LWT - Food Science and Technology 194 (2024) 115770

Contents lists available at ScienceDirect

LWT
journal homepage: www.elsevier.com/locate/lwt

Phenotypic and transcriptomic investigation of the antibacterial

mechanism of hexahydro-colupulone against Listeria monocytogenes and its
application in apple juice
Yan Zhang a, b, Na Xia c, 1, Xinglong Xiao a, c, *, Fengsong Liu a, Yuanyuan Liu a, Qingyao Wang a,
Dequan Zhu b, **, Yifang Cao a, ***
a
School of Food Science and Engineering, South China University of Technology, Guangzhou City, Guangdong Province, 510640, China
b
School of Chinese Ethnic Medicine, Guizhou Minzu University, Guizhou City, Guiyang Province, 550025, China
c
Key Laboratory of Biological Resources and Ecology of Pamirs Plateau in Xinjiang Uygur Autonomous Region, Kashi University, Kashi, 844000, China

A R T I C L E I N F O A B S T R A C T

Keywords: L. monocytogenes is a dangerous food-borne pathogen threatening global food safety, and its antibiotic resistance
L. monocytogenes is on the rise. Hop extracts and their derivatives were recently found to have antibacterial activity against
Hexahydro-colupulone L. monocytogenes, while the antimicrobial mechanism remains unclear. In this study, a new hop derivative,
Antibacterial mechanism
hexahydro-colupulone (HHCL), was prepared based on hop extracts. HHCL inhibited the growth of
Transcriptomic
L. monocytogenes at surprisingly low concentrations (MIC = 0.4 μg/mL). HHCL significantly inhibited the survival
Food safety
of L. monocytogenes in apple juice and decreased the total viable counts in apple juice during storage (10 days).
Sensory evaluation results suggested that the addition of HHCL had no adverse effect on the quality of fresh apple
juice and significantly delayed its browning more than 4 h. Integrating phenotypic and transcriptomic in­
vestigations revealed that HHCL inhibited L. monocytogenes growth and survival through multiple mechanisms
including cell structural damage, intracellular component leakage, energy and respiratory metabolism limitation,
protein synthesis block, DNA replication and repair systems damage. This study is the first to report the inhib­
itory effect of HHCL on L. monocytogenes and the first to reveal the antibacterial mechanism of HHCL at the gene
level, which provides a theoretical basis for developing new antimicrobial agents and application of hop com­
pounds in food safety.

1. Introduction were focused on animal-source foods. However, recent listeriosis out­

In the post-COVID-19 era, people’s awareness of food safety has
increased significantly. L. monocytogenes, one of the most serious food­
borne pathogens, has attracted wide attention in the world. It can cause
a severe disease named listeriosis, with a high mortality rate in
vulnerable groups. The Centers for Disease Control and Prevention
(CDC) estimated that 1600 people have listeriosis annually, with around
260 deaths in the United States (CDC, 2020).
Listeriosis is usually caused by ingesting food contaminated with
L. monocytogenes, and ready-to-eat (RTE) foods are often associated with
this disease. Previous studies on L. monocytogenes contaminated food
breaks involving fresh produce commodities demonstrated that raw
agricultural products are also important listeriosis food vehicles (Garner
& Kathariou, 2016). Several foodborne disease outbreaks have been
linked to the consumption of contaminated fruit juice (Vojdani, Beuchat,
& Tauxe, 2008). However, due to the acidity of juices, people were
rather unconcerned about the microbiological safety of juices,
L. monocytogenes can survive and proliferate over a vast range of adverse
environmental conditions encompassing refrigeration temperature, low
pH, and high salt (Lopes-Luz et al., 2021). Which makes
L. monocytogenes a significant health risk for raw produce juices. The
frequent use of traditional antimicrobials in the food industry have led

* Corresponding author.
** Corresponding author.
*** Corresponding author.
E-mail address: fexxl@scut.edu.cn (X. Xiao).
1
The co-first author.

https://doi.org/10.1016/j.lwt.2024.115770
Received 11 December 2023; Received in revised form 13 January 2024; Accepted 16 January 2024
Available online 29 January 2024
0023-6438/© 2024 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-
nc-nd/4.0/).
Y. Zhang et al.
to increasing resistance in L. monocytogenes (Olaimat et al., 2018).
Therefore, it is urgent to develop more efficient antimicrobial agents to
reduce food contamination.
Hop (Humulus lupulus) as a medicinal and edible plant, was only
known for its sedative (for insomnia) and antibacterial (beer-stabilizing)
characteristics for a long time. Many detailed studies found that hop
extracts and their derivatives (collectively called hop compounds) have
several other important biological properties such as estrogenic activity,
antioxidative activity, anti-inflammatory action, and several anticarci­
nogenic properties (Stulikova, Karabin, Nespor, & Dostalek, 2018). Hop
extracts have even been suggested as potential immunomodulators for
COVID-19 cases in a recent report (Lucas, Froellich-Nowoisky, Oppitz, &
Ackermann, 2021). Despite their excellent antibacterial and antioxidant
activity, hop extracts have not received much attention in the food in­
dustry until recently, due to the high concentration of unique β-acid that
can inhibit the growth of gram-positive bacteria even at surprisingly low
concentrations (Zhang et al., 2023). β-acid has been approved for use as
a generally recognized safe (GRAS) antimicrobial agent on cooked meat
by US-FDA and USDA-FSIS (US-FDA 2001; USDA-FSIS 2013). And it is a
mixture consisting of three homologues: co-lupulone (20–65 %),
n-lupulone (30–55 %), and ad-lupulin (10–15 %) (Steenackers, B., De
Cooman, L., & De Vos, 2015). Among them, co-lupulone has been
proven to be the most antibacterial activity ingredient (Wang et al.,
2022). Although β-acid has various potent biological activities, it is
easily oxidized even at very low temperatures (− 20 ◦ C) (N. E. de
Almeida, E.S. do Nascimento, D.R. Cardoso, 2012). While, hexahy­
dro-β-acid (the hydrogenated derivatives of β-acid) displays stronger
bacteriostatic activity and stability than β-acid (Liu, Tang, Liu, & Chen,
2008). Based on the above theories, it is reasonable to hydrotreat
co-lupulone to produce hexahydrocolupulone (HHCL) as a more stable
and efficient natural antibacterial agent.
In this study, HHCL was prepared as a new plant-derived antibac­
terial agent, and its antibacterial activity against L. monocytogenes was
evaluated for the first time. Fresh apple juice was used as a model to
investigate the application of HHCL in real food systems. Moreover,
transcriptomic analysis was also performed to investigate the compre­
hensive response of L. monocytogenes cells to HHCL stress to further
reflect and illustrate the potential antimicrobial mechanisms.
2. Materials and methods
2.1. Bacterial strains and materials
L. monocytogenes ATCC 19115 was provided by the Microbial Species
Preservation Center (Guangdong, China). Hop extracts were provided by
xinjiang sapporo agricultural science and technology development Co.
Ltd. (Urumqi, Xinjiang, China). Fresh apples “Fuji” were purchased from
a local market (Guangzhou, China) and juiced according to the method
reported in our previous study (Zhang et al., 2023).
2.2. Preparation and characterization of HHCL
The scheme for the preparation of HHCL is shown in Fig. S1. Briefly,
colupulone was separated from hop extracts, and then hydrogenated to
obtain HHCL. The structural characterization methods (includign
melting point determination, UV–vis, FT-IR, HRMS, and NMR spectral
analyses) of HHCL are shown in supplemental materials, and the results
are shown in Fig. S2.
2.3. Evaluation of antibacterial activity
2.3.1. Agar diffusion assay
L. monocytogenes were cultured overnight with shaking at 37 ◦ C, then
200 μl of bacterial dilution (1 × 107 CFU/ml) were evenly smeared on
BHI agar and filter papers (soaked in 100 μg/ml of β-acid or HHCL for 6
h) with a diameter of 6 mm were placed on the surface of the agar plates.
2
LWT 194 (2024) 115770
Ampicillin and 50 % ethanol solution were used as positive and negative
controls, respectively. After incubation at 37 ◦ C for 24 h, the diameter of
the inhibition zone (DIZ) was measured (mean ± SD).
2.3.2. Determination of minimum inhibitory concentration (MIC) and
minimum bactericidal concentration (MBC)
HHCL was diluted in BHI broth to obtain serial concentrations and
mixed with bacterial suspensions (approximately 1 × 106 CFU/ml) in
96-well microplates. The wells without bacteria or HHCL added were set
as negative or positive controls, respectively. Samples were incubated at
37 ◦ C for 24 h. The MIC value was defined as the lowest concentration of
HHCL which observable bacterial growth was not observed. The MBC
was defined as the lowest concentration of HHCL without observable
bacterial colonies on the surface of BHI agar plates.
2.3.3. Growth inhibitory assays in BHI broth
HHCL was added to fresh BHI broth with approximately 6 log CFU/
mL of L. monocytogenes to obtain the desired final concentrations (0, 1/
2MIC, MIC, 1/2MBC or MBC). All cultures were incubated at 37 ◦ C on a
rotary shaker (180 r/min) and then sampled at predetermined intervals.
The samples were serially diluted by 10-fold with sterilized saline so­
lution (0.85 %, m/v) and then mixed with warm BHI agar (approxi­
mately 50 ◦ C) by pour-plating method (Bai et al., 2019). Viable cells
were counted after 48 h of incubation at 37 ◦ C, and the logarithm of
CFU/mL (log10 CFU/mL) at each time point was calculated.
2.4. Antibacterial mechanism of HHCL against L. monocytogenes
L. monocytogenes cells were resuspended in BHI broth to a concen­
tration of approximately 1 × 107 CFU/mL. Then, the bacterial suspen­
sions were treated with HHCL (MIC，1/2MBC or MBC) or PBS instead of
HHCL (the negative control) and incubated at 37 ◦ C for 6 h. Subse­
quently, all the samples were centrifuged to obtained supernatant and
pelleted cells for the following tests.
2.4.1. Determination of alkaline phosphatase (AKP) content, propidium
iodide（PI）uptake, protein and nucleic acid leakage
The AKP activity of different samples was measured by an AKP
detection kit (Jiancheng Bioengineering Institute, Jiangsu, China) using
the aforementioned supernatant according to the manufacturer’s in­
structions. Different treated cells were suspended in PBS and stained
with PI (10 μg/mL) in the dark for 30 min at room temperature. Then,
the fluorescence intensity (λex/λem = 495/625 nm) was detected using
a multimode reader (Tecan, Infinite™ M200 PRO, Männedorf,
Switzerland) to evaluate the PI uptake (Li, Zhang, Addo, Yu, & Xiao,
2022). As for the determination of protein and nucleic acid leakage, all
samples were sampled at predetermined intervals (at 0, 1.0, 2.0, 4.0, and
6.0 h) during incubation and then obtained supernatants by centrifu­
gation. The leakage of nucleic acids was evaluated according to the
OD260 of each supernatant, and the leakage of protein was measured
with a BCA protein assay kit.
2.4.2. Determination of adenosine triphosphate (ATP) concentration and
cellular ATPase activity
Different treated cells were resuspended in saline solution for ul­
trasonic processing (power 300 W, interval 1.1 s, 10 min) in an ice bath.
The intracellular ATP concentration and total ATPase activity of
L. monocytogenes exposed to different concentrations of HHCL were
determined using detection kits (Jiancheng Bioengineering Institute,
Jiangsu, China) according to the manufacturer’s instructions.
2.4.3. Determination of metabolic activity and the activity of respiratory
chain dehydrogenase
The metabolic activity of bacteria was measured using resazurin
(Zhu, Li, Cui, & Lin, 2019). Different treated cells were sampled at
predetermined intervals (at 0, 1.0, 2.0, 4.0, and 6.0 h) during incubation
Y. Zhang et al. LWT 194 (2024) 115770

