Veterinary Microbiology 252 (2021) 108929

Contents lists available at ScienceDirect

Veterinary Microbiology
journal homepage: www.elsevier.com/locate/vetmic

Porcine circovirus type 2 exploits cap to inhibit PKR activation through

interaction with Hsp40
Qizhuang Lv a, b, Tao Wang c, *, Shanchuan Liu c, Yulin Zhu a
a
College of Biology & Pharmacy, Yulin Normal University, No. 1303 Jiaoyu East Road, Yulin, 537000, Guangxi, China
b
Guangxi Key Laboratory of Agricultural Resources Chemistry and Biotechnology, No. 1303 Jiaoyu East Road, Yulin, 537000, Guangxi, China
c
College of Veterinary Medicine, Northwest A&F University, No. 22 Xinong Road, Yangling, 712100, Shaanxi, China

A R T I C L E I N F O A B S T R A C T

Keywords: Porcine circovirus type 2 is the main pathogen of porcine circovirus disease, which has caused enormous eco­
PCV2 nomic losses to the pig industry worldwide. The PKR signaling pathway is important for the cellular antiviral
PKR signaling pathway response, but its role in the process of PCV2 infection is unknown. In this study, we first found that dsRNA was
Cap
produced and that PKR was activated in PCV2 infection. However, interestingly, the activation of PKR was
DNAJC7
P58IPK
inhibited when the Cap protein was exogenously expressed in PAMs, and this inhibition was reversed by the
expression of DNAJC7. The interaction between Cap and DNAJC7 was confirmed by laser confocal microscopy,
coimmunoprecipitation and GST pull-down, and it was found that PCV2 infection or the expression of Cap
protein could induce DNAJC7 to migrate to the nucleus and release P58IPK, an inhibitor of PKR activation.
Downregulating the expression of DNAJC7 by a specific inhibitor or recombinant lentivirus-mediated shRNA,
inhibited the replication of the PCV2 genome and the production of virions, which was consistent with the in­
crease of DNAJC7 expression in multiple tissues of weaned piglets infected with PCV2. These data indicate that
although PKR was activated by PCV2 infection, the activation was inhibited by Cap through an interaction with
DNAJC7. These results help to understand the molecular mechanism of immune escape after PCV2 infection.

1. Introduction Tang, 2012). As an important molecule in the innate immune signaling

Porcine circovirus type 2 (PCV2) is the main pathogen causing
porcine circovirus-associated diseases (PCVADs) (Opriessnig et al.,
2007). Since it was isolated and identified in 1991, related diseases have
occurred and spread all over the world, causing enormous economic
losses to the world pig industry (Harding and Clark, 1997). It has been
found that PCV2 can not only replicate and proliferate in porcine
monocytes/macrophages such as porcine alveolar macrophages (PAMs),
but also persist in immune cells such as dendritic cells (DCs), bone
marrow-like dendritic cells (mDCs), and plasmacytoid dendritic cells
(pDCs) (Vincent et al., 2005; Li et al., 2013), indicating that PCV2 has
the ability to regulate the host immune response; otherwise, PCV2
would not be able to survive in the above immune cells.
Protein kinase R (PKR), the double-stranded RNA (dsRNA)-depen­
dent protein kinase induced by interferon, can phosphorylate the
translation initiation factor eIF2α, resulting in the inhibition of viral
protein synthesis, and can also participate in other antiviral mecha­
nisms, thus playing an important role in antiviral immunity (Kang and
pathway, PKR are widely distributed in a variety of host cells, especially
immune cells, which are the main target cells of PCV2 infection. It has
been found that PCV2 can induce the secretion of type I interferon
(mainly IFN-α) in PAM cells (Chen et al., 2016), and the host antiviral
immune response mediated by type I interferon is the first barrier
against virus invasion. Studies have proven that PCV2 can not only
successfully pass through this barrier, but also cause the virus to spread
throughout the host (Meng, 2013). It is suggested that PCV2 can mediate
the innate antiviral immune response in pigs, but this response cannot
eliminate PCV2 infection, suggesting that PCV2 can counteract the host
innate antiviral immune response through a specific mechanism. How­
ever, the mechanism of PCV2 antagonizing the host innate antiviral
immune response is not clear at present.
The antiviral protein PKR usually exists in an inactivated state in
cells. PKR activation can only be induced by PKR activators such as
dsRNA, PKR activating protein PACT/RAX and polyanions (Gal-Ben-Ari
et al., 2019). P58IPK is a key protein that inhibits PKR activation by
inhibiting PKR dimerization. Typically, Hsp40/DnaJ and P58IPK exist in

* Corresponding author.
E-mail addresses: wangtao080028@nwafu.edu.cn (T. Wang), juanliu012@163.com (Y. Zhu).

