Molecular Characterization of Fluoroquinolone-Resistant Aeromonas

spp. Isolated from Imported Shrimp

Zakiya Shakir,a Saeed Khan,b Kidon Sung,b Sangeeta Khare,b Ashraf Khan,b Roger Steele,b and Mohamed Nawazb
University of Oklahoma, Norman, Oklahoma, USA,a and Division of Microbiology, U.S. Food and Drug Administration, National Center for Toxicological Research, Jefferson,
Arkansas, USAb

Sixty-three nalidixic acid-resistant Aeromonas sp. isolates were obtained from imported shrimp. Phylogenetic analysis of gyrB
sequences indicated that 18 were A. enteropelogenes, 26 were A. caviae, and 19 were A. sobria. Double missense mutations in the
quinolone resistance-determining region (QRDR) of gyrA at codon 83 (Ser¡Val/Ile) and codon 92 (Leu¡Met) coupled with a
point mutation of parC at codon 80 (Ser¡Ile/Phe) conferred high levels of quinolone resistance in the isolates. A majority of A.
enteropelogenes and A. caviae strains harbored toxin genes, whereas only a few A. sobria strains harbored these genes. The fluo-
roquinolone-resistant Aeromonas spp. exhibited higher cytotoxicity than fluoroquinolone-sensitive, virulent Aeromonas spp. to
rat epithelial cells.

T he United States in 2009 imported 589,670 metric tons of

farmed shrimp worth more than $6 billion from Asia (27).
Copious amounts of antibiotics are used in the shrimp ponds to
stimulate growth and to retard the incidence of diseases caused by
overcrowded, factory farm conditions (4, 5, 9). The indiscrimi-
nate use of these antibiotics may select bacteria resistant to multi-
ple antibiotics, and such bacteria may transfer their antibiotic re-
sistance determinants to pathogenic bacteria (14, 16).
Aeromonads are ubiquitous, psychrophilic, Gram-negative
microbes commonly found in fresh water, estuaries, and other
coastal waters (6, 7, 8). They are known to cause hemorrhagic
septicemia in aquatic organisms. These microbes also cause sev-
eral diseases in penaeid shrimp (5). Antibiotics, such as fluoro-
quinolones, are used to curtail infections (5, 9). However, pro-
longed abuse of antibiotics could result in the selection of
fluoroquinolone-resistant Aeromonas spp. (20). The presence of
Hazelwood, MO) and by fatty acid methyl ester analysis (MIDI,
Newark, DE).
Determination of MICs. The MICs of nalidixic acid and cip-
rofloxacin were determined by the broth dilution method using
Mueller-Hinton broth (15).
PCR amplification and sequencing of gyrB and phylogenetic
data analysis. The gyrB gene was amplified from the template
DNA of all fluoroquinolone-resistant aeromonads by PCR (25,
30). Sequencing reactions were performed on both strands of
DNA after purification of PCR amplicons. After the assembly and
alignment of the contigs, the sequences were finalized and com-
pared with those available in the GenBank database by using NCBI
BLAST to identify the alignment with closely related aeromonads.
The nucleotide sequences were aligned by using ClustalX 2.1, and
the phylogenetic evolutionary tree was constructed by the neigh-
bor-joining method (24) with the MEGA 5.1 program (12).

Downloaded from https://journals.asm.org/journal/aem on 06 September 2023 by 45.236.143.10.