at 37 ◦ C, each sample was mixed with resazurin (100 μg/ml) and then
incubated at 30 ◦ C for 2 h in the dark. Subsequently, the cultured mix­
tures were centrifuged to collect the supernatants for the determination
of fluorescence intensity (λex/λem = 560/590 nm).
The activity of respiratory chain dehydrogenase was measured using
iodonitrotetrazolium chloride (INT) (Guo et al., 2021). Briefly, different
treated cells were resuspended with saline solution, then 1350 μL of
each bacterial suspension was mixed with 150 μL INT solution (0.01
mol/L). Following, the mixtures were incubated at 30 ◦ C for 30 min in
the dark and measured absorbance at 630 nm using a UV–vis spectro­
photometer (UV-1800,Shimadzu Corporation Co., Ltd., Japan).
2.4.4. DNA damage and whole-cell protein analysis
DNA damage assay and whole-cell protein assay were performed
respectively based on the method of Zhou et al. (Zhou, Chen, Ouyang,
Zhang, & Wang, 2023) and Kang et al. (Kang, Liu, Wu, Sun, & Liu, 2018)
with some modifications. Different treated cells were used to extract
genomic DNA using a bacterial genomic DNA extraction kit (Sangon
Biotech Co., Ltd, Shanghai, China) following the manufacturer’s in­
structions. Subsequently, the extracted DNA was dissolved in TE buffer
(10 mM Tris-HCl, 1 mM EDTA, and pH 8.0), 5 μL of DNA (100 ng/μL)
was mixed with 1 μL of 6 × loading buffer, and the mixture was sub­
jected to electrophoresis on a 1 % agarose gel. Gel retardation was
imaged with a GelDoc XR gel imaging system (Bio-Rad, USA).
For the whole-cell protein assay, the prepared suspensions of
L. monocytogenes were disrupted by ultrasonic wave treatment for 10
min (200 w, working 20 s, pause 10 s) in an ice bath and then centri­
fuged to obtain supernatant. Subsequently, the supernatant (50 μL) of
each sample was mixed with SDS-PAGE loading buffer (10 μL, 6X). All
mixtures were boiled for 5 min, cooled on ice, and used for SDS-PAGE
analysis after short centrifugation. The protein bands were stained
with Coomassie brilliant blue R-250 in gel and imaged with a GelDoc XR
gel imaging system.
2.4.5. Scanning electron microscopy field emission scanning electron
microscopy (FESEM) and transmission electron microscopy (TEM)
FESEM and TEM assay was performed according to previous study
(Guo et al., 2021). Different treated cells were mixed with glutaralde­
hyde (2.5 %, v/v) at 4 ◦ C overnight. Subsequently, the samples were
dehydrated gradually in graded ethanol (10, 30, 50, 70, 90, and 100 %,
v/v) for 15 min. The cells were then air-dried, gold-coated, and exam­
ined under a FESEM (ZEISS GeminiSEM 500). The preparation for the
TEM was the same as that used for the FESEM. The cells were fixed with
glutaraldehyde (5 %, v/v) and osmium tetroxide (1 %, w/v), dehydrated
with alcohol, embedded in white resin, and then sliced, and stained with
a lead citrate solution and uranyl acetate. The final samples were then
viewed by a Hitachi HT7700 microscope (Tokyo, Japan).
evaluated in terms of color, odor, taste, cloudiness, and general
acceptability by 10 trained panelists using a 9-point hedonic scale (1
meant extremely dislike, 9 meant extremely like, and 6 was considered
as the lower limit of acceptability).
2.6. Transcriptomic assays
2.6.1. Preparation of samples for transcriptomic
Based on the results of section 2.5, the protocol of this experiment
was set as: L. monocytogenes (approximately 1 × 108 CFU/mL) in apple
juice was treated with 0 or sub-lethal concentration (12.5 μg/ml) of
HHCL respectively for 30 min. Then, the bacteria cells were collected
and washed with PBS， the obtained cells were put into liquid nitrogen
for quick freezing and finally stored at − 80 ◦ C for RNA extraction.
2.6.2. Total RNA extraction, cDNA library preparation and sequencing
The total RNA of L. monocytogenes cells was extracted and isolated by
the Trizol method (Liu et al., 2023). A Nanodrop microspectrophotom­
eter (Thermo Fisher Scientific, Nanodrop 2000; China) was used to
determine the concentration and purity of the extracted RNA. Agarose
gel electrophoresis and Agilent 4200 Bio-analyzer (Agilent Technolo­
gies) were used to evaluate and select the RNA of the samples. The
method of constructing RNA library and sequencing is referred to Zhou
et al. (Zhou et al., 2020). The cDNA library was sequenced using the
Illumina HiSeq™2500.
2.6.3. Transcriptomic data analysis
The raw reads were filtered referring to Li et al. (Li et al., 2022) to
discard low-quality readings, including 10 % unknown nucleotides and
>50 % bases. The short sequence alignment tool Bowtie2 was used to
map clean reads to reference the genome index. The estimation of gene
expression was normalized by the FPKM (fragments per kilobase of exon
model per million reads mapped) method. The different expression of
genes (DEGs) were identified by edgeR software, based on |log2 FC (Fold
Change)| ≥1 and FDR ≤0.05. The DEGs were then enriched by GO
function and KEGG pathways, respectively (p < 0.05).
2.7. Real-time qPCR (RT-qPCR) validation
Several DEGs from the key KEGG pathways were verified by RT-
qPCR. The L. monocytogenes treatment and RNA extraction were per­
formed with the same method used in RNA sequencing analysis. The
primers used in this study were presented in Table 1, and the 16S rRNA
bacterial housekeeping gene was used as an internal standard to
Table 1
Primer pairs used for RT-qPCR validation.