https://doi.org/10.1016/j.vetmic.2020.108929
Received 20 June 2020; Accepted 10 November 2020
Available online 16 November 2020
0378-1135/© 2020 Elsevier B.V. All rights reserved.
Q. Lv et al.
the form of an Hsp40-P58IPK complex in an inactivated state (Melville
et al., 1997), so many viruses disassemble the Hsp40-P58IPK complex
and release P58IPK protein through an interaction between an encoded
viral protein and the host Hsp40 protein to inhibit the host PKR effect
and promote the replication and proliferation of the virus. For example,
influenza virus (influenza A virus, IAV) promotes the dissociation of
P58IPK from the Hsp40-P58IPK complex through the interaction between
its nuclear protein NP and the host Hsp40 protein, and the released
P58IPK antagonizes the effect of PKR (Sharma et al., 2011). DNAJC7 is a
major member of the HSP40/DnaJ family, but its role in PCV2 infection
is still unclear. Previous data have shown that host HSP40 can interact
with the Cap protein of PCV1 (Finsterbusch et al., 2009), but whether
DNAJC7 interacts with the Cap protein of PCV2 has not been reported,
and the potential biological significance of this interaction between
them is still unknown.
In this study, we focused on the activation mechanism of the PKR
signaling pathway in PAM cells infected with PCV2, the interaction
between the PCV2 Cap protein and host DNAJC7 protein and the bio­
logical significance of this interaction to clarify the mechanism by which
PCV2 antagonizes the host PKR effect. The results of this study will
provide a theoretical basis for revealing the evasion of the host innate
immune response in the early stage of PCV2 infection, and provide a new
strategy or therapeutic target for the diagnosis, prevention and treat­
ment of PCVADs.
2. Materials and methods
2.1. Cell culture and virus infection
Porcine circovirus type 2 (PCV2, Genetype: PCV2b, GenBank No. :
HM038032) was preserved in our laboratory. Porcine alveolar macro­
phages (PAMs) cells were cultured in RPMI-1640 medium containing 10
% fetal bovine serum (Gibco) at 37 ◦ C and 5% CO2. When the cells grew
to 70 % confluence in 25 cm2 cell culture bottle (Corning), the cell
culture medium was replaced with RPMI-1640 medium without fetal
bovine serum, and the virus was inoculated at 1 MOI. After adsorption at
37 ◦ C for 2 h, the culture medium was replaced with RPMI-1640 medium
containing 2% fetal bovine serum, and the cell culture was collected at
different time points after inoculation.
2.2. Lentivector construction and lentivirus production
Recombinant lentiviruses expressing short hairpin RNA (shRNA)
targeting porcine DNAJC7 and a negative control shRNA were con­
structed in our previous study following previously described proced­
ures (Lv et al., 2019).
2.3. Western blotting
After the protein samples were collected, the concentration was
measured by a BCA protein detection kit, and protein were then dena­
tured with protein sample buffer. The same amount of protein was
separated by 12 % SDS-PAGE and transferred to a 0.22 μm PVDF
membrane. After blocking with 5% skimmed milk powder, the mem­
brane was incubated with specific primary antibody at 4 ◦ C for 8 h, and
then labeled with HRP-conjugated secondary antibody at room tem­
perature for 1 h. Enhanced chemiluminescence reagents (ZETA) were
used for detection. Western blot assays were repeated at least 3 times.
β-Actin was used as an internal reference to detect the relative level of
intracellular protein.
2.4. Real-time PCR assays
Intracellular DNA was extracted by a DNA extraction kit (Takara),
which was used as a template, and real-time PCR analysis was carried
out according to a previously reported procedure (Liu et al., 2014).The
2
Veterinary Microbiology 252 (2021) 108929
sense primer PCV2-F and the antisense primer PCV2-R were used to
amplify the PCV2 DNA fragment.
Total RNA was extracted by TRIzol reagent (Takara). Reverse tran­
scription was carried out according to the instructions of the Takara
reverse transcription kit. The reverse transcription product was used as a
template, and DNAJC7 and β-actin specific primers were used to detect
the relative expression of intracellular DNAJC7 using the procedure
recommended by the SYBR Green Real-time PCR Master Mix manual
(Takara). The reaction conditions were as follows: 95 ◦ C for 30 s, fol­
lowed by 40 cycles of 95 ◦ C for 5 s and 60 ◦ C for 30 s.
2.5. Confocal microscopy
DNAJC7 mRNA was inserted into pcDNA3.1 (+)-EGFP (EGFP-
DNAJC7), and Cap mRNA was inserted into pcDNA3.1 (+)-Red (Red-
Cap), pcDNA3.1 (+)-EGFP and pcDNA3.1 (+)-Red were constructed by
our laboratory. PAM cells were cultured on glass bottom dishes (35
mm), and cotransfected with EGFP-DNAJC7 and Red-Cap plasmid when
the cells grew to the logarithmic phase, and cultured at 37 ◦ C for 24 h.
The cells were washed with PBS 3 times, fixed with 4% para­
formaldehyde (dissolved in PBS) at room temperature for 10 min, and
finally stained the nucleus with DAPI at room temperature for 10 min.
The results were observed and imaged under a laser confocal microscope
(Nikon).
2.6. GST pull-down assay
For GST pull-down assays, the Pierce® GST Protein Interaction Pull-
Down Kit (Thermo Fisher) was used according to the manufacturer’s
instructions. In brief, a suspension containing GST-Cap bait protein was
obtained from E. coli using pull-down lysis buffer. After immobilization
of GST-Cap fusion proteins on an equilibrated gutathione agarose resin,
DNAJC7 prey proteins prepared from PAM cell lysates were added and
incubated at 4 ◦ C for 2 h. The prey protein was captured on agarose
beads containing bait protein, the unbound protein was removed by 5
washes, and the protein samples were eluted with glutathione glution
buffer. Finally, glutathione agarose plus fusion proteins were boiled in
SDS-loading buffer and subjected to Western blot analyses. As a negative
control, GST protein was used.
2.7. Coimmunoprecipitation assays
Cells grown in 6-well plates were simultaneously transfected with a
combination of 2 μg of pcDNA3.1-Cap-Flag and 2 μg of pcDNA3.1-
DNAJC7-Myc plasmids. As negative controls, a plasmid expressing un­
related protein with Myc or Flag tag was used. At 48 h post-transfection,
the cells were washed twice with PBS and treated with lysis buffer
(containing PMSF) for 30 min on ice. After centrifugation, the super­
natants were subjected to immunoprecipitation using ANTI-FLAG® M2
Affinity Gel (Sigma).
2.8. Infection of animals and tissue preparation
A total of 6 Specific Pathogen Free (SPF) pigs (30 days, 10− 15 kg)
purchased from ChongQing Academy of Animal Sciences were used in
this study. The animal procedures were approved and supervised by the
Animal Care Commission of the College of Biology & Pharmacy, Yulin
Normal University (approval No. 2019AE1101). Piglets were housed
indoors, at 20 ~ 25 ◦ C, and regularly provided water and feed. All of the
pigs were negative for PCV2, classical swine fever virus (CSFV) and
porcine reproductive and respiratory syndrome virus (PRRSV) infection,
as confirmed by the negative results from reverse transcription (RT) -
polymerase chain reaction (PCR) and antibody (Ab) test kits (IDEXX)
used according to the manufacturer’s instructions. Subsequently, 3 pigs
were injected intramuscularly with 1 mL PCV2 collected from infected
PAMs [105 50 % tissue culture infective dose (TCID50)/mL]; the
Q. Lv et al. Veterinary Microbiology 252 (2021) 108929

Fig. 1. dsRNA was produced, and the PKR signaling pathway was activated during PCV2 replication in PAM cells. (A) dsRNA was produced 24 h post
infection (hpi) of PCV2. PAM cells were divided into four groups: normal group, poly (I:C) transfection group, PCV2 infection group and UV-inactivated PCV2
infection group. Twenty-four hours post transfection (hpt) or infection, the poly (I:C) group was incubated with different nucleases (DNase I, RNase A, RNase III), and
then IFA analysis was performed in all groups. Mouse anti-dsRNA monoclonal antibody (SCICONS) was used as the primary antibody, the secondary antibody was
Alexa Fluor® 488-conjugated goat anti-mouse antibody, and the nuclei were stained with DAPI, after which the cells were observed under a laser confocal mi­
croscope (Nikon, 100×). (B) An ELISA analysis was performed in all groups to quantify the dsRNA in cells, and the statistics were measured at 450 nm. (C) The
activation of the PKR signaling pathway in PAM cells infected with PCV2. PAM cells treated with different methods were analyzed by Western blotting with anti-PKR,
anti-phosphorylated PKR, anti-eIF2α and anti-phosphorylated eIF2α antibodies, and β-actin was used as an internal reference.