fluoroquinolone-resistant aeromonads in shrimp could pose pub-
lic health concerns because these bacteria are associated with out-
breaks of human infectious diseases in immunocompromised pa-
tients (9, 29). Quinolones are the drugs of choice for the treatment
of Aeromonas-induced infections (11). Thus, U.S. regulatory
agencies, such as the FDA and CDC (28), want to limit the prev-
alence of fluoroquinolone-resistant bacteria in food-producing
animals to protect the efficacy of the drugs. Since little informa-
tion is available on the prevalence of fluoroquinolone-resistant
aeromonads in imported shrimp, we decided to investigate the
prevalence of fluoroquinolone-resistant Aeromonas spp. and the
mechanism of resistance in these bacteria to the antibiotic. We
report here for the first time that imported shrimp may be a res-
ervoir of virulent, fluoroquinolone-resistant strains of A. entero-
pelogenes, A. caviae, and A. sobria.
Isolation, characterization, and identification of bacteria.
Bacteria were isolated from frozen shrimp (Penaeus monodon)
imported from Thailand. Typically, 2 g of thawed shrimp sample
was enriched for 6 h in alkaline peptone medium (pH 8.0) sup-
plemented with 30 ␮g/ml of ampicillin and nalidixic acid. En-
riched samples were streaked on MacConkey agar and incubated
at 37°C overnight. Presumptive positive colonies were biochemi-
cally characterized and identified at the genus level by using the
Vitek GNI⫹ card with VTK-R07-01 software (bioMérieux Vitek,
Primer design and detection of fluoroquinolone resistance
genes by PCR. The presence of qnrAB, gyrAB, and parC was de-
tected in the template DNA by PCR as detailed elsewhere (18).
Detection of mutations in the QRDRs. For detection of muta-
tions in the quinolone resistance-determining regions (QRDRs), pu-
rified target genes (gyrAB and parC) were sequenced with the primers
used for amplification (18).
Detection of toxin genes by PCR. PCR assays for the amplifi-
cation of the aerolysin (aer), cytotoxic enterotoxin (act), and cy-
totonic enterotoxin (ast and alt) genes were performed with the
template DNA of the isolates (17).
Epithelial cell cytotoxicity assay. The cytotoxicities of fluoro-
quinolone-resistant A. enteropelogenes, A. caviae, and A. sobria
strains were compared with those of fluoroquinolone-sensitive
but pathogenic strains of A. hydrophila (ATCC 7966), A. veronii
(ATCC 9071), and A. sobria AS3 (in-house culture). Cytotoxic
Received 2 July 2012 Accepted 17 August 2012
Published ahead of print 24 August 2012
Address correspondence to Mohamed Nawaz, mohamed.nawaz@fda.hhs.gov.
Copyright © 2012, American Society for Microbiology. All Rights Reserved.
doi:10.1128/AEM.02081-12

