Aquaculture 560 (2022) 738612

Contents lists available at ScienceDirect

Aquaculture
journal homepage: www.elsevier.com/locate/aquaculture

Role of vitamin a in the ovary development for female Eriocheir sinensis in

the gonadal development stage
Qincheng Huang a, Xiaodan Wang a, *, Xianyong Bu a, Ying Song a, Fenglu Han a, Zhideng Lin a,
Fang Qiao a, Qingchao Shi b, Jianguang Qin c, Liqiao Chen a, *
a
Laboratory of Aquaculture Nutrition and Environmental Health, School of Life Sciences, East China Normal University, Shanghai 200241, PR China
b
Key Laboratory of Sichuan Province for Fishes Conservation and Utilization in the Upper Reaches of the Yangtze River, Neijiang Normal University, Sichuan 641100,
PR China
c
College of Science and Engineering, Flinders University, Adelaide, SA 5001, Australia

A R T I C L E I N F O A B S T R A C T

Keywords: This study aimed to test the regulatory role of vitamin A in the vitellogenesis of female Eriocheir sinensis. Three
Retinoid X receptor diets containing a gradient of vitamin A level (0-control, 8000 and 30,000 IU/kg) were fed to female crabs (74.44
Vitellogenin ± 0.81 g) for 90 days. Compared to the vitamin A devoid group, 8000 IU/kg of dietary vitamin A increased the
Gonadosomatic index
content of hemolymph ecdysone, vitellogenin levels and the gonadosomatic index. The 8000 IU/kg vitamin A
Lipid metabolism
Ecdysone receptor
level induced vitellogenin (vtg) gene expression in the ovary and hepatopancreas. The vtg gene expression was
induced by upregulating retinoid x receptor, ecdysone receptor, ecdysteroid responsive gene E75 and vitellogenin
receptor. Lipid accumulation was also improved for ovarian development. Hepatosomatic index and lipid accu­
mulation in the hepatopancreas and ovary were increased by 8000 IU/kg vitamin A supplement relative to the
control. The 8000 IU/kg vitamin A diet upregulated the gene expressions in lipid uptake, synthesis and export,
but downregulated the genes related to catabolism in the hepatopancreas. Only genes related to lipid uptake
were positively influenced by 8000 IU/kg of vitamin A in the ovary. Furthermore, proper vitamin A could
improve the health of crabs by enhancing their antioxidant capacity and immunity. In contrast, a negative effect
on hepatopancreas antioxidant ability, lipid metabolism and vitellogenesis was found due to an excess vitamin A
supplement (30,000 IU/kg) compared to 8000 IU/kg of dietary vitamin A. This study indicates the necessity of
vitamin A supplements in formulated diets because they can optimize lipid metabolism and promote vitello­
genesis during ovarian development.

1. Introduction
Female reproduction is an important physiological process for spe­
cies dispersion and continuation (Miao et al., 2021). Yolk proteins,
whose common form is vitellin, are the source of the most important
nutrients for embryonic development (Chen et al., 2004). Vitellogenin
(vtg) transported from the hemolymph to oocytes, is the precursor
substance of vitellin, and its synthesis could be considered an indicator
of female ovarian development (Lin et al., 2020; Tsukimura, 2001). In
the crustacean, the ovaries are also important edible portions in crabs
and have high nutritional value for humans (Wu et al., 2017). Many
researchers have investigated regulatory ways affecting ovary devel­
opment in crustaceans (Girish et al., 2018; Gong et al., 2016; Klueb­
soongnoen et al., 2021; Lin et al., 2020). The retinoid X receptor (RXR)
was a critical nuclear hormone receptor, and it has been reported that
RXR played a positive role in the expression of vtg in Scylla para­
mamosain (Gong et al., 2016), Penaeus monodon (Kluebsoongnoen et al.,
2021) and Carcinus maenas (Nagaraju et al., 2011). In Eriocheir sinensis
(E. sinensis), the expression level of ecdysone receptor (ECR) showed
high transcript abundance during the ovarian development stage (Su
et al., 2020). Generally, the RXR can dimerize with ECR as the cognate
transcription factor, which would regulate downstream genes contain­
ing response elements in crustaceans (Chung et al., 1998; Shyamal et al.,
2015). In the insect Aedes aegypti, the RXR could form a heterodimer
with ECR and then directly bound “ecdysteroid response element” in the
5´-regulatory region of vtg (Martı́n et al., 2001). Similarly, Kluebsoong­
noen et al. (2021) reported that RXR could regulate the transcription of
vtg through retinoic acid response elements in Penaeus monodon. As the

* Correspondig authors.
E-mail addresses: xdwang@bio.ecnu.edu.cn (X. Wang), lqchen@bio.ecnu.edu.cn (L. Chen).

https://doi.org/10.1016/j.aquaculture.2022.738612
Received 24 April 2022; Received in revised form 12 June 2022; Accepted 10 July 2022
Available online 13 July 2022
0044-8486/© 2022 Published by Elsevier B.V.
Q. Huang et al. Aquaculture 560 (2022) 738612

ligand of RXR, the role of retinoic acid in gametogenesis and gonad Table 1
development has been reported in Dicentrarchus labrax (Medina et al., The feed formula (g/kg dry basis) and proximate composition (% dry weight) of
2019), Silurus meridionalis (Li et al., 2016) and Danio rerio (Alsop et al., the three experimental diets.
2008; Sharma et al., 2005). Vitamin A is the generic descriptor of all Items Dietary vitamin A level (IU/kg)
derivatives (retinyl esters, retinol and retinal), which possess the bio­ 0 8000 30,000
logical activity of all-trans retinol (Stephensen, 2001; Zile, 2001). In
Vitamin-free casein1 360 360 360
vertebrate or invertebrate, the function of vitamin A in physiology was
Gelatin 90 90 90
mainly realized through the metabolite-retinoic acid (Heyman et al., Corn starch 250 250 250
1992). Thus, vitamin A might influence ovary development through Soybean lecithin oil 25 25 25
RXR/ECR-vtg. However, the role of dietary vitamin A supplementation Cholesterol 5 5 5
in the vitellogenesis of aquatic animals was rarely reported. Soybean oil 80 80 80
Choline chloride 5 5 5
Besides the potential role in ovary development, vitamin A also Vitamix mix1 40 40 40
regulates lipid metabolism through the nuclear receptor RXR (Bonet Mineral mix2 20 20 20
et al., 2012). The lipid is the vitellin composition and is a vital nutrient Calcium dihydrogen phosphate 10 10 10
for female gonads development because it offers essential fatty acids and Attractant 30 30 30
Antioxidant 1 1 1
energy sources (Du et al., 2018). In the stage of ovary development of
Carboxy methyl cellulose 30 30 30
adult female crabs, lipids were usually accumulated in tissue and Microcrystalline Cellulose 54 52.4 48
transported from the hepatopancreas to gonads (Bo et al., 2021; Lin Vitamin A dilution (5000 IU/g)3 0 1.6 6
et al., 2020; Zhou et al., 2017). Therefore, proper inclusion of dietary Total (g) 1000 1000 1000
lipid would promote the vtg assimilation in the ovary and improve the Proximate composition (%)
Moisture 11.96 11.70 11.34
fecundity, production and quality of egg (Coldebella et al., 2013; Du Crude protein 41.65 41.62 41.72
et al., 2018). Thus, regulation of lipid metabolism might influence ovary Crude lipid 11.49 11.02 11.92
development. Our recent research has demonstrated that vitamin A Crude ash 4.64 4.49 4.50
could reduce lipid accumulation in the whole body and hepatopancreas Detected vitamin A content (IU/kg) ND4 7878 29,420
and improve lipid utilization in juvenile E. sinensis (Huang et al., 2022a). 1
Vitamin mix (g per 100 g premix): biotin, 0.005; cholecalciferol, 0.0075;
However, the regulating mechanisms of lipid metabolism between ju­ cyanocobalamin, 0.01; folic acid, 0.025; menadione, 0.05; riboflavin, 0.0625;
venile and adult female crabs might differ due to different physiological thiamine mononitrate, 0.15; pyridoxine hydrochloride, 0.225; niacin, 0.3;
characteristics (Lin et al., 2020). Therefore, knowledge of the role of D‑calcium pantothenate, 0.3; ascorbic acid, 0.5 g; tocopheryl acetate, 0.5;
vitamin A in lipid metabolism is vital for ovary development. Further­ inositol, 1; (α-cellulose as fillers).
2
more, it is necessary to study the regulatory role of vitamin A in the lipid Mineral mix (g per 100 g premix): CaCO3, 10.5; Ca(H2PO4)2, 26.5; NaH2­
metabolism of female crabs in ovary development. PO4⋅H2O, 10; KH2PO4, 21.5; KCl, 2.8; MgSO4⋅7H2O, 10; MnSO4⋅6H2O, 0.143;
Fe-citrate, 1; CuCl2⋅2H2O, 0.015; AlCl3⋅H2O, 0.024; ZnSO4⋅7H2O, 0.476 g;
Generally, the ovaries of female crustaceans rapidly develop when
CoCl2⋅6H2O, 0.14; KI, 0.023 (α-cellulose as fillers).
finishing the molting at puberty (Wu et al., 2018; Wu et al., 2020), and at 3
Power of vitamin A (retinyl esters, Minsheng Biotechnology Co. Ltd., Zhe­
this point, exogenous nutrient intake is required and accumulated for jiang, China).
normal reproduction and offspring quality (Maneii et al., 2019; Sui 4
ND: Below the detected range.
et al., 2011). Therefore, it is necessary to develop cost-effective and
nutritionally comprehensive complete feeds for the ovary development addition, the prepared vitamin A and choline chloride were dissolved in
of female crustaceans. In contrast, limited knowledge of the regulatory oils and water. The oils and water were added to the mixed ingredients
role of dietary nutrients in the phase of ovaries development was re­ in a tub, and then the homogeneous mixture was processed using ma­
ported in the crustacean, especially before reproductive molting (Lin chine F-26 II (South China University of Technology, Guangdong,
et al., 2020). The E. sinensis, a typical species in studying ovary devel­ China), and finally, the product was finished (pellets, 2 mm diameter).
opment of crustaceans, spread over Asia, Europe and California, has The three diet groups were dried by blowing air (25 ◦ C) until the
been widely farmed in China and is appreciated by consumers (Chang moisture content was under 10 % and finally kept in different marked
et al., 2017; Cheng et al., 2008; Rudnick et al., 2003). The annual output plastic bags in a − 20 ◦ C refrigerator.
has increased from 2.0 hundred thousand tons in 2000 to 7.7 in 2020
(China Fishery Statistical Yearbook, 2000, 2021). The present study 2.2. Farmed experiment
aimed to evaluate the role of dietary vitamin A in the ovary development
and lipid metabolism of female E. sinensis. Our study will help build The farmed experiment was performed at the Zhejiang Institute of
nutritionally complete feeds and improve nutritional value and quality Freshwater Fisheries (Huzhou, China) from August to December 2020.
of female crabs. The female crabs before pubertal molting were obtained from a local
farmer in Changxing (Huzhou, China). For one week before the formal
2. Materials and methods feeding experiment, crabs were bred in several size-identical square
pools (200 cm L × 170 W × 60H) to adjust to experimental diets and
2.1. Experimental diets indoor culture conditions. Then 144 female crabs (74.44 ± 0.81 g,
before reproductive molting) were randomly allotted into 144 rectan­
The basal diet formula is given in Table 1. Three isonitrogenous and gular plastic baskets (36 cm L × 26 cm W × 20 cm H), and then the
isoenergetic diets (40% designed protein and 11% designed lipid level) baskets were divided into three groups with 48 crabs each group. Each
were made containing vitamin A concentrations of 0 (the control), 8000 crab was regarded as one repetition. The three groups of crabs were fed
(medium level), and 30,000 IU/kg (high level) (0, 7878 and 29,420 IU/ the corresponding diets at 2% of their wet body weight at 19:30 h once
kg, measured concentration) based on Huang et al. (2022a) with the daily during the 3-month feeding trial. The superfluous feeds and feces
substitution of microcrystalline cellulose. The main protein sources were were removed every morning, and 2/3 of the water volume for each
casein (vitamin A-free) and gelatin, and the main oil sources were soy­ group was replaced by clean water. The parameter of the aquatic water
bean lecithin oil, hand-worked oil mixture (volume ratio, perilla oil: was as follows. Temperature: 20–27 ◦ C, pH: 7.6–8.4, dissolved oxygen
soybean oil = 1:1), and cholesterol. All raw materials were calculated level higher than 7.0 mg/L and ammonia nitrogen below 0.05 mg/L.
and weighed according to the formula after passing through the strainer
(60-mesh) and thoroughly mixed in a Hobart-type mixer. Before the

