post-renal
causes. Differentiation of the causes of azotemia requires
urinalysis (especially assessment of urine specific gravity),
evaluation of clinical signs and results of other diagnostic tests
(e.g. radiographic evidence of urinary tract obstruction).
Remember that the kidney is essential to acid-base and
electrolyte homeostasis. Any cause of azotemia will result in
retention of organic acids normally excreted by the kidney (i.e. a
high anion gap metabolic acidosis) and hyperphosphatemia.
Prerenal azotemia
Prerenal azotemia is due to a decrease in glomerular filtration
rate (GFR) from circulatory disturbances causing decreased
renal perfusion (hypovolemia, cardiac disease, renal
vasoconstriction). Prerenal azotemia can usually be
distinguished from renal azotemia by clinical signs (evidence of
dehydration or hypovolemia), urinalysis (urine should be
“adequately” concentrated i.e. > 1.030 in the dog, > 1.035 in the
cat, > 1.025 in large animals; with no evidence of renal tubule
dysfunction such as proteinuria, cylindriuria) and response to
therapy. Urine specific gravity may be decreased (despite a
prerenal azotemia) if there are other factors reducing
concentrating ability (see urine specific gravity). Therefore,
often a response to therapy (fluid administration) is required to
differentiate between a primary renal and prerenal azotemia (the
azotemia should correct with appropriate fluid therapy within 24
-48 hours in a pre-renal azotemia).
Many causes of prerenal azotemia will result in renal
hypoxia and ischemia. If this is severe or chronic enough, a
primary renal azotemia may result, and may co-exist with a
prerenal azotemia. As urea levels in blood are dependent on flow

rate through the renal tubules (decreased flow rate in prerenal

azotemia enhances renal absorption of urea, and increases urea
levels in blood), urea may increase without any increase in
creatinine in early pre-renal azotemia.
Renal azotemia
Renal azotemia results from decreased GFR when more than ¾
of the nephrons are non-functional. Renal azotemia may be due
to primary intrinsic renal disease (glomerulonephritis, ethylene
glycol toxicity) or may be secondary to renal ischemia from
prerenal causes or from kidney damage from urinary tract
obstruction (post-renal azotemia). Loss of kidney function
(which manifests as azotemia, which requires loss of 3/4 of
kidney mass) usually follows concentrating defects (requires
loss of 2/3 of kidney mass), therefore isosthenuric urine (USG
1.008-1.012) is common in renal azotemia.
Azotemia with a urine specific gravity less than
adequate is presumptive evidence of renal azotemia or renal
failure unless there are other diseases or conditions affecting
urine concentrating ability independently of renal failure. The
greatest difficulty in differentiating renal from prerenal azotemia
is encountered in those cases with a urine specific gravity
greater than isosthenuric, but less than adequate (< 1.030 in the
dog, < 1.035 in the cat and < 1.025 in large animals). In
addition, there may be other evidence of renal tubular
dysfunction in the urinalysis (such as proteinuria, granular or
cellular casts, and glucosuria without hyperglycemia).
Note that in cats, primary glomerular disease may occur
without loss of renal concentrating ability (so the cat may have
renal azotemia with concentrated urine). In horses and cattle,
increases in urea are modest in renal azotemia due to excretion
of urea into the gastrointestinal system (the urea is broken down
into amino acids in the cecum and rumen, respectively).
Therefore, creatinine is a more reliable indicator of GFR in these
species.
Other findings in renal azotemia
Other findings that are useful for assessment of renal azotemia

include changes in: phosphate and calcium, electrolytes and acid

base, albumin and the presence of a non-regenerative anemia.
Phosphate and calcium
Phosphate is primarily excreted through glomerular filtration in
the kidneys in most mammals, so decreased GFR leads to
increased serum phosphate. However, cattle and horses with
decreased GFR may not always have hyperphosphatemia due to
other sources of phosphate elimination such as saliva and GI
tract.
Calcium concentration in renal failure patients is highly
variable, and can be decreased, normal, or increased due to a
variety of mechanisms. If there is decreased calcitriol synthesis
by the kidney, it will contribute to decreases in total and ionized
calcium. Hyperphosphatemia can lead to increased complexing
of calcium with anions, causing an increase in total calcium
without an increase in ionized calcium.
Electrolytes and acid-base
Potassium is often increased in oliguric renal failure and
post-renal azotemia due to reduced urinary elimination of
potassium. The following electrolyte abnormalities are observed
in different species with renal failure:
Bovine: Decreased sodium chloride is seen, with decreases in
chloride being most consistent. This is associated with a
concurrent metabolic alkalosis. Hypokalemia may be seen in
polyuric renal failure, and hyperkalemia is seen in oliguric renal
failure. Hypocalcemia (total calcium) is common as is increased
fibrinogen.
Equine: Often see a decrease in sodium chloride (especially
chloride). In acute renal failure, total calcium is often low and
phosphate is high (especially in young horses), whilst in chronic
renal failure, hypercalcemia (total calcium) and
hypophosphatemia occur (not in all cases). Hyperkalemia is a
feature (with low sodium and chloride) of uroabdomen.
Small animals: Hyperkalemia is usually only seen in anuric or
oliguric renal failure. Total calcium is often normal (may be
increased or decreased, especially in the dog), hypokalemia is

common in cats in polyuric renal failure and hyper

fibrinogenemia is often seen in cats with acute or chronic renal
failure.
Anion gap:
A high anion gap metabolic acidosis is common in all species
with renal failure. This may be due to decreased renal
elimination of “uremic acids”, such as phosphates, sulfates, and
citrates that are normally excreted by the kidneys. Significant
decreases in GFR can cause build-up of these acids.
Additionally, volume depletion can lead to decreased perfusion
and increased lactic acid that can contribute to an increased
anion gap. Bicarbonate may be decreased in kidney disease due
to “titration” from uremic acids or lactic acid and/or impaired
tubular reabsorption of bicarbonate/secretion of H+.
Albumin:
Albumin can be decreased with glomerular disease due to large
losses of albumin into the urine through the damaged glomeruli.
In this case, there is usually a marked proteinuria on the
urinalysis.
Non-regenerative anemia:
Non-regenerative anemia can occur with chronic kidney disease
due to decreased erythropoietin production. In acute renal injury,
the clinical course is usually too rapid for decreased
erythropoietin to contribute to the anemia. If non-regenerative
anemia is present in animals with acute renal injury, other
mechanisms should be considered (e.g. anemia of inflammatory
disease).
Post-renal azotemia
Post-renal azotemia results from obstruction (urolithiasis) or
rupture (uroabdomen) of urinary outflow tracts. This is best
diagnosed by clinical signs (e.g. frequent attempts to urinate
without success or presence of peritoneal fluid due to
uroabdomen) and ancillary diagnostic tests (e.g. inability to pass
a urinary catheter) as urine specific gravity results are quite
variable. Animals with post-renal azotemia are markedly
hyperkalemic and hypermagnesemic. Uroperitoneum can be

confirmed by comparing the concentration of creatinine in the

fluid to that in serum or plasma; leakage of urine is indicated by
a higher creatinine in fluid than in serum. Post-renal azotemia
can result in primary renal azotemia (failure) due to tubule
dysfunction from impaired renal flow.
Laboratory indicators of renal disease:
These include markers of glomerular filtration rate (GFR), such
as urea nitrogen and creatinine. A urinalysis is an essential part
of assessment of renal function as well. Since the kidney affects
other test results, including proteins (particularly albumin) and
electrolytes and minerals, these test results should be interpreted
along with changes in more direct renal tests indicating renal
dysfunction.
Markers of GFR: Urea nitrogen, creatinine, cystatin C,
symmetrical dimethylarginine (SDMA).
Urinalysis: In particular urine specific gravity, urine sediment
examination (cells, crystals and casts), chemical constituents and
gross features.
Urea
Measurement of urea concentration in serum is included in
chemistry profiles mainly to screen for decreased glomerular
filtration rate (GFR). The test for measurement of urea
concentration is called urea nitrogen (UN) or serum urea
nitrogen (SUN) (blood urea nitrogen [BUN] is not technically
correct as UN is not measured in blood); this is where only the
concentration of the nitrogen component of urea is measured.
Test interpretation
Increased urea concentration
Artifact: severe icterus (increased total bilirubin), ammonia
contamination (uncommon)
Pathophysiologic
Increased protein catabolism: Fever, burns, corticosteroid
administration, starvation, exercise.
Increased protein digestion: Hemorrhage into the
gastrointestinal system, high protein diets.
Decreased GFR (azotemia): Due to prerenal, renal or postrenal

causes.
Note that urea will be increased with a normal creatinine in the
following situations:
Increased production of urea, e.g. protein catabolism.
Early prerenal azotemia (urea resorption in proximal convoluted
tubules is affected by flow rate through the tubules – slowing
down of proximal tubular flow rate will increase urea absorption
whereas creatinine concentrations are not affected since
creatinine is not resorbed in the tubules in most species).
Decreased urea concentration
Pathophysiologic:
Decreased protein intake or protein anabolism: Dietary
restriction of protein, young animals (high anabolic rate).
Increased excretion: Any cause of polyuria, e.g.
hyperadrenocorticism, diabetes mellitus.
Decreased production: Liver disease, enzyme deficiencies in
urea cycle.
Creatinine
Creatinine is produced as the result of normal muscle
metabolism. Phosphocreatine, an energy-storing molecule in
muscle, undergoes spontaneous cyclization to form creatine and
inorganic phosphorous. Creatinine is filtered freely through the
glomerulus and is not reabsorbed in the tubules. Therefore,
creatinine is considered a more reliable measure of GFR,
compared to urea nitrogen, in most species, except for ferrets, as
it is not influenced by diet or protein catabolism. Measurement
of creatinine concentration in serum or plasma is included in
chemistry profiles mainly to screen for decreased glomerular
filtration rate (GFR).
Test interpretation
Increased creatinine concentration
Artifact: When measured by the Jaffe technique (which is based
on color production and is used by the chemistry analyzer at
Cornell University), both creatinine and non-creatinine
chromogens react with the reagent. Non-creatinine chromogens
include acetoacetate, glucose, vitamin C, uric acid, pyruvate,

cephalosporins and amino acids. When present in high

concentrations, these can falsely increase creatinine values.
Physiologic causes:
Physiologic: Creatinine is higher in premature and newborn
foals (up to 8 mg/dL in newborn foals; this is thought to be due
to defective placental transfer with the allantois containing more
creatinine than plasma and should decline within 3-5 days) and
heavily muscled horses (up to 2.5 mg/dL). Creatinine
concentrations are higher in greyhounds (with a published upper
reference limit of 2.0 mg/dL), presumably due to increased
muscle mass (Dunlop et al 2011).
Increased production: A mild increase in creatinine (< 1 mg/
dL) may be seen after ingestion of a recent meat meal.
Pathophysiologic causes:
Decreased GFR: Creatinine will increase with azotemia or
decreased GFR that is due to prerenal, renal or post-renal causes.
In ruminants and horses, creatinine is a better measure of GFR
than urea nitrogen (due to gastrointestinal excretion and
degradation of urea). Creatinine is a fairly insensitive marker of
GFR, being increased with approximately a 1/3 reduction in
renal function as measured by GFR (based on inulin clearance)
and a 75% decrease in renal mass (Hokamp and Nabity review
2016). Less severe reductions in GFR may not manifest with a
high creatinine. Because of the high index of individuality,
monitoring changes in individual animals over time may be a
more sensitive indicator of declining renal function (GFR) than
comparing results to a previously established reference interval,
which may be too broad to detect changes in individual animals
unless there are substantial reductions in GFR. A change in
creatinine of more than 0.3 mg/dL is considered support of
declining GFR, but this change may be within the analytical
variation of many machines used to measure creatinine. Hence,
as for all clinical pathologic values, results should always be
interpreted in context of what is known or suspected to be
occurring in the patient at hand.
Release from muscle: Although there have been reports of high

creatinine due to release of creatine from muscle, studies have

shown that acute myositis does not consistently increase
creatinine. It is more likely that the creatinine is increased due to
a renal azotemia from myoglobinuric nephrosis as a
consequence of myoglobin release from severe myositis or
myopathy.
Decreased creatinine concentration
Physiologic causes
Decreased muscle mass: Creatinine trends lower in small breeds
of dogs, based on body weight. Young dogs have lower
creatinine than adult dogs, presumably due to lower muscle
mass.
Increased GFR: This occurs during pregnancy (due to increased
cardiac output).
Pathophysiologic causes
Decreased production: Loss of muscle mass from starvation or
cachexia. Although creatinine is produced in the liver, low
creatinine with liver insufficiency (e.g. portosystemic shunting)
may be due to increased glomerular filtration rate (Deppe et al
1999) versus decreased creatine production in the liver.
Increased GFR: This occurs in animals with portosystemic
shunts. Urea nitrogen is also frequently low from decreased liver
synthesis of urea.
Urinalysis
The routine urinalysis is a quick and relatively inexpensive test
which can be readily performed. The results are useful in a
variety of situations and are not limited to those directly
involving the urinary tract. Routine urinalysis is an essential part
of the diagnostic evaluation of sick patients and the results
should be interpreted along with the results of a chemistry panel.
Ideally, urine should always be collected at the same time as
blood for hematology and clinical chemistry and before any
treatment (including intravenous fluids) is administered.
Complete interpretation of results of chemistry panels cannot be
performed without concurrent knowledge of the urinalysis,
particularly if there are abnormalities in renal (e.g. urea nitrogen

and creatinine) or acid-base parameters on the chemistry panel.