November 2012 Volume 78 Number 22 Applied and Environmental Microbiology p. 8137– 8141 aem.asm.org 8137
Shakir et al.
FIG 1 Phylogenetic tree based on the gyrB sequence, showing the relationships of select aeromonads. Sequences were finalized and compared with those available
in GenBank database by using NCBI BLAST. Phylogenetic tree was constructed by the neighbor-joining method with the MEGA 5.1 program. Numbers at
branching points represent bootstrap values from 1,000 replicates (only values of ⬎50%).
activities were determined with the lactate dehydrogenase (LDH)
assay using the CytoTox 96 nonradioactive cytotoxicity assay
(Promega, Madison, WI) according to the manufacturer’s in-
structions. Statistical significance was calculated using the un-
paired t test in GraphPad software.
Isolation, characterization, and identification of fluoroquin-
olone-resistant Aeromonas spp. Approximately 317 bacterial
colonies exhibiting typical aeromonad morphological character-
istics were isolated from more than 364 shrimp samples. Sixty-
three of the 317 (ca. 20%) isolates were resistant to nalidixic acid.
Data from the GNI⫹ Vitek system indicated that all 63 isolates
were Aeromonas spp.
PCR amplification, sequencing of gyrB gene, and phyloge-
netic analysis. A 1.2-kb region of the gyrB gene was amplified and
sequenced. The gyrB sequences derived were aligned with those
from reference strains, including A. enteropelogenes AN-35
(AY987508), A. caviae B14 (JQ234886.1), A. hydrophila 2WCL102
(JQ085479), A. veronii PY50 (HQ540320), A. allosaccharophila
JA07 (GU205210), A. jandaei 4pM29 (FJ940783), A. media JHS07
(GU205212), A. schubertii HYB2 (HQ731459), A. popoffii JW08
(GU205208), A. sobria JY081016-1 (GQ232760), A. salmonicida
subsp. smithia JF4097 (FN394064), and A. sharmana DSM
17445T (AM490259), and phylogenetic analysis was undertaken
(25, 30). The gyrB sequences of 18/63 isolates (for example, strains
AH811 and AH519) showed maximum sequence similarity with
those of A. enteropelogenes AN35, and the gyrB sequences of 26/63
(for example, strains AV810 and AV1) had maximum sequence
similarity with a reference strain of A. caviae B14 (Fig. 1). The gyrB
sequences of 19/63 isolates (for example, strain AS110) had the
8138 aem.asm.org
maximum sequence similarity with reference strain A. sobria
JY081016-1 (Fig. 1). All strains were resistant to 64 ␮g/ml of nali-
dixic acid, and eight strains were resistant to ⬎256 ␮g. The MIC
values of ciprofloxacin (0.5 to 128 ␮g/ml) for these eight strains
were determined. All strains were resistant to 4 ␮g, 4/8 strains
Downloaded from https://journals.asm.org/journal/aem on 06 September 2023 by 45.236.143.10.
were resistant to 8 ␮g, and 2/8 strains were resistant to 128 ␮g of
the antibiotic.
Amplification of gyrA, gyrB, parC, qnrA, and qnrB and anal-
ysis of gene sequences. Synthetic oligonucleotide primers (Table
1) specific for the amplification of the 462-bp gyrA, 276-bp gyrB,
and 232-bp parC genes were used to amplify the respective PCR
amplicons from the template DNA of the isolates. Sequence anal-
ysis of the QRDRs of the gyrA and parC amplicons indicated 3
different types of mutations that confer high levels of quinolone
resistance in these isolates (Fig. 2). These three types were (i)
strains of A. enteropelogenes and A. caviae having double point
mutations exclusively in the QRDR of gyrA, (ii) strains of A. en-
teropelogenes and A. caviae having double mutations in gyrA ac-
companied by a point mutation in parC, and (iii) strains of A.
sobria having single point mutations in the QRDRs of gyrA and
parC.
Analysis of the presence of double mutations exclusively in
gyrA indicated a serine residue (S) at position 83 replaced by a
valine (V) and a leucine residue (L) at position 92 replaced by a
methionine (M) (Fig. 2A). In addition, another double mutation
variant in the QRDR of gyrA was also detected. Mutation at posi-
tion 83 resulted in serine replacement by isoleucine, and mutation
at position 92 resulted in the replacement of leucine by methio-
nine (Fig. 2B). Strains of A. enteropelogenes and A. caviae that
Applied and Environmental Microbiology
 Fluoroquinolone-Resistant Aeromonas spp.

