Bioresource Technology 333 (2021) 125208

Contents lists available at ScienceDirect

Bioresource Technology
journal homepage: www.elsevier.com/locate/biortech

Aerobic degradation of decabrominated diphenyl ether through a novel

bacterium isolated from municipal waste dumping site: Identification,
degradation and metabolic pathway
Sonam Paliya a, b, Ashootosh Mandpe a, b, M. Suresh Kumar a, b, Sunil Kumar a, b, *
a
CSIR-National Environmental Engineering Research Institute (CSIR-NEERI), Nehru Marg, Nagpur 440 020, India
b
Academy of Scientific and Innovative Research (AcSIR), Ghaziabad 201 002, India

H I G H L I G H T S

• Aerobic degradation of BDE-209 by Bacillus tequilensis BDE-S1 reported first time.

• 65% of 50 mg/L BDE-209 effectively degraded by Bacillus tequilensis BDE-S1.
• Established significant correlation between BDE 209, bromide, COD and cell biomass.
• Identified metabolites and prediction of possible degradation pathway.
• Debromination at ortho and meta positions was predominant process of degradation.

A R T I C L E I N F O A B S T R A C T

Keywords: In the present study, a novel bacterium capable of degrading BDE-209 aerobically was isolated from a municipal
Polybrominated diphenyl ethers waste dumping site and identified as Bacillus tequilensis strain BDE-S1 through 16S rRNA gene sequencing. A
Aerobic biodegradation correlation between BDE-209 and bromide concentration, COD, TOC, and cell biomass was established. 65% of
Mineralization
50 mg/L initial concentration of BDE-209 was degraded within eight days of incubation by BDE-S1 strain. Two
Degradation pathway
Municipal waste dumping site
hexa, two penta, one tetra-BDE congener, and benzamide were detected as metabolites. The bromide release,
COD, TOC and cell biomass were found to be significantly correlated parameters with BDE-209 degradation.
Based on the metabolite analysis, ortho and meta debromination, cleavage of diphenyl ether bond and ring-
opening were suggested as possible degradation pathways. This is the first study demonstrating the use of
indigenously isolated Bacillus tequilensis strain BDE-S1 for aerobic degradation of BDE-209, which could provide
new comprehension for bioremediation of PBDEs from contaminated environments.

1. Introduction the mercantile deca-BDE mixture was excluded in these prohibitions,

Polybrominated diphenyl ethers (PBDEs) are used extensively in
several materials, including electronic appliances, paints and textiles, as
flame retardants for the prevention of fire propagation (Karakas et al.,
2020; Shi et al., 2019). These flame retardants have 209 congeners,
which are widely mercantile as penta, octa, and deca brominated
diphenyl ether (deca-BDE) mixtures. The manufacturing of penta and
octa-BDE mixtures is discontinued worldwide due to their persisting
nature, biocumulation and toxicity (Lee et al., 2020) and are also
included in the list of new persistent organic pollutants (POPs) by
Stockholm Convention in 2009 (http://www.pops.int/). Nevertheless,
which led to a pervasive utilization of deca-BDE in commercial com­
modities (ATSDR, 2017). Decabromodiphenyl ether (BDE-209) was
predominantly utilized as an additive fire inhibitor in a wide range of
commercial commodities, including electric and electronic equipment,
plastics, textiles, furniture and synthetic materials (Wu et al., 2018). Due
to the relatively less toxic potential, the deca-BDE with smaller quanti­
ties of nona-BDE congeners is contemplated as the least hazardous
among the all other PBDE technical mixtures (Lu et al., 2013). As a
consequence of its huge commercial use and protracted half-life time,
deca-BDE has been invariably perceived in the atmosphere (UNEP,
2019). Apart from this, deca-BDE has also been found in biotic samples,

* Corresponding author at: Waste Reprocessing Division, CSIR-NEERI, Nehru Marg, Nagpur 440 020, India.
E-mail address: s_kumar@neeri.res.in (S. Kumar).