Similarly, interpretation of some abnormalities in urine (e.g.
glucosuria, ketonuria) is facilitated by concurrent knowledge of
chemistry results.
Assessment of visual urine attributes: This includes
volume, color and turbidity. It is ideal to standardize the volume
of urine from which the urine sediment is prepared. In human
medicine, 10 mL of urine is used as the standard volume. This is
difficult to accomplish in many animals, particularly small
patients, hence we try and standardize the urine volume from
which the urinalysis is performed (regardless of the volume
received) to 3 mL in the laboratory at Department of Veterinary
Pathology, Veterinary College, JAU, Junagadh. However, we
often do not receive even this much urine for analysis. Urine
volume affects the results of the urine sediment examination,
because the semi-quantitative results of the sediment are derived
from the standard urine volume and will differ between urine
collections of different volumes. Observations of color and
turbidity are made on the well-mixed urine specimen.
Assessment of concentrating ability: This is usually done by
measuring specific gravity with a temperature-compensated
urine refractometer that is designed for use in veterinary species.
The specific gravity should be read on the urine supernatant
after centrifugation of the urine and not on uncentrifuged urine.
Concentrating ability can also be assessed more accurately by
measuring urine osmolality, but this is not usually done as part
of the routine urinalysis.
Dipstick analysis: Dipsticks consist of various pads containing
chemical ingredients which provide a color change when a
particular analyte is present in urine. This color change is
converted to a semi-quantitative result for the analyte in
question. In animals, the dipstick is used to give results for pH,
protein (mostly albumin), glucose, ketones (primarily
acetoacetic acid), bilirubin (the conjugated or direct form) and
proteins containing a heme group (a porphyrin ring with iron in
its center). There are also dipstick pads for urine specific

gravity, nitrate, leukocytes and urobilinogen on commercially

available dipsticks, e.g. IDEXX Urine stripe®. These are either
not accurate in animals or do not provide much additional
information in animals and are seldom, if ever, reported.
The dipstick analysis is usually performed on
uncentrifuged urine, unless there is marked hematuria (which
may affect interpretation of the color changes on the dipstick). In
urine with marked hematuria, the interfering erythrocytes can be
sedimented by centrifugation and the dipstick analysis can be
performed on the supernatant. In clinical practice, the degree of
color change on the dipstick (e.g. 1+, 2+) is visually (and
subjectively) assessed. We no longer visually examine the
Multistix® to determine the dipstick results, rather the IDEXX®
Urinary Chemistry Analyzer is used, which provides an
automated reading of the Multistix family of urinalysis tests.
The machine corrects for the urine color and provides
semi-quantitative results for several of the urine results.
Sediment examination: For this examination, the standard
volume of urine is centrifuged in a low speed centrifuge (e.g.
250 g for 5 minutes). The supernatant is decanted (by rapid
inversion once) or removed with a plastic pipette and the urine is
gently resuspended in a standard volume (0.5 ml) of urine
supernatant with a pipette. A drop of the resuspended urine is
placed on a slide, coverslipped, and examined under a light
microscope using the 10x and 40x objectives (this is frequently
called a “wet prep”). Subdued lighting is necessary to increase
refractility of the unstained urine elements (lower the condenser
and/or close down the substage iris diaphragm). We only
examine unstained urine sediments. To examine a urine
sediment, we do the following:
Low magnification: Examine the entire coverslip using the 10x
objective. At this magnification, casts, large crystals, large
infectious agents (parasitic ova), and other constituents (debris,
mucus, other contaminants) are semi-quantified.
High magnification: Specific structures identified at low
magnification (e.g. casts) and several random fields are

examined using the 40x (high dry) objective. At this higher

magnification, cells (leukocytes, erythrocytes, epithelial cells,
sperm), small crystals, small infectious agents (bacteria, fungi)
and other constituents (fat droplets, debris, other contaminants)
are semi-quantified.
LIVER FUNCTION TEST
The liver is a complex organ with a multitude of functions.
Understanding liver function facilitates the interpretation of
clinical pathology data. Listed below are some of the functions
of the liver that are relevant to the clinical pathology changes
observed in liver disease.
Carbohydrate metabolism
Glucose: gluconeogenesis, glycogenolysis
Glycogen storage
Lipid metabolism
Cholesterol synthesis, esterification and excretion, triglyceride
metabolism and storage
Lipoprotein synthesis, phospholipid metabolism
Protein synthesis
Albumin, fibrinogen ,acute phase proteins
Coagulation proteins and inhibitors of coagulation: e.g.
coagulation factors, protein C, antithrombin
Vitamin metabolism
Intestinal bile acids facilitate absorption of fat soluble vitamins,
e.g. vitamin K
Immune function
Kupffer cells clear intestinal pathogens, particulates and dam-
aged cells
Detoxification and excretion
Excretion of nitrogenous wastes via urea cycle
Bile secretion
Biotransformation and detoxification of drugs and toxins
Routine laboratory testing in liver disease:
Assessment of liver disease requires the interpretation of clinical
pathology data reflecting the state of the liver. This data comes
from results of chemistry testing, but also hemogram and

urinalysis results (i.e. don’t look at chemistry results in isolation

to interpret results of liver tests) – all of this data provides clues
as to the underlying presence of liver disease allowing for
its laboratory detection. Essentially from these test results, we
try and identify 4 main patholophysiologic processes:
Hepatocellular injury: This is determined by measuring the
activities of enzymes found in high concentrations of liver cells
and are released with injury to hepatocytes or biliary cells-
so-called “liver leakage enzymes. These are: alanine
aminotransferase or ALT, asparate aminotransferase or AST,
sorbital dehydrogenase or SDH, glutamate dehydrogenase or
GLDH, lactate dehydrogenase or LDH). However, some of the
enzymes are found in other cell types (e.g. AST and LDH are
also found in muscle) so increases in such enzymes are not
specific for liver injury, unlike those found mostly in
hepatocytes (SDH, GLDH).
Cholestasis: Cholestasis is defined as decreased or ceased bile
flow and results in an increase in the so-called “inducible
enzymes, alkaline phosphatase (ALP) and γ-glutamyl transferase
(GGT) and in bilirubin concentrations. The membrane
associated enzymes, ALP and GGT are induced (or, in the case
of GGT, released from the membrane) as a consequence of
cholestasis. Bilirubin is the serum indicator of cholestasis,
specifically conjugated bilirubin, which accumulates in blood
during cholestasis and spills into urine, causing bilirubinuria (in
dogs, that is in excess for that expected for the degree of urine
concentration or urine specific gravity).
Hepatic dysfunction or insufficiency: Tests of liver
function evaluate the ability of the liver to clear substances from
blood, including ammonia (produced daily from amino acid
metabolism and must be converted to urea) and bile acids, which
undergo enterohepatic circulation and are efficiently removed
from blood by a normally functioning liver. Liver synthetic
ability (the liver is the main source of many proteins produced in
the body) can also be evaluated indirectly through measurement
serum levels of various proteins, e.g. albumin, transferrin, urea,

coagulation factors and coagulation inhibitors (antithrombin,

protein C), however other disease processes can influence these
proteins. Hepatic failure occurs when there is substantial loss of
liver tissue (>70-80%), resulting in inability of the liver to
produce proteins, clear antigens or other substances from blood
(ammonia, bile acids). Specific clearance studies can be
performed to confirm decreased liver function (i.e. ability to
clear an exogenous substance from blood, e.g. caffeine. Note,
you can have laboratory evidence of dysfunction (e.g. low urea
nitrogen) without the animal being in synthetic liver failure (e.g.
low urea nitrogen is common because of decreased functional
mass in dogs with portosystemic shunts).
Alterations in hepatic portal circulation: The portal vein brings
substances absorbed from the gastrointestinal system to the liver
(the first organ these substances encounter). The liver then
extracts and conserves substances that are normally secreted into
the intestine through bile, particularly bile acids. Abnormalities
in the portal supply, i.e. portosystemic shunting, allows blood to
bypass the liver and directly enter the systemic circulation. This
results in decreased liver extraction (which can also be a
consequence of decreased liver function as well as shunting of
blood away from the liver) and increased concentrations of these
substances in peripheral blood, allowing us to detect such
abnormalities in blood flow. Shunting also causes atrophy of the
liver, with decreased functional mass, which may manifest with
abnormalities in some of the synthetic functions of the liver
(notably, low antithrombin, protein C and urea nitrogen).
PANCREASE FUNCTION TEST:
Serum activity of amylase and lipase is measured as an
(imperfect) aid to the clinical diagnosis of pancreatic injury.
Idiopathic inflammatory disease (acute-to-chronic pancreatitis)
is the most common disease entity (mainly dogs, occasionally
cats, rarely, horses). Less commonly, pancreatic tumors
(adenocarcinoma) or trauma (HBC) can be the cause of clinical
signs and elevated enzyme activity.
With regard to the diagnosis of pancreatitis, results must

be interpreted in light of the history and clinical signs in the

patient, and correlated with physical, radiographic, hematologic,
and other clinical chemistry findings:
 vomiting, diarrhea, history of recent fatty meal, table scraps,
garbage ingestion
 Painful abdomen, dehydration, sometimes icterus
 Hazy cranial abdomen on plain radiographic films
 Neutrophilic leukocytosis
 Azotemia (often), lipemia (sometimes), hypocalcemia
(occasionally), cholestasis.

