See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/222109517

Diversity of lactic acid bacteria and yeast in Airag and Tarag, traditional
fermented milk products of Mongolia

Article in World Journal of Microbiology and Biotechnology · August 2008

DOI: 10.1007/s11274-007-9604-3

CITATIONS READS

168 446

6 authors, including:

Koichi Watanabe Junji Fujimoto

National Taiwan University, College of Bioresources and Agriculture Yakult Central Institute for Microbiological Research
171 PUBLICATIONS 8,156 CITATIONS 60 PUBLICATIONS 2,676 CITATIONS

SEE PROFILE SEE PROFILE

All content following this page was uploaded by Koichi Watanabe on 30 November 2021.

The user has requested enhancement of the downloaded file.

World J Microbiol Biotechnol (2008) 24:1313–1325
DOI 10.1007/s11274-007-9604-3
ORIGINAL PAPER
Diversity of lactic acid bacteria and yeasts in Airag and Tarag,
traditional fermented milk products of Mongolia
Koichi Watanabe Æ Junji Fujimoto Æ Masae Sasamoto Æ Jamyan Dugersuren Æ
Tseveendori Tumursuh Æ Shirchin Demberel
Received: 5 September 2007 / Accepted: 6 November 2007 / Published online: 23 November 2007
Ó Springer Science+Business Media B.V. 2007
Abstract We used culture- and molecular-biology-based
methods to investigate microbial diversity in the traditional
Mongolian fermented milks ‘‘Airag’’ (fermented mare’s milk)
and ‘‘Tarag’’ (fermented milk of cows, yaks, goats, or camels).
By rRNA or functional gene sequencing, we identified 367
lactic acid bacteria (LAB) strains and 152 yeast strains iso-
lated from 22 Airag and 31 Tarag samples. The total
concentration of LAB in Airag (107.78 ± 0.50 c.f.u. ml–1;
mean ± SD) was significantly lower (P \ 0.01) than in Tarag
(108.35 ± 0.62 c.f.u. ml-1), whereas the total concentration of
yeasts in Airag (107.41 ± 0.61 c.f.u. ml-1) was significantly
higher (P \ 0.01) than in Tarag (105.86 ± 1.29 c.f.u. ml-1).
Lactobacillus helveticus and Lactobacillus kefiranofaciens
were isolated from Airag as the predominant LAB strains at
levels of about 107 c.f.u. ml-1, whereas Lactobacillus del-
brueckii subsp. bulgaricus, L. helveticus, and Streptococcus
thermophilus were the predominant isolates from Tarag at
about 107 c.f.u. ml-1. The lactose-fermenting Kluyveromyces
marxianus was isolated predominantly from Airag as its major
alcoholic fermentation component. Non-lactose-fermenting
yeasts such as Saccharomyces cerevisiae, Issatchenkia ori-
entalis, and Kazachstania unispora were the predominant
isolates from Tarag, at about 105 c.f.u. ml-1. The apparent
K. Watanabe (&)
J. Fujimoto
M. Sasamoto
Yakult Central Institute for Microbiological Research,
1796 Yaho, Kunitachi, Tokyo 186-8650, Japan
e-mail: koichi-watanabe@yakult.co.jp
J. Dugersuren
T. Tumursuh
S. Demberel
Mongolian Veterinary Institute, Zaisan, Ulaanbaatar 210153,
Mongolia
S. Demberel
Mongolian State University of Agriculture (MSUA), Zaisan-53,
Ulaanbaatar 210153, Mongolia
geographic differences in the L. kefiranofaciens and S. ther-
mophilus contents of Tarag strongly suggested that
differences among the animal species from which the milk
was sourced, rather than geographic distances, were the most
important factors influencing the diversity of the microbial
composition of traditional fermented milks in Mongolia.
Keywords Airag
Functional gene

Lactic acid bacteria
Molecular identification

rRNA gene
Tarag
Traditional fermented milk

Yeast
Introduction
For centuries, the nomads of Mongolia have been pro-
ducing various kinds of traditional fermented dairy
products. ‘‘Airag’’, also called Koumiss, is a very popular
beverage traditionally produced in Mongolia, Kazakhstan,
Kyrgyzstan, and some Central Asian regions of Russia. It is
a mildly alcoholic, sour-tasting fermented drink that is
usually made from the raw milk of mares or camels. In
Mongolia, the traditional Airag is made by the fermenta-
tion of mares’ milk by its indigenous lactic acid bacteria
(LAB); this is followed by alcoholic fermentation of the
residual sugar by yeasts. This traditional Airag contains a
small amount of carbon dioxide and as much as 2% alco-
hol, but it does not contain kefir grains (a combination of
bacteria and yeasts in a matrix of lipids, proteins, and
polysaccharides, used to start fermentation). Not only Ai-
rag, but also various kinds of traditional yogurt, which are
called ‘‘Tarag’’ and are made from cow, yak, goat, or
camel milk, have played extremely important roles in the
Mongolian diet from ancient times.
123
1314
By a culture method based on phenotypic traits, Baldorj
et al. (2003) reported that LAB such as Lactobacillus
bulgaricus (senior synonym of Lactobacillus delbrueckii
subsp. bulgaricus) and Streptococcus lactis (senior syno-
nym of Lactococcus (Lc.) lactis), and alcoholic-fermenting
yeasts such as Saccharomyces lactis (senior synonym of
Kluyveromyces lactis), Saccharomyces cartilaginosus
(senior synonym of Saccharomyces (Sac.) cerevisiae), and
Saccharomyces torulosus (senior synonym of Torulaspora
delbrueckii) predominate in Airag. Among samples col-
lected from different geographic regions, such as the forest-
steppe, Gobi Desert, and Mongolian steppe, there were no
differences in microbial composition, but significant dif-
ferences in the quantitative ratios of each microbe were
observed.
There have been a number of analyses of the LAB and
yeasts in the traditional fermented milks of Inner Mongolia
in China. Enterococcus sp., Lc. lactis, Leuconostoc (Leuc.)
sp. and Sac. cerevisiae predominated in fermented cows’
milk (Naersong and Kitamoto 1995; Watabe et al. 1998).
Enterococcus faecium, Leuconostoc mesenteroides, Lac-
tobacillus helveticus, Lactobacillus kefirgranum (senior
synonym of Lactobacillus kefiranofaciens subsp. kefirgra-
num), Lactobacillus paracasei, Lactobacillus plantarum,
Lactobacillus rhamnosus, and lactose-fermenting yeasts as
represented by Candida kefyr and Kluyveromyces marxi-
anus were the predominant isolates from fermented mares’
milk (Naersong et al. 1996; Ishii et al. 1997; Watabe et al.
1998; Burentegusi et al. 2002; Shuangquan et al. 2006),
and E. faecium, Lactobacillus acidophilus, L. helveticus, C.
kefyr, and Sac. cerevisiae were the major microbes in
fermented camels’ milk (Shuangquan et al. 2004). An et al.
(2004) reported that Lactobacillus pentosus, L. plantarum,
Lc. lactis subsp. cremoris, Leuc. mesenteroides, Leuco-
nostoc pseudomesenteroides, and Streptococcus parauberis
were the predominant isolates in fermented mares’ milk
from Inner Mongolia, in China, by using SDS-PAGE
profiling of whole-cell protein and phylogenetic analysis
on the basis of 16S rRNA gene sequences for typing and
identifying LAB strains. There have also been similar
studies on the predominant LAB or yeasts in other tradi-
tional dairy products; Dadih in Indonesia (Hosono et al.
1989), Amasi in Zimbabwe (Gadaga et al. 2000), South
African fermented milk (Beukes et al. 2001), Kule naoto in
Kenya (Mathara et al. 2004), fermented raw goat milk in
Algeria (Guessas and Kihal 2004), Laban in Lebanon
(Chammas et al. 2006), Dahi in Bangladesh (Harun-ur-
Rashid et al. 2007), and Matsoni in Georgia (Uchida et al.
2007). However, almost all the previous information
available on the microbial composition of the traditional
fermented milks prepared by the nomads of the Mongolian
region has come from studies performed in Inner Mongolia
(in China), but not in Mongolia itself. Moreover, these
123
World J Microbiol Biotechnol (2008) 24:1313–1325
research results have not always contributed accurate and
detailed information about the microbial diversity in fer-
mented milks (especially in the case of LAB and yeasts)
because they have relied only on culture methods based on
phenotypic traits.
To evaluate the usefulness of Mongolian traditional
fermented milk products as probiotics it is very important
that we investigate as many as possible of the LAB and
yeast strains associated with their fermentation. Here, we
report our use of culture- and molecular-biology-based
methods to investigate the microbial diversity of the tra-
ditional fermented milk products of Mongolia. We used the
RAPD-PCR technique to type LAB and yeast strains iso-
lated from Airag and Tarag. Strains were identified by
phylogenetic analysis based on rRNA gene sequences such
as 16S, the 18S–26S internal transcribed spacer region, or
the D1/D2 region of 26S, and by PCR using species- or
subspecies-specific primers that targeted the 16S rRNA
gene or functional genes.
Materials and methods
Sampling of traditional fermented milk
Airag and Tarag prepared by the traditional methods
developed by nomadic people in their gers (portable houses
for nomads) were sampled in the Mongolian provinces of
Arhangai, Bulgan, Dundgobi, Tov, Uburhangai, and Um-
nugobi in July 2004. Most of the Airag samples, and those
Tarag samples that were made from yak milk, were col-
lected in the forest–steppe region of Arhangai and
Uburhangai. The Tarag samples made from goat and camel
milk were collected in the Gobi Desert region of Dundgobi
and Umnugobi (Table 1).
Fermented milk samples of about 3 ml were collected in
5-ml sterile tubes (Sarstedt, cat. no. 60.9921.523S,
Nümbrecht, Germany) by using disposable transfer pipettes
(Becton Dickinson [BD] Falcon 357575, Franklin Lakes,
NJ, USA). They were then transported to the Mongolian
Veterinary Institute at 4°C in a vehicle-mounted refriger-
ator. Subsequently, all of the samples were transported by
air to the Yakult Central Institute for Microbiological
Research, Tokyo, Japan, at below freezing and stored at -
20°C until they were used in the experiments. The analyses
were carried out within 10 days after sampling.
Enumeration and isolation of LAB and yeasts
One milliliter of each sample was aseptically added to 9 ml
of sterile 0.85% NaCl solution and mixed thoroughly.
Serial 10-fold dilutions were performed, and 0.1-ml
World J Microbiol Biotechnol (2008) 24:1313–1325 1315