2.5. Application of HHCL in apple juice Gene name Primer pair (5′- 3′) Reference

murE (F)GCTCGTTGGGATTACTGGG (Liu et al., 2023)

2.5.1. Survival of L. monocytogenes treated with HHCL in apple juice (R)AGTGAGGCTATCTGGCGTTG
pyk (F)CCTAATGGTTGCTCGTGGTG Azi et al. (2022)
Bacterial suspensions of L. monocytogenes (approximately 1 × 108
(R)TCTTCCACAACAACTGCAGC
CFU/mL) were inoculated into 50 mL of apple juice with different znuB (F)AGCCATGTGACTCTAGGTGG Azi et al. (2022)
concentrations of HHCL (0, MIC, 1/2MBC, MBC) and incubated at 37 ◦ C (R)CCACCTAGAGTCACATGGCT
for 120 min. The number of bacteria was counted by pour-plating pstA (F)TAGGGCTATTCGGTTTCCTT Suo et al. (2018)
method every 15 min. (R)AAGTGCCTCTTCGACAACAC
pstC (F)CGTTCCATTTATTCGTGACC Suo et al. (2018)
(R)AGCTTCTCGGTAGTGACGTG
2.5.2. The total viable counts (TVC) atpB (F)GAAATCTGCAACGCCGACC ( Liu et al., 2023)
Fresh apple juice was treated with different concentrations of HHCL (R)CAAGTACATGGAATCTCCCACC
(0, MIC, 1/2MBC, MBC) and stocked at 4 ◦ C. The TVC in apple juice was cydA (F)TTGGAGCTTCCGTATCAT Gao et al. (2019)
(R)TGTCGCCCTATTTCTGTC
measured following the Chinese National Standard (GB/T 4789.2–2016)
rpoB (F)CGTCGTCTTCGTTCTGTTGG Gao et al. (2019)
every 2 days. (R)GTTCACGAACCACACGTTCC
tuf (F)CCAATGTTGTCGCCAGCTTC Kokkoni et al. (2021)
2.5.3. Sensory evaluation (R)GCAACTGGACGTGTTGAACG
The apple juice samples were prepared as described in section 2.5.2 16S rRNA (F)ACCGTCAAGGGACAAGCA Miao et al. (2019)
(R)GGGAGGCAGCAGTAGGGA
and stored at 4 ◦ C for 4 h. The sensory properties of apple juice were

3
Y. Zhang et al.
normalize the expression levels.
2.8. Statistical analysis
All experiments were performed with three biological replicates and
the results are presented as the mean ± standard deviation (SD), and
plotted with Origin 8.5. The significance of differences (p < 0.05) was
analyzed by one-way analysis of variance (ANOVA) using the statistical
software SPSS Statistics 22.0 (IBM, USA).
3. Results and discussion
3.1. Antibacterial activity of HHCL
Based on the speculation mentioned above, the antibacterial activity
of β-acid and HHCL against L. monocytogenes was investigated. As shown
in Fig. 1A, the DIZ, MIC, and MBC of HHCL were 21.87 ± 0.96 mm, 0.4
μg/mL and 50 μg/mL, respectively. While β-acid with values of 11.83 ±
0.74 mm, 3.2 μg/mL, and 200 μg/mL, respectively. These results indi­
cated that HHCL is an excellent antimicrobial agent and is more bacte­
riostatic than β-acid on L. monocytogenes, which is consistent with our
speculation. Hence, HHCL was chosen as the potential antibacterial
agent for the following studies.
To further confirm the inhibitory effect of HHCL on L. monocytogenes,
time-dependent kinetic curves were established, L. monocytogenes
growth was inhibited by HHCL when compared to untreated cells
(Fig. 1B). 1/2 MIC of HHCL induced a retardation period of about 4 h,
followed by normal growth, MIC of HHCL completely inhibited the
growth of L. monocytogenes in BHI. Additionally, L. monocytogenes
treated with HHCL at MBC were completely killed after 1 h of treatment.
These findings supported the rapid bactericidal effect of HHCL on
L. monocytogenes.
3.2. Antibacterial mechanism
3.2.1. Effect of HHCL on cell wall
AKP is mainly located between the bacterial cell wall and cell
membrane under normal physiological conditions (Pramanik et al.,
2017). When the cell walls are damaged, AKP leaks into the extracellular
milieu, increasing extracellular AKP activity. According to Fig. 2A,
extracellular AKP activity increased obviously（p < 0.05）at the first
hour of HHCL treatment and increased continuously throughout the
experimental time with the increase of treatment time or HHCL con­
centration, which revealed that the cell wall was damaged under HHCL
Fig. 1. The antibacterial activity of HHCL against L. monocytogenes: (A) The image of the zone of inhibition. (B) Time-dependent kinetic curves of L. monocytogenes
treated with HHCL in BHI broth.
4
LWT 194 (2024) 115770
stress. He et al. (2023) have also reported similar findings in
L. monocytogenes treated with linalool. Therefore, we speculated that the
destruction of cell wall integrity may be related to the antibacterial
mechanism of HHCL.
3.2.2. Effect of HHCL on cell membrane
The impact of HHCL on the cell membrane permeability and integ­
rity was evaluated by measuring PI uptake and the leakage of intracel­
lular components (including proteins and nucleic acids). PI is a nucleic
acid dye that cannot penetrate living cells, but only penetrates the cell
membrane of damaged cells and binds to nucleic acids, resulting in
increased fluorescence intensity (Li, Lu, Duan, Yang, & Tang, 2020). As
illustrated in Fig. 2B, the fluorescence intensity was enhanced with
increasing concentrations of HHCL. A similar trend was observed in the
protein and nucleic acid leakage (Fig. 2C and D). These findings were
similar to recent studies by Azi et al. (Azi, Li, Xu, & Dong, 2022) and Liu
et al. (Liu et al., 2023). These results suggested that HHCL is a
membrane-active product that may damage the cellular membrane and
cause intracellular substance leak, thereby affecting the maintenance of
normal physiological functions of L. monocytogenes and even resulting in
cell death.
3.2.3. Effect of HHCL on ATP concentration and cellular ATPase activity
As observed in Fig. 2E and F, with the increase in HHCL concentra­
tion, both intracellular ATP concentration and total ATPase activity
dropped considerably (p < 0.05) in HHCL-treated cells compared to the
control group. The observed trend was similar to the previous reports
from Kang et al. (Kang, Liu, Liu, & Wang, 2020). It was thus speculated
that HHCL could reduce intracellular ATP levels and ATPase activity,
both of which are vital for the growth of L. monocytogenes.
3.2.4. Effect of HHCL on the respiratory metabolism of the cells
Metabolic respiration is considered to be the primary process of
energy producing for most bacteria during germination and growth.
Additionally, the respiratory system is a popular target for antimicrobial
agents (Yang et al., 2016). Resazurin is a weak fluorescent dye, which
can be degraded into high fluorescence resorufin by various oxidore­
ductase enzymes in cells. Hence, the changes in fluorescence intensity
can be used to assess the metabolic activity in treated cells (Zhu et al.,
2019). As shown in Fig. 2G, the metabolism capacity of HHCL-treated
L. monocytogenes decreased with the increase of treatment time or
HHCL concentrations. A similar trend was observed in the result of the
determination of respiratory chain dehydrogenase activity (Fig. 2H).
Respiratory chain dehydrogenase converts the colorless
Y. Zhang et al. LWT 194 (2024) 115770

Fig. 2. Effect of treatment with different concentration of HHCL on extracellular AKP content (A), PI uptake (B), the leakage of protein (C), the leakage of nucleic
acids (D), the intracellular ATP concentration (E), total ATPase activity (F), metabolic activity (G), and respiratory chain dehydrogenase (H) of L. monocytogenes.
Each value indicated the average of three independent determinations.