2
Q. Huang et al.
2.3. Method of sampling
The protocols for animals were conducted under the guidance of the
Care and Use of Laboratory Animals in China (20201001). At the end of
the feeding trial, crabs of each pool were fasted for 24 h. After being
anaesthetized with ice, the hepatopancreas and ovaries of 8 crabs per
group were collected and weighed to calculate the hepatosomatic index
(HSI) and gonadosomatic index (GSI) and then were stored at − 20 ◦ C for
determination of lipid content and composition. Hepatopancreas and
ovaries of 8 crabs were collected, frozen in liquid nitrogen, and stored at
− 80 ◦ C for analysis of enzymatic activities and gene expressions. Ovaries
from 5 crabs per group were sampled for histological analysis. Hemo­
lymph was taken from the leg joints of 8 crabs per group using a ster­
ilized syringe (1 ml). After being centrifuged, the supernatant was
obtained and used to detect biochemical indices. The pretreatment of
hemolymph samples before detection was the same as Lin et al. (2020).
The whole body of 4 crabs per group was kept at − 20 ◦ C for measure­
ment of vitamin A deposition.
2.4. Biochemical analysis
The hepatopancreas was homogenized in a centrifuge tube (1.5 ml,
w: v = 1:9) using physiological saline (0.85%) at 4 ◦ C and then centri­
fuged to collect the supernatant for enzymatic activities detection. The
following indices were measured by commercial kits (Nanjing Jiancheng
Bioengineering Institute, China) complied with the manufacturer's in­
structions: malondialdehyde (MDA, method of TBA at 532 nm) content,
total antioxidant capacity (T-AOC, method of ABTS at 405 nm), gluta­
thione peroxidase (GPx, colorimetric method at 412 nm), and superox­
ide dismutase (SOD, method of WST-1 at 450 nm) activities; alkaline
phosphatase (AKP, microplate method at 520 nm) and acid phosphatase
(ACP, microplate method at 520 nm) activities; triglyceride content (TG,
method of GPO-PAP at 510 nm), cholesterol content (TC, method of
GPO-PAP at 510 nm), free fatty acid content (NEFA, enzymic method at
546 nm), high-density lipoprotein (HDL–C, direct method at 546 nm),
low-density lipoprotein (LDL-C, direct method at 546 nm). Elisa kits
specific for crabs (Shanghai Enzyme Biotechnology Company, China)
were used to determine the serum ecdysterone (Cat. # ml420078)
content, vtg (Cat. # ml215719) content, and very-low-density lipopro­
tein (VLDL, Cat. # ml226119-C). The high-performance liquid chro­
matography (HPLC) method was applied to determine vitamin A content
in the whole body and diets, and specific parameters consulted Huang
et al. (2022a).
2.5. Lipid extraction and analysis
The lipid extraction and composition analysis methods were the
same as the previous study in our lab (Lin et al., 2020). Total lipid in
hepatopancreas or ovary was sufficiently extracted using chloroform-
methanol (2:1, v/v) mixture for 24 h. The KCl solution (0.37 mol/l)
was used for delamination before centrifuging at 2000 rpm for 10 min.
The volatile organic residue faded away through a vacuum drying oven
(DZF-6050, Jinghong, Ltd., China), and finally, the liquid at the bottom
was obtained and weighed. The thin-layer chromatography (TLC)
method was used to check the total content of neutral and polar lipids
according to a previous study in our lab (Lin et al., 2020). Neutral lipid
content is the sum of triglyceride, cholesterol, diacylglycerol and
monoglyceride. Polar lipid mainly includes phosphatidylethanolamine,
phosphatidylinositol, phosphatidylcholine and lysophosphatidylcho­
line. The lipids were first dissolved in chloroform-methanol (2:1, v/v)
and then dotted on a silica gel plate (20 cm × 20 cm). Two solvent
systems were used to separate different lipid classes on the silica gel
plate. The first procedure was for polar lipid isolation by 0.25% KCl,
methanol, isopropyl acid chloroform, and methyl acetate (9: 10: 25: 25:
25 by volume), lasting for 100 min. After being dried at 50 ◦ C for 30 min,
neutral lipid was separated by acetic acid, ether, and isohexane (1.5: 25:
3
Aquaculture 560 (2022) 738612
80 by volume) for 150 min. At last, the silica gel plate was dyed with
iodine for another 20 min and quantified by a thin-layer chromatog­
raphy scanner (KH-3000, Kezhe Biotechnology Company, China).
2.6. Genes expression
The total RNA in the hepatopancreas or ovaries of crabs was
extracted through Trizol reagent (Invitrogen, USA). The quality and
quantity of the RNA were controlled through a spectrophotometer
(NanoDrop 2000, USA) and the agarose gel electrophoresis. The reagent
kit-Prime Script™ RT (Takara, USA) was applied to the reverse tran­
scription of RNA into cDNA. The cDNA was used for quantitative real-
time PCR, which was carried out in the CFX96 Real-Time PCR system
(Bio-rad, Richmond) with a 20 μl solution system (Vazyme Biotech Co.,
Ltd., China): SYBR qPCR reaction reagent-10 μl, forward primers (10
mmol/l)-0.4 μl, reverse primers (10 mmol/l)-0.4 μl, cDNA template-1 μl,
and DEPC-water-8.2 μl. The reaction procedure was the same as previ­
ous study (Huang et al., 2022a). Genes of β-actin and S27 (ubiquitin/
ribosomal S27 fusion protein) were the housekeeping genes, and the
relative gene expression was determined using the method of 2-△△Ct.
The information on gene primers detected in the present study is given
in Table 2. The amplification efficiency of target genes was determined
by the formula of E = 10(− 1/Slope) – 1 and was between 90 and 101%.
2.7. Histological analysis
Paraformaldehyde (4%) solution was employed to fix the ovary tis­
sue. And then, ethanol, toluene and xylene were used for dehydration,
rinsing and equilibrium, respectively. After being embedded in paraffin
and cut by a rotary microtome, ovary slices (thickness, 5-μm) were made
and stained with hematoxylin and eosin, and finally photographed
through the microscope (BX51, Japan). Average numbers of yolk gran­
ules and the diameter of oocytes on the slices were analysed using the
software of ImageJ.
2.8. Calculations and statistical analysis
The computational formulas mentioned above were as follows:
100 × wet hepatopancreas weight
HSI (%) =
wet body weight
100 × wet gonad weight
GSI (%) =
wet body weight
The homogeneity test of variances was executed before one-way
ANOVA analysis, followed by Duncan's multiple range test through
SPSS 20.0 (Chicago, IL, USA). Data were shown as means with the
standard error. If the P value of the data was under 0.05, the difference
was statistically significant. The value of P of each index can be found in
the supplementary Table S1.
3. Results
3.1. HSI, GSI, body vitamin a deposition and ovary morphology
Dietary vitamin A did not significantly affect the HSI value (p > 0.05,
Fig. 1A). Crabs fed the control diet showed significant lower GSI values
than those fed 8000 and 30,000 IU/kg dietary vitamin A (p < 0.05,
Fig. 1B). However, no significant difference in the GSI was found in
crabs fed 8000 and 30,000 IU/kg dietary vitamin A (p > 0.05). The
vitamin A content in the whole body was significantly increased with
dietary vitamin A levels (p < 0.05, Fig. 1C). The ovary of female crabs
fed 8000 and 30,000 IU/kg dietary vitamin A had more yolk granules
deposition and higher oocyte diameters than those fed the control diet
(p < 0.05, Fig. 2, A-E). However, yolk granules deposition in crabs fed
30,000 IU/kg dietary vitamin A were lower than those fed 8000 IU/kg
Q. Huang et al. Aquaculture 560 (2022) 738612