12 Epidemiological Approaches in Investigation
of Zoonotic Disease
J.B. Kathiriya* and S. H. Sindhi
Department of Veterinary Public Health& Epidemiology,
College of Veterinary Science & A. H., J. A. U., Junagadh
*jbkathiriya@gmail.com; +919924619719.
E pidemiology helps not only for getting information on

diseases in population but also gives information on factors that
can lead to occurrence of diseases. Knowledge on different
factors causing diseases helps for easy diagnosis of disease. It is
the collection and analysis of data to determine whether an
association may exist between one or more exposures and the
occurrence of disease. In practice, epidemiologists often employ
statistics and probability to look at who gets sick or injured and
why. In a sense, epidemiology is as old as medicine itself.
Hippocrates suggested, in the fifth century B.C., that the
development of human disease might be related to the external
as well as the personal environment of an individual.
Epidemiology helps for diagnosis as well as control of
diseases since it can predict the occurrence of diseases. Along
with epidemiology, both subjective and objective symptoms are
needed for getting the complete picture of the disease. Important
diseases of bacterial, viral and fungal origin have been discussed
in this article which will help for a better diagnosis of these
diseases.
Inherent in the epidemiological approach is the belief
that the frequency of occurrence of a disease in a population is
governed by the interaction of a large number of different
factors or determinants. The epidemiologist believes that by
studying these interactions it may become possible to
manipulate some of the determinants involved, and so reduce the
frequency with which the disease in question occurs in a

Epidemiological Approaches in Investigation of Zoonotic Disease
population. Another term often used in epidemiological studies

is population at risk. This is usually a subset of the original,
defined population and comprises the total number of
individuals in that original population that are considered
capable of acquiring the particular disease or disease
characteristic being studied.
Introduction
The ability to detect outbreaks early is important to minimize
morbidity and mortality through timely implementation of
disease prevention and control measures. The World Trade
Center and Anthrax terrorist attacks in 2001 as well as the recent
West Nile virus and SARS outbreaks, have motivated many
public health authorities to develop early disease outbreak
detection systems using non-diagnostic information, often
derived from electronic data collected for other purposes.
Emerging infectious diseases pose a growing threat to human
population. Climatic changes like warmer temperatures and
altered rainfall patterns are likely to increase the burden of
vector-borne diseases resulting into emergence of zoonotic
diseases, too. Many of the world's epidemics are known to be
highly sensitive to changes in climate and short-term
fluctuations in the weather. “Forecasting” is the monitoring of
specific risk parameters helping to predict situations that could
lead to the occurrence of a given disease and its subsequent
spread. The forecasting of disease helps to predict the course of
disease, warn health care workers and adopt control measures to
prevent disease outbreaks.
Passive disease surveillance involves voluntary
reporting by people who are ill enough to go to a treatment
center; such centers are therefore only effective for detection and
mitigation after a person has been infected. On the other hand,
active disease surveillance, which involves ''searching'' for
evidence of disease proactively through routine and continuous
monitoring in endemic areas, could help to prevent an outbreak,
or slow the rate of transmission at an earlier stage of an
epidemic. The National Oceanic and Atmospheric

Administration (NOAA) operate a series of weather satellites

that collect operational data for weather forecasting and climate
prediction. Besides NASA and NOAA, several European Union
countries, Japan, Canada and India have remote sensing
satellites that provide global observations to predict occurrence
of disease. The use of GIS to map vector species distribution and
disease risks has evolved considerably during the past two
decades. The objectives of this review are to summarize
developments in the application of disease surveillance system
for studying animal and zoonotic disease pathogen biology and
to identify opportunities for future research on forecasting of
diseases.
Objectives of forecasting
 The objectives employed for forecasting of the diseases
include:
 To study modes of transmission and to understand how to
prevent spread of epidemic diseases
 To monitor the effectiveness of disease control campaigns
 Emergency preparedness & disease management strategies
 To demonstrate knowledge about the epidemiology of
diseases
 To study disease importance from a public health point of
view
Advances in disease surveillance systems, epidemiological
modelling combined with information technology have
generated the expectation that early warning systems are not
only feasible but necessary tools to combat the re-emergence
and spread of infectious diseases .
What is early warning?
Early Warning is the provision of timely and effective response
through the recognized institutions that allows individuals
exposed to hazards to take actions to avoid or reduce risk and
prepare for an effective response. Early Warning and Response
(EWS) is based on the concept of dealing with a disease
epidemic in its early stages. From a public health perspective,
early warning of outbreaks with a known zoonotic potential of

disease will enable control measures that can reduce human

morbidity and mortality rates. The main uses of early warning
system include education as an aid to understanding the crucial
elements involved in early detection and response to
environmental threats.
Early warning initiatives
Several initiatives, at national and regional levels have already
been developed in the field of early warning. At the international
level FAO, OIE and WHO have each developed early warning
and Response Systems that systematically collect, verify,
analyze and respond to information from a wide variety of
sources, including unofficial media reports and informal
networks.
International organizations and their initiative role in
development of early warning system
1. Office International Des Epizooties (OIE)'S early warning
system
OIE was established on 25th January 1924 in Paris. In May 2003
the Office became the World Organization for Animal Health
but kept its historical acronym OIE. This organization has set up
an animal health information search and verification system
for the notification of emerging and reemerging diseases that
have not yet been officially notified to the OIE. The framework
was designed to empower countries and regional alliances in the
fight against Transboundry animal Diseases (TADs). Emergency
funds are rapidly mobilized for sending experts from OIE
Reference Laboratories to assess the epidemiological situation in
a country and define the actions required.
World Animal Health Information Database (WAHID)
Interface provides access to all data held within OIE's new
World Animal Health Information System (WAHIS). It replaces
and significantly extends the former web interface named
Handistatus II System. A comprehensive range of information is
available from immediate notifications and follow-up reports

submitted by Country/Territory Members notifying exceptional

epidemiological events current in their territory. A six-monthly
reporting by member country on the absence or presence and
evolution of diseases listed by the OIE and information of
epidemiological significance to other countries.
Food and Agriculture Organisation
FAO was establishedon 16th October 1945, Canada then
transferred to Rome, Italy. Achieving food security for all is the
main goal at the heart of FAO. FAO, through its special
EMPRES priority programme established in 1994, developed an
early warning and response system. EMPRES Global Animal
Disease Information System (EMPRES-i) is a web-based
application that has been designed to support veterinary services
by facilitating regional and global disease information. Timely
and reliable disease information enhances early warning and
response to transboundary animal diseases (TADs) including
emergent zoonoses, and supports their progressive control and
elimination. EMPRES-i aims to clarify disease events
worldwide that FAO receives from different sources: country or
regional project reports, field mission reports, partner
Non-Governmental Organizations (NGOs), cooperating
institutions, government Ministries of Agriculture and Health.
For verification purposes, EMPRES uses not just official, but
also unofficial sources of information. A major thrust of the
EMPRES activity for early warning and early response has been
the development of softwares such as Transboundary Animal
Disease Information System (TAD info), Transboundary Animal
Diseases Simulator (TAD simulator) and Good Emergency
Management Practice (GEMP).
World Health Organisation
WHO was established on 7th April 1948, located at Geneva,
Switzerland, concerned with international public health. WHO
offers assistance to affected countries in the form of technical
advice, supplies and by mounting coordinated international
investigations. The Global Outbreak Alert and Response
Network (GOARN) is building on new and existing partnerships

of national and international institutions and networks, to deal

with the global threats of epidemic-prone and emerging diseases
in humans and to prepare for rapid deployment and coordination
of international resources in response to an outbreak of
international importance. GOARN aims at ensuring appropriate
technical support to affected human populations quickly,
assessing risks of rapidly emerging epidemic disease threats and
sustaining containment and control of outbreaks by contributing
to national outbreak preparedness. WHO has developed a
compre-hensive “Event Management System” to manage critical
information about outbreaks and ensure accurate and timely
communications between key international public health
professionals, including WHO Regional Offices, Country
Offices, collaborating centers and partners in the Global
Outbreak Alert and Response Network. This system generates a
dynamic picture of Alert and Response Operations and provides
information for action in a systematic way to enable both WHO
and the Global Outbreak Alert and Response Network to prepare
better, respond faster, and manage resources more effectively.
The WHO event management system is being further
strength-ened to support alert and response operational aspects
of the revised International Health Regulations.
Global early warning and response system (GLEWS)
GLEWS is a joint system that builds on added value of
combining and coordinating the alert, response mechanisms
developed by OIE, FAO and WHO [18]. The GLEWS assists in
prediction, prevention and control of animal disease threats,
including zoonoses through sharing of information,
epidemiological analysis and joint field missions to assess and
control the outbreak, whenever needed. The GLEWS initiative
started with the voluntary participation of represen-tatives of
FAO, OIE and WHO, who share the common objective to
enhance the early warning and response capacity for the benefit
of the international community. Mutual benefit through
collaboration has been identified throughout the Early Warning
and Response process.

Well defined GLEWS are available for highly

pathogenic avian influenza (HPAI), Rift Valley fever (RVF) and
other vector borne diseases and for rest of the diseases GLEWS
is under development.
The GLEWS Management Committee (GMC) is responsible for
supervising the implementation of the GLEWS agreement, the
strategic plan and provides general oversight of GLEWS. The
GLEWS Manage-ment Committee guides and decides on the
different tasks to be accomplished by the GLEWS Task Force
which is co-chaired by FAO, OIE and WHO. After being
notified a rumor, suspicion or forecast regarding a disease
outbreak the information gathered through the respective
tracking and verification channels of each organization will be
fed into a GLEWS electronic platform information will be
further analyzed, monitored and/or sent out as Early Warning
Messages. Specific analysis and modeling of trends will be
carried out utilizing selected OIE and FAO collaborating
centers, OIE and FAO laboratories and WHO collabo-rating
centers. A GLEWS Emergency Response will only be neces-
sary, if there is clear indication for a joint onsite assessment or
intervention mission.
Aims of GLEWS
 Better international preparedness and rapid containment
 Improve detection of exceptional epidemiolo-gical events at
country level
 Increase timeline and sensitivity of alerts and improve
national surveillance and monitoring systems
 Improve transparency among countries and compliance with
reporting to OIE
 Improve field animal health information quality and provide
technical support
 Strengthening the network between veterinary & medical
laboratories
 Provide rapid, efficient and coordinated assistance to the
affected countries.
GLEWS joint risk analysis for emergent zoonotic diseases

Risk analysis is essential to assess and provide options to miti-

gate risks associated with the emergence or spread of animal
pathogens at the animal/human/ecosystem interface. Risk
analysis is one of the core areas that have been recently high
-lighted for increased collaboration between FAO, OIE and
WHO to address emergence of pathogens, in particular on
emergent zoonotic pathogens.
Joint risk assessment as planned will initially be
performed in specific regions for priority zoonotic diseases, such
as CCHF, RVF, H5N1 HPAI, Rabies and Brucellosis. In this
framework, risk analysis and mapping methodologies will be
developed and validated using data available on reported
outbreaks, surveillance activities carried out by countries and
combining this information with other datasets including land
use, trade, livestock population, animal movement, etc. Risk
mapping tools are essential to enhance accuracy and sensitivity
of early warning activities. Early warning messages will be
made available to the international community to serve effective
response purposes and aid targeting disease surveillance and
control activities at the animal-human-ecosystem interface.
GLEWS is supported by the following Regional/ National
Networks:
FAO (191 Member Nations)
WHO (194 Member States)
OIE (178 Member Countries)
Regional Organizations: EC, SADC, ASEAN, CAN
International Reference Laboratories
National Authorities
Unofficial surveillance programs (PROMED, GPHIN)
Laboratory and Epidemiological networks
Other partners
GLEWS approach for Highly Pathogenic Avian Influenza
(HPAI): In the aftermath of the avian influenza (AI) crisis
triggered by the spread of the highly pathogenic avian influenza
H5N1 (HPAI H5N1), the world has been on alert to curb the

spread of the disease and to mitigate the risk of a potential

human pandemic.
The FAO Early Warning System for worldwide
monitoring of avian influenza highlights the potential for better
integration and exchange of information among key
stakeholders, and better understanding of the disease. Through
EMPRES I disease tracking list is one example generation of
disease information. All confirmed outbreaks, pending and
foregoing investigations worldwide in domestic poultry and wild
birds are listed. The Disease Tracking List (DTL) also displays
the temporal evolution of daily incidence for a 1-yr period. This
list is shared with national and regional field staff as well as key
partner institutions, which are requested to verify and validate
the unconfirmed events, and to follow up and search for reliable
sources of information. Risk maps are made showing location of
confirmed outbreak in poultry and in wild birds. EMPRES I
linked with GIS to provide visual representation of disease
outbreak and to understand epidemiological factors responsible
for TADs emergence and spread.
These examples show the importance of GIS to identify
spatial or spatiotemporal patterns that can be used in developing
more rigorous causal hypothesis tests. In conclusion, the
ultimate goal of early warning systems is to make information
and risk-assessment outcomes available to all relevant
stakeholders and to provide the opportunity for timely reaction
in the most cost-effective manner.
GLEWS approach for Vector borne diseases; Rift Valley
Fever (RVF)
In parts of East Africa known to be prone to RVF
epidemics, remotely-sensed rainfall and vegetation
measurements have been integrated into regional and global
early warning systems and are used to predict RVF before it
reaches epidemic proportions. The ultimate goal of such systems
is to safeguard sustained livestock production and have
developing countries participate legitimately in local, regional
and international trade.