TABLE 1 Sequences of oligonucleotide primers used for the detection thermore, fluoroquinolone-resistant A. caviae AV14 had the high-
of virulence genes and fluoroquinolone resistance genes in Aeromonas est cytotoxicity among all the strains that were investigated.
spp. isolated from shrimp The characterization and identification of the members of the
Product genus Aeromonas by conventional biochemical methods is often
Gene size (bp) Primer direction,a sequence Tm (°C)b inaccurate and controversial, warranting the use of molecular
aer 431 F, CCTATGGCCTGAGCGAGAAG 63 techniques that provide unambiguous, precise diagnosis (25). Re-
R, CCAGTTCCAGTCCCACCACT cently, molecular biology methods have been used in the identifi-
act 231 F, AGAAGGTGACCACCACCAAGAACA 65 cation of aeromonads. The amplification and sequencing of the
R, AACTGACATCGGCCTTGAACTC gyrB gene (encoding the B-subunit of DNA gyrase, a type II DNA
ast 331 F, TCTCCATGCTTCCCTTCCACT 63 topoisomerase) has proved to be an accurate, unequivocal molec-
R, GTGTAGGGATTGAAGAAGCCG
ular chronometer in the identification, strain differentiation, and
alt 442 F, TGACCCAGTCCTGGCACGGC 64
R, GGTGATCGATCACCACCAGC
phylogenetic analysis of the genus Aeromonas and other Gram-
gyrA 462 F, CGACCTTGCGAGAGAAAT 59 negative bacteria (25, 30, 31). Three different species of aeromon-
R, GTTCCATCAGCCCTTCAA ads were identified among 63 fluoroquinolone-resistant bacteria
gyrB 276 F, GCGCGTGAGATGACCCGCCGT 56 by the gyrB gene sequence analysis. Eighteen of the 63 isolates were
R, CTGGCGGTAGAAGAAGGTCAG identified as A. enteropelogenes, 26/63 as A. caviae, and 19/63 as A.
parC 232 F, CTTTGCGCTACATGAATTTA 64 sobria. To the best of our knowledge, little information is available
R, CAGGTTATGCGGTGGAATAT on the isolation and identification of A. enteropelogenes from
qnrA 580 F, AGAGGATTTCTCACGCCAGG 62 food-producing ecosystems. The identification of this rarely re-
R, TGCCAGGCACAGATCTTGAC ported strain indicates the usefulness of gyrB sequencing in un-
qnrB 264 F, GGMATHGAAATTCGCCACTG 60
equivocal identification of aeromonads.
R, TTTGCYGYYCGCCAGTCGAA
a
A majority of mutations described to date in Gram-negative
F, forward; R, reverse.
b bacteria have been found within the N termini of the gyrA, gyrB,
Tm, melting temperature.
and parC proteins, between codons 83 and 87 in the QRDRs (1, 3,
10, 18, 19, 22, 23). Mutations at these locations alter the binding of
quinolones to the active site and lead to reduced susceptibility (22,
harbored the above-described double mutations also contained a 23). However, sequence analysis of all highly quinolone-resistant
point mutation in parC. The point mutation resulted in the re- strains of Aeromonas spp. in the present study indicated amino
placement of serine by isoleucine at position 80 in parC amplicons acid changes in the GyrA subunit, at positions 83 and 92. The
(Fig. 2D). exclusive double missense mutations in the gyrA QRDR, indepen-
Amplification and analysis of gyrA from strains of A. sobria dent of mutation in parC, may be an alternate mechanism in-
indicated only a single point mutation. The mutation resulted in volved in the regulation of high-level quinolone resistance in aero-
the replacement of serine by isoleucine at position 83 (Fig. 2C). monads. Double missense mutations in the gyrA QRDR of
These strains also had a point mutation at position 80 (Ser¡Phe) Pseudomonas (1) and Escherichia coli (3, 10), particularly at posi-
in parC amplicons (Fig. 2E). No mutations were detected in gyrB, tions 83 and 87, are associated with increased levels of quinolone
qnrA, and qnrB. resistance.

Downloaded from https://journals.asm.org/journal/aem on 06 September 2023 by 45.236.143.10.

Amplification of toxin genes (aer, act, ast, and alt). The PCR Reports have indicated the necessity of concurrent point mu-
protocol (Table 1) unambiguously amplified the aer gene (Fig. tations in both gyrA and parC for high-level quinolone resistance
3A) from the template DNA of 17/18 (94.0%) A. enteropelogenes in several clinical and environmental strains of aeromonads (19,
strains, 24/26 (92.0%) A. caviae strains, and 3/19 (15.0%) A. sobria 23). These isolates had double mutations at codon 83 (Ser¡Ile/
strains. A pair of synthetic act-specific primers (Table 1) amplified
a 231-bp PCR amplicon from a majority of A. enteropelogenes
strains (16/18, 88.0%), 92.0% of A. caviae isolates (Fig. 3B), and
7/19 (36.0%) A. sobria strains. Template DNA from all aer-posi-
tive A. enteropelogenes also contained the act gene. However, only
14 of the 26 strains (54.0%) of A. caviae harbored the act gene.
None of the A. sobria isolates contained both aer and act genes.
Oligonucleotide primers failed to amplify the two cytotoxic en-
terotoxin genes (331-bp ast and 442-bp alt) from the template
DNA of any of the 63 isolates.
Determination of cytotoxicity of fluoroquinolone-resistant
aeromonads. Data from our cytotoxicity assays indicate that both
fluoroquinolone-resistant and fluoroquinolone-sensitive strains
of Aeromonas spp. caused an increase in LDH release in the culture
supernatant after 24 h postinfection, indicating that they were
cytotoxic to the rat epithelial cells (Fig. 4). However, the cytotox-
icity of the fluoroquinolone-resistant Aeromonas spp. showed sta-
tistically significant higher LDH activity (P ⬍ 0.03) than the fluo-
roquinolone-sensitive but virulent strains of A. veronii ATCC FIG 2 Sequence analysis of mutations in quinolone resistance-determining
9071, A. hydrophila ATCC 7966, and A. sobria AS3 (Fig. 4). Fur- regions (QRDRs) of Aeromonas spp.

