Showcasing research from Professor Shaoping Nie's

laboratory, School of Food Science and Technology, As featured in:

Nanchang University, Jiangxi Province, China.
Volume 12
Number 14
21 July 2021

Food &
Pages 6123-6638

A polysaccharide from natural Cordyceps sinensis regulates

the intestinal immunity and gut microbiota in mice with Function
Linking the chemistry and physics of food with health and nutrition
rsc.li/food-function

cyclophosphamide-induced intestinal injury

A polysaccharide from natural Cordyceps sinensis showed

immunoregulatory effect on Treg and Th17 cells in the small
intestine, and modulated the microbiota composition in the
colon of cyclophosphamide-induced intestinal injury mice.

ISSN 2042-650X

PAPER
Xuedong Fang, Wenjin Guo et al.
The alleviating effect and mechanism of Bilobalide on
ulcerative colitis

See Shaoping Nie et al., Food Funct.,

2021, 12, 6271.

rsc.li/food-function
Registered charity number: 207890
 Food &
Function
View Article Online
PAPER View Journal | View Issue

A polysaccharide from natural Cordyceps sinensis

Cite this: Food Funct., 2021, 12, 6271
regulates the intestinal immunity and gut
microbiota in mice with cyclophosphamide-
induced intestinal injury
Shuping Chen,a Junqiao Wang,a Qiuyue Fang,a Nan Dong,a Qingying Fang,a
Published on 12 May 2021. Downloaded on 9/2/2021 10:14:46 AM.

Steve W. Cuia,b and Shaoping Nie *a

Received 25th February 2021,
Accepted 6th May 2021
DOI: 10.1039/d1fo00596k
rsc.li/food-function
A polysaccharide from Cordyceps sinensis (NCSP) was reported to attenuate intestinal injury and regulate
the balance of T helper (Th)1/Th2 cells in immunosuppressed mice. However, whether it influences Th17
and regulatory T (Treg) cells as well as gut ecology remains unknown. In the present study, the intestinal
injury mouse model was also established by intraperitoneal injection of cyclophosphamide (Cy) for three
consecutive days. NCSP was found to increase the number of CD4+ T cells, stimulate the secretion of
interleukins (IL)-17 and IL-21, and the expression of transcription factor (retinoic acid-related orphan
receptor (ROR)-γt). The levels of transforming growth factor (TGF)-β3 and transcription factor (forkhead
box (Fox)p-3) were increased in NCSP-treated groups. Moreover, NCSP upregulated the mRNA expression
of toll like receptors (TLR-2, -6 and -9), while it downregulated the TLR-4 expression. In addition, NCSP
modulated the intestinal microbiota composition and increased the levels of SCFAs. These findings indi-
cated that NCSP may enhance intestinal immunity and have the potential to become a prebiotic to regu-
late intestinal microbiota.

1. Introduction
The gut, the biggest immune organ, is the home to many
immunocytes, including T cells, B cells, DC cells, macro-
phages, Paneth cells and goblet cells, contributing to intestinal
homeostasis.1 There are two main subtypes of T cells, CD4+
and CD8+, in the intestinal tract, which are also known as
helper T (Th) cells and cytotoxic cells, respectively.2 CD4+ T
cells receive signals identified by pattern recognition receptors
(PRRs), toll like receptors (TLRs), nod like receptors (NLRs), on
antigen-presenting cells stimulated by antigen, and then are
polarized into different types of Th cells, including Th1, Th2,
Th17, follicular helper T cell (Tfh) and Treg cells.3,4 Among
them, Th17 cells in the lamina propria play a vital role in pro-
tecting mucosal surfaces from microbial pathogens,5 while
regulatory T (Treg) cells suppress immune response to main-
tain immune homeostasis.6 The balance between them is very
critical for keeping an appropriate immune response. Th17
cells are characterized by the expression of the retinoic acid-
a
State Key Laboratory of Food Science and Technology, China-Canada Joint Lab of
Food Science and Technology (Nanchang), Nanchang University, Nanchang 330047,
China. E-mail: spnie@ncu.edu.cn; Fax: +86-791-88304452; Tel: +86-791-88304452
b
Guelph Research and Development Centre, Agriculture and Agri-Food Canada, 93
Stone Road West, Guelph, Ontario, N1G 5C9, Canada
related orphan receptor (ROR)-γt, IL-17 and IL-21.7 The devel-
opment of Th17 cells depends on the pleiotropic cytokine,
transforming growth factor (TGF)-β, which is also associated
with the development and function of Treg cells.8 It was
reported that disruption of the balance between Th17/Treg
cells occurred in patients with psoriasis, multiple sclerosis,
rheumatoid arthritis and inflammatory bowel disease.9–11 It
was found that polysaccharides promoted host health by
adjusting the equilibrium between Th17 and Treg cells.12 For
example, recent studies found that polysaccharides from
Inonotus obliquus regulated the balance of Th17/Treg cells
through modulating the Janus kinase-signal transducer and
activator of transcription (JAK-STAT) signaling pathway in mice
with colitis,13 or the TLR4/NF-κB pathway in mice with adverse
pregnancy caused by Toxoplasma gondii infection.14
The intestinal tract harbors a complex and dynamic popu-
lation of microorganisms, which play an imperative role in
host health.15 Intestinal flora could be recognized by PRRs,
which then activated and regulated signal transduction path-
ways associated with intestinal mucosal immune function.16 A
series of research studies have shown that microbiota dysbio-
sis was associated with diabetes and inflammatory bowel
disease.17,18
Cordyceps sinensis (C. sinensis), one of the famous resources
for traditional healthy food, could enhance leukocyte recovery,

This journal is © The Royal Society of Chemistry 2021 Food Funct., 2021, 12, 6271–6282 | 6271