https://doi.org/10.1016/j.biortech.2021.125208
Received 20 March 2021; Received in revised form 19 April 2021; Accepted 19 April 2021
Available online 21 April 2021
0960-8524/© 2021 Elsevier Ltd. All rights reserved.
S. Paliya et al.
including fish, birds, human breast milk and blood serum (Ranjbar
Jafarabadi et al., 2020). On account of its higher bioaccumulation po­
tency and lipophilicity, BDE-209 can cause a hazard for the ecosystem
and human beings (Malarvannan et al., 2020; Li et al., 2021). Moreover,
deca-BDE can debrominate into more toxic congeners with a lower de­
gree of bromination. Hence, the pollution of deca-BDE has grabbed
increased attention and concern globally, and it is of utmost importance
to develop competent and environment-friendly techniques for the
removal of deca-BDE from the environmental compartments.
There are numerous techniques, including physical, chemical and
biological methods, aimed to lessen the deca-BDE concentration from
the environment, including adsorption, reductive debromination via
photocatalysis, electrochemical, chemical and biological techniques,
oxidative degradation and combined techniques (Yao et al., 2021).
Among all these processes, biological transformation and degradation
are considered the most competent approach because of their environ­
ment friendliness as well as practicability and cost-effectiveness (Yu
et al., 2019). However, only a few reports are available concerning the
biotic degradation (including anaerobic and aerobic approaches) of
deca-BDE (Liu et al., 2016). The studies conducted on anaerobic
degradation in the recent past showed that BDE-209 could be trans­
formed to congeners with a degree of lower bromination through
anaerobic bacteria; however, it is a time-consuming process (Yao et al.,
2021). Gerecke et al. (2006) noted that anaerobic biodegradation of
deca-BDE in sewage sludge took 238 days, while the efficiency of
biodegradation was only 50%. In the comparison of anaerobes, aerobic
bacteria can quickly mineralize several organic pollutants. However,
studies conducted on aerobic biodegradation of deca-BDE are limited
due to the scarcity of potential aerobic microorganisms.
Kim et al. (2007) reported Sphingomonas sp. PH-07, aerobically
degrading the mono, di and tri-BDEs efficiently with the use of diphenyl
ether as a substrate. Deng et al. (2011) recognized the Lysinibacillus
fusiformis DB-1 bacterium, which was proficient in debromination of
deca-BDE (BDE-209) by using lactate as the co-carbon source. Some
other investigations reporting the potency of bacteria to transmute deca-
BDE were reported by Shi et al. (2013) and Lu et al. (2013).
The mounting waste streams of flame-retarded goods (electronics,
mattresses, vehicle interiors, polyurethane foam, etc.) continue to
release PBDEs during disposal processes, including incineration, recy­
cling and landfill burial (Cai et al., 2020). The PBDEs are subjected to
long-range atmospheric transport and undergo net deposition to land by
wet and dry processes (Das et al., 2020). With a higher value of Kow,
ranging between 5.9 and 10, the PBDEs bound firmly to organic media
and was perceived to accumulate in soils throughout the world (ATSDR,
2017). From the critical review of literature, it was found that studies
regarding the fate of PBDE in soil and sludge under anaerobic environ­
ment are available; however, reports on microbial aerobic degradation
are still lacking (Zhao et al., 2018).
To the best of our knowledge, the degradation of the widespread
deca-BDE (BDE-209) under aerobic environment using indigenously
isolated bacteria from municipal waste dumping site, which is capable of
utilizing deca-BDE as a sole carbon source, is not studied yet in the In­
dian context. Thus, the present study was attempted to investigate the
biodegradation of BDE 209 through a novel bacterium isolated from the
soil samples of a municipal waste dumping site situated in Nagpur city,
India. The results exhibited in the present study will help in elucidating
the possible strategies for the elimination of these hazardous chemicals
from the polluted environment.
2. Materials and methods
2.1. Materials and reagents
An analytical standard containing mixture of 8 PBDE congeners
(concentration of tri to hepta BDE, 20 µg/ml and BDE 209, 200 µg/ml in
isooctane : toluene (80:20)) of primary interest including BDE 28 (2,4,4′ -
2
Bioresource Technology 333 (2021) 125208
Tri-BDE), 47 (2,2′ ,4,4′ -Tetra-BDE), 99 (2,2′ ,4,4′ ,5-Penta-BDE), 100
(2,2′ ,4,4′ ,6-Penta-BDE), 153 (2,2′ ,4,4′ ,5,5′ -Hexa-BDE), 154
(2,2′ ,4,4′ ,5,6′ -Hexa-BDE), 183 (2,2′ ,3,4,4′ ,5′ ,6-Hepta-BDE) and BDE
209 (2,2′ ,3,3′ ,4,4′ ,5,5′ ,6,6′ -Deca-BDE) was acquired from AccuStandard
(New Haven, CT, USA). BDE-209 with purity of > 96% was obtained
from Tokyo chemical industries, Japan and dissolved in dichloro­
methane (DCM): hexane (1:1) solution to prepare stock solution for
isolation and degradation studies. A multi anion standard containing F,
Cl, Br, NO3, PO4 and SO4 was purchased from Inorganic ventures (USA).
Acetone, hexane, and DCM (HPLC grade) were purchased from Sigma-
Aldrich (USA). The ultrapure water utilized was obtained from Elix
Essential water purification system (Merck, USA). Anhydrous sodium
sulphate, silica gel, glass wool and all other chemicals and reagents used
for analysis were of reagent grade.
2.2. Soil sample collection area
Soil samples were amassed (0–15 cm) in June 2019 from the Bhan­
dewadi landfill site situated in the eastern part and about 8 km away
from the center of Nagpur city, India. The area of this landfill site is
around 20 ha and almost 1,119 tonnes per day (TPD) of municipal solid
waste is being generated by the 2.5 million population (Nagpur
Municipal Corporation, 2011) of Nagpur city, which is dumped in this
landfill site (Arcadis Germany, 2017).
Soil samples were amassed with the help of a clean hand shovel in
wide mouth precleaned jars and brought to the laboratory at 4 ◦ C and
kept on 4 ◦ C till further analysis (not more than two weeks).
2.3. Physico-chemical analysis of soil sample
The electrical conductivity (EC) and pH were analyzed using the
digital probe of Mettler Toledo (Columbus, USA); cation exchange ca­
pacity (CEC) and exchangeable cations were determined by following
the standard protocols (Bureau of Indian Standards, 1976; Soil Science
Division Staff. USDA, 2017). The method given by Richards (1954) was
followed for the analysis of soluble anions: bicarbonates and carbonates
and the sulfate ions were measured using the UV–Visible Spectropho­
tometer, UV-1650pc (SHIMADZU, Japan). The load of exchangeable
cations (potassium and sodium) and available potassium were deter­
mined through a digital Flame Photometer (Systronics, India). Metal
concentration in the soil sample was assessed by following the meth­
odology given by Malik and Jaiswal (2000), using Inductive Coupled
Plasma Optical Emission Spectroscopy (ICP-OES, iCAP 6000 Series,
Thermo Scientific, USA).
The total bacterial count of the soil sample was enumerated by using
Nutrient Agar medium, actinomycetes on Kenknight and Munaiers me­
dium and fungal count on Rose Bengal Chloramphenicol Agar medium.
For total viable count determination, 1 g of soil sample was transferred
in 9 ml sterile distilled water and vortexed thoroughly for 10 min. Serial
dilutions were prepared, thereafter 100 µl of diluted sample was inoc­
ulated on respective media plates using spread plate technique followed
by incubated in an incubator for 48 h (at 37 ◦ C for bacterial and acti­
nomycetes and 25 ◦ C for fungus) and colony-forming unit (CFU/g) per
gram were estimated.
2.4. Culture medium
Luria-Bertani (LB) Agar medium was used for separation,
morphology and biomass analysis. The composition of LB medium was
as follows: yeast extract 5 g/L, sodium chloride 5 g/L, peptone 10 g/L,
and agar 12 g/L. Mineral salt medium (MSM) was utilized as isolation,
acclimatization and degradation medium and prepared according to a
previous study of (Wu et al., 2018) with slight modifications, briefly:
basal mineral medium (BMM) prepared with Na2HPO4 3.6 g/L, KH2PO4
1 g/L, (NH4)2 SO4 1 g/L and trace mineral solution (2 ml/L of BMM)
containing HCl 2 ml/L, MnCl2⋅4H2O 1.15 g/L, FeCl3⋅6H2O 7.74 g/L,
S. Paliya et al.
CoCl2⋅6H2O 0.13 g/L, ZnO 0.4 g/L, CuSO4⋅5H2O 0.146 g/L, H3BO3
0.124 g/L, Na2MoO4⋅2H2O 1.04 g/L, MgCl2⋅6H2O 13.42 g/L. The pH of
media was adjusted to 7.4 and kept at 121 ◦ C for 30 min in the autoclave
for sterilization.
2.5. Bacterial isolation
The soil sample (10 g) was transferred in 100 ml of the sterile saline
solution followed by vortexing for 10 min and standing for 15 min at
room temperature. Then 5 ml of supernatant was transferred to Erlen­
meyer flasks containing 500 ml of pre-sterilized substrate specific MSM
supplemented with 30 mg/L of BDE-209 (deca-BDE). Then, flasks were
incubated at 37 ± 1 ◦ C and 130 rpm in the dark for 60 days. After in­
cubation of one month, mixed culture capable of growth was spread
onto LB agar medium plates. Single colonies were picked from mixed
culture and inoculated onto LB agar media plates for preparing pure
cultures, and five cultivable isolates were attained.
2.6. Identification of bacterial strain using BDE-209 as a sole carbon
source
The isolated bacterium was recognized based on morphological,
physiological and biochemical properties, also genotypically identified
using 16S rRNA sequence analysis. The genomic DNA of strain BDE-S1
was extracted using ZR Fungal/Bacterial DNA MiniPrep Kit (Zymor­
esearch, USA). The gene sequence of 16S rRNA was PCR amplified using
a universal primer (27F: AGAGTTTGATCCTGGCTCAG and 1492R:
TACGGYTACCTTGTTACGACTT). The PCR amplicons were visualized
on agarose gel (1%), followed by gel elusion and purification of ampli­
cons using QIAquick gel extraction kit (Qiagen, Germany). Purified PCR
amplicons were sequenced using the Sanger DNA sequencing method
and sequences were analyzed and visualized using Finch TV software
version 1.4. Assembled 16S rRNA gene nucleotide sequences were
subjected to BLAST tool in NCBI for similarity search to compare with
GenBank database. The phylogenetic tree was constructed following the
neighbor joining method utilizing the program MEGA-X software. The
cell morphology was determined by Scanning Electron Microscopy
(SEM) using VEGA 3 TESCAN SEM (Brno, Czech Republic).
2.7. Acclimatization and enrichment
For enhancing the growth and BDE-209 degradation capability, 1 ml
broth culture of strain BDE-S1 having inoculum size of 1.1 × 105 CFU/
ml was transferred in 500 ml conical flasks containing 250 ml of MSM
supplemented with 50 mg/L D-glucose and 30 mg/L of BDE-209. The
flasks were placed on a shaking incubator at 130 rpm, 37 ◦ C for 4 days in
the dark. Subsequently, 10 ml aliquot of bacterial culture (5.1 × 106
CFU/ml, growing in 50 mg/L D-glucose and 30 mg/L BDE-209) was
transferred in 250 ml of fresh MSM containing 30 mg/L of glucose: 30
mg/L BDE-209 concentration followed by in 10 mg/L D-glucose: 30 mg/
L BDE-209, 1 mg/L D-glucose: 30 mg/L BDE-209 and MSM with 30 mg/L
of BDE-209 as sole carbon source. Followed by the acclimatization, the
concentration of BDE-209 was increased from 30 mg/L to 50 mg/L for
the enrichment of bacterial culture. The flasks were kept on a shaking
incubator at 130 rpm, 37 ◦ C for 10 days in the dark. After 30 days, strain
BDE-S1 was enriched with an increased growth and biodegradation
potential. Strain BDE-S1 was stored at − 20 ◦ C in LB broth and MSM
(supplemented with 50 mg/L of BDE-209) containing 5% of glycerol.
2.8. Analysis of BDE-209 degradation by BDE-S1
The batch biodegradation studies were performed in 500 ml Erlen­
meyer flasks in triplicate. A 1 g/L stock solution of BDE-209, prepared in
DCM: hexane (1:1), was added to flasks and kept for evaporation at room
temperature, followed by 250 ml sterile MSM was added into the flasks
to reach 50 mg/L concentration of BDE-209 as a sole carbon source in
3
Bioresource Technology 333 (2021) 125208
the medium. Then, a 1 ml culture of BDE-S1 (5.6 × 107 CFU/ml) was
added to the medium. MSM without inoculum was kept as abiotic
control. All the flasks were incubated at 130 rpm and 37 ◦ C for 8 days in
the dark. Individual flasks were sacrificed at regular interludes for
analysis.
2.9. Analysis
2.9.1. Biomass, total organic carbon, chemical oxygen demand and
bromide analysis
The biomass of the culture was determined by estimating optical
density (OD) (at 600 nm) by utilizing Microprocessor UV–Visible
Spectrophotometer (Labtronics, India), keeping sterilized culture me­
dium as a blank. Also, the viability of the bacterium was analyzed by
calculating CFU/ml.
Samples were filtered through a 0.2 µm filter and used for the
analysis of total carbon content (TC), chemical oxygen demand (COD)
and bromide ions. For TC analysis, samples were injected into the TOC
Analyser (Shimadzu, Kyoto, Japan), COD was determined following the
standard protocol (Baired et al., 2013) and bromide concentration was
estimated using Dionex ICS-3000 Ion Chromatography system (Thermo
Fisher Scientific, USA) equipped with conductivity detector and Dionex
IonPac AS23 column (Thermo Fisher Scientific, USA).
2.9.2. Sample extraction and analysis of PBDE and other metabolites
At regular time intervals of incubation, samples were withdrawn and
extracted by liquid–liquid extraction using the methodology given by
Wu et al. (2018). Briefly, after vigorous shaking, 10 ml samples were
removed from the flask and spiked with an equal volume of 1:1 DCM:
hexane solution. The mixture was then vortexed for 15 min, followed by
shaking for 12 h in the dark. Subsequently, centrifuged at 10,000 RPM
for 15 min and the upper DCM: hexane layer containing PBDEs was
collected and concentrated up to 2 ml using a rotary evaporator (Hei­
dolph Laborota 4001 efficient, Germany). The resulting extracts were
then purified using a sodium sulphate silica gel column (Wu et al.,
2018). The column was packed with 1 cm layer of glass wool, 1 gm of
sodium sulphate, 5 gm of activated silica gel and again 1 gm of sodium
sulphate layer. The silica gel and anhydrous sodium sulphate were
previously baked at 180 ◦ C and 400 ◦ C, respectively, for 6 h and stored in
screw-capped dry bottles. The packed column was initially washed with
the 20 ml of DCM: hexane (1:1) solution, thereafter extract was trans­
ferred into the column and eluted with the 20 ml of DCM: hexane (1:1)
solution. Collected elutes were dried using a rotary evaporator and
dissolved in 1 ml of hexane and stored in amber colour gas chroma­
tography (GC) vials for further analysis.
The quantity assessment of BDE-209 and other less brominated
congeners was conducted on a Claurus 690 GC system fitted with a 63Ni
electron capture detector (ECD) (PerkinElmer, USA). A DB-MS capillary
GC column (Agilent J&W, USA) having a length of 15 m, 0.25 mm in­
ternal diameter (ID) and 0.10 µm film thickness was utilized for chro­
matographic separation. The 1 µl sample was inserted through splitless
injection at 250 ◦ C and nitrogen was employed as a carrier gas (flow rate
of 1 ml/minute). The temperature of the oven was programmed from an
initial temperature of 100 ◦ C for 1 min, increased up to 250 ◦ C with the
rate of 15 ◦ C/minute (hold for 2 min) and finally raised to 300 ◦ C at the
rate of 25 ◦ C/minute, hold for 10 min. The temperature of the detector
was kept at 320 ◦ C.
A GC (Varian GC-450, USA) ion trap mass spectrometer (MS) system
(Varian 240-MS, USA) was used for the detection of lower PBDE con­
geners and other metabolites using electron ionization with selective ion
monitoring mode. The GC–MS was also equipped with the same column
used for the analysis on GC-ECD. Helium was utilized as carrier gas with
a flow rate of 1 ml/minute. A 1 µl sample was injected into the system by
split less automatic injection at the temperature of 250 ◦ C. The tem­
perature of the oven was started from 100 ◦ C to 250 ◦ C at the rate of
15 ◦ C/minute and finally raised up-to 300 ◦ C at the rate of 25 ◦ C/minute.
S. Paliya et al. Bioresource Technology 333 (2021) 125208