Table 2 dietary vitamin A (p < 0.05, Fig. 2, D).

Information of genes primers used for qPCR experiment.
Gens Sequence (5′ -3′ ) Tm (◦ C) Product size (bp) 3.2. Tissue lipid deposition and biochemical indices
(F)TCTTCACACCCTCTGGACGC 60.5 162
srebp1
(R)CCAAGGTTGTAATGGCACGC 61.3 Crabs fed 8000 dietary vitamin A showed higher total lipid content,
(F)GTCCCTTCTTCTACGCCATCC 60.3 127 TG and neutral lipid content in the hepatopancreas and ovary relative to
fas
(R)CGCTCTCCAGGTCAATCTTCAC 61.3 the control (p < 0.05, Table 3). Total lipid content in the hepatopancreas
(F)CGAGCACATAACACAAGCGG 59.9 98 crabs fed 30,000 IU/kg dietary vitamin A were significantly lower than
dgat1
(R)AACCAGACGACCACGAGAAC 59.9
(F)TAGGACAAGCAGGACTTTCCTCA 60.8 138
those fed 8000 dietary vitamin A (p < 0.05). In addition, 30,000 IU/kg of
mttp dietary vitamin A significantly reduced TG content in the hepatopan­
(R)CCACATCCACAAACACATCAACA 61.3
(F)CATCTGGACACCCACCTCCA 60.8 183 creas and ovary compared to 8000 dietary vitamin A (p < 0.05). TC
cpt1a
(R)ATCTCCTCACCCGGCACTCT 60.7 content in the hepatopancreas fed 8000 dietary vitamin A showed a
(F)AGCAGGCAGTGGCTCAGTTTA 60.2 169
cpt2 higher value than those fed other diets (p < 0.05), while TC content in
(R)AAGGCAAGGAAGGGGTTGTAG 60.1
(F)CATCAAGAGCCAGGAGCCCA 63.2 172 the ovary was not affected (p > 0.05). Polar lipid showed a decreasing
caat
(R)CTTCAACAGCAGCCCGCAAA 64.5 trend in the hepatopancreas, and it was decreased by 30,000 IU/kg of
fabp3
(F)CCACCGAGGTCAAGTTCAAGC 58.4 195 dietary vitamin A relative to the control (p < 0.05). However, dietary
(R)TCACACCATCACACTCCGACAC 59.5 vitamin A supplements increased the ovary polar lipid, with the
(F)GCCGCACCTCAACTCCACTACAA 66.1 108
fabp9
(R)ATCACCAGTCCCACACCCAAAGC 66.9
maximum observed at 8000 IU/kg dietary vitamin A group (p < 0.05).
(F)TGATGGGAAGGCAGGAATGG 62.1 119 The TG, NEFA, and TC in the hemolymph of crabs fed 8000 U/kg
fatp6
(R)TGCGGATGAAGCGAGGTACA 61.9 dietary vitamin A were significantly lower than those fed the control diet
fabp10
(F)TGCTGATTGGCTCAGTGCTGTG 64.4 115 (p < 0.05). HDL-C and VLDL in the hemolymph of crabs fed 8000 IU/kg
(R)CGTGGTCTTGATGACGATGTCG 63.5
dietary vitamin A was markedly higher than those fed other diets (p <
(F) AAGGTCCGCAGCAAGCAGAT 62.2 181
vtg
(R) GGCGAGGCACGAGGTAGAAT 61.6 0.05). Crabs fed 30,000 IU/kg dietary vitamin A showed significant
(F) GCAACGCCTTCCTTCTGGTA 60.3 193 higher TC content in the hemolymph than those fed 8000 IU/kg dietary
vgr
(R) GGCACGGTGTTCGCTATCAT 60.7 vitamin A diets (p < 0.05) but did not differ from those fed the control
(F)TGGTGGACTCCATGTTCGAC 57.5 199 diet (p > 0.05). There was no significant change in the hemolymph LDL-
E75
(R)GGGTTCTCTGGGTGGTGTTT 59.5
(F)TTGTAAATCCAAAGGTCCAT 49.3 223
C content between crabs fed the control and 8000 IU/kg dietary vitamin
ECR1 A diet (p > 0.05), while crabs fed 30,000 IU/kg dietary vitamin A
(R)ACCATCGAAGTTAAATCTGA 49.3
(F)CCCATTAGTCCATGTAAATCCA 54.0 106 showed significant higher hemolymph LDL-C content than that fed the
ECR2
(R)GCATGGCTGACATAGGAGAC 57.5 control diet (p < 0.05). No significant change was found in the hemo­
(F)GAGAGAACAGAAAAAGGCACGA 55.8 105
ECR3 lymph TG, NEFA and LDL-C in crabs fed 8000 and 30,000 IU/kg dietary
(R)ATGGCTGACATTGGACTAATGG 55.8
(F)AAGTGATGACGACTCGGATG 55.4 87 vitamin A (p > 0.05).
ECR4 Hemolymph vitellogenin content showed the same variation ten­
(R)CGCTTGGAGAACTCTACGAT 55.4

RXR
(F)ACTGCTGCAATGACGTGGAA 55.4 84 dency as ecdysone content. There was no significant change in the he­
(R)GCTCGTCAGGGTAGGTGGTG 61.5 molymph content of the two indices in crabs fed 8000 and 30,000 IU/kg
(F)TCGTGCGAGACATCAAGGAAA 61.5 178
β-actin dietary vitamin A (p > 0.05). However, any dietary vitamin A level
(R)AGGAAGGAAGGCTGGAAGAGTG 61.6
(F)CCCCCAAGAAGATCAAGCACA 62.3 179 increased hemolymph vitellogenin and ecdysone content in crabs rela­
S27
(R)CAGATGGCAGCGACCACAGTA 61.8 tive to those fed vitamin A devoid group (p < 0.05).
srebp1, sterol regulatory element-binding protein 1; dgat1: diacylglycerol acyl­
transferase 1; fas, fatty acid synthase; cpt, carnitine palmitoyltransferase; caat, 3.3. Antioxidative and immune parameters
carnitine acetyltransferase; mttp, microsomal triglyceride transfer protein; fatp,
fatty acid transport protein; fabp, fatty acid-binding protein; vtg, vitellogenin; The T-AOC value in the hepatopancreas was not affected by dietary
vgr, vitellogenin receptor; E75, ecdysteroid responsive gene; ECR, ecdysone re­ vitamin A supplementation (p > 0.05, Fig. 3A). Crabs fed 8000 IU/kg of
ceptor; RXR, retinoid x receptor. S27, ubiquitin/ribosomal S27 fusion protein. F, dietary vitamin A showed significantly higher GPx and SOD activities
Forward; R, Reverse. and lower MDA content than those fed other diets (p < 0.05, Fig. 4 B–D).
There was no significant change in GPx and SOD activities and MDA
content between crabs fed the control and 30,000 IU/kg dietary vitamin