Paper
Fig. 1 The detailed chemical structure of the polysaccharide from natural Cordyceps sinensis extracted by hot water and ethanol precipitation.21
accelerate lymphocyte proliferation and prevent bowel injury.19
In our previous research, the water-extracted polysaccharide
from C. sinensis (NCSP) was mainly composed of 1,4-linked
Glcp.20 A highly purified polysaccharide was obtained by
further re-precipitation using 50% ethanol, and its structure
was found to be a bioactive α-1,4-glucan (Fig. 1).21 Further
Published on 12 May 2021. Downloaded on 9/2/2021 10:14:46 AM.
in vivo study showed that NCSP alleviated the intestinal injury
induced by cyclophosphamide (Cy).22 In order to further
pursue the possible mechanisms, its modulatory activities on
intestinal immunity concerning Th17 and Treg cells and gut
microbiota were investigated in this study under the Cy-
induced intestinal injury mice model.
2. Materials and methods
2.1 Materials and reagents
The polysaccharide was prepared in our laboratory as reported
previously, and its chemical structure was characterized as
α-glucan with 1,4-Glcp as the major glycosidic linkage.20
Cy was purchased from Sigma-Aldrich (St Louis, MO, USA).
Levamisole hydrochloride was produced by Shandong
Renhetang Pharmaceutical Co. Ltd. Enzyme-linked immuno-
sorbent assay (ELISA)-based cytokine kits (IL-17, IL-21 and
TGF-β3) were from Wuhan Boster Biological Engineering Co.
Ltd (Wuhan, China). A Revert Aid First Strand cDNA Synthesis
Kit was purchased from Thermo Fisher Scientific (Vilnius,
Lithuania). An SYBR premix ex taq II kit was purchased from
Takara Biotechnology (Dalian, China). Primers were designed
by GenScript China, Ltd (Nanjing, China). The protein extrac-
tion kit was from KeyGEN Bio TCEH (Nanjing China). Anti-
β-actin and HRP-conjugated secondary antibodies were from
ZSGB-Bio (Beijing, China). The primary antibodies, anti-ROR-
γt and anti-Foxp-3, were purchased from BD Bioscience (New
Jersey, USA) and Cell Signaling Technology (Danvers, MA),
respectively.
2.2 Animals
Female Balb/c mice (no. SCKX 2016-0011), aged 6–8 weeks old
(weight 20 ± 2 g), were purchased from the Beijing Vital River
Experimental Animal Technology Company (Beijing, China).
Animals were adapted to the new rodent facility for one week
before the experiment. They were fed a regular chow diet, and
housed in the rodent facility at 22 ± 1 °C with a 12 h light/dark
cycle for acclimatization. All animal procedures in this study
were performed in accordance with the Guidelines for Care
and Use of Laboratory Animals of the National Institutes of
6272 | Food Funct., 2021, 12, 6271–6282
View Article Online
Food & Function
Health and approved by the Experimental Animal Care and
Use Committee of Nanchang University (PR, China).
2.3 Experimental design
The experimental mice were randomly divided into six groups
(n = 12), i.e. normal control group (NC), model control group
(MC), high dose NCSP group (100 mg per kg bw, NCSPH),
medium dose NCSP group (50 mg per kg bw, NCSPM), and low
dose NCSP group (25 mg per kg bw, NCSPL), as well as positive
control group treated with levamisole hydrochloride (40 mg
per kg bw, PC). The intestinal injury mouse model was con-
structed according to our previous study.22 For the next seven
days, mice in NC and MC groups were treated with normal
saline by gastric gavage once daily, and mice in the NCSP-
treated groups and PC group were treated with different doses
of NCSP or levamisole hydrochloride. Feces were collected
after the last administration. Subsequently, 24 h after the last
administration, all the animals in each group were sacrificed.
The small intestine and colonic contents were collected
immediately and stored at −80 °C before use.
2.4 Immuno-histochemical analysis for immune cells in the
small intestine
The number of CD4+ and CD8+ T lymphocytes in the small
intestine was determined by the indirect immune-histochem-
ical assay following the method by Ramos-Vera.23 Briefly,
paraffin-embedded gut tissues were cut into 4 µm thickness
sections, deparaffinized in xylene, and rehydrated with graded
ethanol. Tissues were incubated with 3% H2O2 (Sangon
Biotech Co. Ltd, Shanghai, China) for 10 min. Antigen retrieval
was performed by heating the tissue slides in antigen retrieval
buffer (Na2EDTA, pH 8.0). The slides were incubated with the
rat anti-mouse CD4 and CD8 polyclonal antibodies at 4 °C
overnight. The slides were then permeated with mouse anti-rat
IgG HRP antibodies at room temperature for 1 h, followed by
washing with phosphate buffered saline (PBS) three times, and
staining with the 3,3-diaminobenzidine (DAB) substrate chro-
mogen system for 1–5 min and counterstaining with hemato-
xylin. Finally, the slides were observed under a microscope in a
blinded manner by an independent researcher. The results are
expressed as the number of positive cells (200×).
2.5 ELISA of cytokine contents in the small intestine
The small intestine for each mouse was prepared at a mass–
volume concentration of 1/9 with PBS. After homogenization,
the supernatant was collected by centrifuging at 3000 rpm for
This journal is © The Royal Society of Chemistry 2021