November 2012 Volume 78 Number 22 aem.asm.org 8139

Shakir et al.
FIG 3 PCR amplification of virulence genes (aer and act) from the template DNA of fluoroquinolone-resistant aeromonads isolated from imported shrimp. (A)
Lane 1, 100-bp molecular size marker; lane 2, PCR negative; lanes 3 to 7, 431-bp aerolysin (aer) amplified from the template DNA of the isolates. (B) PCR
amplification of the cytotoxic enterotoxin (act). Lane 1, 100-bp molecular size marker; lane 3, PCR negative; lanes 2 and 4 to 7, 231-bp act gene amplified from
the template DNA.
Arg) of the gyrA QRDR, coupled with a missense mutation at
position 80 (Ser¡Ile/Phe) in the parC QRDR. Contrarily, our
results indicate unique double missense mutations in gyrA at
codon 83 (Ser¡Ile) and codon 92 (Leu¡Met) coupled with a
point mutation in parC at position 80 (Ser¡Ile/Phe). It is possible
that these mutations could also be a vital, alternate mechanism
involved in regulating high levels of quinolone resistance in aero-
monads. In addition, to our knowledge, the point mutation at
position 92 (Leu¡Met) is a novel, unique mutation recorded for
FIG 4 Cytotoxic activities of Aeromonas spp. isolated from imported shrimp.
LDH activities were estimated for the fluoroquinolone-resistant Aeromonas
spp. isolated from imported shrimp and compared with the activities of fluo-
roquinolone-sensitive but virulent strains A. veronii ATCC 9071, A. hydrophila
ATCC 7966, and A. sobria AS3 (in-house strain). The LDH assay was per-
formed with a CytoTox 96 nonradioactive kit. Error bars show standard devi-
ations.
8140 aem.asm.org
the first time in aeromonads. It is possible that mutations at codon
Ser83 may confer high levels of quinolone resistance without the
necessity of concurrent point mutations in parC in aeromonads
isolated from imported shrimp.
The pathogenicity of Aeromonas spp. is attributed to various
putative virulence genes (6, 7, 21). The mechanisms of pathogen-
esis are complex and multifactorial. Aeromonads are known to
produce at least four different kinds of enterotoxins (6, 7, 17), and
Downloaded from https://journals.asm.org/journal/aem on 06 September 2023 by 45.236.143.10.
many of these putative virulence genes exhibit hemolytic, cyto-
toxic, and enterotoxic activities (7). However, the occurrence and
prevalence of these toxin genes in aeromonads isolated from dif-
ferent ecosystems are ambiguous. Chacon et al. (6) indicated that
65.0% of the aeromonads isolated from clinical and environmen-
tal samples harbored the aer and act genes. All freshwater fish
isolates of A. hydrophila harbor the aer gene, but strains of A.
veronii do not contain the gene (8). However, Nawaz et al. (17)
reported that template DNA from 96.0% of the A. veronii strains
isolated from catfish harbored the putative aerolysin gene. How-
ever, very little is known about the virulence mechanisms in A.
enteropelogenes and A. caviae. Our results indicate that the major-
ity of the fluoroquinolone-resistant A. enteropelogenes and A.
caviae strains and a few of the A. sobria isolates from imported
shrimp are putatively virulent because they harbored aer and act
genes.
The importance of various types of secretion systems, as well as
virulence factors, in the cytotoxicity caused by Aeromonas spp. has
been the focus of research for the development of new therapeutic
agents (2). Earlier studies have demonstrated that a type 3 secre-
tion system (T3SS) is required for A. hydrophila pathogenesis. Yu
et al. showed that insertional inactivation of two of the T3SS genes
(aopB and aopD) led to decreased cytotoxicity in carp epithelial
cells (32). Another mechanism of pathogenesis includes a require-
Applied and Environmental Microbiology