The temperature of the transfer line and ion source was kept at 230 ◦ C Table 1
and 180 ◦ C, respectively. Metabolites were identified by library search Physico-chemical and biological characteristics of soil samples collected from
of the spectrum. municipal waste dumping site for bacterial isolation.
Parameter Values
2.10. Analytical method validation pH 8.23 ± 0.22
EC (mS/cm) 3.75 ± 0.98
Analytical grade solvents and chemicals were used for the experi­ Total Carbon (%) 11.04 ± 1.21
ments. The PBDE and all other standards were prepared in the fume Nitrogen (%) 1.17 ± 0.04
Hydrogen (%) 1.62 ± 0.02
hood. Ultrapure water was used to conduct all experiments. MSM Available Nitrogen (kg/ha) 1697.00 ± 1142.61
without inoculum was kept as abiotic control to evaluate abiotic Organic Carbon (%) 5.63 ± 2.23
degradation of BDE-209 and processed in identical conditions as the Available Potassium (kg/ha) 1406.67 ± 728.07
sample. The biological activity was also checked in control at regular Silica (mg/kg) 0.02 ± 0.02
Soluble Anions Carbonate (meq/litre) 7.50 ± 2.12
time intervals. One procedural blank was analyzed after each sample for
Bicarbonate (meq/litre) 16.50 ± 4.58
quality control. A single concentration of the mixed standard (10 10 μg/ Sulphate (mg/litre) 183.46 ± 49.84
ml of TrBDE to HpBDE congeners and 100 μg/ml concentration of BDE Exchangeable Calcium (meq/litre) 20.17 ± 4.51
209 congener for GC–MS and 1 μg/ml concentration of all the congeners Cations Magnesium (meq/litre) 9.67 ± 5.13
for GC-ECD) was introduced in GC systems to determine the retention Sodium (meq/litre) 35.43 ± 25.52
Potassium (meq/litre) 46.75 ± 27.84
time of individual congeners. The retention time of bromide ion was also Cation Exchange Capacity (meq/ 13.33 ± 2.66
determined using 1 mg/L concentration of bromide anion standard. 100 g)
Calibration curves were prepared, and quantification was performed Viable count Total bacterial count (CFU/g) 47 X 105 ± 1.1 X
through good linearity. 105
Total actinomycetes Count (CFU/g) 8.1 X 105 ± 7 X 106
Total fungal count (CFU/g) 3.1 X 105 ± 3 X 105
2.11. Measurement of biodegradation efficiency
Columns Represent Mean Of Three Replications And Standard Error Bars.
Carbon mineralization, chemical oxygen demand removal, debro­
mination and BDE-209 biodegradation efficiencies were calculated and hydrogen were estimated as 11.04, 1.17 and 1.62%, respectively,
using the equation (1), (2), (3) and (4), respectively. while the value of available nitrogen and available potassium were
observed 1697 and 1407 kg/ha, respectively in the soil sample. EC is a
MTOC’ − MTOC
Carbonmineralizationefficiency(%) = X100 (1) crucial parameter that indicates the health and microbial activity of the
MTOC’ soil (Ramaswamy, 2018). The high EC value observed in the soil sample
of the dumping site recommended the existence of salts which might be
RCOD’ − RCOD
Chemicaloxygendemandremovalefficiency(%) = X100 the attribute of the scrapping of metallic waste at the landfill (Agbeshie
RCOD’
et al., 2020). The higher percentage of organic carbon in soil samples
(2)
might be due to the presence of biodegradable municipal solid waste in
RBr landfills (Deshmukh and Aher, 2017). The magnitudes of soluble anions,
Debrominationefficiency(%) = X100 (3) carbonate and bicarbonate were observed 7.50 and 16.50 meq/liter,
RT
respectively, while the values of exchangeable cations viz. Ca, Mg, Na
C0 − C and K were observed as 20.17, 9.67, 35.43 and 46.75 meq/liter,
BDE − 209degradationefficiency(%) = X100 (4)
CO respectively (Table 1). A higher concentration of anion and cations in
the soil of the dumping site was also observed in the study of Gutiérrez-
Where MTOC’ is the initial total organic carbon (TOC) concentration, Ginés et al. (2016). In the study of Chineyre et al. (2013), an elevated
MTOC is the TOC concentration at the time indicated. RCOD’ is the initial amount of salts was found associated with the increasing waste dumping
COD, RCOD is the COD at the time indicated. RBr is the concentration of at the landfill site. The total bacterial count of soil was recorded 47 ×
bromide ions released, RT is the theoretical bromide ion concentration 105 CFU/g, however total actinomycetes and the fungal viable count
from the complete debromination of the substrate. C0 is the initial BDE- were estimated 8.1 X 105 and 3.1 X 105 CFU/g, respectively. Landfills
209 concentration, C is the BDE-209 concentration at the time indicated. have been considered nutrient rich biosphere system due to the presence
of a higher amount of carbon and other nutrients (Meyer-Dombard et al.,
2.12. Statistical analysis 2020). Therefore, the elevated microbial count observed in the present
study might be the attribute of the higher carbon and other nutrient
The data of physicochemical properties of soil, PBDE concentration contents.
and all other parameters were subjected to analysis of variance
(ANOVA). The descriptive analyses were conducted using Microsoft
office excel 2016 software and the least significant differences (LSD) 3.2. Identification and characterization of BDE-209 degrading bacteria
were calculated (p ≤ 0.05). All the graphical representations and the
Pearson correlation coefficient were evaluated using OriginPro version 8 A total of five cultivatable isolates were purified after two months of
software. enrichment. Among these isolates, BDE-S1 showing the higher growing
and BDE-209 degrading capability was chosen for further character­
3. Results and discussion ization. The strain BDE-S1 was gram negative and observed rod shape,
approximately 2.37–2.94 µm in length and 0.48–0.61 µmin diameter
3.1. Physico-chemical properties of soil sample after 24 h of incubation at 37 ◦ C on LB agar medium plates (Table 2). The
morphological and biochemical attributes of strain BDE-S1 are pre­
The physico-chemical characteristics of soil samples collected from sented in Table 2. The colony morphology of strain BDE-S1 on LB agar
Bhadewadi landfill site, Nagpur, Maharashtra, India, for the isolation of plates was observed opaque white with undulated margins, elevated
microorganisms are presented in Table 1. The pH of the soil was folds on the surface and a gummy consistency. As per the BLAST search
observed 8.23, indicating the alkaline nature of landfill soil. The mea­ tool utilizing NCBI GenBank, strain BDE-S1 was found to have 99%
sure of EC was found 3.75 mS/cm and the value of total carbon, nitrogen similarity with Bacillus tequilensis. The 1402 bp sequences obtained from