Food & Function
20 min. The levels of cytokines (IL-17, IL-21 and TGF-β3) were
measured by ELISA according to the procedures provided by
the manufacturer.
2.6 Reverse transcription quantitative polymerase chain
reaction analysis of gene expression of TLRs in the small
intestine
Total RNA was extracted from the small intestinal tissue by
steeping in RNA wait (Solarbio, Beijing, China), and cDNA was
produced by reverse transcription using the Revert Aid First
Strand cDNA Synthesis Kit (Takara, Dalian, China) according
to the instructions of the manufacturer. The PCRs were carried
out with a Quant Studio 7 Real-Time PCR System (Life
Technologies, Waltham, MA, USA) using the SYBR Premix Ex
Taq II kit (Takara, Dalian, China). Data analysis was carried
Published on 12 May 2021. Downloaded on 9/2/2021 10:14:46 AM.
out using the 2−ΔΔCt method. The reference gene, β-actin, was
used for normalization. The primer sequences used were as
follows: β-actin, forward: ACTGCCGCATCCTCTTCCTC, reverse:
AAAGAGCCTCAGGGCATCGG; TLR2, forward: ACCCGCCCTT-
TAAGCTGTGT, reverse: TCGTACTTGCACCACTCGCT; TLR4,
forward: TCTGGGGAGGCACATCTTCT, reverse: AGGTCCAA-
GTTGCCGTTTCT; TLR6, forward: CATCCAGAGTGAGTG-
GTGCCAT, reverse: CCCACGTTTGCCCTTCTCAG; TRL9,
forward: GCATGGTGGTGCCTATACTG, reverse: AACACCACG-
AAGGCATCATA.
2.7 Western blot (WB) assay of expression levels of
transcription factors in the small intestine
Nucleoprotein was extracted from the small intestinal tissue
samples using the nucleoprotein and cytoplasmic protein
extraction kit according to the manufacturer’s instruction
(KeyGEN Biotech, Nanjing, China). Protein contents were
determined using the BCA assay kit (Beyotime, Shanghai,
China). The denatured protein was separated on 10%
SDS-PAGE gels and transferred to PVDF membranes. Blots
were blocked for 1 h at room temperature in 5% bovine serum
albumin (BSA) prepared in Tris-buffered saline containing
0.1% Tween 20 (TBST) and then incubated with the following
primary rabbit polyclonal antibodies overnight at 4 °C: anti-
Foxp3, anti-ROR-γt, and anti-β-actin. After washing with TBST
for 15 min three times, the membranes were incubated with
secondary HRP-conjugated goat anti-rabbit IgG at room temp-
erature for 1 h. The immunoreactive bands were visualized
using an enhanced chemiluminescence detection kit
(Beyotime, Shanghai, China) according to the manufacturer’s
instructions. β-actin was used as a control. Densitometry was
performed using Quantity One 4.6.2 software (Bio-Rad
Laboratories, CA, USA).
2.8 GC analysis of short-chain fatty acids (SCFAs) in feces
Feces (100 mg) were diluted with deionized water at a mass-to-
volume ratio of 1 : 7, and was then vortexed for 1 min, followed
by sonication for 20 min. The supernatants were collected by
centrifuging at 4800 rpm at 4 °C for 20 min. This process was
repeated as mentioned above and the supernatants were
This journal is © The Royal Society of Chemistry 2021
View Article Online
Paper
mixed. Then the levels of SCFAs were determined using GC
according to the method described previously.24
2.9 DNA extraction and Illumina Miseq analysis of colon
microbiota
DNA was extracted from the colonic content using a QIAamp
DNA stool mini kit (Qiagen, Hilden, Germany) according to
the manufacturer’s instruction. The quality and quantity of the
genomic DNA were determined by using a Nano Drop
2000 microspectrophotometer (Thermo Fisher Scientific,
Waltham, USA). The 16S rRNA amplicon sequencing was exe-
cuted according to a previous study.24
QIIME (Quantitative Insights into Microbial Ecology, v1.8.0,
http://qiime.org) software was used for quality control splicing,
filtering and other pre-processing of the raw data, and Usearch
software was used to remove chimeric sequences. Based on the
Greengenes database, the OTU table was generated and filtered
according to the data volume. QIIME software was used for
alpha diversity and microbial taxa distribution analysis.
The Metastats statistical algorithm (http://metastats.cbcb.umd.
edu/) is used in the Mothur software in order to compare and
test the difference of sequence quantity (i.e. absolute abun-
dance) between the phylum and genus level of various classifi-
cation units in samples (groups). Linear discriminant analysis
effect size (LEfSe) analysis of the relative abundance matrix at
the genus level was submitted on the Galaxy online analysis
platform (http://huttenhower.sph.harvard.edu/galaxy/).
2.10 Statistical analysis
Results were expressed as means ± SD. Statistical analysis was
performed with SPSS 21.0 software. Statistical significance was
determined using one-way analysis of variance (ANOVA), fol-
lowed by the LSD multiple comparison test. A p < 0.05 was con-
sidered to be statistically significant.
3. Results
3.1 Number of T lymphocytes in lamina propria of the small
intestine
The IHC method was used to determine the number of CD4+
and CD8+ T lymphocytes in the lamina propria of the small
intestine. As shown in Fig. 2, the number of CD4+ T cells in
the MC group (97.25 ± 4.72 cells) significantly decreased com-
pared with that in the NC group (160 ± 27.68 cells) ( p < 0.01).
The number of CD8+ T cells in the MC group (37.25 ± 6.90
cells) tended to be less than that in the NC group (58.25 ± 4.34
cells) ( p > 0.05). NCSP obviously increased the number of CD4+
T cells (136.5 ± 13.72 cells) in the intestinal injury mice ( p <
0.01). In addition, NCSP tended to increase the number of
CD8+ T cells ( p > 0.05).
3.2 Relative expression levels of nuclear transcription factors
in the small intestine
Foxp-3 and ROR-γt are nuclear transcription factors of Treg
and Th17 cells, respectively. WB analysis showed that the
Food Funct., 2021, 12, 6271–6282 | 6273
 View Article Online

Paper Food & Function

Published on 12 May 2021. Downloaded on 9/2/2021 10:14:46 AM.

Fig. 2 Changes in the number of T cells in the small intestine. (a) Representative images of immunohistochemical staining of CD4+ and CD8+ T
cells in lamina propria of the intestine (×200). (b) The number of CD4+ and CD8+ T cells. NC, normal control; MC, model control; NCSPL, 25 mg per
kg bw NCSP; NCSPM, 50 mg per kg bw NCSP; NCSPH, 100 mg per kg bw NCSP; PC, positive control, 40 mg per kg bw levamisole hydrochloride.
Data are expressed as the mean ± SD (n = 6). ##p < 0.01, compared with NC, **p < 0.01, compared with MC.

protein expression of Foxp-3 in the MC group notably reduced
( p < 0.01), while the expression of ROR-γt tended to decrease
( p > 0.05) in comparison with the NC group (Fig. 3). However,
when compared with the MC group, treatment with NCSP
dose-dependently enhanced the Foxp-3 expression level ( p <
0.01). Furthermore, the level of Foxp-3 in the NCSPH group
was higher than that in the PC group. The expression of ROR-
γt in the NCSPM group was the highest, and obviously
enhanced in comparison with the MC group ( p < 0.05).
3.3 Cytokine contents in the small intestine
Concentrations of cytokines (IL-17, IL-21 and TGF-β) in the
small intestine were used to investigate Th17 and Treg
responses. As shown in Fig. 4, intraperitoneal injection of Cy
led to significant reductions of all cytokines mentioned above
in the small intestine ( p < 0.01). Significant increases in the
levels of IL-21 and IL-17 were seen in both the NCSPH group
(83.5 ± 5.67, 41.85 ± 4.29 pg mL−1) and the PC group (72.54 ±
2.74, 40.33 ± 4.31 pg mL−1) compared with the MC group
(55.56 ± 8.49, 26.31 ± 1.24 pg mL−1). The contents of TGF-β3
(210.24 ± 19.46 and 340.50 ± 31.65 pg mL−1 in the NCSPM and
NCSPH groups, respectively) were notably improved in com-
parison with that in the MC group (113.60 ± 15.68 pg mL−1)
( p < 0.01). In addition, all the cytokine concentrations in the
NCSPH group were higher than those in the PC group.
3.4 Relative levels of mRNA expression of TLRs in the small
intestine
The relative levels of mRNA expression of TLR-2, TLR-4, TLR-6
and TLR-9 were determined. As displayed in Fig. 5, compared
to the NC group, the MC group exhibited a significant decrease
in the mRNA expression of TLR-2 (0.660 ± 0.048), TLR-6 (0.539
± 0.030) and TLR-9 (0.680 ± 0.100) ( p < 0.01). In contrast, treat-
ment with Cy led to an increase in the mRNA expression of
TLR-4 (4.641 ± 0.842) ( p < 0.01). After supplementation with
different concentrations of NCSP, changes in the relative levels
of mRNA expression of TLRs induced by Cy significantly
reversed in a dose-dependent manner.