Table 1 Mongolian locations

Region Province City Airaga Taragb
where Airag and Tarag samples
were collected, and numbers of Mare Cow Yak Goat Camel
each sample type
Steppe Tov Bayan-Onjuul 1c
Erdenesant 1 5
Bulgan Khishig-Ondor 1
Dasinchilen 1
Forest-steppe Arhangai Khashaat 1 1 1
Tsagaannuur 5 5
Tsenkher 6 5
Uburhangai Bat-Olzii 2 2
a
Fermented mares’ milk Gobi Desert Umnugobi Dalanzadgad 4 6
b
Fermented product made Hanhongor 1 3
from cow, yak, goat, or camel Dundgobi Mandalgovi 2
milk
c
Total no. of samples 22 7 13 6 5
Number of samples collected

aliquots of the appropriate dilutions were directly inocu- DNA extraction

lated in duplicate onto the following media: (a) modified
MRS (m-MRS; glucose replaced with lactose) agar plates
containing (per 1 l) 10 g trypticase peptone (BD BBL
211921), 5 g yeast extract, 3 g tryptose (BD Bacto
211713), 3.9 g K2HPO4
3H2O, 3 g KH2PO4, 2 g diam-
monium hydrogen citrate, 5 ml salt solution (11.5%
MgSO4
7H2O, 3.09% MnSO4
5H2O; 0.68% FeSO4
7H2O),
1 g Tween 80, 1.7 g sodium acetate, 20 g lactose, 0.2 g
L-cysteine HCl
H2O, 15 g agar (pH 6.8), and supplemented
with 0.01% of both cycloheximide and sodium azide and
incubated anaerobically at 30°C for 3 days in an anaerobic
chamber (Coy Laboratory Products, Detroit, MI, USA) for
enumeration of LAB; and (b) YM agar plates (BD Difco
271210) supplemented with 0.01% chloramphenicol and
incubated aerobically at 30°C for 4 days for enumeration
of yeasts. Colonies with distinct morphologies (e.g., in
terms of color, shape, and size) were selected and purified
by streaking at least three times on m-MRS agar or YM
agar. The total concentration of individual species was
calculated from the sum of the numbers of isolates that
were typed and identified as the same species and from the
dilution rates of the colonies on the agar plates.
The genomic DNAs of the isolates were extracted by the
method described by Zhu et al. (1993), with some modi-
fications. Briefly, 1 ml of stationary-phase bacterial culture
was harvested by centrifugation at 20,000g for 3 min. The
cell pellet was suspended in 250 ll of extraction buffer
(100 mM Tris–HCl, 40 mM EDTA, pH 9.0) and 500 ll of
benzyl chloride; 0.7 g of glass beads (0.1 mm in diameter)
were added to the suspension, and the mixture was shaken
vigorously for 30 s with a FastPrep FP120 (Qbiogene,
Carlsbad, CA, USA) at a speed setting of 6.5 m s–1. Sub-
sequently, 50 ll of 10% SDS was added to the suspension,
which was then vortexed vigorously at 50°C for 20 min in
a MicroIncubator M-36 (Taitech, Tokyo, Japan). The
mixture was cooled on ice for 15 min after the addition of
150 ll of 3 M sodium acetate. After centrifugation of the
mixture at 20,000g for 15 min, the supernatant was col-
lected and DNA was obtained by isopropanol precipitation.
Finally, the DNA was diluted to 10 lg ml-1 in TE buffer
(10 mM Tris–HCl, 1 mM EDTA, pH 8.0).
RAPD-PCR typing

RAPD-PCR amplification was performed in a model PTC-

Strains and culture conditions
All the LAB and yeast strains used were stored at -80°C in
Nutrient Broth (BD Difco) containing 10% DMSO and
registered in the culture collection in Yakult Central
Institute (YIT; Tokyo, Japan). The type strains of LAB
used for PCR identification using functional genes or 16S
rRNA gene-based primers were obtained from the culture
collection of YIT. All the stock LAB and yeast strains were
cultured in MRS broth at 37°C for 1 day and in YM broth
at 30°C for 1 or 2 days, respectively, for DNA extraction.
200 thermal cycler (MJ Research Inc., Watertown, MA,
USA). Each reaction mixture (20 ll) contained 10 mM Tris–
HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 200 lM of each
dNTP, 1.5 U Taq DNA polymerase (Takara, Shiga, Japan),
1.5 lM RAPD primer, and 10 ng template DNA. The RAPD
primers used were p1252, p1254, and p1281 (Akopyanz et
al. 1992) (see Table 2). The amplification program consisted
of 1 cycle of 94°C for 2 min; 6 cycles of 94°C for 30 s, 36°C
for 60 s, and 72°C for 90 s; 30 cycles of 94°C for 20 s, 36°C
for 20 s, and 72°C for 90 s; and finally 1 cycle of 72°C for
3 min. RAPD products were electrophoresed at 50 V on a