ment of bacterium-host cell interaction for the type 6 secretion
system (T6SS) to induce cytotoxicity in eukaryotic cells. Suarez et
al. delineated the importance of a T6SS effector protein, VgrG1,
from A. hydrophila that induces host cell toxicity by ADP ribosy-
lation of actin (26). Another study demonstrated the importance
of T2SS in A. veronii (13). Results from our study indicate that the
mutations in the gyrA and parC genes that are components of
T3SS may play a vital role in increased cytotoxicity of the bacteria.
However, further studies are needed to confirm the role of these
mutations in increased cytotoxicity of fluoroquinolone-resistant
strains.
ACKNOWLEDGMENTS
We thank Carl E. Cerniglia, J. B. Sutherland, and Steve Foley for critical
review of the manuscript.
This work was supported by the National Center for Toxicological
Research, U.S. Food and Drug Administration.
The views presented here do not necessarily reflect those of the FDA.
REFERENCES
1. Akasaka T, Tanaka M, Yamaguchi A, Sato K. 2001. Type II topoisom-
erase mutations in fluoroquinolone-resistant clinical strains of Pseudomo-
nas aeruginosa isolated in 1998 and 1999: role of target enzyme in mech-
anism of fluoroquinolone resistance. Antimicrob. Agents Chemother. 45:
2263–2268.
2. Aliprantis AO, et al. 1999. Cell activation and apoptosis by bacterial
lipoproteins through Toll-like receptor-2. Science 285:736 –739.
3. Bagel S, Hullen V, Wiedemann B, Heisig P. 1999. Impact of gyrA and
parC mutations on quinolone resistance, doubling time, and supercoiling
degree of Escherichia coli. Antimicrob. Agents Chemother. 43:868 – 875.
4. Biao X, Kaijin Y. 2007. Shrimp farming in China: operating characteris-
tics, environmental impact and perspectives. Ocean Coastal Manag. 50:
538 –550.
5. Bondad-Reantaso MG, et al. 2005. Disease and health management in
Asian aquaculture. Vet. Parasitol. 132:249 –272.
6. Chacon MR, Figueras MJ, Castro-Escarpulli G, Soler L, Guarro J. 2003.
Distribution of virulence genes in clinical and virulence genes of Aeromo-
nas spp. Antonie Van Leeuwenhoek 84:269 –278.
7. Chopra AK, Houston CW. 1999. Enterotoxins in Aeromonas-associated
gastroenteritis. Microbes Infect. 1:1129 –1137.
8. Gonzalez-Serrano CJ, Santos JA, Garcia-Lopez ML, Otera A. 2002.
Virulence markers in Aeromonas hydrophila and Aeromonas veronii biovar
sobria isolates from freshwater fish and from a diarrhoea case. J. Appl.
Microbiol. 93:414 – 419.
9. Holstrom K, et al. 2003. Antibiotic use in shrimp farming and implica-
tions for environmental impacts and human health. Int. J. Food Sci. Tech-
nol. 38:255–266.
10. Hopkins KL, Davies RH, Threlfall EJ. 2005. Mechanisms of quinolone
resistance in Escherichia coli and Salmonella: recent developments. Int. J.
Antimicrob. Agents 25:358 –373.
11. Jones BL, Wilcox MH. 1995. Aeromonas infections and their treatment. J.
Antimicrob. Chemother. 35:453– 461.
November 2012 Volume 78 Number 22
Fluoroquinolone-Resistant Aeromonas spp.
12. Kumar S, Tamura K, Jakobsen IB, Nei M. 2001. MEGA2: Molecular
Evolutionary Genetic Analysis software. Bioinformatics 50:602– 612.
13. Maltz M, Graf J. 2011. The type II secretion system is essential for eryth-
rocyte lysis and gut colonization by the leech digestive tract symbiont
Aeromonas veronii. Appl. Environ. Microbiol. 77:597– 603.