6274 | Food Funct., 2021, 12, 6271–6282 This journal is © The Royal Society of Chemistry 2021

Food & Function
Published on 12 May 2021. Downloaded on 9/2/2021 10:14:46 AM.
Fig. 3 The protein expression levels of transcription factors in the small
intestine. (a) The protein expression levels of ROR-γt and Foxp-3 were
determined by western blot assay. (b) Relative intensities of ROR-γt and
Foxp-3 bands. (c) The value of Foxp-3/ROR-γt. NC, normal control; MC,
model control; NCSPL, 25 mg per kg bw NCSP; NCSPM, 50 mg per kg
bw NCSP; NCSPH, 100 mg per kg bw NCSP; PC, 40 mg per kg bw leva-
misole hydrochloride. Data are expressed as the mean ± SD (n = 3). #p <
0.05, compared with NC, *p < 0.05 and **p < 0.01, compared with MC.
3.5 Changes in the colonic microbiota composition
16S rRNA amplicon sequencing was used to investigate the
changes in colonic microbiota. Different α diversity indexes
(observed_otus, Chao1 and Shannon indexes) were used for
analyzing the gut microbial diversity and richness (Fig. 6a).
The Chao1 index in NCSP groups was higher than that in the
model group, and the observed_otus and Shannon indexes in
This journal is © The Royal Society of Chemistry 2021
View Article Online
Paper
Fig. 4 The levels of cytokines in the small intestine: (a) IL-17, (b) IL-21,
and (c) TGF-β3. NC, normal control; MC, model control; NCSPL, 25 mg
per kg bw NCSP; NCSPM, 50 mg per kg bw NCSP; NCSPH, 100 mg per
kg bw NCSP; PC, 40 mg per kg bw levamisole hydrochloride. Data are
expressed as the mean ± SD (n = 6). ##p < 0.01, compared with NC, *p <
0.05 and **p < 0.01, compared with MC.
NCSPL and NCSPM groups were higher than that in the model
group. The results of α diversity indexes suggested that NCSP
treatment affected microbial diversity and richness in the
intestinal injury mice. The differences in colonic microbiota
among different treatment groups were determined through
the β diversity metric using principal component analysis
(PCA) (Fig. 6b). Mice in the MC group displayed obvious diver-
Food Funct., 2021, 12, 6271–6282 | 6275
 View Article Online

Paper Food & Function

Published on 12 May 2021. Downloaded on 9/2/2021 10:14:46 AM.

Fig. 5 The mRNA expression levels of TLRs in the small intestine: (a) TLR-2, (b) TLR-4, (c) TLR-6, and (d) TLR-9. NC, normal control; MC, model
control; NCSPL, 25 mg per kg bw NCSP; NCSPM, 50 mg per kg bw NCSP; NCSPH, 100 mg per kg bw NCSP; PC, 40 mg per kg bw levamisole hydro-
chloride. Data are expressed as the mean ± SD (n = 6). ##p < 0.01, compared with NC, *p < 0.05 and **p < 0.01, compared with MC.

gences in the community composition of the gut
microbiota in comparison with the normal control group.
NCSP treatments shifted the microbiota, and the resulting
composition was similar to that of the NC group. This result
suggested that NCSP modulated the colonic microbiota struc-
ture in the Cy-induced intestinal injury mice to a more normal
status.
The changes of the relative abundance at the phylum level
after the NCSP oral treatment are shown in Fig. 6c and Table 1.
Colonic microbiota was mainly composed of Bacteroidetes,
Firmicutes and Cyanobacteria. In NC mice, the relative
abundances of Bacteroidetes, Firmicutes and
Verrucomicrobia were 0.584, 0.397 and 0.0055, respectively. The
proportion of Bacteroidetes was decreased to 0.489, and
Firmicutes and Verrucomicrobia increased to 0.455 and 0.01,
respectively, in the MC group. Obviously, administration of
NCSP modified the microbiota (Table 1). Specifically, the
abundance of Bacteroidetes in the NCSPH group was
significantly increased (0.633, p < 0.05), and the proportions
of Firmicutes (0.423, p < 0.05) and Verrucomicrobia (0.0001,
p < 0.05) were significantly decreased, when compared to the
MC group.
The composition of microbiota in the MC group changed
greatly compared with that in the NC group, at the family level
(Fig. 6d). The abundance of Muribaculaceae was
obviously decreased in the MC group compared with the NC
group ( p < 0.05). However, treatment with NCSP significantly
reversed this trend ( p < 0.05) (Fig. 6e).
LEfSe analysis was used to analyze the key phylotypes of gut
microbiota among different groups (Fig. 7). The results showed
that Anaerostipes, Tenericutes, Mollicutes, RF39, Dehalobacterium,
Dehalobacteriaceae, Porphyromonadaceae, Parabacteroides,
Desulfovibrio, Alphaproteobacteria, Desulfovibrionaceae,
Erysipelotrichales, Erysipelotrichi, Butyricimonas and Dorea were
enriched in the intestinal injury mice compared to the normal
healthy mice (LDA > 2, p < 0.05). After treatment with 25 mg per
kg bw of NCSP, Gammaproteobacteria and Enterobacteriales were
the main microorganisms in colonic contents. Supplementation
of 100 mg per kg bw NCSP enriched the abundances of
Bacteroidales, Bacteroidia, Bacteroidetes, Muribaculaceae,
Rikenellaceae and AF12. However, there were no dominant bac-
teria in NCSPM according to the analysis (LDA > 2, p < 0.05). The
results showed that gut microbiota dysbiosis induced by Cy was
modulated after treatment with NCSP.

6276 | Food Funct., 2021, 12, 6271–6282 This journal is © The Royal Society of Chemistry 2021