4
S. Paliya et al. Bioresource Technology 333 (2021) 125208

Table 2 3.3. Bacterial growth, carbon mineralization and chemical oxygen

Morphological and biochemical characteristics of Bacillus tequilensis strain BDE- demand removal efficiency
S1.
Test item Result Test item Result PBDEs are organo-brominated compounds that show resistance for
Morphology Biochemical characterization
mineralization in an instinctive environment due to their hydrophobic
Margin or edge Undulate Citrate utilization + nature, thus persist in the environment for an extended period (Arslan
Surface texture Elevated Lysine utilization – et al., 2017). In the present study, the carbon mineralization efficiency
Folds of strain BDE-S1 was evaluated in terms of TOC concentration and COD
Elevation Raised Ornithine utilization +
removal and results of carbon mineralization efficiency with respect to
Consistency Gummy Urease test +
Optical features Opaque Phenylalanine – bacterial growth are depicted in Fig. 2. Also, the carbon content and
White deamination COD values obtained at regular time intervals are presented in Table 3.
Pigmentation/ White Nitrate reductions + According to the results, the mineralization and COD removal efficiency
chromogenesis were found quickly increased from day 2 to day 4, thereafter found
Form Irregular H2S production
slightly increasing with the incubation time (Fig. 2(B)). The minerali­
–
Cell shape and size (µm) Glucose test +
Length 2.37–2.94 Adonitol test – zation efficiency was observed 77% on day 4; however, it was recorded
Diameter 0.48–0.61 Lactose test – 81 and 85% on day 6 and 8, respectively. Similarly, COD removal was
Cell structure Rod shape Arabinose test + observed 16, 29 and 47% on days 4, 6 and 8, respectively. The biomass
Gram staining Sorbitol test
– +
of strain BDE-S1 was increased from day 1 (3.7 × 105 CFU/ml) to day 6
+ stands for positive reaction, - stands for negative reaction. (7.2 × 106 CFU/ml), subsequently decreased from day 7 to day 10 (5 ×
106 CFU/ml). Similarly, the values of OD were observed slightly
16 s rRNA sequencing were submitted to GenBank and the novel bac­ increasing from day 1 to day 2 and quickly increasing from day 2 to day
teria capable of degradation of BDE-209 was named Bacillus tequilensis 6, then found slightly invariable with increasing incubation period
BDE-S1. The GenBank accession number of strain BDE-S1 is MW682831. (Fig. 2(A)). COD is a variable related to the concentration of organic
The phyletic tree (Fig. 1) constructed using MEGA-X software clearly matter, which is predominantly removed through microbial biodegra­
indicated the similarity of strain BDE-S1 with Bacillus tequilensis, a dation (Pan et al., 2017; Yi et al., 2020). In the present study, organic
member of the family Bacillaceae (Gatson et al., 2006). The complex matter concentration (TOC and COD) was perceived to have a significant
structure and extensive properties like hydrophobicity of BDE-209 make effect on the growth of bacteria. These results are in line with the
this compound less bioavailable (Wang et al., 2015). Only a few studies findings of the study conducted by (Pan et al., 2017). In the study of
(Wu et al., 2018) are reported the growth of bacteria on BDE-209 (as a Williams et al. (2015), depletion of organic matter was found associated
carbon source). In the present study, Bacillus tequilensis BDE-S1 is being with the total count of bacteria in the examined system. The decline in
reported for the first time with the capability to utilize BDE-209 as a sole the cell concentration observed after 6 days of incubation in the current
carbon source and effective degradation of BDE-209 aerobically. study may be due to the accumulation of growth inhibitory in­
termediates formed in the metabolization of BDE-209 (Lu et al., 2013).