3
Q. Lv et al.
remaining pigs were used as controls. After 21 days, the nucleic acid and
antibody tests of pigs in PCV2 infection group were positive, and all pigs
were euthanized. Subsequently, the heart, liver, spleen, lung, kidney,
tonsils, brain, stomach and intestines of all euthanized pigs were
collected for follow-up experiments.
2.9. Immunohistochemistry (IHC)
Fresh tissue was cut into 1 cm3 cubes and fixed in paraformaldehyde
(4%) for 24 h. The tissue blocks were trimmed and dehydrated, and the
detailed steps were as follows 75 % ethanol for 4 h, 85 % ethanol for 2 h,
90 % ethanol for 2 h, 95 % ethanol for 1 h, anhydrous ethanol for 30
min, anhydrous ethanol for 30 min, mixture of ethanol and xylene (1:1)
for 10 min, xylene for 5 ~ 10 min, xylene for 5− 10 min, and three in­
cubations in paraffin for 1 h each. The tissue soaked in paraffin was
embedded and trimmed and placed on a paraffin slicer. The tissue slice
was flattened in warm water at 40 ◦ C to a thickness of 3 μm and then
placed on glass slides and baked in an oven at 60 ◦ C. Then, the dried
paraffin slices were removed and stored at room temperature.
For IHC, the paraffin slices were deparaffined, and the slices were
sequentially incubated in xylene for 15 min, xylene for 15 min, xylene
for 5 min, anhydrous ethanol for 5 min, anhydrous ethanol for 5 min, 85
% alcohol for 5 min, and 75 % alcohol for 5 min, followed by washing in
distilled water. Then, the tissue slices were placed in EDTA antigen
retrieval buffer (pH 9.0) for antigen retrieval in a microwave oven.
Then, the cells were transferred to endogenous peroxide blocking solu­
tion to block endogenous peroxidase activity. The tissue was evenly
covered with 3% BSA and blocked at room temperature for 30 min.
Then, the blocking solution was gently discarded, a diluted antibody was
added to the slice, and the tissue was incubated in a wet box at 4 ◦ C
overnight. The slices were washed in PBS 3 times, incubated at room
temperature for 50 min with HRP - labeled secondary antibody and
washed in PBS 3 times. Finally, a freshly prepared DAB chromogenic
solution was added, the positive staining was brown, and the staining
was terminated by rinsing the slices with distilled water. Nuclei were
stained with hematoxylin for 3 min, after which the slices were incu­
bated in 75 % alcohol for 5 min, 85 % alcohol for 5 min, anhydrous
ethanol for 5 min, anhydrous ethanol for 5 min, and xylene for 5 min.
The slices were removed from xylene, slightly dried, and sealed with
neutral gum. Microscopic examination, image acquisition and analysis
were then performed.
2.10. Virus titration via immunofluorescence assay (IFA)
The titers of PCV2 samples were detected by IFA. A 100 μL gradient
diluted samples were inoculated on a PK-15 monolayer grown on a 96-
well cell culture plate, and 72 h later, the cells were washed 3 times with
PBS, fixed with 4% paraformaldehyde at room temperature for 10 min,
permeabilized with 0.5 % Triton-X100 at room temperature for 15 min,
blocked with 5% skimmed milk dissolved in PBS at room temperature
for 2 h, incubated with diluted PCV2-positive pig serum (1:100) at room
temperature for 2 h, and then incubated with fluorescently labeled goat
anti-pig IgG at room temperature for 2 h. DAPI was used to stain the
nucleus, and the cells were washed three times with PBS. Finally, the
liquid in the culture plate was replaced with ultrapure water. The data
were observed under a fluorescence microscope and recorded for sta­
tistical analysis. The virus titer was half of the tissue culture infection
dose (TCID50).
2.11. Elisa
Cells grown on 6-well cell culture plate were lysed in NP-40 Lysis
Buffer (beyotime) at 4℃ for 5 min. After being centrifuged at 12,000×g
for 5 min, the supernatants were adhered to a 96-well plate pre-coated
with poly-lysine (Sigma), overnight at 4℃. The wells were washed for
5 times with PBST and blocked by 5% skimmed milk (dissolved in PBST)
4
Veterinary Microbiology 252 (2021) 108929
at room temperature for 2 h. The blocked wells were incubated with
mouse anti-dsRNA J2 antibody (SCICONS) at 37℃ for 1 h, followed by
being washed in PBST for 5 times. Then, the wells were incubated with a
HRP conjugated secondary antibody at 37℃ for 1 h and washed again. A
TMB Single-Component Substrate solution (Solarbio) was used for
quantified the dsRNA in samples, and the reaction was stopped by 1 M
H2SO4 and measured at 450 nm.
2.12. Data analysis
Data analysis was performed with Excel and GraphPad PRIM soft­
ware, and the data are presented as the mean ± standard deviation (SD).
The significant differences between the data were analyzed by Student’s
t-test, and differences were considered significant when the P value was
less than 0.05.
3. Results
3.1. dsRNA is produced and PKR is activated during PCV2 infection
Studies have shown that when cells are infected by the virus, the
dsRNA produced in the process of virus replication can activate PKR.
Usually, DNA viruses produce dsRNA because the virus genome contains
overlapping open reading frames with opposite transcriptional di­
rections (Weber et al., 2006). These open reading frames produce
mRNAs that contain reverse complementary sequences and then
combine into dsRNA (García et al., 2007). This phenomenon is also
observed for PCV2, whereby its ORF3, ORF4 and ORF5 genes are
embedded in the interior of ORF1, and the transcriptional direction of
ORF3 and ORF4 genes is opposite to that of ORF1 genes (Gillespie et al.,
2009), indicating that dsRNA is very likely to be produced in the process
of PCV2 replication. In addition, studies have shown that TLR3 can
recognize the dsRNA of the dsRNA virus genome or the dsRNA produced
in the replication or transcription intermediates of ssRNA viruses and
DNA viruses, indicating that the activation of TLR3 can indirectly
demonstrate that dsRNA is produced in the process of virus infection.
Accordingly, the upregulation of TLR3 during PCV2 infection would
indicate that dsRNA may be produced in the process of PCV2 infection
(Duan et al., 2014; Lin et al., 2013; Li et al., 2013). The production of
dsRNA will inevitably activate the PKR signaling pathway in the host
cell, and then trigger the host innate antiviral immunity. To confirm the
production of dsRNA in the process of PCV2 infection, poly(I:C) was
used as a dsRNA mimic and transfected into PAM cells (40 mg/mL).
Twenty-four hours after transfection, the cells were treated with DNase
I, RNase A or RNase III. Immunofluorescence analysis was performed by
a specific anti-dsRNA antibody. As is shown in Fig. 1A, the specific
fluorescent spots have been found in the poly (I:C) treatment group and
were disappeared in the RNase III treatment group, while those in the
RNase A and DNase I treatment groups did not disappear. It showed that
the dsRNA antibody could specifically bind to dsRNA. The dsRNA was
produced in PCV2 infection, but not in UV-inactivated PCV2, indicating
that virus replication was required for dsRNA production (Fig. 1A-B).
The intracellular activation levels of PKR and eIF2α were detected at 6 h,
12 h, 18 h and 24 h after PCV2 infection. The results showed that PKR
and eIF2α phosphorylation were induced by PCV2 infection, while the
expression of P58IPK decreased the phosphorylation levels of PKR and
eIF2α (Fig. 1C). The above results suggest that dsRNA is produced and
that the PKR signaling pathway is activated in PCV2 infection.
3.2. The expression of Cap protein inhibits PKR pathway activation
HSP40/DnaJ regulates the PKR signaling pathway by regulating the
activity of P58IPK. The interaction between Cap and HSP40, the most
important immunogenic protein of PCV1, was reported as early as 2009
(Finsterbusch et al., 2009). Fig. 1 shows that PCV2 infection can activate
the PKR signaling pathway, so the role of the Cap protein in the PKR
Q. Lv et al.
Fig. 2. Cap protein downregulates the activation level of PKR. PAMs were
transfected with poly (I:C) to activate the PKR signaling pathway. Twelve hours
post transfection, cells were re-transfected with Cap or/and DNAJC7, and 24 h
later, anti-PKR, anti-phosphorylated PKR, anti-eIF2α and anti-phosphorylated
eIF2α antibodies were used for Western blot analysis. Untreated cells were
used as a control, and β-actin was used as an internal reference.
signaling pathway is of interest to us. First, PKR was activated by
transfection of poly (I:C), and Cap and/or DNAJC7 was transfected 12 h
later. The results showed that the expression of Cap protein could inhibit
the phosphorylation of PKR and eIF2α, while the additional expression
of DNAJC7 could reverse the inhibitory effect of Cap protein (Fig. 2).
3.3. PCV2 Cap protein interacts with DNAJC7 and colocalizes in the
nucleus
As conformation of the interaction between DNAJC7 and PCV2 Cap,