Food & Function
Published on 12 May 2021. Downloaded on 9/2/2021 10:14:46 AM.
Fig. 6 Microbial community structure of colonic contents in six groups.
(a) α-Diversity indexes (Chao 1, observed OTUs, and Shannon) of gut
microbiota. (b) β-Diversity analysis of intestinal microbiota. (c) Relative
abundance of microbiota at the phylum levels. (d) Relative abundance of
microbiota at the family levels. (e) Relative abundance of
Muribaculaceae. NC, normal control; MC, model control; NCSPL, 25 mg
per kg bw NCSP; NCSPM, 50 mg per kg bw NCSP; NCSPH, 100 mg per
kg bw NCSP; PC, 40 mg per kg bw levamisole hydrochloride. Data are
expressed as the mean ± SD (n = 4).
3.6 Levels of SCFAs in feces
As shown in Fig. 8, the concentration of total SCFAs in feces of
Cy-induced intestinal injury mice (15.92 ± 0.96 mmol L−1) sig-
nificantly decreased compared with that in the normal mice
This journal is © The Royal Society of Chemistry 2021
View Article Online
Paper
Table 1 Relative abundance of main gut microbiota at the phylum level
Groups Bacteroidetes Firmicutes Cyanobacteria
NC 0.584 ± 0.078 0.397 ± 0.074 0.008 ± 0.010
MC 0.489 ± 0.028 0.455 ± 0.037 0.033 ± 0.024
NCSPL 0.381 ± 0.064 0.567 ± 0.816 0.031 ± 0.020
NCSPM 0.491 ± 0.062 0.484 ± 0.058 0.015 ± 0.011
NCSPH 0.633 ± 0.149* 0.324 ± 0.143* 0.029 ± 0.021
PC 0.731 ± 0.082** 0.231 ± 0.077** 0.012 ± 0.003
*p < 0.05 and **p < 0.01, compared with MC.
(18.64 ± 0.11 mmol L−1) ( p < 0.01). Simultaneously, the con-
centration of acetic acid in the MC group (8.62 ± 0.92 mmol
L−1) was significantly lower than that in the NC group (11.22 ±
0.11 mmol L−1) ( p < 0.01). Mice administered with a high dose
of NCSP exhibited an obviously higher level of total SCFAs
than that in the intestinal injury mice ( p < 0.01). The concen-
tration of acetic acid increased in a dose-dependent manner
after NCSP gastric gavage, and those in NCSPM and NCSPH
groups were apparently improved in comparison with the MC
group ( p < 0.05).
4. Discussion
Cy can dramatically damage the structure of DNA, impair
immune cells and notably interfere with the proliferation and
differentiation of T and B cells, resulting in the reduction of
the number of normal T and B cells.25 Furthermore, it was
shown that Cy treatment would harm mucosal immunity in
the small intestine.26 Polysaccharides are primary active ingre-
dients in herbal medicines and have many biological activities,
including immunomodulatory activity. Administration of poly-
saccharides both before or after Cy-induced mice models were
used. Han et al. revealed that pretreatment with polysaccharide
from Ziziphus Jujiba cv. Pazao before Cy injection could attenu-
ate intestinal injury and regulate gut microbiota.27 Bai et al.
also revealed that early intake of longan pulp polysaccharides
prevented intestinal mucosal injury and promoted morpho-
logical integrity in Cy-treated mice.28 On the other hand, the
model of polysaccharides treated in Cy-induced mice was more
commonly used for evaluating their immunomodulatory
effect, or effect in protecting against intestinal injury. In our
previous study, NCSP significantly restored the pathological
damage, increased the levels of goblet cells and mucus and
regulated the balance of Th1/Th2 cells in the small intestine,
showing an obvious effect on alleviating intestinal damage
induced by Cy.
As the largest immune organ of the host, the gut contains
many immunocytes. T cells, in the lamina propria of the small
intestine, are mainly composed of CD4+ and CD8+ T cells. It
was reported that Ganoderma atrum polysaccharides elevated
CD4+ and CD8+ T cell numbers.29 In the present study, NCSP
significantly increased the number of CD4+ T cells in the intes-
tinal injury mice. A similar finding was also observed by Xie
et al.,30 who found that Th17 and Treg cells, two types of T
Food Funct., 2021, 12, 6271–6282 | 6277
 View Article Online

Paper Food & Function

Published on 12 May 2021. Downloaded on 9/2/2021 10:14:46 AM.

Fig. 7 LEfSe comparison of intestinal microbiota. (a) LDA scores between NC and MC groups, with LDA score > 2; (b) LDA scores among MC,
NCSPL, NCSPM and NCSPH, with LDA score > 3. (c) Cladogram of the LDA scores based on LEfSe analysis between NC and MC groups. (d)
Cladogram of the LDA scores based on LEfSe analysis among NCSPL, NCSPM, NCSPH and MC groups. NC, normal control; MC, model control;
NCSPL, 25 mg per kg bw NCSP; NCSPM, 50 mg per kg bw NCSP; NCSPH, 100 mg per kg bw NCSP; PC, 40 mg per kg bw levamisole hydrochloride.
Data are expressed as the mean ± SD (n = 4).

cells from CD4+ T cells, showed relatively opposite functions in kine for this subset.34 Treg cells produced anti-inflammatory
the modulation of immune response.31 Th17 cells produced cytokine TGF-β, a central cytokine to the differentiation of
the cytokines IL-17, IL-2132 and IL-22.33 Among these, IL-17 both Th17 and Treg cells, and played a crucial role in main-
was widely studied and considered as the typical effector cyto- taining immunological self-tolerance and anti-inflammation.35

6278 | Food Funct., 2021, 12, 6271–6282 This journal is © The Royal Society of Chemistry 2021