123
1316 World J Microbiol Biotechnol (2008) 24:1313–1325

Table 2 Oligonucleotide primers used in the PCR amplification

Primer Oligonucleotide Target Position Reference
sequence
(50 ? 30 )

p1252 GCGGAAATAG Genomic DNA Akopyanz et al. (1992)

p1254 CCGCAGCCAA Genomic DNA Akopyanz et al. (1992)
p1281 AACGCGCAAC Genomic DNA Akopyanz et al. (1992)
8F AGAGTTTGATC(A/C)TGGCTCAG Bacterial 16S rDNA 8–27 Miyake et al. (1998)
520F CAGGAGTGCCAGCAGCCGCGG Bacterial 16S rDNA 515–530 Miyake et al. (1998)
930F GCACAAGCGGTGGAGCATGTGG Bacterial 16S rDNA 933–954 Miyake et al. (1998)
1100F CAGGAGCAACGAGCGCAACCC Bacterial 16S rDNA 1099–1114 Miyake et al. (1998)
520R ACCGCGGCTGCTGGC Bacterial 16S rDNA 531–517 Miyake et al. (1998)
800R CAGGACTACCAGGGTATCTAAT Bacterial 16S rDNA 804–787 Miyake et al. (1998)
1100R AGGGTTGCGCTCGTTC Bacterial 16S rDNA 1115–1100 Miyake et al. (1998)
15R AAGGAGGTGATCCA(A/G)CCGCA Bacterial 16S rDNA 1541–1522 Miyake et al. (1998)
pepR LbC CGCAATTATCTCTTCAATGGTC pepR gene of Lactobacillus casei 385–407 This study
pepR LbR GCGAAGGTGACATTCACC pepR gene of Lactobacillus rhamnosus 65–82 This study
pepR LbZ CTCACCACGGATTATTTCTTG pepR gene of Lactobacillus zeae 260–280 This study
pepR g-LbC GCATGGTTTC(A/G)TGTTCGCC pepR gene of the Lactobacillus casei group 750–732 This study
paraF GTCACAGGCATTACGAAAAC recA gene of Lactobacillus 220–239 Torriani et al. (2001)
paraplantarum
pentF CAGTGGCGCGGTTGATATC recA gene of Lactobacillus pentosus 109–127 Torriani et al. (2001)
planF CCGTTTATGCGGAACACCTA recA gene of Lactobacillus plantarum 9–28 Torriani et al. (2001)
pREV TCGGGATTACCAAACATCAC recA gene of L. plantarum group 327–308 Torriani et al. (2001)
LbD-1 GGTGATTTGTTGGACGCT 16S rRNA gene of Lactobacillus delbrueckii 94–100 This study
LbD-2 AAAGACCAGTTACTGCCTCTATC 16S rRNA gene of Lactobacillus delbrueckii 476–454 This study
LB1 AAAAATGAAGTTGTTTAAAGTAGGTA pepIP gene of Lactobacillus delbrueckii 640–665 Torriani et al. (1999)
LLB1 AAGTCTGTCCTCTGGCTGG pepIP gene of Lactobacillus delbrueckii 1686–1704 Torriani et al. (1999)
Y1750F GTCGTAACAAGGTTTCCGTAG Yeast 18S–26S rDNA ITS region This study
ITS2 GCTGCGTTCTTCATCGATGC Yeast 18S–26S rDNA ITS region Chen et al. (2001)
ITS3 GCATCGATGAAGAACGCAGC Yeast 18S–26S rDNA ITS region Lott et al. (1993)
ITS4 TCCTCCGCTTATTGATATTGC Yeast 18S–26S rDNA ITS region Lott et al. (1993)
NL-1 GCATATCAATAAGCGGAGGAAAAG Yeast 18S–26S rDNA ITS region Sugita et al. (2003)
NL-2A CTTGTTCGCTATCGGTCTC Yeast 18S–26S rDNA ITS region Kurtzman and Robnett
(1997)
NL-3A GAGACCGATAGCGAACAAG Yeast 18S–26S rDNA ITS region Kurtzman and Robnett
(1997)
NL-4 GGTCCGTGTTTCAAGACGG Yeast 18S–26S rDNA ITS region Sugita et al. (2003)

1.5% (w/v) agarose gel. DNA bands were stained with
ethidium bromide 0.5 lg ml-1 and photographed. All iso-
lates were discriminated visually on the basis of their RAPD
profiles, and isolates with identical profiles were regarded as
belonging to the one strain.
PCR amplification of 16S rRNA gene, 18S–26S rRNA
ITS1 and ITS2, and the D1/D2 variable region of 26S
rRNA gene
16S rRNA gene was amplified by PCR with primers 8F and
15R (Miyake et al. 1998); position numbers were based on
the Escherichia coli numbering system (Brosius et al. 1981).
The internal transcribed spacers (ITS1 and ITS2) of 18S–26S
rRNA were amplified by using primers Y1750F and ITS4
(Lott et al. 1993). The D1/D2 variable region of 26S rRNA
gene was amplified by PCR with primers NL-1 (Sugita et al.
2003) and NL-4 (Sugita et al. 2003) (see Table 2). PCR
amplification was performed with a model PTC-200 thermal
cycler (MJ Research) with PCR buffer containing 1.5 mM
MgCl2, 200 mM of each dNTP, 1 lM of each primer, 1 U
Taq DNA polymerase (Takara), and 10 ng of template DNA
in a total volume of 30 ll. The amplification program con-
sisted of 1 cycle of 94°C for 2 min; 30 cycles of 94°C for
20 s, 55°C for 20 s, and 72°C for 90 s; and finally 1 cycle of
72°C for 3 min.

123
World J Microbiol Biotechnol (2008) 24:1313–1325
rRNA gene sequencing and phylogenetic analysis
For the presumptive identification of LAB strains phyloge-
netically, partial sequencing of approximately 500 bp of 16S
rRNA gene of all strains, including the V1, V2, and V3
variable regions, was performed directly with an ABI
PRISM BigDye Terminator Cycle Sequencing Kit (Applied
Biosystems, Foster, CA, USA) in accordance with the
manufacturer’s instructions, and the products were analyzed
on a model ABI PRISM 3100 automated DNA sequencer
(Applied Biosystems) with primers 8F and 520R. To confirm
the identification of the representative LAB strains in each
presumed species group, full sequencing of 16S rRNA gene
was performed with primers 8F, 520F, 930F, 1100F, 520R,
800R, 1100R, and 15R (Miyake et al. 1998) (see Table 2).
For the presumptive identification of all yeast strains
phylogenetically, sequencing of approximately 500 bp of
the D1/D2 variable region in the 26S rRNA gene of all strains
was performed directly with an ABI PRISM BigDye Ter-
minator Cycle Sequencing Kit (Applied Biosystems), and
the products were analyzed on a model ABI PRISM 3100
automated DNA sequencer (Applied Biosystems) with
primers NL-1, NL-2A (Kurtzman and Robnett 1997), NL-3A
(Kurtzman and Robnett 1997), and NL-4. To confirm the
identification of the representative yeast strains in each
presumed species group, sequencing of 18S–26S ITS1 and
ITS2 was performed with primers Y1750F, ITS2 (Chen et al.
2001), ITS3 (Lott et al. 1993), and ITS4 (see Table 2).
Sequence assembly was performed by using AutoAs-
sembler software version 2.1 (Applied Biosystems) and
GENETYX-Mac version 13.0.1 (Software Development
Co., Tokyo). The FASTA program of Pearson (1999) was
applied to find the most similar sequences from the DDBJ/
GenBank/EMBL DNA database. A continuous stretch of
1500 bases ranging from positions 20 to 1520 of the
Escherichia coli 16S rRNA numbering was used for
sequence analysis. The alignments were analyzed to con-
struct a phylogenetic tree and to compare similarities
among the sequences by the neighbor-joining method of
Saitou and Nei (1987) by using Clustal X software version
1.82 (Thompson et al. 1997). The stability of the rela-
tionships was assessed by bootstrap resampling analysis.
Bootstrapping was performed for 1000 trials in accordance
with the Clustal X program.
Specific PCR assay for identification of strains
By applying the partial sequences of 16S rRNA gene (positions
20–520 according to the E. coli numbering system), we used
phylogenetic analysis to differentiate strains that belonged to
the L. casei group (L. casei, L. rhamnosus, and Lactobacillus
zeae), the L. plantarum group (Lactobacillus paraplantarum,
1317
L. pentosus, and L. plantarum), and L. delbrueckii. We next
identified the strains by using functional gene-targeted species-
or subspecies-specific primers. For identification of L. casei,
L. rhamnosus, and L. zeae in the L. casei group, the pepR gene-
based multiplex primers of pepR LbC (L. casei-specific for-
ward primer), pepR LbR (L. rhamnosus-specific forward
primer), pepR LbZ (L. zeae-specific forward primer), and pepR
g-LbC (L. casei-group-specific reverse primer) were used.
These primers were developed on the basis of the species-
specific regions of the pepR gene obtained from the bacterial
pepR gene sequences of six strains in the L. casei group:
AB363815 (L. casei YIT 0180T), AB363816 (L. casei YIT
0437), AB363817 (L. rhamnosus YIT 0105T), AB363818
(L. rhamnosus YIT 0127 = DSM 20178), AB363819 (L. zeae
YIT 0278T), and AB363820 (L. zeae YIT 0078 = ATCC 393).
For identification of L. paraplantarum, L. pentosus, and
L. plantarum in the L. plantarum group, the recA gene-based
multiplex primers of paraF, pentF, planF and pREV were used
(Torriani et al. 2001). For identification of L. delbrueckii
subsp. bulgaricus and L. delbrueckii subsp. lactis in L. del-
brueckii, the 16S rRNA gene-targeted L. delbrueckii species-
specific primers (LbD-1 and LbD-2) and the pepIP gene-based
primers LB1 and LLB1 (Torriani et al. 1999) were used (see
Table 2).
A specific PCR assay was performed with a model PTC-
200 thermal cycler (MJ Research) using PCR buffer con-
taining 1.5 mM MgCl2, 200 mM of each dNTP, 1 lM of
each primer, 0.4 U Taq DNA polymerase (Takara), and
10 ng of template DNA in a total volume of 20 ll. The
amplification program consisted of 1 cycle of 94°C for
2 min; 32 cycles of 94°C for 20 s, 55°C for 20 s, and 72°C
for 90 s; and finally 1 cycle of 72°C for 3 min. PCR
products were electrophoresed at 100 V on a 1.5% (wt/vol)
agarose gel. DNA bands were stained with ethidium bro-
mide 0.5 lg ml-1 and photographed.
Statistical analyses
The concentrations and isolation frequencies of LAB and
yeasts were analyzed statistically to compare the microbial
compositions of Airag and Tarag. Mean differences in the
concentrations of LAB or yeasts were analyzed by the
unpaired t-test. The isolation frequencies of each species
were compared by the 2 9 2 chi-squared test.
Results and discussion
Isolation and identification of LAB
A total of 620 bacterial isolates isolated from 22 Airag
samples and 31 Tarag samples were discriminated into 367
LAB strains by RAPD-PCR (Table 3).
123
1318 World J Microbiol Biotechnol (2008) 24:1313–1325