Epidemics of RVF have occurred in southern and

eastern Africa at irregular intervals. These epidemics have been
associated with above average rainfall after a period of drought
and the presence of susceptible exotic breeds of livestock . Data
sets used in these predictions include satellite vegetation index
and cold cloud duration (CCD) correlated with climatic changes.
Measurements from the Advanced Very High Resolution Radi-
ometer sensor (AVHRR) on-board polar-orbiting satellite series
operated by the NOAA are used to generate the normalized
difference vegetation index (NDVI).
In East Africa, vegetation index maps have been used
together with ground data in monitoring vector populations and
RVF viral activity, establishing a correlation between these two
parameters. Indeed a detailed analysis was made with virus
isolation data over a 25-year period and NDVI records for the
study area. As the water table rises to the point where flooding
may occur, the NDVI ratio approaches 0.43 to 0.45. The main
advantage of using remote sensing for prediction of RVF
occurrence in East Africa is the relatively low cost of the system
and its use may allow for preventive measures to be taken such
as the vaccination of susceptible livestock and mosquito larval
control methods. The technology has been used extensively by
the FAO to warn countries facing an increased risk of the
disease.
The components of an Early Warning System (EWS):
There are three components of EWS, viz., routine surveillance
of the targeted disease, modelling the disease risk based on
historical surveillance and contemporary environmental data and
forecasting future risk through the use of predictive models with
continued epidemiological and environmental surveillance.
1. Disease surveillance: A sentinel network is an interactive
disease surveillance system that involves the collection of health
data on a routine basis, usually by health care professionals over
a wide (usually at country level) area. In most industrialized
nations, notification of many infectious diseases is a statutory
requirement. Rapid collection of data and assessment of regional

and national statistics leads to early detection of changes in the

incidence of infections. The database also provides information
for the planning and implementation of intervention. The growth
of such sentinel systems, from independent national networks to
co-ordinate international information systems, has generated a
demand for health information systems capable of forecasting
disease.
The present understanding that a facility-based sentinel
surveillance system can play an important role in providing
information for monitoring communicable diseases, guiding
further investigation, evaluating control measures and predicting
epidemics.
2. Developing a model: Disease forecasting involves modelling,
which may be based either on statistical relationships established
between past case numbers and environmental predictors
'statistical approach' or an attempt to capture the biology of the
transmission processes 'biological approach'. Briefly, the
statistical approach requires samples from as wide a range of
environmental conditions as possible: predictions arising from
this approach assume that the future will be the same as the past,
i.e. that the relationships already established between case
numbers and environmental variables will persist into the future.
The biological approach requires details on all the
parameters and variables considered to be important in
transmission. Predictions arising from this approach are in
theory able to incorporate the effects of environ-mental changes,
or interventions, as long as the impacts of each of these changes
on the key transmission parameters are established. It should
follow from the above that in the absence of full knowledge of
all the transmission pathways for any particular diseases, only
the statistical approach is possible. This explains why much of
the early epidemiology of poorly-understood diseases such as
cancer adopted the statistical route. Statistical models can be
extremely powerful, but should be only a temporary substitute
for the biological process-based models, whose development

exposes our full ignorance of the systems we study. It is only by

addressing this ignorance that real progress will be made.
3: Disease forecasting and prediction: At the heart of early
warning is a basic trade-off between the specificity of
predictions and the lead times which those predictions can
provide. In general, long-range forecasts give the least specific
warnings, but have the advantage of providing planners with
relatively long lead times. At the other extreme, systems based
on early detection of cases provide highly specific information
on the timing and location of outbreaks, but allow little time for
implementing remedial measures. Any prediction of risk should
include an estimate of its reliability.
Epidemic prevention and control activities usually
involve a chain of events and it is important to recognize the
potential usefulness of a wide range of indicators, which may be
combined to create an integrated prediction strategy. Such a
hierarchical system has recently been proposed for tracking
malaria epidemics in highland areas of Africa.
Geographical information system (GIS)
GIS is an automated system for the input, storage, analysis and
output of spatial information. These data combined with
population data and previous disease records for prediction of
diseases.
Applications of GIS:
Forecast epidemics
Identify gaps in immunizations
Monitor diseases and interventions over time
Study Geographical distribution and variation of diseases
Map populations at risk and stratify risk factors
Monitor Health centers, Routine health workers, equipments &
supplies to service locations
Locate nearest Health facility
Forecasting of diseases in India
In India, the Project Directorate on Animal Disease Monitoring
And Surveillance (PD_ADMAS) was established in 1987 by the
ICAR to develop a system of disease monitoring and

surveillance of economically important livestock diseases, with

a goal to design strategic control measures. Although health care
infrastructure has grown immensely over the years, disease
surveillance system did not get the desired attention as the
outbreaks of bird flu (2006), swine flu (2009), and
Crimean-Congo hemorrhagic fever (2011) in the country
highlighted the weaknesses in the current surveillance system.
Animal disease surveillance network: At present, animal
disease surveillance network in our country include data
collection from diseased animal to veterinary doctor at Govt
hospital/dispensary through clinical diagnosis- passed to
Taluka / Block to District level then to the State Veterinary
authorities. The disease information is shared from diagnostic
laboratories District, State or Regional level. The State
Governments share this information at National level mainly
through Department of Animal Husbandry, Dairying and
Fisheries (DADF), Ministry of Agriculture, Government of
India.
Centre for Animal Disease Research and Diagnosis
(CADRAD): It is recognized as Central Disease Diagnostic
Laboratory (CDDL) by the Department of Animal Husbandry &
Dairying, Ministry of Agriculture (Govt. of India) since 2001-02
with specific mandate, technical programme and financial
support. However, there are five Regional disease diagnosis
laboratories located at Kolkata (Eastern), Pune (Western), Jal-
landhar (Northern), Bangalore (Southern) Guwahati (North-
eastern). There are six Quarantine stations viz. Delhi, Mumbai,
Chennai, Kolkata, Bangalore and Hyderabad.
Disease surveillance and ICAR:
Project Directorate on Foot and Mouth Disease (PDFMD)
Project Directorate on Animal Disease Monitoring and
Surveillance (PD_ADMAS)
High Security Animal Disease laboratory (HSADL, IVRI)
PDADMAS (Project Directorate on Animal Disease Monitoring
and Surveillance) Bangalore: This is the agency working on
surveillance of major economically important animal diseases

including zoonoses. Advances in information technology pro-

vide adequate computing techniques to develop a National
livestock disease information system which is the prime need of
today.
“Epi- InfoTM (Analysis Project On Livestock Disease
Forecasting/Forewarning)”
“NADRES(National Animal Disease Referral Expert System)”
Epi- InfoTM (Analysis Project on Livestock Disease
Forecasting/Forewarning): PD_ADMAS has developed an
innovative india. admas-Epitrak epidemiology software which is
a dynamic and interactive livestock disease related database
supported by GIS. This software addresses the needs of data
collection, retrieval, analysis and critical reporting of disease
events as and when they occur and is useful to students and vet
colleges, field veterinarians, administrators and technocrats.
NADRES (National Animal Disease Referral Expert System):
This is a component of National Agricultural Technology
Program funded mission mode sub project on weather based
animal disease forecasting and animal health information system
through disease monitoring and surveillance.
Conclusions
Early detection and response provides better preparedness for
effective control and containment of disease outbreaks. Animal
Disease Surveillance is a key for improving disease analysis,
early warning and prevents the spread of diseases. GLEWS
strengthen early warning systems of OIE/ FAO/ WHO for the
benefit of international community by using recent advances in
communication & information technologies. GIS offers lot of
scope in Veterinary Public Health research especially for
surveillance, mapping and ecological analysis of emerging
zoonoses. The well defined GLEWS are available for HPAI,
RVF and some vector borne diseases, while for the rest diseases
GLEWS is under development. PD_ADMAS and other
surveillance and information networks are stand alone in India
and there is a need for complete review of surveillance system
for animal diseases which may guide important policy decisions.

Successful implementation of EWS is dependent on efficacy of

national disease surveillance program, degree of awareness
among field veterinarians, technicians, extension specialists, and
farmers about clinical and epidemiological features of diseases.
References: available upon request

13 Anatomy of Various Organs Affected by
Helminth Parasites
Vishnudeo Kumar* and Anil Sharma
Department of Veterinary Anatomy, College of Veterinary
Science & A.H., JAU, Junagadh
* drvishnudeo@yahoo.co.in; +918758869439.
H elminth is a general term for a parasitic worm. The

helminth important in veterinary medicine are nematodes
(roundworms), cestodes (tapeworms) and trematodes (flukes).
The various life cycle stages of helminth can causes the damage
within the host by physical and functional disruption of the
various organs and tissues through which they migrate and in
which they established as adult.
A basic knowledge of anatomy of various organ is a
prerequisite to understand the pathogenesis and manifestation of
lesions and diagnosis of many important parasitic disease of
animals. It provides the required information for the clinician to
determine the disease or clinical abnormalities caused by
parasites. Here the anatomy of the visceral organs commonly
affected by helminths are discussed.
Anatomy of organs of respiratory system
Nasal cavity: The nasal cavity is short, wide anteriorly and
narrows posteriorly. The nasal cavity is lined by pink colored
basal mucosa. It is divided into two halves by an
osseo-cartilaginous septum. The cavity is occupied by turbinate
bones, which project from its lateral wall into the cavity in the
form of bony scrolls known as nasal conchae. The space formed
between these nasal conchae is nasal meatus. They are dorsal,
middle, ventral and common meatus. During passage of stomach
tube the tube must be passed through ventral nasal meatus. The
nasal passage is divided into three regions. Vestibular region
lined by stratified squamous epithelium and contain serous

Anatomy of Various Organs Affected by Helminth Parasites
glands, respiratory region is lined by pseudostratified columnar

ciliated epithelium with goblet cells and olfactory region
presents olfactory and sustentacular cells. Posterior nares or
chonae are elliptical openings by which the nasal cavity and
pharynx communicate. In horse the nasal cavity is longer and
cylindrical. In dogs the nasal cavity varies greatly in different
breeds and almost occupied by turbinate bones.
Nasal schistosomiasial is associated with
cauliflower-like growths on the nasal mucosa of cattle and
buffalo, causing partial obstruction of the nasal cavity and
snoring sounds when breathing. Adult flukes are found in the
blood vessels of the nasal mucosa. In sheep nasal bot fly
deposits larvae, at the nostrils, they move and grow within the
nasal cavity and the frontal sinuses.
Trachea- Trachea is flexible cartilaginous tube occupies a
median position in the ventral aspect of neck and it extends from
the larynx to the hilus of lungs. It is made up of about 50
incomplete C-shaped cartilaginous rings. Trachea has cervical
and thoracic parts. The cervical part of trachea is related dorsally
to longus coli muscle and oesophagus. Antero-laterally to
thyroid gland, carotid artery, jugular vein, vagosympathetic
trunk and cervical lymph gland. Ventrally to skin, subcutaneous
areolar tissue between the two sternothyrohyoideus muscles.
The thoracic part passes backwards between two pleural
sacs and divides into right and left bronchi through which it en-
ters the respective lung. Opposite to the 5th intercostal space, the
trachea is bifurcate into left and right bronchi. The right face of
trachea opposite to 3rd rib detaches an apical bronchus to the
apical lobe of right lung.
Lungs: They are essential organs of respiration, two in number
right and left. They are reddish in color. Healthy lungs have
light, spongy and elastic consistency. It crepitates when pressed
and floats in water. In living animals, they remain inflated fully
to accommodate the greater part of the space available within
the thoracic cavity. The right lung is larger than the left lung.
A little in front of its middle, it presents a hilus, where