5
Y. Zhang et al.
iodonitrotetrazolium chloride (INT) to dark red iodonitrotetrazolium
formazan (INF), hence the loss of respiratory chain enzymatic activity
can be assessed by the decrease in the spectrophotometric value of INF.
Previous studies (Guo et al., 2021) have shown that bacteriostatic agents
can penetrate the extracellular membrane, peptidoglycan and periplas­
mic barriers and damage respiratory chain dehydrogenase thereby
inhibiting cellular respiration. These results indicated that HHCL
inhibited the respiratory metabolism of the L. monocytogenes cells.
3.2.5. Effect of HHCL on DNA and whole-cell protein
To evaluate the effect of HHCL on the genomic DNA of
L. monocytogenes, agarose gel electrophoresis was performed. As shown
in Fig. 3A, the genomic DNA electrophoretogram for untreated bacteria
(Lane 1) exhibits clear and brilliant DNA bands. However, in the HHCL-
treated groups, DNA bands (Lane 2, 3, and 4) faded with the increasing
concentrations of HHCL. A similar trend was observed in the SDS-PAGE
profiles of whole-cell protein（Fig. 3B）, which was considered to be
either intracellular component leakage caused by membrane damage or
interference of HHCL on nucleic acid metabolism and protein synthesis.
Similar findings were reported by Zhou et al. (Zhou et al., 2023) and He
et al. (He et al., 2023).
3.2.6. Effect of HHCL on the ultrastructure of L. monocytogenes
The surface morphological and intracellular structural changes be­
tween untreated and HHCL-treated cells were observed using FESEM
and TEM. As shown in Fig. 4A and B, the untreated L. monocytogenes
cells are plump and have complete, clear profiles, intact membrane
structure, and uniform cytoplasm region. After treatment with HHCL at
MIC, the cell membrane was wrinkled and shrunken (shown with green
arrow), large areas of electron-permeable regions were detected (the
cytoplasm became bright shown with yellow arrow), blebs or vacuoles
were observed next to the cell membrane (shown with blue arrow), but
the cell membrane and wall remained intact. HHCL at MBC caused more
serious cell damage, including more significant electron penetration,
broken membrane and wall, and the leakage of cytoplasm (shown with
red arrow). Besides, cytoplasm without cell membrane was observed
(shown with purple arrow). Similar morphological changes were also
presented when L. monocytogenes were exposed to lipopeptide brevila­
terin B (Liu et al., 2023). The photomicrograph images supported the
results of extracellular AKP activity, PI uptake, protein and nucleic acid
leakage analyses.
Fig. 3. The effect of HHCL on the genomic DNA (A), and SDS-PAGE profile (B) of L. monocytogenes. Lane M: Marker; Lane 1: the control group of L. monocytogenes;
Lane 2–4: L. monocytogenes were treated with MIC, 1/2 MBC, and MBC concentration of HHCL, respectively.
6
LWT 194 (2024) 115770
3.3. Antibacterial activity of HHCL in apple juice and sensory evaluation
The preservation ability of HHCL as a plant-derived agent was
explored using fresh apple juice as a food model. As shown in Fig. 5A,
HHCL at MIC caused no significant reduction in the number of
L. monocytogenes, which was mutually supported by the result of growth
inhibitory assays in BHI broth. These findings suggested that a MIC dose
of HHCL can only inhibit L. monocytogenes growth but not kill them.
When treated with HHCL at 1/2MBC and MBC levels, the number of
bacteria dropped by 5.65 and 7.36 logs in 30 min, respectively. Such a
significant reduction revealed the excellent antibacterial efficacy of
HHCL against L. monocytogenes. Interestingly, we found that HHCL
exhibited stronger antibacterial efficacy against L. monocytogenes
growing in apple juice than those surviving in the BHI medium
(comparing Fig. 1B with Fig. 5A). It might be attributable to the acidity
of apple juice. HHCL is a weak acid that is only active in its undissociated
form, the low pH environment (apple juice) increased the amount of
undissociated HHCL molecules, resulting in an increased antimicrobial
activity due to a facilitated uptake into the bacterial cells.
The TVC in apple juice during storage was shown in Fig. 5B. TVC in
HHCL-treated samples dropped dramatically even on the first day of
treatment, and significantly lower than that in the control group
throughout the storage period, remaining below the limit of acceptable
level (2 log CFU/mL). Suggesting that HHCL can ensure the microbial
safety of apple juice during storage. Similarly, Hauser C. et al. (2015)
reported that the addition of hop compounds reduced the TVC in
fresh-cut endive salad and cantaloupe. Furthermore, freshly squeezed
apple juice often loses commercial value due to browning soon after
preparation. As seen from the results of sensory evaluation (Fig. 5C),
HHCL treatment has no adverse effect on the quality of apple juice, and
significantly delayed its browning, which may be attributed to the
antioxidant properties of HHCL. Overall, HHCL can be used as a new
antiseptic and freshening agent to extend the shelf life of fresh apple
juice.
3.4. Global analysis of the transcriptomic response and RT-qPCR
validation
RNA-Seq was performed to analyze the global gene expression pro­
file changes of L. monocytogenes after HHCL treatment. As depicted in the
volcano plot (Fig. 6A)， a total of 1825 DEGs（|log2FC| ≥ 1, FDR
<0.05）were identified among which 1488 were down-regulated and
337 were up-regulated. These data revealed noteworthy differences
Y. Zhang et al.
Fig. 4. The SEM(A) and TEM(B) photomicrograph images of the cells show the effect of HHCL on L. monocytogenes cells untreated or treated with HHCL. The yellow,
blue, green, red, and purple arrows indicated electron-permeable regions, blebs or vacuoles, wrinkled and shrunken membranes, cytoplasmic contents, and cytoplasm
without cell membrane, respectively. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)
between the treated and control groups, which was essential for figuring
out the critical antibacterial mechanism of HHCL stress to
L. monocytogenes. Besides, 9 genes from the key KEGG pathways were
selected randomly for RT-qPCR analysis. According to the results pre­
sented in Fig. 6B, the data of RT-qPCR was correlated well with that of
RNA-seq (R2 = 0.8992), indicating that the data from the RNA-Seq re­
sults were reliable.
GO function and KEGG pathways analysis were combined to further
explore the antibacterial mechanism of HHCL stress to L. monocytogenes.
GO function annotation of all the DEGs was classified into three groups
(Fig. 6C): biological process (BP), cellular component (CC), and mo­
lecular function (MF). The majority of DEGs were annotated in the
cellular process, metabolic process, and single-organism process in BP,
cell and membrane in CC, binding, catalytic activity and transporter
activity in MF. According to KEGG enrichment results (Fig. 6D), DEGs
were significantly enriched to 23 pathways, including 12 Metabolism
(M) pathways, 4 Genetic Information Processing (GIP) pathways, 3
Cellular Processes (CP) pathways, 2 Environmental Information Pro­
cessing（EIP) pathways, and 2 Organismal Systems（OS）pathways.
Additionally, KEGG annotation results showed that 662 DEGs were
successfully matched to 115 KEGG pathways, and the first 20 signifi­
cantly altered pathways were presented in Fig. 6E. Based on the iden­
tified DEGs and enrich analysis, several crucial pathways or genes
(Table S1）were screened out for further analysis as below.
3.4.1. Cell wall damage
Peptidoglycan and teichoic acid are major components of the cell
wall of gram-positive bacteria, and both are required for cell wall
maintenance, antimicrobial susceptibility, biofilm formation, and host
interaction.
Amino sugar and nucleotide sugar are critical pools that provide key
precursors for the fundamental metabolic processes of peptidoglycan
and cell wall teichoic acid biosynthesis. Down-regulated expression of
related genes (glmMSUQ) suggested that HHCL possibly influence
peptidoglycan and teichoic acid synthesis of L. monocytogenes by
limiting amino sugar and nucleotide sugar metabolism (Suo, Gao,
7
LWT 194 (2024) 115770
Baranzoni, Xie, & Liu, 2018). Peptidoglycan synthesis primarily involves
the intracellular synthesis of repeating units of N-acetylglucosamine,
N-acetylmuramic acid and peptide chains, assembly and transport of
Lipid II in the membrane, and peptidoglycan cross-linking (Beeby,
Gumbart, Roux, & Jensen, 2013). DEGs murACDE and mraY which are
involved in the synthesis, modification and cross-linking of Lipid II and
yodJ which catalyzes the conversion UDP-N-acetylmuramate to pepti­
doglycan were down-regulated. DEGs (cpoA, SF2094, mrcA, yqgF, pbpF,
dacA) involved in peptidoglycan cross-linking (Liu et al., 2023) were
found to be up-regulated. Besides, the synthesis of L-lysine and meso-2,
6-Diaminopimelate were limited, they are important components
involved in peptidoglycan synthesis. These findings suggested that
HHCL significantly disturbed the synthesis of peptidoglycan.
Equally, DEGs involved in teichoic acid biosynthesis and transport,
as well as modification were also down-regulated, including mnaA, tagD,
tagO, gtcA, and dlt operon genes (dltABCD). Of which, mnaA has been
identified to play an important role in teichoic acid synthesis in
L. monocytogenes (Dubail et al., 2006). The dlt operon genes work to
reduce the net negative charge of the cell envelope by incorporating
D-alanine residues into the cell wall-associated lipoteichoic acids. These
molecular modifications of cell envelope constituents are essential for
cationic antimicrobial peptide (CAMP) resistance, virulence and biofilm
formation in L. monocytogenes (Alonso, Perry, Regeimbal, Regan, &
Higgins, 2014; Kang, Wiedmann, Boor, & Bergholz, 2015).
In summary, these results indicated that HHCL specifically damaged
the cell wall of L. monocytogenes by impeding the biosynthesis of
peptidoglycan and teichoic acids, which supported the results of the AKP
activity assay and SEM/TEM observation.
3.4.2. Cell membrane damage
Several DEGs encoding membrane-associated proteins were down-
regulated after HHCL treatment, including yhdP, yqfU, ydbI, yidC1,
and Lm4b_01683, directly that the integrity of the cytoplasmic mem­
brane has been disrupted. Besides, genes kdpABCDE, which are related
to K+ transport, as well as nhaK and mrpE, which are involved in pH
homeostasis and catalyze Na+ efflux and proton absorption were
Y. Zhang et al. LWT 194 (2024) 115770