Cap and DNAJC7 were found to be colocalized in PAM cells by laser
confocal microscopy, and the colocalization was mainly in the nucleus
(Fig. 3A). The binding of Cap and DNAJC7 in PAMs was detected by
coimmunoprecipitation. Fig. 3D shows that the exogenously expressed
Cap protein bound to intracellular DNAJC7, while the control protein
was a nonstructural protein of classical swine fever virus. Fig. 3E and F
show the binding of exogenous DNAJC7 and Cap in PAM cells from two
aspects. The extracellular binding of DNAJC7 and Cap was analyzed by
GST pull-down assay. The results showed that the prokaryotically
expressed Cap could bind to endogenous and exogenous DNAJC7
(Fig. 3B-C). These results suggest that Cap and DNAJC7 interact with
each other in PAM cells.
3.4. DNAJC7 translocated to the nucleus after PCV2 infection
In Fig. 3A, it was found that compared with that in the cells that did
5
Veterinary Microbiology 252 (2021) 108929
not express Cap protein, DNAJC7 had a tendency to migrate to the nu­
cleus in the cells that expressed Cap and DNAJC7 at the same time.
Through western blot detection, it was found that the expression of
DNAJC7 was not significantly changed in whole cell lysates, but was
increased in the nucleus and decreased in the cytoplasm of cells infected
with PCV2 (Fig. 4A), indicating that PCV2 infection caused the DNAJC7
to translocate to the nucleus. Similarly, when the Cap protein was
transfected into PAM cells, an increase in DNAJC7 in the nucleus was
found (Fig. 4B). It is suggested that after PCV2 infection, DNAJC7 mi­
grates to the nucleus through its interaction with the Cap protein.
Usually, DNAJC7 binds with P58IPK to form a complex, that inactivates
P58IPK, an inhibitor of the PKR signaling pathway (Gale et al., 2002).
Fig. 3F shows that there was no interaction between Cap and P58IPK,
there was no tendency for P58IPK to migrate to the nucleus in
PCV2-infected cells (Fig. 4C), and PCV2 infection had no significant
effect on the expression of P58IPK (Fig. 4D). These results suggest that
Cap interacts with DNAJC7, which induces DNAJC7 to migrate to the
nucleus and release P58IPK.
3.5. The effect of DNAJC7 on PCV2 replication
As mentioned above, Cap inhibits the activation of the PKR pathway
through its interaction with DNAJC7, so DNAJC7 should play a pro­
moting role in the process of PCV2 infection. To verify this hypothesis,
PAM cells were first treated with the HSP40 inhibitor KNK437. Fig. 5A
shows that 100 μM KNK437 had no significant effect on cell viability.
The replication of PCV2 in KNK437-treated cells was significantly lower
than that in DMSO-treated cells (Fig. 5B, D), and the titer of progeny
virus was significantly decreased due to KNK437 treatment (Fig. 5C).
Exogenous Cap protein was expressed, and detected at 12 and 24 h post
transfection, and it was found that KNK437 treatment decreased the
expression of Cap protein (Fig. 5E). These data showed that PCV2
replication and Cap protein expression were inhibited by KNK437-
mediated decrease in DNAJC7 expression in PAM cells.
To further determine the effect of DNAJC7 on PCV2 replication, an
shRNA-treated PAM cell line (PAM-shDNAJC7) with stable low
expression of DNAJC7 was constructed by the recombinant lentivirus
technique, and compared with a cell line (PAM-shN) constructed by non-
targeting shRNA (Fig. 6A). Through the detection of cell viability by the
CCK-8 test, it was found that the viability of the cell lines PAM-
shDNAJC7 and PAM-shN relative to normal PAM cells was more than
80 %, and there was no significant difference between these two cell
lines, which could be used in subsequent experiments. The PAM-
shDNAJC7 cell line had stably lower expression of DNAJC7 at both
the mRNA and protein levels (Fig. 6C left, E). PCV2 replicated in PAM-
shDNAJC7 cells, but the DNA replication and protein expression levels
were lower than those in the control group (Fig. 6C right, E), and the
virus titer was significantly decreased (Fig. 6D). In addition, Fig. 6F
shows that the expression of exogenous Cap protein was significantly
decreased in the PAM-shDNAJC7 cell line. These results suggest that
inhibiting the expression of DNAJC7 can inhibit the replication of PCV2
and the expression of Cap protein.
3.6. The expression of DNAJC7 is upregulated in multiple tissues of piglets
infected with PCV2
Weaned piglets were infected with PCV2, and the relationship be­
tween viral load and DNAJC7 expression in different tissues was
determined. Weaned piglets inoculated with PCV2 showed depression,
decreased feed intake and tremors. Twenty-one days after infection,
blood was collected from the anterior vena cava and confirmed to be
positive by PCR and ELISA. The spleen, brain, stomach, kidney, lung,
liver, tonsil, heart and intestine were assayed. PCV2 was distributed in
all tissues, among which the amount of PCV2 in the spleen, heart and
intestine was the highest (Fig. 7). The expression of DNAJC7 was
detected by IHC. The results showed that the expression of DNAJC7 in
Q. Lv et al.
PCV2-infected pigs was generally higher than that in uninfected pigs
(Fig. 8A). The expression of DNAJC7 at the mRNA and protein levels in
the spleen, brain, kidney, tonsil, heart and intestine of PCV2-infected
pigs was significantly higher than that in uninfected pigs, especially in
spleen, heart and intestine which had high PCV2 viral loads (Fig. 8B-C).
These findings suggest that PCV2 infection can promote the expression
of DNAJC7 in pigs (Fig. 9).
4. Discussion
PKR is a key factor of mammalian antiviral response. Once activated,
PKR is dimerized and autophosphorylated, which process further
phosphorylates eIF2α and inhibits the synthesis of viral proteins (García
et al., 2007; Kang and Tang, 2012). dsRNA is a classic inducer of PKR
protein signaling in host cells during virus infection. To determine
whether dsRNA is produced during PCV2 infection, a dsRNA specific
antibody was used for IFA and ELISA analysis and the results showed
that dsRNA is produced during the process of PCV2 replication. dsRNA
6
Veterinary Microbiology 252 (2021) 108929
Fig. 3. DNAJC7 and Cap interact with each
other in PAM cells. (A) DNAJC7 and Cap were
colocalized in the nucleus. EGFP-DNAJC7 and
Red-Cap, pcDNA3.1-EGFP and pcDNA3.1-Red
were cotransfected or EGFP-DNAJC7 was
transfected into PAM cells, after which the cells
were fixed at 24 h post transfection (hpt), and
nuclei were stained with DAPI. The cells were
observed under a laser confocal microscope
(Nikon, 100×). (B-C) GST pull-down analysis.
GST or GST-Cap fusion protein was obtained
from E. coli BL21 (DE3) expression cells and
purified by glutathione agarose beads. The GST-
or GST-Cap-glutathione agarose beads were
incubated with cell lysates of control (C) or
Myc-DNAJC7-expressing (B) PAMs. The bound
protein was detected by Western blotting with
anti-Myc (B) or anti-DNAJC7 (C) antibody. (D-
F) The interaction between Cap and DNAJC7 in
PAM cells was analyzed by co-IP. First, PAM
cells were transfected with Flag-Cap, the cell
lysate was tested by IP, the bound proteins were
detected by Western blotting with anti-DNAJC7
antibody, and Flag-CSFV NS4B was used as a
negative control (D). Then, Flag-cap and Myc-
DNAJC7 were cotransfected into PAM cells,
and the cell lysate was analyzed by IP with
agarose beads conjugated anti-Myc (Thermo
Fisher) (E) or anti-Flag (Sigma) (F) antibody.
The bound protein was detected by Western
blotting with anti-Flag (E) or anti-Myc (F)
antibody, and Flag-CSFV NS4B (E) and Myc-
P58IPK were used as negative controls (F).
produced by DNA viruses may arise as a result of overlapping
converging transcription (Weber et al., 2006). The PCV2 genome is a
single-stranded, closed circular, double-sense DNA, with overlapping
genes; for example, ORF3 and ORF4 are embedded in ORF1, and the
transcription direction is opposite to that of ORF1 (Gillespie et al.,
2009), meaning that the mRNA of ORF3 or ORF4 may be paired with the
complementary bases in the mRNA of ORF1. In addition to PCV2, other
DNA viruses, such as adenovirus, herpes simplex virus 1 and vaccinia
virus also produce dsRNA during infection (Weber et al., 2006).
Usually, PKR is activated in the infection of virus which produces
dsRNA. However, in some virus infection, PKR is not activated by the
viral dsRNA, such as West Nile virus (Elbahesh et al., 2011). To deter­
mine whether PKR in activated in PCV2 infected cells, we detected the
phosphorylation of PKR and eIF2α, and the results showed that PKR is
activated during PCV2 infection. PCV2 infection can not only induce
host cells to synthesize and secrete type I interferon (Chen et al., 2016),
but also induce oxidative stress and endoplasmic reticulum stress (Chen
et al., 2012; Zhou et al., 2016). Thus, apart from dsRNA induction, PCV2
Q. Lv et al. Veterinary Microbiology 252 (2021) 108929