0 8000IU/kg 30000IU/kg

B C
8 A 8 2500
vitamin A content in the

b b 2000 c
whole body(IU/kg)

6
6 a
GSI(%)
HSI(%)

1500
4
b
1000
4
2 a
500

2 0 0
0 8000 30000 0 8000 30000 0 8000 30000
Dietary vitamin A level (IU/kg) Dietary vitamin A level (IU/kg) Dietary vitamin A level (IU/kg)

Fig. 1. Parameters of hepatosomatic index (HSI, A, n = 8), gonadosomatic index (GSI, B, n = 8), and body vitamin A content (C, n = 4) of female E. sinensis fed
different dietary vitamin A. Different letters on the bars indicate a significant difference (P < 0.05). Data were expressed as mean ± SEM (standard error of the mean).

4
 Q. Huang et al.
5

Fig. 2. Photomicrographs of the ovary in female Eriocheir sinensis fed different dietary vitamin A. (A) control group, (B) 8000 IU/kg dietary vitamin A group, (C) 30,000 IU/kg dietary vitamin A group. Different letters
on the bars indicate a significant difference (P < 0.05). Data were expressed as mean ± SEM (standard error of the mean) (D, E, n = 5).

Aquaculture 560 (2022) 738612

Q. Huang et al. Aquaculture 560 (2022) 738612

Table 3 Fig. 4 C).

Effect of dietary vitamin A on tissue lipid content and lipid metabolism-related
biochemical indices of crabs fed different dietary vitamin A levels. 3.5. Genes expression related to lipid metabolism
Parameters Dietary vitamin A level (IU/kg)

ND 8000 30,000
Compared with those fed the control diet, crabs fed 8000 IU/kg di­
etary vitamin A showed significantly higher expression of genes related
Hepatopancreas
to lipid synthesis (srebp1 and fas), transport (mttp) and absorption (fatp6
Total lipid (wet weight, %) 33.16 ± 0.65a 37.75 ± 1.42b 30.07 ± 1.80a
TG content (mmol/gprot) 0.94 ± 0.02b 1.06 ± 0.02c 0.56 ± 0.06a and fabp9) in the hepatopancreas (p < 0.05, Fig. 5A). At the same time,
TC content (nmol/gprot) 15.20 ± 1.15a 22.15 ± 1.81b 14.66 ± 1.33a crabs fed 30,000 IU/kg dietary vitamin A significantly reduced gene
Lipid composition expressions of fas, mttp, fatp6 and fabp9 compared with those fed 8000
Neutral lipid (wet weight, 30.46 ± 0.18b 35.78 ± 0.38c 28.63 ± 0.37a
IU/kg dietary vitamin A (p < 0.05). In addition, crabs fed 8000 IU/kg
%)
Polar lipid (wet weight, %) 2.70 ± 0.18b 1.96 ± 0.38ab 1.44 ± 0.37a
dietary vitamin A significantly decreased expression of genes related to
Ovary fatty acid oxidation (cpt1a, cpt2 and caat) compared with those fed the
Total lipid (wet weight, %) 17.19 ± 2.16a 25.94 ± 2.00b 25.21 ± 2.55b control and 30,000 IU/kg dietary vitamin A diets (p < 0.05). However,
TG content (mmol/gprot) 0.19 ± 0.02a 0.26 ± 0.02b 0.18 ± 0.02a no significant difference was found in the expression of genes related to
TC content (nmol/gprot) 8.39 ± 0.41 7.56 ± 0.50 7.88 ± 0.39
fatty acid oxidation between crabs fed the control and 30,000 IU/kg
Lipid composition
Neutral lipid (wet weight, 9.14 ± 0.26a 13.34 ± 0.08b 7.03 ± 0.25b dietary vitamin A diets (p > 0.05).
%) Dietary vitamin A supplementation did not affect the expression of
Polar lipid (wet weight, %) 8.05 ± 0.26a 12.68 ± 0.08c 11.99 ± 0.25b genes, including lipid synthesis, fatty acid oxidation and transport in the
Hemolymph
ovary (p > 0.05, Fig. 5B). However, crabs fed 8000 IU/kg dietary
Vitellogenin (ng/ml) 110.44 ± 144.28 ± 147.13 ±
1.94a 11.4b 4.85b
vitamin A significantly increased the expression of genes related to lipid
Ecdysone (ng/ml) 70.82 ± 7.47a 124.27 ± 137.77 ± absorption (fabp3 and fabp10) compared with those fed the control and
14.27b 9.82b 30,000 IU/kg dietary vitamin A diets (p < 0.05).
TG (mmol/m) 0.21 ± 0.03b 0.09 ± 0.02a 0.16 ± 0.02ab
NEFA (mmol/l) 0.18 ± 0.03b 0.07 ± 0.01a 0.12 ± 0.03ab
4. Discussion
TC (mmol/l) 0.62 ± 0.04b 0.33 ± 0.03a 0.51 ± 0.05b
HDL-C (mmol/ml) 0.07 ± 0.01a 0.12 ± 0.01b 0.06 ± 0.01a
LDL-C (mmol/ml) 0.42 ± 0.01a 0.47 ± 0.02ab 0.72 ± 0.08b In the present study, the increased GSI value and yolk granule
VLDL (mmol/l) 0.41 ± 0.09a 1.17 ± 0.18b 0.69 ± 0.12a deposition in the ovary showed a vitellogenesis-stimulative effect due to
Data were expressed as mean ± SEM (standard error of the mean) (n = 8). TG: vitamin A supplements. Generally, vitellogenesis is divided into
triglyceride; NEFA: free fatty acid; TC: cholesterol; HDL–C: high-density lipo­ endogenous synthesis by the ovary and exogenous synthesis by the
protein; LDL-C: low-density lipoprotein; VLDL: very low-density lipoprotein; hepatopancreas (Chen et al., 2022; Li et al., 2006; Tsutsui et al., 2000).
Neutral lipid includes triglyceride, cholesterol, diacylglycerol and mono­ The expression level of vtg in the hepatopancreas was higher than in the
glyceride; Polar lipid mainly includes phosphatidylethanolamine, phosphati­ ovary. This may be because that exogenous synthesis through hepato­
dylinositol, phosphatidylcholine and lysophosphatidylcholine. Different letters pancreas might play a dominant role in vitellogenesis (Girish et al.,
in the same line indicate a significant difference (P < 0.05). 2015). The exogenous vtg synthesized by the hepatopancreas was usu­
ally transferred to the ovary through hemolymph, mediated by the vgr in
A diet (p > 0.05). the ovary (Girish et al., 2015; Tiu et al., 2008; Wang et al., 2021). In the
Hemolymph AKP activity was markedly increased by dietary vitamin present study, both hemolymph vtg content and expression of vgr in the
A supplementation (p < 0.05, Fig. 3 E), whereas no significant change ovary are increased by vitamin A supplement. Thus, the elevated yolk
was found between the two treatment groups (p > 0.05). Furthermore, granule deposition in the ovary resulted from joint vitellogenesis by the
hemolymph ACP activity showed an upward trend as dietary vitamin A hepatopancreas and ovary due to vitamin A supplements. Our result
level increased to a significantly higher value at 30000 IU/kg dietary indicated that dietary vitamin A showed a stimulative role in ovary
vitamin A group relative to the control group (p < 0.05, Fig. 3 F). development.
The positive role of vitamin A in ovary development was realized
3.4. Genes expression related to ovary development mainly through the metabolite-retinoic acid, which has been reported in
Astyanax lacustris (Teleostei: Characidae), Silurus meridionalis and Danio
Compared to those fed the control group, crabs fed 8000 IU/kg di­ rerio (da Silva et al., 2021; Li et al., 2016; Ruivo et al., 2018). Studies
etary vitamin A showed significantly higher gene expression of RXR in have proved that vitamin A and retinoic acid treatment could induce the
the hepatopancreas and ovary, respectively (p < 0.05, Fig. 4 A and B). expression of RXR in crabs (Feng et al., 2019). Girish et al. (2018) have
The mRNA levels of ECR1, ECR2 and ECR4 in the hepatopancreas of demonstrated that retinoic acid promoted vitellogenesis by regulating
crabs fed 8000 IU/kg dietary vitamin A were significantly enhanced RXR and ECR gene expressions in Oziotelphusa senex senex in vitro or
relative to those fed the control group (p < 0.05). In contrast, there was a vivo. As we have mentioned, RXR/ECR could regulate vtg expression
decrease in gene expression of ECR1 in the hepatopancreas of crabs fed since vtg gene possesses the retinoic acid and ecdysteroid response ele­
30,000 IU/kg dietary vitamin A compared to those fed 8000 IU/kg (p < ments. Retinoic acid could bind to RXR and enhance the binding of
0.05). ECR1 and ECR2 expression were not affected by dietary vitamin A ecdysteroid to EcR, and a receptor complex of RXR with EcR could also
in the ovary (p > 0.05). ECR4 transcriptional level in the ovary was only modulate ecdysteroid signals and regulate the physiological events
increased in the highest vitamin A supplemented group relative to the (Girish et al., 2018; Hopkins et al., 2008). The early responsive gene E75
control (p < 0.05). There was a significant increase in the gene expres­ is a nuclear receptor in 20-hydroxyecdysone (20E, active form of inac­
sions of E75 and vtg in the hepatopancreas and ovary fed any dietary tive ecdysteroids) signaling pathway and the primary target of RXR/EcR
vitamin A level relative to the control group (p < 0.05). Gene expression (Girish et al., 2015; Priya et al., 2009; Schwedes and Carney, 2012).
of vgr in the ovary of crabs fed 30,000 and 8000 IU/kg dietary vitamin A Therefore, the activation of RXR/EcR heterodimer and E75 could pro­
was significantly higher than those fed the control group (p < 0.05). No mote the transcription of vtg in hepatopancreas and the uptake of vtg in
significant difference in gene expressions of E75, vtg and vgr was found in the ovary (Girish et al., 2015; Gong et al., 2016; Kim et al., 2005). In the
the ovary of crabs fed 30,000 and 8000 IU/kg dietary vitamin A (p > present study, hemolymph ecdysone content and expression of E75 were
0.05). The average gene expression of vtg in the hepatopancreas was increased by dietary vitamin A, in agreement with the vivo and vitro
about 4000 times significantly higher than that in the ovary (p < 0.05, results in Oziotelphusa senex senex (Girish et al., 2018). Thus, vitamin A