membranes, genes encoding important intermediate enzymes in the

glycerophospholipid metabolic pathway were disturbed by HHCL,
including glpD, plsY, plsC and pgsA were significantly down-regulated,
dagK, cdsA and cls were up-regulated. This indicated that glycer­
ophospholipid metabolism has been disrupted and cell membranes may
have been irreversibly damaged.
Fatty acids, as the hydrophobic end of phospholipids and lipopoly­
saccharides, play an important role in cell membrane permeability.
DEGs accABC, which encode subunits of the acetyl-CoA carboxylase
enzyme, were down-regulated. The acetyl-CoA carboxylase enzyme is
involved in the first step of fatty acid biosynthesis and is generally
considered the key rate-limiting enzyme in fatty acid biosynthesis
(Casey et al., 2014). DEGs acpP, plsX, and fab genes (fabDFGIKLV) were
all down-regulated, they encode acyl carrier proteins that are respon­
sible for the series of condensation, reduction, dehydration and elon­
gation steps of fatty acid synthesis. These findings suggested that
exposure to HHCL resulted in an inhibition of fatty acid synthesis,
thereby disrupting the permeability and fluidity of the cell membrane in
L. monocytogenes. This result was consistent with previous studies that
indicated the cell membrane was the target for the antibacterial activity
of hop compounds (Zhang et al., 2023).

3.4.3. Membrane transport

ABC transporters are one of the most extensive families of trans­
membrane transporters. They are responsible for transporting various
substrates across cell membranes and are mainly involved in nutrient
absorption and the export of bacterial toxins and harmful substances
(Xie, Jian, Jin, & Xiao, 2018). In this study, most of the DEGs associated
with ABC transporters were down-regulated after exposed to HHCL.
DEGs involved in metal cation transport, including fhuBG, cbiO, mod­
ABC, znuAB, and mntABCH were down-regulated. Metal ions are
required for bacterial survival and proliferation, they contribute to the
function of numerous cellular proteins, bacterial metabolism and
various virulence factors, as well as pathogen microorganism infection
(Schalk & Cunrath, 2016). Amino acids are important elements in mi­
crobial carbon and nitrogen metabolism (Hosie & Poole, 2001). Hence,
the reduction in amino acid intake of D-methionine (metIQN), L-cystine
(tcyN), and glutamine (glnP, glnQ) might disrupt carbon or nitrogen
metabolism in HHCL-treated L. monocytogenes. Betaine is the most
reactive natural osmotic protection chemical of bacteria (Angelidis &
Smith, 2003), the significant down-regulation of the genes (opuCA-D)
involved in the ABC-type glycine betaine transport system might be a
response of L. monocytogenes to the osmotic imbalance stress. In addi­
tion, DEGs involved in oligopeptide permease transport (oppABCDF),
sugar transport (msmX, ganOPQ) and general nucleoside transport
(nupOPQ) were down-regulated, which might be a derived effect of cell
membrane damage.
In contrast, DEGs involved in phosphate transport (pstABCS)，
multidrug/hemolysin transport(lnrL) and multidrug efflux pump (yheI，
exp8, yfiB) were up-regulated. Phosphate transporters have been
demonstrated to be involved in osmotic regulation and phosphate uti­
lization, and the bacterial pst operon could be activated during phos­
phate starvation, promoting inorganic phosphate uptake (Panhorst,
Sorger-Herrmann, & Wendisch, 2011). Consequently, increased pst
gene expression indicated that HHCL stress caused phosphate starvation
and osmotic dysregulation in L. monocytogenes.
Fig. 5. (A) Survival rate of L. monocytogenes treated with HHCL in apple juice.
(B) The TVC in apple juice during storage. (C) Sensory evaluation of fresh
apple juice.
3.4.4. Energy metabolism disorder
Glycolysis, TCA cycle, and oxidative phosphorylation are vital
pathways to provide energy for cell activity. In this study, DEGs
observed down-regulated. These were generally regarded as symptoms
including glk, pgi, fba, tpiA, gapA, gpmA, gpmI, eno and pyk that are
of membrane damage (Liu et al., 2020).
involved in the glycolytic pathway were significantly down-regulated by
Aside from those indicated above, numerous other genes are
HHCL. Among them, gene glk is in charge of the first step in glycolysis,
involved in membrane integrity and fluidity, including genes associated
pgi converts glucose 6-phosphate to fructose 6-phosphate reversibly,
with the biosynthesis and metabolism of glycerophospholipids and fatty
which is a required process for upstream glycolysis and gluconeogenesis.
acids. Glycerophospholipids are important components of cell
GpmA and GpmI, which catalyze the interconversion of 2-