Table 3 List of samples used in this study

Fermented Sampling No. of No. of Total
milk location strains species (cfu/ml)
isolated isolated
No. Type Species Province City LAB Yeasts Total LAB Yeasts LAB Yeasts
origin

A-1 Airag Mare Arhangai Khashaat 9 2 5 3 2 8.00c 7.78c

A-2 Airag Mare Arhangai Tsagaannuur 7 4 5 1 4 7.28 7.66
A-3 Airag Mare Arhangai Tsagaannuur 5 2 5 3 2 7.58 7.85
A-4 Airag Mare Arhangai Tsagaannuur 8 2 6 4 2 7.52 7.71
A-5 Airag Mare Arhangai Tsagaannuur 7 3 5 2 3 8.64 7.86
A-6 Airag Mare Arhangai Tsagaannuur 9 2 3 2 1 8.65 7.92
A-7 Airag Mare Arhangai Tsenkher 6 2 6 4 2 7.71 7.70
A-8 Airag Mare Arhangai Tsenkher 6 2 5 3 2 7.38 7.53
A-9 Airag Mare Arhangai Tsenkher 9 2 5 4 1 7.76 7.29
A-10 Airag Mare Arhangai Tsenkher 10 3 7 5 2 8.03 7.66
A-11 Airag Mare Arhangai Tsenkher 8 5 7 3 4 6.74 6.96
A-12 Airag Mare Arhangai Tsenkher 3 3 6 3 3 7.26 7.45
A-13 Airag Mare Bulgan Khishig-Ondor 11 2 6 4 2 7.57 7.41
A-14 Airag Mare Tuv Bayan-Onjuul 7 5 8 3 5 7.76 7.76
A-15 Airag Mare Tuv Erdenesant 9 2 2 1 1 7.80 7.73
A-16 Airag Mare Uburhangai Bat-Olzii 10 2 4 3 1 7.41 7.34
A-17 Airag Mare Uburhangai Bat-Olzii 8 3 8 5 3 7.69 7.57
A-18 Airag Mare Umnugobi Dalanzadgad 9 5 11 6 5 8.90 8.24
A-19 Airag Mare Umnugobi Dalanzadgad 11 5 10 6 4 8.29 6.59
A-20 Airag Mare Umnugobi Dalanzadgad 7 4 7 3 4 8.05 7.05
A-21 Airag Mare Umnugobi Dalanzadgad 10 5 9 4 5 7.71 5.44
A-22 Airag Mare Umnugobi Hanhongor 14 3 8 5 3 7.53 6.48
Subtotal in Airag 183 68 6.3 ± 2.2**a 3.5 ± 1.4**a 2.8 ± 1.3b 7.78 ± 0.50d 7.41 ± 0.61d
T-1 Tarag Camel Dundgobi Mandalgovi 11 1 5 4 1 5.97 3.11
T-2 Tarag Camel Dundgobi Mandalgovi 7 2 4 2 2 8.08 5.67
T-3 Tarag Camel Umnugobi Hanhongor 10 3 4 2 2 8.15 6.24
T-4 Tarag Camel Umnugobi Hanhongor 11 3 3 1 2 8.17 4.69
T-5 Tarag Camel Umnugobi Hanhongor 10 1 2 1 1 8.23 6.20
T-6 Tarag Cow Arhangai Khashaat 5 3 5 3 2 8.44 5.03
T-7 Tarag Cow Bulgan Dasinchilen 5 1 3 2 1 8.04 6.76
T-8 Tarag Cow Tuv Erdenesant 4 2 5 3 2 8.00 7.54
T-9 Tarag Cow Tuv Erdenesant 3 2 5 3 2 9.15 7.20
T-10 Tarag Cow Tuv Erdenesant 4 3 5 3 2 8.53 6.97
T-11 Tarag Cow Tuv Erdenesant 4 3 5 2 3 9.00 6.18
T-12 Tarag Cow Tuv Erdenesant 6 2 5 3 2 9.41 7.50
T-13 Tarag Goat Umnugobi Dalanzadgad 9 4 6 3 3 8.05 6.07
T-14 Tarag Goat Umnugobi Dalanzadgad 4 2 6 4 2 7.94 5.85
T-15 Tarag Goat Umnugobi Dalanzadgad 5 2 4 2 2 8.53 5.98
T-16 Tarag Goat Umnugobi Dalanzadgad 2 4 4 1 3 8.51 5.62
T-17 Tarag Goat Umnugobi Dalanzadgad 7 1 4 3 1 7.67 6.11
T-18 Tarag Goat Umnugobi Dalanzadgad 6 5 3 1 2 8.32 5.28
T-19 Tarag Yak Arhangai Khashaat 2 2 4 2 2 8.76 6.94
T-20 Tarag Yak Arhangai Tsagaannuur 8 6 8 3 5 8.25 7.42
T-21 Tarag Yak Arhangai Tsagaannuur 9 5 7 4 3 8.68 5.00
T-22 Tarag Yak Arhangai Tsagaannuur 7 6 7 3 4 8.46 3.87

123
World J Microbiol Biotechnol (2008) 24:1313–1325 1319

Table 3 continued
Fermented Sampling No. of No. of Total
milk location strains species (cfu/ml)
isolated isolated
No. Type Species Province City LAB Yeasts Total LAB Yeasts LAB Yeasts
origin

T-23 Tarag Yak Arhangai Tsagaannuur 2 3 4 2 2 8.70 3.98

T-24 Tarag Yak Arhangai Tsagaannuur 2 2 5 2 3 7.69 6.50
T-25 Tarag Yak Arhangai Tsenkher 6 1 3 2 1 8.68 7.04
T-26 Tarag Yak Arhangai Tsenkher 6 2 6 4 2 8.18 4.61
T-27 Tarag Yak Arhangai Tsenkher 8 3 5 2 3 8.18 3.46
T-28 Tarag Yak Arhangai Tsenkher 7 3 7 4 3 9.13 3.78
T-29 Tarag Yak Arhangai Tsenkher 4 4 5 2 3 9.06 7.42
T-30 Tarag Yak Uburhangai Bat-Olzii 5 2 6 4 2 8.81 6.72
T-31 Tarag Yak Uburhangai Bat-Olzii 5 1 4 3 1 8.09 6.96
Subtotal in Tarag 184 84 4.8 ± 1.4a 2.6 ± 1.0a 2.2 ± 0.9a 8.35 ± 0.62d 5.86 ± 1.29d
Total 367 152 5.4 ± 1.9b 3.0 ± 1.2b 2.5 ± 1.1b 8.12 ± 0.63d 6.50 ± 1.30d
a
Numbers of species of lactic acid bacteria (LAB) or yeasts were compared between the two groups, Airag and Tarag, by the unpaired t-test
Significant difference: **P \ 0.01
b
Numbers of species of lactic acid bacteria (LAB) or yeasts isolated are expressed as means ± SD per ml of sample
c
Concentrations of LAB or yeasts are expressed as log10 per ml of sample
d
Concentrations of LAB or yeasts isolated are expressed as means ± SD of log10 per ml of sample