Fig. 1. Phylogenetic relationship of Bacillus tequilensis strain BDE-S1 based on 16S rRNA sequence analysis using neighbourhood joining method. The tree was
formulated by MEGA-X software.

5
S. Paliya et al. Bioresource Technology 333 (2021) 125208

Fig. 2. Time course of growth, carbon mineralization efficiency and Chemical oxygen demand removal (COD) by Bacillus tequilensis strain BDE-S1 in mineral salt
medium (MSM) with 50 mg/L BDE-209 initial concentration for 8 days incubation period (A) growth of strain BDE-S1 (B) Mineralization and COD removal efficiency.
The temperature of incubation was kept at 37 ◦ C with 130 rpm and initial pH of medium was 7.4.

Table 3
Carbon content, chemical oxygen demand and bromide release profile of Bacillus tequilensis strain BDE-S1 for 8 days incubation period in mineral salt medium (MSM)
supplemented with 50 mg/L BDE-209. The temperature of incubation was kept at 37 ◦ C with 120 rpm and initial pH of medium was 7.4.
Time BDE-S1 Control
(Days)
Carbon content (mg/L) Chemical oxygen Bromide Carbon content (mg/L) Chemical oxygen Bromide
demand (COD) release (mg/ demand (COD) release (mg/
(mg O2/L) L) (mg O2/L) L)

Total Total Inorganic Total Total Inorganic

carbon organic carbon (IC) carbon organic carbon (IC)
(TC) carbon (TC) carbon
(TOC) (TOC)

0 153.30 151.10 2.16 1216 BDL 128.34 127.17 1.17 960 BDL
2 61.41 60.38 1.04 1088 0.04 125.76 124.58 1.18 992 BDL
4 35.69 34.62 1.08 1024 1.04 129.51 128.29 1.22 1120 BDL
6 29.38 28.26 1.12 864 2.09 123.34 122.08 1.26 1088 BDL
8 24.42 23.26 1.16 640 5.12 118.38 117.08 1.30 1120 BDL

BDL stands for below detection limit.

3.4. Debromination efficiency
In the biodegradation of deca-BDE (BDE-209), the debromination of
this halogenated flame retardant is the preliminary step, which results in
the generation of lower brominated compounds. Dehalogenation is the
key process and only process for biodegradation or biotransformation of
highly halogenated compounds like PBDEs (Yu et al., 2019). As the
bromide is one of the pivotal integrals in the structure of BDE-209, hence
the estimation of bromide ion release during deca-BDE degradation may
be a vital indicator of BDE-209 decomposition. In the current study,
bromide concentration was analyzed using ion chromatography and the
results of bromide release efficiency of strain BDE-S1 are exhibited in
Fig. 3(A). The culture of strain BDE-S1 in 50 mg/L of BDE-209 showed
slight debromination from day 2 to day 4 (0.1% (0.04 mg/L) and 2.5%
(1.04 mg/L), respectively), thereafter exhibited 5.02% (2.09 mg/L) and
12.29% (5.12 mg/L) on day 6 and day 8 of incubation, respectively.
There was no bromide concentration detected in controls, kept for
monitoring of abiotic degradation of BDE-209 (Fig. 3(A)). In the present
study, low efficiency of bromide release by strain BDE-S1 was detected
as compared to mineralization and COD removal efficiencies, which

Fig. 3. Time course of debromination and BDE-209 degradation by Bacillus tequilensis strain BDE-S1 in mineral salt medium (MSM) with 50 mg/L BDE-209 initial
concentration for 8 days incubation period (A) Debromination efficiency of strain BDE-S1 (B) BDE-209 degradation efficiency. The temperature of incubation was
kept at 37 ◦ C with 130 rpm and initial pH of medium was 7.4.