pulmonary artery, pulmonary veins, bronchial artery, bronchial

vein, nerve fibers and bronchial lymph nodes are present. In
front of the hilus there is a cardiac impression. Behind the hilus
there is a groove for the aorta above and esophagus below. The
ventral border is thin and presents deep fissures, which divide
the lung into various lobes. The left lung has three lobes, viz;
apical lobe, cardiac lobe and diaphragmatic lobes. Right lung
has an additional lobe called as intermediate/accessory lobe. The
diaphragmatic lobe is the largest lobe and is related with the
convex face of the diaphragm. The base of the lung is oval in
outline and deeply concave. On either side it presents a thin
convex basal border.
The lungs are surrounded by a serous membrane called
the pleural membrane. The narrow parietal space between these
two layers contains a small amount of pleural fluid that allows
the two layers to slide over one another during breathing. The
pressure in the intra-pleural space is negative. This negative
pressure inside the intrapleural space is vital for the expansion of
the lungs.
Parasitic bronchitis (husk) is an economically important
parasite infection of the bovine respiratory tract caused by the
nematode, Dictyocaulus viviparus. Oslerus osleri, also known as
Filaroides osleri and more commonly called tracheal or lung
worms, are fairly small parasites that infect and irritate the
windpipe. They have been reported in many countries and are
found in mink, polecats, monkeys, cats and dogs. Oslerus osleri
larvae enter the dog’s small intestine. They molt and migrate
through the bloodstream into the trachea and bronchi, where
they mature into adults. The worms trigger an inflammatory
reaction inside the dog’s upper respiratory tract, which causes
fibrotic nodules (lumps) to form inside the trachea. Eggs laid by
adult tracheal worms hatch into larvae inside these thin-walled
nodules and can be quite irritating.
Syngamus trachea, also called gapeworm, red worm or fork
worm, is a parasitic roundworm that infects the respiratory

system of poultry - chickens, turkeys, pigeons, guinea fowls,

ducks, pheasants, quails, etc. and numerous wild birds.
Anatomy of cardiovascular system
Heart – It is a hollow, involuntary muscular organ lying in the
ventral half of the middle mediastinum on left side of thoracic
cavity between 3rd to 6th ribs and enclosed in the pericardium. It
is cone shaped and slightly flattened laterally.
External features of the heart – it presents base, apex, borders,
surfaces and grooves.
Base – It is directed upward and is suspended by its arterial
trunks. It lies between 3rd to 6th ribs. The anterior part of base is
about 10 to 12 Cms from the thoracic inlet while the posterior
part is at about the same distance from the tendinous center of
diaphragm.
Apex – It is directed backward, downwards and to the left. It lies
opposite to the 6th chondro-sternal articulation and about 2.5 cm
in front of diaphragm.
There are two borders. Anterior border is slightly
convex and is formed entirely by the right ventricle. The
posterior border is thicker and slightly concave or nearly
vertical. This border lies entirely in the left ventricle and
opposite to the fifth intercostal space.
There are two surfaces. Right surface is formed by the
right ventricle and partly by left ventricle. The left surface is
formed by the left ventricle and partly by right ventricle.
The wall of the heart is made up of epicardium is a
visceral serous layer of pericardium which is closely adherent to
the wall of the heart. Myocardium form the wall of the auricles
and ventricles are made up of cardiac muscle fibers.
Endocardium lines inside of the auricular and ventricular walls
and becomes continues with the internal tunic of vessels
entering and leaving the heart.
Dirofilaria heartworms of dog directly or indirectly
affect various anatomical structures of the heart, with infections
manifested as myocarditis, pericarditis. The larvae get into the
blood stream and move to the pulmonary arteries, their

predilection site, where they arrive 12 to 20 weeks after

infection. They were both in right-sided heart failure from the
mechanical presence of a handful of heartworms inside the right
ventricle of the heart. The mechanical presence of the
heartworms caused the heart chamber to increase 3 times it's
normal size and the main valve in the heart could no longer
close. The blood actually flowed "backwards" with the blood
backing into the right atrium and increasing the pressure in the
abdomen.
Anatomy of organs of digestive system
Oesophagus- Oesophagus is musculo-membranous tube
connecting between pharynx and stomach. The origin of
oesophagus is from the oropharynx and dorsal to the cricoid
cartilage of larynx. At this level, it is median in position and is
related to common carotid artery on both the sides. From 3rd
cervical vertebra onwards oesophagus deviates to left side of
trachea. At the level of 4th cervical vertebra, relations of
oesophagus is- on right side – trachea, left side – left common
carotid artery, jugular vein, vagosympathetic trunk and left
recurrent laryngeal nerve, omohyoideus muscle, Dorsally–
longus colli muscle and Ventrally – sternothyrohyrohyoideus
and sternocephalicus muscles. At the level of 3rd thoracic verte-
bra, oesophagus becomes dorsal to the trachea in the mediastinal
space and then it passes in the abdominal cavity through hiatus
oesophagus in the diaphragm and terminates at the cardia of the
stomach.
Gongylonema pulchrum is a thread-like nematode that
occurs in oesophagus of a large variety of animals. In case of
dogs the Spirocerca lupi causing the oesophageal granuloma.
Rumen: The rumen occupies most of the left half of the
abdomen and extends considerably over the median plane to the
right. It extends form 7/8th inter-costal space to the pelvic inlet.
Parietal (Left) surface is convex and related to spleen,
diaphragm and left abdominal wall and Visceral (Right) Surface
is irregularly concave and related to the omasum, abomasum,
intestine, liver, pancreas, left kidney, adrenal, aorta and posterior

vena cava. Anterior extremity is related with the diaphragm and

reticulum. Posterior extremity is related with the small intestine
and urinary bladder.
The mucosa of rumen is highly studded with papillae,
which gives it turkish towel like appearance. They are present
throughout the mucosa and well developed into the blind sacs.
The external grooves projected shelf like into the ruminal sac
called as ruminal pillars. The ruminal papillae are absent on
pillars.
Reticulum: It is most anterior and smallest compartment
extended from 6th to the 8th ribs. The greater part of it remains
on left of median plane. It is piriform in shape compressed
cranio-caudally. Parietal surface is convex, directed forward and
related with the diaphragm and liver and visceral surface is
slightly flattened, directed caudally and related with dorsal sac
of rumen.
The interior of reticulum is raised into folds of about ½
inch high enclosing 4 – 6 sided spaces or cells giving the
mucosa honey comb like appearance. These cells are divided
again and again into 4 –5 times. The bottom of the cells are
studded with pointed papillae. The free margins of biggest wall
are serrated.
Omasum: It is ellipsoidal in form and somewhat compressed
between two surfaces. It lies to the right side of median plane
extended from 7th rib to 11th rib level. It has two surfaces and
two curvatures. Parietal surface is directed forward and related
to diaphragm and liver and visceral surface is directed backward
and related with other three divisions of stomach.
The cavity of omasum is occupied by about one hundred
of longitudinal mucosal folds, laminae omasii, which are
attached at greater curvature of omasum. They are arranged into
different orders from one to five. The first order is largest and
about a dozen in numbers. The fifth order laminae are smallest
and ridge like. The free surfaces of laminae omasii are studded
with pointed papillae.
Abomasum: It is an elongated glandular compartment situated

on the right side of median plane. It is extended from xiphoid to

the 10th intercostal space. It has an anteriorly enlarged fundus
and posterior narrow pylorus through which it continued with
the small intestine. The parietal surface is in contact with right
abdominal wall and visceral surface is related to rumen and
abomasum.
The cavity of abomasum is divided into two parts by a
constriction. The first part is lined soft glandular epithelium
forming about a dozen or more spiral folds. It is soft in
consistency. The second part is narrow and pear shaped. It is
slightly harder in consistency. The pylorus is the opening of
stomach into duodenum, which is small and round.
Amphistomosis or paramphistomosis parasitic
disease of livestock, more commonly of cattle and sheep caused
by immature helminthic flatworms. The immature flukes which
are most damaging as they get attached to the stomach wall,
literally and actively sloughing off of the tissue.
Stomach of the Horse: It is a simple and glandular
stomach. Situated at the left side of median plane on the dorsal
aspect of abdominal cavity immediately behind the liver and
diaphragm extended from 9th to 14th rib. The capacity is 12
liters. The lesser curvature is shorter where cardia and pylorus
are closely placed. Greater curvature is highly extensive and
related with the spleen. The left extremity presents a cul-de-sac,
saccus caecus. The pyloric end is comparatively smaller. The
mucous membrane is divided into esophageal (non-glandular)
and glandular region separated by a sinuous rough line termed
margoplicatus.
Stomach Worms (Habronema spp. and Trichostrongylus
axei) commonly related with the stomach of horse. Larvae that
are eaten can cause gastritis and tumour-like growths in
stomach.
Stomach of the Dog: It is simple stomach, piriform in shape
with a broad fundus and narrow pylorus. Lies on abdominal
floor about midway between xiphoid cartilage to pubis.
The Gnathostoma spinigerun related with the stomach

of dog.
Small intestine: The small intestine measures about 21.5 meter
in large ruminants and has a diameter of about 5 to 6 cm. It
begins at the pylorus and terminates at ileo-caecal junction. It is
divided into duodenum, jejunum and ileum. The duodenum is
about a meter in length. It begins at the pylorus opposite to the
ventral end of 10th rib. It can be described under three parts. The
first part after its origin from pylorus ascends upwards to the
visceral surface of liver to form ‘S’ shaped curve. The second
part runs backwards to the level of tuber coxae where it turn to
left forming iliac flexure and continue as third part. The third
part runs forward with a company of terminal colon and joins
the mesenteric part. It is attached to the liver by lesser omentum,
to the remainder of its extent by mesoduodenum. The bile duct
opens into the second convexity of ‘S’ curve about 6 inches
away from pylorus. The pancreatic duct opens 30 cm farther
back.
The jejunum is highly coiled part of small intestine
measures about more than 30 feet. It is arranged in the form of
festoon at the edge of mesentery. It is made up of loosely
arranged coils. It remains on the floor of abdomen. The terminal
3 – 4 feet long segment is ileum where coiling is reduced to a
greater extent.
Large Intestine: It starts from ileo-caecal junction to the anus
and measures about 10 to 12 meters in large ruminants. It is
situated on dorsal aspect of abdomen related on its left to the
rumen. The coils are absent but loops and spiral masses are
present. The caecum is a great cul-de-sac intercalated between
the small intestine and colon. It is directly continuous in front
with the colon. It runs backward and upward towards pelvic
inlet with relation to right flank. It is attached by meso-caecum.
Its terminal part is free.
The colon is the largest part of large intestine. The
greater part of it is arranged in double elliptical coils between
the layers of mesentery. It is attached by meso-colon to
sub-lumbar region. The coiled mass is referred as ansa spiralis,

which made up of centrifugal and centripetal coils bound

together by areolar connective tissue. The terminal colon has a
company of third part of jejunum. It inclines to the right, related
to the ventral face of right kidney and forms ‘S’ curve (ansa
sigmoidea) near pelvic inlet and join the rectum.
The rectum is the terminal part of bowel. It extends from
pelvic inlet to anus. It is almost straight part. Its anterior most
part up to first coccygeal vertebra is covered by peritoneum,
meso-rectum. The caudal part is retero peritoneal which presents
dilatation, ampulla recti.
There are many nematodes (Ascaris spp., Strongyloides
spp., Strongylus spp., Trichuris, Toxocara spp, etc.) which affect
the intestinal tract of many species of animals.
Liver: is largest reddish brown colour gland, situated in right of
median plane extends obliquely downward and forward from
lumbo-costal angle to the level of 8th rib.
Parietal surface is strongly curved and adapted to the
abdominal face of diaphragm. Dorsally a small area comes in
contact with upper part of last two ribs (lumbo-costal angle).
The falciform ligament attaches this surface with diaphragm.
Visceral surface is irregularly concave and presents impressions
of various organs with which it is related. They are omasal
impression, reticular impression, cystic impression, portal
fissure and renal impression. The portal fissure is a depression
above the omasal impression, which contains bile duct, vessels,
and lymph nodes. Dorsal and lateral to portal fissure the
pancreas is attached. In young animals abomasal and duodenal
impressions are present.
The dorsal border is short and thick and it presents a
thick caudate lobe. It presents a depression for the lodgment of
anterior pole of right kidney and adrenal gland. Ventral border is
short and thin. The right border is marked by umbilical fissure in
which the round ligament is attached. The left border presents
the esophageal notch below its middle. Above the notch this
border lodges posterior vena cava partly embedded into it.
Gall bladder is a pear shaped sac 4 to 6 inches long,

which lies partly on the visceral surface and right abdominal

wall at 10th / 11th rib.
Liver flukes are very harmful for their hosts, Young
immature flukes migrating through the liver tissues and crossing
the wall of the bile ducts cause the major harm. This process
destroys the tissues and causes bleeding. The spines in the
surface of the flukes irritate the tissues that become inflamed.
All this leads to cell death and fibrosis, i.e. the formation of
excessive connective tissue that replaces the dead liver cells,
which impairs the normal functioning of the liver. Affected
livers increase in size and become fragile. Some flukes can
become encapsulated in the liver tissues and build cysts as large
as walnuts. The bile ducts are also damaged they become
thickened and can be calcified and even obstructed.
Selected References
1. Dyce, K. M., Sac, W. O., and Wensing, C. J. L. (2010) Text book of
Veterinary Anatomy. 4th edn. Saunders, Elsevier, St. Louis Missouri.
2. Evans, H. E., and Lahunta, A. (2013) Miller’s Anatomy of the Dog. 4th
edn. Saunders, Elsevier, St. Louis Missouri.
3. Getty, R. (2012) Sisson and Grossman’s The Anatomy of the Domestic
Animals. 5th edn. W B Saunders Company, Philadelphia.