Food & Function
Published on 12 May 2021. Downloaded on 9/2/2021 10:14:46 AM.
Fig. 8 Effect of NCSP on SCFAs in the feces. NC, normal control; MC,
model control; NCSPL, 25 mg per kg bw NCSP; NCSPM, 50 mg per kg
bw NCSP; NCSPH, 100 mg per kg bw NCSP; PC, 40 mg per kg bw leva-
misole hydrochloride. Data are expressed as the mean ± SD (n = 10).
##
p < 0.01, compared with NC, *p < 0.05 and **p < 0.01, compared
with MC.
In this study, treatment with Cy inhibited the secretion of
IL-17, IL-21 and TGF-β3 in the small intestine compared to
those in the NC group, suggesting that Cy would significantly
disrupt immunity homeostasis. After administration of NCSP,
the levels of these cytokines were increased. These results indi-
cated that immunomodulation of NCSP on the Cy-induced
intestinal injury mice was partly attributed to the regulation of
the production of Th17 and Treg cells associated cytokines.
The polarization of Th17 and Treg cells was reported to rely
on the regulation and activation of transcription factors.36
ROR-γt was an essential transcription factor for the Th17 cell
differentiation.37 Foxp-3, a characteristic transcription factor
expressed by Treg cells, was considered as a crucial factor regu-
lating the development and function of Treg cells.38 In this
study, intraperitoneal injection of Cy slightly suppressed the
expression of Th17 cell-related transcription factors ROR-γt,
but significantly inhibited the level of Foxp-3. Meanwhile, the
ratio of Foxp-3 and ROR-γt in the Cy group was lower than that
in the NC group, suggesting that the balance of Th17 and Treg
cells was disrupted in the intestinal injury mice. After treat-
ment with NCSP, the levels of Foxp-3 and ROR-γt were
increased significantly and the ratio of Foxp-3/ROR-γt was
regulated. Specifically, a high dose of NCSP significantly
increased the value of Foxp-3/ROR-γt compared with that in
the MC group. The balance of Th17/Treg cells plays a critical
role in maintaining immune homeostasis.39 The enhanced
Th17 cell function can cause autoimmune diseases and
inflammation, while excessive expression of Treg cells may
lead to cancer incidence and tolerance to the pathogen.40
These results suggested that NCSP enhanced intestinal immu-
nity and modulated the equilibrium of Th17 and Treg cells.
PRRs, expressed in most immune and intestinal epithelial
cells in the gut, were reported to play an indispensable role in
This journal is © The Royal Society of Chemistry 2021
View Article Online
Paper
intestinal immune regulation.41 They can recognize the anti-
gens, and activate not only innate immune responses but also
stimulate adaptive immune responses.42,43 In the current
study, NCSP stimulated the surface receptors TLR-2 and TLR-6,
as well as the intracellular receptor TLR-9 dose-dependently,
but inhibited the expression of TLR-4. According to the above
results, NCSP might modulate intestinal immunity by influen-
cing the expression of TLRs.
It is widely accepted that colonic microbiota has a great
influence on the host immune system.44 Recently, polysacchar-
ides have been reported to have the ability to modulate gut
microbial ecology.45,46 Therefore, in this study, 16S rRNA high-
throughput sequencing was used to investigate the intestinal
microbiota composition. The results showed that there were
no obvious changes in observed_otus, Chao1 and Shannon
indices among groups. PCA analysis revealed that the overall
microbial community structure was changed with Cy treat-
ment, and NCSP modulated these changes considering the
microbiota structure of the NCSPH group was more similar to
the NC group.
In colonic contents, the most abundant phyla were
Bacteroidetes and Firmicutes. They could decompose polysac-
charides by synthesizing carbohydrate-active enzymes.47
Bacteroidetes tend to be generalists for glycan catabolism and
Firmicutes tend to be specialists for a selected set of glycans.48
In this study, the MC group exhibited decreased Bacteroidetes
but increased Firmicutes in comparison with the NC group;
supplementing with NCSP reversed this trend, similar to a pre-
vious report.49 At the family level, the relative abundance of
Muribaculaceae in the MC group decreased when compared
with that in the NC group; however, oral treatment with NCSP
also reversed the trend. It has been reported that
Muribaculaceae was positively correlated with immune
response, including natural killer cells, and the family
members of Muribaculaceae can interact with both innate and
adaptive immune responses via IgA coating.50 Additionally,
Muribaculaceae was the primary gut microbiota identified in
healthy individuals, participating in fermentation pathways to
produce succinate, acetate and propionate via depredating
complex carbohydrates, like α-glucans, pectin and host-derived
glycans.51 SCFAs, including acetic, propionic, and butyric acids,
were beneficial to maintain the epithelial barrier function and
regulate the immune response.52 It was reported that NCSP, a
kind of α-glucan, significantly increased the concentrations of
acetic acid and total SCFAs.21 This may be attributed to the
modulation of NCSP in the intestinal microbiota structure.
These results showed that NCSP increased the abundance of
beneficial bacteria, Muribaculaceae and the concentrations of
total SCFAs and acetic acid in mice with intestinal injury.
In conclusion, NCSP increased the number of CD4+ T cells
and regulated the expression of TLRs. Moreover, NCSP signifi-
cantly increased the levels of cytokines related to Th17 cells
(IL-17 and IL-21) and Treg cells (TGF-β3) in the small intestine,
and the expression of transcription factors, ROR-γt and Foxp-3.
In addition, NCSP regulated the microbiota composition in
colonic contents and increased the concentration of SCFAs in
Food Funct., 2021, 12, 6271–6282 | 6279