6
Q. Huang et al. Aquaculture 560 (2022) 738612

0 8000IU/kg 30000 IU/kg

0.5 A B

hepatopancreas T-AOC content(mmol/g)

150

hepatopancreas GPx content(U)

0.4 b
100 a a
0.3
a
0.2 a a
50
0.1

0.0 0
0 8000 30000 0 8000 30000
Dietary vitamin A level (IU/kg) Dietary vitamin A level (IU/kg)

D
C 2.5

hepatopancreas MDA content(nmol/mg)

10
hepatopancreas SOD content(U/mgprot)

b
2.0 b b
8 a
a
6 1.5
a a
4 a 1.0 a a

2 0.5

0 0.0
0 8000 30000 0 8000 30000
Dietary vitamin A level (IU/kg) Dietary vitamin A level (IU/kg)
500 E 200 F
b
hemolymph ACP activity(U/L)
hemolymph AKP activity(U/L)

400 b b 150 ab
a
300
100
a
200
50
100

0 0
0 8000 30000 0 8000 30000
Dietary vitamin A level (IU/kg) Dietary vitamin A level (IU/kg)

Fig. 3. Antioxidant ability and immunity of crabs fed different dietary vitamin A. Different letters on the bars indicate a significant difference (P < 0.05). Data were
expressed as mean ± SEM (standard error of the mean) (n = 8). T-AOC: total antioxidant capacity; GPx: glutathione peroxidase; SOD: superoxide dismutase; MDA:
malondialdehyde; AKP, alkaline phosphatase; ACP, acid phosphatase.

enhanced the ecdysteroid signals and induced gene expression of RXR, to explain why vitamin A change the content of TC since little infor­
ECR and E75 to upregulate the transcription of vtg gene in the present mation was found on the metabolic regulated way of TC in crabs.
research. A certain amount of nutrient deposition, such as lipids, was benefi­
Although limited references have reported the effect of vitamin A on cial to the maturity of gonads (Palacios et al., 2000; Zmora et al., 2007).
ecdysone content, as we know, TC was an important factor in affecting In the present study, the GSI value was positively related to the tissue
ecdysone signal (Sheen, 2000). For example, dietary TC increased the lipid content, similar to the results in Penaeus vannamei (Palacios et al.,
ECR gene expression in the eyestalk of mud crab, and TC deficiency 2000). Lipid accumulation was usually affected by synthesis, catabo­
caused lower molting frequency in Scylla serrata (Sheen, 2000; Zheng lism, lipid uptake and transport (Amiri et al., 2018; Lin et al., 2020). The
et al., 2018). It has been reported that 20-hydroxyecdysone could be metabolite of vitamin A (retinoic acid) could form a dimer with nuclear
synthesized from TC in arthropods (Lafont et al., 2012). HDLC is receptors such as peroxisome proliferator-activated receptor (PPAR),
important in transporting TC from hemolymph to other tissue (Levinson liver X receptor (LXR) and hepatocyte nuclear factor (HNF) (Bonet et al.,
and Wagner, 2015). In the present study, the TC content in hemolymph 2012; Li et al., 2011). Many lipid metabolism genes could be regulated
was decreased by 8000 IU/kg of dietary vitamin A (contrary to that in through the formed dimers. For example, srebp1 is a RXR/LXR-induced
hepatopancreas), accompanied by increased hemolymph ecdysone and transcription factor which could upregulate genes related to fatty acid
HDLC content. Homoplastically, vitamin A supplementation increased de novo synthesis (fas) and TG synthesis (dgat1) (Repa et al., 2000). The
serum TC and HDLC contents in rats (Oliveros et al., 2007). This in­ genes related to β-oxidation (cpt) and fatty acid uptake (fabp and fatp)
dicates that vitamin A might promote the content of ecdysone by could be regulated by the HNF and PPAR pathway (Amiri et al., 2018;
influencing TC mobilization and utilization. However, it was a challenge Huang et al., 2022b; Vega et al., 2009; Wang et al., 2022). In the present

7
Q. Huang et al. Aquaculture 560 (2022) 738612

4 A hepatopancreas 0 8000 IU/kg 30000 IU/kg

relative gene expression level b

3
b
b b
b c b
2 b ab b b
b
a a a a a a
1

0
RXR ECR1 ECR2 ECR3 ECR4 E75 vtg

2.5 B ovary 0 8000 IU/kg 30000 IU/kg

relative gene expression level

2.0 b b

b ab b
1.5 b b b
b
a a a a a
1.0 a

0.5

0.0
RXR ECR1 ECR2 ECR4 E75 vtg vgr

Fig. 4. Effect of dietary vitamin A on the expression of genes related to gonad development in hepatopancreas and ovary of E. sinensis. Data were expressed as mean
± SEM (standard error of the mean) (n = 8). The different lowercase letters (a, b and c) indicate significant differences among groups (P < 0.05). RXR, retinoid x
receptor; ECR, Ecdysone receptor, E75, ecdysteroid responsive gene; vtg, vitellogenin; vgr, vitellogenin receptor.

study, 8000 IU/kg of dietary vitamin A increased TG accumulation by
promoting gene expressions of lipid synthesis, export and fatty acid
uptake and restraining β-oxidation in the hepatopancreas. Dietary
vitamin A also increased the lipid accumulation in liver of Carassius
auratus gibelio var. CAS III (Shao et al., 2016). However, our previous
work in juvenile crabs fed 7% lipid level have demonstrated vitamin A
decreased TG content in the hepatopancreas through promoting lipid
synthesis, export and fatty acids β-oxidation by vitamin A supplemen­
tation (Huang et al., 2022b). This indicated that role of vitamin A in lipid
deposition was affected by the growth stages of crabs. Similarly, the

8
Q. Huang et al. Aquaculture 560 (2022) 738612

A Fig. 5. Effect of dietary vitamin A on the expression of genes

hepatopancreas related to lipid metabolism in hepatopancreas (A) and ovary (B)
8
of E. sinensis. Data were expressed as mean ± SEM (standard error
relative gene expression level

b
of the mean) (n = 8). The different lowercase letters (a, b and c)
6 0 8000 IU/kg 30000 IU/kg indicate significant differences among groups (P < 0.05). srebp1,
sterol regulatory element-binding protein 1; fas, fatty acid syn­
b thase; dgat1, diacylglycerol acyltransferase 1; cpt, carnitine pal­
4
mitoyltransferase; caat, carnitine acetyltransferase; mttp,
b a
b microsomal triglyceride transfer protein; fabp, fatty acid binding
b
2 b
a protein; fatp, fatty acid transport protein.
b b a a
a a a a b b b b a
a a a
0
srebp1 fas dgat1 mttp cpt1a cpt2 caat fatp6 fabp9