Fig. 4. DNAJC7 migrates to the nucleus after PCV2 infec­

tion. (A-B) DNAJC7 in the nucleus was upregulated after
PCV2 infection. After PCV2 infection (A) or Cap transfection
(B) of PAM cells for 24 h, the nuclei were isolated, and the
nuclear, cytoplasm and whole-cell proteins were extracted and
detected by Western blot with anti-DNAJC7 (Abcam) and anti-
Cap (Abcam) antibodies. β-Actin was used as the whole-cell
internal reference and LaminB1 as the nuclear internal refer­
ence. (C) P58IPK and Cap were not colocalized in PAM cells.
PAM cells were cotransfected with pEGFP-P58IPK and Red-Cap
or pEGFP-N1 and pDSRed-N1. After 24 h, the cells were fixed,
stained with DAPI and then observed under a laser confocal
microscope (Nikon, 100×). (D) PCV2 infection had no signifi­
cant effect on the expression of P58IPK in PAM.

7
Q. Lv et al. Veterinary Microbiology 252 (2021) 108929

Fig. 5. Effects of inhibitors on the replication of PCV2 and expression of Cap protein. (A) The effect of KNK437 (100 μM) on the activity of PAM cells. Cell
activity was detected by the CCK-8 test, and DMSO-treated PAM cells were used as the control. The ordinate shows the activity of the treated cells relative to the
untreated normal cells. (B) Effect of KNK437 treatment on PCV2 genome replication. PAM cells treated with inhibitors or DMSO, infected with PCV2, and real-time
PCR analysis was performed at 24 hpi. (C) The effect of KNK437 treatment on the titer of PCV2 progeny virus. PCV2-infected cell culture was collected, and virus
titers were detected as TCID50. (D-E) The effect of KNK437 treatment on the Cap protein. PAM cells treated with inhibitors or DMSO, infected with PCV2 or
exogenously expressed Cap (E), and cell extracts were detected by Western blotting with anti-DNAJC7, anti-Cap, and anti-β-actin antibodies.