14. Midtved T, Lingaas E. 1992. Putative public health risks of antibiotic
resistance development in aquatic bacteria, p 302–314. In Michel C, Al-
derman D. (ed), Chemotherapy in aquaculture: from theory to reality.
Office International des Epizooties, Paris, France.
15. National Committee for Clinical Standards. 2002. Development of in
vitro susceptibility testing criteria and quality control parameters for vet-
erinary antimicrobial agents. Approved guideline M37-A2. National
Committee for Clinical Standards, Wayne, PA.
16. Nawaz MS, et al. 2001. Human health impact and regulatory issues
involving antimicrobial resistance in the food animal production environ-
ment. Regul. Res. Perspect. 1:1– 8.
17. Nawaz M, et al. 2010. Detection and characterization of virulence genes
and integrons in Aeromonas veronii isolated from catfish. Food Microbiol.
27:327–331.
18. Nawaz M, et al. 2012. Isolation and characterization of multidrug resis-
tant Klebsiella spp. isolated from shrimp imported from Thailand. Int. J.
Food Microbiol. 155:179 –184.
19. Oppegaard H, Sorum H. 1994. gyrA mutations in quinolone-resistant
isolates of the fish pathogen Aeromonas salmonicida. Antimicrob. Agents
Chemother. 38:2460 –2464.
20. Park ED, Lightner DV, Park DL. 1994. Antimicrobials in shrimp aqua-
culture in United States: regulatory status and safety concerns. Rev. Envi-
ron. Contam. Toxicol. 138:1–20.
21. Pemberton JM, Kidd SP, Schmidt R. 1997. Secreted enzymes of Aero-
monas. FEMS Microbiol. Lett. 152:1–10.
22. Poole K. 2000. Efflux-mediated resistance to fluoroquinolones in Gram-
negative bacteria. Antimicrob. Agent Chemother. 44:2233–2241.
23. Ruiz J. 2003. Mechanism of resistance to quinolones: target alteration,
decreased accumulation and DNA gyrase protection. J. Antimicrob. Che-
mother. 51:1109 –1117.
24. Saitou N, Nei M. 1987. The neighbor-joining method: a new method for
reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406 – 425.
25. Soler L, et al. 2004. Phylogenetic analysis of the genus Aeromonas based
on two housekeeping genes. Int. J. Sys. Evol. Microbiol. 54:1511–1519.
26. Suarez G, et al. 2010. A type IV secretion system effector protein, VgrG1,
from Aeromonas hydrophila that induces host cell toxicity by ADP ribosy-
lation of actin. J. Bacteriol. 192:155–168.
27. US Department of Agriculture. 2010. US shrimp imports, value by se-
Downloaded from https://journals.asm.org/journal/aem on 06 September 2023 by 45.236.143.10.
lected sources. http://www.ers.usda.gov/datafiles/Aquaculture/Trade
/Shrimp_V_YearlyFull.xls.
28. US Food and Drug Administration. 1997. Fluoroquinolone and glyco-
peptides— order of prohibition. Fed. Regist. 62:27944 –27947.
29. Wilcox MH, Cook AM, Eley A, Spencer RC. 1992. Aeromonas spp. as a
potential cause of diarrhea in children. J. Clin. Pathol. 45:95–97.
30. Yamamoto S, et al. 2000. Phylogeny of the genus Pseudomonas: intrage-
neric structure reconstructed from the nucleotide sequences of gyrB and
rpoD genes. Microbiology 146:2385–2394.
31. Yanez MA, Catalan V, Apraiz D, Figueras MJ, Martinez-Murcia AJ.
2003. Phylogenetic analysis of members of the genus Aeromonas based on
gyrB gene sequences. Int. J. Syst. Evol. Microbiol. 53:875– 883.
32. Yu HB, et al. 2004. A type III secretion system required for Aeromonas
hydrophila AH-1 pathogenesis. Infect. Immun. 72:1248 –1256.
aem.asm.org 8141