6
S. Paliya et al.
might occur because of the intracellular absorption and enzyme oriented
degradation of deca-BDE within the microbial cell (Tang et al., 2016).
Also, results of debromination suggested the formation of compounds
with a lower degree of bromination during the degradation of BDE-209
(Xu & Wang, 2014). In the biodegradation pathway of highly haloge­
nated compounds by aerobic bacteria, the complete dehalogenation of
the target molecule at the initial stage is arduous; hence intermediate
organo-halogens always appear (Lu et al., 2013).
3.5. BDE-209 degradation by strain BDE-S1
In the process of biodegradation of highly halogenated compounds,
hydrophilic structural analogs produce, having a lesser persistency and
reduced toxicity for biota (Takagi, 2020). The complex structure and
hydrophobicity of BDE-209 congener limit its bioavailability, which
leads to the reduced biodegradation of this organo-halogen (Stiborova
et al., 2015). As of now, only a few studies are available explaining the
biodegradation of deca-BDE using aerobic microorganisms and exhibit
differences in degradation capability that arise due to different experi­
mental conditions (Stiborova et al., 2015). In the present study, for
determining the BDE-209 degradation capability of aerobic bacterial
strain BDE-S1, the samples were harvested at definite time intervals and
analyzed for remaining BDE-209 concentration and appeared metabo­
lites. The degradation curve of the BDE-S1 strain is illustrated as Fig. 3
(B). During 8 days of incubation, 65% of the initial BDE-209 concen­
tration was observed. However, uninoculated control was found stable,
illustrating the insignificant deprivation of BDE-209 through abiotic
mechanism (Fig. 3(B)). The degradation of BDE-209 by strain BDE-S1
was observed gradually increasing from day 0 to day 2; thereafter, a
sharp increase in degradation efficiency was recorded from day 4 (33%)
to day 8 (65%) of incubation. A similar trend was observed for debro­
mination efficiency by strain BDE-S1 (Fig. 3(A). The increasing degra­
dation efficiency with incubation time might be the attribute of the
rising biomass of strain BDE-S1. The results indicated that the strain
BDE-S1 adopted the nutritional environment and started to uptake BDE-
209 as a sole carbon source for its proliferation. It is evident by the study
of Anwar et al. (2009) that the toxic compounds can also be utilized by
bacteria as a sole carbon source leading to the generation of lag phase
followed by the development of biodegradation capability. In the cur­
rent study, no discernible lag phase was exhibited by strain BDE-S1,
which shows the adaptation of strain BDE-S1 towards the BDE-209
environment at the initial incubation period. Similar results have also
been reported by Lu et al. (2013). The slow degradation rate during the
first 2 days of incubation, thereafter increased degradation efficiency
exhibited by the results might be the attribute of the first adsorption of
the insoluble BDE-209 on the bacterial cell surface followed the inte­
gration into the cell for its utilization as a nutrient (Tang et al., 2016). In
the study of Yu et al. (2019), 10 mg/L initial concentration of BDE-209
was degraded approximately 22.3% by a novel consortium CY1 within 7
days incubation. On the other hand, Shi et al. (2013) reported 55%
degradation of 1 mg/L concentration of BDE-209 through Pseudomonas
aeruginosa during 7 days incubation. In the biodegradation of haloge­
nated pollutants, the expression of catabolic genes for the generation of
catabolic enzymes such as dehalogenase and dioxygenase is the key
factor for initiating the metabolism of these complex molecules (Sti­
borova et al., 2015). The presence of hydrolase, dioxygenase and
dehalogenase enzyme in Stenotrophomonas sp. Strain WZN-1 capable in
aerobic degradation of BDE-209 was reported by Wu et al. (2018).
3.6. Analysis of metabolites and aerobic degradation pathway
To accomplish the apprehension of environmental fate, possible
biodegradation pathway, the process of mineralization, debromination
and BDE-209 degradation by strain Bacillus tequilensis BDE-S1, biodeg­
radation products were identified by GC–MS analysis on the day of in­
cubation. The proposed biodegradation pathway by strain BDE-S1 is
7
Bioresource Technology 333 (2021) 125208
depicted in Fig. 4, which shows the debromination of BDE-209 in lower
brominated congeners. The analysis showed the formation of two hexa-
BDEs (BDE 154 and 153), two penta-BDEs (BDE 100 and 99), one tetra-
BDE (BDE 47) and benzamide from the degradation of deca-BDE (BDE-
209) by strain BDE-S1. The intermediate product benzamide could be
further oxidized and mineralize for producing the CO2 and H2O as end
products. Based on the formed metabolites, debromination, break down
of diphenyl ether bond and ring-opening are the proposed metabolic
pathways for biodegradation of BDE-209. The results indicated possi­
bilities of complete biodegradation of deca-BDE without cumulation of
any persistent and more toxic by-product (Fig. 4) by strain BDE-S1. A
previous study (Wang et al., 2015) has also been reported a similar
degradation pathway for deca-BDE through aerobic bacterial strain
B. pumilus LY2. In the present study, BDE-209 possibly debromination
into BDE-154 and 153 through the removal of four bromine atoms by
ortho and meta debromination, and BDE 154 further converted into
BDE-100 and BDE-99 by ortho and meta debromination; in contrast,
BDE-153 was ortho and meta debrominated into BDE-99. Thereafter,
BDE-100 and 99 were transformed into BDE-47 by ortho and meta
debromination, which finally converted into the benzamide (Fig. 4). In
contrast, no lower PBDE congeners were detected in abiotic controls.
The depicted possible degradation pathway indicates that debromina­
tion at ortho and meta positions were the predominant process of
transformation which was in line with the results of a previous study
conducted by Wang et al. (2015). Several studies, including the study of
Wu et al. (2018), Shi et al. (2013) and Lu et al. (2013), have also been
reported the degradation or biotransformation of BDE-209 by utilizing
pure culture of bacteria. Rhodococcus sp. aerobically transformed BDE-
209 into nona to di-BDEs (Liu et al., 2016). A novel consortium GY1,
developed by Yu et al. (2019), having the Hyphomicrobium, Aminobacter,
Chryseobacterium, Pseudomonas, Bacillus, Streptomonas, Pseudamino­
bacter, Sphingobacterium and Microbacterium as predominant genera,
were found capable of degradation of BDE-209. BDE-7, 17, 47, 99, 154,
155, 181, 190, 206, 207 and BDE 208 were observed as metabolites
during the process of degradation by the consortium GY1 Yu et al.
(2019). Yu et al. (2020) investigated the biodegradation potential of
Microbacterium Y2, which transformed BDE-209 into 11 lower bromi­
nated congeners.
To the best of the author’s knowledge, this is the first study on Ba­
cillus tequilensis strain BDE-S1 mediated biodegradation of BDE-209. The
results of the current study may add objective evidence for the reme­
diation of highly PBDE contaminated matrices by the potential use of
Bacillus tequilensis strain BDE-S1. Although, the research concerning the
process of metabolism is still prefatory and needs further intense
investigation. Future research is required to predict the enzymatic
pathway related to the biodegradation of BDE-209 (deca-BDE) by Ba­
cillus tequilensis strain BDE-S1.
3.7. Correlation of BDE-209 degradation with other parameters
The correlation coefficient analysis was conducted to perceive the
relationship between the concentration of BDE-209 and mineralization
of carbon content, chemical oxygen demand, cellular biomass and bro­
mide concentration. The Pearson correlation coefficient matrix for all
the investigated parameters is exhibited in Table 4. The results indicated
a strong positive correlation between the COD and organic carbon
content (r2 = 0.774). In contrast, a strong negative correlation was
observed between COD and cell biomass and bromide concentration (r2
= 0.968 and − 0.822, respectively). COD and TOC are widely used for
analyzing the strength of organic pollution in different matrices such as
surface waste, organic chemicals and industrial effluents. Hua et al.
(2011) was also reported a significant correlation between COD and
TOC. A negative correlation was observed between the BDE-209 con­
centration and biomass (r2 = -0.811), which suggested increased
degradation efficiency with increasing biomass, leading to a reduction in
the BDE 209 concentration (Table 4). A strong negative correlation was
S. Paliya et al. Bioresource Technology 333 (2021) 125208

Fig. 4. Proposed aerobic degradation pathway for BDE-209 by Bacillus tequilensis strain BDE-S1.

Table 4
Correlation of BDE-209 degradation and debromination with bacterial growth, mineralization, and chemical oxygen demand (COD) removal efficiency of Bacillus
tequilensis strain BDE-S1 in mineral salt medium (MSM) supplemented with 50 mg/L BDE-209.
Chemical oxygen demand Organic carbon Inorganic carbon Bromide concentration BDE 209 concentration Biomass
(mg O2/L) (mg/L) (mg/L) (mg/L) (mg/L) (CFU/ml)

Chemical oxygen demand 1.000

(mg O2/L)
Organic carbon (ppm) 0.774* 1.000
Inorganic carbon (ppm) 0.554 0.936** 1.000
Bromide concentration (mg/ − 0.968** − 0.615 − 0.355 1.000
L)
BDE 209 concentration (mg/ − 0.822* 0.740 0.473 − 0.936** 1.000
L)
Biomass (CFU/ml) − 0.822* − 0.933** − 0.773 0.683 − 0.811* 1.000

significance levels for correlations are *p ≤ 0.05 (significant) and **p ≤ 0.01 (highly significant).

observed among the concentration of deca-BDE, cell growth, minerali­ 4. Conclusion

zation and intracellular protein concentration, indicating the higher
degradation efficiency of Brevibacillus brevis with increasing minerali­
zation, cellular growth and protein concentration (Wang et al., 2016). A
strong negative relationship was observed between the concentration of
bromide and BDE-209 (r2 = -0.936), which means bromide concentra­
tion was increased with the degradation of BDE-209. Similar results
were also reported by Lu et al. (2013) and Xu and Wang (2014).
A novel BDE-209 degrading bacteria, Bacillus tequilensis strain BDE-
S1, isolated from Bhandewadi municipal waste landfill, Nagpur, India,
was found to be adept in utilizing 50 mg/L concentration of BDE-209 as
a sole carbon source. The analysis of degradation metabolites suggested
that debromination at ortho and meta positions, cleavage of diphenyl
ether bond and ring-opening are the possible metabolic pathways.