8
Y. Zhang et al.
Fig. 6. (A)Volcano plots of DEGs. (B) RT-qPCR validations. (C) GO classification of DEGs. (D) KEGG enrichment analysis. (E) Top 20 pathways of KEGG enrichment.
phosphoglycerate and 3-phosphoglycerate, are considered potential
targets for novel antibiotics (Davies et al., 2011). In addition, most of the
DEGs involved in carbohydrate-specific EII components in the PTS sys­
tem (Table S1）were downregulated, implying that sugar uptake was
blocked and glycolysis was constrained by the lack of substrate supply to
provide energy (Zhao et al., 2022). Interestingly, pfkA and fruK,
encoding phosphofructokinase, were up-regulated to promote the uti­
lization of preferred carbon sources. This resistance response might be
an adaptive strategy of L. monocytogenes in response to the starvation
stress caused by HHCL.
Acetyl-coenzyme A (acetyl-CoA) is an integral ingredient of energy
metabolism that can interact with a variety of anabolic pathways. The
down-regulated expression of pdhABC and porA indicated that the syn­
thesis of acetyl-CoA was inhibited, which would directly impact the
supply of substrates for the TCA cycle. In terms of TCA, DEGs citZ, citB,
icd, pdhD, and frdA that are involved in key enzymes were down-
regulated. These genes were also found to be limited by thymol and
cinnamaldehyde thereby limiting the TCA cycle of L. monocytogenes
(Liang et al., 2022). These findings suggested that the TCA cycle was
severely suppressed by HHCL. As a result, amino acid metabolism,
cellular respiration, and energy supply may suffer.
9
LWT 194 (2024) 115770
Oxidative phosphorylation is dependent on the electron transport
chain (ETC), which is the major aerobic ATP synthesis pathway in cells.
The NADH and FADH2 produced during the TCA cycle participate in
oxidative phosphorylation via ETC and ultimately produce energy, a
process in which numerous oxidoreductases are involved. In this study,
yumB was down-regulated, implying that the first step of electron
transport was inhibited. In addition, DEGs involved in succinate dehy­
drogenase (frdA), cytochrome bd panthenol oxidase (cydABCD), cyto­
chrome aa3-type oxidase (qoxABCD), the cytochrome c oxidase(ctaA)
and heme o synthase(ctaB) were all down-regulated, suggesting that the
ETC was obstructed. Likewise, DEGs associated with F-type ATPase
(atpABD) and oxidoreductase (ppaC, ppaX) were all down-regulated,
suggesting that ATP synthesis was inhibited.
Taken together, HHCL restricted energy production in
L. monocytogenes through several pathways. These findings matched the
observations that ATP levels and ATPase activity were rapidly reduced
(Fig. 2E and F). Similar results were reported in recent studies when
L. monocytogenes (Liu et al., 2023) or Staphylococcus aureus (Ma et al.,
2023) were exposed to brevilaterin or monocaprin, respectively. As a
result, it is reasonable to speculate that HHCL would impede more
physiological and metabolic functions by inhibiting cellular respiration
Y. Zhang et al.
Fig. 6. (continued).
and ATP synthesis, ultimately leading to cell death.
3.4.5. Protein biosynthesis
Except for the above different pathways, protein biosynthesis was
also remarkably hampered by HHCL. In bacteria, ribosome is the main
site of protein translation, where proteins are synthesized from mRNA
templates. Bacterial ribosomes are made up of 30S and 50S ribonu­
cleoprotein subunits with many antibiotic-binding sites (Hong, Zeng, &
Xie, 2014). In this study, a large amount of 30S and 50S
ribosome-related genes (Table S1) were up-regulated by HHCL. A
plausible explanation is that HHCL treatment caused a severe loss of
intracellular protein (Fig. 3B) and activated ribosome expression at the
site of protein synthesis (He et al., 2023). The translation initiation
factor is a crucial component of protein synthesis, therefore, the
up-regulated expression of infA and infC exactly revealed the require­
ment of bacteria for protein synthesis under HHCL stress. However,
DEGs including rsmE, rnc, rbgA, rnhB, prmA and tgt are related to ribo­
some enzymes during protein translation, and secG, secDF, yajC, secA
that encode intracellular transmembrane protein transporters were
significantly downregulated. Additionally, genes involved in
ribosome-binding factor, transcriptional regulatory protein, transcrip­
tion termination protein NusG, proteins elongation factor Tu, and
elongation factor G, including rbfA, lin0388, nusG and tuf were down­
regulated. Overall, HHCL blocked the transcription process, disturbed
the normal assembly of ribosomes and the translation process, resulting
in an inhibition of protein synthesis and prevention of bacterial growth.
These findings were consistent with a recent study that indicated phe­
nolics inhibited transcription and translation and consequently sup­
pressed the synthesis of protein in Escherichia coli 0157:H7 and
L. monocytogenes (Azi et al., 2022). The –OH in the structure of HHCL
might work similarly to that in phenolics as described in the literature.
3.4.6. DNA replication and repair
DNA is one of the most basic biological molecules, the replication
and repair of DNA are essential for bacterial growth. Enzymes respon­
sible for DNA replication are often considered appropriate targets for
10
LWT 194 (2024) 115770
antimicrobial agents. In this work, HHCL induced differential expression
of several genes encoding enzymes involved in DNA replication. DNA
polymerase III holoenzyme catalyzes the elongation of DNA chains and
contributes to the high-speed synthesis of DNA in bacteria (He et al.,
2023). It involves several genes including dnaE, polC, dnaN, holB, and
dnaX. Among them, polC and dnaE have been demonstrated to be
necessary for DNA replication in gram-positive bacteria, and inactiva­
tion of either polC or dnaE was bactericidal (Inoue et al., 2001). In our
study, polC was distinctly downregulated (2.32-fold) by HHCL. Also,
topA, topB, dps and ada were all down-regulated. Dps family proteins
have been reported to nonspecifically bind to DNA to protect DNA
molecules from oxidative stress (Chiancone, 2008). Ada is a protein that
participates in both transcriptional regulation and DNA damage repair,
ada-deficient cells (Δada) increased the frequency of mutations (Uphoff
et al., 2016). Therefore, the down-regulation of these genes indicated
that HHCL caused DNA damage, disrupted both transcriptional regula­
tion and DNA repair systems, and might have potentially resulted in
DNA mutations in L. monocytogenes. Conversely, dnaG, rnhB and rnhC,
and ssb1 were all up-regulated, which would contribute to the reduction
of DNA damage and repair of damaged DNA. It might be an adaptive
strategy for L. monocytogenes to cope with HHCL stress.
To alleviate the negative effects of DNA damage, cells would initiate
several repair mechanisms, including nucleotide excision repair,
mismatch repair and base excision repair (Yu, Wang, Cui, & Wang,
2018). Among them, nucleotide excision repair is the major DNA repair
mechanism in all cellular organisms (Hu, Selby, Adar, Adebali, & San­
car, 2017), base excision repair works to protect genome integrity by
eliminating potentially mutated oxidative DNA base damage (He et al.,
2023). In this study, most of the DEGs involved in DNA repair, including
ligA， mfd， HI_0387，uvrA，uvrC, pcrA (uvrD), polC,dnaE, dnaN, holB,
dnaX,recN, mutL, mutS, xseA, xseB, exoA, nfo, ung1, ung2 and
Lm4b_00947 were all downregulated, recJ, mutM, and nth were
up-regulated, suggesting that HHCL blocked the DNA replication and
repair mechanisms in L. monocytogenes, inhibiting DNA synthesis and
increasing the rate of DNA mutation, thereby resulting in cellular
dysfunction in bacteria and growth inhibition or cell death.
Y. Zhang et al. LWT 194 (2024) 115770

4. Conclusion CRediT authorship contribution statement

To sum up, we prepared a new plant-derived antibacterial agent Yan Zhang: Writing – original draft, Methodology, Investigation,
(HHCL) from hot extracts. HHCL inhibited the growth of Formal analysis, Data curation, Conceptualization. Na Xia: Formal
L. monocytogenes at surprisingly low concentrations (MIC = 0.4 μg/mL), analysis. Xinglong Xiao: Funding acquisition, Conceptualization.
which was three orders of magnitude lower than that of common plant Fengsong Liu: Investigation, Formal analysis. Yuanyuan Liu: Investi­
essential oils. Furthermore, the antibacterial mechanism of HHCL gation, Formal analysis. Qingyao Wang: Investigation. Dequan Zhu:
against L. monocytogenes was investigated by phenotypic and tran­ Data curation, Conceptualization. Yifang Cao: Investigation,
scriptomic analysis, and the results suggested that the potential anti­ Conceptualization.
bacterial mechanisms included the damage of cell membrane and cell
wall, interference with membrane transport function, limitation of
Declaration of Competing interest
active transport of sugars and other nutrients, inhibition of cellular
respiration, energy metabolism, protein synthesis, and DNA replication
We wish to confirm that there are no known conflicts of interest
and repair. Overall, HHCL inhibited L. monocytogenes growth and sur­
associated with this publication and there has been no significant
vival through multiple mechanisms (Fig. 7).
financial support for this work that could have influenced its outcome.
Encouragingly, we found that HHCL can delay the browning of fresh
We confirm that the manuscript has been read and approved by all
apple juice without adverse effects on its quality, and effectively ensure
named authors and that there are no other persons who satisfied the
the microbiological safety of apple juice during storage. Therefore,
criteria for authorship but are not listed. We further confirm that the
HHCL is expected to be a nolval antibacterial agent in the food industry.
order of authors listed in the manuscript has been approved by all of us.
To the best of our knowledge, our work is the first to report a significant
We confirm that we have given due consideration to the protection of
antimicrobial effect of HHCL against L. monocytogenes, and the first to
intellectual property associated with this work and that there are no
reveal the antibacterial mechanism of hop compounds (including HHCL)
impediments to publication, including the timing of publication, with
against L. monocytogenes at the gene level. Our research bridged the gap
respect to intellectual property. In so doing we confirm that we have
in the antibacterial mechanism of hop compounds, provided a theoret­
followed the regulations of our institutions concerning intellectual
ical basis for the future development and application of hop compounds
property.
in food safety, and provided novel insights for finding new antimicrobial
We understand that the Corresponding Author is the sole contact for
agents.
the Editorial process. He is responsible for communicating with the