8
Q. Lv et al. Veterinary Microbiology 252 (2021) 108929

Fig. 6. Effect of interfering with DNAJC7 expression on the proliferation of PCV2 cells. Construction of a stable PAM cell line with low expression of DNAJC7
by the recombinant lentivirus technique. (A) The cell lines were imaged under a fluorescence microscope (Nikon, 10×) as follows: (a) control PAM cells, (b) PAM-shN
cells, and (c) PAM-shDNAJC7 cells. (B) Detection of the activity of the recombinant cell lines PAM-shN and PAM-shDNAJC7 relative to control PAM cells by CCK-8
test. (C) The knockdown efficiency (left) and viral genome replication level (right) of the recombinant cell lines infected with PCV2 were detected by real-time PCR.
(D) The titer of progeny virus collected in PAM-shDNAJC7 cells. (E) After the recombinant cell lines were infected with PCV2, the intracellular protein was extracted
and detected by Western blotting. (F) After Cap transfection, intracellular proteins were extracted and detected by Western blotting.

9
Q. Lv et al.
Fig. 7. The distribution of PCV2 in multiple tissues of weaned piglets infected with PCV2. (A) The level of PCV2 in each tissue was detected by IHC. An anti-
Cap antibody was used, and the areal density was measured by IPP6.0 software. (B) PCV2 in each tissue was detected by Western blotting. Fresh tissue was frozen in
liquid nitrogen and ground into powder. Proteins were extracted by RIPA lysis buffer at 4 ◦ C. The corresponding tissues of uninfected weaned piglets were used
as controls.
is able to activate PKR through the PACT/RAX pathway (Table 1).
Although PKR is a molecule generally activated in virus infection,
viruses have developed several strategies to control or hijack this
pathway for replication. For example, Theiler’s murine encephalomy­
elitis virus and Middle East respiratory syndrome coronavirus block PKR
activation by preventing the interaction between PKR and viral dsRNA
(Borghese et al., 2019; Rabouw et al., 2016). Kaposi’s
sarcoma-associated herpesvirus prevents PKR activation by using
ORF57 to bind both PKR and PKCT so that cut-off the PKR-PACT
interaction (Sharma et al., 2017). Adenovirus and Foot-and-mouth dis­
ease virus induce the degradation of PKR to oppose PKR activity
(Goodman et al., 2019; Li et al., 2017). However, CSFV is able to utilize
the PKR pathway and the activation of PKR is beneficial to virus repli­
cation (Liu et al., 2015). In this study, we demonstrated that PCV2
inhibit PKR through the interaction between Cap and DNAJC7 in nu­
cleus; this interaction dissociates the DNAJC7-P58IPK complex and
release P58IPK to inhibit PKR dimerization, which is similar to the
strategy of Influenza A Virus (Sharma et al., 2011).
Heat shock proteins are stress response molecules that regulate
multiple processes in cells (Joly et al., 2010). DnaJ plays an important
role in protein folding, translocation, cell signal transduction and
apoptosis (Li et al., 2009). There are an increasing number of reports
about the role of HSP40/DnaJ in the process of virus replication, pro­
liferation and release (Knox et al., 2011). For example, HSP40 can
promote HSV-1 replication by interacting with herpes simplex virus
(HSV) UL9 protein (Eom and Lehman, 2002), while DnaJ inhibits virus
replication in hepatitis B virus (HBV) (Sohn et al., 2006), yellow fever
virus (Bozzacco et al., 2016) and other viruses (Weeks and Miller, 2008).
In this study, through the low expression of DNAJC7 mediated by
KNK437 and shRNA, the replication of PCV2 is decreased significantly,
10
Veterinary Microbiology 252 (2021) 108929
and the replication level is increased in DNAJC7-overexpressing cell
(data not shown). We believe that DNAJC7 played a role in promoting
PCV2 replication.
HSP40/DnaJ can function together with HSP70 to form a molecular
chaperone complex (Summers et al., 2009). In a report that HSP70
regulates PCV2, Cap and HSP70 were also colocalized in the nucleus, but
this colocalization depended on heat stress at 45 ◦ C (Liu et al., 2013). In
this study, the colocalization of Cap and DNAJC7 did not depend on heat
stress, or even on PCV2 infection, indicating that the interaction be­
tween DNAJC7 and Cap is independent of HSP70.
In this study, PCV2 infected pigs did not show specific symptoms;
only in the initial stage of infection they showed loss of appetite, mental
depression and other common symptoms, but there were no obvious
symptoms in the later stage, and there were no obvious pathological
changes in any tissue compared with normal pig tissue (data not shown),
indicating that the infection was subclinical. In a previous report, the
DNA level of PCV2 and the mRNA expression of Cap in all tissues were
significantly lower at 21 days than at 14 days after infection in PCV2
acute infected pigs, and the replication of PCV2 slowed with the
extension of the infection time (Yu et al., 2007). In this experiment,
subclinically infected pigs had PCV2 distribution in all tissues 21 days
after infection, and the relative distribution was relatively uniform. The
course of disease showed a long-term stable trend, which was more
conducive to the proliferation of the virus. In pigs with this subclinical
infection, the higher the content of PCV2, the more obvious the upre­
gulation of DNAJC7 expression, which may be a strategy for PCV2 to
regulate the pig immune response, but whether this strategy is unique to
subclinical PCV2 infection is not clear, and the specific mechanism
should also be determined according to the changes in DNAJC7 in
acutely infected pigs.
Q. Lv et al. Veterinary Microbiology 252 (2021) 108929

Fig. 8. The expression of DNAJC7 in tissues of weaned piglets infected with PCV2. (A) The expression level of DNAJC7 in various tissues was detected by IHC,
and the areal density of DNAJC7 was measured by IPP6.0 software with anti-DNAJC7 antibody (Abcam). (B) The expression level of DNAJC7 in various tissues was
detected by Western blotting. The intensity of the protein bands was measured by ImageJ software. (C) The expression of DNAJC7 in different tissues was detected by
real-time PCR. Fresh tissue was frozen in liquid nitrogen and ground into powder. TRIzol was used for lysis, and RNA was extracted and reverse transcribed for real-
time PCR detection.

11
Q. Lv et al. Veterinary Microbiology 252 (2021) 108929

Fig. 9. A schematic diagram of the activa­

tion and inhibition of the PKR signaling
pathway in PCV2 infection. After infection,
genomic DNA of PCV2 enters the nucleus to
produce mRNA for viral protein synthesis. ②
Opposing mRNAs originate from the common
region of the viral genome from dsRNA. ③ The
dsRNA activates PKR, PKR is dimerized and
phosphorylated, and then eIF2α is activated,
inhibiting viral protein synthesis. ④ Cap pro­
tein recruits DNAJC7 to the nucleus through
interaction with DNAJC7, and the DNAJC7-
P58IPK complex in the cytoplasm is separated.
⑤ Free P58IPK binds to PKR and inhibits its
dimerization to prevent the activation of the
PKR pathway.