B
3 ovary
relative gene expression level

0 8000 IU/kg 30000 IU/kg b

2
a
a
a a
1

0
srebp1 fas dgat1 mttp cpt1a cpt2 caat fabp3 fabp10

phospholipid nutrient could enhance lipid deposition in the hepato­ detrimental glutathione radical (Palace et al., 1999).
pancreas of female adult crabs, contrary to the report on juvenile crabs On the other hand, excess vitamin A addition would be toxic and
(Lin et al., 2020). For rapid ovarian development, plenty of long-chain could negatively influence the physiological function of an organ (Jiang
fatty acids would be transported to the developing ovaries and cause a et al., 2020; Liu et al., 2016). The increased MDA in the hepatopancreas
less β-oxidation reaction of these fatty acids (Liu et al., 2018). Thus, of crabs fed 30,000 IU/kg dietary vitamin A indicated this supplemen­
suppressed β-oxidation in the hepatopancreas of female crabs might be tary level might be excessive. Furthermore, this was reinforced by the
an adaptive strategy to save fatty acids for promoting ovarian devel­ observed adverse effect on hepatopancreas lipid metabolism and vitel­
opment better. However, why vitamin A showed such a discrepant logenesis at 30000 IU/kg of dietary vitamin A compared to 8000 IU/kg.
regulatory role in different growth stages of crabs needs further Accordingly, AKP and ACP activities were increased by dietary vitamin
research. Besides, most genes expressed in the ovary were not affected in A levels. AKP and ACP are important hydrolytic lysosomal and innate
the present results, indicating that lipids in the ovary are transported immune enzymes in crustaceans (Zhu et al., 2021). A recent study has
from the hepatopancreas (Boucard et al., 2002; Lin et al., 2020; Wen reported that hemolymph vtg accumulation could improve the innate
et al., 2001). This was reinforced by the reduced hemolymph TG and immunity of crabs (Sun et al., 2020). Thus, the improved innate im­
NEFA and increased hemolymph VLDL content and fatty acids uptake munity might be through an indirect regulation of vitamin A, raising vtg
related genes expression in the ovary. Except for the increased tissue accumulation. These results indicated that vitamin A improved crab
neutral lipid content, the polar lipid was increased in the ovary by di­ health in the gonadal development stage.
etary vitamin A level of 8000 IU/kg. Polar lipid (particularly phospho­
lipid) was important for maintaining stability of lipovitellin structure in 5. Conclusion
crustacean (Garcia et al., 2010). It has been reported that proper vitamin
A supplementation increased hepatic phospholipids in rats (Oliveros In summary, 8000 IU/kg vitamin A level could induce vtg expression
et al., 2007). Whereas, there are limited capacity for aquatic animals to through upregulating expression of RXR, ECR and E75 particularly in the
synthesize phospholipids (Kanazawa et al., 1985; Lin et al., 2021). Thus, hepatopancreas, and vgr in the ovary, promoting vitellogenesis and yolk
vitamin A might also promote uptake of polar lipid from exogenous granule deposition in the ovary. Besides, proper vitamin A (8 000 IU/kg)
sources (hepatopancreas or feeds) to the ovary, improving the nutrition increased lipid accumulation in the hepatopancreas and ovary for gonad
value in the edible portion. In a word, vitamin A promoted the fatty acid development. It promoted the lipid uptake in the hepatopancreas and
uptake, lipid synthesis and inhibited catabolism in the hepatopancreas, ovary, enhanced lipid export and synthesis, and inhibited the catabolism
while promoted lipid export from hepatopancreas to the ovary, leading in the hepatopancreas. Moreover, the health of the hepatopancreas was
desired tissue lipid deposition. well protected by proper vitamin A addition. This study reveals that
The change in lipid deposition can be accompanied by lipid peroxi­ proper dietary vitamin A could optimize lipid metabolism and improve
dation, which is reflected by the content of MDA, an indicator of free gonad development in female crabs.
radical damage (Basso et al., 2006; Lin et al., 2021). SOD is the natural
enemy and the top sweeper of oxygen free radicals in the body, and GPx Contribution statement
reduces the hydrogen peroxide and organic peroxides through expend­
ing glutathione (Franco et al., 2009; Liao et al., 2021). The improved Qincheng Huang designed the experiment and wrote this manu­
antioxidant indices indicated that the lipid deposition in the hepato­ script. Qincheng Huang, Xianyong Bu and Ying song helped with the
pancreas of crabs fed 8000 IU/kg dietary vitamin A was in a normal field experiment. Fenglu Han and Zhideng Lin contributed constructive
range. The protective effect of vitamin A in oxidation resistance might opinions for data interpredation. Fang Qiao, Qingchao Shi, Xiaodan
occur because of its regulatory effect in relevant signaling pathways Wang, Jianguang Qin and Liqiao Chen provided suggestions on manu­
(Jiang et al., 2020). Moreover, retinol could scavenge the potentially script writing and the research platform of this study. Xiaodan Wang,