14 Identifications of Etiological Agents Causes
Abortion in Bovine
K. H. Parmar1*, R. J. Raval1, K. B. Vala1, B. J. Thakre2
and Joice P Joseph2
1
Department of Veterinary Gynecology and Obstetrics, 2TVCC
College of Veterinary Science & A. H., JAU, Junagadh
*parmarkiran16@yahoo.in; +919016617817.
A bortions have a highly negative impact on reproductive

efficiency, resulting in significant economic losses for the cattle
industry. Under optimal laboratorial conditions, etiologic
diagnosis is achieved in 23.3 to 45.5% of the cases. Bovine
abortion may be due to infectious, toxic, endocrine, physical or
nutritional causes. Infectious agents associated with abortion in
cattle include viruses, bacteria, protozoa, and fungus. The exact
proportion of cases due to infectious agents is not known, but in
90% of cases in which an etiologic diagnosis is achieved the
cause is infectious. Efficient diagnosis requires a complete
diagnostic protocol associated with submission of appropriate
specimens and clinical history. Traditional diagnostic tools
include serology, histopathology, bacterial and viral isolation,
and for certain agents direct examination or
immunohistochemistry.
Bacterial cause of Bovine Abortion
Brucellosis
Bovine brucellosis is the well-known and most controversial
infection of the bovine reproductive system. Brucellosis
generally has been thought of as a cattle disease, but it is also
seen in swine, sheep, goats, dogs, horses and wildlife, and can
be readily transmitted to humans. The disease represents a real
occupational hazard for veterinarians, slaughter men, and cattle
producers. The organism has an affinity for certain body tissues
such as the udder, uterus, lymph nodes, testicles, and accessory
glands. Because of its affinity for the uterus, abortion is the

Identifications of Etiological Agents Causes Abortion in Bovine
the usual sign of the disease.

Common bacterial causes of bovine abortion
Infectious Time of lesions Sample for
agent abortion diagnosis
Brucella abortus 6-9 months. Placenta: retained, Placenta, foetus,
Brucellosis- Abortion or cotyledons necrotic, or uterine
Bang’s disease stillbirth red-yellow, area between discharge
2 wk to 5 m thickened. Calf: normal or
after autolytic with
infection bronchopneumonia
Campylobacter 5-8 months Placenta: mild placentitis, Placenta, foetal
foetus venerealis hemorrhagic cotyledons and abomasal
Vibriosis an edematous inter contents, vaginal
cotyledonary area. flushing
Foetus: fresh or autolysed;
mild fibrinous pleuritis,
peritonitis,
bronchopneumonia.
Leptospira Last Placenta: diffuse placentitis Placenta, foetus
interrogans, trimester with avascular, light tan
serovars Abortion 2-5 cotyledons and ede-
grippotyphosa, weeks after matous,yellowish inter-
pomona, hardjo, infection cotyledonary areas
canicola, Foetus: autolysed
icterohaemor-
rhagiae
Arcanobacte- Any stage Placenta: endometritis and Placenta, foetus
rium diffuse placentitis, reddish
(Actinomyces) brown to brown colour.
pyogenes Foetus: autolysed, fibrinous
pericarditis, pleuritis, or
peritonitis
Listeria Last Dam: fever, inappetance Placenta, foetus
monocytogenes trimester Placenta: retained. Foetus:
autolysed Fibrinous
polyserositis and white
necrotic foci in the liver and/
or cotyledons

Diagnosis:
Diagnosis and control of the disease in animals must be carried
out on a herd basis. There may be a very long incubation period
in some infected animals and individuals may remain
serologically negative for a considerable period following
infection. The identification of one or more infected animals is
sufficient evidence that infection is present in the herd, and that
other serologically negative animals may be incubating the
disease and present a risk.
Diagnostic tests fall into two categories: Those that demonstrate
the presence of the organisms and those that detect an immune
response to its antigens.
Bacteriological methods: The isolation and identification of
Brucella offers a definitive diagnosis of brucellosis and may be
useful for epidemiological purposes and to monitor the progress
of a vaccination programme. It should be noted that all infected
materials present a serious hazard, and they must be handled
with adequate precautions during collection, transport and
processing.
Stained smears: Smears of placental cotyledon, vaginal
discharge or fetal stomach contents may be stained using
modified Ziehl-Neelsen. The presence of large aggregates of
intracellular, weakly acid-fast organisms with Brucella
morphology is presumptive evidence of brucellosis. Care must
be taken as other infectious agents such as Coxiella burnetii or
Chlamydia may superficially resemble Brucella.
Culture: Brucella may most readily be isolated in the period
following an infected abortion or calving, but isolation can also
be attempted post-mortem. Brucella are excreted in large
numbers at parturition and can be cultured from a range of
material including vaginal mucus, placenta, fetal stomach
contents and milk using suitable selective culture media. It is of
the utmost importance that faecal and environmental
contamination of the material is kept to a minimum to give the
greatest chance of successfully isolating Brucella. If other
material is unavailable or grossly contaminated, the contents of

the fetal stomach will usually be otherwise sterile and are an

excellent source of Brucella. In some circumstances it may be
appropriate to attempt the isolation of Brucella post-mortem.
Suitable material includes supramammary, internal iliac and
retropharyngeal lymph nodes, udder tissue, testes and gravid
uterus.
Serological methods: The detection of specific antibody in
serum or milk remains the most practical means of diagnosis of
brucellosis. The most efficient and cost-effective method is
usually screening all samples using a cheap and rapid test which
is sensitive enough to detect a high proportion of infected
animals. Samples positive to screening are then tested using
more sophisticated, specific confirmatory tests for the final
diagnosis to be made. Serological results must be interpreted
against the background of disease incidence, use of vaccination
and the occurrence of false positive reactions due to infection
with other organisms.
Rose Bengal plate test (RBT): The RBT is one of a group of
tests known as the buffered Brucella antigen tests which rely on
the principle that the ability of IgM antibodies to bind to antigen
is markedly reduced at a low pH. The RBT and other tests such
as the buffered plate agglutination tests and the card test play a
major role in the serological diagnosis of brucellosis worldwide.
The RBT is a simple spot agglutination test where drops of
stained antigen and serum are mixed on a plate and any resulting
agglutination signifies a positive reaction. The test is an
excellent screening test but may be oversensitive for diagnosis
in individual animals, particularly vaccinated ones.
ELISA tests: The ELISA tests offer excellent sensitivity and
specificity whilst being robust, fairly simple to perform with a
minimum of equipment and readily available from a number of
commercial sources in kit form. They are more suitable than the
CFT for use in smaller laboratories and ELISA technology is
now used for diagnosis of a wide range of animal and human
diseases. Although in principle ELISAs can be used for the tests
of serum from all species of animal and man, results may vary

between laboratories depending on the exact methodology used.

Not all standardization issues have yet been fully addressed. For
screening, the test is generally carried out at a single dilution. It
should be noted, however, that although the ELISAs are more
sensitive than the RBT.
Serum agglutination test (SAT): The SAT has been used
extensively for brucellosis diagnosis and, although simple and
cheap to perform, its lack of sensitivity and specificity mean that
it should only be used in the absence of alternative techniques.
Complement fixation test (CFT): The sensitivity and specificity
of the CFT is good, but it is a complex method to perform
requiring good laboratory facilities and trained staff. If these are
available and the test is carried out regularly with good attention
to quality assurance, then it can be very satisfactory
Supplementary tests: Many other serological tests have been
employed. Some, such as the Rivanol or 2-ME test, are
variations of the SAT and, although more specific, share many
of its disadvantages. At present, the use of such procedures in
the place of the standard test is not advised.
Milk testing: In dairy herds, milk is an ideal medium to test as it
is readily and cheaply obtained, tests can be repeated regularly
and give a good reflection of serum antibody. Milk from churns
or the bulk tank can be screened to detect the presence of
infected animals within the herd which can then be identified by
blood testing. This method of screening is extremely effective
and is usually the method of choice in dairy herds.
Milk ring test: The milk ring test (MRT) is a simple and
effective method, but can only be used with cow’s milk. A drop
of haematoxylin-stained antigen is mixed with a small volume
of milk in a glass or plastic tube. If specific antibody is present
in the milk it will bind to the antigen and rise with the cream to
form a blue ring at the top of the column of milk. The test is
reasonably sensitive but may fail to detect a small number of
infected animals within a large herd. Non-specific reactions are
common with this test, especially in brucellosis free areas. The
milk ELISA is far more specific than the MRT.

Milk ELISA: The ELISA may be used to test bulk milk and is
extremely sensitive and specific, enabling the detection of single
infected animals in large herds in most circumstances
Fluorescence polarization assay This technique, which requires
special reagents and reading equipment, is claimed to have
advantages in sensitivity and specificity over other methods.
Evaluation has been limited however, and the procedure is not
widely available. Further information is required before its
overall value can be assessed.
Intradermal test: This procedure, using a standardized antigen
preparation such as Brucellin INRA or Brucellergene OCB, can
be used for monitoring the status of herds in brucellosis-free
areas. It is sensitive and specific but false positive reactions can
occur in vaccinated animals.
Leptospirosis
Cattle are the maintenance hosts for Leptospira interrogans se-
rovar hardjo (type hardjoprajitno) and Leptospira borgpeter
-senii serovar hardjo (type hardjo-bovis) and incidental hosts for
serovar pomona which is maintained in swine. Transmission
among maintenance hosts is through contact with infected urine,
milk, placental fluid, transplacentally, or venereally. Trans-
mission to an incidental host occurs via contact with an environ-
ment contaminated with infected urine. The bacteria gain ac-
cess through the mucous membranes of the eyes, nose, vagina,
or abraded skin. Infection in pregnant animals can lead to abor-
tion, stillbirth, or birth of weak calves.
Diagnosis
Diagnosis of leptospira infection is difficult on an individual
animal basis due to intermittent shedding; therefore, focusing on
the whole herd will provide an increased opportunity to make a
definitive diagnosis. Select a minimum of 15 high risk animals
that are classified as difficult breeders and animals with
abnormal inter-estrus intervals. Blood is drawn for serology and
the animal is given an injection of a diuretic. A urine sample is
collected from the second urination; this ensures that if
leptospires are present they can be collected. A diagnosis is

based on the absence of, or low, antibody titers and the presence
of leptospires in the urine. Speciation is not normally performed.
Various tests detect antibodies to Leptospira Hardjo in blood
samples with serum MAT titres of >1/100 considered to be
significant.
Following is a list of current available tests and their
advantages and disadvantages.
Diagnostic Advantages Disadvantages
Test
Culturing Definitive Expensive Time Consuming
Labor-intensive
Dark Field --- Threads and fibrin easily confused
Microscopy with Leptospires Absence of Lepto
doesn’t rule it out
Fluorescent Quicker than culturing. Only genus specific
Antibody (FA) Lepto organisms are
readily observed
Histo- --- Non-specific May not identify
pathology degenerated leptospires
Serology Best of serological assays Maintenance host normally have
(MAT) Useful for herd level low titers Not hardjo-bovis specific
diagnosis Cannot distinguish vaccination
induced titers from infection
Polymerase Quick Sensitivity is high Not serovar specific Requires spe-
Chain for Lepto cial equipment High cost of
Reaction reagents
Milk Drop Diagnosis: In acute infection paired serum samples