Fig. 7. The proposed HHCL stress response mechanism model of L. monocytogenes. The significantly upregulated and downregulated DEGs are represented by red and
green font respectively. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

11
Y. Zhang et al.
other authors about progress, submissions of revisions and final
approval of proofs. We confirm that we have provided a current, correct
email address which is accessible by the Corresponding Author and
which has been configured to accept email from (fexxl@scut.edu.cn).
Data availability
Data will be made available on request.
Acknowledgments
This work was supported by the National Natural Science Foundation
of China [No. 3217160293], Natural Science Foundation of Guangdong
Province [No. 2021A1515011068].
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.lwt.2024.115770.
References
Alonso, A. N., Perry, K. J., Regeimbal, J. M., Regan, P. M., & Higgins, D. E. (2014).
Identification of Listeria monocytogenes determinants required for biofilm
formation. PLoS One, 9(12). https://doi.org/10.1371/journal.pone.0113696
Angelidis, A. S., & Smith, G. M. (2003). Three transporters mediate uptake of glycine
betaine and carnitine by Listeria monocytogenes in response to hyperosmotic stress.
Applied and Environmental Microbiology, 69(2), 1013–1022. https://doi.org/10.1128/
aem.69.2.1013-1022.2003
Azi, F., Li, Z., Xu, P., & Dong, M. (2022). Transcriptomic analysis reveals the antibacterial
mechanism of phenolic compounds from kefir fermented soy whey against
Escherichia coli 0157:H7 and Listeria monocytogenes. International Journal of Food
Microbiology, 383. https://doi.org/10.1016/j.ijfoodmicro.2022.109953
Bai, H., Zhao, F., Li, M., Qin, L., Yu, H., Lu, L., et al. (2019). Citric acid can force
Staphylococcus aureus into viable but nonculturable state and its characteristics.
International Journal of Food Microbiology, 305, Article 108254.
Beeby, M., Gumbart, J. C., Roux, B., & Jensen, G. J. (2013). Architecture and assembly of
the Gram-positive cell wall. Molecular Microbiology, 88(4), 664–672. https://doi.org/
10.1111/mmi.12203
Casey, A., Fox, E. M., Schmitz-Esser, S., Coffey, A., McAuliffe, O., & Jordan, K. (2014).
Transcriptome analysis of Listeria monocytogenes exposed to biocide stress reveals a
multi-system response involving cell wall synthesis, sugar uptake, and motility.
Frontiers in Microbiology, 5. https://doi.org/10.3389/fmicb.2014.00068
CDC. (2020). Listeria (listeriosis). Retrieved from https://www.cdc.gov/listeria/index.
html.
Chiancone, E. (2008). Dps proteins, an efficient detoxification and DNA protection
machinery in the bacterial response to oxidative stress. Rendiconti Lincei. Scienze
Fisiche e Naturali, 19(3), 261–270. https://doi.org/10.1007/s12210-008-0018-4
de Almeida, N. E., do Nascimento, E. S., & Cardoso, D. R. (2012). On the reaction of lupu-
lones, hops b-acids, with 1-hydroxyethyl radical. Journal of Agricultural and Food
Chemistry, 60(42), 10649–10656.
Dubail, I., Bigot, A., Lazarevic, V., Soldo, B., Euphrasie, D., Dupuis, M., et al. (2006).
Identification of an essential gene of Listeria monocytogenes involved in teichoic
acid biogenesis. Journal of Bacteriology, 188(18), 6580–6591. https://doi.org/
10.1128/jb.00771-06
Gao, Z., Van Nostrand, J. D., Zhou, J., Zhong, W., Chen, K., & Guo, J. (2019). Anti-listeria
activities of linalool and its mechanism revealed by comparative transcriptome
analysis. Frontiers in Microbiology, 10. https://doi.org/10.3389/fmicb.2019.02947
Garner, D., & Kathariou, S. (2016). Fresh produce-associated listeriosis outbreaks,
sources of concern, teachable moments, and insights. Journal of Food Protection, 79
(2), 337–344. https://doi.org/10.4315/0362-028x.Jfp-15-387
Guo, F. Y., Chen, Q. P., Liang, Q., Zhang, M., Chen, W. X., Chen, H. M., et al. (2021).
Antimicrobial activity and proposed action mechanism of linalool against
Pseudomonas fluorescens. Frontiers in Microbiology, 12.
Hauser, C., & Sentürk, P. T. (2015). Antimicrobial hop extracts and their application on
fresh produce. In A. Mendez-Vilas (Ed.), Multidisciplinary approaches for studying and
combating microbial pathogens (pp. 49–52). Baco Raton, FL: BrownWalker Press.
He, R., Zhong, Q., Chen, W., Zhang, M., Pei, J., Chen, H., et al. (2023). Transcriptomic
and proteomic investigation of metabolic disruption in Listeria monocytogenes
triggered by linalool and its application in chicken breast preservation. Lwt-Food
Science and Technology, 176. https://doi.org/10.1016/j.lwt.2023.114492
Hong, W., Zeng, J., & Xie, J. (2014). Antibiotic drugs targeting bacterial RNAs. Acta
Pharmaceutica Sinica B, 4(4), 258–265. https://doi.org/10.1016/j.apsb.2014.06.012
Hosie, A. H. F., & Poole, P. S. (2001). Bacterial ABC transporters of amino acids. Research
in Microbiology, 152(3–4), 259–270. https://doi.org/10.1016/s0923-2508(01)
01197-4
Hu, J., Selby, C. P., Adar, S., Adebali, O., & Sancar, A. (2017). Molecular mechanisms and
genomic maps of DNA excision repair in Escherichia coli and humans. Journal of
12
LWT 194 (2024) 115770
Biological Chemistry, 292(38), 15588–15597. https://doi.org/10.1074/jbc.
R117.807453
Inoue, R., Kaito, C., Tanabe, M., Kamura, K., Akimitsu, N., & Sekimizu, K. (2001). Genetic
identification of two distinct DNA polymerases, DnaE and PolC, that are essential for
chromosomal DNA replication in Staphylococcus aureus. Molecular Genetics and
Genomics, 266(4), 564–571. https://doi.org/10.1007/s004380100564
Kang, J., Liu, L., Liu, Y., & Wang, X. (2020). Ferulic acid inactivates Shigella flexneri
through cell membrane destructieon, biofilm retardation, and altered gene
expression. Journal of Agricultural and Food Chemistry, 68(27), 7121–7131. https://
doi.org/10.1021/acs.jafc.0c01901
Kang, J., Liu, L., Wu, X., Sun, Y., & Liu, Z. (2018). Effect of thyme essential oil against
Bacillus cereus planktonic growth and biofilm formation. Applied Microbiology and
Biotechnology, 102(23), 10209–10218. https://doi.org/10.1007/s00253-018-9401-y
Kang, J., Wiedmann, M., Boor, K. J., & Bergholz, T. M. (2015). VirR-mediated resistance
of Listeria monocytogenes against food antimicrobials and cross-protection induced
by exposure to organic acid salts. Applied and Environmental Microbiology, 81(13),
4553–4562. https://doi.org/10.1128/aem.00648-15
Kokkoni, E.-A., Andritsos, N., Sakarikou, C., Michailidou, S., Argiriou, A., & Giaouris, E.
(2021). Investigating transcriptomic induction of resistance and/or virulence in
Listeria monocytogenes cells surviving sublethal antimicrobial exposure. Foods, 10
(10). https://doi.org/10.3390/foods10102382
Li, R., Lu, J., Duan, H., Yang, J., & Tang, C. (2020). Biofilm inhibition and mode of action
of epigallocatechin gallate against Vibrio mimicus. Food Control, 113. https://doi.