By phylogenetic analysis based on the 16S rRNA gene
sequences, the 183 LAB strains isolated from Airag were
identified as belonging to five genera (Enterococcus, Lac-
tobacillus, Lactococcus, Leuconostoc, and Streptococcus),
two species groups, 12 validated species, and one unknown
species: E. faecium, L. casei group, Lactobacillus diolivo-
rans, Lactobacillus farciminis, L. helveticus, Lactobacillus
hilgardii, L. kefiranofaciens, Lactobacillus kefiri, Lactoba-
cillus parafarranginis, L. plantarum group, Lc. lactis subsp.
lactis, Leuc. mesenteroides, Leuc. pseudomesenteroides,
S. thermophilus, and Lactococcus sp. All of the 13 strains in
the L. casei group were identified as L. casei with the
L. casei-specific amplification product (365 bp) by using
pepR gene-based multiplex primers (Fig. 1a). All eight
L. plantarum group strains were identified as L. plantarum
with the L. plantarum-specific amplification product
(318 bp) by using recA gene-based multiplex primers.
On the basis of the 16S rRNA gene sequences, the 184
LAB strains isolated from Tarag were identified as belonging
to four genera (Enterococcus, Lactobacillus, Pediococcus,
and Streptococcus), two species groups, and eight validated
species: E. faecium, L. casei group, L. delbrueckii,
Lactobacillus fermentum, L. helveticus, L. kefiranofaciens,
L. kefiri, L. plantarum group, Pediococcus pentosaceus, and
S. thermophilus. All of the three strains in the L. casei group
were identified by using pepR gene-based multiplex primers
as L. casei (Fig. 1a). The three strains in the L. plantarum
group were identified by using recA gene-based multiplex
primers as L. plantarum (two strains) and L. paraplantarum,
with amplification products of 318 and 107 bp, respectively.
All 50 strains in L. delbrueckii, which were observed with
primer LbD to have L. delbrueckii species-specific PCR
products (319 bp), were identified by using pepIP gene-
based primers of LB1 and LLB1 as L. delbrueckii subsp.
bulgaricus (Table 4, Fig. 1b).
Lactococcus sp. strains YIT 10647 (B375) and YIT
10740 (B524) isolated from Airag had only a 2 bp diver-
gence in their 16S rRNA gene sequences. By FASTA
analysis, the 16S rRNA gene sequence similarity between
Lactococcus sp. YIT 10647 and Lactococcus raffinolactis
X54261 was 95.9% (Fig. 2). This result suggested that
these two Lactococcus sp. strains could be novel species
because their similarity value was less than 97% against
validated known species (97% is the value regarded to
represent identification at the species level; Stackebrandt
and Goebel 1994).
The mean number of LAB species isolated in each Airag
sample (3.5 ± 1.4) was significantly higher (P \ 0.01) than
that in Tarag (2.6 ± 1.0) (Table 3). This result indicated that
Airag had a more diverse microbial composition than Tarag.
Isolation and identification of yeasts
A total of 320 yeast isolates isolated from the 22 Airag and
31 Tarag samples were discriminated to 152 yeast strains
by RAPD-PCR (Table 3).

123
1320
(A)
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19
bp
685
490
365
(B)
primer 16S-LbD
M 1 2 3 4 5 6 7 8 9 10 11 12 1 2 3 4 5 6 7 8 9 10 11 12
bp
1065
319
Fig. 1 Amplification patterns obtained with pepR gene-based mul-
tiplex primers for the L. casei group (a); the 16S rRNA gene-targeted
L. delbrueckii species-specific primers (16S-LbD); and the pepIP
gene-based multiplex primers (pepIP-LB1) (b). In (a), Lane M, 100-
bp ladder DNA size marker (Seegene, Rockville, MD, USA); lanes 1–
19, L. casei YIT 0180T, L. rhamnosus YIT 0105T, L. zeae YIT 0278T,
YIT 10462, YIT 10463, YIT 10468, YIT 10493, YIT 10494, YIT
10495, YIT 10602, YIT 10626, YIT 10636, YIT 10637, YIT 10700,
YIT 10727, YIT 10741, YIT 10449, YIT 10533, and YIT 10534,
By phylogenetic analysis based on the sequences of 18S–
26S ITS1 and ITS2, the 68 yeast strains isolated from Airag
were identified as belonging to eight species: Candida
pararugosa, Dekkera anomala, Issatchenkia orientalis,
Kazachstania (Ka.) unispora, Kluyveromyces (Kl.) marxi-
anus, Pichia mandshurica, Sac. cerevisiae, and
T. delbrueckii. The 84 yeast strains isolated from Tarag were
identified as belonging to 10 species: Candida zeylanoides,
Debaryomyces hansenii, I. orientalis, Ka. unispora, Kl.
marxianus, Pichia fermentans, P. mandshurica, Sac. cere-
visiae, T. delbrueckii, and Yarrowia lipolytica (Table 4). No
significant difference was observed in the mean number of
yeast species between Airag and Tarag (Table 3).
LAB composition of fermented milk products
The total concentration of LAB in the 22 Airag samples
ranged from 106.74 to 108.90 c.f.u. ml-1 (107.78 ± 0.50
123
World J Microbiol Biotechnol (2008) 24:1313–1325
Airag Tarag
primer pepIP-LB1
respectively. All 16 strains from Airag and Tarag were identified as
L. casei. In (b), Lane M, 100-bp ladder DNA size marker (Seegene);
lanes 1 through 12, L. delbrueckii subsp. bulgaricus YIT 0181T,
L. delbrueckii subsp. delbrueckii YIT 0080T, L. delbrueckii subsp.
lactis YIT 0086T, YIT 10415, YIT 10416, YIT 10417, YIT 10430,
YIT 10431, YIT 10546, YIT 10547, YIT 10576, and YIT 10577,
respectively. All of the strains isolated from Tarag were identified as
L. delbrueckii subsp. bulgaricus
c.f.u. ml-1; mean ± SD), whereas the total concentration of
LAB in the 31 Tarag samples ranged from 105.97 to
109.41 c.f.u. ml-1 (108.35 ± 0.62 c.f.u. ml-1) (Table 3).
In Airag, L. helveticus (107.45 ± 0.50 c.f.u. ml-1 in 21
samples) and L. kefiranofaciens (106.73 ± 0.72 c.f.u. ml-1 in
14 samples) were the predominant isolates. Among the 31
Tarag samples, L. delbrueckii subsp. bulgaricus
(107.71 ± 0.76 c.f.u. ml-1 in 18 samples), L. fermentum
(106.96 ± 1.20 c.f.u. ml-1 in 14 samples), and S. thermophilus
(107.99 ± 0.84 c.f.u. ml-1 in 13 samples) were isolated from
Tarag (other than that made from camel’s milk; Table 5).
Lactobacillus helveticus predominated in 20 of the Tarag
samples at 107.47 ± 1.19 c.f.u. ml-1.
Lactobacillus helveticus was therefore the predominant
LAB component of both Airag and Tarag. No significant
differences between Airag and Tarag in terms of isolation
frequency or concentration of L. helveticus were observed.
The isolation frequencies of L. casei, L. kefiranofaciens,
Lc. lactis subsp. lactis, and Leuc. mesenteroides in Airag
World J Microbiol Biotechnol (2008) 24:1313–1325 1321

Table 4 Comparison of strains isolated from Airag and Tarag

Organism Airag (n = 22) Tarag (n = 31)
a
No. of No. of cfu/ml No. of No. of strains cfu/mla
samples strains in samples in which
in which which in which isolated
detected isolated detected