taken three to four weeks apart will normally demonstrate
increased MAT or ELISA concentrations. Leptospires can be
demonstrated in urine samples using dark-field microscopy.
Abortion Diagnosis: Dam Serology: Dam serology is of limited
use because the MAT titre may fall rapidly after acute infection
and be negative at the time of abortion; a positive result may
only reflect previous exposure. During an abortion outbreak
MAT titres >1/400 in some aborted cows are likely to be

meaningful. ELISA titres are reported to remain positive for

much longer following infection so may simply indicate
previous exposure.
Aborted Foetus: Antibodies in foetal fluids may indicate
exposure to Leptospira hardjo in utero after four months'
gestation however the foetus may die before mounting an
immune response. Fluorescent antibody test (FAT) to detect
Leptospira hardjo antigen in foetal tissues, e.g. kidney and lung
is the best available test to confirm a diagnosis of abortion but
delays in sample submission lead to rapid sample autolysis
adversely affecting the test.
Herd screening tests: A bulk milk ELISA test is available and
can be monitored regularly as part of surveillance programme in
a herd. Pooling milk samples from first lactation heifers is a
useful way of monitoring the infection status in a herd.
Campylobacteriosis (vibriosis)
Campylobacteriosis (vibriosis) is a venereal disease of cattle
caused by the organism Campylobacter foetus sub species
foetus. Campylobacteriosis is characterized by infertility with an
increased number of services necessary for conception. Early
embryonic deaths are common. In a herd that has never been
exposed, and where no immunity exists, an acute type of
infertility problem develops. In this case, infertility caused by
endometritis results in early in cattle embryonic death and a
prolonged unapparent infections period (up to 120+ days)
Diagnosis
A definite diagnosis of genital campylobacteriosis can be
difficult and laboratory test results are often disappointing.
Although blood tests are available, they are not reliable because
it is not a systemic disease and antibodies are rarely found in the
bloodstream. Most infected heifers rid themselves of the
organism within 6 months of sexual rest, thus a reduction of
demonstrable antibodies occurs. Bacteriological examination of
aborted foetuses appears to be the only practical method of
confirming the diagnosis later in gestation. Without vaccination,
control and prevention of this disease can be difficult.

Listeriosis
Listeria monocytogenes is a well-recognized cause of abortion,
encephalitis and septicaemia in cattle. L. ivanovii has also been
implicated as a cause of abortion in cattle but occurs less
frequently than L. monocytogenes. Listeric infections and
abortions usually develop in the late winter or early spring.
Abortions are most commonly recognized in the last trimester of
pregnancy.
Diagnosis
Samples of lumbosacral CSF can be collected under local
anesthesia. In cases of listeriosis, the CSF has an increased
protein concentration (0.6–2 g/L [normal 0.3 g/L]) and a mild
pleocytosis composed of large mononuclear cells. Listeriosis is
confirmed only by isolation and identification of
L. monocytogenes. Specimens of choice are brain from animals
with CNS involvement and aborted placenta and fetus. If
primary isolation attempts fail, ground brain tissue should be
held at 4°C (39°F) for several weeks and recultured weekly.
Occasionally, L monocytogenes has been isolated from spinal
fluid, nasal discharge, urine, feces, and milk of clinically ill
ruminants. Serology is not used routinely for diagnosis, because
many healthy animals have high Listeria titers. Immuno-
fluorescence is effective for rapidly identifying
L. monocytogenes in smears from animals dead or aborted from
listeriosis and from milk, meat, and other sources. Fluorescent
antibody teclmiques and peroxidase anti-peroxidase staining
methods exist but results from the use of polyclonal sera must be
regarded with caution because of the likely abundance of
cross-reactions with other" bacteria.
IBRT (Infectious Bovine Rhinotrachitis) Virus
Infectious Bovine Rhinotracheitis or "Red Nose" is caused by
bovine herpesvirus 1 is an alpha herpesvirus that can lead to
respiratory and genital infections, as well as abortion. Abortions
due to IBR virus may result from two different mechanisms.
First, once the virus circulates in the blood it can infect the fetus.
If the fetus is about 4 to 6 months of age fetal death may occur.

In this case, abortion usually occurs during the 6th to 9th month
of pregnancy. IBR virus also can infect the ovary, causing the
corpus luteum, which maintains pregnancy in early pregnancy,
to regress. As a result the fetus is aborted.
Diagnosis
BHV-1 infection is commonly diagnosed by detection of the
host response to the virus (for example, antibodies in serum) or
by direct detection of the agent. Serological tests are frequently
used for the detection of BHV-1 infection. The types of
serological tests commonly used for testing for BHV-1 antibody
are: (a) The virus neutralisation (VN) test; and (b) The antibody
ELISA. Antibodies are detected in the serum of most animals
within 2–3 weeks of infection. Maternally-derived antibodies
may be detected for up to 7 months, but usually disappear in
about 4–5 months.
Bovine Viral Diarrhoea (BVD)
Bovine viral diarrhea virus is a Pestivirus that is transmitted
transplacentally or through inhalation or ingestion of material
contaminated with infected secretions. Animals with acute
infection present with fever, nasal discharge, enteritis, and
leukopenia. Pregnant animals infected up to 45 d of gestation
can have decreased fertilization rates and embryonic death.
Infection between 45 and 175 d of gestation can result in
abortion; however, fetuses that survive infection with a
non-cytopathic strain of BVDV between 70 and 150 d of
gestation usually become persistently infected (PI). Animals that
are PI shed large amounts of BVDV and generally do not
produce antibodies to BVDV.
Diagnosis
The diagnosis of BVDV infection hinges on the identification of
virus (using virus isolation, antigen ELISA, polymerase chain
reaction or immunoperoxidase staining techniques) or evidence
of exposure to virus (by antibody ELISA). Antibody tests, in
providing an indication of exposure, are useful in assessing the
status of a group of animals or a whole herd prior to, or as a part
of, a disease control programme. Tests for BVDV identify those

animals that are persistently infected. It is these tests that should

be used on a whole herd basis for virus eradication programmes.
Bluetongue Virus: Bluetongue virus is an orbivirus that is
transmitted by a midge Culicoides variipennis. Fetuses infected
during the first 100 d of gestation, resorb or abort. Infections
between 75 and 100 d of gestation can result in stillbirths, birth
of weak calves, or birth of calves with cerebral abnormalities.
Infection after Day 150 of gestation does not generally have a
negative effect on the fetus.
Viral causes of abortion in Bovine
Infectious agent Time of Lesions Sample for
abortion diagnosis
Bovine Viral Abortion Placenta: retained, Placenta, foetus
Diarrhoea Virus usually up to no specific lesions. (preferred
(BVD-MD) 4 months Foetus: no specific spleen), dam and
lesions, autolysed, herd mates serum
mummified
Bovine Possibly any Placenta: necrotizing Placenta, foetus,
Herpesvirus type stage but vasculitis serum samples
I (BHV I) most Foetus: autolysed, foci from the dam
Infectious Bovine commonly of necrosis in the liver
rhinotracheitis from 4
virus months to
term
Blue tongue virus Variable Foetus: autolysed Placenta, foetus,
Blue tongue serum samples
from the dam
Diagnosis
Collection of samples for investigation are blood in heparin,
Freshly dead animals: spleen, liver, red bone marrow, heart
blood, lymph nodes, Aborted and congenitally infected newborn
animals: pre-colostrum serum plus same samples as for freshly
dead animals, All samples have to be preserved at 4°C, and not
frozen.
Bluetongue virus isolation: Bluetongue virus can be propagated
in embryonated chicken eggs, cell cultures or in sheep.

Antigen identification: A direct identification of BTV in blood

or tissue samples is possible with use of the reverse transcription
-polymerase chain reaction (RT-PCR) method that allows for
serotyping and can detect BTV RNA in samples as late as six
months after infection.
Antibody identification: Serogroup-specific antibodies against
BTV can be detected by a competitive ELISA test targeted to the
VP7 protein. This is a rapid method permitting determination of
serum or plasma antibody as early as the 6th post-infection day.
Serological tests: Complement fixation largely replaced by the
AGID test, Agar gel immunodiffusion (an alternative test for
international trade)
Protozoal Causes of Abortion in Bovine
Common Protozoal diseases causing abortion are
Trichomoniasis and Neosporosis.
Trichomoniasis
Diagnosis: Trichomoniasis is diagnosed by culturing samples
from the infected bull’s prepuce or from the uterine discharge of
infected cows.
Neosporosis
Neospora caninum is protozoa that can cause abortion early in
the second trimester and infected cows can abort repeatedly. The
definitive host for the organism is the dog that ingests tissue
cysts. The cow then ingests sporulated oocysts in feed, water or
soil contaminated with the dog feces. Tachyzoites can then be
transmitted through the placenta to infect the fetus. Infected
cows are asymptomatic.
Diagnosis: An aborted foetus is the best specimen to be sent to a
laboratory to establish the cause of any abortion. In the case of
neosporosis, the foetal brain and heart are the best specimens for
diagnosis, as these organs show distinctive changes under the
microcope in a high percentage of affected foetuses. Even
mummified, decomposing or partly-eaten foetuses can been use-
ful for diagnosis, provided that the head is intact, with the brain
(and heart and lung) collected for fixation in 10% formalin solu-
tion for microscopic examination. It is important to collect

aborted foetuses, chill them and submit them to a laboratory as

soon as possible. Alternatively, blood samples or foetal fluids
can be tested for the presence of antibodies to Neospora
caninum. Positive results from foetal samples are a strong
indicator of exposure to the parasite, but negative results in
younger foetuses are not reliable, as the immune system of the
foetus may simply not have been mature enough to mount an
immune response. Because many cows may be positive for
Neospora but not abort, care must be taken in interpreting the
mother’s blood results. Comparing antibody levels in cows that
have aborted with levels in pregnant cows in the same herd is
more likely to provide meaningful results than a sample from a
single cow.
Infectious agent Time of Lesions Sample for

abortion diagnosis
Aspergillus sp 4 months Placenta: severe, necrotising Foetus, placenta
(6080% to term placentitis Cotyledons
Mucorsp, most enlarged, necrotic,
Absidia, or common intercotyledonary area is
Rhizopus sp in winter thickened and leathery.
Foetus: autolysed ~30% have
gray ringwormlike skin
lesions principally involving
the head and shoulders
Tritrichomonas First half Placenta: retained, mild Placenta,
(Trichomonas) of placentitis with hemorrhagic foetus, vaginal/
foetus gestation cotyledons and thickened uterine discharge
Trichomoniasis intercotyledonary areas
covered with flocculent
exudates.
Foetus: no specific lesions
Neospora Any Placenta, foetus: no specific Placenta, foetus
caninum stage, but gross lesions, autolysed. (brain, heart, liver,
Neosporosis most Microscopic: focal body fluids), serum
often 5-6 encephalitis with necrosis from the dam
months and nonsuppurative
inflammation, hepatitis inf.

Mycotic Causes of Abortion in Bovines

Fungal or mycotic infection of the placenta is one of the most
common causes of sporadic bovine abortion. Anywhere from 20
-35% of abortions have been attributed to fungal causes.
Abortion occurs when fungal spores enter a pregnant cow’s
blood stream (possibly through breaks in the lining of the upper
digestive tract), settle at the junction of the maternal and foetal
placentas, grow and attack the placental tissues. In general,
fungal spores may be present in cattle feed. However, some
feeds such as improperly preserved silage and hay that has been
wet, contain many more spores than others.
Moreover, several PCR and RT-PCR (reverse
transcription-polymerase chain reaction) protocols have been
recently developed for identification of infectious agents in
aborted bovine fetuses, including Brucella abortus Leptospira
spp., Listeria monocytogenes Bovine Herpesvirus 1,
Campylobacter fetus subsp. venerealis, Neospora caninum
Mycoplasma bovis, Mycoplasma bovigenitalium,
Chlamydophila, Salmonella enterica.
Even today bovine abortion is still remains a major
economic problem in India. Numerous bacterial, viral, protozoan
and fungal pathogens have been associated with abortion in
cattle. These pathogens can result in substantial economic
losses, indicating the need for control measures to prevent
infection or disease. Prevention must be centered on keeping
accurate records and collecting good samples for laboratory
analysis and employing good biosecurity practices that inhibit
the introduction and spread of infectious agents and utilizing
vaccination programs could limit abortion occurrence. Maintain
the general health and immune function of animals by providing
a well-formulated ration, clean water and a clean/dry
environment.
References: available upon request.