Table 1
Primers in this research.
Primers Sequence(5′ -3′ ) Purpose

PCV2-F CCAGGAGGGCGTTCTGACT
qPCR for detection of PCV2
PCV2-R CGTTACCGCTGGAGAAGGAA
β-actin-F GAAGGACCTCTACGCCAACAC
qPCR for detection of β-actin
β-actin-R GGTGCTAGGCTATGGTATCGTTC
DNAJC7-F GCTAAACTCTACTGTAATCGGGGTA
qPCR for detection of DNAJC7
DNAJC7-R TTATGTAAGTGTCATCGAGCTTCAC
EGFP-DNAJC7-F CGGGGTACCGCCACCATGGCGGCTGCCGCGGAG
Amplification of EGFP-DNAJC7
EGFP-DNAJC7-R CGCGGATCCGCCAAACTGGAAAAAGAAATTC
Cap-F CGGGATCCATGACGTATCCAAGGAGGCGT
Amplification of Red-Cap and GST-Cap
Cap-R CCGCTCGAGTTAAGGGTTAAGTGGGGGGTCT
Flag-Cap-F CGGGATCCATGACGTATCCAAGGAGGCGT
Amplification of Flag-Cap
Flag-Cap-R CCGCTCGAGTTACTTGTCATCGTCGTCCTTGTAATCAGGGTTAAGTGGGGGGTCT
Myc-DNAJC7-F CGGGGTACCGCCACCATGGCGGCTGCCGCGGAG
Amplification of Myc-DNAJC7
Myc-DNAJC7-R CGCGGATCCTTACAGATCCTCTTCAGAGATGAGTTTCTGCTCGCCAAACTGGAAAAAGAAATTC
ShDNAJC7-F GATCCGGACACAGAACAGTATGAAGACAAGAGTCTTCATACTGTTCTGTGTCCTTTTTG
Knockdown of DNAJC7
ShDNAJC7-R AATTCAAAAAGGACACAGAACAGTATGAAGACTCTTGTCTTCATACTGTTCTGTGTCCG
shN-F GATCCGCTTAAACGCATAGTAGGACTCAAGAGAGTCCTACTATGCGTTTAAGCTTTTTG
Negative control of knockdown
shN-R AATTCAAAAAGCTTAAACGCATAGTAGGACTCTCTTGAGTCCTACTATGCGTTTAAGCG
Myc-P58IPK-F CGGGGTACCGCCACCATGGTGGCCCCCGGCTC
Amplification of Myc-P58IPK
Myc-P58IPK-R CGCGGATCCTCACAGATCCTCTTCAGAGATGAGTTTCTGCTCATTGAAGTGGAATTTGAAGCGGAAG
EGFP-P58IPK-F CGGGGTACCGCCACCATGGTGGCCCCCGGCTC
Amplification of EGFP-P58IPK
EGFP-P58IPK-R CGCGGATCCATTGAAGTGGAATTTGAAGCGGAAG

In summary, this study shows that infection with PCV2 activates the
PKR signaling pathway, but the Cap protein can interact with DNAJC7 to
inhibit the activation of PKR, which is beneficial for PCV2 to evade the
host immune mechanism, thus promoting the replication of PCV2.
Compliance with ethics guidelines
All institutional and national guidelines for the care and use of lab­
oratory animals were followed (approval No. 2019AE1101).
Declaration of Competing Interest
The authors report no conflict of interest.
Acknowledgments
This work was supported by the National Natural Sciences Founda­
tion of China (NSFC) (No. 31860708) and the Natural Science Founda­
tion of Guangxi Province (No. 2017GXNSFBA198025).