Paper
feces. This study has demonstrated that NCSP exerted an
immunoregulatory effect on Treg and Th17 cells, and adjusted
microbiota composition in the gut of Cy-induced intestinal
injury mice. NCSP might be a potential candidate derived
from natural edible food for modulating intestinal immunity
and optimizing the intestinal environment.
Conflicts of interest
The authors declare that there are no conflicts of interest.
Acknowledgements
Published on 12 May 2021. Downloaded on 9/2/2021 10:14:46 AM.
The financial supports from the National Science Fund for
Distinguished Young Scholars of China (31825020) and
Technological Innovation Guidance Plan of Jiangxi Province
(20203AEI91007) are gratefully acknowledged. The authors are
very grateful to Mrs Yajing Li of Qinghai Ta Er Sheng Gu
Agricultural Science and Technology Co. Ltd. for providing
partial samples of natural C. sinensis.
References
1 J. L. Round and S. K. Mazmanian, The gut microbiota
shapes intestinal immune responses during health and
disease, Nat. Rev. Immunol., 2009, 9, 313–323.
2 A. Cruz-Adalia and E. Veiga, Close encounters of lymphoid
cells and bacteria, Front. Immunol., 2016, 7, 1–15.
3 J. Zhu and W. E. Paul, Peripheral CD4+ T-cell differentiation
regulated by networks of cytokines and transcription
factors, Immunol. Rev., 2010, 238, 247–262.
4 G. R. Lee, The balance of Th17 versus Treg cells in autoim-
munity, Int. J. Mol. Sci., 2018, 19, 1–14.
5 S. A. Khader, S. L. Gaffen and J. K. Kolls, Th17 cells at the
crossroads of innate and adaptive immunity against infec-
tious diseases at the mucosa, Mucosal Immunol., 2009, 2,
403–411.
6 U. Hadis, B. Wahl, O. Schulz, M. H. Wolenski, A. Schippers,
N. Wagner, W. Muller, T. Sparwasser, R. Forster and
O. Pabst, Intestinal tolerance requires gut homing and
expansion of FoxP3 + regulatory T cells in the lamina
propria, Immunity, 2011, 34, 237–246.
7 D. D. Patel and V. K. Kuchroo, Th17 cell pathway in human
immunity: lessons from genetics and therapeutic interven-
tions, Immunity, 2015, 43, 1040–1051.
8 Y. K. Lee, R. Mukasa, R. D. Hatton and C. T. Weaver,
Developmental plasticity of Th17 and Treg cells, Curr. Opin.
Immunol., 2009, 21, 274–280.
9 E. Bettelli, T. Korn, M. Oukka and V. K. Kuchroo, Induction
and effector functions of T(H)17 cells, Nature, 2008, 453,
1051–1057.
10 M. Chabaud, J. M. Durand, N. Buchs, F. Fossiez, G. Page,
L. Frappart and P. Miossec, Human interleukin-17: A T cell-
6280 | Food Funct., 2021, 12, 6271–6282
View Article Online
Food & Function
derived proinflammatory cytokine produced by the rheu-
matoid synovium, Arthritis Rheum., 1999, 42, 963–970.
11 J. S. Tzartos, M. A. Friese, M. J. Craner, J. Palace,
J. Newcome, M. M. Esiri and L. Fugger, Interleukin-17 pro-
duction in central nervous system-infiltrating T cells and
glial cells is associated with active disease in multiple scler-
osis, Am. J. Pathol., 2008, 172, 146–155.
12 C. Shi, H. Zhu, H. Li, D. Zeng, X. Shi, Y. Zhang, Y. Lu,
L. Ling, C. Wang and D. Chen, Regulating the balance of
Th17/Treg cells in gut-lung axis contributed to the thera-
peutic effect of Houttuynia cordata polysaccharides on
H1N1-induced acute lung injury, Int. J. Biol. Macromol.,
2020, 158, 52–66.
13 Y. Chen, J. Zheng, C. Qu, Y. Xiao, F. Li, Q. Jin, H. Li,
F. Meng, G. Jin and D. Jin, Inonotus obliquus polysaccharide
ameliorates dextran sulphate sodium induced colitis invol-
ving modulation of Th1/Th2 and Th17/Treg balance, Artif.
Cells, Nanomed., Biotechnol., 2019, 47, 757–766.
14 L. Xu, Y. Yu, R. Sang, B. Ge, M. Wang, H. Zhou and
X. Zhang, Inonotus obliquus polysaccharide protects against
adverse pregnancy caused by Toxoplasma gondii infection
through regulating Th17/Treg balance via TLR4/NF-κB
pathway, Int. J. Biol. Macromol., 2020, 146, 832–840.
15 E. Thursby and N. Juge, Introduction to the human gut
microbiota, Biochem. J., 2017, 474, 1823–1836.
16 N. Kamada, S. U. Seo, G. Y. Chen and G. Nunez, Role of the
gut microbiota in immunity and inflammatory disease,
Nat. Rev. Immunol., 2013, 13, 321–335.
17 H. Khalili, S. S. M. Chan, P. Lochhead,
A. S. Ananthakrishnan, A. R. Hart and A. T. Chan, The role
of diet in the aetiopathogenesis of inflammatory bowel
disease, Nat. Rev. Gastroenterol. Hepatol., 2018, 15, 525–535.
18 L. Zhao, F. Zhang, X. Ding, G. Wu, Y. Lam, X. Wang, H. Fu,
X. Xue, C. Lu, J. Ma, L. Yu, C. Xu, Z. Ren, Y. Xu, S. Xu,
H. Shen, X. Zhu, Y. Shi, Q. Shen, W. Dong, R. Liu, Y. Ling,
Y. Zeng, X. Wang, Q. Zhang, J. Wang, L. Wang, Y. Wu,
B. Zeng, H. Wei, M. Zhang, Y. Peng and C. Zhang, Gut bac-
teria selectively promoted by dietary fibers alleviate type 2
diabetes, Science, 2018, 359, 1151–1156.
19 H. Lo, C. Hsieh, F. Lin and T. Hsu, A systematic review of
the mysterious caterpillar fungus ophiocordyceps sinensis in
Dong-ChongXiaCao (Dong Chong Xia Cao) and related bio-
active ingredients, J. Tradit. Complementary Med., 2013, 3,
16–32.
20 J. Wang, S. Nie, L. Kan, H. Chen, S. Cui, A. Phillips,
G. Phillips and M. Xie, Comparison of structural features
and antioxidant activity of polysaccharides from natural
and cultured Cordyceps sinensis, Food Sci. Biotechnol., 2017,
26, 55–62.
21 J. Wang, S. Nie, S. Cui, Z. Wang, A. Phillips, G. Phillips,
Y. Li and M. Xie, Structural characterization and immunos-
timulatory activity of a glucan from natural Cordyceps sinen-
sis, Food Hydrocolloids, 2017, 67, 139–147.
22 S. Chen, J. Wang, Q. Fang, N. Dong and S. Nie,
Polysaccharide from natural Cordyceps sinensis ameliorated
intestinal injury and enhanced antioxidant activity in
This journal is © The Royal Society of Chemistry 2021