9
Q. Huang et al.
Jianguang Qin and Liqiao Chen revised the text and improved clarity
and readability.
Declaration of Competing Interest
No.
Data availability
The data that has been used is confidential.
Acknowledgment
It was subsidized by the Agriculture Research System of China of
MOF and MARA (CARS-48), National Key Research and Development
Program of China (2018YFD0900400), the National Natural Science
Foundation of China (32072986), Research and Development Project in
Key Areas of Guangdong Province (2020B0202010001), Agriculture
Research System of Shanghai, China (2022), and The Opening Fund of
Key Laboratory of Sichuan Province for Fishes Conservation and Utili­
zation in the Upper Reaches of the Yangtze River (NJTCCJSYSYS01).
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.aquaculture.2022.738612.
References
Alsop, D., Matsumoto, J., Brown, S., Van Der Kraak, G., 2008. Retinoid requirements in
the reproduction of zebrafish. Gen. Comp. Endocrinol. 156, 51–62.
Amiri, M., Yousefnia, S., Forootan, F.S., Peymani, M., Ghaedi, K., Esfahani, M.H.N.,
2018. Diverse roles of fatty acid binding proteins (FABPs) in development and
pathogenesis of cancers. Gene 676, 171–183.
Basso, M.M., Eynard, A., Valentich, M., 2006. Dietary lipids modulate fatty acid
composition, gamma glutamyltranspeptidase and lipid peroxidation levels of the
epididymis tissue in mice. Anim. Reprod. Sci. 92, 364–372.
Bo, Q.-K., Lu, Y.-Z., Ma, C., Mi, H.-J., Jia, L., Meng, Y.-G., Geng, X.-Y., 2021.
Reproductive biology and biochemical changes in female mantis shrimp Oratosquilla
oratoria (Stomatopoda) with ovary development from the Tianjin coastal zone of
Bohai Bay. Aquaculture. 534, 736239.
Bonet, M.L., Ribot, J., Palou, A., 2012. Lipid metabolism in mammalian tissues and its
control by retinoic acid. Biochimica et Biophysica Acta (BBA)-molecular and cell
biology of lipids 1821, 177–189.
Boucard, C.G.V., Levy, P., Ceccaldi, H.J., Brogren, C.-H., 2002. Developmental changes
in concentrations of vitellin, vitellogenin, and lipids in hemolymph, hepatopancreas,
and ovaries from different ovarian stages of Indian white prawn Fenneropenaeus
indicus. J. Exp. Mar. Biol. Ecol. 281, 63–75.
Chang, G., Wu, X., Cheng, Y., Zeng, C., Yu, Z., 2017. Reproductive performance, offspring
quality, proximate and fatty acid composition of normal and precocious Chinese
mitten crab Eriocheir sinensis. Aquaculture. 469, 137–143.
Chen, L., Jiang, H., Zhou, Z., Li, K., Li, K., Deng, G.Y., Liu, Z., 2004. Purification of
vitellin from the ovary of Chinese mitten-handed crab (Eriocheir sinensis) and
development of an antivitellin ELISA. Comp. Biochem. Physiol. B: Biochem. Mol.
Biol. 138, 305–311.
Chen, T., Xu, R., Sheng, N., Che, S., Zhu, L., Liu, F., Li, X., 2022. RNAi silencing of the 3-
hydroxy-3-methylglutaryl coenzyme a reductase (HMGR) gene inhibits
vitellogenesis in Chinese mitten crab Eriocheir sinensis. Comp. Biochem. Physiol. A
Mol. Integr. Physiol. 263, 111078.
Cheng, Y., Wu, X., Yang, X., Hines, A.H., 2008. Current trends in hatchery techniques and
stock enhancement for Chinese mitten crab, Eriocheir japonica sinensis. Rev. Fish. Sci.
16, 377–384.
China Fishery Statistical Yearbook, 2000. China Agriculture Press, Beijing, China. pp. 21.
China Fishery Statistical Yearbook, 2021. China Agriculture Press, Beijing, China. pp. 24.
Chung, A.C.-K., Durica, D.S., Clifton, S.W., Roe, B.A., Hopkins, P.M., 1998. Cloning of
crustacean ecdysteroid receptor and retinoid-X receptor gene homologs and
elevation of retinoid-X receptor mRNA by retinoic acid. Mol. Cell. Endocrinol. 139,
209–227.
Coldebella, I., Emanuelli, T., Veiverberg, C., Pretto, A., Rossato, S., Ferreira, D., Neto, J.
R., 2013. Effect of different dietary lipid levels on the reproduction of Rhamdia
quelen (Quoy and Gaimard, 1824). Aquac. Nutr. 19, 751–764.
da Silva, J., Brambila-Souza, G., de Magalhães Araujo, D., Moreira, R.G., 2021. Effects of
Vitamin a Supplementation on Ovarian Development of Astyanax Lacustris
(Teleostei: Characidae) during the Non-breeding Season. Comparative Biochemistry
and Physiology Part A: Molecular & Integrative Physiology, p. 111132.
10
Aquaculture 560 (2022) 738612
Du, H., Yao, J., Zhou, H., Leng, X., Wu, J., He, S., Tan, Q., 2018. Optimal dietary lipid
level promoted ovary development of Chinese sturgeon (Acipenser sinensis)
broodstocks. Aquaculture. 495, 288–294.
Feng, D., Wang, X., Li, E., Bu, X., Qiao, F., Qin, J., Chen, L., 2019. Dietary Aroclor 1254-
induced toxicity on antioxidant capacity, immunity and energy metabolism in
Chinese mitten crab Eriocheir sinensis: amelioration by vitamin a. Front. Physiol. 10,
722.
Franco, J.L., Posser, T., Dunkley, P.R., Dickson, P.W., Mattos, J.J., Martins, R.,
Farina, M., 2009. Methylmercury neurotoxicity is associated with inhibition of the
antioxidant enzyme glutathione peroxidase. Free Radic. Biol. Med. 47, 449–457.
Garcia, C., Cunningham, M., Soulages, J., Heras, H., Garda, H., 2010. Structure and
stability of crustacean lipovitellin: influence of lipid content and composition. Comp.
Biochem. Physiol. B: Biochem. Mol. Biol. 155, 126–131.
Girish, B., Swetha, C., Reddy, P.S., 2015. Expression of RXR, EcR, E75 and VtG mRNA
levels in the hepatopancreas and ovary of the freshwater edible crab, Oziothelphusa
senex senex (Fabricius, 1798) during different vitellogenic stages. The Science of
Nature. 102, 20.
Girish, B., Swetha, C., Srilatha, M., Hemalatha, M., Reddy, P.S., 2018. Evidence for
retinoic acid involvement in the regulation of vitellogenesis in the fresh water edible
crab, Oziotelphusa senex senex. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 222,
1–6.
Gong, J., Huang, C., Shu, L., Bao, C., Huang, H., Ye, H., Li, S., 2016. The retinoid X
receptor from mud crab: new insights into its roles in ovarian development and
related signaling pathway. Sci. Rep. 6, 1–13.
Heyman, R.A., Mangelsdorf, D.J., Dyck, J.A., Stein, R.B., Eichele, G., Evans, R.M.,
Thaller, C., 1992. 9-cis retinoic acid is a high affinity ligand for the retinoid X
receptor. Cell. 68, 397–406.
Hopkins, P.M., Durica, D., Washington, T., 2008. RXR isoforms and endogenous retinoids
in the fiddler crab, Uca pugilator. Comp. Biochem. Physiol. A Mol. Integr. Physiol.
151, 602–614.
Huang, Q., Wang, X., Bu, X., Song, Y., You, J., Zhang, C., Chen, L., 2022a. Dietary
vitamin a affects growth performance, immunity, antioxidant capacity, and lipid
metabolism of juvenile Chinese mitten crab Eriocheir sinensis. Aquaculture. 548,
737556.
Huang, Q., You, J., Wang, X., Bu, X., Song, Y., Zhang, C., Chen, L., 2022b. Effect of
vitamin a supplement on the growth performance, antioxidant status, and lipid
accumulation of Chinese mitten crab Eriocheir Sinensis fed different lipid levels.
Aquaculture 738123.
Jiang, W., Zhang, L., Feng, L., Wu, P., Liu, Y., Jiang, J., Zhou, X., 2020. Inconsistently
impairment of immune function and structural integrity of head kidney and spleen
by vitamin a deficiency in grass carp (Ctenopharyngodon idella). Fish Shellfish
Immunol. 99, 243–256.
Kanazawa, A., Teshima, S.-I., Sakamoto, M., 1985. Effects of dietary lipids, fatty acids,
and phospholipids on growth and survival of prawn (Penaeus japonicus) larvae.
Aquaculture. 50, 39–49.
Kim, H.-W., Chang, E., Mykles, D., 2005. Three calpains and ecdysone receptor in the
land crab Gecarcinus lateralis: sequences, expression and effects of elevated
ecdysteroid induced by eyestalk ablation. J. Exp. Biol. 208, 3177–3197.
Kluebsoongnoen, J., Panyim, S., Sarnowski, T.J., Udomkit, A., 2021. Retinoid X receptor
modulates vitellogenin gene expression in black tiger shrimp, Penaeus monodon.
Comp. Biochem. Physiol. A Mol. Integr. Physiol. 254, 110877.
Lafont, R., Dauphin-Villemant, C., Warren, J., Rees, H., 2012. Ecdysteroid chemistry and
biochemistry. In: Insect Endocrinology. Elsevier, pp. 106–176.
Levinson, S.S., Wagner, S.G., 2015. Implications of reverse cholesterol transport: recent
studies. Clin. Chim. Acta 439, 154–161.
Li, K., Chen, L., Zhou, Z., Li, E., Zhao, X., Guo, H., 2006. The site of vitellogenin synthesis
in Chinese mitten-handed crab Eriocheir sinensis. Comp. Biochem. Physiol. B:
Biochem. Mol. Biol. 143, 453–458.
Li, R., Chen, W., Li, Y., Zhang, Y., Chen, G., 2011. Retinoids synergized with insulin to
induce Srebp-1c expression and activated its promoter via the two liver X receptor
binding sites that mediate insulin action. BBRC. 406, 268–272.
Li, M., Feng, R., Ma, H., Dong, R., Liu, Z., Jiang, W., Wang, D., 2016. Retinoic acid
triggers meiosis initiation via stra8-dependent pathway in southern catfish, Silurus
meridionalis. Gen. Comp. Endocrinol. 232, 191–198.
Liao, Y., Liu, K., Ren, T., Zhang, Z., Ma, Z., Dan, S.F., Zhang, Y., 2021. The
characterization, expression and activity analysis of three superoxide dismutases in
Eriocheir hepuensis under azadirachtin stress. Fish Shellfish Immunol. 117, 228–239.
Lin, Z., Qi, C., Han, F., Chen, X., Qin, C., Wang, C., Chen, L., 2020. Selecting suitable