org/10.1016/j.foodcont.2020.107148
Li, H., Zhang, M., Addo, K. A., Yu, Y., & Xiao, X. (2022). Action mode of cuminaldehyde
against Staphylococcus aureus and its application in sauced beef. Lwt-Food Science
and Technology, 155. https://doi.org/10.1016/j.lwt.2021.112924
Liang, S., Hu, X., Wang, R., Fang, M., Yu, Y., & Xiao, X. (2022). The combination of
thymol and cinnamaldehyde reduces the survival and virulence of Listeria
monocytogenes on autoclaved chicken breast. Journal of Applied Microbiology, 132
(5), 3937–3950. https://doi.org/10.1111/jam.15496
Liu, M., Feng, M., Yang, K., Cao, Y., Zhang, J., Xu, J., et al. (2020). Transcriptomic and
metabolomic analyses reveal antibacterial mechanism of astringent persimmon
tannin against Methicillin-resistant Staphylococcus aureus isolated from pork. Food
Chemistry, 309. https://doi.org/10.1016/j.foodchem.2019.125692
Liu, Y., Ning, Y., Chen, Z., Han, P., Zhi, T., Li, S., … Jia, Y. (2023). Transcriptomics
reveals substance biosynthesis and transport on membranes of Listeria
monocytogenes affected by antimicrobial lipopeptide brevilaterin B. Food Science
and Human Wellness, 12(4), 1359–1368. https://doi.org/10.1016/j.
fshw.2022.10.037
Liu, Y., Tang, J., Liu, K., & Chen. (2008). Synthesis technology of hexahydro-beta-acids, a
novel antibacterial agent. Shipin Gongye Keji, 29(11), 225–229.
Lopes-Luz, L., Mendonca, M., Fogaca, M. B., Kipnis, A., Bhunia, A. K., & Buhrer-Sekula, S.
(2021). Listeria monocytogenes: Review of pathogenesis and virulence determinants-
targeted immunological assays. Critical Reviews in Microbiology, 47(5), 647–666.
https://doi.org/10.1080/1040841x.2021.1911930
Lucas, K., Froellich-Nowoisky, J., Oppitz, N., & Ackermann, M. (2021). Cinnamon and
hop extracts as potential immunomodulators for severe COVID-19 cases. Frontiers in
Plant Science, 12. https://doi.org/10.3389/fpls.2021.589783
Ma, M., Zhao, J., Zeng, Z., Yu, P., Xia, J., Wan, D., … Gong, D. (2023). Deciphering the
antibacterial mechanism of monocaprin against methicillin-resistant Staphylococcus
aureus by integrated transcriptomic and metabolomic analyses and its application in
pork preservation. Lwt-Food Science and Technology, 177. https://doi.org/10.1016/j.
lwt.2023.114569
Miao, X., Liu, H., Zheng, Y., Guo, D., Shi, C., Xu, Y., et al. (2019). Inhibitory effect of
thymoquinone on Listeria monocytogenes ATCC 19115 biofilm formation and
virulence attributes critical for human infection. Frontiers in Cellular and Infection
Microbiology, 9. https://doi.org/10.3389/fcimb.2019.00304
Olaimat, A. N., Al-Holy, M. A., Shahbaz, H. M., Al-Nabulsi, A. A., Abu Ghoush, M. H.,
Osaili, T. M., … Holley, R. A. (2018). Emergence of antibiotic resistance in Listeria
monocytogenes isolated from food products: A comprehensive review.
Comprehensive Reviews in Food Science and Food Safety, 17(5), 1277–1292. https://
doi.org/10.1111/1541-4337.12387
Panhorst, M., Sorger-Herrmann, U., & Wendisch, V. F. (2011). The pstSCAB operon for
phosphate uptake is regulated by the global regulator GlxR in Corynebacterium
glutamicum. Journal of Biotechnology, 154(2–3), 149–155. https://doi.org/10.1016/
j.jbiotec.2010.07.015
Pramanik, K., Ghosh, P. K., Ray, S., Sarkar, A., Mitra, S., & Maiti, T. K. (2017). An in silico
structural, functional and phylogenetic analysis with three dimensional protein
modeling of alkaline phosphatase enzyme of Pseudomonas aeruginosa. Journal of
Genetic Engineering and Biotechnology, 15(2), 527–537. https://doi.org/10.1016/j.
jgeb.2017.05.003
Schalk, I. J., & Cunrath, O. (2016). An overview of the biological metal uptake pathways
in Pseudomonas aeruginosa. Environmental Microbiology, 18(10), 3227–3246.
https://doi.org/10.1111/1462-2920.13525
Steenackers, B., De Cooman, L., & De Vos, D. (2015). Chemical transformations of
characteristic hop secondary metabolites in relation to beer properties and
thebrewing process: A review. Food Chemistry, 172, 742–756.
Stulikova, K., Karabin, M., Nespor, J., & Dostalek, P. (2018). Therapeutic perspectives of
8-prenylnaringenin, a potent phytoestrogen from hops. Molecules, 23(3). https://doi.
org/10.3390/molecules23030660
Suo, Y., Gao, S., Baranzoni, G. M., Xie, Y., & Liu, Y. (2018). Comparative transcriptome
RNA-Seq analysis of Listeria monocytogenes with sodium lactate adaptation. Food
Control, 91, 193–201. https://doi.org/10.1016/j.foodcont.2018.03.044
Uphoff, S., Lord, N. D., Okumus, B., Potvin-Trottier, L., Sherratt, D. J., & Paulsson, J.
(2016). Stochastic activation of a DNA damage response causes cell-to-cell mutation
Y. Zhang et al.
rate variation. Science, 351(6277), 1094–1097. https://doi.org/10.1126/science.
aac9786
Vojdani, J. D., Beuchat, L. R., & Tauxe, R. V. (2008). Juice-associated outbreaks of
human illness in the United States, 1995 through 2005. Journal of Food Protection, 71
(2), 356–364. https://doi.org/10.4315/0362-028x-71.2.356
Xie, Z., Jian, H., Jin, Z., & Xiao, X. (2018). Enhancing the adaptability of the deep-sea
bacterium shewanella piezotolerans WP3 to high pressure and low temperature by
experimental evolution under H2O2 stress. Applied and Environmental Microbiology,
84(5). https://doi.org/10.1128/aem.02342-17
Yu, Y., Wang, P., Cui, Y., & Wang, Y. (2018). Chemical analysis of DNA damage.
Analytical Chemistry, 90(1), 556–576. https://doi.org/10.1021/acs.
analchem.7b04247
Zhang, Y., Liu, F., Cao, Y., Xu, H., Xie, Y., Xiao, X., … Peng, X.-f. (2023). Preparation and
characterization of a solid dispersion of Hexahydrocolupulone and its application in
the preservation of fresh apple juice. Food Chemistry, 424. https://doi.org/10.1016/j.
foodchem.2023.136367
13
LWT 194 (2024) 115770
Zhao, N., Jiao, L., Xu, J., Zhang, J., Qi, Y., Qiu, M., … Fan, M. (2022). Integrated
transcriptomic and proteomic analysis reveals the response mechanisms of
Alicyclobacillus acidoterrestris to heat stress. Food Research International, 151.
https://doi.org/10.1016/j.foodres.2021.110859
Zhou, A., Cao, Y., Zhou, D., Hu, S., Tan, W., Xiao, X., … Li, X. (2020). Global
transcriptomic analysis of Cronobacter sakazakii CICC 21544 by RNA-seq under
inorganic acid and organic acid stresses. Food Research International, 130. https://
doi.org/10.1016/j.foodres.2019.108963
Zhou, H., Chen, L., Ouyang, K., Zhang, Q., & Wang, W. (2023). Antibacterial activity and
mechanism of flavonoids from Chimonanthus salicifolius S. Y. Hu. and its
transcriptome analysis against Staphylococcus aureus. Frontiers in Microbiology, 13.
https://doi.org/10.3389/fmicb.2022.1103476
Zhu, Y., Li, C., Cui, H., & Lin, L. (2019). Antimicrobial mechanism of pulsed light for the
control of Escherichia coli O157:H7 and its application in carrot juice. Food Control,
106. https://doi.org/10.1016/j.foodcont.2019.106751