12
Q. Lv et al. Veterinary Microbiology 252 (2021) 108929

References host protein kinase PKR by 3C proteinase to facilitate virus replication. Virology 509,
222–231.
Lin, C.M., Jeng, C.R., Liu, J.P., Lin, E.C., Chang, C.C., Huang, Y.L., Tsai, Y.C., Chia, M.Y.,
Borghese, F., Sorgeloos, F., Cesaro, T., Michiels, T., 2019. The leader protein of Theiler’s
Wan, C.H., Pang, V.F., 2013. Immune gene expression profiles in swine inguinal
virus prevents the activation of PKR. J. Virol. 93 e01010-19.
lymph nodes with different viral loads of porcine circovirus type 2. Vet. Microbiol.
Bozzacco, L., Yi, Z., Andreo, U., Conklin, C.R., Li, M.M., Rice, C.M., MacDonald, M.R.,
162, 519–529.
2016. Chaperone-Assisted Protein Folding Is Critical for Yellow Fever Virus NS3/4A
Liu, J., Bai, J., Zhang, L., Jiang, Z., Wang, X., Li, Y., Jiang, P., 2013. Hsp70 positively
Cleavage and Replication. J. Virol. 90, 3212–3228.
regulates porcine circovirus type 2 replication in vitro. Virol. 447, 52–62.
Chen, X., Ren, F., Hesketh, J., Shi, X., Li, J., Gan, F., Huang, K., 2012. Reactive oxygen
Liu, J., Zhang, L., Zhu, X., Bai, J., Wang, L., Wang, X., Jiang, P., 2014. Heat shock protein
species regulate the replication of porcine circovirus type 2 via NF-κB pathway.
27 is involved in PCV2 infection in PK-15 cells. Virus Res. 189, 235–242.
Virol. 426, 66–72.
Liu, W.J., Yang, Y.T., Zhao, M.Q., Dong, X.Y., Gou, H.C., Pei, J.J., Chen, J.D., 2015. PKR
Chen, M., Han, J., Zhang, Y., Duan, D., Zhang, S., 2016. Porcine circovirus type 2 induces
activation enhances replication of classical swine fever virus in PK-15 cells. Virus
type I interferon production via MyD88-IKKα-IRFs signaling rather than NF-κB in
Res. 204, 47–57.
porcine alveolar macrophages in vitro. Res. Vet. Sci. 104, 188–194.
Lv, Q.Z., Zhuo, Y.L., Zhang, Y.W., Deng, J.H., Tang, X.M., Lin, Q., 2019. Construction of
Duan, D., Zhang, S., Li, X., Guo, H., Chen, M., Zhang, Y., Han, J., Lv, Y., 2014. Activation
recombinant lentivirus vectors with porcine Hsp40 gene for overexpression and
of the TLR/MyD88/NF-κB signal pathway contributes to changes in IL-4 and IL-12
interference. Chinese Vet. Sci. 49, 76–84.
production in piglet lymphocytes infected with porcine circovirus type 2 in vitro.
Melville, M.W., Hansen, W.J., Freeman, B.C., Welch, W.J., Katze, M.G., 1997. The
PLoS One 9, e97653.
molecular chaperone hsp40 regulates the activity of P58IPK, the cellular inhibitor of
Elbahesh, H., Scherbik, S.V., Brinton, M.A., 2011. West Nile virus infection does not
PKR. Proc. Natl. Acad. Sci. U. S. A. 94, 97–102.
induce PKR activation in rodent cells. Virology 421, 51–60.
Meng, X.J., 2013. Porcine circovirus type 2 (PCV2): pathogenesis and interaction with
Eom, C.Y., Lehman, I.R., 2002. The human DnaJ protein, hTid-1, enhances binding of a
the immune system. Annu. Rev. Anim. Biosci. 1, 43–64.
multimer of the herpes simplex virus type 1 UL9 protein to oris, an origin of viral
Opriessnig, T., Meng, X.J., Halbur, P.G., 2007. Porcine circovirus type 2 associated
DNA replication. Proc. Natl. Acad. Sci. U. S. A. 99, 1894–1898.
disease: update on current terminology, clinical manifestations, pathogenesis,
Finsterbusch, T., Steinfeldt, T., Doberstein, K., Rödner, C., Mankertz, A., 2009.
diagnosis, and intervention strategies. J. Vet. Diagn. Invest. 19, 591–615.
Interaction of the replication proteins and the capsid protein of porcine circovirus
Rabouw, H.H., Langereis, M.A., Knaap, R.C., Dalebout, T.J., Canton, J., Sola, I.,
type 1 and 2 with host proteins. Virol. 386, 122–131.
Enjuanes, L., Bredenbeek, P.J., Kikkert, M., de Groot, R.J., van Kuppeveld, F.J.,
Gal-Ben-Ari, S., Barrera, I., Ehrlich, M., Rosenblum, K., 2019. PKR: a kinase to remembe.
2016. Middle east respiratory coronavirus accessory protein 4a inhibits PKR-
Front.Mol. Neurosci. 11, 480.
Mediated antiviral stress responses. PLoS Pathog. 2, e1005982.
Gale Jr, M., Blakely, C.M., Darveau, A., Romano, P.R., Korth, M.J., Katze, M.G., 2002.
Sharma, K., Tripathi, S., Ranjan, P., Kumar, P., Garten, R., Deyde, V., Katz, J.M., Cox, N.
P52rIPK regulates the molecular cochaperone P58IPK to mediate control of the RNA-
J., Lal, R.B., Sambhara, S., Lal, S.K., 2011. Influenza A virus nucleoprotein exploits
dependent protein kinase in response to cytoplasmic stress. Biochemistry 41,
Hsp40 to inhibit PKR activation. PLoS One 6, e20215.
11878–11887.
Sharma, N.R., Majerciak, V., Kruhlak, M.J., Zheng, Z.M., 2017. KSHV inhibits stress
García, M.A., Meurs, E.F., Esteban, M., 2007. The dsRNA protein kinase PKR: virus and
granule formation by viral ORF57 blocking PKR activation. PLoS Pathog. 13,
cell control. Biochimie 89, 799–811.
e1006677.
Gillespie, J., Opriessnig, T., Meng, X.J., Pelzer, K., Buechner-Maxwell, V., 2009. Porcine
Sohn, S.Y., Kim, S.B., Kim, J., Ahn, B.Y., 2006. Negative regulation of hepatitis B virus
circovirus type 2 and porcine circovirus-associated disease. J. Vet. Intern. Med. 23,
replication by cellular Hsp40/DnaJ proteins through destabilization of viral core and
1151–1163.
X proteins. J. Gen. Virol. 87, 1883–1891.
Goodman, D.E., Pretto, C.D., Krepostman, T.A., Carnahan, K.E., Spindler, K.R., 2019.
Summers, D.W., Douglas, P.M., Ramos, C.H., Cyr, D.M., 2009. Polypeptide transfer from
Enhanced replication of mouse adenovirus type 1 following virus-induced
Hsp40 to Hsp70 molecular chaperones. Trends Biochem. Sci. 34, 230–233.
degradation of protein kinase r (PKR). mBio 10 e00668-19.
Vincent, I.E., Carrasco, C.P., Guzylack-Piriou, L., Herrmann, B., McNeilly, F., Allan, G.M.,
Harding, J.C., Clark, E., 1997. Recognizing and diagnosing postweaning multisystemic
Summerfield, A., McCullough, K.C., 2005. Subset-dependent modulation of dendritic
wasting syndrome (PMWS). J. Swine Health Prod. 5, 201–203.
cell activity by circovirus type 2. Immunology 115, 388–398.
Joly, A.L., Wettstein, G., Mignot, G., Ghiringhelli, F., Garrido, C., 2010. Dual role of heat
Weber, F., Wagner, V., Rasmussen, S.B., Hartmann, R., Paludan, S.R., 2006. Double-
shock proteins as regulators of apoptosis and innate immunity. J. Innate Immun. 2,
stranded RNA is produced by positive-strand RNA viruses and DNA viruses but not in
238–247.
detectable amounts by negative-strand RNA viruses. J. Virol. 80, 5059–5064.
Kang, R., Tang, D., 2012. PKR-dependent inflammatory signals. Sci. Signal. 5, pe47.
Weeks, S.A., Miller, D.J., 2008. The heat shock protein 70 cochaperone YDJ1 is required
Knox, C., Luke, G.A., Blatch, G.L., Pesce, E.R., 2011. Heat shock protein 40 (Hsp40) plays
for efficient membrane-specific flock house virus RNA replication complex assembly
a key role in the virus life cycle. Virus Res. 160, 15–24.
and function in Saccharomyces cerevisiae. J. Virol. 82, 2004–2012.
Li, J., Qian, X., Sha, B., 2009. Heat shock protein 40: structural studies and their
Yu, S., Opriessnig, T., Kitikoon, P., Nilubol, D., Halbur, P.G., Thacker, E., 2007. Porcine
functional implications. Protein Pept. Lett. 16, 606–612.
circovirus type 2 (PCV2) distribution and replication in tissues and immune cells in
Li, W., Liu, S., Wang, Y., Deng, F., Yan, W., Yang, K., Chen, H., He, Q., Charreyre, C.,
early infected pigs. Vet. Immunol. Immunopathol. 115, 261–272.
Audoneet, J.C., 2013. Transcription analysis of the porcine alveolar macrophage
Zhou, Y., Qi, B., Gu, Y., Xu, F., Du, H., Li, X., Fang, W., 2016. Porcine circovirus 2 deploys
response to porcine circovirus type 2. BMC Genomics 14, 353.
PERK pathway and GRP78 for its enhanced replication in PK-15 cells. Viruses 8, 56.
Li, C., Zhu, Z., Du, X., Cao, W., Yang, F., Zhang, X., Feng, H., Li, D., Zhang, K., Liu, X.,
Zheng, H., 2017. Foot-and-mouth disease virus induces lysosomal degradation of

13