Total Microorganisms 22 8.03 ± 0.42 31 8.36 ± 0.62 **c

Total LAB 22 183 7.78 ± 0.50 31 184 8.35 ± 0.62 **c
Enterococcus faecium 1 1 6.30 1 1 5.96
Lactobacillus casei 9**b 13 6.11 ± 0.70 2 3 5.45
Lactobacillus delbrueckii subsp. bulgaricus 18**b 50 7.71 ± 0.76
Lactobacillus diolivorans 1 1 7.43
Lactobacillus farciminis 1 1 6.30
Lactobacillus fermentum 14**b 19 6.96 ± 1.20
Lactobacillus helveticus 21 93 7.45 ± 0.50 20 32 7.47 ± 1.19
Lactobacillus hilgardii 1 1 5.60
Lactobacillus kefiranofaciens 14**b 35 6.73 ± 0.72 8 57 7.62 ± 0.97*c
Lactobacillus kefiri 4 4 6.21 ± 0.20 2 2 6.10
Lactobacillus parafarranginis 1 1 6.00
Lactobacillus paraplantarum 1 1 4.78
Lactobacillus plantarum 5 8 5.60 ± 1.25 1 2 4.76
Lactococcus lactis subsp. lactis 6*b 7 6.19 ± 0.87
Lactococcus sp. 2 2 6.86
Leuconostoc mesenteroides 8**b 13 6.58 ± 0.82
Leuconostoc pseudomesenteroides 2 2 6.79
Pediococcus pentosaceus 1 1 5.56
Streptococcus thermophilus 1 1 7.00 13**b 16 7.99 ± 0.84
Total Yeasts 22 68 7.41 ± 0.61 **c 31 84 5.86 ± 1.29
Candida pararugosa 1 1 5.48
Candida zeylanoides 2 2 3.08
Debaryomyces hansenii 3 4 2.75 ± 0.09
Dekkera anomala 3 3 5.06 ± 0.32
Issatchenkia orientalis 5 5 3.16 ± 0.45 13 14 4.19 ± 1.15
Kazachstania unispora 13 14 4.98 ± 1.55 10 10 5.30 ± 1.22
Kluyveromyces marxianus 22**b 28 7.28 ± 0.67**c 7 7 5.00 ± 1.44
Pichia fermentans 6 10 4.96 ± 1.49
Pichia mandshurica 5 5 4.43 ± 0.97 1 2 6.07
Saccharomyces cerevisiae 10 10 5.07 ± 1.09 23 31 5.75 ± 1.39
Torulaspora delbrueckii 2 2 5.57 3 3 4.95 ± 1.63
Yarrowia lipolytica 1 1 3.78
a
Concentrations of LAB or yeasts are expressed as means ± SD of log10 per ml of sample
b
Isolation frequencies of each species were compared between the two groups, Airag and Tarag, by the 2 9 2 chi-squared test
c
Concentrations of LAB or yeasts were compared between the two groups, Airag and Tarag, by the unpaired t-test
Statistical significance: *P \ 0.05; **P \ 0.01

were significantly higher than in Tarag (P \ 0.01,
P \ 0.01, P \ 0.05, and P \ 0.01, respectively). The iso-
lation frequencies of the predominant species in Tarag–L.
delbrueckii subsp. bulgaricus, L. fermentum, and S. ther-
mophilus—were significantly higher than in Airag
(P \ 0.01) (Table 4). Lactobacillus delbrueckii subsp.
bulgaricus was isolated from Tarag made from cow,
yak, or goat milk; L. helveticus from Tarag made from
cow, yak, goat, or camel milk; L. kefiranofaciens from
Tarag made from goat or camel milk; and S. thermo-
philus from Tarag made from cow, yak, or goat milk
(Table 5).

123
1322
E. coli JO1695
1000
S. salivarius M58839
S. thermophilus X68418
Lc. garvieae AB012306
889
1000 Lc. lactis subsp. cremoris AB100791
Lc. lactis subsp. lactis AB100805
996
Lc. piscium X53905
886
Lc. plantarum X54259
1000
Lc. raffinolactis X54261
1000
Lactococcus sp. YIT 10740
993
Lactococcus sp. YIT 10647
10 %
Fig. 2 Phylogenetic tree derived from 16S rRNA gene sequence
analysis showing the position of Lactococcus sp. strains YIT 10647
and YIT 10740 among related taxa. The tree was constructed by the
neighbor-joining method, and Escherichia coli was used as the
outgroup. Bootstrap values based on 1000 replications are given at the
nodes, and the scale bar represents 10% sequence divergence
Yeast composition of fermented milk products
The total concentration of yeasts in the 22 Airag samples
ranged from 105.44 to 108.24 c.f.u. ml-1 (107.41 ± 0.61 c.f.u.
ml-1; mean ± SD), whereas the total concentration of yeasts
in the 31 Tarag ranged from 103.11 to 107.54 c.f.u. ml-1
(105.86 ± 1.29 c.f.u. ml-1; mean ± SD) (Table 3). Kazachs-
tania unispora was the predominant isolate in 13 Airag
samples at 104.98 ± 1.55 c.f.u. ml-1, and Sac. cerevisiae pre-
dominated in 23 Tarag samples at 105.75 ± 1.39 c.f.u. ml-1
(Table 4).
Kluyveromyces marxianus was the predominant yeast
component in Airag, and the isolation frequency and con-
centration of Kl. marxianus in Airag were significantly
higher than those in Tarag (P \ 0.01). In Airag, the con-
centration of Kl. marxianus was about 107 c.f.u. ml-1—
significantly higher (P \ 0.01) than those of the other yeast
species isolated, which were in the range of 103 to
105 c.f.u. ml-1. In Tarag, Sac. cerevisiae, Ka. unispora, and
I. orientalis were isolated at high frequencies at concentra-
tions of 104 to 105 c.f.u. ml-1(Table 4). Saccharomyces
cerevisiae and I. orientalis were isolated from Tarag made
from cow, yak, goat, or camel milk; Ka. unispora from Tarag
made from yak, goat, or camel milk; and Kl. marxianus from
Tarag made from yak or goat milk. The concentration of
yeasts in Tarag made from camel’s milk was significantly
lower than in Tarag made from cow’s milk (P \ 0.05)
(Table 5).
Latorre-Garcia et al. (2007) reported that I. orientalis,
Sac. unisporus (senior synonym of Ka. unispora), Sac.
exiguus (senior synonym of Kazachstania exigua), and Sac.
123
World J Microbiol Biotechnol (2008) 24:1313–1325
humaticus (senior synonym of Kazachstania humatica)
were the predominant species in homemade kefir samples
in which grain production was observed, whereas Kl. lactis
was isolated at 104/g only from the commercially available
kefir samples in which grains were not produced. In addi-
tion, Cheirshilps et al. (2003) reported that production of
the kefiran was enhanced by using a mixed culture of
L. kefiranofaciens and Sac. cerevisiae.
Grains were not observed in Airag samples, in which
L. kefiranofaciens and Kl. marxianus were the predominant
species, nor in Tarag samples, in which the total concen-
tration of yeasts was low. The lack of grain production in
Airag or Tarag suggests that the production of kefiran is
strongly dependent on the LAB and yeast composition of
Airag and Tarag.
Factors influencing the diversity of microbial
compositions of fermented milk products
The total concentration of yeasts in Airag (107.41 c.f.u. ml-1)
was significantly higher (P \ 0.01) than that in Tarag
(105.86 c.f.u. ml-1), whereas the total concentration of LAB
in Airag (107.78 c.f.u. ml-1) was significantly lower
(P \ 0.01) than that in Tarag (108.35 c.f.u. ml-1). Conse-
quently, the total concentration of microorganisms (sum of
the total concentration of LAB and yeasts) in Airag was
significantly lower (P \ 0.01) than in Tarag (Table 4).
Lactobacillus helveticus, L. kefiranofaciens, and Kl. marxi-
anus were the predominant isolates from Airag, at means of
about 107 c.f.u. ml-1, whereas L. delbrueckii subsp. bul-
garicus, L. fermentum, L. helveticus, and S. thermophilus
were predominantly isolated from Tarag at means of about
107 c.f.u. ml-1. Kazachstania unispora and Sac. cerevisiae
were isolated with high frequency from Tarag at about
105 c.f.u. ml-1.
As might be expected, in many cases, we found that
common strains were isolated from both Airag and Tarag
made in the same gers (portable houses of nomads) at the
same time (Fig. 3). This result may have been caused by
cross-contamination through use of the same equipment for
stirring or ladling the fermented products; microenviron-
mental conditions are also likely to have had a marked
influence.
The lactose-fermenting Kl. marxianus was isolated at
high average concentrations (107 cfu ml-1) as the pre-
dominant species from all Airag samples, whereas it was
isolated from only 23% of Tarag samples, at means of
about 105 c.f.u. ml-1. Montanari et al. (1996) reported that
Saccharomyces unisporus (senior synonym of Ka. unis-
pora) is the predominant species in traditional koumiss in
Kazakhstan. Baldorj et al. (2003) reported that Saccharo-
myces lactis (senior synonym of Kl. lactis), Saccharomyces
World J Microbiol Biotechnol (2008) 24:1313–1325 1323