8
S. Paliya et al.
Correlation analysis indicated a strong relation of BDE-209 concentra­
tion with bromide concentration and cell biomass. An indigenously
isolated bacterium from a PBDE polluted site for the aerobic disinte­
gration of BDE-209 was reported first time in India, which can be
meaningful for the bioremediation of PBDE contaminated matrices.
CRediT authorship contribution statement
Sonam Paliya: Conceptualization, Formal analysis, Data curation,
Writing - original draft and review. Ashootosh Mandpe: Formal anal­
ysis, Writing - review & editing. M. Suresh Kumar: Resources, Super­
vision, Validation. Sunil Kumar: Resources, Supervision, Validation.
Declaration of Competing Interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
Acknowledgments
The first author, Sonam Paliya, is thankful to the University Grants
Commission (UGC) for awarding Rajiv Gandhi Fellowship to work at
CSIR-NEERI, Nagpur. The authors acknowledge the Director, CSIR-
NEERI for granting permission to perform this research work in the
premises of CSIR-NEERI, Nagpur (India).
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.biortech.2021.125208.
References
Agbeshie, A.A., Adjei, R., Anokye, J., Banunle, A., 2020. Municipal waste dumpsite:
Impact on soil properties and heavy metal concentrations, Sunyani, Ghana. Sci.
African 8, e00390. https://doi.org/10.1016/j.sciaf.2020.e00390.
Anwar, S., Liaquat, F., Khan, Q.M., Khalid, Z.M., Iqbal, S., 2009. Biodegradation of
chlorpyrifos and its hydrolysis product 3,5,6-trichloro-2-pyridinol by Bacillus
pumilus strain C2A1. J. Hazard. Mater. 168, 400–405. https://doi.org/10.1016/j.
jhazmat.2009.02.059.
Arcadis Germany, 2017. Solid waste management for Nagpur (feasility study).
Arslan, M., Imran, A., Khan, Q.M., Afzal, M., 2017. Plant–bacteria partnerships for the
remediation of persistent organic pollutants. Environ. Sci. Pollut. Res. 24,
4322–4336. https://doi.org/10.1007/s11356-015-4935-3.
ATSDR, 2017. Toxicological profile for polybrominated diphenyl ethers (PBDEs), U.S.
Department of Healrth and Human Services.
Baired, R.B., Eaton, A.D., Rice, E.W., 2013. Standard methods for the examination of
water and wastewater, 23rd Edition, American public health association. https://
doi.org/10.1016/B978-0-12-382165-2.00237-3.
Bureau of Indian Standards, 1976. Indian standard methods of test for soils, Bureau of
Indian Standards. https://doi.org/10.4028/www.scientific.net/AMM.675-677.1197.
Cai, K., Song, Q., Yuan, W., Ruan, J., Duan, H., Li, Y., Li, J., 2020. Human exposure to
PBDEs in e-waste areas: a review. Environ. Pollut. 267, 115634 https://doi.org/
10.1016/j.envpol.2020.115634.
Chineyre, G., Obisike, E., Ugbogu, A., Osuocha, K., 2013. Studies on municipal solid
wastes dumping on soil anions, cations and selected enzymes activities at Njoku
Sawmill waste dumpsite, Owerri municipal, Imo Ssate, Nigeria. Ethiop. J. Environ.
Stud. Manag. 6, 774–783. https://doi.org/10.4314/ejesm.v6i6.8s.
Das, S., Aria, A., Cheng, J.O., Souissi, S., Hwang, J.S., Ko, F.C., 2020. Occurrence and
distribution of anthropogenic persistent organic pollutants in coastal sediments and
mud shrimps from the wetland of central Taiwan. PLoS One 15, 1–17. https://doi.
org/10.1371/journal.pone.0227367.
Deng, D., Guo, J., Sun, G., Chen, X., Qiu, M., Xu, M., 2011. Aerobic debromination of
deca-BDE: Isolation and characterization of an indigenous isolate from a PBDE
contaminated sediment. Int. Biodeterior. Biodegrad. 65, 465–469. https://doi.org/
10.1016/j.ibiod.2011.01.008.
Deshmukh, K.K., Aher, S.P., 2017. Assessment of soil fertility around municipal solid
waste disposal site near Sangamner city, Maharashtra. India. Curr. World Environ.
12, 401–410. https://doi.org/10.12944/cwe.12.2.24.
Gatson, J.W., Benz, B.F., Chandrasekaran, C., Satomi, M., Venkateswaran, K., Hart, M.E.,
2006. Bacillus tequilensis sp. nov., isolated from a 2000-year-old Mexican shaft-
tomb, is closely related to Bacillus subtilis. Int. J. Syst. Evol. Microbiol. 56,
1475–1484. https://doi.org/10.1099/ijs.0.63946-0.
Gerecke, A.C., Giger, W., Hartmann, P.C., Heeb, N.V., Kohler, H.P.E., Schmid, P.,
Zennegg, M., Kohler, M., 2006. Anaerobic degradation of brominated flame
9
Bioresource Technology 333 (2021) 125208
retardants in sewage sludge. Chemosphere 64, 311–317. https://doi.org/10.1016/j.
chemosphere.2005.12.016.
Gutiérrez-Ginés, M.J., Hernández, A.J., Pastor, J., 2016. Impacts of soil-soluble anions on
wild and cultivated herbaceous species: Implications for soil phytoremediation.
J. Soil Sci. Plant Nutr. 16, 423–437. https://doi.org/10.4067/S0718-
95162016005000037.
http://www.pops.int/ [WWW Document], n.d. URL http://chm.pops.int/.
Hua, X., Song, X., Yuan, M., Donga, D., 2011. The factors affecting relationship between
COD and TOC of typical papermaking wastewater. Adv. Intell. Soft Comput. 105,
239–244. https://doi.org/10.1007/978-3-642-23756-0_39.
Karakas, F., Aksoy, A., Imamoglu, I., 2020. Development of a fate and transport model
for biodegradation of PBDE congeners in sediments. Environ. Pollut. 266, 115116
https://doi.org/10.1016/j.envpol.2020.115116.
Kim, Y.M., Nam, I.H., Murugesan, K., Schmidt, S., Crowley, D.E., Chang, Y.S., 2007.
Biodegradation of diphenyl ether and transformation of selected brominated
congeners by Sphingomonas sp. PH-07. Appl. Microbiol. Biotechnol. 77, 187–194.
https://doi.org/10.1007/s00253-007-1129-z.
Lee, H.K., Kang, H., Lee, S., Kim, S., Choi, K., Moon, H.B., 2020. Human exposure to
legacy and emerging flame retardants in indoor dust: A multiple-exposure
assessment of PBDEs. Sci. Total Environ. 719, 137386 https://doi.org/10.1016/j.
scitotenv.2020.137386.
Li, X., Gao, H., Li, P., Chen, W., Tang, S., Liu, L., Zhou, G., Xia, T., Wang, A., Zhang, S.,
2021. Impaired sperm quantity and motility in adult rats following gestational and
lactational exposure to environmentally relevant levels of PBDE-47: A potential role
of thyroid hormones disruption. Environ. Pollut. 268, 115773 https://doi.org/
10.1016/j.envpol.2020.115773.
Liu, L., Zhang, Y., Liu, R., Wang, Z., Xu, F., Chen, Y., Lin, K., 2016. Aerobic
debromination of BDE-209 by Rhodococcus sp. coupled with zerovalent iron/
activated carbon. Environ. Sci. Pollut. Res. 23, 3925–3933. https://doi.org/
10.1007/s11356-015-5663-4.
Lu, M., Zhang, Z.Z., Wu, X.J., Xu, Y.X., Su, X.L., Zhang, M., Wang, J.X., 2013.
Biodegradation of decabromodiphenyl ether (BDE-209) by a metal resistant strain,
Bacillus cereus JP12. Bioresour. Technol. 149, 8–15. https://doi.org/10.1016/j.
biortech.2013.09.040.
Malarvannan, G., Poma, G., Covaci, A., 2020. Interspecies comparison of the residue
levels and profiles of persistent organic pollutants in terrestrial top predators.
Environ. Res. 183, 109187 https://doi.org/10.1016/j.envres.2020.109187.
Malik, A., Jaiswal, R., 2000. Metal resistance in Pseudomonas strains isolated from soil
treated with industrial wastewater. World J. Microbiol. Biotechnol. 16, 177–182.
https://doi.org/10.1023/A:1008905902282.
Meyer-Dombard, D.R., Bogner, J.E., Malas, J., 2020. A review of landfill microbiology
and ecology: A call for modernization with ‘next generation’ technology. Front.
Microbiol. 11, 1–22. https://doi.org/10.3389/fmicb.2020.01127.
Nagpur Municipal Corporation, 2011. Case Study: Integrated solid waste management in
Nagpurs, Maharashtra.
Pan, W., Xiong, Y., Huang, Q., Huang, G., 2017. Removal of nitrogen and COD from
reclaimed water during long-term simulated soil aquifer treatment system under
different hydraulic conditions. Water 9, 1–18. https://doi.org/10.3390/w9100786.
Ramaswamy, H.S., 2018. Soil electrical conductivity: Soil quality kit - guide for
educators, United States department of agriculture, natural resources conservation
services. https://doi.org/10.1201/b16605-8.
Ranjbar Jafarabadi, A., Dashtbozorg, M., Raudonytė-Svirbutavičienė, E., Riyahi
Bakhtiari, A., 2020. First report on polybrominated diphenyl ethers in the Iranian
Coral Islands: Concentrations, profiles, source apportionment, and ecological risk
assessment. Chemosphere 251, 1–12. https://doi.org/10.1016/j.
chemosphere.2020.126397.
Richards, L.A., 1954. Diagnosis and improvement of saline and alkaline soils, United
States Department of Agriculture. https://doi.org/10.2136/
sssaj1954.03615995001800030032x.
Shi, C., Hu, Y., Kobayashi, T., Zhang, N., Kuramochi, H., Zhang, Z., Xu, K.Q., 2019.
Anaerobic degradation of deca-brominated diphenyl ether contaminated in
products: effect of temperature on degradation characteristics. Bioresour. Technol.
283, 28–35. https://doi.org/10.1016/j.biortech.2019.03.059.
Shi, G., Yin, H., Ye, J., Peng, H., Li, J., Luo, C., 2013. Effect of cadmium ion on
biodegradation of decabromodiphenyl ether (BDE-209) by Pseudomonas aeruginosa.
J. Hazard. Mater. 263, 711–717. https://doi.org/10.1016/j.jhazmat.2013.10.035.
Soil Science Division Staff. USDA, 2017. Soil Survey Manual. https://doi.org/10.2307/
1233734.
Stiborova, H., Vrkoslavova, J., Lovecka, P., Pulkrabova, J., Hradkova, P., Hajslova, J.,
Demnerova, K., 2015. Aerobic biodegradation of selected polybrominated diphenyl
ethers (PBDEs) in wastewater sewage sludge. Chemosphere 118, 315–321. https://
doi.org/10.1016/j.chemosphere.2014.09.048.
Takagi, K., 2020. Study on the biodegradation of persistent organic pollutants (POPs).
J. Pestic. Sci. 45, 119–123. https://doi.org/10.1584/JPESTICS.J19-06.
Tang, S., Yin, H., Chen, S., Peng, H., Chang, J., Liu, Z., Dang, Z., 2016. Aerobic
degradation of BDE-209 by Enterococcus casseliflavus: Isolation, identification and
cell changes during degradation process. J. Hazard. Mater. 308, 335–342. https://
doi.org/10.1016/j.jhazmat.2016.01.062.
UNEP, 2019. Preliminary draft guidance on preparing inventories of decabromodiphenyl
ethers.
Wang, L., Li, Y., Zhang, W., Niu, L., Du, J., Cai, W., Wang, J., 2015. Isolation and
characterization of two novel psychrotrophic decabromodiphenyl ether-degrading
bacteria from river sediments. Environ. Sci. Pollut. Res. 23, 10371–10381. https://
doi.org/10.1007/s11356-015-5660-7.
Wang, L., Tang, L., Wang, R., Wang, X., Ye, J., Long, Y., 2016. Biosorption and
degradation of decabromodiphenyl ether by Brevibacillus brevis and the influence of
S. Paliya et al.
decabromodiphenyl ether on cellular metabolic responses. Environ. Sci. Pollut. Res.
23, 5166–5178. https://doi.org/10.1007/s11356-015-5762-2.
Williams, K., Pruden, A., Falkinham, J.O., Edwards, M., 2015. Relationship between
organic carbon and opportunistic pathogens in simulated glass water heaters.
Pathogens 4, 355–372. https://doi.org/10.3390/pathogens4020355.
Wu, Z., Xie, M., Li, Y., Gao, G., Bartlam, M., Wang, Y., 2018. Biodegradation of
decabromodiphenyl ether (BDE 209) by a newly isolated bacterium from an e-waste
recycling area. AMB Express 8, 2–12. https://doi.org/10.1186/s13568-018-0560-0.
Xu, G., Wang, J., 2014. Biodegradation of decabromodiphenyl ether (BDE-209) by white-
rot fungus Phlebia lindtneri. Chemosphere 110, 70–77. https://doi.org/10.1016/j.
chemosphere.2014.03.052.
Yao, B., Luo, Z., Zhi, D., Hou, D., Luo, L., Du, S., Zhou, Y., 2021. Current progress in
degradation and removal methods of polybrominated diphenyl ethers from water
and soil: a review. J. Hazard. Mater. 403, 123674 https://doi.org/10.1016/j.
jhazmat.2020.123674.
10
Bioresource Technology 333 (2021) 125208
Yi, Y., Zhao, T., Xie, B., Zang, Y., Liu, H., 2020. Dual detection of biochemical oxygen
demand and nitrate in water based on bidirectional Shewanella loihica electron
transfer. Bioresour. Technol. 309, 123402 https://doi.org/10.1016/j.
biortech.2020.123402.
Yu, Y., Yin, H., Peng, H., Lu, G., Dang, Z., 2020. Proteomic mechanism of
decabromodiphenyl ether (BDE-209) biodegradation by Microbacterium Y2 and its
potential in remediation of BDE-209 contaminated water-sediment system.
J. Hazard. Mater. 387, 121708 https://doi.org/10.1016/j.jhazmat.2019.121708.
Yu, Y., Yin, H., Peng, H., Lu, G., Dang, Z., 2019. Biodegradation of decabromodiphenyl
ether (BDE-209) using a novel microbial consortium GY1: Cells viability, pathway,
toxicity assessment, and microbial function prediction. Sci. Total Environ. 668,
958–965. https://doi.org/10.1016/j.scitotenv.2019.03.078.
Zhao, C., Yan, M., Zhong, H., Liu, Z., Shi, L., Chen, M., Zeng, G., Song, B., Shao, B., Feng,
H., 2018. Biodegradation of polybrominated diphenyl ethers and strategies for
acceleration: a review. Int. Biodeterior. Biodegrad. https://doi.org/10.1016/j.
ibiod.2017.12.010.