15 Herd-Based Laboratory Tools for Evaluation
of Nutritional and Metabolic Disease in Dairy
Herds
S.S. Patil*, H.H. Savsani, D.D. Garg, K.S. Murthy,
R.B. Makwana and Oliva Das
Department of Animal Nutrition, C.V.Sc. & A.H., JAU, Junagadh-
362 001.
*drsrpatt@gmail.com; +919725561653
M etabolic and nutritional diseases follow increased milk

production and increase in dairy herd’s size. These factors favor
the use of rigorous, quantitative monitoring of metabolic and
nutritional diseases whenever possible. There are three most
critical diseases in dairy herds – sub-acute ruminal acidosis
(SARA), ketosis, and parturient hypocalcemia (clinical plus
subclinical milk fever) along with other conditions like
hypomagnesemia, udder edema, hypokalemia, etc), but these are
less common disorders and there are limited published data
available to permit the development of a testing scheme (Oetzel,
2004).
Appropriate Sample Sizes for Herd-Based Tests.
The suggested minimum sample size for herd-based tests with
proportional outcomes is 12 cows. This minimum sample size
gives reasonable confidence (75% or more) that the herd
classification from the test results of 12 cows will correctly
represent the true classification for the entire group.
Interpreting Test Results for Groups vs. Individual Cows.
The interpretation of herd-based tests for metabolic and
nutritional diseases is very different than interpreting laboratory
results for metabolites from individual cows. Test results from
individual cows are interpreted by comparing the laboratory
result to a normal range established by the laboratory. Normal
ranges are often derived by calculating a 95% confidence
interval (or a similar statistic) of test results from clinically
Herd-Based Laboratory Tools —— Metabolic Disease in Dairy Herds
normal animals. This approach is useful for making decisions

about individual sick cows, but is not useful for interpreting herd
- based test results. Interpretation of herd-based test results
requires an understanding of how the each test affects cow
performance (regardless of whether they are within the normal
range or not), a statistically- based approach to determining
subsample sizes, and an emphasis on monitoring subclinical
disease prevalence instead of clinical disease incidence.
Interpreting Herd Proportions vs. Herd Means.
Herd test results for metabolic diseases can be interpreted as
either the mean test result of the subgroup sampled or as the
proportion of animals above or below a certain cut-point within
the subsample. If a test is associated with disease when it is
either above or below a biological threshold (cut-point), then it
should be evaluated as a proportional outcome. For example,
ruminal pH ≤5.5 puts cows at risk for SARA, with subsequent
rumenitis and other complications (Garret et al., 1999). High
ruminal pH values are not important per se in the herd
evaluation, as any value over 5.5 is considered acceptable.
Therefore, interpret the proportion of cows with ruminal pH
below the cut- point and do not be concerned with the mean
value of the group tested.
Herd Monitoring for Subacute Ruminal Acidosis
Subacute ruminal acidosis (SARA) is diagnosed and prevented
on a herd basis, there is no practical way to diagnose or treat it
on an individual cow basis. Clinical signs in dairy herds affected
with SARA may include low or fluctuating dry matter intakes,
low body condition scores, diarrhea, nosebleeds, unexplained
deaths due to chronic inflammatory diseases, unexplained high
cull rates due to vague health problems, milk fat depression, and
decreased milk production in the second and greater lactation
cows relative to the first lactation cows. None of these signs by
themselves are diagnostic for SARA; however, considered
together they form the basis for a presumptive herd diagnosis of
SARA. It can be extremely useful to support a presumptive
diagnosis of SARA in a herd with quantitative ruminal pH data.

Ruminal pH below about 5.5 for prolonged time periods

is the apparent cause of the clinical signs observed in herds with
SARA problems. Evaluation of ruminal pH is challenging
because it is difficult to obtain a sample for testing, and because
ruminal pH varies from day to day within herds and time of day
within cow.
Herd Monitoring for Ketosis
Ketosis in dairy herds can be monitored by testing for blood
β-hydroxybutyric acid (BHBA). Ketosis is also a threshold
disease, and cows are affected only when BHBA concentrations
are elevated. Lowering BHBA below a threshold concentration
is of little to no biological significance to the cow. Therefore,
herd-based BHBA test results are interpreted on a proportional
basis, and the mean concentration for the group of cows tested is
of no concern. Blood BHBA concentration above 14.4 mg/dl
(1400 μmol/L) is the most commonly used cut-point for ketosis.
This cut-point is considerably higher than the upper end of the
typical laboratory normal reference range for BHBA in
individual cows.
Non-esterified fatty acid (NEFA) concentrations in
blood can be used to monitor energy balance in pre- fresh cows.
Elevated NEFA prior to calving indicate negative energy balance
are suggest increased risk for DA, ketosis, and other problems
after calving (Cameron et al., 1998). Low NEFA concentrations
are not biologically important. The threshold for NEFA in
pre-fresh cows (2 to 14 days before actual calving) is 0.400 mEq/
L. In herd testing situations, we evaluate the proportion of cows
tested above this cut-point and not the mean.
Herd Monitoring for Hypocalcemia
The incidence of parturient hypocalcemia (clinical plus
subclinical milk fever) in a dairy herd is evaluated by measuring
serum calcium concentration within 12 to 24 hours of calving. A
cut-point of less than 8.0 mg/dl (2.0 mmol/l) total serum calcium
has been used to define parturient hypocalcemia (Oetzel et al.,
1996). Blood calcium results from fresh cows are interpreted as
the proportion of cows below the cut-point.

Tests for herd-based evaluations of metabolic and

nutritional diseases also require well-defined alarm levels for the
proportion of animals above (or below) the described cut-point.
Because of normal biological variation, a few individual cows
are expected to be above (or below) the biological threshold.
Alarm levels are established from research results and/or clinical
experience with these tests in herd settings. Table 1 lists
suggested cut-points and alarm levels for ruminal pH, BHBA,
and NEFA test results. Cows chosen to be sampled must come
from the appropriate “eligible” or “at risk” group within the
herd. It is of no clinical value to test cows for a condition for
which they have little risk.
Table 1. Cut-points, alarm levels, and defined at-risk groups for
metabolic tests and their associated diseases (Cook et al., 2006).
Test Cut point Alarm level At risk group Associated
proportion disease
risk
BHBA 14.4 mg/dl >10% Lactating cows 5 Ketosis,
to 50 days in DA
milk
NEFA 0.400 mEq/l >10% Pre-fresh dry Ketosis,
cows 2 to 14 days DA, Fatty
before actual Liver
calving
Ruminal pH 5.5 >25% Lactating cows 5 SARA
to 50 days in
milk in herds
where
concentrate fed
separately, 50 to
150 days in milk
in TMR fed herds
Blood Cal- 8.0 mg/dl >30% Lactating Clinical
cium multiparous Milk fever
cows, 12-Ketosis,
DA

Urea Nitrogen Testing to Evaluate Protein and Energy

Nutrition
Blood UN (BUN) or milk UN (MUN) are indirect measures of
protein and energy nutrition in lactating cows. High UN’s may
be caused by either high dietary crude protein (especially soluble
protein) and/or low dietary NFC. High UN’s are a risk factor for
infertility and body condition score loss due to the energy cost of
detoxifying excessive ruminal ammonia into urea by the liver.
The effect of time relative to feeding on UN concentrations is
great, particularly if the protein is fed as a separate component of
the diet two or three times a day. Lack of control of the time of
UN sampling relative to feeding has greatly hindered the
effectiveness of this test in the past. Sampling at about 3 hours
after a major protein feeding should assist in determining peak
daily UN concentrations. Consistent time of sampling relative to
feeding is necessary when monitoring a herd over time.
Sources of Error in Herd-Based Testing.
Biological tests can be very useful in supporting other clinical
evidence of a metabolic disease problem on a dairy subject to
errors from inadequate sample size, improper sample handling,
inappropriate time of sample collection relative to feeding, and
laboratory error. Thus, biological test results should be
supported by other herd data. For example, a finding of a high
proportion of cows with low ruminal pH collected by
rumenocentesis should be supported by low fiber diets being
consumed by the cows.
Conclusion:
Different herd monitoring protocols in correlation with history
and signs and symptoms of affected animals are very useful for
early and confirmative measures for various metabolic diseases
in livestock. This methodology has particular importance in
large farms.

Advanced Laboratory Techniques in Livest

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Advanced Laboratory Techniques in Livest

Uploaded by

Copyright:

Available Formats

Binod Kumar, B J Thakre, B S Mathapati, V A Kalariya,

V K Singh and Tapas Kumar Patbandha

Advanced Laboratory Techniques in

Assistance to States for Control of Animal Diseases

All rights reserved. No part of this publication may be

Applications for reproduction should be made through the

Publication No. : 3/1-24

Correct Citation: Binod Kumar, Thakre, BJ, Mathapati, BS, Singh

Production, printing and distribution of this guide-book has

Dr. Binod Kumar

L ivestock sector plays an important role in the national

gastro-intestinal nematodes (GIN) are the major parasites drawn

2 Advanced laboratory techniques in livestock disease investigation

of parasites. Following information need to be gathered before

Advanced laboratory techniques in livestock disease investigation 3

in Teladorsagia circumcincta in lambs and goats after

4 Advanced laboratory techniques in livestock disease investigation

control is the FAMACHA system. Hereby, the lower eyelid of

Advanced laboratory techniques in livestock disease investigation 5

6 Advanced laboratory techniques in livestock disease investigation

vaccine for dog hook worm and anti-coccidial vaccines, were

Advanced laboratory techniques in livestock disease investigation 7

measures viz, managemental control, nutritional control,

8 Advanced laboratory techniques in livestock disease investigation

D uring 1940-2004, more than 20% of all emerging

Acarida) includes ticks. A characteristic of the Acarines is the

10 Advanced laboratory techniques in livestock disease investigation

multi-species of ticks, which apart from transmitting diseases

Advanced laboratory techniques in livestock disease investigation 11

management in which different control methods are adapted to a

Ticks can be identified to the family, genus and species level

Advanced laboratory techniques in livestock disease investigation 13

Argasid (soft) ticks Ixodid (hard) ticks

below for identification.

14 Advanced laboratory techniques in livestock disease investigation

 Salient features are similar to R. (B). microplus

Advanced laboratory techniques in livestock disease investigation 15

Hyalomma anatolicum and Hyalomma marginatum

16 Advanced laboratory techniques in livestock disease investigation

S pecimen collection involves the sampling of tissue or fluid

Advanced laboratory techniques in livestock disease investigation

18 Advanced laboratory techniques in livestock disease investigation

abnormal organs both). Small pieces of about 0.5 cm in 10%

Advanced laboratory techniques in livestock disease investigation 19

bovis), Body cavities (Setaria spp), Trachea (Syngamus

20 Advanced laboratory techniques in livestock disease investigation

Advanced laboratory techniques in livestock disease investigation 21

Identification of organism by direct microscopy and culture

22 Advanced laboratory techniques in livestock disease investigation

of organisms is an important feature in identification of the

Advanced laboratory techniques in livestock disease investigation 23

24 Advanced laboratory techniques in livestock disease investigation

Advanced laboratory techniques in livestock disease investigation 25

Tissue for histopathology: 10% formalin is added in about 25

26 Advanced laboratory techniques in livestock disease investigation

T horough examination helps in proper diagnosis of disease

Advanced laboratory techniques in livestock disease investigation

region will show trembling and violent twitching. Crepitating

28 Advanced laboratory techniques in livestock disease investigation

In chronic case abortion is less common but retained placenta is

Advanced laboratory techniques in livestock disease investigation 29

consistency containing mucous and blood, weakness, fall in

30 Advanced laboratory techniques in livestock disease investigation

body lesions, extensive areas of alopecia and scarring.