Table 5 Comparison of microbial compositions of Tarag made from the milk of different animal species
Cow Yak Goat Camel
b b b
No. of cfu/ml No. of cfu/ml No. of cfu/ml No. of cfu/mlb
samplesa samplesa samplesa samples a

Total counts of lactic acid bacteria 7 8.65 ± 0.55 13 8.51 ± 0.42 6 8.17 ± 0.34 5 7.71 ± 0.97
Enterococcus faecium 1 5.96
Lactobacillus casei 1 6.78 1 4.11
Lactobacillus delbrueckii subsp. bulgaricus 5 7.56 ± 0.71 10 7.74 ± 0.84 3 7.88 ± 0.81
Lactobacillus fermentum 6 7.35 ± 0.99 6 6.56 ± 1.48 2 7.00
Lactobacillus helveticus 5 8.26 ± 0.99 9 7.48 ± 0.83 4 7.42 ± 0.97 2 5.54
Lactobacillus kefiranofaciens 3 7.74 ± 0.71 5 7.61 ± 1.19
Lactobacillus kefiri 1 6.60 1 5.60
Lactobacillus paraplantarum 1 4.78
Lactobacillus plantarum 1 4.76
Pediococcus pentosaceus 1 5.56
Streptococcus thermophilus 3 7.78 ± 1.25 9 8.17 ± 0.69 1 6.97
Total counts of yeasts 7 6.77 ± 0.89 13 5.66 ± 1.55 6 5.82 ± 0.32 5 5.18 ± 1.32*c
Candida zeylanoides 2 3.08
Debaryomyces hansenii 2 2.78 1 2.70
Issatchenkia orientalis 5 5.23 ± 0.87 4 3.44 ± 1.08 3 3.83 ± 0.28 1 3.11
Kazachstania unispora 4 4.93 ± 1.80 3 5.72 ± 0.42 3 5.39 ± 1.03
Kluyveromyces marxianus 6 4.84 ± 1.51 1 5.93
Pichia fermentans 5 4.88 ± 1.65 1 5.32
Pichia mandshurica 1 6.07
Saccharomyces cerevisiae 7 6.40 ± 1.31 11 5.55 ± 1.64 4 5.49 ± 0.40 1 4.51
Torulaspora delbrueckii 1 6.18 2 4.34
Yarrowia lipolytica 1 3.78
a
Number of samples in which the microorganism was detected
b
Concentrations of LAB or yeasts are expressed as means ± SD of log10 per ml of sample
c
Concentrations of yeasts were compared between the two groups of Tarag made from, cow and camel, by the unpaired t-test
Statistical significance: *P \ 0.05

cartilaginosus (senior synonym of Sac. cerevisiae), and
Saccharomyces torulosus (senior synonym of T. del-
brueckii) play the principal roles in alcoholic fermentation
in Airag. However, our results revealed that the lactose-
fermenting Kl. marxianus predominated in association with
alcoholic fermentation in Airag. This contradiction
between our results and these previous results may be due
to differences in the analytical methods.
The percentages of lactose, protein, and fat and the
contents of amino acids, vitamins, and minerals in the
milks used to prepare Airag or Tarag in Mongolia differ,
depending on the milk’s origin. The mares’ milk used to
prepare Airag has a higher concentration of sugar and a
lower concentration of fat than the cow, yak, goat, or camel
milk used to prepare Tarag (Farah 1993; Indra and Magash
1998). The lactose-fermenting yeast Kl. marxianus was the
predominant isolate in all Airag samples, whereas it was
isolated from only 23% of samples of Tarag and at a lower
concentration (105 c.f.u. ml-1). We considered that this
difference was related to the difference in the lactose
content of the milks—that is, mares’ milk contains 6 to 7%
lactose, whereas the milk of cows, yaks, goats, and camels
contains 4 to 5% lactose. Narvhus and Gadaga (2003)
reported that many indigenous fermented milk products in
Zimbabwe and Uganda contained yeast strains, as repre-
sented by lactose-negative species such as Sac. cerevisiae,
in numbers up to 108 c.f.u. ml-1 together with varied LAB
strains. This result also supports our suggestion that lac-
tose-fermenting yeasts are associated with fermentation in
Airag because mare’s milk has a higher concentration of
lactose than milks from other source animals.
We compared the geographic differences in the LAB
and yeast components of Airag and Tarag in the Gobi
Desert region (provinces of Dundgobi and Umnugobi) and
the forest-steppe region (provinces of Arhangai and
Uburhangai). For Airag, we found no geographic differ-
ences in the total numbers and isolation frequencies of each
species in the LAB population. In the case of Tarag,