phospholipid source for female Eriocheir sinensis in pre-reproductive phase.
Aquaculture. 528, 735610.
Lin, Z., Wang, X., Bu, X., Jia, Y., Shi, Q., Du, Z., Chen, L., 2021. Dietary
phosphatidylcholine affects growth performance, antioxidant capacity and lipid
metabolism of Chinese mitten crab (Eriocheir sinensis). Aquaculture. 541, 736814.
Liu, B., Zhao, Z., Brown, P.B., Cui, H., Xie, J., Habte-Tsion, H.M., Ge, X., 2016. Dietary
vitamin a requirement of juvenile Wuchang bream (Megalobrama amblycephala)
determined by growth and disease resistance. Aquaculture. 450, 23–30.
Liu, L., Long, X., Deng, D., Cheng, Y., Wu, X., 2018. Molecular characterization and tissue
distribution of carnitine palmitoyltransferases in Chinese mitten crab Eriocheir
sinensis and the effect of dietary fish oil replacement on their expression in the
hepatopancreas. PLoS One 13, e0201324.
Maneii, K., Oujifard, A., Ghasemi, A., Mozanzadeh, M.T., 2019. Reproductive
performance and vitellogenin mRNA transcript abundance in the hepatopancreas of
female Litopenaeus vannamei fed diets with different soy lecithin content. Anim.
Reprod. Sci. 211, 106228.
Martı́n, D., Wang, S.-F., Raikhel, A.S., 2001. The vitellogenin gene of the mosquito Aedes
aegypti is a direct target of ecdysteroid receptor. Mol. Cell. Endocrinol. 173, 75–86.
Q. Huang et al.
Medina, P., Gómez, A., Zanuy, S., Blázquez, M., 2019. Involvement of the retinoic acid
signaling pathway in sex differentiation and pubertal development in the European
sea bass Dicentrarchus labrax. Heliyon. 5, e01201.
Miao, S., Wang, S., Yang, B., Wang, Z., Lu, Y., Ren, Y., 2021. Functional analysis of
vitellogenin and juvenile hormone-mediated regulation in a Psocoptera insect
Liposcelis entomophila (Enderlein). J. Stored Prod. Res. 94, 101885.
Nagaraju, G.P.C., Rajitha, B., Borst, D.W., 2011. Molecular cloning and sequence of
retinoid X receptor in the green crab Carcinus maenas: a possible role in female
reproduction. J. Endocrinol. 210, 379.
Oliveros, L.B., Domeniconi, M.A., Vega, V.A., Gatica, L.V., Brigada, A.M., Gimenez, M.S.,
2007. Vitamin a deficiency modifies lipid metabolism in rat liver. Br. J. Nutr. 97,
263–272.
Palace, V.P., Khaper, N., Qin, Q., Singal, P.K., 1999. Antioxidant potentials of vitamin a
and carotenoids and their relevance to heart disease. Free Radic. Biol. Med. 26,
746–761.
Palacios, E., Ibarra, A., Racotta, I., 2000. Tissue biochemical composition in relation to
multiple spawning in wild and pond-reared Penaeus vannamei broodstock.
Aquaculture. 185, 353–371.
Priya, T.J., Li, F., Zhang, J., Wang, B., Zhao, C., Xiang, J., 2009. Molecular
characterization and effect of RNA interference of retinoid X receptor (RXR) on E75
and chitinase gene expression in Chinese shrimp Fenneropenaeus chinensis. Comp.
Biochem. Physiol. B: Biochem. Mol. Biol. 153, 121–129.
Repa, J.J., Liang, G., Ou, J., Bashmakov, Y., Lobaccaro, J.-M.A., Shimomura, I.,
Mangelsdorf, D.J., 2000. Regulation of mouse sterol regulatory element-binding
protein-1c gene (SREBP-1c) by oxysterol receptors. LXRα and LXRβ. Genes Dev. 14,
2819–2830.
Rudnick, D.A., Hieb, K., Grimmer, K.F., Resh, V.H., 2003. Patterns and processes of
biological invasion: the Chinese mitten crab in San Francisco Bay. Basic Appl. Ecol.
4, 249–262.
Ruivo, R., Capitão, A., Castro, L., Santos, M., 2018. The cycling gonad: retinoic-acid
synthesis and degradation patterns during adult zebrafish Danio rerio oogenesis.
J. Fish Biol. 92, 1051–1064.
Schwedes, C.C., Carney, G.E., 2012. Ecdysone signaling in adult Drosophila melanogaster.
J. Insect Physiol. 58, 293–302.
Shao, L.Y., Zhu, X.M., Yang, Y.X., Jin, J.Y., Liu, H.K., Han, D., Xie, S.Q., 2016. Effects of
dietary vitamin a on growth, hematology, digestion and lipometabolism of on-
growing gibel carp (Carassius auratus gibelio var. CAS III). Aquaculture. 460, 83–89.
Sharma, M.K., Saxena, V., Liu, R.-Z., Thisse, C., Thisse, B., Denovan-Wright, E.M.,
Wright, J.M., 2005. Differential expression of the duplicated cellular retinoic acid-
binding protein 2 genes (crabp2a and crabp2b) during zebrafish embryonic
development. Gene Expr. Patterns 5, 371–379.
Sheen, S.-S., 2000. Dietary cholesterol requirement of juvenile mud crab Scylla serrata.
Aquaculture. 189, 277–285.
Shyamal, S., Anilkumar, G., Bhaskaran, R., Doss, G., Durica, D., 2015. Significant
fluctuations in ecdysteroid receptor gene (EcR) expression in relation to seasons of
molt and reproduction in the grapsid crab, Metopograpsus messor (Brachyura:
Decapoda). Gen. Comp. Endocrinol. 211, 39–51.
Stephensen, C.B., 2001. Vitamin a, infection, and immune function. Annu. Rev. Nutr. 21,
167–192.
Su, Y., Guo, Q., Gong, J., Cheng, Y., Wu, X., 2020. Functional expression patterns of four
ecdysteroid receptor isoforms indicate their different functions during vitellogenesis
of Chinese mitten crab, Eriocheir sinensis. Comp. Biochem. Physiol. A Mol. Integr.
Physiol. 248, 110754.
11
Aquaculture 560 (2022) 738612
Sui, L., Sun, H., Wu, X., Wille, M., Cheng, Y., Sorgeloos, P., 2011. Effect of dietary HUFA
on tissue fatty acid composition and reproductive performance of Chinese mitten
crab Eriocheir sinensis (H. Milne-Edwards) broodstock. Aquacult. Int. 19, 269–282.
Sun, W., Li, L., Li, H., Zhou, K., Li, W., Wang, Q., 2020. Vitellogenin receptor expression
in ovaries controls innate immunity in the Chinese mitten crab (Eriocheir sinensis) by
regulating vitellogenin accumulation in the hemolymph. Fish Shellfish Immunol.
107, 480–489.
Tiu, S.H.K., Benzie, J., Chan, S.-M., 2008. From hepatopancreas to ovary: molecular
characterization of a shrimp vitellogenin receptor involved in the processing of
vitellogenin. Biol. Reprod. 79, 66–74.
Tsukimura, B., 2001. Crustacean vitellogenesis: its role in oocyte development. Am. Zool.
41, 465–476.
Tsutsui, N., Kawazoe, I., Ohira, T., Jasmani, S., Yang, W.-J., Wilder, M.N., Aida, K., 2000.
Molecular characterization of a cDNA encoding vitellogenin and its expression in the
hepatopancreas and ovary during vitellogenesis in the kuruma prawn, Penaeus
japonicus. Zool. Sci. 17, 651–660.
Vega, V.A., Anzulovich, A.C., Varas, S.M., Bonomi, M.R., Giménez, M.S., Oliveros, L.B.,
2009. Effect of nutritional vitamin a deficiency on lipid metabolism in the rat heart:
its relation to PPAR gene expression. Nutrition. 25, 828–838.
Wang, S., Miao, S., Yang, B., Wang, Z., Liu, Q., Wang, R., Lu, Y., 2021. Initial
characterization of the vitellogenin receptor from a Psocoptera insect: function
analysis and RNA interference in Liposcelis entomophila (Enderlein). J. Stored Prod.
Res. 92, 101803.
Wang, X., Jin, M., Cheng, X., Hu, X., Zhao, M., Yuan, Y., Zhou, Q., 2022. Hepatopancreas
transcriptomic and lipidomic analyses reveal the molecular responses of mud crab
(Scylla paramamosain) to dietary ratio of docosahexaenoic acid to eicosapentaenoic
acid. Aquaculture 737903.
Wen, X., Chen, L., Ai, C., Zhou, Z., Jiang, H., 2001. Variation in lipid composition of
Chinese mitten-handed crab, Eriocheir sinensis during ovarian maturation. Comp.
Biochem. Physiol. B: Biochem. Mol. Biol. 130, 95–104.
Wu, X., Liu, M., Pan, J., Chen, H., Zeng, C., Cheng, Y., 2017. The ovarian development
pattern of pond-reared Chinese mitten crab, Eriocheir sinensis H. Milne-Edwards,
1853. Crustaceana. 90, 449–470.
Wu, X., Zhao, H., Jiang, X., He, J., Liu, N., Cheng, Y., 2018. Comparison of culture
performance and gonadal development of wild-caught Chinese mitten crab Eriocheir
sinensis juveniles from three major river populations. Fish. Sci. 84, 929–937.
Wu, X., Zhu, S., Zhang, H., Liu, M., Wu, N., Pan, J., Cheng, Y., 2020. Fattening culture
improves the gonadal development and nutritional quality of male Chinese mitten
crab Eriocheir sinensis. Aquaculture. 518, 734865.
Zheng, P., Wang, J., Han, T., Yang, M., Li, X., Wang, C., 2018. Effect of dietary
cholesterol levels on growth performance, body composition and gene expression of
juvenile mud crab Scylla paramamosain. Aquac. Res. 49, 3434–3441.
Zhou, H., Leng, X.Q., Tan, Q.S., Du, H., Wu, J.P., Liang, X.F., Wei, Q.W., 2017.
Identification of key nutrients for gonadal development by comparative analysis of
proximate composition and fatty/amino acid profile in tissues and eggs of Chinese
sturgeon (Acipenser sinensis gray, 1835). J. Appl. Ichthyol. 33, 885–891.
Zhu, S., Long, X., Turchini, G.M., Deng, D., Cheng, Y., Wu, X., 2021. Towards defining
optimal dietary protein levels for male and female sub-adult Chinese mitten crab,
Eriocheir sinensis reared in earthen ponds: performances, nutrient composition and
metabolism, antioxidant capacity and immunity. Aquaculture. 536, 736442.
Zile, M.H., 2001. Function of vitamin a in vertebrate embryonic development. J. Nutr.
131, 705–708.
Zmora, N., Trant, J., Chan, S.-M., Chung, J.S., 2007. Vitellogenin and its messenger RNA
during ovarian development in the female blue crab, Callinectes sapidus: gene
expression, synthesis, transport, and cleavage. Biol. Reprod. 77, 138–146.