Food & Function
immunosuppressed mice, Food Hydrocolloids, 2019, 89,
661–667.
23 J. A. Ramos-Vara, Technical aspects of immunohistochem-
istry, Vet. Pathol., 2005, 42, 405–426.
24 H. Li, Q. Fang, Q. Nie, J. Hu, C. Yang, T. Huang, H. Li and
S. Nie, Hypoglycemic and hypolipidemic mechanism of tea
polysaccharides on type 2 diabetic rats via gut microbiota
and metabolism alteration, J. Agric. Food Chem., 2020, 68,
10015–10028.
25 Y. Meng, B. Li, D. Jin, M. Zhan, J. Lu and G. Huo,
Immunomodulatory activity of Lactobacillus plantarum
KLDS1.0318 in cyclophosphamide-treated mice, Food Nutr.
Res., 2018, 62, 1–9.
26 Y. Bai, F. Huang, R. Zhang, Q. Ma, L. Dong, D. Su, J. Chi
and M. Zhang, Longan pulp polysaccharide protects against
Published on 12 May 2021. Downloaded on 9/2/2021 10:14:46 AM.
cyclophosphamide-induced immunosuppression in mice
by promoting intestinal secretory IgA synthesis, Food
Funct., 2020, 11, 2738–2748.
27 X. Han, B. Bai, Q. Zhou, J. Niu, J. Yuan, H. Zhang, J. Jia,
W. Zhao and H. Chen, Dietary supplementation with poly-
saccharides from Ziziphus Jujuba cv, Pozaointervenes in
immune response via regulating peripheral immunity and
intestinal barrier function in cyclophosphamide-induced
mice, Food Funct., 2020, 11, 5992–6006.
28 Y. Bai, F. Huang, R. Zhang, L. Dong, X. Jia, L. Liu, Y. Yi and
M. Zhang, Longan pulp polysaccharides relieve intestinal
injury in vivo and in vitro by promoting tight junction
expression, Carbohydr. Polym., 2020, 229, 1–12.
29 M. Ying, B. Zheng, Q. Yu, K. Hou, H. Wang, M. Zhao,
Y. Chen, J. Xie, S. Nie and M. Xie, Ganoderma atrum poly-
saccharide ameliorates intestinal mucosal dysfunction
associated with autophagy in immunosuppressed mice,
Food Chem. Toxicol., 2020, 138, 1–33.
30 J. Xie, S. Nie, Q. Yu, J. Yin, T. Xiong, D. Gong and M. Xie,
Lactobacillus plantarum NCU116 attenuates cyclophospha-
mide-induced immunosuppression and regulates Th17/
Treg cell immune responses in mice, J. Agric. Food Chem.,
2016, 64, 1291–1297.
31 M. B. Geuking and R. Burkhard, Microbial modulation of
intestinal T helper cell responses and implications for
disease and therapy, Mucosal Immunol., 2020, 13, 855–866.
32 T. Korn, E. Betteli, W. Gao, A. Awasthi, A. Jager, T. B. Strom,
M. Oukka and V. K. Kuchroo, IL-21 initiates an alternative
pathway to induce proinflammatory T(H)17 cells, Nature,
2007, 448, 484–487.
33 Y. Chung, X. Yang, S. H. Chang, L. Ma, Q. Tian and
C. Dong, Expression and regulation of IL-22 in the IL-17-
producing CD4+ T lymphocytes, Cell Res., 2006, 16, 902–
907.
34 I. I. Ivanov, R. L. Frutos, N. Manel, K. Yoshinaga,
D. B. Rifkin, R. B. Sartor, B. B. Finlay and D. R. Littman,
Specific microbiota direct the differentiation of IL-17-pro-
ducing T-helper cells in the mucosa of the small intestine,
Cell Host Microbe, 2008, 4, 337–349.
35 L. Xu, Y. Yu, R. Sang, B. Ge, M. Wang, H. Zhou and
X. Zhang, Inonotus obliquus polysaccharide protects against
This journal is © The Royal Society of Chemistry 2021
View Article Online
Paper
adverse pregnancy caused by Toxoplasma gondii infection
through regulating Th17/Treg balance via TLR4/NF-κB
pathway, Int. J. Biol. Macromol., 2020, 146, 832–840.
36 L. Zhou, J. E. Lopes, M. M. W. Chong, I. I. Ivanov, R. Min,
G. D. Victora, Y. Shen, J. Du, Y. P. Rubtsov, A. Y. Rudensky,
S. F. Ziegler and D. R. Littman, TGF-beta-induced Foxp3
inhibits T(H)17 cell differentiation by antagonizing ROR
gamma t function, Nature, 2008, 453, 236–240.
37 H.-R. Cha, S.-Y. Chang, J.-H. Chang, J.-O. Kim, J.-Y. Yang,
C.-H. Kim and M.-N. Kweon, Downregulation of Th17 cells
in the small intestine by disruption of gut flora in the
absence of retinoic acid, J. Immunol., 2010, 184, 6799–6806.
38 N. Ohkura, M. Hamaguchi, H. Morikawa, K. Sugimura,
A. Tanaka, Y. Ito, M. Osaki, Y. Tanaka, R. Yamashita,
N. Nakano, J. Huehn, H. J. Fehling, T. Sparwasser, K. Nakai
and S. Sakaguchi, T cell receptor stimulation-induced epi-
genetic changes and Foxp3 expression are independent
and complementary events required for Treg cell develop-
ment, Immunity, 2012, 37, 785–799.
39 S. Sakaguchi, Naturally arising CD4(+) regulatory T cells for
immunologic self-tolerance and negative control of
immune responses, Annu. Rev. Immunol., 2004, 22, 531–
562.
40 L. Sun, J. Fu and Y. Zhou, Metabolism controls the balance
of Th17/T-regulatory cells, Front. Immunol., 2019, 8, 1–12.
41 J. H. C. Yiu, B. Dorweiler and C. W. Woo, Interaction
between gut microbiota and toll-like receptor: from immu-
nity to metabolism, J. Mol. Med., 2017, 95, 13–20.
42 H. Echeverry, M. Alizadeh, A. Yitbarek, B. Slominsk and
J. C. Rodriguez-Lecompte, Yeast cell wall polysaccharides
enhanced expression of T helper type 1 and 2 cytokines
profile in chicken B lymphocytes exposed to LPS challenge
and enzyme treatment, Br. Poult. Sci., 2021, 62, 125–130.
43 A. Iwasaki and R. Medzhitov, Regulation of adaptive immu-
nity by the innate immune system, Science, 2010, 327, 291–
295.
44 K. Huang, Y. Yan, D. Chen, Y. Zhao, W. Dong, X. Zeng and
Y. Cao, Ascorbic acid derivative 2-O-β-d-glucopyranosyl-l-
ascorbic acid from the fruit of Lycium barbarum modulates
microbiota in the small intestine and colon and exerts an
immunomodulatory effect on cyclophosphamide-treated
BALB/c mice, J. Agric. Food Chem., 2020, 68, 11128–11143.
45 Q. Li, J. Hu, Q. Nie, X. Chang, Q. Fang, J. Xie, H. Li and
S. Nie, Hypoglycemic mechanism of polysaccharide from
Cyclocarya paliurusleaves in type 2 diabetic rats by gut
microbiota and host metabolism alteration, Sci. China: Life
Sci., 2020, 64, 117–132.
46 K. Zhu, G. Mao, D. Wu, C. Yu, H. Cheng, H. Xiao, X. Ye,
R. J. Linhardt, C. Orfila and S. Chen, Highly branched RG-I
domain enrichment is indispensable for pectin mitigating
against high-fat diet-induced obesity, J. Agric. Food Chem.,
2020, 68, 8688–8701.
47 D. W. Cockburn and N. M. Koropatkin, Polysaccharide
degradation by the intestinal microbiota and its influence
on human health and disease, J. Mol. Biol., 2016, 428,
3230–3252.
Food Funct., 2021, 12, 6271–6282 | 6281

Paper
48 H. Shi, Y. Chang, Y. Gao, X. Wang, X. Chen, Y. Wang and
C. Xue, Dietary fucoidan of Acaudina molpadioides alters gut
microbiota and mitigates intestinal mucosal injury induced
by cyclophosphamide, Food Funct., 2017, 8(9), 3383–3393.
49 W. Huo, Z. Feng, S. Hu, L. Cui, T. Qiao, L. Dai, P. Qi,
L. Zhang, Y. Liu and J. Li, Effects of polysaccharides from
wild morels on immune response and gut microbiota com-
position in non-treated and cyclophosphamide-treated
mice, Food Funct., 2020, 11, 4291–4303.
50 I. Lagkouvardos, T. R. Leshker, T. C. A. Hitch,
E. J. C. Galvez, N. Smit, K. Neuhaus, J. Wang, J. F. Baines,
B. Abt, B. Stecher, J. Overmann, T. Strowing and T. Clavel,
Published on 12 May 2021. Downloaded on 9/2/2021 10:14:46 AM.
6282 | Food Funct., 2021, 12, 6271–6282
View Article Online
Food & Function
Sequence and cultivation study of Muribaculaceae reveals
novel species, host preference, and functional potential of
this yet undescribed family, Microbiome, 2019, 7, 1–15.
51 K. L. Ormerod, D. L. A. Wood, N. Lachner, S. L. Gellatly,
J. N. Daly, J. D. Parsons, C. G. O. Dal’Molin,
R. W. Palfreyman, L. K. Nielsen, M. A. Cooper,
M. Morrison, P. M. Hansbro and P. Hugenholtz, Genomic
characterization of the uncultured Bacteroidales family
S24–7 inhabiting the guts of homeothermic animals,
Microbiome, 2016, 4, 1–17.
52 K. M. Maslowski and C. R. Mackay, Diet, gut microbiota
and immune responses, Nat. Immunol., 2011, 12, 5–9.
This journal is © The Royal Society of Chemistry 2021