123
1324
(A)
(B)
Fig. 3 RAPD-PCR profiles obtained from 10 yeast isolates isolated
from Airag (sample A-2) and Tarag (sample T-20), sampled in the
same nomad’s ger using primers p1252 (a) and p1281 (b). The four
isolates Y227, Y230, Y232, and Y235 were isolated from Airag, and
the six isolates Y236, Y239, Y240, Y241, Y243, and Y245 were
isolated from Tarag. Lane M, pHY DNA size marker (Takara); lanes
1 through 10, Y227, Y230, Y232, Y235, Y236, Y239, Y240, Y241,
Y243, and Y245, respectively. Isolates Y227 and Y236 had identical
RAPD profiles, as did the pairs Y230 and Y239, Y232 and Y243, and
Y235 and Y245
L. kefiranofaciens was isolated only from goat and camel
milk samples and only from the Gobi Desert region, not from
the forest–steppe region (Table 5) (P \ 0.01; data not
shown). No geographic differences in L. kefiranofaciens
content were observed in Airag. Almost of the strains iden-
tified as S. thermophilus were isolated from Tarag made from
cow or yak milk in the forest–steppe region (data not shown).
As was the case in the study of Baldorj et al. (2003), we could
not be more precise in our analyses of the geographic dif-
ferences in microbial composition of the fermented milk
products. However, we did find that the microbial population
of fermented milk products varied with the source animal
(Table 5); that is, the apparent geographic differences in the
L. kefiranofaciens and S. thermophilus contents of Tarag
suggested strongly that differences among the animal species
from which the milk was sourced, rather than geographic
distances, were the most important factors influencing the
diversity of the microbial composition of traditional fer-
mented milks in Mongolia.
Conclusions
This study was the first to investigate microbial diversity in
the traditional fermented milk products of Mongolia by
123
World J Microbiol Biotechnol (2008) 24:1313–1325
using molecular-biology-based methods. We confirmed
that the fermented milk products Airag and Tarag had
unique microbial compositions as compared with the tra-
ditional fermented milk products in other countries—that
is, L. helveticus, L. kefiranofaciens, and the lactose-fer-
menting yeast Kl. marxianus were isolated from Airag as
the predominant isolates, whereas L. delbrueckii subsp.
bulgaricus, L. helveticus, and S. thermophilus were the
predominant isolates from Tarag. We also observed the
close relationship between the lactose content in milk used
to prepare the fermented milk products and the concen-
tration of the lactose-fermenting yeast strains in these
fermented milk products. The information obtained here
will be useful for screening the beneficial strains from
traditional fermented milk products in Mongolia. It will
also help to clarify the reasons why these fermented milks
play important roles as probiotics.
Acknowledgements The authors wish to thank the Mongolian
Scientific-Technological Foundation for its financial support.
References
Akopyanz N, Bukanov NO, Westblom TU, Kresovich S, Berg DE
(1992) DNA diversity among clinical isolates of Helicobacter
pylori detected by PCR-based RAPD fingerprinting. Nucleic
Acids Res 20:5137–5142
An Y, Adachi Y, Ogawa Y (2004) Classification of lactic acid
bacteria isolated from chigee and mare milk collected in Inner
Mongolia. Anim Sci J 75:245–252
Baldorj R, Tumenjargal D, Batjargal B (2003) Biochemical and
microbiological study of fermented mare’s milk (Airag) prepared
by traditional Mongolian technology. In: Proceedings of inter-
national scientific symposium on nomadic cultural tradition:
Mongolian dairy products. The International Institute for the
Study of Nomadic Civilization, Ulaanbaatar, pp 70–76. ISBN:
99929-5-789-1
Beukes EM, Bester BH, Mostert JF (2001) The microbiology of South
African traditional fermented milks. Int J Food Microbiol
63:189–197
Brosius J, Dull TJ, Sleeter DD, Noller HF (1981) Gene organization
and primary structure of a ribosomal RNA operon from
Escherichia coli. J Mol Biol 148:107–127
Burentegusi, Miyamoto T, Nakamura S, Nozaka Y, Aoishi A (2002)
Identification of lactic acid bacteria isolated from fermented
mare’s milk ‘‘Chigee’’ in Inner Mongolia, China. Nihon
Chikusan Gakkaiho 73:441–448 (in Japanese with English
abstract)
Chammas GI, Saliba R, Corrieu G, Béal C (2006) Characterisation of
lactic acid bacteria isolated from fermented milk ‘‘laban’’. Int J
Food Microbiol 110:52–61
Cheirshilp B, Shimizu H, Shioya S (2003) Enhanced kefiran
production by mixed culture of Lactobacillus kefiranofaciens
and Saccharomyces cerevisiae. J Biotechnol 100:43–53
Chen YC, Eisner JD, Kattar MM, Rassoulian-Barrett SL, Lafe K, Bui
U, Limae AP, Cookson BT (2001) Polymorphic internal
transcribed spacer region 1 DNA sequences identify medically
important yeasts. J Clin Microbiol 39:4042–4051
Farah Z (1993) Composition and characteristics of camel milk. J
Dairy Res 60:603–626
World J Microbiol Biotechnol (2008) 24:1313–1325
Gadaga TH, Mutukumira AN, Narvhus JA (2000) Enumeration and
identification of yeasts isolated from Zimbabwean traditional
fermented milk. Int Dairy J 10:459–466
Guessas B, Kihal M (2004) Characterization of lactic acid bacteria
isolated from Algerian arid zone raw goat’s milk. Afr J
Biotechnol 3:339–342
Harun-ur-Rashid M, Togo K, Ueda M, Miyamoto T (2007) Identi-
fication and characterization of dominant lactic acid bacteria
isolated from traditional fermented milk Dahi in Bangladesh.
World J Microbiol Biotechnol 6:178–186
Hosono A, Wardojo R, Otani H (1989) Microbial flora in ‘Dadih’, a
traditional fermented milk in Indonesia. Technol Lebensm-Wiss
u-Technol 22:20–24
Indra R, Magash A (1998) Composition, quality and consumption of
yak milk in Mongolia. J Food Biochem 22:104–124
Ishii S, Kikuchi M, Takao S (1997) Isolation and identification of
lactic acid bacteria and yeasts from ‘‘Chigo’’ in Inner Mongolia,
China. Anim Sci Technol 68:325–329 (in Japanese with English
abstract)
Kurtzman CP, Robnett CJ (1997) Identification of clinically important
Ascomycetous yeasts based on nucleotide divergence in the 50 -
end of the large-subunit (26S) ribosomal DNA gene. J Clin
Microbiol 35:1216–1223
Latorre-Garcı́a L, del Castillo-Agudo L, Polaina J (2007) Taxonom-
ical classification of yeasts isolated from kefir based on the
sequence of their ribosomal RNA genes. World J Microbiol
Biotechnol 23:785–791
Lott TJ, Kuykendall RJ, Reiss E (1993) Nucleotide sequence analysis
of the 5.8S rDNA and adjacent ITS2 regions on Candida
albicans and related species. Yeast 9:1199–1206
Mathara JM, Schillinger U, Kutima PM, Mbugua SK, Holzapfel WH
(2004) Isolation, identification and characterisation of the
dominant microorganisms of kule naoto: the Maasai traditional
fermented milk in Kenya. Int J Food Microbiol 94:269–278
Miyake T, Watanabe K, Watanabe T, Oyaizu H (1998) Phylogenetic
analysis of the genus Bifidobacterium and related genera based
on 16S rDNA sequences. Microbiol Immunol 42:661–667
Montanari G, Zambonelli C, Grazia L, Kamesheva GK, Shigaeva MK
(1996) Saccharomyces unisporus as the principal alcoholic
fermentation microorganism of traditional koumiss. J Dairy Res
63:327–331
Naersong, Kitamoto Y (1995) Microbial flora of ‘‘Edosensuu’’, a
traditional fermented milk of Inner-Mongolia in China. Anim Sci
Technol 66:555–563 (in Japanese with English abstract)
Naersong, Tanaka Y, Mori N, Kitamoto Y (1996) Microbial flora of
‘‘Airag’’, a traditional fermented milk of Inner-Mongolia in
China. Anim Sci Technol 67:78–83 (in Japanese with English
abstract)
View publication stats
1325
Narvhus J, Gadaga TH (2003) The role of interaction between yeasts
and lactic acid bacteria in African fermented milks: a review. Int
J Food Microbiol 86:51–60
Pearson WR (1999) Flexible similarity searching with the FASTA3
program package. In: Misener S, Krawetz SA (eds) Bioinfor-
matics methods and protocols. Humana Press, Totowa, pp 185–
219
Saitou N, Nei M (1987) The neighbor-joining method: a new method
for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425
Shuangquan, Burentegusi, Yu B, Miyamoto T (2004) Microflora in
traditional fermented camel’s milk from Inner Mongolia, China.
Milchwissenschaft 59:649–652
Shuangquan, Burentegusi, Yu B, Miyamoto T (2006) Microflora in
traditional starter cultures for fermented milk, hurunge, from
Inner Mongolia, China. Anim Sci J 77:235–241
Stackebrandt E, Goebel BM (1994) Taxonomic note: a place for
DNA–DNA reassociation and 16S rRNA sequence analysis in
the present species definition in bacteriology. Int J Syst Bacteriol
44:846–849
Sugita T, Saito M, Ito T, Kato Y, Tsuboi R, Takeuchi S, Nishikawa A
(2003) The Basidiomycetous yeasts Cryptococcus diffluens and
C. liquefaciens colonize the skin of patients with atopic
dermatitis. Microbiol Immunol 47:945–950
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG
(1997) The CLUSTAL_X windows interface: flexible strategies
for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Res 25:4876–4882
Torriani S, Felis GE, Dellaglia F (2001) Differentiation of Lactoba-
cillus plantarum, L. pentosus, and L. paraplantarum by recA
gene sequence analysis and multiplex PCR assay with recA
gene-derived primers. Appl Environ Microbiol 67:3450–3454
Torriani S, Zapparoli G, Dellaglio F (1999) Use of PCR-based
methods for rapid differentiation of Lactobacillus delbrueckii
subsp. bulgaricus and L. delbrueckii subsp. lactis. Appl Environ
Microbiol 67:3450–3454
Uchida K., Urashima T., Chanishvili N., Arai I., Motoshima H.
(2007) Major microbiota of lactic acid bacteria from Matsoni, a
traditional Georgia fermented milk. Anim Sci J 78:85–91
Watabe J, Ikeda N, Mizutani J, Sato N, Jin S, Hirai T, Ariga H (1998)
Comparison of microbiological and chemical characteristics
among types of traditionally fermented milk in Inner Mongolia
in China and Calpis sour milk (Sannyuu). Milk Sci 47:1–8 (in
Japanese with English abstract)
Zhu H, Qu F, Zhu LH (1993) Isolation of genomic DNA from plants,
fungi and bacteria using benzyl chloride. Nucleic Acids Res
21:5279–5280
123